Вы находитесь на странице: 1из 6
Experimental Parasitology 129 (2011) 234–239 Contents lists available at SciVerse ScienceDirect Experimental

Contents lists available at SciVerse ScienceDirect

Experimental Parasitology

journal homepage: www.else vier.com/locate/yexpr

journal homepage: www.else vier.com/locate/yexpr Real-time PCR to assess the Leishmania load in Lutzomyia

Real-time PCR to assess the Leishmania load in Lutzomyia longipalpis sand flies:

Screening of target genes and assessment of quantitative methods

Diana R. Bezerra-Vasconcelos a , Luciana M. Melo b , Érica S. Albuquerque b , Maria C.S. Luciano b , Claudia M.L. Bevilaqua a ,

a Laboratório de Doenças Parasitárias, Programa de Pós-graduação em Ciências Veterinárias, Universidade Estadual do Ceará, Brazil b Laboratório de Fisiologia e Controle da Reprodução, Programa de Pós-graduação em Ciências Veterinárias, Universidade Estadual do Ceará, Brazil

article info

Article history:

Received 25 November 2010 Received in revised form 7 August 2011 Accepted 8 August 2011 Available online 16 August 2011

Keywords:

Leishmania infantum chagasi Lutzomyia longipalpis PCR Molecular targets

abstract

Visceral Leishmaniasis is an endemic disease in Brazil caused by Leishmania infantum chagasi and its main vector species is the sand fly Lutzomyia longipalpis . Epidemiological studies have used conventional PCR techniques to measure the rate of infection of sand flies collected in the field. However, real-time PCR can

detect lower parasite burdens, reducing the number of false negatives and improving the quantification of Leishmania parasites in the sand fly. This study compared genes with various copy numbers to detect and quantify L. infantum chagasi in L. longipalpis specimens by real-time PCR. We mixed pools of 1, 10 and 30 male sand flies with various amounts of L. infantum chagasi , forming groups with 50, 500, 5000 and 50,000 Leishmania parasites. For the amplification of L. infantum chagasi DNA, primers targeting kDNA, polymerase a and the 18S ribosome subunit were employed. Parasites were measured by absolute and relative quantification. PCR detection using the amplification of kDNA exhibited the greatest sensitivity among the genes tested, showing the capacity to detect the DNA equivalent of 0.004 parasites. Addition- ally, the relative quantification using these primers was more accurate and precise. In general, the num- ber of sand flies used for DNA extraction did not influence Leishmania quantification. However, for low- copy targets, such as the polymerase a gene, lower parasite numbers in the sample produced inaccurate quantifications. Thus, qPCR measurement of L. infantum chagasi in L. longipalpis was improved by target- ing high copy-number genes; amplification of high copy-number targets increased the sensitivity, accu- racy and precision of DNA-based parasite enumeration.

2 0 1 1 E l s e v i e r I n c .

Open access under the Elsevier OA license.

1. Introduction

Leishmaniasis is the collective name for a number of diseases with diverse clinical manifestations that are caused by protozoan flagellates of the genus Leishmania . Visceral Leishmaniasis (VL) is the most severe form of the disease and is characterized by a chronic and potentially lethal pathology ( WHO, 2004 ). VL is caused by Leishmania donovani in India and East Africa and by L. infantum in Europe and North Africa ( Lukes et al., 2007 ). In the Americas, the only species reported to cause VL is Leishmania chagasi. However, recent studies employing enzymatic and genetic methods have indicated that the differences between strains of L. infantum and L. chagasi from different sources are so slight that some researchers do not differentiate between them ( Mauricio et al., 1999, 2000; Kuhls et al., 2005 ).

Corresponding author. Address: Universidade Estadual do Ceará/Programa de Pós-graduação em Ciências Veterinárias, Av. Dede Brasil, 1700, CEP 60740-903 Fortaleza, Ceará, Brazil. Fax: +55 85 31019840. E-mail addresses: claudia.bevilaqua@pq.cnpq.br , claudiamlb@yahoo.com.br (C.M.L. Bevilaqua).

0 0 1 4 - 4 8 9 4 2 0 1 1 E l s e v i e r I n c .

Open access under the Elsevier OA license.

In the wild, the natural reservoirs of VL are foxes ( Cerdocyon thous), opossums ( Didelphis albiventris ) and rodents ( Nectomys squamipes); in contrast, the primary urban reservoir of VL is domestic dogs ( Dantas-Torres and Brandão-Filho, 2006 ). In Brazil, VL is an endemic disease with frequent outbreaks, with the phlebotomine sand fly Lutzomyia longipalpis as its main vector ( Lainson and Rangel, 2005 ). Due to the lack of efficacious vaccines and the small number of drugs available to treat VL, re- search involving the vector remains an important component of the effort to control VL ( Desjeux, 2004 ). The natural infection rate of VL has been traditionally estimated by the microscopic identifi- cation of Leishmania protozoans in the gut of dissected sand flies. However, this method is laborious and exhibits low sensitivity. Molecular methods, such as polymerase chain reaction (PCR), are being used in epidemiological studies to determine the rate of VL infection in sand flies. End-point PCR studies have shown low rates of infection, ranging from 0.4% to 3.9% ( Paiva et al., 2006; Oliveira- Pereira et al., 2006; Silva et al., 2008 ). Compared with real-time PCR (qPCR), end-point PCR is more time-consuming and presents only qualitative data. Furthermore, qPCR products are quantitated and monitored in real time. This technique has been employed uti-

D.R. Bezerra-Vasconcelos et al. / Experimental Parasitology 129 (2011) 234–239

235

lizing samples from dogs and humans in studies examining para- site burden, host–parasite interactions and the monitoring of drug therapy ( Mary et al., 2004; Mortarino et al., 2004; Rolão et al., 2004; Francino et al., 2006 ). Consequently, qPCR allows for greater accuracy in the determination of the natural infective dose ( Rana- singhe et al., 2008 ). The detection of Leishmania spp. can be accomplished through the PCR amplification of specific regions of kinetoplastid DNA (kDNA) and genes encoding the small (18S) ribosome subunit, DNA polymerase a , glucose 6-phosphate dehydrogenase and hexo-

kinase ( Fernandes et al., 1993; Bretagne et al., 2001; Prina et al.,

2007 ).

However, to date, information is lacking regarding the optimi- zation of qPCR in studies involving the detection and quantification of L. infantum chagasi in sand flies. Thus, questions remain regard- ing the best gene to amplify, the best method of quantification and whether the number of sand flies utilized for isolation affects par- asite quantification and test sensitivity. Therefore, the aim of this work was to optimize the conditions for qPCR to detect L. infantum chagasi in L. longipalpis captured in the field using two methods of quantification and single- or multiple-copy templates.

2. Materials and methods

2.1. Leishmania strain and serial dilution

The L. infantum chagasi strain MHOM46/LC/HZ1 was cultured at 26 C in M199 medium supplemented with 10% heat-inactivated fetal calf serum, 40 mg/mL of gentamicin and 5% male human ur- ine. Stationary-phase promastigotes were harvested by centrifuga- tion (2000 g ) and washed with phosphate-buffered saline. The solutions were divided and centrifuged again (2000 g ) to remove the supernatants. Two pellets were resuspended in the medium to enable parasite quantification using a Neubauer hemacytometer. Counts were made in triplicate for a total of six counts, with a mean ± standard deviation of 8.056 10 6 ± 0.08 parasites per pel- let. The remaining pellets were stored at 20 C until DNA extrac- tion; these parasites were utilized to establish standard curves for Leishmania gene amplifications and to prepare the experimental groups. For the experimental groups, serial dilutions were per- formed to obtain solutions containing 50,000, 5000, 500 and 50 parasites prior to DNA purification.

2.2. Sand flies

In 2009, male L. longipalpis were captured with CDC light traps in the city of Fortaleza ( 03 43’02’’S, 38 32’35’’W), Brazil. Once captured, total phlebotomine sand flies were killed with cotton balls soaked with ethyl acetate and stored in isopropanol at 20 C. Species and sex identification was performed as described by Young and Duncan (1994) . In order to form the experimental groups, sand flies were grouped into pools of 1, 10 and 30 speci- mens. In addition, only one sample of 30 sand flies was used for DNA purification to construct a standard curve for L. longipalpis gene amplification. All samples were stored at 20 C until DNA extraction.

2.3. Experimental groups and DNA extraction

Before DNA purification, the serial dilutions of Leishmania para- sites described above were mixed with sand fly pools, forming groups with various quantities of insects (0, 1, 10 and 30) and promastigotes (0, 50, 500, 5000 and 50,000). DNA was extracted using the Wizard SV Genomic DNA Purification System Kit (Prome- ga Corporation, USA). Briefly, samples were macerated with pistils,

fragmenting the sand flies, and then incubated overnight at 55 C in a digestion solution containing 145 mM proteinase K, 90 mM EDTA and 72 mM RNaseA. After the cell debris was removed by centrifugation (2000 g ), the samples were transferred to spin col- umns and eluted in 100 l L of water (first elution). A second elution of 100 l L was made to calculate the total yield of extracted DNA, as described bellow. All DNA extractions were performed in tripli- cate; replicates were then combined into a representative pool. To determine the total DNA yield from Leishmania parasites, both the first and second DNA elutions from a triplicate sample were quantified by spectrophotometry (Biophotometer, Eppendorf, Germany), summed and then divided by the number of specimens present in the sample (about eight millions of parasites). The first elution of these samples was pooled and used to construct the standard curves for qPCR analysis.

2.4. Genes and primers

Sets of primers generating genomic Leishmania , kinetoplastid or L. longipalpis DNA amplicons were designed using unique or multi- ple sequences retrieved from NCBI databases ( Table 1 ). ClustalW 2 software was utilized for sequence alignment. Oligonucleotide pairs and the similarities of primer sequences with those present in nucleotide databanks were validated using PrimerBlast soft- ware. For amplification of the 18S gene, we utilized the primer pair described by Prina et al. (2007) . Additionally, amplifications target- ing the sand fly V-ATPase gene were used as reference in relative quantifications.

2.5. Real-time PCR

Each reaction consisted of a total volume of 10 l L, containing 5 l L 2X Fast Start Universal SYBR Green Master (Roche), 0.3 l M of primer mix (forward and reverse) and 0.5 l L template. Amplifi- cations were performed in a Mastercycler EP Realplex 4 S (Eppen- dorf). Each sample was analyzed in triplicate. The PCR protocol included an initial incubation at 95 C for 10 min, followed by 40 cycles of the amplification program at 95 C for 15 s and 60 C for 30 s. SYBR Green fluorescent emission (530 wavelength) was mea- sured at the end of the elongation step. The specificity of each reaction was ascertained after the com- pletion of the amplification protocol by performing melt curve analysis (55–95 C, initiating fluorescence acquisition at 55 C and taking measurements at 10-s intervals until the temperature reached 95 C). Negative controls were performed without DNA templates. Additionally, DNA samples from 10 sand flies or 50,000 Leishmania parasites were used as negative controls in reac- tions for the amplification of Leishmania or phlebotomine genes, respectively. The sizes of the PCR products were further confirmed by gel electrophoresis using standard ethidium bromide-stained 1.5% agarose gel and visualized by exposure to UV light.

2.6. Analysis of qPCR data

Threshold and threshold cycle ( C t ) values were automatically determined by Realplex 2.2 software (Eppendorf) using default parameters. The C t and melting temperature ( T m ) data are ex- pressed as the mean ± s.d. of three measurements. To establish standard curves, serial dilutions of L. infantum chag- asi and L. longipalpis DNA were subjected to qPCR amplifications. The final concentrations of parasite DNA/reaction ranged from 2.3 ng to 0.23 fg (equivalent to 40,280 to 0.004 parasites/reaction), while the sand fly DNA/reaction ranged from 14.625 ng to 1.46 pg (equivalent to 0.15 to 0.000015 sand fly/reaction). The standard curves were also used to determine the detection limit of the as- says and to assess the linearity ( R 2 ) and the efficiency ( E ) of the

236

D.R. Bezerra-Vasconcelos et al. / Experimental Parasitology 129 (2011) 234–239

Table 1 Oligonucleotides used to amplify Leishmania infantum chagasi and Lutzomyia longipalpis genes in real-time PCR assays.

Target gene

Organism

Accession number

Primer sequence (5 0 –3 0 )

Product size (bp)

Pol a a

L. chagasi

AF009139

CTTCGAGCCTGGCACCTCGG

95

 

ACACAGCGCAGTTGCACACC

18S b

Leishmania spp.

M81430

TACTGGGGCGTCAGAG

153

 

GGGTGTCATCGTTTGC

kDNA a

Leishmania spp.

AF103738

CTCCGGGTAGGGGCGTTC

122

 

GCCCTATTTTACACCAACCCC

V-ATP

L. longipalpis

EF156436

ACGTGACGAGCAAGCAGGGG

107

GCCGAGATCGTCCGACAGGC

a The primers were designed from multiple alignments of L. chagasi (AF103738, AF169138, AF103739, AF169137, AF169132, AF308682) minicircle sequences for kDNA and L. chagasi (AF009139) and L. infantum (AF009147, XM_001464606) genomic sequences for DNA polymerase a (Pol a ).

b The multi-copy gene encoding the small ribosomal subunit (18S) was previously amplified by Prina et al. (2007) .

PCR amplifications. The amplification efficiency of each target was determined according to the equation E = 10 ( 1/ S ) 1 , where S was the slope of the standard curve generated from tenfold serial dilu- tions of purified parasite or sand fly DNA. The interpolation of sample mean Ct values in the standard curves generated during the amplification of Leishmania genes was used in absolute quantifications. The relative quantification was calculated using the 2 DD Ct method ( Livak and Schmittgen, 2001 ). The C t values for the sand fly V-ATP reference gene were used for data normalization. Arbitrarily, samples with 500 para- sites were used as calibrators. Measurement accuracy was assessed by comparing the calcu- lated number of parasites with the a priori amount in the samples. For this, the relationship between these variables was compared with an ideal curve. The measurement precision is expressed in terms of coefficients of variation (CV), which was defined as the ra- tio of the standard deviation to the mean of the calculated number of parasites assessed by each gene amplification.

3. Results

3.1. DNA extraction, Sensitivity and Specificity

Using a silica membrane spin column method, the average yield calculated for a single Leishmania protozoan was 77.58 ± 0.88 fg DNA. When considering only the first column elution, one parasite yielded a mean of 57.1 ± 3.51 fg DNA. As all amplification reactions were performed with template samples only from the first DNA elution, the qPCR sensitivities, expressed as number of parasites, were calculated using the latter value. Fig. 1 shows the T m of all PCR products as the mean ± s.d. Only one melting peak per gene with a nearly constant value was ob- served for each amplification product. No amplicons were ob- served in the negative controls. Visualization on an agarose gels confirmed the size of each amplified product. Standard curves for both Leishmania and sand fly genes are pre- sented in Fig. 2 . The amplification efficiencies were found to be

Fig. 2 . The amplification efficiencies were found to be Fig. 1. Specificity of real-time PCR

Fig. 1. Specificity of real-time PCR amplifications to quantify L. infantum chagasi parasites in the presence or absence of sand flies during DNA extraction. Derivative melting curves of polymerase a , 18S ribosomal subunit, kDNA and V-ATP amplicons in L. infantum chagasi (A) and L. longipalpis (B). Negative controls (arrows) were reactions performed without DNA templates. The inserts in panels (A) and (B) show the electrophoretic analysis of the products. M: 50-bp DNA ladder.

D.R. Bezerra-Vasconcelos et al. / Experimental Parasitology 129 (2011) 234–239

237

et al. / Experimental Parasitology 129 (2011) 234–239 237 Fig. 2. Linearity, efficacy and sensitivity of

Fig. 2. Linearity, efficacy and sensitivity of real-time PCR amplifications used to quantify L. infantum chagasi parasites. Standard curves for polymerase a , 18S ribosomal subunit and kDNA sequences (full lines) were prepared through tenfold serial dilutions of a 4.6-ng/ l L stock solution of L. infantum chagasi DNA. By the same method, V-ATP (reference gene) amplifications were prepared using L. longipalpis DNA. The curve slopes, efficiency values (E) and square of Pearson correlation coefficients (R 2 ) were calculated. a DNA amount utilized in the real-time PCR reaction. The DNA amount is in fg for Leishmania genes and pg for the V-ATP gene. b Number of Leishmania protozoans corresponding to the quantity of DNA, taking into account the average yield of 57.10 fg of DNA per Leishmania protozoan. c For sand fly analysis, the abscissa axis is expressed in pg of DNA/reaction.

high (>0.93), with a strong linearity ( R 2 > 0.97) over the range of DNA concentrations studied. Amplifications targeting the polymerase a and 18S genes were linear over a five-log-fold range of Leishmania DNA concentrations; additionally, the assay detected quantities as small as 23 fg of DNA (equivalent to 0.4 parasites/reaction). The dynamic range of detec- tion of kDNA was established as seven logs, with a limit of detec- tion of 0.004 parasites/reaction.

3.2. Leishmania DNA targets and quantification

The polymerase a gene displayed less accuracy in the sand flies groups with small numbers of Leishmania parasites, as measured by both quantitative methods. In groups with larger numbers of parasites, absolute quantification was more accurate. In both types of quantification, the 18S ribosomal subunit gene exhibited good accuracy regardless of the number of parasites or sand flies. In

regardless of the number of parasites or sand flies. In Fig. 3. Influence of the number

Fig. 3. Influence of the number of sand flies present before DNA extractions on the accuracy of real-time PCR quantifications used to estimate the number of Leishmania protozoans in sand flies. The correlation between the estimated number of Leishmania parasites calculated by absolute (upper graphics) or relative (bottom graphics) quantification and the true value (50 to 50,000 parasites) present in samples with 0, 1, 10 or 30 sand flies (0f,1f, 10f and 30f) before the DNA extraction w as measured. Ideal:

Theoretical curve represents a perfect measurement of the number of Leishmania protozoans in samples.

238

D.R. Bezerra-Vasconcelos et al. / Experimental Parasitology 129 (2011) 234–239

et al. / Experimental Parasitology 129 (2011) 234–239 Fig. 4. Precision of real-time PCR quantification methods

Fig. 4. Precision of real-time PCR quantification methods used to estimate the number of Leishmania protozoans in sand flies. The graphics show the coefficients of variation (CV) of the absolute and relative quantifications of Leishmania protozoans (50 to 50,000 parasites) in sand flies.

the relative quantification, kDNA exhibited a good level of accu- racy. No interference was observed by varying the numbers of par- asites or sand flies ( Fig. 3 ). Fig. 4 shows the correlation between the estimated number of Leishmania protozoans, as calculated by absolute or relative quan- tification, and the true value (50–50,000 parasites) present in the samples prior to DNA extraction. The evaluation of the CV of the two quantification methods per gene demonstrated a high degree of variation in the measurements involving fewer parasites and when the polymerase a gene was targeted.

4. Discussion

The present work reports the validation of real-time PCR assays for the detection and quantification of L. infantum chagasi in sand fly samples. For this, three different Leishmania genes were ampli- fied from template in samples obtained from mixing male sand flies with promastigote parasites prior to DNA extraction. Addi- tionally, Leishmania genes were compared to assess the sensitivity, accuracy and precision of parasite quantification using both abso- lute and relative qPCR methods. DNA extraction with a commercial kit based on silica columns yielded a total amount of 77.58 ± 0.88 fg DNA for a single parasite specimen. Previously, Ranasinghe et al. (2008) reported a theoret- ical value of 83.4 fg DNA for the diploid genome of Leishmania ma- jor . Taking into account this value, the protocol used in the present investigation allowed for the recovery of 93.02% of the total DNA of the parasite. The methods commonly used to isolate DNA from Leishmania parasites involve the precipitation of genetic material ( Martín-Sán- chez et al., 2006 ; Paiva et al., 2007; Ranasinghe et al., 2008; Silva et al., 2008; Quaresma et al., 2009 ). However, silica extraction col- umn-based methods are known to be quick and simple, resulting in a high yield of pure DNA that serves as an excellent template for molecular techniques such as qPCR analysis ( Mary et al., 2004 ; Clements et al., 2008 ). In this context, when using primers targeting kDNA, it was pos- sible to detect an amount as small as 0.004 Leishmania per reaction. This higher sensitivity, when compared to the other parasite genes investigated here, is not surprising and is most likely due to the extensive number of copies of the minicircle molecules per para- site (approximately 10,000 copies) ( Mary et al., 2004; Francino et al., 2006; Prina et al., 2007 ). Nicolas et al. (2002) reported a sen- sitivity of 100 fg during the development of a real time PCR assay to monitoring experimental Leishmania infections in mice. In this study, we were able to detect as little as 0.23 fg of DNA per reac- tion. However, the sensitivity of kDNA may be greater than the measured (0.004 parasites per reaction) because all dilutions tested in this paper amplified. Mary et al. (2004) tested dilutions ranging from 50,000 to 0.0001 parasites in reaction tubes and re- ported a detection level of 0.0005 parasites/reaction.

As a single-copy gene, the polymerase a gene exhibited an in- creased level of error in the measurement in the small quantities

of extracted Leishmania DNA because it had a 50% chance of being ab-

sent in the analyzed sample. This explains why one tube from the triplicate containing 23 fg of DNA (equivalent to 0.4 parasite) did not generate an amplicon with primers targeting the polymerase a

gene. Each parasite contains a large number ( 160) of copies of the ribosomal 18S subunit gene. Thus, several studies reported good sensitivities for Leishmania detection using qPCR to amplify this gene. Here, we are able to detect less than one parasite per 10 l L

reaction (0.4 parasites per reaction or 40 parasites/mL). Then, our re- sults were greater than that reported by Schulz et al. (2003) , in which the accuracy was weak when parasitemia was less than 100 para- sites/mL. Additionally, other studies using also qPCR have reported

a sensitivity of 10–100 fg of Leishmania DNA when targeting the

18S gene ( Prina et al., 2007; Deborggraeve et al., 2008 ). Because we could efficiently amplify 23 fg DNA per reaction, but did not 2.3 fg, we believe that the 18S primers can detect amount smaller than 23 fg but larger than 2.3 fg. Although the tenfold dilution factor used did not allow for the visualization of this information, our re- sults are in the same range of sensitivity from those reported in pre- vious studies. Ranasinghe et al. (2008) reported that, despite copy-number differences, when tested by qualitative PCR, primers targeting Leishmania DNA polymerase and kinetoplast origin sequences dis- played similar levels of sensitivity and specificity in amplifying a defined single product only in the presence of Leishmania DNA (10 pg–100 ng). Thus, the authors used only the polymerase a gene

amplification to quantify the parasite by PCR in samples consti- tuted of DNA extracted from Leishmania mixed with DNA extracted from sand flies in equal and different proportions. They reported that high amounts of sand fly and Leishmania DNA (100 ng each) appeared to inhibit quantitative amplifications, whereas highly di- luted Leishmania /sand fly DNA samples (10–100 pg) resulted, mostly, in Leishmania DNA overestimations. In our simulation, different from Ranasinghe et al. (2008), we attempted to replicate natural conditions more faithfully by mix- ing sand flies captured in the field with Leishmania parasites prior to DNA extraction and we used smaller quantities of DNA. Under these conditions the results yielded by the two genes were quite different. Here a defined number of Leishmania parasites was used as calibrator in relative quantification method and allow us to quantify parasites more accurately with kDNA and 18S amplifica- tions, when compared to polymerase a . Additionally, despite the lower precision to detect up to 5000 parasites ( Fig. 4 ), targeting the kDNA sequence exhibited particularly high accuracy when the relative quantification method was utilized ( Fig. 3 ) indepen- dent of the L. longipalpis pool size present before DNA extraction. The use of primers designed to amplify conserved genes from L. longipalpis will benefit similar studies because many molecular

D.R. Bezerra-Vasconcelos et al. / Experimental Parasitology 129 (2011) 234–239

239

biology studies on this species use polymorphic genes to study the L. longipalpis species complex ( Bauzer et al., 2002; Watts et al., 2002 ). In further studies involving the detection of L. infantum chagasi in female sand flies, it may be possible to use V-ATP gene amplification in sand flies (laboratory samples or field males) as an exogenous reference gene for relative quantification; addition- ally, parasite promastigotes could be used to construct standard curves for absolute quantification. Given the above results, we conclude that estimating the num- ber of L. infantum chagasi protozoans in the vector is more reliable and sensitive when targeting kDNA sequences for relative quanti- fication in pools of up to 30 sand flies. However, the interpretation of parasite burden measured in pools with numerous sand flies should be made carefully because the parasite burden may be dif- ferent in each infected female, and the level of individual infection can interfere with total parasite burden in the pool. Thus, if a sam- ple presented a relative high parasite burden, this could be due to one or more infected specimen.

Acknowledgments

Dr. Claudia M.L. Bevilaqua has a grant from CNPq and Dr. Luciana M. Melo from CAPES.

References

Bauzer, L.G., Souza, N.A., Ward, R.D., Kyriacou, C.P., Peixoto, A.A., 2002. The period gene and genetic differentiation between three Brazilian populations of Lutzomyia longipalpis . Insect Molecular Biology 11, 315–323. Bretagne, S., Durand, R., Olivi, M., Garin, J.F., Sulahian, A., Rivollet, D., Vidaud, M., Deniau, M., 2001. Real-time PCR as a new tool for quantifying Leishmania infantum in liver in infected mice. American Society for Microbiology 8, 828–831. Clements, D.N., Wood, S., Carter, S.D., Ollier, W.E.R., 2008. Assessment of the quality and quantity of genomic DNA recovered from canine blood samples by three different extraction methods. Research in Veterinary Science 85, 74–79. Dantas-Torres, F., Brandão-Filho, S.P., 2006. Visceral Leishmania sis in Brazil:

revisiting paradigms of epidemiology and control. Revista do Instituto de Medicina Tropical de São Paulo 48, 151–156. Deborggraeve, S., Boelaert, M., Rija, S., Doncker, S., Dujardin, J.C., Herdewijn, P., Büscher, P., 2008. Diagnostic accuracy of a new Leishmania PCR for clinical visceral Leishmania sis in Nepal and its role in diagnosis of disease. Tropical Medicine & International Health 13, 1378–1383. Desjeux, P., 2004. Leishmania sis: current situation and new perspectives. Comparative Immunology, Microbiology and Infectious Diseases 27, 305–318. Fernandes, A.P., Nelson, K., Beverley, S.M., 1993. Evolution of nuclear ribosomal RNAs in kinetoplastid protozoa: perspectives on the age and origins of parasitism. Proceedings of the National Academy of Sciences 90, 11608–11612. Francino, O., Altet, L., Sánchez-Robert, E., Rodriguez, A., Solano-Gallego, L., Alberola, J., Ferrer, L., Sánchez, A., Roura, X., 2006. Advantages of real-time PCR assay for diagnosis and monitoring of canine leishmaniosis. Veterinary Parasitology 137,

214–221.

Kuhls, K., Mauricio, I.L., Pratlong, F., 2005. Analysis of ribosomal DNA internal transcribed spacer sequences of the Leishmania donovani complex. Microbes and Infection 7, 1224–1234. Lainson, R., Rangel, E.F., 2005. Lutzomyia longipalpis and the eco-epidemiology of American visceral Leishmaniases , with particular reference to Brazil – a review. Memórias do Instituto Oswaldo Cruz 100, 811–827. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2 - DD CT method. Methods 25, 402–408.

Lukes, J., Mauricio, I.L., Schönian, G., Dujardin, J.C., Soteriadou, K., Dedet, J.P., Kuhls, K., Tintaya, K.W.Q., Jirku, M., Chocholová, E., Haralambous, C., Pratlong, F., Oborník, M., Horák, A., Ayala, F.J., Miles, M.A., 2007. Evolutionary and geographical history of the Leishmania donovani complex with a revision of current taxonomy. Proceedings of the National Academy of Sciences of the United States of America 104, 9375–9380. Martín-Sánchez, J., Gállego, M., Barón, S., Castillejo, S., Morillas-Marquez, F., 2006. Pool screen PCR for estimating the prevalence of Leishmania infantum infection in sandflies (Diptera: Nematocera, Phlebotomidae). Transactions of the Royal Society of Tropical Medicine and Hygiene 100, 527–532. Mary, C., Faraut, F., Lascombe, L., Dumon, H., 2004. Quantification of Leishmania infantum DNA by a real-time PCR assay with high sensitivity. Journal of Clinical Microbiology 42, 5249–5255. Mauricio, I.L., Howard, M.K., Stothard, J.R., Miles, M.A., 1999. Genetic diversity in the Leishmania donovani complex. Parasitology 119, 237–246. Mauricio, I.L., Stothard, J.R., Miles, M.A., 2000. The strange case of Leishmania chagasi. Parasitology Today 16, 188–189. Mortarino, M., Franceschi, A., Mancianti, F., Bazzocchi, C., Genchi, C., Bandi, C., 2004. Quantitative PCR in the diagnosis of Leishmania . Parasitologia 46, 163–167. Nicolas, L., Prina, E., Lang, T., Milon, G., 2002. Real-time PCR for detection and quantification of Leishmania in mouse tissues. Journal of Clinical Microbiology 40, 1666–1669. Oliveira-Pereira, Y.N., Rebêlo, J.M.M., Moraes, J.L.P., Pereira, S.R.F., 2006. Molecular diagnosis of the natural infection rate due to Leishmania sp in sandflies (Psychodidae, Lutzomyia ) in the Amazon region of Maranhão, Brazil. Revista da Sociedade Brasileira de Medicina Tropical 39, 540–543. Paiva, B.R., Secundino, N.F.C., Nascimento, J.C., Pimenta, P.F.P., Galati, E.A.B., Andrade Jr., H.F., Malafronte, R.S., 2006. Detection and identification of Leishmania species in field-captured phlebotomine sandflies based on mini-exon gene PCR. Acta Tropica 99, 252–259. Paiva, B.R., Secundino, N.F.C., Pimenta, P.F.P., Galati, E.A.B., Andrade Jr., H.F., Malafronte, R.S., 2007. Padronização de condições para detecção de DNA de Leishmania spp . em flebotomíneos (Diptera, Psychodidae) pela reação em cadeia da polimerase. Cadernos de Saúde Pública 23, 87–94. Prina, E., Roux, E., Mattei, D., Milon, G., 2007. Leishmania DNA is rapidly degraded following parasite death: an analysis by microscopy and real-time PCR. Microbes and Infection 9, 1307–1315. Quaresma, P.F., Murta, S.M.F., Ferreira, E.C., Rocha-Lima, A.C.V.M., Xavier, A.A.P., Gontijo, C.M.F., 2009. Molecular diagnosis of canine visceral Leishmania sis:

identification of Leishmania species by PCR-RFLP and quantification of parasite DNA by real-time PCR. Acta Tropica 111, 289–294. Ranasinghe, S., Rogers, M.E., Hamilton, J.G.C., Bates, P.A., Bates, P.A., Maingon, R.D.C., 2008. A real-time PCR assay to estimate Leishmania chagasi load in its natural sand fly vector Lutzomyia longipalpis . Transactions of the Royal Society of Tropical Medicine and Hygiene 102, 875–882. Rolão, N., Cortes, S., Rodrigues, O.R., Campino, L., 2004. Quantification of Leishmania infantum parasites in tissue biopsies by real-time polymerase chain reaction and polymerase chain reaction-enzyme-linked immunosorbent assay. Journal of Parasitology 90, 1150–1154. Schulz, A., Mellenthin, K., Schonian, G., Fleischer, B., Drosten, C., 2003. Detection, differentiation, and quantitation of pathogenic Leishmania organisms by a fluorescence resonance energy transfer-based real-time PCR assay. Journal of Clinical Microbiology 41, 1529–1535. Silva, E.A., Andreotti, R., Dias, E.S., Barros, J.C., Brazuna, J.C.M., 2008. Detection of Leishmania DNA in phlebotomines captured in Campo Grande, Mato Grosso do Sul, Brazil. Experimental Parasitology 119, 343–348. Watts, P.C., Boyland, E., Noyes, H.A., Maingon, R., Kemp, J., 2002. Polymorphic dinucleotide microsatellite loci in the sandfly Lutzomyia longipalpis (Diptera:

Phlebotominae). Molecular Ecology Notes 2, 62–64. WHO – World Health Organization, 2004. Scientific working group on Leishmaniasis . TDR Research Publication. Young, D.G., Duncan, M.A., 1994. Guide to the identification and geographic distribution of Lutzomyia sand flies in the Mexico the West Indies Central and the South America (Diptera: Psychodidae). Memoirs of the American Entomological Institute, 54, Associate Publishers, Gainesville, pp. 881.