APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Mar. 1998, p. 824–829 Vol. 64, No.

3
0099-2240/98/$04.0010
Copyright © 1998, American Society for Microbiology

Engineering of Plasmin-Resistant Forms of Streptokinase and

Their Production in Bacillus subtilis: Streptokinase
with Longer Functional Half-Life
XU-CHU WU, RUIQIONG YE, YANJUN DUAN, AND SUI-LAM WONG*
Division of Cellular, Molecular and Microbial Biology, Department of
Biological Sciences, University of Calgary, Calgary, Alberta, Canada
Received 4 August 1997/Accepted 4 December 1997

The short in vivo half-life of streptokinase limits its efficacy as an efficient blood clot-dissolving agent. During
the clot-dissolving process, streptokinase is processed to smaller intermediates by plasmin. Two of the major
processing sites are Lys59 and Lys386. We engineered two versions of streptokinase with either one of the lysine
residues changed to glutamine and a third version with both mutations. These mutant streptokinase proteins
(muteins) were produced by secretion with the protease-deficient Bacillus subtilis WB600 as the host. The puri-
fied muteins retained comparable kinetics parameters in plasminogen activation and showed different degrees
of resistance to plasmin depending on the nature of the mutation. Muteins with double mutations had half-
lives that were extended 21-fold when assayed in a 1:1 molar ratio with plasminogen in vitro and showed better
plasminogen activation activity with time in the radial caseinolysis assay. This study indicates that plasmin-
mediated processing leads to the inactivation of streptokinase and is not required to convert streptokinase to
its active form. Plasmin-resistant forms of streptokinase can be engineered without affecting their activity, and
blockage of the N-terminal cleavage site is essential to generate engineered streptokinase with a longer in vitro
functional half-life.

The formation of pathologic blood clots that block the cir-
culation to heart muscle can result in acute myocardial infarc-
tion (heart attack). Several blood clot-dissolving agents includ-
ing streptokinase and tissue-specific plasminogen activator are
commonly applied to treat these patients. Many large-scale
clinical trials (10, 14, 17) have demonstrated both the short-
and long-term benefits of these agents in saving lives. To gain
maximum benefits of thrombolytic therapy in restoring blood
flow, limiting damage to heart muscles, and preserving heart
functions, early treatment is particularly important (14). The
relationship between early treatment with thrombolysis and
lower mortality has been well established (6, 11, 11a, 16, 27, 30,
33, 34, 44). However, one of the limitations of these blood
clot-dissolving agents is their short in vivo half-lives. With
half-lives of 30 min for streptokinase (15) and 5 min for tPA
(19), these agents are commonly introduced into the patients
by a 30- to 90-min infusion. If the half-lives of these agents can
be prolonged, the agents could possibly be administered as a
single bolus intravenous injection and patients could be treated
upon the arrival of the medical personnel. This would help
minimize the time delay in the transportation of patients to
hospital. The reocclusion rate could also be reduced by using
these long-half-life clot-dissolving agents.
Streptokinase is a 47-kDa (414-amino-acid) protein from
pathogenic strains of the Streptococcus family (25). To dissolve
a blood clot, streptokinase forms a 1:1 molar complex with
plasminogen (1). The resulting complex (8) has the ability to
convert plasminogen to plasmin, the active protease that de-
grades fibrin in the blood clot. However, plasmin also rapidly
* Corresponding author. Mailing address: Division of Cellular, Mo-
lecular and Microbial Biology, Department of Biological Sciences,
University of Calgary, 2500 University Dr., N.W., Calgary, Alberta
T2N 1N4, Canada. Phone: (403) 220-5721. Fax: (403) 289-9311. E-
mail: slwong@acs.ucalgary.ca.
processes streptokinase to smaller fragments. This can be a
major factor contributing to the short half-life of streptokinase.
The processing pathway of streptokinase has been well char-
acterized (28, 38, 39). Several intermediates, including a few
products with molecular masses of 37 to 44 kDa, are transiently
accumulated (38, 39). The 42- to 44-kDa intermediates appear
first and are generated by C-terminal processing, since they
have identical N-terminal residues to those observed in the
intact streptokinase (28). Isolation of a short C-terminal pep-
tide with the N-terminal sequence corresponding to Tyr402
(38) indicates that one of the C-terminal cleavage events takes
place between Arg401 and Tyr402. The 37-kDa product ap-
pears later and is relatively stable (4, 28, 38, 39). N-terminal
sequencing and composition analysis suggest that this fragment
has the sequence corresponding to Ser60 to Lys386 from the
authentic streptokinase (38). This product is therefore gener-
ated through both N- and C-terminal processing events. Al-
though this 37-kDa product has high affinity to both plasmin-
ogen and plasmin, it retains only 16% of the activity of the
intact streptokinase in plasminogen activation (38). Further
processing of the 37-kDa product at a series of cleavage sites
(38) results in the complete degradation of streptokinase into
small fragments. Since plasmin is a trypsin-like serine protease
that specifically cleaves the peptide bond after lysine or argi-
nine (45), it would be interesting to see whether selectively
changing lysine and arginine residues at these processing sites
to other amino acids (e.g., glutamine) would generate plasmin-
resistant streptokinase that may have a longer functional half-
life. The successful generation of these new versions of strep-
tokinase depends critically on whether processing at these sites
is a necessary event. Currently, it is uncertain whether these
processing events are simply a consequence of positioning ly-
sine and arginine residues at the flexible and surface-exposed
regions or are essential events in the conversion of streptoki-
nase to the active form. It has been observed that the 7-kDa
N-terminal peptide can associate with the 37-kDa intermediate

824
VOL. 64, 1998 PLASMIN-RESISTANT STREPTOKINASE FROM B. SUBTILIS
to form a functional plasminogen activator that has almost the
full activity of the intact streptokinase (38). In a similar situa-
tion, N-terminal processing that results in the removal of the
first 10 amino acids from staphylokinase, another plasminogen
activator from lysogenic strains of Staphylococcus, by plasmin is
demonstrated to be essential in the generation of the active
staphylokinase (37). To determine the significance of the N-
terminal processing event and to explore the possibility of
developing engineered forms of streptokinase with longer
functional half-lives, we report the development of various
forms of streptokinase through site-directed mutagenesis.
These mutant proteins (abbreviated as muteins) of streptoki-
nase were produced by the Bacillus subtilis secretory produc-
tion system (48). Biochemical characterization and in vitro
processing studies of these purified streptokinase muteins il-
lustrate that plasmin-resistant streptokinase can be developed.
Some of these engineered muteins have longer in vitro func-
tional half-lives and show better activity with time.
MATERIALS AND METHODS
Bacterial strains and culture conditions. A six-extracellular-protease-deficient
B. subtilis strain, WB600 (trpC2 nprA apr epr bfp mpr::ble nprB::ery) (49), was used
for routine transformation and expression studies. Transformed cells were plated
on tryptose blood agar base (TBAB; Difco, Detroit, Mich.) plates containing 10
mg of kanamycin per ml. Cells carrying expression vectors were cultivated in
superrich medium (12) with kanamycin. All the expression vectors are pUB18
derivatives (43). Therefore, WB600(pUB18) serves as a negative control for the
study of streptokinase production. The initial cell density in the culture was
adjusted to 10 Klett units (1 Klett unit is equivalent to approximately 106 cells/
ml). When the cell density reached 100 Klett units, sucrose was added at a final
concentration of 2% (wt/vol) to induce the expression. The culture supernatant
was collected by centrifugation 5 h after induction.
Site-directed mutagenesis of the streptokinase production plasmid. Plasmid
pSK3 (48) is an expression vector in B. subtilis that is used to produce streptoki-
nase with the sucrose-inducible regulatory region from B. subtilis sacB, encoding
levansucrase, to control the expression. In this expression vector, secretion of
streptokinase is directed by the sacB signal sequence (41, 47). To change Lys59
to either glutamine or glutamic acid, site-directed mutagenesis based on the
inverse PCR method described by Hemsley et al. (13) was used. Two primers,
SKMF [59 CAAGGCTTAAGTCCA(C/G)AATCAAAACC 39] and SKMB (59
CTCTGTCTTTCCTCCATGAGCAGG) were used for PCR by using the super-
coiled pSK3 plasmid as the template. The amplified fragment was then end
repaired, kinase treated, and recircularized by ligation. Plasmid DNA was trans-
formed to WB600. This site-directed mutagenesis method allows direct intro-
duction of mutations to B. subtilis vectors without using E. coli vectors as the
intermediate. The restriction enzymes and DNA-modifying enzymes used in this
study are from New England Biolabs Canada, Ltd. (Mississauga, Ontario, Can-
ada), Pharmacia Biotech Inc. (Baie d’Urfé, Quebec, Canada), and GIBCO BRL
Canada (Burlington, Ontario, Canada).
Purification of streptokinase and its derivatives. Streptokinase (or its deriva-
tives) from the culture supernatant was precipitated and concentrated by adding
ammonium sulfate to 60% saturation. After dialysis, the sample was applied to
preparative nondenaturing polyacrylamide gels (7.5%, wt/vol) that have the same
composition as that for the standard sodium dodecyl sulfate-polyacrylamide gel
electrophoresis (SDS-PAGE) except for the omission of SDS. To minimize the
presence of free radicals that may modify functional groups of proteins, the gels
were prerun for 2 h with the addition of reduced glutathione, at a final concen-
tration of 50 mM, to the electrophoresis buffer in the upper reservoir. The
preelectrophoresis buffer was decanted, and fresh buffer containing 0.1 mM
sodium thioglycolate was used for the actual run. At the end of the electro-
phoretic run, a strip of gel was excised and briefly stained with 1% (wt/vol)
Coomassie blue R-250 for 5 min. The location of the major protein band was
determined and used as the reference point to locate streptokinase in the non-
stained gel. The excised gel was cut into small pieces, and the protein was
electroeluted under a constant current (5 mA per tube) with Tris-glycine buffer
(25 mM Tris base, 192 mM glycine [pH 8.3]) for 8 h at 4°C with the electroelution
system from Bio-Rad Laboratories Canada Ltd. (Mississauga, Ontario, Canada).
The eluted protein sample was collected and dialyzed against the streptokinase
assay buffer (50 mM Tris-HCl [pH 7.2], 0.1 M NaCl, 0.001% [wt/vol] Tween 80).
Preparation of the 37-kDa processing intermediate from streptokinase. To
determine the N-terminal sequence of the 37-kDa processing intermediate from
streptokinase, streptokinase was mixed with plasminogen in a 1:1 molar ratio in
the assay buffer for 10 min. The reaction was terminated by adding the sample-
loading buffer for SDS-PAGE, and the sample was loaded onto a 12% polyacryl-
amide gel containing SDS. The resolved protein bands were then electroblotted
to Immobilon membrane as previously described (26). These protein bands were
briefly stained, and the protein band corresponding to the 37-kDa protein was
825
excised. The first five amino acid residues from this protein was determined at
the Microchemistry Center, University of Victoria.
Determination of the activity of streptokinase and its kinetic parameters for
plasminogen activation. The activity of streptokinase was determined by two
methods (48): the colorimetric method (7) with tosyl-glycyl-prolyl-lysine-4-ni-
troanilide acetate (Chromozym PL; Boehringer Mannheim Canada, Laval, Que-
bec, Canada) as the substrate and the radial caseinolysis method (36) with
agarose containing both plasminogen and skim milk. To determine the kinetic
parameters for the activation of plasminogen by streptokinase and its muteins,
the conditions described by Shi et al. (38) were used except that Chromozym PL
was used as the substrate. In these assays, streptokinase or its muteins were
mixed with plasminogen at various concentrations (0.02 to 0.4 mM) and the
change in absorbance at 405 nm was monitored at 37°C by using a Beckman
DU65 spectrophotometer equipped with a constant-temperature cuvette cham-
ber. The final concentration of streptokinase or its muteins was 0.003 mM. The
kinetic data were analyzed with the mathematic model presented by Wohl et al.
(46) and graphed as a Lineweaver-Burk plot. This one-stage assay allows the
determination of the apparent Michaelis constant (Km) of streptokinase and its
derivatives to plasminogen and the catalytic rate constant (kp) of plasminogen
activation.
Half-life determination. To determine the half-lives of various forms of strep-
tokinase in the plasminogen activation process, streptokinase was mixed with
plasminogen in a 1:1 molar ratio and samples were collected at different time
points up to 60 min and added to microcentrifuge tubes containing sample
application buffer for SDS-PAGE in a boiling-water bath. SDS-PAGE and West-
ern blotting with antibodies against streptokinase from rabbit were performed as
described previously (48). To ensure that all the proteins were completely trans-
ferred to the nitrocellulose filter, the electroblotted gels were restained with
Coomassie blue. Blots with complete protein transfer were used for quantitative
analysis. Pictures of Western blot were taken with the GDS 7500 gel documen-
tation system from UVP, Inc. (San Gabriel, Calif.). The intensity of the 47-kDa
protein which represents the intact form of streptokinase (see Fig. 2) on the
Western blot was quantified with a Fuji bioimaging analyzer (BAS 1000, Fuji
Medical Systems U.S.A., Stamford, Conn.) and the MacBAS software.
Other methods. Protein concentrations were determined by the Bradford
method (2) with reagents from Bio-Rad Laboratories Canada Ltd. Glu-plasmin-
ogen was prepared from human plasma by using essentially the lysine-Sepharose
method (9, 42). To identify colonies that show streptokinase activity, cells were
plated on TBAB agar plates overlaid with a thin layer of agarose (0.5% [wt/vol]
agarose in physiological buffered saline with 0.5 mg of plasminogen and 0.1 g of
skim milk in a final volume of 10 ml). Other general chemicals and reagents are
from Sigma-Aldrich Canada Ltd. (Oakville, Ontario, Canada).
RESULTS
Streptokinase muteins with mutations in the N-terminal
region. To determine whether the plasmin-mediated process-
ing of streptokinase at the N-terminal region is an essential
step in the generation of active streptokinase, the nucleotide
sequence AAA, which corresponds to Lys59 in the natural
streptokinase, was changed to CAA or GAA by site-directed
mutagenesis involving inverse PCR. From 200 transformants,
28 were randomly selected and spotted on to TBAB agar plates
that had been overlaid with a thin layer of agarose containing
both plasminogen and skim milk. Based on the halo size, these
transformants were divided into three groups. The first group
(14 colonies) had the largest halos. The second group (13
colonies) had halos smaller than those in group 1 but still
slightly larger than that for the positive control strain, WB600
(pSK3), which produces the wild-type streptokinase. The third
group (1 colony) did not show any halo surrounding the colony.
The nucleotide sequence of a 253-bp ClaI-BstEII region which
covers the predicted mutation was determined from five group
1 mutants. They all carried the A-to-C mutation, which con-
verts Lys59 to glutamine. No other mutations could be ob-
served within the sequenced 253-bp region. Five randomly
selected group 2 mutants also carried the A-to-G mutation,
which converts Lys59 to glutamic acid. The only mutant from
group 3 was found to carry the same mutation as that observed
in the group 1 mutants except for the presence of an unex-
pected 1-nucleotide deletion at the 59 end region of the mu-
tagenic primer. This introduced a frameshift mutation and
provided an explanation for the failure to observe the strep-
tokinase activity from this clone. Since Taq polymerase does
826 WU ET AL.
FIG. 1. Production and purification of streptokinase and its muteins. (a)
Western blot of secreted streptokinase. Lanes: 1, prestained markers, with
the molecular mass in kilodaltons shown on the left; 2 to 6, 60 ml of culture
supernatant from WB600(pUB), WB600(pSK3), WB600(pSKC32), WB600
(pSKN460), and WB600(pSKN460-C32), respectively. (b) SDS-PAGE analysis
of purified streptokinase. Lanes: 1, molecular mass markers; 2 to 5, 5 ml of
purified SKN460, SKC32, SKN460-C32 and natural streptokinase, respectively.
not have the proofreading function (35), it could possibly in-
troduce extra mutations to DNA fragments during amplifica-
tion. To eliminate the possibility of the presence of extra mu-
tations in both the group 1 and group 2 mutants, the 253-bp
ClaI-BstEII fragment was isolated from mutants in both
groups and each of these fragments was ligated to the 6-kb
ClaI-BstEII-digested pSK3, which has never been subjected
to inverse PCR-based mutagenesis. ClaI and BstEII sites were
selected for this fragment exchange reaction because each of
these sites is unique on pSK3 and they flank the predicted
mutation. To confirm the successful introduction of the group
1 and group 2 mutations to pSK3, the 253-bp ClaI-BstEII re-
gion in the resulting transformants was sequenced. Plasmids
pSKN460 and pSKN461 were shown to carry group 1 and
group 2 mutations, respectively. Consistent with the previ-
ous observation, the halos of WB600(pSKN460) and WB600
(pSKN461) are larger than that of WB600(pSK3) (data not
shown). Since these muteins were produced at a comparable
level relative to the wild-type streptokinase (data not shown),
this observation indicated that these muteins retain relatively
good activity in plasminogen activation. SKN460 was selected
for further characterization because of its high activity. The
secretory production of SKN-460 is shown (Fig. 1a, lane 5).
Streptokinase muteins with mutations in the C-terminal
region. To block the plasmid-mediated processing of streptoki-
nase at the C-terminal region, Lys386 in streptokinase should
be changed to glutamine. As reported previously (48), residual
proteases from WB600 could also degrade wild-type streptoki-
nase at the C-terminal region and generated a low percentage
of degraded streptokinase (Fig. 1a, lane 3). To eliminate the
C-terminal degradation, hydrophobic residues at positions 380
to 384 were changed to either polar or charged residues and
Lys386 was changed to glutamine. The resulting streptokinase
muteins can be produced in WB600 in intact form and retain
almost the full activity of the authentic streptokinase (48). One
of the WB600 strains carrying the mutated streptokinase gene
in the expression vector (pSKC32) was used here to study the
APPL. ENVIRON. MICROBIOL.
C-terminal processing event mediated by plasmin. Figure 1a
(lane 4) shows the production of this mutein in intact form
from WB600.
Streptokinase muteins with mutations in both the N- and
C-terminal regions. To generate a streptokinase mutein that
shows resistance to the plasmin-mediated processing, the 1.3-
kb BstEII-PstI fragment encoding the C-terminal portion of
streptokinase in pSKN460 was replaced by the one from
pSKC32 to generate pSKN460-C32. The successful exchange
of this fragment was confirmed by nucleotide sequencing.
WB600(pSKN460-C32) produced this mutein in intact form
(Fig. 1a; lane 6). This mutein retains biological activity in
plasminogen activation (see Table 1 and Fig. 3a).
Plasmin-mediated processing of streptokinase and its deriv-
atives. Natural streptokinase (SK3) and three other streptoki-
nase muteins (SKN460, SKC32, and SKN460-C32) produced
from WB600 strains were purified from the culture superna-
tant by electrophoresis on a native polyacrylamide gel. Purified
streptokinase proteins were found to be homogeneous (Fig.
1b) and were used to study the plasmin-mediated processing by
mixing streptokinase with plasminogen in a 1:1 molar ratio.
The processing reaction was conducted at 37°C. To avoid the
complication for the presence of plasminogen and its deriva-
tives in the reaction mixture, streptokinase and its processed
intermediates were identified by Western blotting with strepto-
kinase-specific polyclonal antibodies. As shown in Fig. 2a, nat-
ural streptokinase was rapidly converted to various processed
forms with molecular masses around 44 kDa. The 37-kDa
intermediate could also be observed after 1 min of reaction
and became the major product after 10 min of reaction. N-
terminal sequencing of the first five amino acid residues from
the electroblotted 37-kDa protein showed the sequence Ser-
Lys-Pro-Phe-Ala. This sequence matched that at positions 60
to 64 in the natural streptokinase and confirmed that an N-
terminal processing event took place between Lys59 and Ser60.
For the streptokinase mutein SKN460, the change of Lys59 to
glutamine indeed blocked the major N-terminal processing
event mediated by plasmin. Accumulation of the 44- to 46-kDa
processing intermediates was observed (Fig. 2b). The 44-kDa
product was relatively stable and could be observed even after
60 min of reaction. This is not the case for the wild-type
streptokinase. At least one new intermediate was detected. On
a relative scale, it migrated faster than the stable 37-kDa in-
termediate generated in the reaction with the natural strep-
tokinase. For the streptokinase mutein SKN460-C32, this pro-
tein showed resistance to plasmin (Fig. 2c). Typical processing
intermediates (i.e., the 44- and 37-kDa products) observed with
the natural streptokinase were not detected here. The half-lives
of natural streptokinase, SKN460, and SKN460-C32 in the
presence of plasmin generated during the plasminogen activa-
tion process were found to be 2, 6.4, and 43 min, respectively.
Steady-state kinetic parameters of plasminogen activation
by streptokinase and its muteins. Although the half-life of the
streptokinase mutein SKN460-C32 was extended 21-fold under
the in vitro condition, it is important to examine whether the
amino acid changes at the N- and C-terminal regions affect the
binding affinity and the ability of SKN460-C32 to activate plas-
minogen. Kinetic parameters for the activation of plasminogen
by purified streptokinase and its derivatives (SKN460, SKC32,
and SKN460-C32) were determined in three independent deter-
minations. As shown in Table 1, the apparent Michaelis con-
stant Km and the catalytic rate constant kp for these streptoki-
nase proteins were comparable, indicating that these amino
acid changes in streptokinase affect neither the binding nor the
activation of plasminogen.
VOL. 64, 1998
FIG. 2. Processing of streptokinase and its muteins by plasmin. Streptokinase
and plasminogen were mixed in a 1:1 molar ratio and incubated at 37°C. Samples
were collected at different time points (in minutes) and analyzed by Western blot
with streptokinase-specific polyclonal antibodies. (a) Wild-type streptokinase;
(b) SKN460; (c) SKN460-C32. An asterisk marks a new form of intermediate
generated during the processing of SKN460.
Biological activity of streptokinase and its engineered de-
rivatives as determined by radial caseinolysis. In the determi-
nation of the steady-state kinetic parameters of streptokinase
and its derivatives, the initial velocity of the reaction was mea-
sured. The effects on the extension of the half-lives of these
engineered streptokinase derivatives as plasminogen activators
will not be reflected in this analysis. Plasmin-resistant strep-
tokinase derivatives with longer half-lives would be expected to
function as plasminogen activators for a longer period, and this
should be reflected in the radial caseinolysis assay by showing
a bigger clearing zone. In this assay, the culture supernatant
with streptokinase or its derivatives was applied in equal quan-
tity (confirmed by Western blotting) to individual wells in an
agarose gel containing skim milk and plasminogen. Relative to
TABLE 1. Steady-state kinetic parameters of streptokinase
and its muteins for plasminogen activation
Streptokinase Km (mM) kp (min21)
Wild type 0.20 6 0.02 34.36 6 1.2
SKN-460 0.22 6 0.03 32.16 6 1.3
SKC-32 0.21 6 0.03 34.02 6 1.2
SKN460-C32 0.28 6 0.04 35.17 6 1.4
PLASMIN-RESISTANT STREPTOKINASE FROM B. SUBTILIS 827
FIG. 3. Activity of various forms streptokinase based on the radial caseinoly-
sis. Each form of streptokinase, in equal quantities, was loaded into individual
wells and incubated at 37°C for 12 h. Numbers indicate the relative activity of
each form of streptokinase.
natural streptokinase as the reference, the engineered deriva-
tives SKN460 and SKN460-C32 showed better total activity as
plasminogen activators. This was reflected by a 2.2- to 2.5-fold
increase in halo size (Fig. 3). However, the streptokinase mu-
tein, SKC32 has a halo size similar to that of the natural
streptokinase.
DISCUSSION
There are several approaches to prolonging the half-life of
blood clot-dissolving agents. These include the preparation
of the streptokinase-acylated plasminogen complex known as
APSAC (40), attachment of polyethylene glycol (5) or maltose
binding protein to streptokinase (15), chemical coupling of
human serum albumin to urokinase (3), and site-directed mu-
tagenesis of glycosylation sites and domains in tissue plasmin-
ogen activator (19, 24). While some of these agents have shown
promising results, others have lower activity or become heter-
ogeneous nature because of the chemical modification. As the
first step to the development of streptokinase with a longer
functional half-life, we genetically engineered plasmin-resis-
tant streptokinase. Since streptokinase is processed N-termi-
nally between Lys59 and Ser60 and C-terminally between
Lys386 and Asp387 to generate the 37-kDa intermediate which
retains only 16% of the intact streptokinase activity during the
plasminogen activation process (38), lysine residues in these
sites are the logical targets for site-directed mutagenesis. Three
versions of streptokinase were developed in this study. They
either carried a single mutation that led to the conversion of
lysine to glutamine (SKN460 and SKC32) or a double mutation
that changed both lysine residues to glutamine (SKN460-C32).
Glutamine was selected to replace lysine because the length of
its side chain is comparable to that of lysine and so it should
not significantly perturb the three-dimensional structure of
streptokinase. It also does not introduce a positive charge to
streptokinase. Therefore, plasmin with the trypsin-like sub-
strate specificity should not cut the engineered streptokinase at
828 WU ET AL.
these sites. This prediction was supported by our processing
study (Fig. 2) and the observed increase in biological activity of
SKN460 and SKN460-C32 on radial caseinolysis assays (Fig.
3). SKN460 with the change of Lys59 to glutamine allowed
C-terminal processing events to proceed. The appearance of
the 46-kDa (Fig. 2b, lane 1 min) and 44-kDa (Fig. 2b, 5 min to
60 min) intermediates was consistent with processing at
Arg401 and Lys386, respectively. Both intact SKN460 and
these intermediates were more stable and could be observed
even after 60 min of reaction. This could be explained by the
abolition of the rapid N-terminal processing at Lys59. These
44- to 46-kDa intermediates are expected to retain good activ-
ity for plasminogen activation since C-terminal deletion of 31
amino acid residues from streptokinase does not significantly
affect the activity for plasminogen activation (18, 20). This
expectation is supported by the observation of a 2.2-fold in-
crease in the total activity of SKN460 in the radial caseinolysis
assay. The faint protein band with a molecular mass around 36
kDa (Fig. 2b) could possibly be a fragment with a sequence
corresponding to Ile1 to Lys332 of the intact SKN460. It was
formed by processing of the 44-kDa intermediate at Lys332
and could be observed as a transiently accumulated interme-
diate because of the blockage of the N-terminal processing site.
If it is really the case, this intermediate is unlikely to be active
since residues 244 to 352 (31) and 332 to 386 (38) in streptoki-
nase play an important role in mediating tight binding to plas-
minogen and residues 332, 334, and 369 to 373 are important
for plasminogen activation (20, 23, 32, 50).
To block the C-terminal processing of streptokinase by plas-
min at Lys386, not only was this lysine residue in SKC32
changed to glutamine but also hydrophobic amino acids lo-
cated between residues 380 and 384 were converted to amino
acids with hydrophilic side chains. These modifications elimi-
nate the proteolytic cleavages within the region of 382 to 384
by residual proteases from B. subtilis WB600 during the secre-
tory production of streptokinase. As demonstrated previously
(48), these modifications do not significantly affect the activity
of streptokinase. This is further supported by the determina-
tion of the steady-state kinetic parameters observed in the
present study (Table 1).
The design of SKN460-C32 allows the generation of plas-
min-resistant streptokinase and its production in intact form
from the B. subtilis secretory production system. When both
critical lysine residues were changed to glutamine, the half-life
of intact streptokinase during the plasminogen activation pro-
cess was greatly extended and SKN460-C32 was apparently
processed at other minor processing sites without generating
any transiently stable intermediates. Although both the appar-
ent Michaelis constant and catalytic rate constant were un-
changed in this mutein in reference to those of the natural
streptokinase, radial caseinolysis indicated that SKN460-C32
was a better plasminogen activator. This can be explained by
the prolonged half-life of SKN460-C32 as the functional plas-
minogen activator. The kinetic parameter measurement did
not reflect any effect of prolonged half-life of SKN460-C32,
since only the initial rate was determined in this type of anal-
ysis. Although replacement of Lys59 and Lys386 with glu-
tamine does not affect either the binding or the catalytic ac-
tivity of streptokinase, some lysine residues in streptokinase
are essential for its function. Lysine residues at positions 256
and 257 of streptokinase are important for binding to plasmin-
ogen, and lysine residues 332 and 334 are required for catalytic
activity (23).
Our results showed that only the conversion of Lys59 to
glutamine was important in extending the functional half-life
of streptokinase. This is consistent with the idea that C-termi-
APPL. ENVIRON. MICROBIOL.
nal processing at Lys368 does not affect the activity of the
44-kDa intermediate to function as an efficient plasminogen
activator. Many pieces of evidence indicate that the first 59
amino acids have multiple functional roles for streptokinase.
Site-directed mutagenesis of Val19 (22) and Gly24 (21) inac-
tivates streptokinase. Residues between Phe37 and Lys51 are
suggested to function as a plasminogen binding site (29). The
first 59 residues are also suggested to be required for stabiliz-
ing the conformation of streptokinase (38, 50). Without these
N-terminal amino acids, the streptokinase fragment (residues
60 to 414) has much lower activity and shows a disordered
secondary structure (50). Our study also illustrates that the
plasmin-mediated proteolytic degradation of streptokinase
leads only to the inactivation of streptokinase as the plasmin-
ogen activator. These cleavages are not required to convert
streptokinase to the active form to mediate the plasminogen
activation process. This is opposite to the case for staphyloki-
nase, another bacterial plasminogen activator. In that situa-
tion, removal of the first 10 amino acid residues from the N
terminus of staphylokinase is essential to generate the active
plasminogen activator (37). Our next target is to examine the
in vivo half-life and biodistribution of SKN460-C32 in the
experimental animal system and its efficiency in clot lysis.
ACKNOWLEDGMENTS
We thank Canada Red Cross at Calgary for heparinized blood and
David A. Hart (Department of Microbiology and Infectious Diseases,
University of Calgary) for advice in the preparation of human Glu-
plasminogen. Sequence determination for some of the mutated strep-
tokinase genes by Louise Tran is greatly appreciated.
This work was supported by a strategic grant from the Natural
Sciences and Engineering Research Council of Canada. S.-L. Wong is
a senior medical scholar of the Alberta Heritage Foundation for Med-
ical Research.
REFERENCES
1. Bajaj, A. P., and F. J. Castellino. 1977. Activation of human plasminogen by
equimolar levels of streptokinase. J. Biol. Chem. 252:492–498.
2. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of
microgram quantities of protein utilizing the principle of protein dye bind-
ing. Anal. Biochem. 72:248–254.
3. Breton, J., N. Pezzi, A. Molinari, L. Bonomini, J. Lansen, G. Gonzalez De
Buitrago, and I. Prieto. 1995. Prolonged half-life in the circulation of a
chemical conjugate between a pro-urokinase derivative and human serum
albumin. Eur. J. Biochem. 231:563–569.
4. Brockway, W. J., and F. J. Castellino. 1974. A characterization of native
streptokinase and altered streptokinase isolated from a human plasminogen
activator complex. Biochemistry 13:2063–2070.
5. Brucato, F. H., and S. V. Pizzo. 1990. Catabolism of streptokinase and
polyethylene glycol-streptokinase: evidence for transport of intact forms
through the biliary system in the mouse. Blood 76:73–79.
6. Cannon, C. P., and S. Z. Goldhaber. 1995. The importance of rapidly treat-
ing patients with acute myocardial infarction. Chest 107:598–600.
7. Castellino, F. J., J. M. Sodetz, W. J. Brockway, and G. E. Siefring, Jr. 1976.
Streptokinase. Methods Enzymol. 45:244–257.
8. Davidson, D. J., D. L. Higgins, and F. J. Castellino. 1990. Plasminogen
activator activities of equimolar complexes of streptokinase with variant
recombinant plasminogens. Biochemistry 29:3585–3590.
9. Deutsch, D. G., and E. T. Mertz. 1970. Plasminogen: purification from
human plasma by affinity chromatography. Science 170:1095–1096.
10. Gruppo Italiano Per Lo Studio Della Sopravvivenza Nell’Infarto Mio-
cardico. 1990. GISSI-2: a factorial randomised trial of alteplase versus strep-
tokinase and heparin versus no heparin among 12,490 patients with acute
myocardial infarction. Lancet 336:65–71.
11. GUSTO Angiographic Investigators. 1993. The effects of tissue plasminogen
activator, streptokinase, or both on coronary-artery patency, ventricular
function, and survival after acute myocardial infarction. N. Engl. J. Med. 329:
1615–1622.
11a.GUSTO Angiographic Investigators. 1993. An international randomized
trial comparing four thrombolytic strategies for acute myocardial infarction.
N. Engl. J. Med. 329:673–682.
12. Halling, S. M., F. J. Sanchez-Anzaldo, R. Fukuda, R. H. Doi, and C. F.
Meares. 1977. Zinc is associated with the beta subunit of DNA dependent
RNA polymerase of Bacillus subtilis. Biochemistry 16:2880–2884.
VOL. 64, 1998 PLASMIN-RESISTANT STREPTOKINASE FROM B. SUBTILIS
13. Hemsley, A., N. Arnheim, M. D. Toney, G. Cortopassi, and D. J. Galas. 1989.
A simple method for site-directed mutagenesis using the polymerase chain
reaction. Nucleic Acids Res. 17:6545–6551.
14. Hennekens, C. H., C. J. O’Donnell, P. M. Ridker, and V. J. Marder. 1995.
Current issues concerning thrombolytic therapy for acute myocardial infarc-
tion. J. Am. Coll. Cardiol. 25:18S–22S.
15. Houng, A., S. Quen, L.-F. Jean, and G. L. Reed. 1995. Construction of a
recombinant streptokinase that resists cleavage and inactivation by plasmin.
Thromb. Haemostasis 73:1130. (Abstract.)
16. Huber, K. and G. Maurer. 1996. Thrombolytic therapy in acute myocardial
infarction. Semin. Thromb. Hemostasis 22:15–26.
17. ISIS-3 Collaborative Group. 1992. ISIS-3: A randomised comparison of
streptokinase vs tissue plasminogen activator vs anistreplase and of aspirin
plus heparin vs aspirin alone among 41 299 cases of suspected acute myo-
cardial infarction. Lancet 339:753–770.
18. Jackson, K. W., H. Malke, D. Gerlach, J. J. Ferretti, and J. Tang. 1986.
Active streptokinase from the cloned gene in Streptococcus sanguis is without
the carboxyl-terminal 32 residues. Biochemistry 25:108–114.
19. Keyt, B. A., N. F. Paoni, C. J. Refino, L. Berleau, H. Nguyen, A. Chow, J. Lai,
L. Peña, C. Pater, and J. Ogez. 1994. A faster-acting and more potent form
of tissue plasminogen activator. Proc. Natl. Acad. Sci. USA 91:3670–3674.
20. Kim, I. C., J. S. Kim, S. H. Lee, and S. M. Byun. 1996. C-terminal peptide
of streptokinase, Met369-Pro373, is important in plasminogen activation.
Biochem. Mol. Biol. Int. 40:939–945.
21. Lee, B. R., S. K. Park, J. H. Kim, and S. M. Byun. 1989. Site-specific
alteration of Gly-24 in streptokinase: its effect on plasminogen activation.
Biochem. Biophys. Res. Commun. 165:1085–1090.
22. Lee, S. H., S. T. Jeong, I. C. Kim, and S. M. Byun. 1997. Identification of the
functional importance of valine-19 residue in streptokinase by N-terminal
deletion and site-directed mutagenesis. Biochem. Mol. Biol. Int. 41:199–207.
23. Lin, L. F., S. Oeun, A. Houng, and G. L. Reed. 1996. Mutation of lysines in
a plasminogen binding region of streptokinase identifies residues important
for generating a functional activator complex. Biochemistry 35:16879–16885.
24. Madison, E. 1994. Probing structure-function relationships of tissue-plas-
minogen activator by site-specific mutagenesis. Fibrinolysis 8:221–236.
25. Malke, H., and J. J. Ferretti. 1984. Streptokinase: cloning, expression, and
excretion by Escherichia coli. Proc. Natl. Acad. Sci. USA 81:3557–3561.
26. Matsudaira, P. 1987. Sequence from picomole quantities of proteins elec-
troblotted onto polyvinylidene difluoride membranes. J. Biol. Chem. 262:
10035–10038.
27. Maynard, C., R. Althouse, M. Olsufka, J. L. Ritchie, K. B. Davis, and J. W.
Kennedy. 1989. Early versus late hospital arrival for acute myocardial infarc-
tion in the Western Washington Thrombolytic Therapy Trials. Am. J. Car-
diol. 63:1296–1300.
28. McClinock, D. K., M. E. Englert, C. Dziobkowski, E. H. Snedeker, and P. H.
Bell. 1974. Two distinct pathways of the streptokinase-mediated activation of
highly purified human plasminogen. Biochemistry 13:5334–5344.
29. Nihalani, D., and G. Sahni. 1995. Streptokinase contains two independent
plasminogen-binding sites. Biochem. Biophys. Res. Commun. 217:1245–1254.
30. Rawles, J. 1994. Halving of mortality at 1 year by domiciliary thrombolysis in
the Grampian Region Early Anistreplase Trial (GREAT). J. Am. Coll.
Cardiol. 23:1–5.
31. Reed, G. L., L.-F. Lin, B. Parhami-Seren, and P. Kussie. 1995. Identification
of a plasminogen binding region in streptokinase that is necessary for the
creation of a functional streptokinase-plasminogen activator complex. Bio-
chemistry 34:10266–10271.
32. Rodrı́guez, P., P. Fuentes, M. Barro, J. G. Alvarez, E. Muñoz, D. Collen, and
H. R. Lijnen. 1995. Structural domains of streptokinase involved in the
interaction with plasminogen. Eur. J. Biochem. 229:83–90.
829
33. Rozenman, Y., M. Gotsman, T. Weiss, C. Lotan, M. Mosseri, D. Sapoznikov,
S. Welber, H. Nassar, Y. Hasin, and D. Gilon. 1994. Very early thrombolysis
in acute myocardial infarction—a light at the end of the tunnel. Isr. J. Med.
Sci. 30:99–107.
34. Rozenman, Y., M. S. Gotsman, A. T. Weiss, C. Lotan, M. Mosseri, D.
Sapoznikov, S. Welber, Y. Hasin, and D. Gilon. 1995. Early intravenous
thrombolysis in acute myocardial infarction: the Jerusalem experience. Int.
J. Cardiol. 49(Suppl.):S21–S28.
35. Saiki, R. K., D. H. Gelfand, S. Stoffel, S. J. Scharf, R. Higuchi, G. T. Horn,
K. B. Mullis, and H. A. Erlich. 1988. Primer-directed enzymatic amplifica-
tion of DNA with a thermostable DNA polymerase. Science 239:487–491.
36. Saksela, O. 1981. Radial caseinolysis in agarose: a simple method for detec-
tion of plasminogen activators in the presence of inhibitory substances and
serum. Anal. Biochem. 111:276–282.
37. Schlott, B., K. H. Guhrs, M. Hartmann, A. Rocker, and D. Collen. 1997.
Staphylokinase requires NH2-terminal proteolysis for plasminogen activa-
tion. J. Biol. Chem. 272:6067–6072.
38. Shi, G.-Y., B.-I. Chang, S.-M. Chen, D.-H. Wu, and H.-L. Wu. 1994. Function
of streptokinase fragments in plasminogen activation. Biochem. J. 304:235–
241.
39. Siefring, G. E., Jr. and F. J. Castellino. 1976. Interaction of streptokinase
with plasminogen: isolation and characterization of a streptokinase degra-
dation product. J. Biol. Chem. 251:3913–3920.
40. Smith, R. A., R. J. Dupe, P. D. English, and J. Green. 1981. Fibrinolysis with
acyl-enzymes: a new approach to thrombolytic therapy. Nature 290:505–508.
41. Steinmetz, M., D. LeCoq, S. Aymerich, G. Gonzy-Treboul, and P. Gay. 1985.
The DNA sequence of the secreted Bacillus subtilis enzyme levansucrase and
its genetic control sites. Mol. Gen. Genet. 200:220–228.
42. Summaria, L., L. Arzadon, P. Bernabe, K. C. Robbins, and G. Barlow. 1973.
Characterization of the NH2-terminal glutamic acid and NH2-terminal lysine
forms of human plasminogen isolated by affinity chromatography and iso-
electric focusing methods. J. Biol. Chem. 248:2984–2991.
43. Wang, L.-F., and R. H. Doi. 1987. Promoter switch during development and
the termination site of the s43 operon of Bacillus subtilis. Mol. Gen. Genet.
207:114–119.
44. Weaver, W. D., M. Cerqueira, A. P. Hallstrom, P. E. Litwin, J. S. Martin,
P. J. Kudenchuk, and M. Eisenberg. 1993. The Myocardial Infarction Triage
and Intervention Project Group: prehospital-initiated vs hospital-initiated
thrombolytic therapy. The Myocardial Infarction Triage and Intervention
Trial. JAMA 270:1211–1216.
45. Weinstein, M. J. and R. F. Doolittle. 1972. Differential specificities of throm-
bin, plasmin and trypsin with regard to synthetic and natural substrates and
inhibitors. Biochim. Biophys. Acta 258:577–582.
46. Wohl, R. C., L. Summaria, and K. C. Robbins. 1980. Kinetics of activation of
human plasminogen by different activator species at pH 7.4 and 37 degrees
C. J. Biol. Chem. 255:2005–2013.
47. Wong, S.-L. 1989. Development of an inducible and enhancible expression
and secretion system in Bacillus subtilis. Gene 83:215–223.
48. Wong, S.-L., R. Ye, and S. Nathoo. 1994. Engineering and production of
streptokinase in a Bacillus subtilis expression-secretion system. Appl. Envi-
ron. Microbiol. 60:517–523.
49. Wu, X.-C., W. Lee, L. Tran, and S.-L. Wong. 1991. Engineering a Bacillus
subtilis expression-secretion system with a strain deficient in six extracellular
proteases. J. Bacteriol. 173:4952–4958.
50. Young, K.-C., G.-Y. Shi, Y.-F. Chang, B.-I. Chang, L.-C. Chang, M.-D. Lai,
W.-J. Chuang, and H.-L. Wu. 1995. Interaction of streptokinase and plas-
minogen—studied with truncated streptokinase peptides. J. Biol. Chem. 270:
29601–29606.