Вы находитесь на странице: 1из 24
FUVEST 2019 1ª Fase − Conhecimentos Gerais (31/03/2019)
FUVEST 2019 1ª Fase − Conhecimentos Gerais (31/03/2019)
FUVEST 2019 1ª Fase − Conhecimentos Gerais (31/03/2019)

FUVEST 2019

1ª Fase − Conhecimentos Gerais (31/03/2019)

FUVEST 2019 1ª Fase − Conhecimentos Gerais (31/03/2019)

ASSINATURA DO CANDIDATO

Conhecimentos Gerais (31/03/2019) ASSINATURA DO CANDIDATO MEDICINA PROVA DE CONHECIMENTOS GERAIS 31.03.2019
MEDICINA
MEDICINA
Gerais (31/03/2019) ASSINATURA DO CANDIDATO MEDICINA PROVA DE CONHECIMENTOS GERAIS 31.03.2019 INSTRUÇÕES 1.
Gerais (31/03/2019) ASSINATURA DO CANDIDATO MEDICINA PROVA DE CONHECIMENTOS GERAIS 31.03.2019 INSTRUÇÕES 1.

PROVA DE CONHECIMENTOS GERAIS

31.03.2019

CANDIDATO MEDICINA PROVA DE CONHECIMENTOS GERAIS 31.03.2019 INSTRUÇÕES 1. Só abra este caderno quando o fiscal
CANDIDATO MEDICINA PROVA DE CONHECIMENTOS GERAIS 31.03.2019 INSTRUÇÕES 1. Só abra este caderno quando o fiscal

INSTRUÇÕES

1. Só abra este caderno quando o fiscal autorizar.

2. Verifique, na capa deste

caderno, se seu nome está correto e se sua folha óp�ca de respostas pertence ao grupo V.

3. Este caderno compõe-se

de 90 questões obje�vas. Em cada questão, há 5 alterna�vas, sendo correta apenas uma.

4. Assinale a alterna�va

que você considera correta, preenchendo o círculo correspondente na folha óp�ca de respostas, u�lizando necessariamente caneta esferográfica de �nta azul ou preta.

5. Preencha a folha

óp�ca de respostas com cuidado, pois, em caso

de rasura, ela não poderá ser subs�tuída e o uso de corre�vo não será permi�do.

6. Duração da prova:

cinco horas. Não haverá tempo adicional para transcrição de gabarito para a folha óp�ca de respostas.

de gabarito para a folha óp�ca de respostas. 7. Durante a prova, são vedadas a comunicação

7. Durante a prova, são

vedadas a comunicação entre candidatos e a u�lização de qualquer material de consulta, eletrônico ou impresso, e de aparelhos de telecomunicação.

8. O candidato poderá

re�rar-se do prédio após 1 hora do início da prova.

9. Ao final da prova, é

obrigatória a devolução deste caderno de questões e da folha óp�ca

de respostas. Poderá ser levado somente o gabarito provisório de respostas.

01

Um

aluno

ao

tentar

resolver

a

expressão

real

01 Um aluno ao tentar resolver a expressão real acabou se equivocando e invertendo o sinal
01 Um aluno ao tentar resolver a expressão real acabou se equivocando e invertendo o sinal

acabou se equivocando

e invertendo o sinal do resultado, desse modo, o valor numérico encontrado por esse aluno está compreendido entre:

(A)

1 e 2

(B)

– 0,003 e – 0,004

(C)

– 0,063 e – 0,062

(D)

0,064 e 0,063

(E)

– 1,5 e – 1,4

02

O ladrilho abaixo é formado pelos quadrados ABDC e EFGH e

pelos triângulos AEB, BFD, DGC E CHA

ABDC e EFGH e pelos triângulos AEB, BFD, DGC E CHA Se o quadrado ABCD tem
ABDC e EFGH e pelos triângulos AEB, BFD, DGC E CHA Se o quadrado ABCD tem
ABDC e EFGH e pelos triângulos AEB, BFD, DGC E CHA Se o quadrado ABCD tem

Se o quadrado ABCD tem lado de medida

mede 60°, então, a área do quadrado EFGH, em cm 2 , é

(A)

(B)

(C)

3 ​​​cm​e​o​ângulo​A​​ ^

C ​​H 

3  ​​.

5

8  ​​.

6  ​​.

(D) 3 (1​-​​ 

(E) 3

8  ​​.

2 3 ​   ​  ) ​​.

03

Pedro desenha em uma folha de cartolina uma região triangular

ABC​com​uma​característica​particular:​o​encontro​das​bissetri-

zes​dos​ângulos​externos​do​vértice​B​e​C​formam​um​ângulo​de​

medida​50°.​Sendo​assim,​o​valor​do​ângulo​interno​do​vértice​A​

desenhado por Pedro vale:

(A) 115°

(B)​85°

(C)​80°

(D)

37°

(E)

10°

04

Uma pequena metalúrgica constrói peças para atender uma in-

dústria​automobilística​onde​cada​peça​construída​possui​mas-

sa​total​de​32​kg.​Cada​peça​é​formada​pelos​componentes​A​e​

M, sendo que a metalúrgica gastou o mesmo valor na compra de​cada​componente.​Sabendo​que​o​custo​de​cada​quilograma​ do componente A foi um terço do custo de cada quilograma do componente​M,​qual​deve​ser​a​quantidade​de​componente​A,​ em quilogramas, usada na fabricação dessa peça

(A)

10 kg

(B)

12 kg

(C)

16 kg

(D)

20 kg

(E)

24 kg

05

Um hacker está tentando invadir um sistema operacional que

possui​uma​senha​numérica​formada​por​5​dígitos.​O​hacker​já​

descobriu​ os​ 4​ primeiros​ dígitos​ e​ sabe​ que​ o​ último​ dígito​ é​

dado pelo oposto do valor da expressão (  ​ 

x -2 - y -2

   

  x -1 + y -1

) · (  x 2 y + xy

x 2 - y 2

  ​      ) ,

2

em que x e y, x 0 e y 0 IR e x y e x -y, então tal dígito é:

(A)

(B)

(C)

(D)

(E)

1

- 1

3

0

- 2

06

Uma imobiliária contrata um topógrafo para avaliar e medir um terreno​que​será​posto​a​venda.​Ao​chegar​ao​local​o​topógrafo​

visualiza​uma​região​triangular​de​vértices​A,​B​e​C.​Após​algu-

mas medições conclui-se que tal triângulo é retângulo em A e que AB​=​21​e​AC​=​20.​Sabendo​que​D​é​pertencente​AC​e​BD​é​ bissetriz do ângulo ABC, a medida de AD vale:

(A)​​​  5  ​​    

(B)

8 ​​

(D)

(C)

42

15

12

(E)

5

07

Um​matemático​analisa​um​problema​físico​que​consiste​em​de-

terminar​qual​deve​ser​o​valor​real​e​positivo​de​a, para que a soma dos quadrados das raízes da expressão x 2 ​ +​ ax​ +​ 12​ seja​ igual a 25?

Após​estudar​o​caso​o​matemático​conclui​que​o​valor​procurado​ de a é:

(A)

(B)

(C)

(D)

(E)​8

7

1

5

2

08

Um pedreiro estabeleceu a meta de construir um muro comple- to​em​três​dias.​No​primeiro​dia,​construiu​um​terço​do​muro.​No​ dia​seguinte,​mais​um​terço​do​que​faltava.​Que​fração​do​muro​ ele​necessita​construir​no​terceiro​dia​para​atingir​sua​meta?

(A)​​​ 

(A) ​​​  1 3  ​​    

1

3  ​​    

(B)​​​ 

(B) ​​​  2 3  ​​    

2

3  ​​    

(C)​​​ 

(C) ​​​  5 3  ​​    

5

3  ​​    

(D)​​​ 

(D) ​​​  4 9  ​​    

4

9  ​​    

(E)​​​ 

(E) ​​​  3 8  ​​    

3

8  ​​    

3

09

Uma​ olimpíada​ de​ matemática​ foi​ realizada​ na​ escola​ “Futuro​ Feliz” e cada vencedor recebeu uma medalha com o símbolo abaixo formada por três circunferências de raio unitário e de centros A, B e C e uma região sombreada

raio unitário e de centros A, B e C e uma região sombreada Dessa forma, o

Dessa forma, o perímetro da região sombreada, em unidades de comprimento, é

(A)​5.

(B)

(C)

(D)

(E)

3 ​​.

p.

2p.

8.

10

Durante​um​processo​seletivo​para​seleção​de​voluntários​para​ um evento cultural, sabe-se que:

Do​total​T​de​candidatos,​80​compareceram​à​primeira​fase​do​

processo​seletivo,​85,​à​segunda​fase​e​65​compareceram​à​ter-

ceira​fase.

Dos​candidatos​que​participaram​da​primeira​fase,​36​não​retor-

naram para as duas fases seguintes, 15 retornaram apenas para

a​segunda​e​20​compareceram​às​três​fases.

Dos candidatos que não estavam presentes na primeira fase, 30 compareceram​à​segunda​e​à​terceira​fases.

1

Com​base​nessas​informações,​se​​​   ​​​do​total​de​candidatos​não​

3

compareceu​ao​processo​seletivo,​então​o​valor​de​T​é

(A)

175

(B)

197

(C)

204

(D)

215

(E)

300

11

Arlindo comemorou seu aniversário em um salão de festas e combinou com seus convidados que gostaria de receber dinhei- ro​como​presente.​Ao​final​da​festa​Arlindo​observou​que​havia​

ganhado​ao​todo​a​quantia​de​R$​633,00.​Sabendo​que​nenhum​

de​seus​convidados​o​presenteou​com​menos​de​R$​17,00,​mas​

também​ ninguém​ presenteou​ com​ mais​ de​ R$​ 33,00,​ pode-se​

afirmar​que​o​número​mínimo​e​o​número​máximo​de​convida-

dos​presentes​no​aniversário​são,​respectivamente,​iguais​a

(A)​15​e​32.

(B)​20​e​37.

(C)​17​e​33.

(D)​19​e​38.

(E)​ 20​e​30.

12

A​figura​abaixo​representa​uma​horta​comunitária​onde​a​região​

formada​pelo​triângulo​CDE​será​destinada​ao​plantio​de​milho,​a​

região​formada​pelo​triângulo​DEA​será​destinada​ao​plantio​de​

maçãs​e​a​região​formada​pelo​triângulo​ABC​será​destinada​ao​

plantio​de​laranjas.

Dado que o ângulo é

EADé congruente ao ângulo

DEA​​. 

 EAD   é congruente ao ângulo   DEA​​. 

Pode-se​afirmar​que​a​medida​do​segmento​CE​é​igual​a:

(A)

(B)

(C)

(D)

(E)

3,0

2,7

2,4

2,5

2,1

13

O​tungstênio​(W)​é​um​elemento​químico​utilizado​em​filamen-

tos​de​lâmpadas​incandescentes.​Isso​porque​quando​passa​uma​

corrente​elétrica​por​um​filamento​de​pequena​secção​transver-

sal,​ele​dissipa​energia​por​efeito​Joule,​esquentando​e​emitindo​

luz​e​calor.

Analise​as​assertivas​abaixo​sobre​o​tungstênio:

I.​​

II.​

III.

IV.​

O​modelo​atômico​que​permite​explicar​a​cor​da​luz​emiti- da​pelo​filamento​de​tungstênio​é​o​modelo​de​Rutherford​ –​Bohr.

O tungstênio deve ter alta resistência elétrica e, por isso, não

pode​ser​um​metal.

De acordo com o modelo atômico de Thomson, os elétrons mais externos do átomo de tungstênio estão orbitando ao redor do núcleo em uma camada eletrônica mais afastada de seu​núcleo.

O​tungstênio​é​um​elemento​químico​dúctil.

Está​correto​o​que​se​afirma​em

(A)

I e IV

(B)

I e II

(C)

III e IV

(D)

I, III e IV

(E)

I, II e III

14

Dentre​as​espécies​químicas​representadas​abaixo,​aquela​cujo​ elétron de valência NÃO​é​mais​energético​é:

(A)​Na​(Z​=​11)

(B) Sc +3 ​(Z​=​21)

(C)​Kr​(Z​=​36)

(D)​Cu​(Z​=​29)

(E) Se -2 ​(Z​=​34)

4

15

O​ físico​ dinamarquês​ Niels​ Bohr​ (1885​ –​ 1962)​ propôs​ alguns​

postulados​a​fim​de​explicar​alguns​fenômenos​não​soluciona-

dos​conclusivamente​pelo​modelo​atômico​de​Rutherford.​Um​ desses fenômenos é:

(A)​A​deflexão​de​poucas​partículas​alfa​que​foram​incididas​por​

Rutherford​numa​lâmina​fina​de​ouro.

(B)​A​emissão​descontínua​de​espectros​de​radiação.

(C)​A​emissão​de​raios​catódicos​na​ampola​de​Crookes.

(D)​A​conservação​de​massa​em​uma​reação​química​qualquer.

(E) A concentração de massa em apenas uma região pequena do átomo.

16

O tecnécio ( 43 Tc)​ foi​ o​ primeiro​ elemento​ químico​ artificial,​ ou​

seja,​produzido​pela​humanidade.​Foi​sintetizado​pela​primeira​ vez em 1937, na Itália, após uma amostra de outro elemento químico, o molibdênio ( 42 Mo),​ ser​ utilizada​ em​ um​ acelerador​ de​partículas.

Sobre​o​elemento​tecnécio,​pode-se​afirmar​que:

(A)​Nas​CNTP,​o​tecnécio​apresenta-se​como​um​gás​incolor.

(B)​Pode​ser​utilizado​em​artigos​eletrônicos,​por​ser​um​exce-

lente​semicondutor.

(C)​O​tecnécio​tem​número​atômico​44.

(D)

Apesar de conduzir bem a eletricidade, não é um bom con- dutor​de​calor.

(E)

Além de conduzir bem a eletricidade, apresenta brilho carac- terístico​quando​polido.

17

Os motores de combustão dos automóveis funcionam, em sua

maioria,​ à​ base​ de​ gasolina.​ Esse​ combustível​ é​ composto​ por​ uma mistura de hidrocarbonetos, dentre os quais o n – octano

(C 8 H

C 8 H 18 + O 2 CO 2 + H 2 O Um determinado veículo consegue percorrer a distância de 9 km

18 ).​A​sua​equação​de​combustão​não​balanceada​é​dada​por:

consumindo​1​litro​de​gasolina.​O​gráfico​abaixo​mostra​o​movi-

mento desse veículo durante determinado percurso, durante 15 segundos,​seguindo​uma​trajetória​retilínea.

13 12 11 10 9 8 7 6 5 4 3 2 1 0 0
13
12
11
10
9
8
7
6
5
4
3
2
1
0
0
1
2 3
4
5 6
7 8
9 10
11 12 13 14
15
16
Velocidade (m/s)

Tempo (s)

Admitindo​que​a​gasolina​utilizada​por​esse​automóvel​seja​com-

posta exclusivamente de n – octano e que a combustão, que é completa, se dá a um rendimento de 100 %, qual a massa de

dióxido de carbono que foi liberada pelo veículo durante os 15 segundos de movimento?

(A)

14 g

(B)

10 g

(C)

32 g

(D)

126 g

(E)

63 g

Note e adote:

Densidade do n – octano: 0,74 g/cm 3 Massa molar do n – octano: 114 g/mol Massa molar do dióxido de carbono: 44 g/mol

18

Um estudante teve a oportunidade de visitar a USP durante a Se- mana​da​Química​promovida​pela​universidade.​No​laboratório,​ se​deparou​com​um​balão​volumétrico,​no​qual​estava​contido​ uma​substância​gasosa,​com​coloração​característica.​O​técnico​ do laboratório informou que se tratava de uma substância tóxica e​simples. Acertadamente, o estudante soube que o elemento químico em questão era o(a):

(A)

Mercúrio ( 80 Hg).

(B)

Cloro ( 17 Cl).

(C)

Samário ( 62 Sm).

(D)

Gadolínio ( 64 Gd).

(E)

Césio ( 55 Cs).

Note e adote:

No​laboratório,​a​temperatura​estava​em​30​°C.

Para​efeitos​práticos,​a​pressão​atmosférica​na​USP​é​de​apro-

ximadamente​1​atm.

19

O​ DDT​ (dicloro​ difenil​ tricloroetano)​ é​ um​ conhecido​ pestici- da.​ Utilizado​pelos​ ingleses​em​ larga​ escala​na​Birmânia​(atual​ Myanmar)​após​a​Segunda​Guerra​Mundial,​foi​sintetizado​pela​

primeira​vez​em​1874.​Sua​utilização​foi​proibida​em​vários​países​

(como​o​Brasil),​pois​possui​grande​tendência​à​bioacumulação​ em​populações.​Comprovou-se,​por​exemplo,​a​sua​longevidade​ química​ nos​ animais​ mesmo​ 50​ anos​ após​ as​ suas​ respectivas​ populações​terem​sido​expostas​ao​composto. Abaixo,​está​representada​a​fórmula​estrutural​do​DDT.

C l

C l C l C l
C l
C l
C l

C l

Sobre​as​duas​substâncias,​analise​as​afirmações​a​seguir:

I.​​ A fórmula molecular do DDT é C 13 H 9 Cl 5 . II.​ Os organismos vivos não conseguem metabolizar o DDT, cau- sando​o​processo​de​bioacumulação. III.​ O​DDT​possui​cadeia​ramificada,​sem​heteroátomos. IV.​ A​cadeia​do​DDT​é​alicíclica. Está​correto​o​que​se​afirma​apenas​em:

(A)

II e III

(B)

I e II

(C)

I e IV

(D)

I, II, III e IV

(E)

II e IV

20

Pressão de vapor é uma grandeza que permite mensurar a pres- são exercida por determinada substância, no estado gasoso, quando em equilíbrio termodinâmico com o líquido que deu origem​ao​vapor. Considere as substâncias: propano (C 3 H 8 ), água (H 2 O),​flúor​(F 2 ), metanal (CH 2 O) e etanol (C 2 H 6 O). As substâncias com maior e menor pressão de vapor, a 25 °C, são respectivamente:

(A)​Flúor​e​água.

(B)​Etanol​e​propano.

(C)​Etanol​e​metanal.

(D)​Metanal​e​água.

(E)​ Água​e​etanol.

5

21

Uma​ mistura​ X,​ cuja​ composição​ percentual​ volumétrica​ é​ de​

85%​ de​ água​ e​ 15%​ de​ etanol,​ se​ encontra​ em​ um​ recipiente​ A.​Uma​mistura​Y,​cuja​composição​percentual​volumétrica​é​de​

85%​de​água​e​15%​de​gasolina,​se​encontra​em​um​recipiente​

B.​Ambas​as​misturas​são​colocadas​em​repouso​a​temperatura​

ambiente​e​1​atm,​tempo​suficiente​para​o​estabelecimento​do​

equilíbrio​em​cada​recipiente.​Em​seguida,​aproximam-se​laba-

redas​em​ambas​as​misturas.

Assinale​a​alternativa​correta​a​respeito​do​que​ocorre,​quando​

aproxima​se​a​labareda.

(A)​Ocorrerá​combustão​somente​sobre​a​superfície​líquida​do​

recipiente​A,​devido​à​diferença​de​polaridade​e​densidade​

entre​os​líquidos.

(B)​Ocorrerá​combustão​somente​sobre​a​superfície​líquida​do​

recipiente​B,​devido​à​diferença​de​polaridade​e​densidade​

entre​os​líquidos.

(C)​Não​ocorrerá​combustão​em​nenhuma​das​superfícies​devi-

do​à​grande​similaridade​de​polaridade​e​densidade​entre​os​

líquidos.

(D)​Não​ocorrerá​combustão​em​nenhuma​das​superfícies​devi-

do​à​grande​diferença​de​polaridade​entre​os​líquidos. (E)​Ambas​ as​ superfícies​ entrarão​ em​ combustão,​ simultanea- mente, devido á elevada diferença de polaridade e densida- de​entre​os​líquidos.

22

Gelo​seco,​Gás​Nitrogênio​e​Pedra​são​respectivamente​exem-

plos de:

(A)​Mistura,​Substância​composta​e​substância​simples.

(B)​Substância​simples,​Mistura,​substância​composta.

(C)​Mistura,​Substância​simples,​substância​composta.

(D)​Substância​composta,​Mistura​e​substância​simples.

(E)​ Substância​composta,​Substância​simples,​Mistura.

23

A dose diária recomendada do elemento cálcio para um adulto

é​de​800​mg.​Suponha​certo​suplemento​nutricional​à​base​de​

casca​de​ostras​que​seja​100%​CaCO 3 .​Se​um​adulto​tomar​dia- riamente dois tabletes desse suplemento de 500 mg cada, qual porcentagem​de​cálcio​da​quantidade​recomendada​essa​pessoa​ está ingerindo?

(A)

(B)

(C)

(D)​80%

(E) 125%

25%

40%

50%

Note e adote:

Massas​molares​(g/mol):​Ca​=​40;​O​=​16;​C​=​12.

24

No​modelo​padrão​das​partículas​elementares​o​próton​é​cons-

tituído​ de​ subpartículas​ chamadas​ de​ quarks,​ dois​ do​ tipo​ up

(Q​=​+​2e/3)​e​um​do​tipo​down​(Q​=​-​e/3).​Numa​representação​

simplificada,​esses​três​quarks​são​dispostos​nos​vértices​de​um​ triângulo equilátero de lado L = 3,2 × 10 -12 ​m.​Determine​o​mó- dulo da força entre um quark up e um down.

(A)​2,5​µN.

(B)​5,0​µN.

(C)​1,25​µN.

(D)​7,5​µN.

(E)​ 22,5​µN.

Note e adote:

e = 1,6 × 10 -19 C, k = 9 × 10 9 ​N​m 2 /C 2 .

25

Quatro​cargas​elétricas​estão​dispostas​nos​vértices​de​um​qua-

drado​conforma​a​figura​abaixo.

+Q

+Q

- drado​conforma​a​figura​abaixo. +Q +Q +Q L L -Q O campo elétrico resultante no centro do quadrado

+Q- drado​conforma​a​figura​abaixo. +Q +Q L L -Q O campo elétrico resultante no centro do quadrado

- drado​conforma​a​figura​abaixo. +Q +Q +Q L L -Q O campo elétrico resultante no centro do quadrado

L

- drado​conforma​a​figura​abaixo. +Q +Q +Q L L -Q O campo elétrico resultante no centro do quadrado

L

-Q- drado​conforma​a​figura​abaixo. +Q +Q +Q L L O campo elétrico resultante no centro do quadrado abaixo

O campo elétrico resultante no centro do quadrado abaixo está na direção ilustrada em:

(A)

 
 

(B)

 
 

(C)

(C)

(D)

 
 

(E)

 
 

26

No​ quadro​ abaixo​ encontram-se​ as​ temperaturas​ de​ fusão​ e​

ebulição​de​3​compostos​químicos.

Substância

Ponto de Fusão (°C)

Ponto de Ebulição (°C)

Oxigênio

-​218,4

-183

Fenol

43

182

Pentano

-130

36,1

Qual​a​variação​entre​o​ponto​de​ebulição​do​Fenol​e​o​ponto​de​ fusão do pentano na escala Kelvin?

(A)​312​K.

(B)​139​K.

(C)​166,1​K.

(D)​-​6,9​K.

(E)​ 32,4​K.

6

27

“Radiador”​é​o​nome​dado​para​equipamentos​que​realizam​a​

troca de calor entre o ar e alguma outra substância, geralmente

líquidos,​presentes​em​um​sistema​fechado.​O​núcleo​do​radia-

dor possui diversos canais, com formato de colmeia ou tubos, que​possibilitam​a​passagem​do​ar.​O​formato​do​radiador​tem​

relação​direta​com​sua​eficácia:​quanto​maior​a​região​de​conta-

to​do​equipamento​com​o​ar,​mais​rápida​será​a​troca​de​calor.​ Um​modelo​de​radiador​recebe​um​fluxo​de​ar​capaz​de​baixar​a​

temperatura​do​líquido​em​120​°C.​Dado​que​o​calor​específico​

do​líquido​no​radiador​é​0,8​cal/g​°C,​determine​a​massa​de​líqui-

do​contida​no​interior​do​radiador.

Note e adote:

1​cal​=​4​J,​calor​trocado​pelo​fluxo​de​ar​é​igual​a​384​kJ

(A)​1000​g.

(B)​250​g.

(C)​1200​g.

(D)​2600​g.

(E)​ 500​g.

28

Dois​automóveis​percorrem​trajetórias​retilíneas,​numa​mesma​ via, com as seguintes informações:

§ O automóvel A parte da posição X 0A = 5 m com velocidade inicial V 0A = 5 m/s;

§ O automóvel B parte da posição X 0B = -5 m com velocidade inicial V 0B ​=​15​m/s. Considerando que os automóveis possuem velocidades cons- tantes, determine o intervalo de tempo entre a passagem do automóvel B pela origem X B = 0 e o encontro entre os dois au- tomóveis.

(A)​0​s.

(B)​1​s.

(C)​1/3​s.

(D)​2/3​s.

(E)​ 4/3​s.

29

Hércules entrou no labirinto do Minotauro e descreveu a se- guinte​trajetória,​ilustrada​na​figura​abaixo,​entre​a​entrada​e​a​ posição​em​que​encontra​a​fera.​Qual​o​vetor​deslocamento​de​ Hércules?​Note​e​anote:​cada​quadrado​tem​área​igual​à​u 2 , os eixos​coordenados​ são​ x​ (horizontal​–​ direção​ i)​e​ y​ (vertical​–​ direção​j).

i)​e​ y​ (vertical​–​ direção​j). 0 (A) ​5u​i​+​3u​j. (B) ​3u​i​+​5u​j.

0

(A)​5u​i​+​3u​j.

(B)​3u​i​+​5u​j.

(C)​5u​i​+​5u​j.

(D)​3u​i​-​5u​j.

(E)​ -5u​i​+​3u​j.

(D) ​3u​i​-​5u​j. (E) ​ -5u​i​+​3u​j. 30

30

Uma​esfera​A,​inicialmente​carregada​com​carga​Q,​é​colocada​ em contato com uma outra esfera B inicialmente neutra de mes-

mo​diâmetro.​Após​o​equilíbrio​de​cargas,​observou-se​que​a​for-

ça​de​interação​entre​elas​tinha​módulo​F​a​uma​distância​D​uma​ da​ outra.​ Logo​ em​ seguida,​ colocou-se​ a​ esfera​ B​ em​ contato​

com​uma​esfera​C​de​carga​2Q​e​mesmo​diâmetro,​afastando-se​

esta​ a​ uma​ distância​ 2D​ após​ estabelecido​ o​ equilíbrio.​ Sendo​ assim, qual a relação entre o módulo da força F' de interação entre B e C e a força F?

(A)​F'​=​​​ 

(B)​F'​=​​​ 

(C)​F'​=​​​ 

(D)​F'​=​​​ 

25 F

16  ​​    

16 F

25  ​​    

16 5  ​​ F    

25 4  ​​ F    

(E)​ F'​=​​​  4 25 F  ​​    

Note e adote:

Considere​o​sistema​eletricamente​isolado.

As​esferas​são​feitas​do​mesmo​material.

31

Em um recipiente de capacidade térmica desprezível, encontra-se 10 kg de um líquido X a uma temperatura T x = 10 °C que , ao adi- cionar 200 g de água a temperatura T A = 60 °C nesse, observa-se que após algum tempo que o sistema entra em equilíbrio a T E .​O​ gráfico​ abaixo​ ilustra​ o​ comportamento​ do​ líquido​ X​ em​ função​ da​ variação​ de​ temperatura.​ Dessa​ forma,​ conforme​ a​ tabela​ 1,​ a temperatura de equilíbrio T E ​e​o​líquido​X​são​respectivamente:

Líquido X

7000 6000 5000 4000 3000 2000 1000 0 0 5 10 15 20 25 30
7000
6000
5000
4000
3000
2000
1000
0 0
5
10
15
20
25
30
Quan dade de calor (cal)

Variação da temperatura (°C)

Calor específico de algumas substância

Substância (sólidos e líquidos)

Calor especifico (a 25°C e pressão normal) (J/kg °C) e (cal/g °C)

Água

4200

1,0

Álcool​etílico

2400

0,58

Alumínio

900

0,22

Chumbo

130

0,031

Cobre

390

0,092

Concreto

840

0,20

Ferro

450

0,11

Gelo (a- 5°C)

2100

0,50

Mercúrio

140

0,033

Ouro

130

0,031

Prata

230

0,056

(A)​10°C​e​Água.

(B)​30°C​e​Mercúrio.

(C)​50°C​e​Alumínio.

(D)​20°C​e​Ferro.

(E)​ 30°C​e​Álcool​etílico.

Note e adote: Considere​o​sistema​adiabático.

7

32

Na​ trajetória​ representada​ abaixo,​ uma​ partícula​ descreve​ um​ movimento​uniforme​conforme​ilustra​a​figura.​Sabendo​que​o​ vetor​ velocidade​ é​ tangente​ a​ cada​ ponto​ da​ trajetória​ e​ tem​ módulo v e que o ângulo formado em relação a horizontal é de 30°, qual módulo da variação da velocidade do ponto A ao ponto B,​segundo​a​figura?

Pele de coelho Vidro Cabelo humano Mica Lã Pele de gato Seda Algodão Âmbar Ebonite
Pele de coelho
Vidro
Cabelo humano
Mica
Pele de gato
Seda
Algodão
Âmbar
Ebonite
Poliéster
Isopor
Plástico
A v B
A
v
B

v

(A)​∆v​=​v​​​

(B)​∆v​=​3v​​​

3 ​​

3 ​​

(C)​∆v​=​​​ 

1

 ​​​v​​​

3 ​​

2

(D)​∆v​=​2v​​​

(E)

2 ​​

2 ​​

∆v​=​​​ 

1

2

   

 ​​​v​​​

(A) O estudante não observou a esfera eletrizada, porque esta perdeu​toda​a​sua​carga​devido​ligação​desta​com​a​Terra.

(B)​O​estudante​observou​a​esfera​eletrizada​positivamente,​por-

que​ao​ser​ligada​com​a​Terra​através​do​fio​condutor,​essa​ perde​toda​a​sua​carga​negativa. (C)​O​ estudante​ observou​ a​ esfera​ eletrizada​ negativamente,​ porque​estando​a​garrafa​de​vidro​eletrizada​negativamente,​ a​esfera​perde​elétrons​através​do​contato​que​o​fio​condutor​ estabelece​com​a​Terra.

(D)​O​ estudante​ observou​ a​ esfera​ eletrizada​ negativamente,​ porque​estando​a​garrafa​de​vidro​eletrizada​positivamente,​

a​esfera​ganha​elétrons​através​do​contato​que​o​fio​condu-

33

Um veículo A inicialmente a uma velocidade constante V A ​=​108​km/h​ percorre​uma​trajetória​retilínea​durante​∆t 1 = 5 min e, após de- corrido este intervalo, diminui sua velocidade para V A ', percor-

rendo​uma​distância​D.​O​motorista​ao​observar​que​está​a​300​m​

do​ final​ de​ seu​ destino,​ passa​ a​ imprimir​ a​ mesma​ velocidade​ que​a​inicial.​Sabendo​que​o​percurso-retilíneo-total​da​viagem​é​ de 27,3 km e o tempo total da viagem é de 1030 s, o valor de V A ', no​SI,​é​respectivamente

tor​estabelece​com​a​Terra.

(E)​ O​estudante​observou​a​esfera​eletrizada​positivamente,​por-

que​estando​a​garrafa​de​vidro​eletrizada​negativamente,​a​

esfera​perde​elétrons​através​do​contato​que​o​fio​condutor​

estabelece​com​a​Terra.

(A)

10 m/s

(B)

20 m/s

(C)

15 m/s

(D)

25 m/s

(E)

30 m/s

35

34

Um​aluno​do​Instituto​De​Física​da​USP,​para​observar​o​fenô-

meno de eletrização por indução realizou os seguintes procedi- mentos:

§ 1 º Passo: atritou um pano de seda com uma garrafa de vidro;

§ 2º Passo: aproximou a parte da garrafa – sem encostá-la - que fora atritada com seda de um esfera metálica neutra;

§ 3º Passo:​conectou​um​fio​condutor​ligando​a​esfera​à​super- fície​da​Terra​com​o​vidro​ainda​próximo;

§ 4º Passo:​após​um​longo​intervalo​de​tempo,​corta-se​o​fio​ condutor,​afastando​a​garrafa​eletrizada​para​longe.

Com base nos passos seguido pelo estudante e considerando a​ série​ triboelétrica​ abaixo,​ podemos​ afirmar​ que,​ ao​ final​ do​ processo:

As temperaturas de fusão e de ebulição da água de um termô- metro na escala X são raízes da equação x 2 ​-​18x​-​40.​Sabendo​ disso, quando um termômetro graduado em Fahrenheit marcar 122 °F, o valor da indicação em °X do termômetro será de:

(A)

11°X

(B)

9°X

(C)

15°X

(D)

14°X

(E)

12°X

36

Um experimento foi montado para determinar a aceleração da

gravidade​de​uma​determinada​região​de​São​Paulo.​O​arranjo​

experimental​é​constituído​de​um​tubo​vertical​de​comprimen-

to L, que permite o lançamento livre de dois corpos de massas diferentes.​As​medidas​obtidas​(apresentadas​na​tabela​abaixo)​ são​as​diferenças​de​velocidades​(ΔV)​final​e​inicial,​bem​como​os​ tempos​de​queda​(Δt),​de​cada​corpo.

Massa dos corpos (Kg)

ΔV (m/s)

Δt (s)

2

X – 20

5

4,2

28,8

y

Tendo​obtido​g​=​10​m/s 2 , quais os valores de x e y na tabela acima?

(A)​70​e​2,88.

(B)​70​e​5.

(C)​50​e​2,88.

(D)​2,88​e​70.

(E)​50​e​70.

8

37

Sobre​as​características​das​espécies​atuais​que​podem​ser​utili-

zadas​como​evidências​evolutivas,​podemos​dizer​que:

(A) A semelhança entre indivíduos de grupos diferentes que ha- bitam o mesmo ambiente, ou analogia, sugere parentesco entre​eles.

(B)​Ao​longo​das​últimas​décadas,​surgiram​técnicas​que​possibi-

litam​analisar​a​evolução​do​ponto​de​vista​bioquímico.​Essas​ técnicas se baseiam principalmente na ideia de que, quanto

mais​próximas​filogeneticamente,​as​espécies​produzem​pro-

teínas​com​maior​semelhança​estrutural.

(C)​Órgãos​ que​ possuem​ a​ mesma​ origem​ evolutiva,​ embora​ suas​ funções​ sejam​ diferentes,​ são​ denominados​ homólo-

gos.​É​o​caso​do​esqueleto​dos​membros​anteriores​dos​ver-

tebrados.

(D)​Os​ fósseis​ podem​ ser​ utilizados​ como​ evidências​ da​ evolu- ção, pois mostram que as espécies atuais são mais especiali- zadas​e​bem​sucedidas​do​que​as​extintas.

(E)​Estruturas​vestigiais,​ou​seja,​que​não​apresentam​mais​fun-

ção no corpo, podem denotar especialização de um grupo a

determinado​ambiente,​como​é​o​caso​do​apêndice​intesti-

nal​nos​mamíferos,​atrofiado​e​sem​função​aparente.

38

Durante os primeiros bilhões de anos de existência da vida, os seres procariontes evoluíram e desenvolveram processos bio- químicos fundamentais, tais como mecanismos de duplicação do material hereditário, síntese de proteínas, obtenção de ener- gia​e​outros.​Em​relação​à​evolução​dos​processos​de​obtenção​ de energia, é lógico se pensar que:

(A) Uma hipótese amplamente aceita atualmente é de que as primeiras formas de vida foram originadas a partir de aglomerados de carboidratos e vitaminas, chamados de coacervados. (B) Uma linhagem de seres procariontes desenvolveu um pro-

cesso​ autotrófico,​ a​ fotossíntese,​ em​ que​ é​ possível​ obter​ energia​a​partir​de​substâncias​orgânicas. (C) A fermentação é um mecanismo de obtenção de energia bastante simples, que pode ou não resultar na liberação de gás carbônico, e os primeiros seres vivos a habitarem a Ter- ra​provavelmente​o​utilizavam,​por​se​tratar​de​um​processo​ anaeróbico.

(D)​Após​o​surgimento​dos​seres​autotróficos,​a​presença​de​oxi-

gênio na atmosfera criou as condições necessárias para que uma linhagem de procariontes desenvolvesse um mecanis-

mo​muito​mais​eficiente​de​obtenção​de​energia,​a​respira-

ção​aeróbica​ou​fermentação. (E)​A​atmosfera​primitiva​apresentava​gases​como​ metano,​va- por de água e oxigênio, o que é uma evidência de que os primeiros​seres​vivos​a​surgirem​na​Terra​eram​autótrofos.

39

A imagem abaixo ilustra o que aconteceu com a variação no comprimento dos indivíduos de uma população de lagartos de- pois​de​uma​mudança​ambiental.​Com​base​nessas​informações,​ assinale​a​alternativa​correta:

frequência de indivíduos frequência de indivíduos
frequência de indivíduos
frequência de indivíduos

(A) A seleção natural está atuando nessa população; teve como

consequência​à​eliminação​de​indivíduos​com​fenótipos​in-

termediários.

(B)​A​mudança​ambiental​produziu​nessa​população​característi-

cas​que​antes​não​eram​encontradas.

(C)​A​mudança​ambiental​teve​um​efeito​negativo​para​a​espé-

cie,​uma​vez​que​indivíduos​com​determinada​característica​ estão​sendo​eliminados.​ (D)​A​ mudança​ ambiental​ promoveu​ o​ aumento​ na​ competição​ intraespecífica​(entre​indivíduos​da​mesma​espécie),​em​que​ os​indivíduos​com​características​extremas​levaram​vantagem. (E) A seleção natural não é uma explicação possível para o fenô- meno observado na população de lagartos depois da mudan- ça​ambiental.

40

O Homo sapiens faz parte da Ordem dos Primatas, e apresenta alto​grau​de​parentesco​com​diversas​espécies​deste​grupo.​Na​ tabela a seguir constam as diferenças entre a sequências de ba- ses​nitrogenadas​do​DNA​do​ser​humano​e​o​DNA​de​algumas​ espécies​de​primatas.

Espécie

Diferença nas sequências do DNA

Macaco Rhesus

7,0%

Orangotango

3,1%

Gorila

1,6%

Chimpanzé

1,0%

De​acordo​com​os​dados​da​tabela,​pode-se​afirmar​que:

(A)

Orangotangos e macacos Rhesus​ constituem​ um​ grupo​ ir- mão​a​humanos,​chimpanzés​e​gorilas.

(B)

Gorilas​são​mais​próximos​de​chimpanzés​que​de​orangotangos.

(C)

Os macacos Rhesus​são​espécies​mais​antigas​que​os​demais​ primatas​representados.

(D)​Orangotangos​surgiram​antes​de​chimpanzés.

(E)​ A​ semelhança​ entre​ os​ DNAs​ de​ gorilas​ e​ orangotangos​ é​ maior​que​a​entre​chimpanzés​e​humanos.

41

Observe a tabela a seguir, em que estão representadas caracte- rísticas​de​quatro​espécies​de​plantas:

Característica

 

Espécie

 

1

2

3

4

Apresenta​flores?

Não

Não

Sim

Não

Apresenta vasos condutores?

Sim

Não

Sim

Sim

Apresenta sementes?

Sim

Não

Sim

Não

Possui​clorofila?

Sim

Sim

Sim

Sim

A​partir​destes​dados,​é​possível​obter​uma​árvore​filogenética​ contendo as relações de parentesco entre as espécies estuda- das.​Ao​construir​esta​árvore,​poderemos​notar​que:

(A)​As​espécies​1​e​3​formam​um​grupo-irmão​das​espécies​2​e​4.

(B)​A​espécie​4​tem​origem​evolutiva​mais​recente​do​que​a​es-

pécie​3.

(C) Todas as espécies estudadas apresentam o mesmo grau de parentesco,​ já​ que​ contêm​ uma​ características​ em​ comum​ (corpo​com​clorofila).

(D)​As​espécies​1,​2​e​4​formam​um​grupo​monofilético,​ou​seja,​

um grupo que contém todos os táxons descendentes de de- terminado​ancestral​comum.

(E)​As​espécies​1​e​3​compartilham​um​ancestral​comum​mais​

recente​do​que​o​compartilhado​entre​1​e​4.

9

42

As DSTs (doenças sexualmente transmissíveis) assolam a huma- nidade​nos​tempos​atuais.​Herpes,​sífilis,​HPV,​gonorreia​e​AIDS​ ainda são comuns mesmo com todos os esforços de órgãos de saúde​ em​ promover​ campanhas​ de​ conscientização​ para​ sua​ prevenção. As​doenças​acima​são​causadas,​respectivamente,​por:

(A)​Bactéria,​bactéria,​vírus,​bactéria,​vírus.

(B)​Vírus,​vírus,​bactéria,​vírus,​vírus.

(C)​Vírus,​bactéria,​vírus,​bactéria,​vírus.

(D)​Bactéria,​bactéria,​vírus,​vírus,​vírus.

(E)​Vírus,​vírus,​bactéria,​bactéria,​vírus.

43

Sobre​as​características​das​bactérias,​considere​as​afirmativas​abaixo:

I.​​ As​bactérias​podem​se​reproduzir​sexuadamente,​ou​seja,​há​ produção​e​troca​de​gametas​entre​indivíduos. II.​ Todos​os​organismos​quimiossintetizantes​conhecidos​atual- mente​fazem​parte​do​Reino​Monera. III.​ O​material​genético​das​bactérias​se​encontra​disperso​pelo​ citoplasma. IV.​ Enquanto​ as​ bactérias​ Gram-positivas​ apresentam​ celulose​ na​ composição​ de​ sua​ parede​ celular,​ as​ Gram-negativas​ apresentam​apenas​peptideoglicanos. Assinale​a​alternativa​que​apresenta​somente​afirmativas​corretas:

(A)

II e IV

(B)

II e III

(C)

III e IV

(D)

I e II

(E)

II, III e IV

44

Para​testar​os​efeitos​da​aplicação​de​antibióticos​em​populações​ de bactérias, um grupo de alunos de Medicina aplicou, em um

meio​de​cultura​com​bactérias​da​espécie​E.​coli​,​o​antibiótico​X.​ Qual​dos​gráficos​abaixo​representa,​de​maneira​mais​adequada,​ as mudanças na proporção de bactérias resistentes (R) e não-re- sistentes​(N)​ao​longo​do​tempo,​após​a​aplicação​do​antibiótico?

(A)

(B)

(C)

R N R N Freq. de Freq. de (% )indivíduos (% )indivíduos
R
N
R
N
Freq. de
Freq. de
(% )indivíduos
(% )indivíduos
R N Freq. de (% )indivíduos
R
N
Freq. de
(% )indivíduos

(D)

R N Freq. de (% )indivíduos
R
N
Freq. de
(% )indivíduos

(E)

N R Freq. de (% )indivíduos
N
R
Freq. de
(% )indivíduos

45

Com​relação​à​seleção​natural,​assinale​a​afirmativa​INCORRETA.

(A)

A seleção natural é um processo que ocorre reduzindo a di-

versidade​genética​nas​populações,​já​que​elimina​os​indiví-

duos​que​não​estão​adaptados​ao​ambiente.

(B)

A variabilidade entre os indivíduos de uma população é ge- rada basicamente através de dois processos, a mutação e a recombinação​ gênica,​ sendo​ esta​ última​ exclusiva​ de​ seres​ vivos​com​reprodução​sexuada.

(C)

Fenômenos como a migração podem alterar as frequências genéticas​ das​ populações,​ e​ assim​ modificar​ o​ impacto​ da​ seleção​natural​nestas.

(D)

A seleção natural direciona a adaptação dos indivíduos ao ambiente, atuando sobre a variabilidade populacional gera- da através de mutações, que ocorrem nos organismos sem- pre​que​o​ambiente​se​torna​desfavorável.

(E)

As​ mutações​ genéticas​ podem​ trazer​ vantagens,​ desvanta- gens​ou​não​ter​nenhum​impacto​no​indivíduo.

46

Um​investigador​encontrou​uma​amostra​de​material​genético​ na​cena​de​um​crime.​A​partir​de​uma​análise​deste​material,​a​ sequência​obtida​foi:​AUGCCGUAUGCAUUGCAUUC Podemos​ dizer​ que​ o​ material​ genético​ analisado​ pelo​ investi- gador é:

(A)​RNA,​e​a​sequência​no​DNA​complementar​é​ATGCCGTATG-

CATTGCATTC.

(B)​RNA,​e​a​sequência​no​DNA​que​serviu​de​molde​para​trans-

crição​é​UACGGCAUACGUAACGUAAG.

(C)​DNA,​e​a​sequência​no​DNA​complementar​é​ATGCCGTATG-

CATTGCATTC.

(D)​RNA,​e​a​sequência​no​DNA​complementar​é​TACGGCATACG-

TAACGTAAG.

(E)​DNA,​e​a​sequência​no​DNA​que​serviu​de​molde​para​trans-

crição​é​TACGGCATACGTAACGTAAG.

47

Erwin​ Chargaff​ foi​ um​ bioquímico​ que​ dedicou​ seus​ estudos​ a​

desvendar​o​material​genético​dos​seres​vivos.​Seus​experimen-

tos forneceram informações essenciais para a descoberta da estrutura​ de​ dupla-hélice​ da​ molécula​ de​ DNA.​ Em​ um​ deles,​ Chargaff​conseguiu​estabelecer​as​proporções​relativas​de​cada​

base nitrogenada nesta molécula de diversas espécies, e apon- tou​relação​entre​elas.​No​trigo,​por​exemplo,​observou-se​que​

as​bases​guanina​e​citosina​somam​45,5%​do​material​genético.​

Com​base​nessa​informação,​analise​as​afirmativas​a​seguir. I.​​ A base nitrogenada citosina corresponde a 22,75% deste ma- terial​genético.

II.​ A​ base​ nitrogenada​ timina​ compõe​ 27,25%​ deste​ material​ genético.

III.​ As​bases​timina​e​adenina​somam​54,5%.​Porém,​não​é​pos- sível​determinar​a​proporção​de​cada​base​separadamente. IV.​ Não​ é​ possível​ afirmar​ que​ a​ relação​ de​ Chargaff​ entre​ as​ bases nitrogenadas está presente no trigo, uma vez que era

esperado que houvesse 50% de citosina e guanina, e 50% de adenina​e​timina.

10

As​afirmativas​corretas​são:

(A)​Apenas​I.

(B)​I​e​II.

(C)​I,​II​e​IV.

(D)​III​e​IV.​

(E)​ I,​III​e​IV.

48

No​romance​O coronel e o lobisomem, o narrador-protagonista, chamado Ponciano de Azeredo Furtado, narra suas aventuras e façanhas como proprietário da fazenda Sobradinho que ele her- dara​do​avô.

No​ trecho​ abaixo,​ Ponciano​ relata​ o​ momento​ em​ que,​ algum​ tempo depois de receber a herança, ele e seu advogado estão finalmente​concluindo​a​documentação​que​define​as​divisas​de​ suas​terras​com​as​dos​fazendeiros​vizinhos.

Valeu​a​pena​o​trabalho.​Pernambuco​Nogueira,​a​poder​

de​leis​e​artimanhas,​não​só​limpou​as​propriedades​de​

agravos e roubalheiras, como adentrou suas leis em terra que​não​era​minha.​​Refuguei:

-​​Sou​lá​homem​disso,​doutor!​Quero​só​o​que​é​meu. Mas um aguardenteiro de nome Cicarino Dantas, com

engenho​de​cachaça​em​Paus​Amarelos,​quis​jogar​a​de-

manda​no​terreno​do​atrevimento.​Avisaram​a​ele:

-​​Esse​Ponciano​é​o​tal​que​em​dia​dos​antigos​estuporou​

um​valentão​de​circo​de​cavalinhos.

Deu​de​ombros.​Não​levava​medo​de​homem,​coisa​que​

acabou​desde​a​inventoria​do​pau​de​fogo.​​Era​camarada​

vingancista​e​garantiu​que​o​coronel​do​Sobradinho​não​

pegava​o​tempo​das​águas​com​vida​no​corpo.​Como​fos-

se mês de agosto aproveitei para fazer ironização:

- Pois diga a esse boi de chocalho que ainda tenho mês e meio​para​rebentar​o​chifre​dele.

José​Cândido​de​Carvalho.​O​coronel​e​o​lobisomem.​​

Rio​de​Janeiro:​José​Olympio,​1980.p.19-20.

Considere​as​afirmativas​abaixo:

I.​​

O verbo roubar​é​uma​palavra​primitiva,​da​qual​derivam​os​ substantivos​roubo e roubalheira.

II.​

No​contexto​da​narrativa,​seria​válido​substituir​roubalheira por roubo.

III.

Aguardente é sinônimo de cachaça.

IV.​

Seria​adequado,​no​contexto​da​narrativa,​substituir​aguar- denteiro por cachaceiro.

Assinale​alternativa​correta​em​relação​às​afirmações​acima:

(A)

I, II e III estão corretas;

(B)

I e III estão corretas;

(C)

II e IV estão corretas;

(D)

II e III estão corretas;

(E)

II,​III​e​IV​estão​corretas.

49

O​sentido​de​um​enunciado​é​o​resultado​conjunto​das​palavras​ que selecionamos para construí-lo e da ordenação que damos a essas palavras; por isso, muitas vezes, as mesmas palavras, com

ordenações​diferentes,​resultam​em​enunciados​de​sentidos​dife-

rentes.​Identifique​a​alternativa​em​que​a​mudança​da​posição​da​

palavra​destacada​não​causa​alteração​no​sentido​do​enunciado:

(A)

 

I.​​

Os diretores da empresa ​participaram​da​reunião.

II.​

​diretores​da​empresa​participaram​da​reunião.

(B)

 

I.​​

Professores mais​ novos​ passaram​ a​ participar​das​ deci- sões​da​escola.

II.

Mais​professores​novos​passaram​a​participar​das​deci- sões​da​escola.

(C)

 

I.​​

No​livro​Memórias póstumas de Brás Cubas, o narrador personagem é um defunto autor?

II.​

No​livro​Memórias póstumas de Brás Cubas, o narrador- -personagem é um autor defunto?

(D)

 

I.​

Por​mais​influente​que​ele​possa​parecer,​é​um​gerente​

 

simples.

 

II.

Por​mais​influente​que​ele​possa​parecer,​é​um​simples

 

gerente.

(E)

 

I.​

Na​Península​de​Maraú​na​Bahia,​existem​praias​lindíssimas.

II.

Na​ Península​ de​ Maraú,​ na​ Bahia,​ existem​ lindíssimas praias.

50

Nova lei torna airbag frontal obrigatório O​projeto​de​lei​que​torna​o​airbag​frontal para motorista e pas- sageiro item de segurança obrigatório em carros, camionetes e picapes, aprovado pela Câmara no mês passado, foi sancionado pelo presidente da República e publicado ontem​no​“Diário​Ofi- cial”​da​União.

A​estimativa​é​que​hoje​de​15%​a​25%​dos​veículos​vendidos​no​

país tenha o airbag, índice​que​é​menor​entre​os​populares​(5%).

(Folha​de​S.Paulo,​20.3.2009)

Entre os termos em destaque no texto, os que realmente exer- cem​a​função​de​adjetivo​são​respectivamente:

(A)​Frontal,​passado​e​Oficial;

(B) Item, camionetes e passado;

(C)​Oficial,​ontem​e​índice;

(D)​Oficial,​item​e​passado;

(E)​ Item,​ontem​e​índice.

51

“Ele​é​o​homem, Eu sou apenas Uma mulher” Assinale​a​alternativa​com​análise​errônea​do​trecho​acima:

(A)​Nesses​versos​há​oposição​entre​os​termos​HOMEM​e​MULHER.

(B)​O​artigo​definido​O​para​HOMEM​mostra​uma​sobreposição​

à​MULHER.

(C)​O​artigo​indefinido​UMA​para​MULHER​mostra​que​ela​está​

reforçada​e​superior​em​relação​ao​termo​HOMEM.

(D)​O​adjunto​APENAS​emprega​um​caráter​de​exclusão​ao​ter-

mo​MULHER.

(E)​ O​uso​do​artigo​definido​O​para​HOMEM​reforça​a​soberania​

do​HOMEM.

11

52

Arte suprema1 Tal como Pigmalião, a minha ideia

Visto na pedra: talho-a, domo-a, bato-a;

E ante os meus olhos e a vaidade fátua

Surge,​formosa​e​nua,​Galateia. Mais​um​retoque,​uns​golpes ​e​remato-a; Digo-lhe:​“Fala!”​ao​ver​em​cada​veia Sangue​rubro​que​a​cora​e​aformoseia E​a​estátua​não​falou,​porque​era​estátua. Quer​mesquinho​e​sem​cor,​quer​amplo​e​terso. Em​vão​não​e​que​eu​digo​ao​verso:​“Fala!” E​ele​fala-me​sempre,​porque​é​verso.​

(Júlio​César​da​Silva.​Arte​de​amar.​São​Paulo:​

Companhia​Editora​Nacional,​1961.)

Qual​verso​mostra​dois​ADJETIVOS​sendo​ligados​por​um​conec-

tivo​aditivo?

(A)

(B)

(C)

(D)

(E)

3;

4;

5;

7;

11.

53

Em:​“Consequentemente​(os​homens​que​trabalham​com​a​má-

quina) devem estar muito mais contentes​que​os​bisavós”.

Em​se​tratando​de​grau​dos​adjetivos,​é​correto​afirmar​que​as​ palavras em destaque referem-se:

(A)​ao​grau​comparativo​de​igualdade;

(B)​ao​grau​comparativo​de​superioridade;

(C)​ao​grau​superlativo​relativo​de​inferioridade;

(D)​ao​grau​superlativo​relativo​de​superioridade;

(E)​ ao​grau​normal​quanto​ao​uso​de​um​adjetivo.

Texto para as próximas duas questões Querelas do Brasil

Maurício​Tapajós​e​Aldir​Blanc

O

Brazil não conhece o Brasil

O

Brasil nunca foi ao Brazil

Tapir,​jabuti,​liana,​alamanda,​alialaúde Piau, ururau, aqui, ataúde Piá, carioca, porecramecrã

Jobim akarore Jobim-açu Oh, oh, oh Pererê, camará, tororó, olererê Piriri, ratatá, karatê, olará

O

Brazil não merece o Brasil

O

Brazil ta matando o Brasil

Jereba, saci, caandrades

Cunhãs, ariranha, aranha Sertões, Guimarães, bachianas, águas

E Marionaíma, arirariboia

Na​aura​das​mãos​de​Jobim-açu Oh, oh, oh Jererê, sarará, cururu, olerê Blablablá, bafafá, sururu, olará Do Brasil, SoS ao Brasil Do Brasil, SoS ao Brasil Do Brasil, SoS ao Brasil

Tinhorão, urutu, sucuri

O Jobim, sabiá, bem-te-vi

Cabuçu, Cordovil, Cachambi, olerê Madureira, Olaria e Bangu, Olará Cascadura, Água Santa, Acari, Olerê

Ipanema​e​Nova​Iguaçu,​Olará Do Brasil, SoS ao Brasil Do Brasil, SoS ao Brasil

(https://jornalggn.com.br/noticia/o-brazil-nao-

conhece-o-brasil-o-brasil-nunca-foi-ao-brazil/)

54

A​expressividade​da​letra​da​canção​“Querelas​do​Brasil”​parte​

de​um​pressuposto​interpretativo​a​partir​do​próprio​título,​que​

além​de​um​jogo​de​palavras​intertextual​com​a​famosa​compo-

sição​“Aquarelas​do​Brasil”​nos​remete​a​uma​ideia​de

(A)​abordagem​ eletiva​ sobre​ a​ performance​ de​ exaltação​ de​ Aquarela​do​Brasil,​trazendo​à​tona​a​idealização​de​um​Brasil​ que​não​existe.

(B)

crítica​ao​suposto​momento​nacional​que​envolve​a​reflexão​so- bre​o​pensamento​ufanista​deflagrado​em​Aquarela​do​Brasil.

(C)

sancionar​a​ideia​de​um​Brasil​mítico​que​atrai​por​suas​belezas​ naturais​e​excentricidades​culturais​aos​parâmetros​estrangeiros.

(D)

revelar o subúrbio como a verdadeira forma de vida e reali- dade​nacional​e​expurgar​a​visão​externa​de​nossos​valores.

(E)

discussão​sobre​a​pendência​de​pensamento​crítico​sobre​a​ forma​como​o​brasileiro​enxerga​o​Brasil.

55

A​clara​intenção​de​mesclar​a​diversidade​que​constitui​a​forma-

ção cultural e social do Brasil se dá em diversos versos, exceto em:

(A)

O Brasil nunca foi ao Brazil

(B)

Piriri, ratatá, karatê, olará

(C)

Piá, carioca, porecramecrã

(D)

E Marionaíma, arirariboia

(E)

O Jobim, sabiá, bem-te-vi

56

Sermão de Santo Antônio (aos peixes) Neste​sermão,​Vieira​utiliza​seu​poder​argumentativo​por​tratar​ da tarefa do pregador em uma terra corrompida Vós, diz Cristo Senhor nosso, falando com os Pregadores, sois sal da terra; e chama-lhes sal da terra, porque quer que façam na terra,​o​que​faz​o​sal.​O​efeito​do​sal​é​impedir​a​corrupção,​mas​ quando a terra se vê tão corrupta como está a nossa, havendo tantos​nela​que​têm​ofício​de​sal,​qual​será,​ou​qual​pode​ser​a​ causa desta corrupção? Ou é porque o sal não salga, ou é porque a​terra​se​não​deixa​salgar.​Ou​é​porque​o​sal​não​salga,​e​os​

Pregadores não pregam a verdadeira doutrina; ou porque a terra se não deixa salgar e os ouvintes, sendo verdadeira a dou-trina​ que​ lhes​ dão,​ a​ não​ querem​

trina​ que​ lhes​ dão,​ a​ não​ querem​ receber.​ Ou​ é​ porque​ o​ sal​ não salga, e os Pregadores dizem uma coisa e fazem outra; ou porque a terra se não deixa salgar, e os ouvintes querem antes imitar o que eles fazem, que fazer o que dizem; ou é porque a terra se não deixa salgar, e os ouvintes em vez de servir a Cristo, servem​a​seus​apetites​[ ] Suposto, pois, que ou o sal não salgue, ou a terra se não deixe salgar; que se há de fazer a esse sal, e que se há de fazer a esta terra? O que se há de fazer ao sal, que não salga, Cristo o disse logo:​[ ]​Se​o​sal​perder​a​substância​e​a​virtude,​e​o​Pregador​

faltar​à​doutrina,​e,​ao​exemplo;​o​que​se​lhe​há​de​fazer​é​lan-

çá-lo​fora​como​inútil,​para​que​seja​pisado​de​todos.​Quem​se​ atrevera a dizer tal coisa se o mesmo Cristo a não pronunciara? Assim​como​não​há​quem​seja​mais​digno​de​reverência,​e​de​ser​ posto sobre a cabeça, que o Pregador, que ensina e faz o que deve; assim​é​merecedor​de​todo​o​desprezo,​e​de​ser​metido​debaixo​ dos​pés,​o​que​com​a​palavra​ou​com​a​vida​prega​o​contrário.

Isto​é​o​que​se​deve​fazer​ao​sal,​que​não​salga.

VIEIRA,​Antônio.​In:​PÉCORA,​Alcir​(Org.).​Sermões.​Tomo)​

São​Paulo:​Hera,​2000.p.317-318.​(Fragmento)

Abaixo​todas​as​alternativas​estão​corretas,​exceto:

(A)​O​questionamento​que​faz​aos​seus​ouvintes​serve​para​en-

fatizar​a​afirmação​que​fará​no​texto.

(B) Os pregadores encontram-se perdidos e obsoletos na con- textualização​funcional​da​vida.

(C)​Vieira​questiona​seus​ouvintes​sobre​as​causas​da​corrupção​

que​toma​conta​da​terra.

(D)

Há apresentação de causa para a corrupção constatada na sociedade​em​que​vive​o​autor.

(E)

Há tantos pregadores na sociedade, os quais deveriam impe- dir​a​corrupção.

12

57

A morte de F. Este Jasmim, que arminhos desacata, Essa Aurora, que nácares aviva, Essa​Fonte,​que​aljôfares​deriva Essa Rosa, que púrpuras desata

Troa em cinza voraz lustros prata Brota em pranto cruel púrpura viva, Profana​em​turvo​pez​prata​nativa, Muda​em​luto​infeliz​tersa​escarlata.

Jasmim na alvura foi, na luz Aurora, Fonte na graça, Rosa no atributo, Essa​heroica​Deidade,​que​em​luz​repousa.

Porém fora melhor que assim não fora, Pois a ser cinza, pranto, barro, e luto Nasceu​Jasmim,​Aurora,​Fonte,​Rosa.

VASCONCELOS,​Francisco​de​In:​PÉCOR,​Alcir​(Org.).​ Poesia seiscentista Fênix​renascida​&​Postilhão​

de​Apolo​São​Paulo:​Hedra,​2002.p.150

O​poema​apresenta​4​partes​distintas​com​suas​respectivas​ca-

racterísticas:​ Vida​ (Primeira​ estrofe),​ Morte​ (Segunda​ estrofe,​ Vida​(Terceira​estrofe)​e​Vida​e​Morte​(Quarta​estrofe).​Com​um​

olhar​atento​à​primeira​estrofe,​há​uma​metáfora​entre​os​ter-

mos​GOTA​D´ÁGUA​PEROLADA,​a​COR​ROSADA,​a​COR​BRANCA,​

e​a​COR​VERMELHO-ESCURO.​Assinale​a​alternativa​que​mostra​ os termos a que essas se referem:

(A)

Gota d´água perolada: Rosa – Cor rosada: Aurora – Cor Bran- ca: Fonte – Cor vermelho-escuro: Jasmim

(B)

Gota d´água perolada: Rosa – Cor rosada: Aurora – Cor Bran- ca: Jasmim – Cor vermelho-escuro: Fonte

(C)

Gota d´água perolada: Jasmim – Cor rosada: Aurora – Cor Branca: Fonte – Cor vermelho-escuro: Rosa

(D)

Gota d´água perolada: fonte – Cor rosada: Aurora – Cor Bran- ca: Jasmim – Cor vermelho-escuro: Rosa

(E)

Gota d´água perolada: Rosa – Cor rosada: Fonte – Cor Bran-

ca: Jasmim – Cor vermelho-escuro: Aurora

58

Canção

Nessa​cantiga​de​amor​provenha,​Bernart​de​Ventadorn​nos​ofe-

rece​um​bom​exemplo​da​coisa​de​amor. Ao ver a ave leve mover Alegres as alas contra a luz, Que​se​olvida​e​deixa​colher Pela doçura que a conduz, Ah!​Tão​grande​inveja​me​vem Desses​que​venturosos​vejo! É​maravilha​que​o​meu​ser Não​se​dissolva​de​desejo. Ah!​Tanto​julguei​saber​ De amor e menos que supus Sei, pois amar não me faz ter Essa​a​que​nunca​farei​jus. A mim de mim e a si também De​mim​e​tudo​o​que​desejo Tomou e só deixou querer Maior​e​um​coração​sobejo. [ ]

Bem feminino é o proceder Dessa​que​me​roubou​a​paz. Não​quer​o​que​deve​querer E​tudo​o​que​não​deve​faz.

Má​sorte​enfim​me​sobrevém, Fiz​como​um​louco​numa​ponte. E tudo me foi suceder Só​porque​quis​mais​horizonte.

Piedade​já​não​pode​haver No​universo​para​os​​mortais. Se aquela que a devia ter Não​tem,​quem​a​terá​jamais? Ah! Como acreditar que alguém De olhara tão doce e clara fronte Deixe que eu morra sem beber Água de amor em sua fonte? [ ]

VENTADORN​Bernart​de.​Verso​reverso​controverso.​ Tradução​de​​Augusto​de​Campos.​​São​Paulo:​

Perspectiva,​1978.p.83-87.​(Fragmento).​​

Analisando os seguintes aspectos:

I.​​

Estado de espírito do eu lírico;

II.​

Que​imagem​se​opõe​ao​seu​estado;

III.

Como essa imagem contribui para caracterizar desse​eu​lírico.

sofrimento

Qual​alternativa​faz​associação​correta​aos​pontos​requisitados​

acima?

(A)

 

I.​​

O eu lírico está sofrendo por um amor não correspondi- do.​Imaginou​que​soubesse​tudo​desse​sentimento,​mas​

descobre que nada sabia, pois o amor não lhe trará aque- la a quem ele ama; II.​ imagem do voo da ave, símbolo de liberdade;

III.

O​eu​lírico​inveja​essa​liberdade​e​a​capacidade​de​entre-

 

ga​que​pode​constatar​no​voo​da​ave.​Já​ele​está​aprisio-

nado pelo sofrimento de viver um amor não correspon- dido.​A​imagem​do​voo​enfatiza​o​“aprisionamento”​e​a​ infelicidade​em​que​o​eu​lírico​se​encontra.

(B)

 

I.​

O​eu​lírico​tem​um​amor.​Descobriu​com​a​vida​que​sabia​ tudo​sobre​esse​sentimento;

II.

A imagem do voo da ave, símbolo de liberdade;

III.

O​eu​lírico​inveja​essa​liberdade​e​a​capacidade​de​entre-

 

ga​que​pode​constatar​no​voo​da​ave.​​Já​ele​está​aprisio-

nado pelo sofrimento de viver um amor não correspon- dido.​A​imagem​do​voo​enfatiza​o​“aprisionamento”​e​a​ infelicidade​em​que​o​eu​lírico​se​encontra.

(C)

 

I.​​

O​eu​lírico​tem​um​sentimento​incoerente​dentro​de​seu​ peito, que ele não sabe muito bem como explicá-lo;

II.​

A imagem de alegria e contentamento por ser correspon- dido e compreendido pela amada;

III.

O​eu​lírico​inveja​essa​liberdade​e​a​capacidade​de​entre-

 

ga​que​pode​constatar​no​voo​da​ave.​Já​ele​está​aprisio-

nado pelo sofrimento de viver um amor não correspon- dido.​A​imagem​do​voo​enfatiza​o​“aprisionamento”​e​a​ infelicidade​em​que​o​eu​lírico​se​encontra.

(D)

 

I.​

O​eu​lírico​tem​um​sentimento​que​ele​não​sabe​muito​ bem como explicá-lo;

II.

A imagem da fé em um ponto dentro de seu peito, que ele​não​sabe​muito​bem​definir​em​palavras;

III.

A liberdade proporcionada pelo voo da ave dá a sensação

 

de​superioridade​ao​homem.​Ele​está​aprisionado​ao​so-

frimento​que​não​sabe​muito​bem​definir.

(E)

 

I.​​

O eu lírico tem algo frágil dentro de seu peito, esperando ser acalentado pela mulher amada;

II.

A imagem de ódio por não correspondido pela amada;

III.

O​eu​lírico​inveja​a​alegria​das​pessoas​que​têm​sentimen- tos​correspondidos,​dentre​eles:​o​amor.

13

59

MUDAM-SE OS TEMPOS, MUDAM-SE AS VONTADES

Mudam-se os tempos, mudam-se as vontades, Muda-se​o​ser,​muda-se​a​confiança; Todo o mundo é composto de mudança, Tomando​sempre​novas​qualidades.

Continuamente​vemos​novidades, Diferentes em tudo da esperança; Do​mal​ficam​as​mágoas​na​lembrança, E​do​bem,​se​algum​houve,​as​saudades.

O tempo cobre o chão de verde manto,

Que​já​coberto​foi​de​neve​fria,

E​em​mim​converte​em​choro​o​doce​canto.

E, afora este mudar-se cada dia,

Outra mudança faz de mor espanto:

Que​não​se​muda​já​como​soía.

Luís de Camões

Considere​as​afirmações​sobre​o​poema.

I.​​

O​ poema​ “Mudam-se​ os​ tempos,​ mudam-se​ as​ vontades”,​ de Luís Vaz de Camões, é um soneto, pois está estruturado em quatro estrofes, sendo dois quartetos (estrofes de quatro versos cada) e dois tercetos (estrofes de três versos cada);

II.

Seus​versos,​do​ponto​de​vista​da​metrificação,​são​decassíla- bos,​isto​é,​contêm​dez​sílabas​poéticas;

III.

As rimas A são intercaladas (interpoladas ou opostas), na me- dida em que são os extremos do quarteto, enquanto as rimas B​são​emparelhadas​(paralelas),​ou​seja,​rimam​dois​a​dois;​ nos​tercetos,​as​rimas​C​e​D​são​cruzadas​(entrecruzadas).

IV.

O esquema rímico apresenta a seguinte distribuição: ABBA ABBA​CDC​DCD.​Como​se​percebe,​nos​quartetos​e​nos​tercetos.

É​correto​afirmar:

(A) Somente a I está correta;

(B)​Somente​a​II​está​correta.

(C)​Somente​a​III​está​correta.

(D)​Somente​a​IV​está​correta.

(E)​ Todas​estão​corretas.

60

Que​és​terra​Homem,​e​em​terra​há​de​tornar-te,

Te​lembra​hoje​Deus​por​sua​Igreja,

De​pó​te​faz​espelho,​em​que​se​veja

A​vil​matéria,​de​que​quis​formar-te.

Lembra-te Deus, que és pó para humilhar-te, E​como​o​teu​baixel​sempre​fraqueja Nos​mares​da​vaidade,​onde​peleja, Te​põe​à​vista​a​terra​onde​salvar-te.

Alerta, alerta pois, que o vento berra,

E se assopra a vaidade, e incha o pano, Na​proa​a​terra​tens,​amaina​e​ferra.

Todo o lenho mortal, baixel humano Se​busca​a​salvação,​tome​hoje​terra, Que​a​terra​é​porto​soberano

(Gregório de Matos, Poemas Escolhidos)

Dentre​os​sentimentos​bem​delimitados​no​contexto​dos​versos​ de Gregório de Matos, podemos excluir

(A)

desengano no mundo

(B)

brevidade da vida

(C)

terror do inferno

(D)

efemeridade da alma

(E)

tragicidade da existência

61

O​fragmento​da​carta​de​Caminha​revela​uma​característica​pró-

pria que tem origem nos textos da literatura de informação, que

é o culto à natureza.​Sobre​as​afirmações​dadas,​apenas​uma​

está​de​acordo​com​a​característica​em​destaque. "Mas a terra em si é muito boa de ares, tão frios e tempera- dos como os de Entre-Douro e Minho, porque,neste tempo de agora,​assim​os​achávamos​como​os​de​lá.​Águas​são​muitas​e​ indefinidas.​De​tal​maneira​é​graciosa​e​querendo​aproveitá-las,​ dar-se-à​nela​tudo​por​bem​das​águas​que​tem.” “Mostrara-lhes​um​papagaio​pardo​que​o​Capitão​traz​consigo,​ tornaram-no logo na mão e acenaram para a terra, como quem diz​que​os​estavam​ali.” “Assim,​quando​o​batel​chegou​à​foz​do​rio,​estavam​ali​dezoito​ ou vinte homens pardos todos nus sem nenhuma roupa que lhes cobrisse​suas​vergonhas.” “Porém​o​melhor​fruto,​que​dela​se​pode​tirar,​me​parece​que​ será​salvar​esta​gente.​E​esta​deve​ser​a​principal​semente​que​ Vossa​Alteza​em​ela​deve​lançar.” “Viu​ um​ deles​ umas​ contas​ rosário,​ brancas;​ acenou​ que​ lhes​ dessem,​folgou​muito​com​elas,​e​lanço-as​ao​pescoço.”

Está​correta​a​afirmação:

(A)​“De​tal​maneira​é​graciosa​e​querendo​aproveitá-las,​dar-se-à​

nela​tudo​por​bem​das​águas​que​tem.”​(o​fragmento​traz​cla-

ramente​ a​informação​ dada,​visto​ que​o​ termo​ “é​ graciosa”​

faz​menção​à​natureza”;​logo,​é​uma​maneira​de​cultuá-la;

”​ (o​

fragmento​revela​o​culto​à​natureza​propriamente​dito”,​con-

siderando que o vocábulo terra​retoma​a​natureza​em​si.)

(B)​“tornaram-no​ logo​ na​ mão​ e​ acenaram​ para​ a​ terra

(ao​ mencio-

nar o vocábulo rio, o fragmento da carta revela incontestável culto​à​natureza,​pois​rio​pertence​à​natureza,​e,​ao​citá-lo,​o​ autor​revela​admiração​pela​terra​encontrada.) (D)​“Porém​o​melhor​fruto,​que​dela​se​pode​tirar ”​(a​expressão​ melhor fruto deixa​claro​o​culto​à​natureza,​pois​trata-se​dos​ frutos​que​ela​pode​oferecer​ao​homem.) (E)​ “Viu​um​deles​umas​contas​de​rosário,​brancas;​acenou​que​ lhes​dessem,​folgou​muito​com​elas,​e​lanço-as​ao​pescoço.”​ (o excerto traz o vocábulo rosário, que, ao simbolizar um ri- tual​sagrado​faz​direta​ligação​com​o​culto​à​natureza.)

(C)​“Assim,​ quando​ o​ batel​ chegou​ à​ foz​ do​ rio

”​

62

Revelação do subúrbio

Quando​vou​para​Minas,​gosto​de​ficar​de​pé,​contra​a​vidraça​ do carro* Vendo​o​subúrbio​passar.

O subúrbio todo se condensa para ser visto depressa,

Com​medo​de​não​repararmos​suficientemente

Em​suas​luzes​que​mal​tem​tempo​de​brilhar.

A noite come o subúrbio e logo o devolve,

Ele reage, luta, se esforça, Até​que​vem​o​campo​onde​pela​manhã​reponham​laranjais E​à​noite​só​existe​a​tristeza​do​Brasil. (*)​Carro​vagão​ferroviário​para​passageiros.

Carlos​Drummond​de​Andrade.​Sentimento do mundo.​1940.Adaptada

Em Sentimento do mundo, o eu lírico manifesta vivo interesse pela​paisagem,​que​é​contemplada​no​poema.​Em​consonância​

com​uma​das​linhas​temáticas​principais,​o​subúrbio,​para​o​au-

tor, remete ao aspecto:

14

I.​​

Familiar;

64

II.​

Bucólico;

III.

Saudosista;

IV.​

Popular;

V. ​​ Interiorano.

Considerando​as​temáticas​principais​do​poema,​é​correto​afirmar:

(A) Somente a I está correta;

(B)

Somente a II está correta;

(C)

Somente a III está correta;

(D)

Somente a IV está correta;

(E)

Somente​a​V​está​correta.

63

Ó meu bem, pois te partiste

Este poema é um exemplo da poesia palaciana apresentada nos serões​do​Paço​Real​português​no​século​XV.

Ó​meu​bem,​pois​te​partiste Dante meus olhos coitado, Os ledos me farão triste, Os​tristes​desesperado.

Triste vida sem prazer E deixas com grã cuidado, Que​por​meu​negro​pecado Me​vejo​vivo​morrer; Meu prazer me destruíste, Meu​nojo​será​dobrado, Porque​sou​cativo,​triste, Do​meu​bem​desesperado.

Dante:​diante.

Ledos:​alegres.

Grã: grande

Nojo: sofrimento.

MIANDA,​Diogo​de.​In:​SPINA,​Segismundo.​Era​

medieval.​8.​Ed.​São​Paulo:​Difel,​1985.​P.​139-140

(Coleção Presença da Literatura Portuguesa)

Podemos​afirmar​sobre​o​poema​que:

(A)​Não​há​indício​algum​de​poesia​palaciana​no​poema;

(B)

(C)

O poema apresenta versos com redondilhas maiores;

O​vocativo​demonstra​intimidade​com​a​pessoa​a​qual​o​po- eta se dirige;

O amor, neste poema, é visto de forma completamente posi-

tiva​e​feliz;

Os​vocábulos​"ledo"​(V.3)​e​"triste"​(V.4)​se​opõem.

(D)

(E)

O​ Brasil​ possui​ ampla​ diversidade​ climática​ devido​ à​ extensão​ territorial.​ ​ São​ diversos​ fatores​ que​ podem​ modificar​ os​ ele- mentos​que​compõem​o​clima.

Dentre​a​diversidade​climática,​podemos​considerar​as​caracte-

rísticas​associadas​de​diversos​climas,​EXCETO:

(A) o clima equatorial é quente e úmido, sem período de seca definido.​Os​meses​de​novembro​a​março​possuem​a​maior​ incidência​de​chuvas.​Entre​maio​e​setembro​ocorre​a​menor​ incidência de chuva e em algumas regiões acontece um fenô-

meno​de​redução​de​pluviosidade​em​torno​de​10%​devido​à​

ação​do​homem​como​o​desmatamento​e​as​queimadas.

(B)​O​clima​tropical​continental​envolve​a​maior​parte​da​região​

Centro-Oeste,​do​Sudeste​e​partes​do​Nordeste.​As​tempe-

raturas​médias​estão​acima​de​18ºC,​ocorrendo​nítida​alter-

nância entre a estação fria e úmida (inverno) e chuvosa (ve- rão)

(C)

O clima semiárido abrange uma área no território não to- talmente​ contínua,​ com​ baixa​ pluviosidade​ (no​ máximo​

750mm/ano).​Esse​clima​determina​o​sertão​nordestino,​pre-

sente em todos os estados dessa área brasileira com exceção do​Maranhão.

(D)

O clima tropical úmido, também conhecido como tropical

atlântico,​é​próprio​da​faixa​litorânea​que​vai​da​divisa​do​Pa-

raná​e​de​São​Paulo​até​próximo​ao​“cotovelo”​do​Rio​Grande​

do​Norte.​A​precipitação​média​da​área​é​de​2000mm/ano.

(E)

O​clima​tropical​de​altitude​predomina​nos​planaltos​e​ser-

ras​do​leste​e​sudeste​do​Brasil.​Dentre​eles​estão​o​planalto​ Atlântico,​que​compreende​as​serras​do​Mar​e​Mantiqueira,​ além da região metropolitana de São Paulo, conhecida como

Grande​São​Paulo.​Em​geral,​as​precipitações​são​mais​acen-

tuadas​que​na​região​chamada​de​clima​tropical.

65

Numere​a​coluna​da​direita​com​base​na​informação​da​coluna​

da​esquerda,​relacionando​os​principais​vultos​da​Geografia​e/

ou​entidades​às​principais​linhas​evolutivas​do​pensamento​ge-

ográfico.

(Governo do Estado do Paraná – 2007)

1.​ Geografia​Tradicional​ ​ 2.​ Geografia​Crítica​ 3.​ Geografia​Humanística​​

(​​)​Yves​Lacoste

(​​)​Paul​Vidal​de​la​Blache

(​​)​IBGE

4.​ Geografia​Quantitativa​ ​ (​​)​Yi-Fu-Tuan

5.​ Geografia​Cultural​

(​​)​Hagerstrand

Assinale​a​alternativa​que​apresenta​a​sequência​correta​da​co-

luna​da​direita,​de​cima​para​baixo.

(A)​2​–​1​–​4​–​3​–​5.

(B)​1​–​2​–​4​–​3​–​5.

(C)​3​–​1​–​3​–​5​–​4.

(D)​1​–​2​–​5​–​4​–​3.

(E)​2​–​5​–​1​–​2​–​4.

15

66

Trump e Kim se encontram no Vietnã em segunda cúpula histó- rica entre os dois líderes

O presidente dos Estados Unidos, Donald Trump, e o líder da

Coreia​do​Norte,​Kim​Jong-un,​se​encontraram​nesta​quarta-feira​

(27)​ em​ Hanói,​ no​ Vietnã.​ Uma​ reunião​ a​ sós​ seguida​ por​ um​ jantar​ com​ assessores​ marcam​ o​ início​ desta​ segunda​ cúpula​

com​os​dois​líderes,​que​vai​durar​até​esta​quinta-feira​(28).​Kim​

e​Trump​se​encontraram​no​hotel​de​estilo​colonial​francês​Sofi-

tel​Legend​Metropole​às​18h30​horário​local​[

Disponível​em:​<https://g1.globo.com/mundo/

noticia/2019/02/27/trump-e-kim-se-encontram-em-

hanoi-no-vietna.ghtml>.​Acesso​em​01​mar.​2019.

Sabendo​que​o​Hanói​fica​no​meridiano​105º​E​e​Nova​York​no​

meridiano ​ 75º ​ W, ​ qual ​ a ​ hora ​ e ​ o ​ dia ​ em ​ que ​ a ​ reunião ​ entre ​ os ​ dois​ líderes​ aconteceu,​ em​ Nova​ York​ e​ São​ Paulo,​ respectiva- mente.

(A)​7h30​e​8h30​do​dia​26​de​março.

(B)​8h30​e​7h30​do​dia​27​de​março.

(C)​6h30​e​7h30​do​dia​26​de​março.

(D)​7h30​e​9h30​do​dia​27​de​março.

(E)​ 6h30​e​8h30​do​dia​27​de​março.

67

A região Sul do Brasil localizada abaixo do Trópico de Capricórnio apresenta o clima subtropical, o clima mais frio do Brasil, com as

menores​médias​térmicas​do​país,​quase​sempre​inferiores​a​18​°C​

no​ano.​Sobre​este​tipo​climático​é​correto​afirmar:

(A)​a​mTa​é​muito​comum​no​verão,​trazendo​ar​seco​e​às​vezes​

fazendo​as​temperaturas​caírem.

(B)​a​mPa​é​muito​comum​no​verão,​trazendo​chuvas​e​às​vezes​

fazendo​as​temperaturas​caírem.

(C)

a mPa é muito comum no inverno, trazendo e fazendo as temperaturas​subirem.

(D)

a mTa é muito comum no inverno, trazendo ar seco e fazen- do​as​temperaturas​caírem.

(E)

a mTc é muito comum no verão, trazendo chuvas centrais da América​do​Sul​e​fazendo​as​temperaturas​subirem.

68

A​figura​mostra​um​corte​transversal​A-B​de​dobras​geológicas,​ em​ área​ serrana​ embasada​ por​ rochas​ metamórficas​ entre​ os​ municípios​de​Apiaí​e​Iporanga,​no​Vale​do​Ribeira.

NO SE A B 2500 2000 1500 1000 500 0 0 2 4 6 8
NO
SE
A
B
2500
2000
1500
1000
500
0
0
2
4
6
8
10
12
Distância (em km)
Rocha 1
Rocha 2
Rocha 3
Estruturas Pretéritas
Altitude (em m)

CPRM - Serviço Geológico do Brasil. Folha Apiaí SG-22-X-B-V, 2008. Adaptado.

O processo de formação das dobras geológicas está indicado na

alternativa

(A)​as​dobras​se​constituem​a​partir​de​gigantescas​pressões​que​

acontecem de maneira horizontal, exercendo uma grande força sobre rochas de composições mais frágeis e esse fenô- meno​propicia​o​enrugamento​do​relevo.

(B)​as​dobras​são​formadas​a​partir​de​movimentos​provocados​

por​ enormes​ pressões​ que​ sucedem​ de​ maneira​ vertical​ e​ horizontal, exercendo uma grande força sobre rochas mais sólidas e rígidas, formando rupturas ou fendas nas extensões das​rochas.​

(C)​as​dobras​se​constituem​a​partir​de​gigantescas​pressões​que​

acontecem de maneira horizontal, exercendo uma grande força sobre rochas mais sólidas e rígidas, formando rupturas ou​fendas​nas​extensões​das​rochas.​

(D)​as​dobras​se​constituem​a​partir​de​gigantescas​pressões​que​

acontecem de maneira horizontal, exercendo grande pres-

são​sobre​as​rochas​mais​frágeis,​formando​fissuras​e​enru-

gamento​do​relevo.

(E)​as​dobras​são​formadas​a​partir​de​movimentos​provocados​

por​ enormes​ pressões​ que​ sucedem​ de​ maneira​ vertical​ e​ horizontal, exercendo uma grande força sobre rochas de composições mais frágeis e esse fenômeno propicia o fratu- ramento​do​relevo.

69

Na​figura​acima​encontra-se​representada​a​Bacia​de​Campos,​ responsável por considerável parcela da produção de petróleo no​Brasil.​

parcela da produção de petróleo no​Brasil.​ A estrutura geológica e o processo o qual ocorre a

A estrutura geológica e o processo o qual ocorre a formação do petróleo são

(A)​escudo​cristalino​-​soerguimento​de​plataforma​continental.

(B)​bacia​sedimentar​-​alta​pressão​e​temperatura.

(C)​depressão​-​subsidência​da​plataforma​continental.

(D)​dobramento​moderno​-​dobra​da​placa​tectônica.

(E)​ planalto​-​soerguimento​da​plataforma​oceânica.

70

A Ecologia presta muita atenção aos solos, pois estes são a base

de todo o ecossistema pousado sobre​ eles.​ No​ Brasil,​ temos​ solos​de​boa​fertilidade​que​permitem​grande​aproveitamento​ agrícola. Sobre​os​solos​brasileiros,​a​afirmação​correta​é:

(A) a decomposição e desagregação das rochas no seu local de origem​formam​os​solos​aluviais.

(B)​a​terra​roxa​é​encontrada​principalmente​no​Planalto​Atlânti-

co​Brasileiro.

(C)

o massapé, solo escuro riquíssimo em matéria orgânica, é encontrado​no​Sudeste​e​sua​utilização​é​histórica​no​cultivo​ do​café​em​épocas​coloniais.

(D)

no Centro-Sul do país, observa-se presença do solo denomi- nado​salmourão.

(E)

o massapé e a terra roxa, quanto a sua origem podem ser classificados​como​solos​aluviais.

16

71

Esta foto ilustra uma das formas do relevo brasileiro, que são os inselbergs.

das formas do relevo brasileiro, que são os inselbergs. “Pedra​que​brilha”​-​Itaberaba/BA

“Pedra​que​brilha”​-​Itaberaba/BA

É​correto​afirmar​que​essa​forma​de​relevo​está:

(A)​distribuída​pelas​regiões​Norte​e​Centro-Oeste,​em​terrenos​

cristalinos,​geralmente​moldados​pela​ação​do​vento.

(B)​localizada​no​litoral​da​região​Nordeste​e​decorre,​em​geral,​da​

ação​destrutiva​da​água​do​mar​sobre​rochas​sedimentares.

(C)​restrita​a​trechos​do​litoral​Norte-Nordeste,​sendo​resultan-

te, sobretudo, da ação modeladora da chuva, em terrenos cristalinos.

(D)​presente​ nas​ regiões​ Centro-Oeste​ e​ Nordeste,​ tendo​ sua​ formação associada, principalmente, a processos erosivos em​planaltos​sedimentares.

(E) presente em meio a uma paisagem de depressão, trata-se de um resto de relevo com aspecto geológico cristalino saliente, resultado​do​intemperismo​físico.

72

Em​2018,​duas​meninas,​uma​em​São​Paulo​(45°​W)​e​outra​na​

Califórnia​-​ EUA​ (120°​ W),​ assistiram​ a​ Copa​ do​ Mundo​ de​ Fu- tebol, que ocorreu na Rússia, país dos czares, de Dostoiévski e berço​da​União​das​Repúblicas​Socialistas​Soviéticas.​Em​termos​

de​geografia​física,​a​Rússia​é​o​maior​território​do​mundo,​loca-

lizado​entre​a​Europa​e​Ásia,​cuja​separação​entre​os​continentes​

é​determinada​pelos​Montes​Urais​e​contém​11​fusos​horários.​

Sabendo​que​a​final​da​Copa​do​Mundo​de​futebol,​definida​en-

tre​Croácia​(15°​E)​e​França​(0°​E),​ocorreu​em​Moscou​(30°​E),​às​

18h​no​horário​local,​responda,​qual​o​horário​em​que​croatas,​

franceses,​paulistanos​e​californianos​puderam​assistir​a​última​ partida​em​suas​respectivas​localidades

(A)​16h,​17h,​11h​e​8h.

(B)​13h,​18h,​18h​e​7h.

(C)​17h,​16h,​13h​e​8h.

(D)​15h,​15h,​10h​e​8h.

(E)​ 17h,​16h​e​11h​e​6h.

73

Observe o mapa abaixo, no qual estão representadas as cidades

em​que​ocorreram​jogos​da​seleção​brasileira​de​futebol​na​pri-

meira​fase​da​Copa​do​Mundo​da​Rússia.

- meira​fase​da​Copa​do​Mundo​da​Rússia. Sabendo que as distâncias no mapa entre Moscou e Rostov é

Sabendo que as distâncias no mapa entre Moscou e Rostov é de

1,9 cm e entre São Petersburgo e Moscou é 1,2 cm, as distâncias

em​quilômetros​entre​Moscou​e​as​demais​cidades​é​respecti-

vamente de:

(A)​1​102​000​Km​e​6​960​Km.​

(B)​1​102​Km​e​6​960​Km.

(C) 1 103 Km e 695 Km

(D)​1​102​Km​e​696​Km.

(E)​ 1​102​000​Km​e​696​Km.

74

A imagem retrata os Jardins Suspensos da Babilônia, construí-

dos​pelo​imperador​Nabucodonosor​(604-562​a.c​)​e​importante​

obra​de​engenharia​do​Império​Babilônico.

obra​de​engenharia​do​Império​Babilônico. https://pt.wikipedia.org/wiki/Jardins_

https://pt.wikipedia.org/wiki/Jardins_

Suspensos_da_Babil%C3%B3nia

Sobre​a​grandiosa​obra​é​correto​afirmar:

(A)

Foi construída durante o Primeiro Império Babilônico, por hebreus escravizados durante a tomada de Jerusalém pelos Caldeus​através​de​inúmeras​invasões​e​ataques.

(B)

Foi construída durante o Primeiro Império Babilônico por Sí- rios, Fenícios e Hebreus dominados e vencidos por caldeus através​de​guerras.

(C)​Foi​o​maior​símbolo​de​poder​e​ostentação​já​visto​na​Me-

sopotâmia, erguido durante o Segundo Império Babilônico pelos​fenícios.

(D)​Foram​ jardins​ monumentais​ do​ mundo​ antigo,​ entretan- to, não existem provas escritas nem arqueológicas de sua existência.

(E) Foram considerados uma das sete maravilhas do mundo an- tigo,​expressão​do​poder​e​do​luxo​do​Império​Persa.

17

75

Considerando​ as​ ações​ praticadas​ em​ Atenas​ pelo​ legislador​ e​ Jurista​Sólon​(Séc.​VII-VI​a.c),​considera-se​correto​afirmar​que:

I.​​

Cancelou e renegociou as dívidas dos camponeses para com os eupátridas, bem como proibiu a escravidão por dívida contra​qualquer​indivíduo​de​origem​grega.

II.​

Promoveu a divisão dos cidadãos em quatro classes sociais

distintas,​ com​ base​ no​ patrimônio​ agrícola,​ determinando​ que​somente​os​mais​abastados​tivessem​o​direito​de​ocupar​ cargos​governamentais​relevantes.

III.

Implantou medidas que resguardavam as liberdades indivi-

duais,​criando​os​fundamentos​político-jurídicos​que​permi-

tiriam​o​advento​da​Democracia​Ateniense,​após​a​tirania​dos​ eupátridas.

IV.​

Priorizava​o​interesse​coletivo​onde​a​religião​e​a​moral​mos- travam-se na obediência aos deuses tradicionalmente cultu- ados em Atenas, tendo sido fundamental na consolidação da fé​politeísta.

Assinale​as​afirmações​corretas:

A escravidão trouxe uma série de profundas mudanças na Roma antiga,​tais​como:​

(A)

O enriquecimento do Estado Romano, com a conquista de

terras,​rebanhos,​dinheiro​de​impostos​e​demais​bens​obti-

dos​nos​territórios​conquistados​fora​da​Península​Itálica.​

(B)

A ascensão dos cavaleiros, uma nova classe social formada por homens que enriqueceram através do comércio de es- cravos e cobranças de impostos nos territórios conquistados fora​da​Itália.​

(C)

Aumento considerável da população, com as conquistas de tantos​povos​e​territórios​e​a​quantidade​de​prisioneiros​que​ foram​levados​para​a​Itália​como​escravos.​