Genetics Final Question Collector PDF

GENETICS FINAL QUESTION COLLECTOR

Downloading, sharing and adding people to these docs is strictly forbidden.
This will not be tolerated and you shall be eliminated from all the docs, even if it’s Mohit.
FORMAT RULES

● Font: CAIRO
● Size: 11
● Spacing: 1.5
● Question in bold

KEY
Answer = Dipika, Inder, Ritika, etc answer[TEMPORARY]
Answer = MOHIT’s, EMILIA answer [PERMANENT]
like this (something in blue) = The correct information

CONTENTS:
2018 FINAL (2nd Year) = SOLVED 2
2017 FINAL = SOLVED 10
POLISH DIVISION 2018 FINAL = SOLVED 20
2016 FINAL = SOLVED 29
2016 FINAL Retake = SOLVED 40
MCQ-1 48
2015 4yr 53
POLISH DIVISION 2017 57
RANDOM 1 69
RANDOM 2 71
MCQ’s FROM BOOK = SOLVED 72
2009 FINAL 94
MCQ-2 104
RANDOM YEAR 114

2018 FINAL (2nd Year)

1. Choose the correct set of answers (T-true, F-false) for the statements:
1) For estimating the recurrence risk for siblings of a person with the disease caused by de novo
mutation a Punnett square should be used
2) De novo mutation cannot occur in genes which are linked
3) Germline mosaicism cannot be responsible for recurrence of Duchenne muscular dystrophy
4) De novo mutations always have phenotypic effect
5) De novo mutations cannot occur in genes linked to polygenic disease
A. 1F, 2T, 3F, 4F, 5T
B. 1F, 2T, 3T, 4T,5F
C. 1F, 2F, 3F, 4F, 5F
D. 1T, 2T, 3F, 4T, 5F

2) In this pedigree:
A. Both parents are carriers
B. The disease most probably occurred as a result of de novo mutation
C. X-linked or autosomal recessive model of inheritance is likely
D. Answer A and C are correct

3) In autosomal dominant disease the normal allele in population has the
frequency of 0.996. The disease is not genetically lethal, but it affected people have an
approximately 1/4 fewer children. The frequency of the mutation causing this disease equals:
A. 0.0005
B. 0.001
C. 0.1245
D. 0.001

4) Choose:
A. In autosomal dominant diseases, the mutated allele frequency equals the frequency of the
disease divided by two
B. In autosomal dominant disease, the frequency of the disease equals a half of the mutated allele
frequency
C. In X-linked disease the frequency of the affected men equals a half of the frequency of the
mutated allele
D. Answer is B and C are correct

5) Which point mutations cannot be detected by PCR and Sanger sequencing
A. deletion of five base pairs tag
B. Duplication of 100 kip
C. Insertion of thymine
D. Substitution of adenine into guanine

6) Select the correct answer for the Sanger sequencing:
A. Detects deletions and duplications above 10 kb
B. It Is an alternative method to FISH
C. Allows for the Analysis of the whole genome in one experiment
D. Enable the detection of point mutation and analyzed fragment of DNA

7) The unit of genetic mapping is 1 CentImorgan (1cM) that corresponds to:
A. 1 kilo base pair distance between two genes
B. 1% probability of linkage
C. Lod score amounting to 1
D. 1% frequency of crossing-over between two genes

8) Mark corrects about linkage analysis
A. In a 3 generation family, the phase is usually unknown and the calculations are carried out for 2
phases
B. In a 2 generation family, that phase is unknown
C. In a 2 generation family, the phase is known and calculations are carried out for two phases
D. In two families with the same disease, the phases are usually consistent

9) Indicate the correct answer for the linkage Analysis assuming that the disease is inherited in a
autosomal dominant pattern and in the adopted phase the disease Segregated with the 4 allele. NR
is the person who hasn’t recombined; R is the person who has recombined.
A. NR, R, NR, NR
B. R, R, R, R
C. R, NR, R, R
D. NR, NR, NR, NR

10) Select the right answer:
A. “The gold standard”, used for pathogenicity estimation in prospective studies, is odds ratio (OR)
B. “The gold standard”, used for pathogenicity estimation in prospective studies, is relative risk
(RR)
C. “The gold standard”, used for pathogenicity estimation in retrospective studies, is relative risk
(RR) n
D. It is possible to calculate relative risk (RR) in retrospective studies

Disease Disease
+ -
Mutation + 50 1000
Mutation - 25 500

11) When is the value of odds ratio (OR) similar to the value of risk ratio (RR)
a. When the probability of getting the illness in the study group is high, while the probability for
the control group is low
b. When the probability of getting the illness in the study group is low, while the probability for the
control group is high
c. When the probability of getting the illness for both groups is low
d. Never, the values of OR and RR always differ

12) What is the value of odds ratio (OR) in the retrospective study above?
a. 1
b. 0,1
c. 10
d. 100

13) Is the prospective study carried out properly?
Disease Disease
+ -
Mutation + 5 195
Mutation - 3 197

a. Yes, because both the study group and the control group are equally large
b. No, because both the study group and the control group are equally large
c. Yes, because in the study group and the control group the number of affected patients is low
d. No, because in the study group and the control group the number of affected patients is low

14) Autosomal recessive inheritance. Parents are carriers. The risk of healthy child being a carrier
equals:
a. 25%
b. 33%
c. 50%
d. 66%

15) Autosomal recessive inheritance. The status of parents carrier is unknown. The disease
frequency in the population is 0.0004. The approximate risk of being a carrier for each parent is:
a) 0.005
b) 0.002
c) 0.04
d) 0.02

16) X-linked inheritance. A healthy woman has a sick brother, two healthy sons and a healthy
daughter. Grandparents (her parents) are healthy. The risk of being a carrier for a daughter is:
a) There is no risk for being a carrier
b) 1%
c) 10%
d) 50%

17) Autosomal dominant inheritance. One of the parents is affected heterozygote, the other is a
healthy homozygote. If the penetrance is 100%, the probability of having a healthy child is 50%. How
will the probability of having a healthy child change if the penetrance equals 80%?:
a) Will not change (50%)
b) Will increase (60%)
c) Will increase (80%)
d) Will decrease (20%)

18) Which karyotype designates the male patient with Patau syndrome?
a) 47,XY,+13
b) 45,XY,der(13;21) (p11;p11)+13
c) 47,XY +13[20]/46,XY[20]
d) All answers are correct

19) Indicate an incorrect statement:
a) Array CGH offers karyotype analysis with no need of cell culturing, high resolution and
enables to detection of all type of chromosomal aberrations
b) G-banding of chromosomes during prometaphase provide higher resolution than during
metaphase
c) Interphase FISH is commonly used in the analysis of chromosomal rearrangements in tumor
cells
d) Spectral karyotype is especially useful for the identification of chromosomal translocations.

20) Indicate a parent with the highest risk of having child with Down syndrome:
a) 25-year old woman with previous Down- syndrome child
b) 25-year old female carrier of a chromosomal aberration 45,XX,der(14;21) (p11;p11)
c) 25-year old male carrier of chromosomal aberration 45,XY,der(14;21) (p11;p11)
d) 45-year old woman with no previous history of Down syndrome child (mother of two healthy
children)

21) Indicate a balanced chromosomal aberration:
a) Reciprocal translocation
b) Terminal deletion
c) Isochromosome

22) Approximately 70% of cases of Prader-Willi syndrome is caused by:
a) Uniparental disomy of chromosome 13 inherited from father
b) Duplication of 13q11-13 region on the maternally inherited chromosome
c) Deletion of 15q11-13 region on paternally inherited chromosome
d) Deletion of 15p11-13 region on paternally inherited chromosome

23) Indicate the incorrect sentence describing X-linked recessive pattern of inheritance:
a) Females carriers are asymptomatic
b) Hemizygous male transfer mutated allele to all sons, never to daughters
c) Females transmit mutated alleles to sons as well as to daughters
d) All daughters of an affected male are mandatory carriers

24. Indicate the incorrect sentence describing genomic imprinting:
a) It’s a specific kind of epigenetic mechanism of gene
expression
b) One of the mechanisms of genomic imprinting is methylation of inactive allele
c) This sex-specific genomic modification occurs during conception
d) Inactive alleles are inherited according to Mendel’s rules, whereas expression depends on the
sex of a parent from whom this allele came.

25. Indicate appropriate pedigree for family with autosomal dominant disease which comes under
paternal genomic imprinting (meaning the paternally inherited allele is inactive). c)
2017 FINAL
1. The diagnosis of a genetic cause of autism spectrum disorder is MOST likely in an
individual with:
A. Essential autism
B. Autism + microcephaly
C. Autism + congenital heart disease
D. Autism + extrapyramidal disorder + dysmorphism

2. In autosomal recessive conditions:
A. The healthy sibling of an affected person bears a 2 in 3 risk of being a carrier
B. The risk of the affected offspring if both parents are carriers is 50%
C. Parental consanguinity does not increase the risk of such condition of the offspring
D. All above

3. If the population frequency of an autosomal recessive disease is 1/2500, then,
according to the Hardy-Weinberg equilibrium, the frequency of the mutated allele
and the frequency of carriers, respectively, are approximately:
A. 1/50 and 1/25
B. 1/25 and 1/50
C. 1/1,250 and 1/25
D. 1/25 and 1/1,250

4. A typical clinical indication for Preimplantation Genetic Diagnosis (PGD) is
establishing:
A. A deletion of SMN1 gene in both mates (autosomal recessive spinal muscular atrophy)
B. A pathogenic variant in CFTR gene in one mate (autosomal recessive cystic fibrosis)
C. A history of autosomal dominant osteogenesis imperfecta in one mates family without
genetic testing ever performed
D. All above

5. Indicate the true statement for turner syndrome:
A. Majority of affected individuals have intellectual disability
B. Secondary sex characteristics in male
C. Great majority of cases are sporadic
D. None of the above is true

6. In the pedigree below, indicate who should be genetically tested first:
A. The consultant
B. Any one of the living affected
C. Choice of the one to be tested doesn't change the odds of detecting pathogenic variant
D. No one, as this is not a pattern characteristics of hereditary cancer

7. Early onset breast cancer and soft tissue sarcomas are the hallmark of:
A. Cowden syndrome
B. Lynch syndrome
C. Peutz jeghers syndrome
D. Li-fraumeni syndrome

8. Increased nuchal translucency (NT) above two standard deviations (>250) at 11-13
wks of pregnancy points to a possible:
A. Down syndrome
B. isolated congenital heart defect
C. normal outcome of pregnancy
D. all of the above

9. The so-called chromosomal phenotype includes the following except:
A. mental retardation
B. facial dysmorphism
C. isolated congenital heart defect
D. multiple congenital anomalies

10. Which of the following syndromes could not be diagnosed by classic karyotyping:
A. Down syndrome
B. Klinefelter syndrome
C. neurofibromatosis type 1
D. Edwards syndrome

11. Which following statements are true for prader-willi syndrome except
A. it is one of the most commonly recognized genetic forms of obesity
B. it manifests with Central hypotonia and feeding difficulties with failure to thrive in
infancy
C. it can be caused by a microdeletion on the maternal chromosome 15
D. hypogonadism is part of the clinical picture

12. Spinal muscular atrophy is caused by
A. smn2 gene mutation
B. smn1 Gene point mutation
C. deletion of the Exon 7 of smn1
D. recessive definition of Exon 7 of smn1

13. Exon skipping technology:
A. Is not used in neuromuscular disorders
B. Can be used for point mutations only
C. Results in DMD gene duplication
D. Can be used for Duchenne muscular dystrophy

14. Charcot-Marie-Tooth (CMT) disease type 1X:
A. Is the most common form of CTM
B. Is inherited from male to male
C. Is inherited from male to male with an early onset disease present in males
D. Is inherited as an X-linked dominant trait

15. TP53, RB1, APC, BRCA1, BRCA2 are examples of:
A. Tumor suppressor genes
B. (Proto)oncogenes
C. Transcription factors
D. Tyrosine kinase inhibitors

16. Explain the following: 46, XY, der (19),t(4;19)(p15.3;q13.2)mat
A. A male with trisomy of a fragment of chromosome 4 short arm and a monosomy of a
fragment of chromosome 19 long arm
B. A male with a trisomy of a fragment of chromosome 19 short arm and a monosomy of
a fragment of chromosome 4 long arm
C. A male with a trisomy of a fragment of chromosome 19 long arm and a monosomy of a
terminal fragment of chromosome 4 short arm
D. A male with a trisomy of a fragment of chromosome 4 long arm and a monosomy of a
fragment of chromosome 19 short arm

17. Lynch syndrome refers to inherited susceptibility of:
A. Skin cancer (melanoma)
B. Colorectal cancer (CRC)
C. Small cell lung cancer (SCLC)
D. Non-small cell lung cancer (NSCLC)

18. Gene mutation associated with polyprotein structures alteration that can disrupt the
activity if the wild-type gene when overexpressed is called:
A. Haploinsufficiency
B. Two hit theory
C. Clonal theory of cancer
D. The dominant negative effect

19. Breast cancer caused by BRCA2 mutation is available for treatment with PARP
inhibitors (poly-ADP-ribose polymerase) by exploiting:
A. Crossing-over
B. Dominant negative effect
C. Negative feedback
D. Synthetic lethality

20. A pleiotropic gene is the one which:
A. Is expressed in one specific tissue only
B. Is present in the genome in multiple copies
C. Affects more than one trait
D. Due to its size, it is especially exposed to mutations

21. Indicate karyotype for an unbalanced chromosomal aberration
A. 46, XX, del(13)(q12;q13)
B. 46, XY, inv(5)(q20;q22)
C. 45, XX, der(13;14)(q10;q10)
D. A and C

22. Assuming a dominant X-linked inheritance pattern, penetrance of 100% and
frequency of mutated allele of 2x10^-1, the likelihood of the pedigree (the disease
occurrence in a family of four as on the scheme) is approximately:

A. 0,032
B. 0,064
C. 0,128
D. 0,2

23. Indicate a true statement:
A. Heteroplasmy is the presence of both mutated and wild-type DNA in the cell nucleus
B. Depletion of mitochondrial DNA (reduction in the number of mtDNA copies in the
cell) is a cause of certain diseases with the dysfunction of mitochondria
C. Crossover between nuclear and mitochondrial DNA enables the transmission of
mitochondrial traits from father
D. All of the above are false

24. What are the odds that the tested marker is fully linked (theta=0) to a causative gene
for an autosomal dominant disease in the family showed on the picture. Results of
the genetic marker genotyping are indicated on the pedigree.

A. 1
B. 16
C. 32
D. 64

25. An individual has a mutation causing a disease (e.g. retinoblastoma), yet they do not
develop any symptoms in their lifetime. Which mechanism is responsible for such
situation?
A. Reduced penetrance
B. Varied expression
C. Germinal mutation
D. Locus heterogeneity

26. The analysis of metaphasic chromosomes after G-band staining DOES NOT give
possibility of:
A. Evaluating complete karyotype in a single test
B. Detecting both numerical and structural aberrations
C. Detecting microdeletions
D. Detecting Robertsonian translocations

27. The most probable inheritance pattern for the pedigree below is:

A. Autosomal dominant
B. Autosomal recessive
C. X-linked recessive
D. X-linked dominant

28. Indicate a true statement. Genetically lethal diseases….:
A. Always cause death of an individual
B. Have the selection coefficient equal to 0
C. Have a frequency which, among others, depends on the mutation rate
D. Always result from a de novo mutation

29. Two days ago, a 25 year old woman gave birth to a healthy child. Her mother (child’s
grandmother) in her childhood had a surgery due to retinoblastoma. The young
woman herself has never suffered from this cancer but she wants to know what the
probability of the disease is in her newborn. The child’s father and grandfather both
are wild-type homozygotes. To determine genetic risk, you will take into account:
A. Disease frequency in population
B. Lack of disease in mother
C. Lack of disease in child
D. Both B and C

30. Which of the statements about aCGH is true?
A. Is is the cheapest type of a cytogenetic test
B. It does not detect balanced translocations
C. Its resolution is the same as for FISH method
D. All are false

31. Which pedigree is the most probable (taking into account the number and sex of
affected individuals in I and II generation) for autosomal dominant inheritance with
paternal imprinting (paternal allele is inactivated)?

A. Pedigree A
B. Pedigree B
C. Pedigree C
D. Pedigree D

32. Next generation sequencing (NGS) is:
A. A sequencing based on capillary electrophoresis
B. A sequencing based on capillary electrophoresis with the use of fluorescent terminators
C. A group of novel DNA sequencing techniques based mostly on microarrays
D. None above

33. The frequency of AA genotype among affected individuals is 50%, and among healthy
individuals - 20%. The Odds Ratio (OR) for the occurence of the disease associated
with AA genotype is
A. 2
B. 2,5
C. 3
D. 4

34. Which of the statements about mutation rate in germ cells is true?
A. Chromosomal mutations are more frequent in females
B. Point mutations are more frequent in males
C. In both sexes, mutations occur in germ cells more frequently with age
D. All statements are true

35. A 4 year old child with mild mental retardation, congenital heart defect:
supravalvular aortic stenosis, joint laxity, facial dysmorphism: periorbital fullness,
wide mouth, full lips, and over-friendly personality presents typical symptoms of:
A. DiGeorge syndrome
B. Williams syndrome
C. Angelman syndrome
D. Prader-Willi syndrome
POLISH DIVISION 2018 FINAL

1. Choose the genes responsible for the transformation of a hypothetical gonad into a testicle:
a) SRY, SOX9, SF1
b) WNT4, SRY, SF1
c) SRY, SOX9, DAX1
d) SRY, DAX1, WNT4

2. Which of these karyotypes is not possible in Turner’s syndrome?
a) 45,X
b) 45,X/46,XX
c) 46,X,i(Xq)
d) All of these karyotypes are possible

3. Ovotestis is:
a) The presence of both gonads: testicles and ovaries in one person
b) A gonad containing both testicular and ovarian aspects
c) True hermaphroditism
d) Prader stage V genitalia

4. Choose the correct karyotype of a girl with Down’s syndrome:
a) 47,XX, +21
b) 46,XX,der(14;21)(q10;q10),+21
c) 46,XX [10] / 47,XX,+21 [40]

5. Choose the karyotype of a Robertsonian Translocation:
a) 46,XY ,t(15,22)(q10;q10)
b) 45,XY ,der(13,22)(q10;q10)
c) 45,XY ,t(14;20)(q10;q10)
d) 46,XY ,der(13;21)(q10;q10)

6. Choose the correct sentence:
a) Numerical chromosomal aberrations in autosomal chromosomes are always lethal
b) Reciprocal translocations are unbalanced
c) Paracentric inversions engages p and q arms of the chromosome and the centromere
d) A ring chromosome forms as a result of terminal deletions of chromosomal arms and their
subsequent fusion

7. Choose the genogram in which woman II.3 has the highest probability of being a carrier:

a) A
b) B
c) C
d) D

8. What conditional probability would you consider in the genogram below to calculate the risk of
woman II.3 being a carrier (according to Bayes’ theorem)?

a) Three healthy sons
b) A sick brother
c) The healthy father of II.3
d) No conditional probability should be considered in this situation

9. Choose the INCORRECT statement about an autosomal dominant disease that is genetically lethal:
a) It’s impossible to pass the faulty copy of the gene to the next generation
b) The alleles with the mutation arise only as a result of de novo mutations
c) Mosaicism of the parent reduces the risk of the disease manifesting itself in a given family
d) The risk of the disease recurring is minimal

10. Selection coefficient is:
a) The percentage of the population with the lethal mutation
b) The degree of retardation of reproductive capabilities
c) The amount of infertile individuals due to the mutation
d) Considered when estimating the risk of lethal genetic conditions

11. Choose the karyotype that shows an unbalanced chromosomal aberration:
a) 46,XY,inv(5)(q20;q22)
b) 45,XX,der(13;14)(q10;q10)
c) 46,XX,del(13)(q12;q13)

12. 80% penetrance of disease means that in a group of 100 people affected by the disease:
A. 20% will show symptoms of the disease
B. 20 people won’t show symptoms of the disease
C. 80 people will manifest a full phenotype of the disease, while in 20 people the symptoms will
be very mild
D. 20 people will manifest a full phenotype of the disease, while in 80 people the symptoms will
be very mild

13. Prader–Willi syndrome is most commonly caused by:
A. Deletion of about 4 Mb on the long arm of paternal chromosome 15
B. Deletion of about 4 Mb on the long arm of maternal chromosome 15
C. Non-genetic conditions
D. Abnormal imprinting patterns

14. Parents brought in their 8 year old daughter into a Genetics Clinic, as they noticed 14 spots on
her skin in the colour of “milk coffee”. The diameter of the 12 spots exceeds 5mm. The patient was
also diagnosed with optic nerve glioma.
The last 3 generations of the family have not had any similar symptoms.
Which clinical diagnosis is the most probable?
a) Waardenburg syndrome
b) Warburg syndrome
c) Waardenburg syndrome type 7
d) Neurofibromatosis

15. Biologic material used for preparing a cytogenetic specimen for karyotyping can not be:
a) amniocytes from amniotic fluid
b) skin fibroblasts
c) tumor cells from a specimen fixed in paraffin
d) fetal tissue

16. Defect of which gene or metabolic pathway causes abnormal sex development in people with
karyotype 46,XX and female androgyny:
a) SRY gene
b) Cortisol synthesis pathway
c) AR gene
d) SOX9 gene

17. A man has been diagnosed with a disease of autosomal dominant pattern. His partner is healthy.
What kind of genetic advice can be given to the couple?
a) Probability of having an affected child is ½
b) The odds that the couple will have an affected child is 1:2
c) Each respective child will have a smaller probability of being affected
d) All sons of this couple will be healthy

18. The chromatogram presents a:
a) Homozygotic deletion
b) Heterozygotic deletion
c) Homozygotic substitution
d) Heterozygotic substitution

19.Choose the correct statement regarding linkage disequilibrium:
A. Linkage disequilibrium is a non-random association of alleles in linked loci in the whole
population
B. In the population, linkage disequilibrium between alleles increases with time due to
recombination
C. Analysis of linkage disequilibrium is often used to specify the order of the genes on the
chromosome
D. All answers are incorrect

20. Choose the genes linked to a high risk of breast cancer:
a) NF1, APC, BRCA2
b) BRCA1, BRCA2, TP53
c) RET, BRCA1, MLH1
d) PALB2, CHEK2, MSH2

21. A metabolic disorder in an infant is suggested by:
a) Increased appetite
b) Often concomitance with a CNS congenital developmental disorder
c) Sudden deterioration of general state of well-being
d) All of the above

22. The disease is inherited in an autosomal dominant pattern. For the affected parent, 2 phases
have been applied. In phase 1, the disease categorises with marker 2, in phase 2 the disease
categorises with marker 1. NR means no recombination, R – presence of recombination. Choose the
correct option describing the 2nd generation (from left to right):

a) Phase 1 NR, NR, R, NR
b) Phase 2 R, R, NR, R
c) Phase 1 R, R, NR, R
d) Both a) and b) are correct

23. Which of the following properly connects a genetic disease with an abnormal or absent protein?
a) Duchenne muscular dystrophy - dystrobrevin
b) SCID - tryptophan deaminase
c) CF - transmembrane conductance regulator
d) ADA deficiency - ornithine transcarbamylase

24. An example of epistasis is:
a) amorphous O allele in ABO group system
b) phenotype Bombay in H system
c) phenotype weak D in RHD system
d) all of the avone are correct

25. Indicate a false sentence regarding cell-free DNA (cffDNA)
a) comes mostly from trophoblasts breakdown
b) its concentration in serum of a pregnant woman increases as the pregnancy progresses
c) is subjacent to degradation a few weeks after delivery
d) has a different methylation profile than the mother’s circulating DNA

27. Pedigree shows segregation of a sex-linked recessive and genetically lethal disorder. What are
the odds and probability that mother is a carrier. While making calculations assume that mutation
frequency in men (µm) is 3 times higher than in women (µf).

a) LR = 3, L = 0.667
b) LR = 4, L = 0.750
c) LR = 3, L = 0.750
d) LR = 2, L = 0.667

28. In every generation, mutated alleles present in hemizygous males, are eliminated from the
population's gene pool in case of a disease that is:
a) recessive, X-linked, genetically lethal
b) fatal recessive, X-linked
c) only caused by mutations
d) only caused by inheriting mutation from a father

29. Which sentence concerning the Duchenne muscle dystrophy is true?
A. In some families occurs the germline Mosaicism, which basically is the occurrence of a
mutation of a part of the cells from the germline of the parent
B. Germline mosaicism in the Duchenne dystrophy doesn’t have any influence on the degree of
genetic risk
C. Germline mosaicism is characterised by an additional coexisting random X chromosome
inactivation
D. Germline mosaicism coexists always with a somatic mosaicism.

30. Rh disease occurs with the situation when in the gene RHD:
1. In the Mom D/D, in the child d/d
2. In the Mom D/d, in the child d/d
A. 1 is correct
B. 4 is correct
C. 1 and 2 are correct
D. 3 and 4 are correct

31. For a lethal genetic disease, assuming X-linked recessive inheritance, and that µ is the frequency
of de novo mutation:
A. The frequency for female carriers is 4µ
B. The frequency for healthy men is 3µ
C. The frequency for sick women is 4µ
D. The frequency for male carriers is 4µ

32. Show the WRONG answer concerning the whole exome sequencing on the Illumina platform:
A. During sequencing, we can observe a migration of DNA strands according to the
electrophoresis rules
B. Important data files are the files FASTQ and BAM
C. A cluster is an aggregation (agglomeration) of DNA strands, arising through the bridge
amplification from one DNA molecule.
D. The Program IGV serves the visualization of the results

33. The phenotype of the Prader – Willi syndrome has the following characteristics:
A) Low height
B) Hypotonia
C) Small feet and hands
D) All of the above

34. You are consulting 4 pregnant women. Which one has the highest risk to give birth to a child
with Down syndrome?
A) 23-years old woman, who gave birth to a Down syndrome baby two years ago.
B) 27-years old woman, whose niece has Down syndrome with the karyotype 47, XX, +21
C) 41-years old woman, whose first child has Down syndrome
D) 33-years old woman, who is a carrier for the Robertsonian translocation 14;21

35. Describe the risk for a Rh disease, when the mother has the phenotype Rh negative and the
child's father has the genotype D/d in the RHD gene.
A) 25%
B) 50%
C) 75%
D) 100%

36. The grandma of a proband died of Huntington's disease. This disease is showing 50% penetrance
in patients at the age of 50 years.
Which is the probability for that the proband is a carrier of the underlying disease.
A) ⅓
B) ⅔
C) ⅙
D) ⅛

37. The strategy ex vivo in the genetic therapy is the following:
A) Allogeneic transplantation of cells with the aim to rebuild a population of normal cells in the sick
organism.
B) Direct application of the transgene to the patients system
C) Isolation of an adequate population of cells from the patient, their modification and
reinjection to the patient
D) Isolation of stem cells from one of the patients tissues and application to a destination, with the
aim to rebuild the stem cells in the given organ.

38. The definition of penetrance of a given variant (mutation) is the following:
A) It's the probability to get sick from the possession of the mutation responsible for the given
disease.
B) It's the population risk to the development of the disease
C) Only affects those people, where the genetic disease runs in the family.
D) Refers to the frequency estimation of a given mutation in a population.

39. A couple, whose first child died from multiple developmental defects, is getting karyotyping. The
mother has a normal karyotype. The father has a balanced reciprocal translocation between the
chromosomes 4 and 11. You have to inform the parents, that:
A) Every of their children will have multiple developmental defects
B) The risk, that this couple will have another child with these defects is high
C) Balanced reciprocal translocations are usually harmless, so it is unlikely, that the found
translocation has caused the defects in the child
D) The chromosomal translocation in the father occured due to dissociation (failure of separation)

40. What's FALSE? aCGH:
A) Allows the analysis of aberrations throughout the genome in a single hybridization
B) Allows the identification of balanced aberrations
C) Is not legitimate in the search for chromosomal rearrangements in the area of the centromere
and the telomere (karyotype analysis)
D) Allows the diagnosis of biologic material, from which it was impossible to retrieve dividing cells

41. Deformations are related to:
A) Amniotic band syndrome
B) Insufficient amount of amniotic fluid
C) Minor defects of the extremities
D) the Robin sequence

42. Not true is that:
A) with the help of Bayes theorem we're getting the final risk +
B) LR is for calculating the likelihood ratio +
C) LR can be bigger than 1
D) LR allows to directly calculate the risk of a disease

43. Typical clinical problems found in heterozygous Factor 5 Leiden mutation are:
A) Arterial thrombosis and ischemic stroke in the CNS
B) Venous thromboembolic disease and early pregnancy termination
C) Heart attack
D) All of the above

44. Choose the correct sentence concerning Down syndrome:
A) Some children with this syndrome only show small stature anomalies 108 Milder clinical
expression with Mosaicism
B) The karyotype always shows 47 chromosomes (And Robertsonian translocation, 46)
C) The chromosomal aberration appears just as often in oogenesis as in spermatogenesis
D) The karyotype mostly shows triploidy (trisomy, Downs is most common autosomal aneuploid
condition compatible with survival to term)

45. Choose the WRONG sentence concerning the Sanger sequence for the coding sequence:
A) It is based on the chromatogram analysis from the thread forward and reverse
B) The chromatogram of the patient’s DNA is compared with the chromatogram of the sequence
analysis (correct translation????)
C) Basic information should include the name of the gene, the description of the mutation on the
level of DNA and proteins as well as the description if the mutation is homozygous or
heterozygous
D) The description of the mutation always takes place in the direction from the sequence
analysis to the DNA of the patient

46. Miss W. comes to you. She is in the 10th week of pregnancy and has a sister suffering from
mucoviscidosis (cystic fibrosis) and is worried that her child will have the disease. Which is the
probability of being a carrier of the mutated gene CFTR in Miss W.?
A) ½
B) ¼
C) ⅔
D) 1/25

47. Choose the real definition of genotype:
A) The genotype is a mutation that occurs in the examined gene in a sick patient
B) The genotype is the description of the number and structure of all chromosomes
C) The genotype is a unique allele arrangement in a given locus
D) The genotype is a unique allele arrangement only on one chromosome

48. Mark the WRONG sentence about crossing-over:
A) Crossing-over is the exchange of parts of the DNA between homologous chromosomes
throughout prophase of the I meiotic division +
B) Throughout the double crossing-over no recombination appears
C) The distance between loci is counted in centimorgan +
D) Loci found on the same chromosome undergo recombination in 50% of cases

49. Show the genotype of the parents, that have the highest risk of Rh disease:
A) Mom D/d, dad D/D
B) Mom d/d, dad D/d
C) Mom d/d, dad D/D
D) Mom D/D, dad d/d

50. Which of the answers below is correct in the case of spinal bulbar muscular atrophy?
A) The disease is caused by an excess number of CAG repeats
B) The correct range of CAG repeats is 9 to 36 (11 - 34, info from polish skript)
C) The correct range of CAG repeats in the polish population is 15 to 94
D) A and B are correct

2016 FINAL
1. Indicate true sentence.
A) Paracentric inversion does not change shape of chromosome.
B) Robertsonian translocation occurs between two random autosomal chromosomes.
C) Isochromosomes arise after deletion of two subtelomeric regions.
D) Direct duplication does not cause change pattern of bands in chromosome.

2. Which sentence describing aCGh microarrays method is true?
A) Allows to detect majority of known mutations.
B) Does not detect balanced translocations.
C) Is used to estimate sex of fetus in very severe diseases linked with chromosome X.
D) Allows to detect majority of known and unknown mutations.

3. Pedigree shows segregation of autosomal dominant disease with paternal imprinting (paternal
allele is inactivated). Which statement is true?

A) The son will be for sure healthy, but daughter will be for sure affected.
B) The children have the same disease probability which equals 50%.
C) The children will be for sure healthy but daughter's children can be affected.
D) The children will be for sure healthy but son's children can be affected.

4. A male with impaired hearing caused by a 35delG homozygous mutation in GJB2 gene married a
woman who is a heterozygous carrier of the same mutation. What is the risk of impaired hearing in
their offspring?
A) 25%
B) 50%
C) 75%
D) 100%

5. Indicate a karyotype for an unbalanced chromosomal aberration.
A) 46,XX,del(13)(q12;q13)
B) 46,XY,inv(5)(q20;q22)
C) 45,XX,der(13;14)(q10;q10)
D) A and C

6. Which of the following inheritance patterns is relatively often associated with consanguinity
between parents?
A) Autosomal dominant
B) Autosomal recessive
C) X-linked recessive
D) Mitochondrial

7. The risk of having a child with Down syndrome when one parent is a carrier of t(21;21)
translocation is:
A) 1%
B) 4%, if translocation is paternal
C) 25%
D) 100%

8. On a pedigree, which symbol you will use to indicate a proband?

A) Symbol A
B) Symbol B
C) Symbol C
D) Symbol D

9. An individual has a mutation causing a disease (e.g. retinoblastoma), yet they do not develop any
symptoms in their lifetime. Which mechanism is responsible for such situation?
A) Reduced penetrance
B) Varied expression
C) Germinal mutation
D) Locus heterogeneity

10. When is the most possible inheritance pattern of disease observed in family showed on pedigree
below?

A) Recessive X-linked
B) Autosomal dominant
C) Autosomal recessive
D) Mitochondrial

11. Which sentence describing Duchenne Muscular Dystrophy is false?
A) Risk of having second child with DMD by a healthy woman equals 1/3.
B) Female mutation rate and male mutation rate in DMD are very similar.
C) Approximately 67% women who have one affected child are carriers of mutation.
D) Dystrophia gene is mapped on chromosome X.

12. Select the most likely mode of inheritance shown on the pedigree below:

A) Autosomal dominant
B) Autosomal recessive
C) Recessive X-linked
D) Dominant X-linked

13. A clinical genetics laboratory is offering, among its clinical services, a Genetics test that is
advertised as a test for 43 genetic variants that are associated with diet (e.g. associations with fat
mobilization, response to dietary nutrients, increased waist circumference, obesity risk, etc.) and
exercise (e.g. endurance, power, speed). The test is advertised as being useful to guide personalized
diet and exercise recommendations from nutritional experts for better weight management
and fitness. An obese, Caucasian, 39 years old patient of yours, that you have been guiding on her,
mostly unsuccessful, efforts to lose weight, asks your opinion about doing such test. The patient's
efforts to lose weight have been unsuccessful mostly because she does not comply very much with
the diet recommendations.

A) To ask the laboratory offering the test about the studies on which they based their selection of
the variants that they test for, to assess the applicability of the results of the studies to your
patient.
B) To tell the patient that personalized medicine based on the genetic makeup of the patient is
the current trend and thus, since the laboratory is already offering the test and advertising in
that way, the test will be useful to help her lose weight.
C) To ask the laboratory offering the test, if there is any supporting evidence to their claim that the
test results, and the consequent personalized recommendations, will improve the chances that
patients will lose weight, in comparison with current, non-personalized, interventions for
weight loss.
D) To expect that, most likely, the evidence described in C is still not available, because appropriate
randomized controlled trials, considered the best providers of such evidence, are expensive and
take time to accomplish.

14. Continuation of the above. The patient decided to go ahead and take the test. It was found that
she carries the less common variant allele at a gene named FTO. Carriers of such less common
variant allele have been found, in a single study, published in 2012, to have better response (1.51 kg
greater reduction in weight) to a „low calorie, high protein diet“ than to a „low calorie, low protein
diet“ after controlling for age, sex, ethnicity and baseline BMI. The nutritionist provided by the
laboratory, based on this study, proposed a diet to the patient that was low in calories and relatively
high in protein.
You did some further research and found a few other studies that do not seem to corroborate the
effect of the above referred study, although they had different designs.
Based on the above, which of the following sentences is correct?
A) It is almost sure that the patient will lose weight with this new diet.
B) It is almost sure that the patient will not lose weight with this new diet.
C) It is difficult to predict what will happen with the weight of this patient with the new diet.
D) The patient should not try this new diet and should give up on trying to lose weight.

15. Recognizable genetic etiology concerns all possible anomaly patterns except:
A) Dysplasia
B) Association and syndrome
C) Disruption and deformation
D) Sequence

16. What should be looked for when collecting medical history for a patient with possible genetic
disease?
A) Miscarriage
B) Ethnic origin
C) In vitro fertilization
D) All of the above

17. Indicate karyotype with unbalanced chromosomal aberration
A) 46, XX, del (13) (q12; q13)
B) 46, XY, inv (5) (q20; q22)
C) 45, XX, der (13; 14) (q10;q10)
D) Correct A and C

18. A 39 years old patient of yours is pregnant. In her reproductive history, you see that she had a
miscarriage around 10 weeks, in her first pregnancy, then she had a healthy daughter, currently 7
years old, and then a second miscarriage around a similar gestational age. You referred her for
genetic counseling. After counseling, she decided to have the amniocentesis to check the karyotype
of the fetus.

A) Because she understood that, because of her age she has a risk for fetal chromosomal
aneuploidies that is above the average and high enough to cause concern.
B) Because she understood that, because of her age she has a risk she had an increase in the risk
for fetal structural chromosome anomalies.
C) Because she understood that, because she had 2 miscarriages she has an increase in the risk
for fetal structural chromosome aneuploidies.
D) Because she understood that she has a risk for chromosomal aneuploidies, which is common in
every woman, regardless of age.

19. Continuation of the above. After approximately 10 days, she calls you very worried because the
laboratory called her to tell her that the fetus, has a balanced robertsonian translocation between
the chromosome 21 and the 13 and one chromosome X and one chromosome Y, which correspond to
a karyotype 45, XY, … (22;23) (q10;q10). She was referred for genetic counseling with a genetical …
the earliest appointment was possible only within 3 days and she is very worried, despite the fact
that the laboratory staff person that called her, told her not to be worried.
At this stage, with just this information available, which of the following statements is not correct?
A) The fetus will not have an abnormal phenotype caused by the genomic defect, because the
translocation is balanced and the breakpoints affect non-essential loci.
B) The patient and her partner, assumed to be the father of the baby, will need to check their own
chromosomes by karyotype as verify if the fetus inherited the anomaly from one of the parents
or if it was a de novo defect.
C) If one of the parents is also a carrier, her daughter may then be a carrier and thus, should get
genetic counseling when she reaches reproductive age. This is important because, if she is also
a carrier of the same defect, she will also have reproductive risks.
D) The only problem is for the future reproductive plans of the individual that will result from
this pregnancy. There will be a risk for live newborns with trisomy 21, trisomy 13 or
monosomy 13 or monosomy 21.

20. Fabry's disease manifests with:
A) Burning pain in the palms and soles precipitated by stress, alcohol, exercise or heat,
B) Neonatal coma and convulsions,
C) Rapid developmental regression,
D) Mental retardation.

21. Abdominal ultrasound done in an otherwise healthy neonate reveals a unilateral multicystic
kidney. What is the most likely karyotypic finding in this individual?
A) 47, XXY
B) 45, X
C) 46, XY
D) 46, XY ish del (7)(q11.23q11.23)(ELN-) Williams

22. A useful diagnostic marker leading to a possible diagnosis of a genetic syndrome in a child with
intellectual disability (ID) is:
A) Macrocephaly / Microcephaly
B) Facial dysmorphism
C) Accompanying behavioral abnormalities
D) All of the above

23. An „all or none“ phenomenon referring to the presence or absence of observable phenotypic
expression of features of a dominant disease in an individual known to have a mutant allele is
called:
A) Variable expression
B) Incomplete penetrance
C) Phenocopy
D) Dysplasia

24. One of your patients, a 38 female, is pregnant for the second time. She had a girl before, now 7
years old. She consults you because of common cold. You ask her how is the pregnancy going. She
says she is happy because she is going to have a boy. She knows that because she did a fetal
karyotype reported as „normal male, 46, XY“. She expresses concern only with the fact that during
the ultrasound exams the doctor was never able to see the sex of the baby, because of positioning
reasons. At birth the patient is congratulated on the birth of an apparently healthy girl! She gets
puzzled. Which of the following sentences is appropriate?
A) It is impossible to have a XY karyotype and be a girl.
B) If the sex chromosomes are confirmed to be XY, one of the possible explanations for the
discrepancy between the sex and the karyotype is a rare condition in which the SRY gene which
codes for a protein named Testis Determining Factor, a gene normally located in the Y
chromosome, may have been translocated in an autosome.
C) If the sex chromosomes are confirmed to be XY, one on the possible explanations for the
discrepancy between the sex and the karyotype is a rare condition, which is X-linked
recessive, and is caused by an inactivating mutation in the gene that codes for the androgen
receptor, leading to a complete absence of the receptor, a condition known as Complete
Androgen Insensitivity Syndrome (CAIS).
D) There is no risk that the sister is affected with the same condition of the newborn, regardless of
the cause of the sex reversal observed in the newborn.

25. A male patient of yours brings you, his primary care family physician, his 4 years old male child,
who has symptoms of a common cold. You know the child has been seen in specialized pediatric
services because he was late to walk, and he does not speak yet, having been diagnosed with
intellectual disability. You also have noted that the child has some peculiar face, which you, a
non-specialist, have some difficulties in describing. You had been told before that the child had a
karyotype done 1 year ago and it had been reported as normal. The father tells you that the
pediatrician had sent the child for a clinical geneticist consultation and that the geneticist, after a
detailed observation and description, had suggested to perform “chromosome microarray”.
Which of the following opinions about this suggestion by the clinical geneticist is correct?
A) If the karyotype was normal, a chromosomal microarray will not bring any more relevant
information and so it is a waste of time and money.
B) The geneticist is probably expecting to identify a balanced translocation, a chromosomal defect
not suitable for detection by karyotype, which is a likely explanation of the phenotype of the
child.
C) The geneticist is probably expecting to find a submicroscopic genomic unbalance that could
be the explanation of the phenotype of the child.
D) Chromosome microarrays are still not recommended as clinical exams. They are still only used
for research.

26. The epigenetic changes differ from other DNA changes found in cancers because they are:
A) Silent
B) Rare
C) Nonsense
D) Reversible

27. According to the Knudson hypothesis, known also as two hits hypothesis, phenotypic effect of a
cancer suppressor gene damage appears after:
A) Inactivation of both alleles
B) Demethylation of both alleles
C) Amplification of both alleles
D) The correct A and B

28. What is the estimated number of women carriers of a X-linked recessive disease in 40 mln
population if prevalence of affected men equals 1/10000? Ignore de novo mutation phenomena.
A) 4 thousand
B) 8 thousand
C) 16 thousand
D) 64 thousand

29. A 23 years old male who you have diagnosed with diabetes a few years ago, tells you that he has
been having hearing problems which you confirm using appropriate hearing tests. Later he tells you
that he had two episodes of seizures and an electroencephalogram confirms the diagnosis of
epilepsy. Due to the combination of progressively acquired symptoms in different organs and
systems, that are especially demanding in terms of cell energy requirements you consider the
hypothesis of a mitochondrial disorder. You refer your patient to a specialist who, after requesting
several types of tests, later confirms the diagnosis. Genetic testing identifies a mutation in the
mitochondrial DNA. The patient consults you for further information.
Of the following statements about these type of disorders (grouped under the name “mitochondrial
disorders”), which one is incorrect?
A) All mitochondrial disorders are caused by mutations in mitochondrial DNA.
B) Several of these disorders tend to be progressive and it may be possible that symptoms in
other systems may still appear.
C) There is no specific treatment of these conditions and each problem/symptom must be
managed as they would be in people who have them because of different etiologies.
D) Among individuals with the same mutation in the mitochondrial DNA the symptoms and
evolution of the disease have a relatively broad range of severity.

30. Continuation of the above. The patient described in the previous question is worried about the
possibility of having affected children. You ask him about his family history and he says that he has
a younger sister, aged 17. His parents (father aged 50 also complaining of hearing problems
recently, and mother aged 45, has been relatively healthy, although lately she refers feeling tired
easily).
About his family, which of the following sentences is correct?
A) There is a small risk of transmitting the condition to his daughters but not to his sons.
B) There is a small risk of transmitting the condition to his sons but not to his daughters.
C) His father’s deafness may also have the same cause of his own symptoms, that is, the father
may also have the same mutation is his mitochondrial DNA, and the patient may have inherited
it from him.
D) His mother’s symptoms of easily feeling tired may also have the same cause of his own
symptoms, that is, the mother may also have the same mutation is his mitochondrial DNA,
and the patient may have inherited it from her.

31. Assuming a dominant X-linked inheritance pattern, penetrance of 100% and a frequency of
mutated allele of 0.2, the likelihood of the pedigree (the disease occurrence in the family of four as
on the scheme) is approximately:

A) 0.032
B) 0.064
C) 0.128
D) 0.2

32. What are the odds (likelihood ratio, LR) that a tested marker is linked (theta = 0) to a gene
causing an autosomal dominant disease in the family showed on the right. Results of the genetic
marker genotyping are indicated on the pedigree.

A) 1
B) 16
C) 32
D) 64

33. Which of the following statements regarding the autosomal dominant diseases is not true?
A) These diseases manifest themselves in those heterozygous for the mutated gene.
B) The probability of the disease in a relative affected person may be dependent on the
penetration.
C) The disease affects many people, but only in one generation.
D) None of the parents of a affected person has to be heterozygous mutated gene

34. B
35. C

2016 FINAL Retake

1-5 not visible

6. Which of the following symptoms is not present in individuals with Klinefelter syndrome
(47,XXY)?
a) Tallness
b) IQ lower than in healthy siblings
c) Webbed neck
d) Infertility

7. Mark a false statement.
a) Females with FRA X usually have severe disability
b) Females with FRA X may experience premature menopause
c) Prenatal diagnosis in FRA X syndrome is possible
d) In males with FRA X, delayed speech development occurs

8. The risk of recurrence of multifactorial disease does not depend on:
a) Frequency of the particular disease in the population
b) Sex
c) Number of miscarriages
d) Number of affected individuals in the family

9. A child with an autosomal dominant disease was born to healthy parents. What is the risk that
their next child also will be affected?
a) 100%
b) 0%
c) 50%
d) The risk will depend on whether one of the parents is a germinal mosaic

10. The symbol shown here denotes:
a) Siblings
b) Monozygotic twins
c) Dizygotic twins
d) Consanguineous relationship

11. Indicate a karyotype for an unbalanced chromosomal aberration
a) 46,XX,del (13)(q12;q13)
b) 46,XY, inv(5)(q20;q22)
c) 45,XX,der(13;14)(q10;q10)
d) A and C

12. Select the most likely mode of inheritance shown on the pedigree below:
a) Autosomal dominant
b) Autosomal recessive
c) Recessive X-linked
d) Dominant X-linked

13. Recognizable genetic etiology concerns all possible anomaly patterns except:
a) Dysplasia
b) Association and syndrome
c) Disruption and deformation
d) Sequence

14. An “all or none” phenomenon referring to the presence or absence of observable phenotypic
expression of features of a dominant disease in an individual known to have a mutant allele is
called:
a) Variable expression
b) Incomplete penetrance
c) Phenocopy
d) Dysplasia

15. Indications for genetic evaluation, including testing, should include individuals with:
a) Autism and developmental regression
b) Autism and any of the following: dysmorphism, congenital anomaly (-ies), developmental delay,
macrocephaly > 3SD, microcephaly <3SD
c) Autism and family history of autism or other neuropsychiatric disease in 1st/2nd degree
relatives
d) All of the above

16. After an uneventful pregnancy, a 31 years old woman delivers at term a newborn by normal
vaginal delivery. The mother asks anxiously about the “sex of the baby”. It seems that there had
been some issues with the ultrasound assessment of the sex, which was always difficult and
apparently seeming to contradict the results of a cell-free maternal plasma screening test for
chromosomal defects that the patient had decided to have. The test reported a 46,XX fetus but the
doctor doing the ultrasound scans thought it could be a boy, although he could not be sure. The
nurse attending to the baby looked at the genitals of the baby and started mumbling with the other
colleagues instead of answering the mother’s question. They took the baby away and called the
attending doctor. A few minutes later the doctor came in and told the patient that the genitals of the
baby were ambiguous and it was not possible to determine the sex at that moment. Some tests
would need to be ran first. A few anguishing days later the mother was told the baby had a 46XX
karyotype but the genitals had an abnormal development due to an autosomal recessive heritable
monogenic condition called congenital adrenal hyperplasia, that, in this particular case, was caused
by a complete deficiency of one enzyme named 21-hydroxylase. Of the following sentences, which
ones are correct?
1) In this condition,the gonads are normal ovaries
2) The internal sexual reproductive organs have normal female organs (uterus and tubes) but
also some Wolffian duct structures
3) Other than the external genital issue and the sexual development anomaly, there are no other
medical care requiring issues.
4) This condition has a likely 50%risk of recurring in each of the pregnancies of the couple
5) The baby, when grown up, and willing to have children, may require medical assistance
6) If reproduction is achieved by the grown up baby, there will be a 50% risk of transmitting the
disease to the offspring, regardless of the genetic makeup of the partner.

a) 1,2,5
b) 1,4,6
c) 2,3,6
d) 2,3,5

17. A woman of 40 years and her 20 years old daughter got pregnant more or less at the same time
and they both miscarried. The mother , at 12 weeks and the daughter at 9 weeks. This was the first
pregnancy of the daughter and the 4th of the mother, who had another miscarriage at around 8
weeks, on her third pregnancy, when she was 38 years old.
Which of the following sentences is correct?
a) The most likely cause of the miscarriages of the mother is random accidental aneuploidy
(trisomies) but the miscarriage of the daughter is more likely to have another cause.
b) The most likely cause of the miscarriage of the daughter is random accidental aneuploidy
(trisomies) but the miscarriages of the mother are more likely to be caused by another cause,
such as unbalanced translocation.
c) The most likely cause of the miscarriages of both, mother and daughter, is random
accidental aneuploidy (trisomies)
d) The most likely cause of the miscarriages of both, mother and daughter, is unbalanced
translocations.

18. On the basis of a drawing showing chromatograms of the STR marker analysis, point, in which
meiotic division and in which parent nondisjunction occured.
a) In the mother in the first meiotic division
b) In the father in the first meiotic division
c) In the mother in the second meiotic division
d) In the father in the second meiotic division

CANT SEE 19-20

21. Fabry's disease manifests with:
A. Burning pain in the palms and soles precipitated by stress, alcohol, exercise or heat,
B. Neonatal coma and convulsions,
C. Rapid developmental regression
D. Mental retardation.

23. Point one of the following karyotypes that is the least likely to involve at a live newborn:
A) 45,X
B) 46, XY,-16qh
C) 47,XX,-7
D) 47,XX,-11

24. Spinal muscular atrophy:
a) Is a heterogenous group of disorders
b) Approximately 95% of 5MA affected patients lack both copies of SMN1 gene (unclear)
c) Is caused by mutations in SMN2 gene
d) Is inherited as an X-linked trait

25. Which woman is the greatest risk of having a baby with down’s syndrome?
a) 25-year old woman who had a baby with karyotype 47,XX,-21
b) 30-year old woman who is a carrier of the Robertsonian translocation 21;21
c) 35-year old woman whose niece has Down syndrome
d) 40-year old woman who had a baby with karyotype 47,XY,-21

26. Select which statement regarding autosomal recessive inheritance is incorrect.
a) If both parents are carriers, then the fertilization risk that their child will be a carrier is 2/3
b) These diseases are more common in societies where marriage between relatives are frequent
c) The incidence of these diseases in men is the same as in women
d) The disease usually occurs in one generation

27. The woman, carrier of a X-linked recessive disease, sometimes reveals symptoms of the disease,
which results from the phenomena:
a) Variable expression
b) Mitochondrial heredity
c) Inactivation of one of the X chromosome (Lyonization effect)
d) Incomplete penetration

28. The most common cause of intellectual disability in the population is:
a) Trisomy 21
b) Trisomy 13
c) Trisomy 18
d) Turner syndrome

29. Which statement(s) about the frequency of mutations in germ cells are true?
a) Chromosomal mutations occur more frequently in women
b) Point mutations occur more frequently in men
c) In both sexes mutations in the germ cells arise more frequently in the elderly
d) All of the above

30. Person 3:
a) Is currently healthy but with high risk will be ill in the future
b) Is a carrier of the autosomal recessive mutation
c) Exhibits the subclinical characteristics of the disease
d) Is a carrier of the X-linked recessive mutation

31. Lod score = 0 means that:
a) Is 10 times less likely that loci are linked than they are independent
b) Is 10 times more likely that loci are linked than they are independent
c) Is just as likely that loci are linked and they are independent
d) None of the above

32. The gene responsible for the occurrence of family polyposis colon cancer (a form of hereditary
dominant colorectal cancer) is:
a) Tumor suppressor gene
b) Proto-oncogene
c) DNA repair gene
d) Gene of the reduced-shortening telomeres in dividing cells

33. A 25 year old woman two days ago gave birth to a healthy baby. Her mother (the child’s
grandmother) as a child was operated on due to retinoblastoma. The woman never became ill with
the cancer, but she wants to know what is the probability of occurrence of the disease in the
newborn child. Both the father and grandfather of the child are homozygous wild types. In order to
determine the genetic risk you will take into account:
a) The incident of disease in the population
b) That there is no maternal disease
c) That there is no disease in child
d) The correct are B and C

34. The most complete interpretation of the karyotype test result 47,XXY [60]/46,XY [40] is:
a) Mosaicism- in 60 of the 100 examined cells identified karyotype of Turner syndrome, other
normal cells
b) Mosaicism- in 60% identified the karyotype of Klinefelter syndrome, other cells -normal
c) Mosaicism - 60% of the 100 examined cells with karyotype of Klinefelter syndrome, other
normal cells

35. Pedigree shows the segregation of Duchenne dystrophy. What are the odds that the mother in a
carrier of pathogenic mutations?

a) 1
b) 1:2
c) 2:1

MCQ-1

1. Which of the following is inherited as an autosomal recessive condition?
a) Achondroplasia
b) Phenylketonuria
c) Factor VIII deficiency (haemophilia A)
d) Neurofibromatosis
e) Spina bifida

2. A 36- year old woman has only a son in whom haemophilia has diagnosed. He is also affected.
Which of the following statements is correct?
a) The condition is X-linked dominant
b) All of her future daughters will be carriers
c) All of her sons daughters will be carriers
d) Her son’s sons will be at 50% risk of haemophilia
e) Fetal diagnosis of haemophilia for future pregnancy by DNA analysis is most used

3. A man and a woman have short stature, prominent forehead, shallow nasal bridge, short limbs,
and other skeletal changes. Both of them have been told that they have achondroplasia (100800),
and wish to know their recurrence risk for affected children. Match the recurrence risks for the child
of achondroplastic parents to be affected (heterozygous and homozygous).
a) 100%
b) 75%
c) 50%
d) 25%
e) Virtually 0

4. Following the birth of an affected child, the probability for the second child of the achondroplastic
parents to be affected.
a) 100%
b) 75%
c) 50%
d) 25%
e) Virtually 0

5. The cytogenetic term “6q+’’ refers to… ?
a) 46,XX,dup(6q)
b) Extra chromosome material derived from the long arm of chromosome 6
c) 46,XX,dup(6)
d) Extra chromosome material, origin specified, attached to the long arm of chromosome 6
e) 47,XX,+6

6. Mark the true statement regarding the family tree shown below:

a) I-2 is dead
b) II-2 is a male
c) III-3 is affected
d) III-1 and III-3 are consanguineous couple
e) II-3 has one boy

7. Mark the FALSE statement regarding the family tree shown below:

a) The condition is X- linked
b) II-5 is a non-penetrant gene carrier
c) There is a 50% risk that any offspring of II-3 will carry the faulty
d) The condition is likely to affect males and females equally
e) II1-1 AND III-2 have 50% of their genes in common

8. Which of the following statements on birth defects is true?
a) Occur in 3:1000 live births
b) In most children involve multiple organs
c) Are common in chromosomal abnormalities
d) Are almost all due to known single- gene defects
e) Always involve malformations

13. Which of the following conditions have polygenic inheritance?
a) Galactosaemia
b) Polydactyly
c) Meningomyelocele
d) Turner’s syndrome
e) Marfan’s syndrome

14. What proportion of early spontaneous abortions are chromosomal?
a) 1%
b) 5%
c) 10%
d) 25%
e) 50%

15. Anticipation is characteristic of conditions caused by
a) Microdeletions
b) Mitochondrial inheritance
c) Genomic imprinting
d) Trinucleotide repeat expansions
e) Germline mosaicism

2015 4yr
1) A male has 2 sons affected by a dominant X-linked disease:
a. His all children are likely to be affected
b. His all sons are likely to be affected
c. His all daughters are likely to be affected
d. Other

2) THE BEST description of the term ‘syndrome’ is:
a. A chromosomal abnormality, e.g Down syndrome
b. A set of developmental anomalies occurring together in an recognizable and consistent
pattern and assumed to be of single etiology
c. Two congenital anomalies in one individual
d. An abnormal developmental process

3) Frequency of an allele on X chromosome is 10%. At least one copy of his allele will be carried by
a. 10% population
b. 10% males
c. 19% females
d. B and C

4) Maternal uniparental disomy (UPD)
a. Is always symptomless if mother is healthy and has normal karyotype
b. May cause pathology if the involved chromosome contains loci with maternal imprinting
c. May cause pathology if the involved chromosome contains loci with paternal imprinting
d. B and C

5) Based on the analysis of STR genetic markers carried out in trisomic healthy child and his parents,
you find that nondisjunction occurred during (peak position on the horizontal axis corresponds to
the type cariant, the peak height corresponds to the number of copies):

a. Spermatogenesis, in the first meiotic division
a. Spermatogenesis, in the second meiotic division
b. Oogenesis, in the first meiotic division
c. Oogenesis, in the second meiotic division

6) Symbol beneath denotes
a. Perinatal death
b. Infertility
c. Lack of children
d. Other

7) In achondroplasia (inheritance autosomal dominant) which is true?
a. The risk to the sibling of an affected person who has normal parents is 50%
b. The risk of achondroplasia each offspring of an affected person is 50%
c. There is an increased frequency of consanguinity in the parents of affected peoples
d. All the offspring of two achondroplastic parents will be affected
e. The abnormal gene is on the X chromosome

8) Pedigree shows a family in which there was a case of with a boy with Duchenne muscular
dystrophy. What are the odds that mother is a carrier of pathogenic mutation
a. 1:1
b. 1:2
c. 1:3
d. 2:1

9) Prenatal diagnosis in Duchenne muscular dystrophy
a. Is available to carriers of a known dystrophin mutation by chorionic villus sampling (CVS) at 24
weeks gestation
b. Is available to carriers of a known dystrophin mutation by chorionic villus sampling (CVS) at
11 weeks gestation
c. Is available only to patients without gonadal mosaicism
d. Is not available to mothers of an apparently de novo DMD mutation (germline mosaicism)

10) Please indicate a true risk for multifactorial disorders:
a. Cleft/lip palate 1%, spina bifida 10%, schizophrenia 50%
b. Cleft/lip palate 4%, spina bifida 4-5%, schizophrenia 10%
c. Cleft/lip palate 12%, spina bifida 12%, schizophrenia 20%
d. Cleft/lip palate 1%, spina bifida 10%, schizophrenia 20%

11) Which percentage of abnormalities is observed also in first degree relatives of a patient
a. Mental retardation: severe 25%, mild 35%, recessive disorders 10%, congenital malformation
10%
b. Mental retardation: severe 35%, mild 25%, recessive disorders 50%, congenital malformation
20%
c. Mental retardation: severe 50%, mild 35%, recessive disorders 10%, congenital malformation
10%
d. Mental retardation: severe 25%, mild 40%, recessive disorders 10%, congenital malformation
10%

12) Please indicate false opinions concerning genetic counseling
a. Not needed if a single affected child present
b. Not needed if disease is not inborn (no symptoms from the birth)
c. Not needed in a case of autosomal recessive disease in a second child if the first child is already
affected
d. All the opinions (A,B,C) are false

13) Which causative associations between clinical syndrome and chromosomal aberration are true?
a. Wolf-Hirschhorn 4p, Cri-du-chat 5p, Smith Magenis del117p11.2
b. Wolf-Hirschhorn 5p, Cri-du-chat 4p, Smith Magenis del117p11.2
c. Wolf-Hirschhorn 4p, Cri-du-chat 5p, Smith Magenis dell116p11.2
d. Wolf-Hirschhorn 4p, Cri-du-chat 5p, Smith Magenis del117q11.2

14) Emery-Dreifuss muscular dystrophy is characterized by:
a. Selective distal muscle wasting
b. Limited neck and trunk flexion, limitation of elbow extension
c. Sparing of forearm muscles
d. B and C are true

15) Duchenne muscular dystrophy is caused by:
a. 60% large deletions, 35% point mutations, 5% duplications
b. 60% large deletions, 20% small duplications
c. Point mutations in DMD gene
d. Mutations in the DMD20 gene

16) Spinal muscular atrophy:
a. Is a heterogenous group of disorders
b. Approximately 95% of SMA affected patients lack both copies of SMN1 gene
c. Is caused by mutations in SMN2 gene
d. Is inherited as an X-linked trait

17) Gonadal mosaicism in Duchenne muscular dystrophy
a. Has been never found in muscular dystrophies
b. Is present in 80% of DMD affected patients
c. Occurs in some DMD affected patients
d. Should be considered in all DMD affected patients

18) A baby born with squashed face and talipes equinovarus because of large fibroids in its mother’s
uterus would be classified as having:
a. A malformation
b. A deformation
c. A dysplasia
d. A sequence
e. A syndrome

19) Which of the following statements on birth defects is true?
a. In most children involve multiple organs
b. Are common in chromosomal aberrations
c. Occur in 3:1000 live births
d. Are all due to known monogenic defects
e. Always involve malformations

POLISH DIVISION 2017

1. Proband:
a. Carrier
b. Parent
c. Propositus
d. Interesting case

2. Which of the following situations present the highest risk of the child to have Down
syndrome?
a. 45 year old woman
b. 25 year old woman, pregnant before, child with Down syndrome
c. 20 year old woman, carrier of balanced translocation of chromosomes 14 and 21
d. 20 year old male, carrier of balanced translocation of chromosomes 23 and 21

3. In the first pregnancy, the boy with DiGeorge syndrome was born. What is the chance that
that syndrome will appear in the next pregnancies?
a. 50% for male gender
b. 50% independently from the gender
c. It is population risk
d. All of the answers are false

4. Pleiotropic gene:
a. Is expressed only in one particular tissue
b. Is present in the genome in many copies
c. Influences more than one trait
d. Due to its size it is more prone for mutations

5. Which of the following chromosomes never takes part in Robertsonian translocation:
a. 13
b. 15
c. 16
d. 21

6. Trait, which would explain the occurrence of inappropriate phenotype in people with
inappropriate sex chromosome number :
a. Inactivation of only maternal X chromosomes
b. Inactivation of only paternal X chromosomes
c. Incomplete inactivation of X chromosomes at the ends of short and long arm (active fragments
on both copies)
d. None of above

7. In the familial hypercholesterolemia, the mutation in LDL receptor gene was found. Both
homozygotes and heterozygotes are affected. However, the symptoms in homozygotes are
more severe. Molecular basis of this disease is:
a. Negative dominant effect
b. Haplotype insufficiency
c. Gain of function
d. Positive dominant effect

8. On the basis of segregation analysis, the following scheme presents disease that is inherited
by:
a. Autosomal dominant
b. Autosomal recessive
c. Dominant X linked
d. Recessive X linked

1. Down syndrome (the most common mutation):
a. Aneuploidy
b. Polyploidy
c. Triploidy
d. Somatic mutation

9. The following profile of gene mutation in neoplasms indicates that gene mutated this way
may act in the neoplastic process as:
a. Passenger gene
b. Suppressor gene
c. Mutagen
d. Oncogene

10. Angelman syndrome is a result of:
a. One parent disomy of maternal chromosome 15
b. Deletion of maternal fragment of chromosome 15 (del15q11-13)
c. Deletion of paternal fragment of chromosome 15 (del15q11-13)
d. None of the above

1. What is the genetic risk for child whose one parent is affected with autosomal dominant
disease (heterozygote) and other is healthy:
a. For each child it is equal and it is ½ according to the rule of independence
b. ½ but only for daughters
c. ½ for the first child of this pair, with each next one the risk is lower
d. Impossible to assess the risk based on this information

1. The advantage of analysis of chromosomes in metaphase after staining for bands G is not:
a. Possibility of assessing whole karyotype in single test
b. Possibility of using both chromosomal number aberrations and structural aberrations
c. Possibility of using microdeletions
d. Possibility of using Robertsonian translocations

1. Which statement concerning Duchenne dystrophy is correct:
a. Female carriers of mutation in gene DMD newer show traits/symptoms of disease
b. In affected people, creatinine kinase (CK) levels are significantly increased
c. DMD gene consists of 12 exons
d. None of above

1. Clinical expression of myotonic dystrophy:
a. Decreases with the number of repeats of trinucleotides
b. Increase with the number of repeats of trinucleotides
c. Depends on deletion of gene DMPK
d. Depends on duplication of gene DMPK

1. In Charcot Marie Tooth disease, which is X linked with dominant pattern of inheritance:
a. We shouldn’t expect 2 times bigger amount of affected women than men
b. All the women are asymptomatic carriers
c. There are father to son inheritance patterns
d. In the relationship of affected male with not affected female all daughters may present
symptoms of the disease

1. Inherited neoplasms characterized by presence of germinal mutation of suppressor gene
account for about 10% of all the neoplasms. For one type of neoplasm this percentage can be
lower, for others significantly higher. From the examples below, choose only this in which
the possibility of diagnosis of germinal mutation is above 10%:
a. Lung cancer
b. Ovarian cancer
c. Cervical cancer
d. Laryngeal cancer

1. … Graves’ disease was conducted … applied for the tests before getting a job. From those
people 11 were diagnosed with the disease, 7 of those were carriers of risk genotype. Due to
small number of diseased patients the group was enlarged up to 1100 people being signed in
the clinic. All patients were screened and the results are below:

Then RR was counted. RR equals 1,31. Assess the accuracy of this test:
a. RR was correctly counted, but based on the research it is not a reliable test assessing influence
of the genotype on the behavior ???
a. The RR value was not correctly counted, because it should be 1,75. Independently from
counted value, RR is not reliable parameter assessing influence of genotype on
behavior based on conducted test.
b. RR was correctly counted and it is reliable parameter, assessing the influence of genotype on
the risk of being diseased based on conducted tests.
c. RR value was incorrectly counted and it is 1,75. Independently from counted value, RR is a
reliable parameter assessing influence of the genotype on the risk of being diseased on the
basis of conducted tests.

1. If the frequency (allelic) of occurrence of allele, which causes disease inherited in the
autosomal recessive pattern, is 1/40 according to Hardy-Weinberg equation, frequency of
disease and carriers is approximately:
a. 1/1600 and 1/20
b. 1/800 and 1/20
c. 1/1600 and 1/40
d. 1/800 and 1/40

1. Choose true sentence concerning aberrations of sex chromosomes:
a. Males 47, XXY are fertile on condition they are given testosterone substitute
b. The most frequent result of karyotype in women/girls with Turner syndrome is 45X/46XX
c. Estrogen substitution in Turner syndrome prevent cardiovascular complications
d. In Klinefelter syndrome there are indications for prophylactic gonadectomy due to high risk of
testicular cancer.

1. Choose the false sentence describing Pierre Robin sequence:
a. Is genetically heterogeneous; genetic factors account for 40-50% of its basis
b. Pierre Robin's sequence is never genetically based/coded/inherited
c. Significant percentage of genetic causes of sequences are micro aberrations detected in aCGH
test, including DiGeorge syndrome and connective tissue diseases
d. Micrognathia in sequence may result from intrauterine pressure (deformity)

1. Choose the false sentence:
a. Aneuploidy in autosomes is always lethal
b. Trisomies are more frequent as a result of mistake in first meiotic division
c. In case of trisomies, additional chromosome has most commonly maternal origin
d. Trisomies in mosaic version are characterized by less severe course of disease

1. Unbalanced aberration is described by the karyotype:
a. 46,XY,t(4;7)(p14;q23)
b. 46,XX,der(1)t(1,9)(qter;qter)
c. 46,XY,inv(3)(p21q13)
d. None of the above

1. In which case we can observe the highest probability of spontaneous abortion during
pregnancy:
a. Down’s syndrome
b. Neurofibromatosis type 1
c. Huntington’s disease
d. Trisomy of chromosome 18

1. Choose the clinical symptoms in newborn, which suggest congenital metabolic defect:
a. Seizures
b. Lethargy or coma
c. Difficulties in feeding and vomiting
d. All of above

1. Which of the following results of karyotype testing is the most probable in phenotypically
healthy woman who is infertile:
a. 46,XX/45,X
b. 47,XXX
c. 46,XX
d. 45,X

1. 35 year old woman with muscle weakness and receipt hearing loss. Considering possible
metabolic causes, first of all we should measure:
a. Ammonia in the serum
b. Mucopolysaccharides in urine
c. Lactic acid and alanine in the blood
d. Neurotransmitters in CSF

1. Typical indication for Preimplantation Genetic Diagnosis (PDG) is the carriage by one of the
spouses:
a. Deletion of SMN1 gene (spinal muscular atrophy)
b. Pathogenic variant in CFTR gene (cystic fibrosis)
c. Balanced translocation
d. All of above

1. Parents, whose first child has an autosomal disease come to the clinic , because their second
child was also born with the disease. With the first child they used genetic tests (DNA
isolated from the blood) and it appeared, that mutation causing the disease is de novo
mutation and a genetic risk in the next child is low. What is the probable explanation of this
situation:
a. This is the second time when the same de novo mutation occurred
b. Mosaicism of germ line in one of the parent
c. The reason of the disease is unidentified environmental factor
d. None of above

1. In the newborn, whose mother has uterine leiomyoma, asymmetrical flattening of the face
and club feet were diagnosed. How would you classify those anomalies in the child:
a. Malformation
b. Deformation
c. Dysplasia
d. Rupture/discontinuance

1. Single flexion line is frequent symptom in Down syndrome. It is an example of:
a. Deformation
b. Sequence
c. Rupture/discontinuance
d. Malformation

1. Explain: 46,XY, der(19);t(4;19)(p15.3;q13.2)mat:
a. Male with trisomy of fragment of short arm of chromosome 4 and monosomy of fragment of
long arm of chromosome 19
b. Male with trisomy of fragment of short arm of chromosome 19 and monosomy of fragment of
long arm of chromosome 4
c. Male with trisomy of fragment of long arm of chromosome 19 and monosomy of fragment of
short arm of chromosome 4
d. Male with trisomy of fragment of long arm of chromosome 4 and monosomy of fragment of
short arm of chromosome 19

1. The student had to count probability that healthy woman is a carrier of pathogenic allele. Her
father is diseased and the conducted test with sensitivity 0.75 gave a negative result. The
disease is inherited in autosomal dominant pattern, homozygosity is lethal, penetration is
0.8. We can omit de novo mutations. Which student filled the table properly?

a. Student A
b. Student B
c. Student C
d. Student D

1. In the micro-Warburg syndrome we can observe following clinical features:
a. Microcephaly
b. Microphthalmia
c. Pseudohypertrophy of calf muscles
d. Answers A and B are correct

1. In which case the risk of recurrence of autosomal recessive disease is the highest:
a. Lineage A
b. Lineage B
c. Lineage C
d. Risk is the same in all lineages

1. Choose the false sentence:
a. Important parameters of analysis of coupling (??) is type of inheritance and theta, which is the
frequency of recombination between loci of marker and loci of the disease
b. Lod score is customary form of presenting LR value in coupling analysis
c. Probability assuming that there is no coupling is equal with probability assuming that there is
coupling when theta is equal to zero.
d. Coupling analysis is used in indirect diagnosis of the presence of unknown pathogenic mutation

1. Which of the karyotypes indicates cytogenetic polymorphism in chromosome 9:
a. 46, XY,dup(9q)
b. 46, XY,9qh-
c. 46,XY,del(9q)
d. All of above

1. Define the risk of occurrence of antigen incompatibility, which can result in serological
conflict in the case, when mother has phenotype Rh negative and father has genotype D/d in
the gene:
a. 25%
b. 50%
c. 75%
d. 100%

1. Patau syndrome is connected to the karyotype:
a. 47, XX, +13
b. 46, XX, der(13,14)(q10;q10) +13
c. 47, XY, +13[10]/46,XY[10]
d. All of above are correct

1. Lyon hypothesis:
a. Relationship factor
b. Penetration depending on age
c. De novo mutation
d. Inactivation of chromosomes X

1. Mark wrong sentence
a. Germline mosaicism in parent decreases genetic risk in the offspring.
b. People who are germline mosaics do not show the symptoms of the disease.
c. In germline mosaicism mutation is present in the cells of sex differentiation line.
d. Somatic cells of person, who is germline mosaic, are not affected by mutation.

1. Choose the false sentence concerning coupling analysis:
a. In the two generation family the phase is usually unknown and calculations are made for two
phases.
b. In the three generation family phase can be determined, so the calculations are made only for
one phase.
c. In the two generation family the phase is always known.
d. For two families we always determine phases independently.

1. Choose the false sentence concerning sequencing of the next generation:
a. DNA of patients is prepared according to special protocol, which leads to creating so called
“libraries”.
b. In the process of sequencing we can observe migration of DNA strands in the gel following the
rules of electrophoresis.
c. Cluster is an aggregation of DNA strands arising in the process of bridge amplification (??) with
one molecule of DNA.
d. Many DNA molecules is sequenced at once.

1. Penetration of the disease on the 80% level means that in the group of 100 people having the
genotype causing the disease:
a. 20 people will show symptoms of the disease
b. 20 people will not present disease
c. 80 people will manifest fully blown disease, in 20 people disease symptoms are going to be
negligible
d. 20 people will manifest fully blown disease, in 80 people disease symptoms are going to be
negligible

1. Choose the correct sentence:
a. Crossing-over between loci on the same chromosome can lead to recombination.
b. Loci which are close on the same chromosome undergo recombination in less than 50% of
cases, which means that they are coupled.
c. The distance between loci can be expressed in centimorgans, where 1 cM corresponds with
frequency of recombination of about 1%.
d. All of above

1. Multifactorial disease occurs with frequency of 1/100 in males and 1/300 in females. You
are analyzing families in which the disease appears in one of the parents. In which case of
the following combinations parent-child there is the highest risk of reappearance of the
disease:
a. Father - son
b. Father - daughter
c. Mother - son
d. Mother – daughter

1. Choose the proper genotype definition:
a. Genotype is a mutation occurring in the investigating gene in the diseased patient
b. Genotype is the whole human genetic material
c. Genotype is unique system of alleles in particular locus/loci
d. Genotype is unique system of alleles on only one chromosome

1. Causes of genetically determined infertility:
a. Aberrations in sex chromosomes
b. Mutation of CFTR gene
c. Permutation of FMR1 gene ( fragile X syndrome)
d. All of above

1. Neurofibromatosis type I is characterized by conditional mode:
a. Autosomal recessive
b. Autosomal dominant
c. Recessive X linked
d. Mitochondrial

1. Phenotypic trait that are diagnostically important and increase the likelihood of
identification of genetically determined cause of autism spectrum disturbances
a. Macrocephaly
b. Dysmorphia in stature
c. Seizures/epilepsy
d. All of above

RANDOM 1
1. Which of the following is inherited in an autosomal recessive condition?
A. Achondroplasia
B. Phenylketonuria
C. Factor VIII deficiency (haemophilia A)
D. Neurofibromatosis
E. Spina bifida

2. A 36 year old woman has an only son whom haemophilia is diagnosed . Father is also affected.
Which of the following statements is correct?
A. The condition is X-linked dominant
B. All of her future daughters will be carriers
C. All of her sons will be carriers
D. Her son’s sons will be at 50% risk of haemophilia
E. Fetal diagnosis of haemophilia for future pregnancy by DNA analysis is most used

3. A man and a woman have short stature, prominent forehead, shallow nasal bridge, short limbs
and other skeletal changes. Both have been told that they have achondroplasia (100800), and wish
to know their recurrence risk for affected children. Match the recurrence risks for the child of
achondroplastic parents to be affected (heterozygous and homozygous)
A. 100%
B. 75%
C. 50%
D. 25”
E. Virtually 0

4. Following the birth of an affected child, the probability for the second child of the achondroplastic
parents to be affected
A. 100%
B. 75%
C. 50%
D. 25%
E. Virtually 0

5. The cytogenic term “6q+” refers to
A. 46, XX, dup (6q)
B. Extra chromosome material derived from the long arm of chromosome 6
C. 46, XX, dup (6)
D. Extra chromosome material, origin unspecified, attached to the long arm of chromosome 6
E. 47, XX, +6

6. Mark true statement regarding family tree shown below

A. I-2 is dead
B. II-2 is a male
C. III-3 is affected
D. III-1 and III-3 are a consanguineous couple
E. II-3 has one boy

7. Mark false statement regarding family tree below

A. The condition is X-linked
B. II-5 is a non-penetrant gene carrier
C. There is a 50% risk that any offspring of II-3 will carry the faulty
D. The condition is likely to affect males and females equally
E. II1-1 and III-2 have 50% of their genes in common

8. Which of the following statements on birth defects is true
A. Occur in 3:1000 live births
B. In most children involve multiple organs
C. Are common in chromosomal abnormalities
D. Are almost all due to known single-gene defects
E. Always involve malformations
Questions 9-12:
For each clinical description given below, select the most closely associated kind of genetic disease
A. Chromosome abnormality
B. Multifactorial condition
C. X-linked disease
D. Autosomal recessive disease
E. Autosomal dominant disease

9. Due to a combination of genetic and non genetic influences ……………

10. A mendelian disorder characterized on the X chromosome………..

11. Occurs only when both genes in a pair are mutant and located on a chromosome other than X or
Y…………

12. The cause of most common diseases of adulthood such as coronary artery disease and
non-insulin-dependent diabetes………

13. Which of the following conditions have polygenic inheritance?
A. Galactosemia
B. Polydactyly
C. Meningomyelocele
D. Turner syndrome
E. Marfan syndrome

14. What proportion of early spontaneous abortions are chromosomal?
A. 1%
B. 5%
C. 10%
D. 25%
E. 50%

15. Anticipation is characteristic of conditions caused by
A. Microdeletions
B. Mitochondrial inheritance
C. Genomic imprinting
D. Trinucleotide repeat expansions
E. Germline mosaicism

RANDOM 2
1. Which would NOT be an effective way to diagnose sickle cell anemia?
A. PCR exon 1 of the beta-globin gene, followed by restriction digest with MstII
B. Hemoglobin electrophoresis
C. Restriction digest of genomic DNA with MstII, followed by southern blot, using a beta-globulin
gene product
D. Enzymatic assay for hemoglobin activity

2. A human male carrying an allele for a trait on the X chromosome is
A. Heterozygous
B. Homozygous
C. Hemizygous
D. Monozygous

3. Mark the sentence that is false for chromosome X inactivation
A. Inactivation occurs in somatic and germ line cells
B. Occurs early in embryonic life
C. Is random
D. Inactivate chromosome is present as a Barr body

4. Which of the following procedures is used as a routine technique for karyotyping using light
microscopy
A. C-banding
B. Fluorescence in situ hybridization
C. G-banding
D. Q-banding

5. If a person with blood type AB mates with someone with blood type 0, what are the possible blood
types of their offspring
A. AB, 0
B. A, B, 0
C. A, B
D. A, B, AB, 0

6. Haemolytic disease of newborn (HDN) is a result of
A. Rh factor conflict between Rh(-) mother and Rh(+) child
B. Rh factor conflict between Rh(+) mother and Rh(-) child
C. Being mother affected with sickle cell anemia
D. Being mother affected with malaria during pregnancy

7. For a given autosomal recessive disease, q=0,02 (where q is the allele frequency of the mutant
allele). Approximately what percentage of the population has two copies of the normal allele?
A. 19%
B. 1,9%
C. 96%
D. 98%

8. Mark the false sentence describing mitochondrial inheritance
A. Only affected females transmit the disease to offspring
B. Neuropathies and myopathies are the most common mitochondrial diseases
C. Mitochondrial DNA particles are circular single stranded
D. Different cells vary in number of mt DNA copies

9. Late paternal age can result in higher frequency of
A. Genomic imprinting
B. New mutations
C. Mitochondrial mutations
D. Chromosomal aberrations

10. Mark the disease which is NOT caused by expanded triplet repeats
A. Myotonic dystrophy
B. Duchenne muscular dystrophy
C. Huntington disease
D. Fragile X syndrome

11. Rett syndrome, lethal in hemizygous males, is an example of
A. Dominant x-linked inheritance
B. Recessive x-linked inheritance
C. Co-dominant inheritance
D. Mitochondrial inheritance

12. Mark the false sentence describing fragile X syndrome
A. Is one of the most common causes of mental retardation in males
B. The frequency is 1 in about 2000 male live births
C. Can be detected using banding techniques and molecular methods
D. Is dominant X-linked disease

13. Which of the following disorders, except Tay-Sachs disease, is also more common in Ashkenazi
Jews
A. Gaucher disease
B. Sickle cell anemia
C. Cystic fibrosis
D. Niemann-Pick disease

14. Which of the following is NOT a chromosomal aberration
A. Frame shift
B. Deletion
C. Translocation
D. Inversion

15. Which disorders are examples of uniparental disomy
A. Prader-Willi and Angelman syndrome
B. Duchenne and Becker muscular dystrophy
C. Alpha and beta thalassemia
D. Trisomy 21 and 22

16. The karyotype 46,XX del Xp can occur in females with
A. Testicular feminization syndrome
B. Turner syndrome
C. “Superwoman” syndrome
D. None of these

17. Which statement about down syndrome is false
A. The frequency increases is mothers over age 35
B. The cause is a nondisjunction
C. The only aberration is a simple trisomy of 21 pair
D. There are patients with translocation i.e. t(14;21)

18. Match the karyotypes with the probable phenotypes
1. Fragile X syndrome
2. 45, XX
3. Unbalanced translocation carrier

a. Neonatal death
b. Reduced fertility
c. Mental retardation

A. 1a, 2c, 3b
B. 1c, 2a, 3b
C. 1a, 2b, 3c
D. 1b, 2a, 3c

19. The acrocentric chromosomes are
A. 21, 22, and Y
B. 13, 14 and 15
C. 13, 14, 15, 21 and 22
D. X and Y

20. Karyotyping in prenatal diagnosis is important in cases of
A. Pregnancy of females who had miscarriages
B. Pregnant females that already have 1 child with congenital defects
C. Pregnant females after age 36
D. All above

21. The banding techniques are used for detection of
A. All structural aberrations
B. Number and big structural aberrations
C. Microdeletions
D. Aneuploidies

22. FISH as a technique for mutation diagnosis in human genetics is essential for detection of:
A. Angelman syndrome
B. Turner syndrome
C. XYY males
D. Cri du chat syndrome

23. CML is caused by translocation between abl and bcr genes which determines male karyotype:
A. 46, XY, t(9;21)
B. 46, XY, t(9;22)
C. 46, XY, t(21;22)
D. 46, XY, t(11;22)

24. Many different mutations within CFTR gene cause
A. Galactosemia
B. Tay-Sachs disease
C. Cystic fibrosis
D. Albinism

25. Fluorescently labelled molecular probes are used in
A. PCR
B. FISH
C. AFLP
D. SSCP

26. PCR-RFLP can be useful in
A. Related species identification
B. Point mutation detection
C. Population studies
D. All answers are correct

27. VNTR sequences are mostly used in
A. Point mutations determination
B. Detection of pathogens
C. Forensic medicine
D. Chromosome aberration study

28. The frequency of phenylketonuria is 1 per 7000 (in Europe). What is the frequency of carriers?
A. 1,195%
B. 0,988%
C. 2,361%
D. 1,180%

29. All of the following karyotypes are found in spontaneous abortuses. Which of the following is
least likely to be found in a live-born infant?
A. 45, X
B. 47, XX, + 21
C. 47, XX, + 16
D. 47, XY, +18

30. Which of the following syndromes is associated with maternal disomy of chromosome 15?
A. Prader Willi syndrome
B. Angelman syndrome
C. Klinefelter's syndrome
D. Rett syndrome

31. Fragile X syndrome is associated with
A. Chromosome 16 abnormalities
B. A chromosomal deletion at Xq28
C. Expansion of CAG triplet repeat
D. Expansion of CGG triplet repeat

32. A nineteen year old female with short stature, wide spaced nipples, and primary amenorrhea
most likely has the karyotype of
A. 47, XXX
B. 47, XXY
C. 45, X
D. 47, XX, + 18

33. The majority of cases of Down syndrome occur as a result of
A. Nondisjunction during paternal meiosis
B. End to end fusion of two chromosomes 21
C. Nondisjunction during maternal meiosis
D. Mosaicism of normal and trisomic cell lines

34. A person with two or more different cell lines originating from a single zygote is called a
A. Hemizygote
B. Chimaera
C. Mosaic
D. Carrier

35. Technique useful for person identification is
A. DNA fingerprint analysis
B. Northern blot
C. SSCP
D. RFLP analysis

36. Nucleic acid amplification is performed in vitro by:
A. PCR and southern
B. Southern and northern
C. PCR and RT-PCR
D. RT-PCR and northern

37. It is not possible to detect frameshift mutation by
A. PCR and RT-PCR
B. Western (immunological) techniques
C. Southern techniques
D. Northern techniques

38. Molecular techniques are useful for
A. Point mutation detection
B. gene(s) expression analysis
C. Parasites detection and determination
D. All above

39. For eukaryotic gene(s) expression in Escherichia coli it is obligatory to use
A. cDNA and expression vector
B. Genomic DNA and expression vector
C. cDNA and YAC vector
D. Genomic DNA and YAC vector

40. Molecular assay for paternity determination can involve
A. Mitochondrial DNA polymorphism analysis
B. Ribosomal DNA polymorphism analysis
C. Microsatellite DNA polymorphism analysis
D. Promoter polymorphism analysis

41. What kind of inheritance is the pedigree showing

A. Mitochondrial
B. X-linked recessive
C. Autosomal dominant
D. X-linked dominant

42. The pedigree pattern is an example of

A. Autosomal dominant inheritance
B. Autosomal recessive inheritance
C. X-linked recessive inheritance
D. X-linked dominant inheritance

MCQ’s FROM BOOK

Select the best single answer to the following questions:

1. A term female infant to a 37-year-old mother with three prior children has a low birth weight and
a poor latch for breast-feeding the first 24 hours of life. Mother had first trimester maternal serum
screening (quad screen) that was normal. Your assessment of the baby reveals an unusual facial
appearance with a broad nose and extra skin folds on the neck. Based on the history, which of the
following is the most likely reason for poor breast-feeding in this child:
A. Maternal incompetence
B. Autosomal dominant disorder in mother
C. X-linked recessive disorder in child
D. Chromosomal disorder in child
E. Multifactorial disorder in child

2. Prior to receiving test results, the most important aspect of care along with evaluating the
feeding problem is:
A. Genetic counseling regarding recurrence risk
B. Genetic counseling regarding prenatal diagnosis
C. Supportive counseling for future mental retardation
D. Supportive counseling for probable birth defects
E. Supportive counseling explaining the management plan

3. A female infant demonstrates inconsistent bottle feeding and exaggerated jaundice with a total
bilirubin of 14 at day 2 of life. Your assessment reveals the infant is less responsive than early on
your shift, and you note decreased muscle tone with a poor suck. The prenatal history is normal
except that the mother and father are from Pakistan and are second cousins. Which of the following
conditions would be most likely in this infant?
A. Chromosome disorder
B. Biliary atresia
C. Inborn error of metabolism
D. Lactose intolerance
E. Multifactorial disorder

4. As the infant is being evaluated, a grandparent brings documentation from Pakistan showing a
prior child of this couple died with a diagnosis of maple syrup urine disease. Which of the following
would resources would provide information on the inheritance of this disorder?
A. Online Mendelian Inheritance in Man
B. Gene Tests
C. Alliance of Genetic Support Groups
D. ISONG
E. ACOG

5. A 21-year-old female was referred to obstetric clinic from the emergency room after a diagnosis
of malnutrition and a positive pregnancy test. She had been brought in by the police for vagrancy
and alcoholism, exhibiting poor hygiene and nutrition on examination. She also was affected with
cystic fibrosis, having a milder disease course, and a sister had a child with spina bifida. Fetal
ultrasound revealed a fetus of about 3 months gestation with very small head circumference,
abnormal head shape, and intrauterine growth retardation. The poor malnutrition and unplanned
pregnancy caused the young woman to miss the following standards of care:
A. Amniocentesis because of higher risks for chromosome abnormalities and cystic fibrosis
B. Triple/Quad screening with ultrasound to screen for fetal chromosome abnormalities
C. Preconception counsel including provision of vitamins with folic acid
D. Prosecution because of suspected alcoholism causing damage to the fetus
E. Preimplantation genetic diagnosis of to avoid the high risk for fetal cystic fibrosis

6. Which of the following birth defects would be most likely to occur in this situation?
A. Congenital heart defect
B. Omphalocele
C. Anencephaly
D. Tracheo-esophageal fistula
E. Anal atresia

7. A Caucasian couple in the 20s comes in for preconception counseling regarding their first
pregnancy. They have had no prior miscarriages or infertility and their family histories are normal.
This lack of risk factors means that their risk for fetal abnormalities in this pregnancy is
approximately:
A. 50%
B. 25%
C. 10%
D. 2-3%
E. <1%

8. Which of the following genetic screening tests should be considered for this couple?
A. Alpha-thalassemia
B. Beta-thalassemia
C. Tay-Sachs disease
D. Sickle cell anemia
E. Cystic fibrosis

9. A couple present to an obstetric nurse for counseling because they have had three early
miscarriages at 6-8 weeks gestation. Both are in good health without chronic illnesses, and neither
has any family history of birth defects or miscarriages. Which of the following is an important
contributor to miscarriages that can be tested in this couple?
A. Autosomal dominant disorders
B. Chromosomal disorders
C. Multifactorial disorders
D. Mitochondrial disorders
E. X-linked recessive disorders

10. Which of the following results is most plausible for this couple, along with its likelihood given
their history?
A. Trisomy,1%
B. Trisomy,10%
C. Translocation,2-3%
D. D. Translocation 20-30%
E. E. Turner syndrome,10%

11. A woman is diagnosed with Crohn’s disease, and wishes to know the risk that her daughter will
develop the disease. She is otherwise normal with an unremarkable family history. The likely
inheritance mechanism and her daughter’s risk would be:
A. Autosomal dominant with a 50% risk
B. Autosomal recessive with a 25% risk
C. X-linked recessive with a 25% risk
D. Chromosomal with a 10-15% risk
E. Multifactorial determination with a 5-7% risk

12. A 24-year-old Ashkenazi Jewish woman develops bilateral breast cancer. Her mother and
grandmother died of ovarian cancer, and a maternal aunt also had early onset breast cancer. She has
two daughters aged 12 and 16. The most probable mechanism and risk to her daughters would be:
A. Multifactorial determination with a 1-2% risk
B. Autosomal dominant with a 50% risk
C. Autosomal dominant with a 25% risk
D. X-linked dominant with a 50% risk
E. X-linked dominant with a 25% risk

13. (pectus), long fingers, flat feet, and increased joint laxity. His father died at age 35 with a heart
attack. He wants approval to play basketball. An important disease category and disorder to
consider would be:
A. Coronary artery disease and myocardial infarction
B. Coronary artery disease and congestive heart failure
C. Connective tissue disease and aortic dilatation
D. Connective tissue disease and myocardial infarction
E. Connective tissue disease and aortic coarctation

14. A 30-year-old man has hypertension controlled by diet and medication, and one of his three
siblings is affected. His father died of kidney failure, and one of the man’s three sons had urinary
tract infections with cystic kidneys on ultrasound. The most likely diagnosis is:
A. Multifactorial predisposition to renal failure
B. Isolated congenital anomaly of the urinary tract
C. Autosomal dominant polycystic kidney disease
D. Autosomal recessive polycystic kidney disease
E. X-linked recessive polycystic kidney disease

15. At her first obstetric visit, a woman tells you she has a brother with mental retardation. She asks
what the risk for mental retardation will be for her current pregnancy. You reply:
A. Mental retardation is a complex phenotype that is rarely genetic.
B. Mental retardation fits into the polygenic category with a low recurrence risk.
C. It is imperative to establish a more specific diagnosis before counseling can be provided.
D. It is imperative to perform a karyotype on her brother before counseling can be provided.
E. The risk is significant but there is no prenatal diagnosis for mental retardation.

16. An individual with genotype Aa at a genetic locus will produce:
A. Only gametes with genotype Aa
B. Only gametes with genotype a
C. Only gametes with genotype aa
D. Half of gametes with genotype A and half with genotype a
E. Only gametes with genotype AA

17. If allele B causes disease and allele b is associated with a normal phenotype, what is the chance
that a baby born to a Bb mother will have the disease? Assume that the father has a bb genotype
and that there is no variable expressivity.
A. 100%
B. 75%
C. 50%
D. 25%
E. Less than 1%

18. The allele for normal hemoglobin is represented as A, and that for sickle hemoglobin as S. A man
with sickle cell trait (genotype AS) marries a woman who is also sickle trait. What are their chances
to have a child with sickle cell anemia (genotype SS)?
A. 100%
B. 75%
C. 50%
D. 25%
E. Less than 1%

Match the following questions with one or more correct answers:

A man learns that he has an abnormal allele Z for a particular type of liver disease that is extremely
rare in the general population. If his genotype is Zz, what are the chances for the following relatives
to have the Z allele? Assume that no mutations have occurred.
A. 3/4
B. 1⁄2 5
C. 1⁄4 7
D. ⅛ 6
E. 1/16

2-5. His son: B
2-6. His first cousin: D
2-7 his grandson: C

3.1. An affected male infant born to normal parents could be an example of all the following
disorders except:
A. an autosomal dominant disorder
B. an autosomal recessive disorder
C. a polygenic disorder
D. a vertically transmitted disorder
E. an X-linked recessive disorder

4.1.A father has a child with a cleft palate and learns that his mother had a heart defect. He has two
normal children. What is the risk for his next child to be have cleft palate?
A. 35-50%
B. 6-8%
C. 3-5%
D. 0.7%
E. 0.2%

4.2. A father with unilateral cleft lip/palate has a son with unilateral cleft lip/palate. His risk for the
next child to be affected with unilateral cleft lip/palate is
A. 38-40%
B. 10-12%
C. 6-10%
D. 3-4%
E. 0.1%

4.3. Males are five-fold more likely than females to have pyloric stenosis. Using this knowledge and
figures in Table 4.1, what would be the recurrence risk for offspring of a father affected with pyloric
stenosis
A. 55-60%
B. > 7.5%
C. 7.5%
D. < 7.5%
E. 0.4%

4.4. A mother with history of pyloric stenosis has which of the following risks that her newborn son
will develop pyloric stenosis.
A. 20.5%
B. 13.2%
C. 11.1%
D. 6.8%
E. 2.5%

4.5. A 46-year-old man hears that his identical twin, separated at birth, died of coronary artery
disease in the past year. What is his risk to develop the disorder?
a. Higher than 39-44%
b. 39-44%
c. Lower than 39-44%, but higher than 30%
d. 14-25%
e. Lower than 14-15%

4.6-4.9 Many of the more common birth defects like cleft palate or congenital heart disease exhibit
multifactorial determination. Although specific empiric risks can be specified as in Tables 4.2 and
4.3, general risks can be borne in mind relative to an affected person: identical twin, 20-30%;
first-degree relative, 3-4%; two first-degree relatives, 5-8%; three first-degree relatives, 9-12%;
second-degree relatives, 0.7-2 %, third-degree relatives and general population, less than 0.5%. By
reference to the person with a birth defect, match the relatives below with their proportion of genes
in common and their concordance or recurrence risk:
A. 100% genes in common, 20-30% concordance risk
B. 50% genes in common, 3-4% concordance risk
C. 50% genes in common, 3-4% recurrence risk
D. 25% genes in common, 2% recurrence risk
E. 12.5% genes in common, <0.5% recurrence risk

4.6. Twin brother whose twin sister has cleft palate by ultrasound: B
4.7. Unborn sibling of a child with congenital heart defect: C
4.8. Grandchild of a person with spina bifida: D
4.10 A man learns that his fraternal twin has developed type I diabetes mellitus at age 17. He has
HLA testing and finds that his DR haplotypes are different from his twin’s, and that he does not have
the DR3 or DR4 allele. His risk to develop type I diabetes is
A. 90%
B. 30-50%
C. 10-15%
D. 4-6%
E. < 4-6%

5.1E 5.2E 5.3C 5.4E 5.5E 5.6B 5.7C 5.8C

5.1 A woman has a brother with sickle cell anemia. She marries an unrelated man with a normal
family history. Given a 1/16 frequency for the sickle globin allele, what is their risk to have an
affected child (equate 15/16 to 1)?
(A) ¼
(B) 1/6
(C) 1/8
(D) 1/24
(E) 1/48

5.2 A population has a 1/3000 frequency of individuals with cystic fibrosis. If all affected individuals
were sterilized, the frequency of those affected in the next generation would be
a) Reduced by 2/3
b) Reduced by 1/2
c) Reduced by 1/3
d) Reduced to O
e) Approximately the same

5.3 In a population in which random mating occurs, 50% of the people are heterozygotes for a
mutant allele. In the following generation, the frequency of heterozygotes will be:
a) 100%
b) 75%
c) 50%
d) 25%
e) 0%

5.4 Of the following assumptions that must be valid for a population to be in Hardy-Weinberg
equilibrium, which is the least likely to hold for modern Americans?
a) no positive or negative selection
b) no assortative mating
c) low rates of mutation
d) large populations to dilute the effect of genetic drift
e) no migrations to alter frequencies by gene flow

5.5-5.7 Match each of the ethnic groups listed below with the genetic disorder commonly associated
with it.
a) Cystic fibrosis
b) Alfa-thalassemia
c) Tay sachs disease
d) Alfa-1 antitrypsin deficiency
e) Glucose-6-phosphate dehydrogenase deficiency

5.5 african americans= E
5.6 chinese americans =B
5.7 jewish americans = C

A man loses a child because of failure to recover from anesthesia. A diagnosis of succinylcholine
apnea is made, and the man and his wife test positive as carriers for the A mutant allele (see Table
5.3). Later, the man remarries and has a second family. What are the risks that his new children will
be AA homozygotes?
a) 1/30
b) 1/60 6
c) 1/240
d) 1/480
e) 1/540

6.1 A hypothetical gene contains two exons that encode a protein of 100 amino acids. They are
separated by an intron of 100 bp beginning after the codon for amino acid 10. The gene’s messenger
RNA (mRNA) has 5’ and 3’ untranslated regions of 70
and 30 nucleotides, respectively. Match the characteristics of the gene with the appropriate
measures below.
(A) 500 bp 1
(B) 400 bp 2
(C) 300 bp
(D) 100 bp
(E) 70 bp

6.1. Size of nuclear RNA transcript minus added poly(A) tail = A
6.2. Size of cDNA made from mature mRNA= B

6.3 to 6.5. Recall that adult hemoglobin synthesis requires transcription factors that activate the -
and -globin genes, splicing to form mature mRNA, balanced globin protein synthesis, and
association of the globins with heme to form a functional hemoglobin molecule. Match the
phenotypes below with the process(es) affected by mutation:
a. Severe anemia with targeted cells indicative of imbalanced globin protein synthesis Mild
anemia with no cyanosis
b. Mild anemia with obvious cyanosis
c. Mild anemia with small, rounded red cells
d. Severe anemia with vascular blockage causing heart attacks and strokes

6.3. Deletion in the upstream promoter of the beta-globin gene = A
6.4 Deletion of a 3 bp codon in an alfa-globin gene = B
6.5 Frameshift mutation in the beta-globin gene= A

6.6 to 6.10. The various types of genetic anemias, like many other genetic disease categories, must
be diagnosed by particular laboratory studies. Match the following alterations of -globin gene
expression with the test that will be sufficiently abnormal to allow diagnosis.
(A). Point mutation upstream of the -globin gene causing mild thalassemia 9
(B). Deletion of the second translated region in the -globin gene (second) exon to cause severe
thalassemia 8
(C). RNA splice site mutation to cause severe thalassemia 10
(D). Amino acid substitution (charged to neutral) to produce an unstable -globin peptide 6
(E). Amino acid substitution (neutral to neutral) in the binding site for heme. 7

6.6. Analysis to detect altered mobility of beta-globin protein by electrophoresis = D
6.7. Analysis to detect decreased oxygen binding by red blood cells= E
6.8. Analysis to detect altered size of beta-globin protein = B
6.9. Analysis to detect altered DNA sequence of promoter regions = A
6.10. Analysis to detect altered size of beta-globin mRNA= C

6.11. Which characteristic best refers to single nucleotide substitutions in human DNA?
(A) They are rarely seen in introns
(B) They usually result in disease
(C) They may create a restriction fragment length polymorphism (RFLP)
(D) They may create a VNTR allele
(E) They may delete a codon

6.12. Which of the following methods could not be used to detect the point mutation in the -globin
gene that causes sickle cell anemia?
(A) Polymerase chain reaction (PCR) with allele-specific oligonucleotide (ASO) hybridization
(B) Southern blot analysis
(C) DNA sequencing
(D) Polymerase chain reaction (PCR) with restriction enzyme digestion
(E) Northern blot analysis

7.1. The cytogenetic term “6q+” refers to
(A) 46,XX,dup(6q)
(B) extra chromosome material derived from the long arm of chromosome 6
(C) 46,XX,dup(6p)
(D) extra chromosome material, origin unspecified, attached to the long arm of chromosome
6
(E) 47,XX,+6

7.2–7.4. Match each clinical situation below with the appropriate risk figure.
(A) 1/10,000
(B) 1/800
(C) 1/100
(D) 1/10
(E) 1

7.2. The risk for a newborn to have Down syndrome = 1/800
7.3. The theoretical risk for a 21/21 translocation carrier to have a child with Down syndrome= 1
7.4. The risk for parents of a trisomy 21 child to have a second offspring with a chromosomal
abnormality = 1/100

7.5–7.7. Match each of the genetic conditions below with the correct cytogenetic notation.
A. 47,XX,+21
B. 45,X
C. 47,XXX
D. 47,XY,+21
E. 45,XX,-21

7.5. Male with trisomy 21 (Down syndrome) = 47, XX, + 21 ; Male with trisomy 21 (Down Syndrome)
7.6. Female with monosomy X (Turner syndrome)=45, X ; Female with trisomy X (Turner Syndrome)
7.7. Female with monosomy 21= 45, XX, -21 ; Female with monosomy 21

8.1 The discovery of genetic diseases due to expanding triplet repeats validated the concept of:
A. Variable expression
B. New mutation
C. Genomic imprinting
D. Anticipation
E. Mitochondrial inheritance

8.2 A child has symptoms of neurofibromatosis-1 (NF-1; 162200), including café-au-lait spots and
neurofibromas, but they are confined to his right leg and inguinal region. The family history is
normal. This is most consistent with:
A. Mitochondrial disease
B. Triplet repeat disease
C. Gene expression influenced by parent of origin (imprinting effects)
D. Somatic mosaicism

8.3 In a large family, disease A occurs in offspring when their mother is affected, while disease B
occurs in offspring when their father is affected. This pattern is suggestive of:
A. Mitochondrial disease
B. Triplet repeat disease
C. Gene expression influenced by parent of origin (imprinting effects)
D. Somatic mosaicism

8.4 A DNA methylation analysis is performed on a gene region that is known to be imprinted in the
mouse. The finding of identical DNA methylation patterns on alleles from both homologous
chromosomes would occur in which tissue?
A. Male gametes
B. Heart tissue in adult females
C. Liver tissue in adult males
D. Male primordial germ cells
E. Female neural crest cells

8.5 Atypical inheritance mechanisms have been revealed by molecular genetic technology, including
all of the following except:
A. sporadic mutation
B. uniparental disomy and genomic imprinting
C. mitochondrial inheritance
D. trinucleotide repeat amplification
E. maternal inheritance

8.6 Normal grandparents have a grandson with the fragile X syndrome. Their daughter has had
learning differences in school, but is otherwise normal. The grandfather is most likely:
a) An affected male with incomplete penetrance
b) A transmitting male
c) A son of a fragile X carrier
d) Not the real father of his daughter
e) Mosaic in his germline tissue

8.7 to Match the following diseases with the genetic mechanisms indicated below:
A. Huntington chorea A - triplet repeat expansion during female meiosis
B. Prader-Willi syndrome
C. Angelman syndrome
D. Myotonic dystrophy 7 - triplet repeat expansion during male meiosis
E. Hypomelanosis of Ito

9.1. Monozygotic twins with connected placental circulations can develop a pattern of vascular
occlusions due to blood clots. A twin with a brain cyst, absent kidney, cleft palate, and absent digits
has:
A. a malformation syndrome
B. a deformation syndrome
C. a disruption syndrome
D. a dysplasia syndrome
E. anassociation

9.2. A child has a small head, minor anomalies of the face including a thin upper lip, growth delay,
and developmental disability. His mother becomes defensive when asked about her pregnancy. The
child is likely to have:
A. a chromosomal syndrome
B. a teratogenic syndrome
C. a Mendelian syndrome
D. a polygenic syndrome
E. Anassociation

9.3. A newborn has multiple blood vessel tumors (hemangiomas) over his trunk and legs, together
with a large head and body asymmetry. He has:
A. a malformation syndrome
C. a disruption syndrome
D. a dysplasia syndrome
E. anassociation

9.4. A child has congenital contractures (bent limbs) due to a large uterine fibroid that her mother
developed during pregnancy. The child has:
a. a malformation syndrome
b. a deformation syndrome
c. a disruption syndrome
d. a dysplasia syndrome
e. anassociation

9.5. Several patients are described with similar congenital anomalies including defects of the sacral
vertebrae, kidneys, anus, and trachea. The children do not have minor anomalies and their faces do
not resemble one another. The child most likely has:
a) a malformation sequence
b) a deformation syndrome
c) a disruption syndrome
d) a dysplasia syndrome
e) An association

9.6-9.7. A family requests genetic counseling because the father has widely spaced eyes, increased
facial hair and deafness. One of their three children also has deafness with similar facial features.
The mother is normal, but a paternal sister and the paternal grandfather are known to have
deafness and increased facial hair.

9.6. The most likely pattern of inheritance of this disorder is
a) Autosomal dominant
b) Autosomal recessive
c) X-linked dominant
d) X-linked recessive
e) None of the above

9.7 the recurrence risk for this couple is
a) 100%
b) 67%
c) 50%
d) 25%
e) Virtually 0

9.8-9.10. A man and woman have short stature, prominent forehead, shallow nasal bridge, short
limbs, and other skeletal changes. Both have been told that they have achondroplasia (100800), and
wish to know their recurrence risks for affected children. Match the recurrence risks with the
questions below.
(A) 100%
(B) 75% - 8* 9*
(C) 50% - 10*
(D) 25%
(E) Virtually 0

8* The probability for the first child of achondroplastic parents to be affected (heterozygous or
homozygous)
9*. Following the birth of an affected child, the probability for the second child of achondroplastic
parents to be affected
10* The probability for the first child to be affected if an achondroplast marries an unaffected
person

10. A 3-day-old infant is the fourth child of immigrant parents. She stops feeding, becomes
lethargic, and appears more noticeably jaundiced. In addition to cultures of blood, cerebrospinal
fluid, and urine, a blood pH of 7.1 is found. The electrolytes show a sodium of 135, potassium 4,
chloride 99, and bicarbonate 15 milliequivalents per liter. A family history reveals that the parents
are first cousins, and that prior child died in the nursery because of infection.

10.1. The blood pH and electrolyte values suggest:
A. Alkalosis with high bicarbonate
B. iÍncreased anion gap with acidosis
C. Increased anion gap with alkalosis
D. Acidosis with high bicarbonate
E. Alkalosis with low bicarbonate

10.2. The most important metabolic test in this setting is:
A. Blood glucose
B. Blood amino acids
C. Blood organic acids
D. Urine amino acids
E. Urine organic acids

10.3. Other initial metabolic tests to consider would be:
A. Blood glucose
B. Blood carnitine
C. Blood amino acids
D. Blood ammonia
E. All of the above

10.4. The disease category that best describes this child is:
a. Catastrophic disease of the newborn
b. Sudden infant death syndrome (SIDS)
c. Large molecule storage disease
d. Urea cycle disorder
e. Amino acid disorder

10.5. The finding most suggestive of metabolic disease is:
A. A prior child dying from infection
B. Abnormal blood pH
C. Increased amount of jaundice
D. Consanguinity in the parents
E. Absence of documented infection in the baby

10.6-10.10.
A 2-year-old child presents with lethargy and decreased appetite. On physical examination, she
appears dehydrated with an enlarged liver. Initial testing reveals a low blood glucose of 55
milligrams per deciliter, a pH of 7.3, and a slightly low bicarbonate of 15 milliequivalents per liter.
The prior childhood and family history are normal. A urine test was run and was negative.

10.6. The urine test is most likely:
A. Urine pH
B. Urine reducing substances
C. Urine organic acids
D. Urine glucose
E. Urine ketones

10.7. The negative ketone test is suggestive of the category of:
a. Amino acid disorders
b. Carbohydrate disorder
c. Nonketotic hypoglycemia
d. Nonketotic hyperglycinemia
e. Organic acidemias

10.8. The most likely diagnosis in this child is:
A. Organic acidemia
B. Fatty acid oxidation disorder
C. Urea cycle disorder
D. Amino acid disorder
E. Glycogen storage disease

10.9. Additional tests that should be considered are:
A. Urine organic acids, urine reducing substances
B. Blood amino acids, blood carnitine
C. Urine organic acids, blood carnitine and acylcarnitine profile
D. Blood ammonia, liver biopsy for enzyme assay
E. Blood amino acids, urine reducing substances

10.10. After the preliminary tests were completed, a specific mutation was demonstrated using the
polymerase chain reaction and allele-specific oligonucleotide hybridization. The most likely
diagnosis is:
A. Maple syrup urine disease
B. Galactosemia
C. Long chain hydroxyacyl-CoA dehydrogenase (LCHAD) deficiency
D. Short chain acyl-CoA dehydrogenase (SCAD) deficiency
E. Medium chain acyl-CoA dehydrogenase (MCAD) deficiency

2009 FINAL
Ps: i’m really confused about the order of the questions.

1) Mark the false sentence describing autosomal recessive inheritance
a. The pattern of pedigree is vertica;
b. If the disease is very rare- the parents are probably related
c. Males and Females are at equal risk for being affected
d. Carriers are not always healthy

2) Mark the disease doesn’t caused by expanded triplet repeats
a. Fragile X syndrome
b. Duchenne muscular dystrophy
c. Myotonic dystrophy
d. Huntington disease

3) Complete but age-dependent penetrance is characteristic for
a. Sickle cell disease
b. Myotonic dystrophy
c. Huntington disease
d. Achondroplasia

4) Which disorders are examples of uniparental disomy
a. Duchenne and Becker muscular dystrophy
b. Prader-Willi and Angelman syndrome
c. Alpha and beta thalassemia
d. Diabetes Type I and II

5) Mark the false sentence describing mitochondrial inheritance
a) Is called maternal inheritance because affected females transmit the disease to offspring
b) Neural and muscle cells are rich in mitochondria therefore neuropathies and myopathies are the
most common mitochondrial diseases
c) Mitochondrial DNA particles are circular
d) Sperm cells have mitochondria in tail and head

6) The karyotype 46, XY can occur in females with
a. Testicular feminization syndrome
b. Turner syndrome
c. Triple X syndrome
d. Triploidy

7) Rett syndrome, lethal in hemizygous males, is an example of
a. Dominant X-linked inheritance
b. Recessive X-linked inheritance
c. Co-dominant inheritance
d. Autosomal dominant inheritance

8) Duchenne muscular dystrophy-recessive X-linked disease can occur in female being a carrier
a. With a new mutation on second X chromosome
b. With Turner syndrome
c. Showing atypical lyonization
d. All answers are appropriate

9) Mark the false sentence describing Fragile X syndrome
a. Occurs both in males and females with identical frequency
b. Is the most common cause of mental retardation in males
c. Is recessive X-linked disease
d. Can be detected using banding techniques

10)...

b. recessive X-linked inheritance
c. Co-dominant inheritance
d. Autosomal dominant inheritance

11) Duchenne muscular dystrophy-recessive X-linked disease can occur in female being a carrier
e. With a new mutation on second X chromosome
f. With Turner syndrome
g. Showing atypical lyonization
h. All answers are appropriate

e. Testicular feminization syndrome
f. Turner syndrome
g. Triple X syndrome
h. Triploidy

13) Mark the karyotype of a mosaic male half normal and half Philadelphia
a. 46,XY / 46,XY, t(9;21)
b. 46,XY / 46,XY t(9;22)
c. 46,XY / 47,XY t(9;22)
d. 46,XY / 46,XY t(14;21)

14) Which statement (s) are correct
1. G and Q banding are novel techniques which are likely to replace traditional FISH
2. G banding is performed with Giemsa dye
3. Chromosome painting allows differential visualization of all human chromosomes
4. FISH technique can be used only in metaphase stage
a. 1 and 2
b. 2, 3 and 4
c. 1 and 4
d. 2 and 3

15) The fact that known chromosomal autosomal aneuploidies in the live newborns are limited to
crisomies of chromosomes 21, 13 or 18 is related to
1. Resistance to other human chromosomes to meiotic nondisjunction
2. Embryonic lethality of all the other autosomal aneuploidies in human
3. Unavailability of methods allowing a large scale study of the prevalence of other aneuploidies
4. Occurrence of multiple fragile sites on chromosomes 21, 13, or 18
a. 1 and 4
b. 3 only
c. 2 only
d. All

12) The acrocentric chromosomes are
a. 20, 21 and 22
b. 13, 14 and 15
c. 1, 2 and 3
d. X and Y

13) mark the false statement for chromosome X inactivation
a. Inactivation occurs in somatic and germ line cells
b. Occur in early embryonic life
c. Is random
d. Inactive chromosome is present as a Barr body

14) Different mutations within dystrophin gene cause
a. Galactosaemia
b. Cystic Fibrosis
c. Myotonic dystrophy

15) The karyotype can be performed from
a. Skin cells
b. Amniotic fluid
c. Blood cells
d. All answers are correct

16) Which statement about Patau syndrome is false
a. The frequency increases dramatically in mothers over the age of 35
b. The cause is a mitochondrial mutation
c. Affected individuals have an extra copy of 13 autosome
d. There are some cases of a robertsonian translocation

17) DNA denaturation in PCR method requires
a. Low temperature
b. F
c. F
d. F

1) Mark the false sentence describing X-linked recessive inheritance
a. The pattern of pedigree is like a knight’s move
b. The father never transmits the disorder to his sons
c. Males and females are at equal risk for being affected
d. Carriers are females

2) Variable expressivity is characteristic for
A. Turner syndrome
B. Duchenne muscular dystrophy
C. Skin albinism
D. Marfan syndrome

a. Males do not transmit mitochondrial disorders
b. Muscle cells are rich in mitochondria therefore myopathies are common mitochondrial disease
c. Mitochondrial DNA particles are linear
d. Sperm cells have only a few mitochondria

4) Mark the trait which is not an example of discontinuous multifactorial trait
a. Height
b. Schizophrenia
c. Cleft lip
d. Neural tube defect

b. Turner syndrome
d. Triploidy

6) Mark the karyotype of a mosaic male half normal and half cri du chat

1) Mark the false sentence describing autosomal recessive inheritance
e. The pattern of pedigree is vertica;
f. If the disease is very rare- the parents are probably related
g. Males and Females are at equal risk for being affected
h. Carriers are not always healthy

2) Mark the disease NOT caused by expanded triplet repeats
a) Colour blindness
b) Duchenne muscular dystrophy
c) Myotonic dystrophy
d) Phenylketonuria

3) Which disorders are examples of uniparental disomy?
a. Duchenne and Becker muscular dystrophy
b. Prader-Willi and Angelman syndrome
c. Alpha and beta thalassemia
d. Diabetes type I and II

a. Is called maternal inheritance because affected females transmit the disease to offspring
b. Neural and muscle cells are rich in mitochondria therefore neuropathies and myopathies are the
most common mitochondrial diseases
c. Mitochondrial DNA particles are circular
d. Sperm cells have mitochondria in tail and head

5) Mark the trait which is not an example of continuous multifactorial trait
a. Height
b. Skin colour
c. Cleft lip
d. Intelligence

6) Rett syndrome, lethal in hemizygous males, is an example of
a. Dominant X-linked inheritance
b. Is the most common cause of mental retardation in males
c. Is recessive X-linked disease
d. Can be detected using banding techniques

b. Turner syndrome
d. Triploidy

8) The fact that known chromosomal aneuploidies in live newborns are limited to trisomies of
chromosomes 21, 13, or 18 is related to
1. Resistance to other human chromosomes to meiotic nondisjunction
2. Embryonic lethality of all the other autosomal aneuploidies in human
3. Unavailability of methods allowing a large scale study of the prevalence of other aneuploidies
4. Occurrence of multiple fragile sites on chromosomes 21, 13, or 18
a. 1 and 4
b. 3 only
c. 2 only
d. All

9) The acrocentric chromosomes are
a. 13,14,15,21 and 22
b. 9,10 and 11
c. 20,21, and 22
d. X and Y

10) 80% of achondroplasia cases are a result of
a. Genomic imprinting
b. New mutations
c. MItochondrial mutations
d. Pleiotropy

11) Increased number of triplets within FMR1 gene cause
a. Galactosemia
b. Fragile X syndrome
c. Alzheimer disease

12) Cytogenetics is a study of
a. Chromosomes and their abnormalities
b. ..
c. ..
d. ..

7) Becker muscular dystrophy - recessive X-linked disease can occur in a female being a carrier
a. With a new mutation on second X chromosome
b. With Turner syndrome
c. Showing atypical lyonization
d. All answers are appropriate

e. Testicular feminization syndrome
f. Turner syndrome
g. Triple X syndrome
h. Triploidy

9) ) Mark the karyotype of a mosaic male half normal and half Philadelphia
e. 46,XY / 46,XY, t(9;21)
f. 46,XY / 46,XY t(9;22)
g. 46,XY / 47,XY t(9;22)
h. 46,XY / 46,XY t(14;21)

10) Which statement (s) are correct
5. G and Q banding are novel techniques which are likely to replace traditional FISH
6. G banding is performed with Giemsa dye
7. Chromosome painting allows differential visualization of all human chromosomes
8. FISH technique can be used only in metaphase stage
e. 1 and 2
f. 2, 3 and 4
g. 1 and 4
h. 2 and 3

19) Sequence GCAATATTCCGGTAATAGCACT was cut by enzyme recognizing GCA. How many bands will
be seen in electrophoresis analysis
a. One band
b. Two bands
c. Three bands
d. Four bands

20) Join the disorder with the inheritance type
1. Myoclonic epilepsy a. Autosomal dominant
2. Hyperthermia of anesthesia b. Mitochondrial
3. Color blindness c. X-linked recessive

……………………………………………………………………………………………………………

21. In a certain population Gaucher disease occurrence is 1 per 10 000 humans. Calculate the frequency
of the carriers.

22. The pedigree shows …X LINKED RECESSIVE….. Inheritance

MCQ-2
1. Which would NOT be an effective way to diagnose sickle cell anemia
a) PCR exon 1 of the Beta-globin gene, followed by restriction digest with MstII
b) Hemoglobin electrophoresis
c) Restriction digest of genomic DNA with MstII, followed by Southern blot, using a Beta-globin
gene product
d) Enzymatic assay for hemoglobin activity

2. A human male carrying an allele for a trait on the X chromosome is :
a) Heterozygous
b) Homozygous
c) Hemizygous
d) Monozygous

3. Mark the sentence that is false for chromosome X-inactivation:
a) Inactivation occurs in somatic and germ line cells
b) Occurs in early embryonic life
c) Is random
d) Inactive chromosome is present as a Barr body

4. Which of the following procedures is used as a routine technique for karyotyping using light
microscopy?
a) C-banding
b) Fluorescence in situ hybridization (FISH)
c) G-banding
d) Q-banding

5. If a person with blood type AB mates with someone with blood type 0, what are the possible blood
types of theis offspring?
a) AB, 0
b) A,B,0
c) A,B
d) A,B,AB,0

6. Hemolytic Disease of Newborn (HDN) is a result of:
a) Rh factor conflict between Rh(-) mother and Rh(+)child
b) Rh factor conflict between Rh(+)mother and Rh(-) child
c) Being mother affected with sickle cell anemia
d) Being mother infected with malaria during pregnancy

7. For a given autosomal recessive disease, q=0.02 (where q is the allele frequency of the mutant
allele). Approximately what percentage of the population has two copies of the normal allele.
a) 19%
b) 1.9%
c) 96%
d) 98%

8. Mark the false sentence describing mitochondrial inheritance:
a) Only affected females transmit the disease to offspring
b) Neuropathies and myopathies are the most common mitochondrial diseases
c) Mitochondrial DNA particles are circular single stranded
d) Different cells vary in number of mt DNA copies

9. Late paternal age can result in higher frequency of:
a) Genomic imprinting
b) New mutations
c) Mitochondrial mutations
d) Chromosomal aberrations

10. Mark the disease which is not caused by expanded triplet repeats:
a) Myotonic dystrophy
b) Duchenne muscular dystrophy
c) Huntington disease
d) Fragile X syndrome

11. Rett syndrome, lethal in hemizygous males, is an example of:
a) Dominant X-linked inheritance
b) Recessive X-linked inheritance
c) Co-dominant inheritance
d) Mitochondrial inheritance

12. Mark the false sentence describing Fragile X syndrome:
a) Isone of the most common causes of mental retardation in males
b) The frequency is 1 in about 2000 male live births
c) Can be detected using banding technique and molecular methods
d) Is dominant X-linked disease

13. Which of the disorders, except Tay-Sachs disease, is also more common in Ashkenazi Jews:
a) Gaucher disease
b) Sickle cell anemia
c) Cystic fibrosis
d) Niemann-Pick disease

14. Which of the following is NOT a chromosomal aberration?
a) Frame shift
b) Deletion
c) Translocation
d) Inversion

15. Which disorders are examples of uniparental disomy:
a) Prader-Willi and Angelman syndrome
b) Duchenne and Becker muscular dystrophy
c) Alpha and beta thalassemia
d) Trisomy 21 and 22

16. The karyotype 46,XX del Xp can occur in females with:
a) Testicular feminization syndrome
b) Turner syndrome
c) “Superwoman” syndrome
d) None of these

17. Which statement about Down Syndrome is false?
a) The frequency increases in mothers over the age of 35
b) The cause is nondisjunction
c) The only aberration is a simple trisomy of 21 pair
d) There are patients with translocation i.e t(14;21)

18. Match the karyotypes with the probable phenotypes
1. Fragile X syndrome a.neonatal death
2. 45,XX b. Reduced fertility
3. Unbalanced translocations carrier c. mental retardation

a) 1a, 2c, 3b
b) 1c, 2a, 3b
c) 1a, 2b, 3c
d) 1b, 2a, 3c

19. The acrocentric chromosomes are:
a) 21, 22 and Y
b) 13,14 and 15
c) 13,14,15,21 and 22
d) X and Y

20. Karyotyping in prenatal diagnosis is important in cases of:
a) Pregnancy of females who had miscarriages
b) Pregnant females that already have 1 child with congenital defects
c) c) pregnant females after 36
d) All above

21. The banding techniques are used for detection of:
a) All structural aberrations
b) Number and big structural aberrations
c) Microdeletions
d) Aneuploidies

22. FISH as a technique for mutation diagnosis in human genetics is essential for detection of:
a) Angelman syndrome
b) Turner syndrome
c) XYY males
d) Cri du chat syndrome

23. Chronic Myeloid Leukemia is caused by translocation between ABL and BCR genes which
determines male karyotype:
a) 46,XY, t(9;21)
b) 46,XY, t(9;22)
c) 46,XY, t(21;22)
d) 46,XY, t(11;22)

24. Many different mutations within CFTR gene cause:
a) Galactosemia
b) Tay - Sachs disease
c) Cystic fibrosis
d) albinism

25. Fluorescently labelled molecular probes are used in:
a) PCR
b) FISH
c) AFLP
d) SSCP

26. PCR-RFLP can be useful in:
a) Related species identification
b) Point mutation detection
c) Population studies

27. VNTR sequences are mostly used in:
a) Point mutations determination
b) Detection of pathogens
c) Forensic medicine
d) Chromosome aberration study

28. The frequency of phenylketonuria is 1 per 7000 (in Europe). What is the frequency of carriers?
a) 1.195%
b) 0.988%
c) 2.361%
d) 1.180%

29. All of the following karyotypes are found in spontaneous abortuses. Which of the following is
least likely to be found in a live-born infant?
a) 45,X
b) 47,XX, +21
c) 47,XX, +16
d) 47,XY, +18

30. Which of the following syndromes is associated with maternal disomy for chromosome 15?
a) Prader Willi syndrome
b) Angelman syndrome
c) Klinefelter´s syndrome
d) Rett Syndrome

31. Fragile-X syndrome is associated with:
a) Chromosome 16 abnormalities
b) A chromosomal deletion at Xq28
c) Expansion of a CAG triplet repeat
d) Expansion of a CGG triplet repeat

32. A nineteen year old female with short stature, wide spaced nipples, and primary amenorrhea
most likely has the karyotype of:
a) 47,XXX
b) 47,XXY
c) 45,X
d) 47,XX, +18

33. The majority of cases of Down syndrome occur as a result of:
a) Nondisjunction during paternal meiosis
b) End to end fusion of two chromosomes 21
c) Nondisjunction during maternal meiosis
d) Mosaicism of normal and trisomic cell lines

34. A person with two or more different cell lines originating from a single zygote is called a:
a) Hemizygote
b) Chimaera
c) Mosaic
d) Carrier

35. Technique useful for person identification is:
a) DNA fingerprint analysis
b) Northern blot
c) SSCP analysis
d) RFLP assay

36. Nucleic acid amplification is performed in vitro by:
a) PCR and Southern
b) Southern and Northern
c) PCR and RT-PCR
d) RT-PCR and Northern

37. It is NOT possible to detect frameshift mutation by:
a) PCR and RT-PCR
b) Western (immunological) techniques
c) Southern techniques
d) Northern techniques

38. Molecular techniques are useful for:
a) Point mutations detection
b) gene(s) expression analysis
c) Parasites detection and determination
d) All mentioned above

39. For eukaryotic gene(s) expression in Escherichia coli it is obligatory to use:
a) cDNA and expression vector
b) Genomic DNA and expression vector
c) cDNA and YAC vector
d) Genomic DNA and YAC vector

40. Molecular assay for paternity determination can involve :
a) Mitochondrial DNA polymorphism analysis
b) Ribosomal DNA polymorphism analysis
c) Microsatellite DNA polymorphism analysis
d) Promoter polymorphism analysis

41. What kind of inheritance is the pedigree showing?

a) Mitochondrial
b) X-linked recessive
c) Autosomal dominant
d) X-linked dominant

42. The pedigree pattern is an example of:

a) Autosomal dominant inheritence
b) Autosomal recessive inheritance
c) X-linked recessive inheritance
d) X-linked dominant inheritance

MUSCULAR DYSTROPHY QUIZ - during seminars.

1. What is muscular dystrophy?
a) Diseases that destroy the bodies muscles
b) Disease that makes muscles unproportional
c) Being born with a too much or too little muscles
d) Disease that makes muscles not grow

2. Most patients with Duchenne muscular dystrophy exhibit clinical signs of muscle weakness
between:
a) 0-2 years
b) 2-5 years
c) 5-7 years
d) 7-9 years

3. The pattern of weakness that predominates in the early stages of Duchenne muscular dystrophy
is:
a) Proximal muscles and lower extremities
b) Distal muscles and upper extremities
c) Proximal muscles and upper extremities
d) Distal muscles and lower extremities

4. All of the following tests are helpful in diagnosing Duchenne muscular dystrophy except:
a) Pelvic X-ray
b) Electromyography
c) Serum levels of muscle enzymes
d) Muscle biopsy

5. Duchenne muscular dystrophy is associated with a defect on chromosome
a) 1
b) 5
c) 21
d) X-chromosome

6. All of the following regarding Becker muscular dystrophy are correct except
a) Dystrophin is not produced at all
b) Occurs due to deletions in dystrophin gene
c) It is less severe than Duchenne muscular dystrophy
d) Some functional dystrophin is produced
e) Age of onset is 8-25 years

7. The couple has son with Becker muscular dystrophy. Genetic test have shown that mother is a
carrier of dystrophin mutation, however she does not exhibits any abnormalities in clinical
examination . What is the probability that the next child of this couple will suffer from Becker
muscular dystrophy.
a) Each son has 50% chance of being affected, each daughters has a 50% chance of being a carrier
b) each child, regardless of its sex, has 50% chance of being affected
c) each child, regardless of its sex, has 25% chance of being affected
d) because the couple already has the affected son, their next child will be unaffected.

8. What role does dystrophin play in the muscle cell?
a) Dystrophin works to increase the ability of actin and myosin to bind together
b) Dystrophin is a transport protein that helps control the intracellular environment of the
myocyte
c) Dystrophin works to link the cytoskeleton with the extracellular matrix

SPECIAL QUESTIONS
Questions 1-3
1. A term female infant to a 37-year-old mother with three prior children has a low birth weight
and a poor latch for breastfeeding the first 24 hours of life. Mother had first trimester maternal
serum screening (quad screen) that was normal. Your assessment of the baby reveals an unusual
facial appearance with a broad nose and extra skin folds on the neck. Based on the history, which of
the following is the most likely reason for poor breastfeeding in this child:
A. Maternal incompetence
B. Autosomal dominant disorder in mother
C. X-linked recessive disorder in child
D. Chromosomal disorder in child
E. Multifactorial disorder in child
2. Which of the following is an important test to consider for this infant along with the expected
time to receive results?
A. Routine blood karyotype, 2-4 hours
B. Routine blood karyotype, 2-4 days
C. DNA chip for Mendelian disorders, 2-3 days
D. DNA chip for Mendelian disorders, 2-3 weeks
E. Neonatal blood spot, 2-4 hours
F. Neonatal blood spot, 7-10 days

3. Prior to receiving test results, the most important aspect of care along with evaluating the
feeding problem is:
A. Genetic counseling regarding recurrence risk
B. Genetic counseling regarding prenatal diagnosis
C. Supportive counseling for future mental retardation
D. Supportive counseling for probable birth defects
E. Supportive counseling explaining the management plan
Questions 4-5
A 21-year-old female was referred to obstetric clinic from the emergency room after a diagnosis

of malnutrition and a positive pregnancy test. She had been brought in by the police for vagrancy
and alcoholism, exhibiting poor hygiene and nutrition on examination. She also was affected with
cystic fibrosis, having a milder disease course, and a sister had a child with spina bifida. Fetal
ultrasound revealed a fetus of about 3 months gestation with very small head circumference,
abnormal head shape, and intrauterine growth retardation.

4. The poor nutrition and unplanned pregnancy caused the young woman to miss the following
standards of care:
A. Amniocentesis because of higher risks for chromosome abnormalities and cystic fibrosis
B. Triple/Quad screening with ultrasound to screen for fetal chromosome abnormalities
C. Preconception counsel including provision of vitamins with folic acid
D. Prosecution because of suspected alcoholism causing damage to the fetus
E. Preimplantation genetic diagnosis of to avoid the high risk for fetal cystic fibrosis

5. Which of the following birth defects would be most likely to occur in this situation?
A. Congenital heart defect
B. Omphalocele
C. Anencephaly
D. Tracheoesophageal fistula
E. Anal atresia

6. A Caucasian couple in the 20s comes in for preconception counseling regarding their first
pregnancy. They have had no prior miscarriages or infertility and their family histories are normal.
This lack of risk factors means that their risk for fetal abnormalities in this pregnancy is
approximately:
A. 50%
B. 25%
C. 10%
D. 2-3%
E. <1%

7. Which of the following genetic screening tests should be considered for this couple?
A. Alpha-thalassemia
B. Beta-thalassemia
C. Tay-Sachs disease
D. Sickle cell anemia
E. Cystic fibrosis
Questions 8-9
8. A couple present to an obstetric nurse for counseling because they have had three early
miscarriages at 6-8 weeks gestation. Both are in good health without chronic illnesses, and neither
has any family history of birth defects or miscarriages. Which of the following is an important
contributor to miscarriages that can be tested in this couple?
A. Autosomal dominant disorders
B. Chromosomal disorders
C. Multifactorial disorders
D. Mitochondrial disorders
E. X-linked recessive disorders

9. Which of the following results is most plausible for this couple, along with its likelihood given

their history?

A. Trisomy, 1%
B. Trisomy, 10%
C. Translocation, 2-3%
D. Translocation 20-30%
E. Turner syndrome, 10%

10. A pregnant couple had a prior child with multiple birth defects who died at another hospital.

During the history, the parents describe some of the laboratory results that were obtained. Which
of the following descriptions is most accurate?
A. A normal karyotype was obtained, ruling out a chromosome disorder.
B. Blood was frozen so that a chromosome study could be performed.
C. Blood was obtained on us (the parents), ruling out a problem in our child
D. Our son had a normal karyotype, so he cannot carry the gene for cystic fibrosis like our daughter
does.
E. Blood was obtained for chromosome studies, so you should be able to determine our blood
types.

11. A couple who both have Aa genotypes at a locus will produce fertilized eggs in which of the
following ratios?:
A. 1AA : 1 Aa : 1 aa
B. 1AA : 1 Aa : 1 aa
C. 1AA : 2 Aa : 1 aa
D. 1AA : 2 Aa : 2 aa
E. 1AA : 3 Aa

12. A couple requests counseling to determine the recurrence risk for albinism (203100). Their
first son is affected, consistent with the presence of two abnormal alleles (genotype aa). No other
family members are affected. The mother and father are first cousins and the grandfathers are
brothers. The mother has four older sisters and the father is an only child. The couple’s recurrence
risk for their next child to have albinism is:
A. 100%
B. 75%
C. 50%
D. 25%
E. Less than 1%

13. A man is affected with polydactyly, an autosomal dominant trait that produces an extra
finger on the ulnar (little finger) side. What is the risk that the man’s first two children will have
polydactyly?
(A) 100%
(B) 75%
(C) 50%
(D) 25%
(E) Virtually 0

14. All the following statements regarding autosomal dominant conditions are true except that:
A. they produce a vertical pattern in pedigree
B. they affect both sexes
C. they transmit through both sexes
D. they often exhibit variable expressivity
E. their expression requires the presence of two abnormal alleles at a locus

15-18. Match the descriptions below with the appropriate method of DNA analysis.
(A) Southern blot detecting globin gene deletion
(B) Southern blot detecting amplified DNA fragment
(C) Polymerase chain reaction followed by hybridization to oligonucleotide probes
(D) Hemoglobin electrophoresis
(E) Northern blot demonstrating increased RNA transcription

15. Diagnosis of thalassemia A

16. Diagnosis of mutant alleles C
17. Diagnosis of diseases with unstable triplet repeats like fragile X syndrome or Huntington
chorea B
18. Diagnosis of altered protein D

19-20. Match the following descriptions with the terms below:

(A) A recombinant DNA molecule that contains a DNA sequence of interest
(B) A DNA molecule into which the DNA sequence of interest is cloned
(C) Radioactive or fluorescent labeled DNA or RNA fragment used for hybridization
(D) A DNA sequence that enhances RNA transcription
(E) Oligonucleotide designed to catalyze DNA amplification in sequencing or polymerase chain
reactions
19. Probe
20. Primer

21. A couple is referred to the physician because the first three pregnancies have ended in
spontaneous abortion. Chromosomal analysis reveals that the wife has two cell lines in her blood,
one with a missing X chromosome (45,X) and the other normal (46,XX). Her chromosomal
constitution can be described as
(A) chimeric
(B) monoploid
(C) trisomic
(D) mosaic
(E) euploid
Questions 22-23
22. A couple in their 20s present to an obstetric nurse for counseling because they had an early
miscarriage where studies showed disorganized fetal tissue and a karyotype of trisomy 16. Both are
in good health without chronic illnesses, and neither has any family history of birth defects or
miscarriages. What would be an important recommendation for their next pregnancy?
A. Parental chromosomes
B. First trimester quad screen
C. Chorionic villus sampling
D. Planned pregnancy and routine care
E. Preimplantation genetic diagnosis

23. Given appropriate testing, what is the risk for chromosome aberrations in the next pregnancy

to this couple?
A. 100%
B. 50%
C. 25%
D. 20-30%
E. <1%

24. A child with severe kidney failure has what chance that his or her sibling will have identical
haplotypes at the HLA C locus?
A. 100%
B. 75%
C. 50%
D. 25%
E. virtually 0%
25. Which of the following parent-offspring units would be at highest risk for Rh disease?
A. mother C+, father D+, baby D+, first pregnancy
B. mother E+, father D+, baby E+, second pregnancy
C. mother D+, father CD+, baby CD+, second pregnancy
D. mother DC+, father D+, baby CD+, second pregnancy
E. mother CE+, father D+, baby CDE+, second pregnancy

26. A physician wishing to prevent ABO incompatibility from occurring in his type O daughter’s
pregnancies should recommend:
A. Denial of type A or type B suitors
B. Administration of blocking antibodies to A antigen if she has a pregnancy with a type A fetus.
C. Denial of type O suitors
D. Administration of blocking antibodies to B antigen if she has a pregnancy with a type B fetus
E. Free selection of suitors because ABO incompatibility does not occur

27. What is the risk for any type of fetal incompatibility to a type A, Rh C+ mother and a type B,
Rh D+ father who are beginning their second pregnancy? It is known from the grandparental blood
types that these parents are heterozygous at all blood group loci.
A. 100%
B. 75%
C. 50%
D. 25%
E. Virtually 0

28-33. Match the following risk factors with the syndrome categories below:
A. a chromosomal syndrome
C. a Mendelian syndrome
D. a disruption syndrome
E. a malformation syndrome

28. Oligohydramnios (scanty amniotic fluid)
29. Renal agenesis
30. Advanced paternal age
31. Advanced maternal age
32. Multiple miscarriages
33. Tearing of the amnion

34-36. Match each of the ethnic groups listed below with the genetic disorder commonly
associated with it.
(A) Cystic fibrosis
(B) α-thalassemia
(C) Tay-Sachs disease
(D) α-1-antitrypsin deficiency
(E) Glucose-6-phosphate dehydrogenase deficiency
34. African Americans
35. Chinese Americans
36. Jewish Americans

37-41. The various types of genetic anemias, like many other genetic disease categories, must be
diagnosed by particular laboratory studies. Match the following alterations of β-globin gene
expression with the test that will be sufficiently abnormal to allow diagnosis.
(A). Mutation in the upstream region to cause mild thalassemia
(B). Deletion of the second β-globin exon to cause severe thalassemia
(C). Mutation in an RNA splice site to cause severe thalassemia
(D). Amino acid substitution (charged to neutral) to produce an unstable β-globin peptide
(E). Amino acid substitution (neutral to neutral) in the binding site for heme.
37. Analysis to detect altered mobility of β-globin protein by electrophoresis
38. Analysis to detect decreased oxygen binding by red blood cells
39. Analysis to detect altered size of β-globin protein
40. Analysis to detect altered DNA sequence of promoter regions
41. Analysis to detect altered size of β-globin mRNA

42. The cytogenetic term “6q+” refers to

(A) 46,XX,dup(6q)
(B) extra chromosome material derived from the long arm of chromosome 6
(C) 46,XX,dup(6p)
(D) extra chromosome material, origin unspecified, attached to the long arm of chromosome 6
(E) 47,XX,+6
43–45. Match each clinical situation below with the appropriate risk figure.
(A) 1/10,000
(B) 1/800
(C) 1/100
(D) 1/10
(E) 1
43. The risk for a newborn to have Down syndrome
44. The theoretical risk for a 21/21 translocation carrier to have a child with Down syndrome
45. The risk for parents of a trisomy 21 child to have a second offspring with a chromosomal
abnormality

46–48. Match each of the genetic conditions below with the correct cytogenetic notation.
(A) 47,XX,+21
(B) 45,X
(C) 47,XXX
(D) 47,XY,+21
(E) 45,XX,-21
46. Male with trisomy 21 (Down syndrome)
47. Female with monosomy X (Turner syndrome)
48. Female with monosomy 21

49. Monozygotic twins with connected placental circulations can develop a pattern of vascular
occlusions due to blood clots. A twin with a brain cyst, absent kidney, cleft palate, and absent digits
has a:
A. Malformation syndrome
B. Deformation syndrome
C. Disruption syndrome
D. Dysplasia syndrome
E. Malformation sequence

50. At her first obstetric visit, a woman tells you she has a brother with mental disability. She
asks what the risk for mental disability will be for her current pregnancy. You reply:
A. Mental disability is a complex phenotype that is rarely genetic.
B. Mental disability fits into the polygenic category with a low recurrence risk.
C. It is imperative to establish a more specific diagnosis before counseling can be provided.
D. It is imperative to perform a karyotype on her brother before counseling can be provided.
E. The risk is significant but there is no prenatal diagnosis for mental disability.

51. An individual with genotype Aa at a genetic locus will produce:

A. Only gametes with genotype Aa
B. Only gametes with genotype a
C. Only gametes with genotype aa
D. Half of gametes with genotype A and half with genotype a
E. Only gametes with genotype AA
52. A woman has two brothers with mental disability, and her mother also had a brother with
mental disability plus two with normal cognitive function. The woman’s would occur if her
fetus was:
A. Male—50%
B. Male—25%
C. Male <1%
D. Male or female—50%
E. Male or female—25%

53. If allele B causes disease and allele b is associated with a normal phenotype, what is the
chance that a baby born to a Bb mother will have the disease? Assume that the father has a bb
genotype and that there is no variable expressivity.
A. 100%
B. 75%
C. 50%
D. 25%
E. Less than 1%

54. The allele for normal hemoglobin is represented as A, and that for sickle hemoglobin as S. A

man with sickle cell trait (genotype AS) marries a woman who is also sickle trait. What are their
chances to have a child with sickle cell anemia (genotype SS)?
A. 100%
B. 75%
C. 50%
D. 25%
E. Less than 1%

55. A woman is distraught because she has had a child with spina bifida and believes her episode
of influenza at 6 months gestation is responsible. You reply:
A. Influenza does not cause birth defects.
B. The neural tube forms in the first month, so infections in the second trimester should not
affect it.
C. Congenital infections always produce syndromes, not single birth defects.
D. Spina bifida is due to an underlying Mendelian disorder
E. Spina bifida is due to an underlying chromosome disorder

56-58. Many of the more common birth defects like cleft palate or congenital heart disease
exhibit multifactorial determination. Although specific empiric risks can be specified as in Tables 4.2
and 4.3, general risks can be borne in mind relative to an affected person: identical twin, 20-30%;
first-degree relative, 3-4%; two first-degree relatives, 5-8%; three first-degree relatives, 9-12%;
second-degree relatives, 0.7-2 %, third-degree relatives and general population, less than 0.5%. By
reference to the person with a birth defect, match the relatives below with their proportion of genes
in common and their concordance or recurrence risk:
(A) 100% genes in common, 20-30% concordance risk
(B) 50% genes in common, 3-4% concordance risk
(C) 50% genes in common, 3-4% recurrence risk
(D) 25% genes in common, 2% recurrence risk
(E) 12.5% genes in common, <0.5% recurrence risk
56. Twin brother whose twin sister has cleft palate by ultrasound
57. Unborn sibling of a child with congenital heart defect
58. Grandchild of a person with spina bifida

59-60. For each clinical presentation, discuss risks for the next pregnancy and the best prenatal
diagnosis option.
59. A couple in their early 30’s has a child with the trisomy 21 form of Down syndrome; they
want the earliest and most accurate prenatal diagnosis..
A. Risk for Down syndrome 1%--first trimester quad screen plus ultrasound
B. Risk for Down syndrome 1%--chorionic villus sampling
C. Risk for Down syndrome 1%--amniocentesis
D. Risk for Down syndrome 10%--first trimester quad screen plus ultrasound
E. Risk for Down syndrome 10%--chorionic villus sampling
60. A couple in their 20’s has a child with spina bifida. They want the safest method of prenatal
diagnosis.
A. Risk for spina bifida 2%--first trimester quad screen plus ultrasound
B. Risk for spina bifida 2%--chorionic villus sampling
C. Risk for spina bifida 2%--amniocentesis
D. Risk for spina bifida 10%--first trimester quad screen plus ultrasound
E. Risk for spina bifida 10%--amniocentesis

Genetics Final Question Collector PDF

Загружено:

Сведения о документе

Оригинальное название

Авторское право

Доступные форматы

Поделиться этим документом

Поделиться или встроить документ

Параметры публикации

Этот документ был вам полезен?

Это неприемлемый материал?

Авторское право:

Доступные форматы

Genetics Final Question Collector PDF

Загружено:

Авторское право:

Доступные форматы

GENETICS ​FINAL​ QUESTION COLLECTOR

2018 FINAL (2nd Year)​ ​= SOLVED 2

2017 FINAL​ ​= SOLVED 10

POLISH DIVISION 2018 FINAL​ ​= SOLVED 20

2016 FINAL​ ​= SOLVED 29

2016 FINAL Retake​ ​= SOLVED 40

2015 4yr 53

POLISH DIVISION 2017 57

2009 FINAL 94

RANDOM YEAR 114

2018 FINAL (2nd Year)

Mutation + 50 1000

Mutation - 25 500

POLISH DIVISION 2018 FINAL

2016 FINAL Retake

POLISH DIVISION 2017

MUSCULAR DYSTROPHY QUIZ - during seminars.

A 21-year-old female was referred to obstetric clinic from the emergency room after a diagnosis

9. Which of the following results is most plausible for this couple, along with its likelihood given

10. A pregnant couple had a prior child with multiple birth defects who died at another hospital.

15. Diagnosis of thalassemia ​A

18. Diagnosis of altered protein ​D

19-20. Match the following descriptions with the terms below:

23. Given appropriate testing, what is the risk for chromosome aberrations in the next pregnancy

29. Renal agenesis

30. Advanced paternal age

31. Advanced maternal age

32. Multiple miscarriages

33. Tearing of the amnion

34. African Americans

35. Chinese Americans

36. Jewish Americans

37. Analysis to detect altered mobility of ​β​-globin protein by electrophoresis

38. Analysis to detect decreased oxygen binding by red blood cells

39. Analysis to detect altered size of ​β​-globin protein

40. Analysis to detect altered DNA sequence of promoter regions

41. Analysis to detect altered size of ​β​-globin mRNA

42. The cytogenetic term “6q+” refers to

43. The risk for a newborn to have Down syndrome

46. Male with trisomy 21 (Down syndrome)

47. Female with monosomy X (Turner syndrome)

48. Female with monosomy 21

51. An individual with genotype Aa at a genetic locus will produce:

54. The allele for normal hemoglobin is represented as A, and that for sickle hemoglobin as S. A

57. Unborn sibling of a child with congenital heart defect

58. Grandchild of a person with spina bifida

Вам также может понравиться

GENETICS FINAL QUESTION COLLECTOR

2018 FINAL (2nd Year) = SOLVED 2

2017 FINAL = SOLVED 10

POLISH DIVISION 2018 FINAL = SOLVED 20

2016 FINAL = SOLVED 29

2016 FINAL Retake = SOLVED 40

15. Diagnosis of thalassemia A

18. Diagnosis of altered protein D

37. Analysis to detect altered mobility of β-globin protein by electrophoresis

39. Analysis to detect altered size of β-globin protein

41. Analysis to detect altered size of β-globin mRNA