f u n g a l b i o l o g y x x x ( 2 0 1 5 ) 1 e1 1

journal homepage: www.elsevier.com/locate/funbio

Substratum preference of two species

of Xanthoparmelia

Chris DEDUKE*, Michele D. PIERCEY-NORMORE

Department of Biological Sciences, University of Manitoba, Winnipeg, Manitoba R3T 2N2, Canada

article info abstract

Article history: The distribution of established saxicolous lichens has been previously studied but substra-
Received 17 October 2014 tum preference and elemental composition has been relatively unexplored. The objectives
Received in revised form of this study were to compare ascospore germination and growth for two species of Xantho-
22 March 2015 parmelia using media supplemented with pulverized rock and to explore photobiont
Accepted 14 May 2015 selectivity relative to ecological guilds. Mature apothecia from X. cumberlandia and
Corresponding editor. Martin Grube X. viriduloumbrina were subjected to five treatments, which include water agar supple-
mented with crushed granodiorite, basalt, mica schist, dolostone, and malt yeast agar as
Keywords: the control. The algal actin gene was sequenced and the closest algal matches were re-
Ascospore trieved from GenBank and analysed to produce a haplotype network. X. cumberlandia ex-
Basalt hibited substratum preference for the mica schist treatment, while X. viriduloumbrina
Dolostone grew better on granodiorite and malt yeast agar relative to dolostone. Ascospore germina-
Germination tion for both species failed to progress beyond the initial swelling and protrusion stage on
Granodiorite the dolostone treatment. The actin gene sequences for the algae were most similar to those
Schist of Trebouxia jamesii. The rock substrates did not correspond with the photobiont haplo-
types, which does not support the ecological guild hypothesis. This study provided insights
into substratum preference and the suitability of the substratum for algal selection.
ª 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Introduction will fail. Xanthoparmelia is a large genus of foliose lichens that

Colonization of a rock substratum by fungi has been examined
in the context of fungal preference for substrata (Burford et al.
2003a, 2003b; Gadd 2007). Studies showed that the pH is im-
portant for colonization (Lisci et al. 2003), oxygen and temper-
ature also play a role (Cotter 1981; Cotter & Raper 1968a,
1968b), and the texture, water retention, and elemental com-
position must also contribute to successful colonization. Col-
onization of rocks by a lichen forming fungus (mycobiont) and
its algal partner (photobiont) begins at the early stages of the
interaction between the fungal and algal symbionts that con-
stitute a lichen. If neither of the symbionts can tolerate the
conditions of the substratum, the formation of a lichen thallus
primarily grows on felsic rock (Hale 1967). Xanthoparmelia vir-
iduloumbrina (Gyelnik) Lendemer, previously known as X. som-
lo€ensis (Lendemer 2005), was reported on granite or schist,
with some occurrences on basalt (Giordani et al. 2002). Xantho-
parmelia cumberlandia (Gyelnik) Hale was primarily on basalts
(Giordani et al. 2002) and sometimes on granite (Golm et al.
1993). Based on these and other studies (Scarciglia et al.
2012), substratum preference seems to vary between species.
Knowledge of the ability for the ascospore to germinate and
grow under controlled conditions may determine whether
the variation is the result of the element content or another
feature of the substratum. If other features of the substratum
were kept constant, such as water retention or texture,

* Corresponding author. Tel.: þ1 204 474 9610; fax: þ1 204 474 7604.
E-mail addresses: umdeduke@myumanitoba.ca (C. Deduke), Michele.Piercey-Normore@umanitoba.ca (M. D. Piercey-Normore).
http://dx.doi.org/10.1016/j.funbio.2015.05.005
1878-6146/ª 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Please cite this article in press as: Deduke C, Piercey-Normore MD, Substratum preference of two species of Xanthoparmelia, Fun-
gal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.05.005
2 C. Deduke, M. D. Piercey-Normore
insights into the effects of elemental composition on fungal
growth may be gained.
The substratum may also influence the type of alga avail-
able for thallus formation by the mycobiont. Sexual reproduc-
tion by X. viriduloumbrina and X. cumberlandia results in
ascospores that must come into contact with a suitable photo-
biont in a suitable habitat, or a new lichen thallus will fail to
become established (Bu € del & Scheidegger 2008). If photobionts
form ecological guilds reflecting adaptation to particular hab-
itats and substrata (Beck 1999; Blaha et al. 2006; Helms 2003;

Peksa & Skaloud 2011; Rikkinen et al. 2002), the algal species
associated with lichen fungi could be predicted based on the
substrata. Some species of Xanthoparmelia show substratum
preference (Brodo et al. 2001; Giordani et al. 2002), which may
be influenced by abiotic features of the substratum (Cotter
1981; Cotter & Raper 1968a, 1968b; Lisci et al. 2003) or a photo-
biont preference for the substratum (Rikkinen et al. 2002).
While photobionts are influenced by pH (Blaha et al. 2006;

Helms 2003; Peksa & Skaloud 2011), both pH and temperature
affected the symbionts of Cladonia rangiferina during the initial
interaction (Athukorala et al. 2014). After development of a li-
chen thallus, the attachment organs penetrating the substra-
tum are exposed to the elements of the substratum, which
must also be tolerated and/or nontoxic to allow the lichen to
persist on the substratum.
Xanthoparmelia viriduloumbrina associates with Trebouxia
arboricola and T. gigantea (Ahmadjian 1993) while X. cumberlan-
dia, is known to associate with the same two algal species in
addition to two others, T. gelatinosa and T. impressa (Leavitt
et al. 2013), suggesting that X. cumberlandia is less selective of
its photobiont than X. viriduloumbrina. Algal selectivity is de-
fined as the frequency of association in a lichen symbiosis
depending on the availability of algae in the surrounding envi-
ronment (Honegger 2008; Yahr et al. 2006). Since both species
of Xanthoparmelia are closely related in the same genus
(Leavitt et al. 2013) they may be expected to share their photo-
biont species. The same type of rock substratum would be
expected to have the same pool of available algae according
to the ecological guild hypothesis (Rikkinen et al. 2002).
For saxicolous lichens that grow on different types of rock sub-
stratum (Benedict & Nash 1990; Brodo et al. 2001; Giordani et al.
2002) the photobionts may further vary according to the rock
type if the ecological guild hypothesis is supported.
The general goal of this study was to investigate the sub-
stratum preferences of X. viriduloumbrina and X. cumberlandia.
More specifically, the objectives were to compare germination
and growth between two species of lichen fungi, and among
four treatments of growth media containing defined crushed
rock substrata, and 2) to gain some preliminary insights into
the photobiont selectivity in the context of the ecological guild
hypothesis.
Materials and methods
Specimen collection and experimental design
To test for substrate preference, five specimens of Xanthopar-
melia viriduloumbrina were collected from Manitoba (N50 020 -
49 500 , W95 360 -95 230 ) and five specimens of X. cumberlandia
Please cite this article in press as: Deduke C, Piercey-Normore MD, Substratum preference of two species of Xanthoparmelia, Fun-
gal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.05.005
were collected from northern Ontario (N50 110 -49 370 ,
W93 150 -92 090 ), based on accessibility and prevalence of the
species in these areas in the summer of 2013. Mature apothe-
cia were used as described in Belleme re & Letrouit-Galinou
(2000). Taxonomic identification of the two species was con-
firmed using Hale (1990) and Lendemer (2005). To test for algal
association, three samples of X. viriduloumbrina and three
samples of X. cumberlandia were collected based on the
methods in Deduke et al. (2014). An additional ten samples
of Arctoparmelia centrifuga, were also collected for comparison
since the species is morphologically similar and grows in sim-
ilar habitats. All specimens were collected from northern
Manitoba (N101 340 to N101 220 , W55 000 to W54 360 ), southern
Manitoba (N95 360 to N95 230 , W50 020 to W49 500 ) and north-
ern Ontario (N93 150 to N92 090 , W50 110 to W49 370 ), and are
deposited in the cryptogam division of the University of Man-
itoba Herbarium (WIN).
The experimental design for the substrate preference
study consisted of two apothecia for each of four biological
replicate petri-plates for each of four treatments (granodiorite,
dolostone, basalt, and mica schist; and malt yeast agar as the
control) for each of two species X. viriduloumbrina and X. cum-
berlandia. The spacing was distant enough in each plate to al-
low for a zone of an absence of ascospores so spores from each
apothecium can be counted separately. Apothecia were
washed and prepared using a modified protocol of Kofler
(1970), which involved attaching the apothecia to the under-
surface of the petri-plate lids using Vaseline and monitoring
the growth on the agar plate. After one week the media sur-
face was examined for ascospores, and the petri-plate lids
with the apothecia were replaced with new lids to prevent
apothecia from becoming a potential source of contamina-
tion. Petri plates were incubated at a temperature of 20  C
and 24 hour darkness. Denison (2003) found that light was
not a requirement for lichen ascospore discharge or germina-
tion and that there was no difference based on the light re-
gime. Other studies on lichen ascospore germination have
been conducted in 24 hour darkness (Athukorala et al. 2014;
Cordeiro et al. 2004; Jeong et al. 2015; Kranner et al. 2005;
Molina et al. 2015; Molina & Crespo 2000).
Mycobiont cultures and substratum preparation
Numbers of ascospores and germinated ascospores were
counted twice a week, beginning after the first week for a to-
tal of eight weeks using a dissecting microscope (Leica MZ6),
with a 1010 grid placed in the right eye piece. The edges of
the grid were marked on the petri plate lid to ensure accu-
racy with subsequent recounting. Ascospores were counted
in a single 110 row based on largest numbers of ascospores
released using 40 magnification. Three sequential counts
were done for each row for the number of ascospores, the
number of germinated ascospores, and the percent cover
of mycelium for each grid cell. Ascospores were considered
germinated when they showed physical changes by the pro-
trusion of a germ tube (Cotter 1981). Percent cover of myce-
lium was used to determine growth of the mycelium.
Photos were taken at week 8.5 using a dissecting microscope
(Olympus SZH) at 40 magnification to show differences in
growth patterns. The camera was an Olympus QColour 5
Substratum preference of Xanthoparmelia 3

and imaging software was QCapture Suite 3.1.1 (QImaging,

Table 1 e Quantities of the 21 elements within each of the
Surrey, BC). four rock types used as media supplements in this study.
Rock samples were collected from Manitoba and northern
Element Granodiorite Dolostone Basalt Mica Schist
Ontario (Deduke et al. 2014). Granodiorite was collected from
an outcrop near Brereton Lake, Manitoba (N49 560 11.8800 ; Ag (ppm) <0.20 <0.20 0.20 <0.20
W95 310 06.8000 ). Dolostone was collected near Cranberry Por- Ca (%) 0.35 17.40 1.54 0.11
Co (ppm) 8.00 <1.00 11.00 12.00
tage, Manitoba (N54 300 25.7700 ; W101 090 29.2500 ). Basalt was
Cr (ppm) 72.00 2.00 25.00 99.00
collected from an outcrop along Sherridon road, Manitoba
Cu (ppm) 33.00 3.00 3.00 17.00
(N54 410 17.5600 ; W101 310 38.8900 ). Mica schist was collected Fe (%) 1.38 0.19 3.52 3.42
from an outcrop north of Finger Lake, Manitoba (N54 460 K (%) 0.50 0.03 0.06 0.75
14.9800 ; W95 170 38.4900 ). Rock samples were sent to Activation La (ppm) 40.00 <10.00 <10.00 33.00
Labs (Thunder Bay, Ontario) for AR-ICP analysis (Aqua Regia e Mg (%) 0.86 12.60 1.34 1.43
Inductively Coupled Plasma). The rock samples were weighed Mn (ppm) 332.00 157.00 552.00 427.00
Na (%) 0.06 0.02 0.24 0.03
to 0.5 g and crushed to a size where 95 % of the rock powder
Ni (ppm) 32.00 1.00 10.00 30.00
passed through a 105 mm aperture/150 mesh (Actlabs 2014)
P (%) 0.05 0.01 0.02 0.06
and the powder from each of granodiorite, dolostone, basalt Pb (ppm) 2.00 <2.00 <2.00 3.00
and mica schist were returned for culture media preparation. S (%) <0.01 <0.01 <0.01 0.03
The culture media consisted of water agar with crushed rock Sc (ppm) 4.00 <1.00 12.00 3.00
(0.25 g rock powder and 0.5 g agar in 25 mL water) for the Sr (ppm) 9.00 39.00 17.00 11.00
rock treatments and malt yeast agar for the control (0.5 g Te (ppm) 3.00 1.00 <1.00 2.00
V (ppm) 27.00 <1.00 68.00 39.00
agar; 0.5 g malt; 0.05 g yeast in 25 mL water; Stocker-
Y (ppm) 13.00 <1.00 7.00 5.00
Wo € rgo
€ tter 2002). The growing conditions in this study,
Zn (ppm) 39.00 2.00 30.00 57.00
crushed rock in agar medium, may not be consistent with
those found in nature in terms of water availability and min-
eral size, but by controlling both variables (mineral size and Glacial Acetic Acid 5 mL). The isolated DNA was further cleaned
25 mL of water), we were able to create identical growth con- using a silica bead purification protocol (#K0513B, Fisher Scien-
ditions to compare species and growing conditions of the sub- tific, Ottawa, Canada) following the manufacturer’s instruc-
stratum. Twenty-one elements measured in the AR-ICP tions. DNA pellets were resuspended in sterile distilled water
analysis met quality control standards and were included in and the algal actin gene was amplified by polymerase chain re-
analyses: silver (Ag; ppm); calcium (Ca; %); cobalt (Co; ppm); action (PCR) using two forward and two reverse actin gene
chromium (Cr; ppm); copper (Cu; ppm); iron (Fe; %); potassium primers. Because amplification and sequencing of the actin
(K; %); lanthanum (La; ppm); magnesium (Mg; %); manganese gene in these species was problematic, amplification using
(Mn; ppm); sodium (Na; %); nickel (Ni; ppm); phosphorus (P; %); two internal primers was performed from the PCR product of
lead (Pb; ppm); sulphur (S; %); scandium (Sc; ppm); strontium the external primers: Act-1T-NS-1F (CAATCACCAGGCTA-
(Sr; ppm); tellurium (Te; ppm); vanadium (V; ppm); yttrium (Y; GATCTG) for the forward and Act-4T-NS-1R (GTTAATA-
ppm); and zinc (Zn; ppm). Sixteen additional elements were CAGCTGCACCTG) for the reverse primer. The internal primers
excluded from this analysis because either values were at or were: Act-1T-NS-2F (CTAGACTACGAGCAAGAGCT) for the for-
below minimum detection standards of AR-ICP or failed to ward and Act-4T-NS-2R (CGWCGTATGATGCCGTGACA) for
meet quality control standards. These elements included the reverse primer. Actin primers were based on sequences de-
aluminium, antimony, arsenic, barium, beryllium, bismuth, rived from the algal-specific primers Act1T and Act4T (Kroken &
boron, cadmium, gallium, mercury, molybdenum, thallium, Taylor 2000). PCR using the external primers consisted of
titanium, tungsten, uranium, and zirconium. 10e50 ng of DNA for one 20 mL reaction, 1x PCR Buffer (50 mM
The rock types granodiorite, basalt and mica schist, were KCL, 100 mM Tris-HCl [pH 8.3]), 200 uM of each dNTPs, 0.5 mM
identified prior to grinding using characteristics including each of two primers (forward and reverse), 2.0 mM of MgCl2
mineral size, foliation, presence of particular minerals, col- and 0.5 units of Taq DNA polymerase (Invitrogen, Burlington,
ouration, hardness, and cleavage planes (Klein & Dutrow ON, Canada). PCR was amplified in a T100 Thermal Cycler
2007). Dolostone was additionally identified with the observa- (Bio-Rad, Mississauga, ON, Canada). PCR cycle for the external
tion of a weak bubbling reaction when acetic acid was applied, primers had an initial denaturing temperature of 94  C for
along with elevated levels of Mg from sample analysis (Klein & 3 min, followed by 30 cycles of denaturing at 94  C for 1 min,
Dutrow 2007; Table 1). annealing at 56  C for 30 s and an extension at 72  C for 45 s.
The PCR conditions using the nested primers were the same
Photobiont DNA extraction, PCR, and sequencing as for the external primers but the annealing temperature
was at 58  C. PCR product was agarose gel-purified with a Wiz-
DNA was extracted from 5.0 mg thallus portions of the younger ard Kit (Promega, Madison, WI, USA) following the manufac-
lobes from 16 samples (Table 2). DNA extraction was done using turer’s instructions. DNA was subsequently quantified on 1 %
cetyltrimethylammonium bromide (CTAB) extraction buffer agarose gels and stained using ethidium bromide. PCR products
and a modified protocol from Grube et al. (1995). Thallus sam- were cycle sequenced following the manufacturer’s instruc-
ples had been previously cleaned of debris and the secondary tions using BigDye v.3.1 (Applied Biosystems, Foster City, CA,
metabolites were extracted and identified following Orange USA). Sequencing was done using a 3130 Genetic Analyzer (Ap-
et al. (2001) with solvent A (Toluene 180 mL; Dioxane 45 mL; plied Biosystems, Foster City, CA, USA). Nucleotide sequences

Please cite this article in press as: Deduke C, Piercey-Normore MD, Substratum preference of two species of Xanthoparmelia, Fun-
gal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.05.005
4 C. Deduke, M. D. Piercey-Normore

Table 2 e Results of a repeated measures ANOVA examining the effects of substrate on ascospore growth (percent cover)
over a 7.5 week period for Xanthoparmelia viriduloumbrina and X. cumberlandia fungi in culture. Subscripted values
indicated degrees of freedom. Significance was calculated at p [ 0.050. ANOVA, Greenhouse & Geisser’s (GeG) indicate p
values. GeG indicate adjusted value for sphericity assumption. Epislon (3) indicates degrees of freedom adjustment for
GeG. An asterisk (*) indicates significance.
Xanthoparmelia cumberlandia Xanthoparmelia viriduloumbrina

F ANOVA GeG F ANOVA GeG

Substrate 35.72 (4, 65) <0.001* 5.45 (4, 8) 0.020*

Time 1.56 (15, 975) 0.128 2.70 (15, 120) 0.083
Substrate  Time 2.93 (60, 975) <0.001* 1.31 (60, 120) 0.294
Epsilon (3) 0.570 0.163

were edited using Sequencher (v. 4.8, Gene Codes Corporation,
Ann Arbour, MI, USA) and aligned manually using SeAl (Se-
quencer Alignment Editor, v. 2.0a11, University of Oxford, UK).
Data analyses
Element quantities and percent cover data were transformed
using a log (xþ1) conversion to minimize the variance in the
data, based on Zar (2010). Principal component analysis
(PCA) was chosen as an ordination method for element con-
centration data because the quantities are linearly related to
one another, are non-binary and are not a species based data
set (Peck 2010). A repeated measures ANOVA was done for
each Xanthoparmelia species to test the effects of substrate
and time on ascospore growth. An interaction between time
and substrate was also tested. Significance was determined
using an F value or Greenhouse & Geisser’s value where appro-
priate. An epsilon value (3) was calculated for each species to
show the Greenhouse & Geisser’s degrees of freedom adjust-
ment. Non-parametric Steel-Dwass tests were done to test
overall significance of percent cover between culture treat-
ments and culture treatments between species. Krus-
kaleWallis tests were used to test the significance between
species for each culture treatment. PCA analysis was done us-
ing PC-ORD (version 6.08; McCune & Mefford 2011). Repeated
measures ANOVA, KruskaleWallis and Steel Dwass tests
were calculated using JMP 10.0.2 (SAS Institute, Cary, NC).
The algal haplotype network was inferred using the algal
actin gene sequenced from 16 thallus samples (10 Arctoparme-
lia centrifuga, 3 X. viriduloumbrina and 3 X. cumberlandia) and an
additional 12 sequences from NCBI Genbank as reference se-
quences for Trebouxia simplex and T. jamesii (Table 4). Since
the species are closely related (Leavitt et al. 2013) and the se-
quence variation is low, a haplotype network was created us-
ing TCS (v.1.21, Clement et al. 2000) with gaps set to missing
data and a 90 % connection limit.
and Sr, while granodiorite and mica schist were found at
the negative end of the primary axis and the positive end of
the secondary axis. Basalt was centrally located along the pri-
mary axis, but was at the negative end of the secondary axis.
Dolostone contained higher amounts of Ca, Mg and Sr than
the other rock types (Table 1). Granodiorite was highest in
Cu, La, Ni, Te and Y. Mica schist had larger amounts of Co,
Cr, K, P, Pb, S and Zn. Basalt had larger amounts of Fe, Mn,
Na, Sc and V (Table 1).
Observations of mycelial growth
The growth medium containing granodiorite produced differ-
ent morphological forms of mycelial mats between the two
species (Fig 2). Xanthoparmelia cumberlandia produced growth
patches with clearly separated hyphal branches (Fig 2A) but
X. viriduloumbrina produced patches with more extensive
and dense hyphal branching (Fig 2F). Ascospore germination
and mycelial growth for both species showed identical pat-
terns on media supplemented with dolostone where no
growth was observed. Some ascospores showed swelling fol-
lowed by the formation of a small bulge, presumably where
a germ tube would emerge. However, no germ tube was pro-
duced and ascospores never developed beyond this point
nor acquired any additional size (Fig 2B and G). The media sup-
plemented with basalt produced mycelial patches in both spe-
cies with small dense hyphal branching (Fig 2C and H). The
media supplemented with mica schist produced large
Table 3 e Comparison of growth (percent cover of
mycelium) between each of the five treatments:
granodiorite, dolostone, basalt, mica schist and the
control, malt yeast agar, at week 9.0 for X. viriduloumbrina
and X. cumberlandia using a SteeleDwass test.
Species Treatment Rank

X. cumberlandia Granodiorite b
Results Dolostone c
Basalt b
Elemental composition of rock types Mica Schist a
Malt Yeast Agar b

The elemental composition and defined rock substrata in the X. viriduloumbrina Granodiorite a
PCA shows the primary axis which explains 55.79 % of the Dolostone b
Basalt ab
variation in the data, and the secondary axis accounts for
Mica Schist ab
an additional 31.43 % (Fig 1). Dolostone was at the positive
Malt Yeast Agar a
end of the primary axis due to higher amounts of Ca, Mg

Please cite this article in press as: Deduke C, Piercey-Normore MD, Substratum preference of two species of Xanthoparmelia, Fun-
gal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.05.005
Substratum preference of Xanthoparmelia 5

Table 4 e Algal specimens used in this study including collection number, source of collection and accession number for
GenBank.
Species Source of collection Accession no.

Arctoparmelia centrifuga Canada, Manitoba, Payuk Lake, 7203 KP322556

Arctoparmelia centrifuga Canada, Manitoba, Payuk Lake, 7233 KP322557
Arctoparmelia centrifuga Canada, Manitoba, Payuk Lake, 7403 KP322558
Arctoparmelia centrifuga Canada, Manitoba, Sherridon Road, 8101 KP322559
Arctoparmelia centrifuga Canada, Manitoba, Sherridon Road, 8322 KP322560
Arctoparmelia centrifuga Canada, Manitoba, Sherridon Road, 8511 KP322561
Arctoparmelia centrifuga Canada, Manitoba, Sherridon Road, 8703 KP322562
Arctoparmelia centrifuga Canada, Manitoba, Sherridon Road, 8802 KP322563
Arctoparmelia centrifuga Canada, Manitoba, Sherridon Road, 8911 KP322564
Arctoparmelia centrifuga Canada, Manitoba, Highway 10, 9301 KP322565
Xanthoparmelia cumberlandia Canada, Manitoba, Rennie, 1332 KP322566
Xanthoparmelia cumberlandia Canada, Ontario, Red Lake, 2112 <200 BP
Xanthoparmelia cumberlandia Canada, Ontario, Red Lake, 2321 KP322567
Xanthoparmelia viriduloumbrina Canada, Ontario, Red Lake, 2222 KP322568
Xanthoparmelia viriduloumbrina Canada, Ontario, Red Lake, 2331 KP322569
Xanthoparmelia viriduloumbrina Canada, Ontario, Dryden, 2931 KP322570
Trebouxia simplex Muggia et al. (2010) HM046943
Trebouxia jamesii Ferna ndez-Mendoza et al. unpublished HM573593
Trebouxia jamesii Ferna ndez-Mendoza et al. unpublished HM573595
Trebouxia jamesii Ferna ndez-Mendoza et al. unpublished HM573598
Trebouxia jamesii Ferna ndez-Mendoza et al. unpublished HM573600
Trebouxia jamesii Ferna ndez-Mendoza et al. (2011) GQ375388
Trebouxia jamesii Ferna ndez-Mendoza et al. (2011) GQ375393
Trebouxia jamesii Ferna ndez-Mendoza et al. (2011) GQ375407
Trebouxia jamesii Ferna ndez-Mendoza et al. (2011) GQ375309
Trebouxia jamesii Domascke and Printzen unpublished GQ375410
Trebouxia jamesii ’vulpinae’ Kroken and Taylor 2000 AY005404
Uncultured photobiont Piercey-Normore (2006) DQ086100

Fig 1 e PCA showing the relationship among the elements and their quantities in each of the four rock types used in this
study.

numbers of small patches in X. cumberlandia that had well de- of growth for both species, with clearly separated hyphal
fined central points (Fig 2D) and more extensive and large branching (Fig 2E and J). While X. viriduloumbrina had larger
patches of dense hyphal branching in X. viriduloumbrina number of patches than X. cumberlandia, there was also a larger
(Fig 2I). Finally, the MY control produced well-defined patches number of ungerminated ascospores in this species (Fig 2J).

Please cite this article in press as: Deduke C, Piercey-Normore MD, Substratum preference of two species of Xanthoparmelia, Fun-
gal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.05.005
6 C. Deduke, M. D. Piercey-Normore

Fig 2 e Mycelial growth after 8.5 weeks on each of the five treatments for each of two species, X. cumberlandia (AeE) and X.
viriduloumbrina (FeJ). The treatments were granodiorite (A and F); dolostone (B and G); basalt (C and H); mica schist (D and I);
and malt yeast agar (E and J). All photos were taken at 403 magnification. Black bar represents 500 mm.

Comparison of growth between treatments within each
species
For Xanthoparmelia cumberlandia, substratum significantly af-
fected ascospore growth, and although the main effect of
time was not significant, the interaction of substratum and
time was significant (Table 2). Substratum had a significant ef-
fect on ascospore growth of X. viriduloumbrina, but there was
no effect of time and no interaction (Table 2). The patterns
of growth rates over time were different between treatments
where X. cumberlandia showed a 10e12 % cover in the first 3
weeks and then an increase on the mica schist after 3 weeks
up to 70 % coverage of the grid (Fig 3A). Growth on the mica
schist levelled off after 6.5e7 weeks. The other treatments
showed a gradual increase (granodiorite, basalt and the con-
trol) or no increase (dolostone) in growth. Xanthoparmelia viri-
duloumbrina showed growth covering 10 % or less of the grid
until 4.5e5 weeks when it began to increase in 3 of 5 treat-
ments but it did not surpass 40 % coverage (Fig 3B). Xanthopar-
melia cumberlandia shows significant differences in growth
between treatments at 9 weeks (Table 3). Mycelial percent
cover on mica schist was greater than the control, granodio-
rite, dolostone and basalt in X. cumberlandia, while dolostone
produced significantly less growth than all other treatments.
Mycelial growth on both granodiorite and the control were sig-
nificantly greater than growth on dolostone for X. viriduloum-
brina at 9 weeks of growth (Table 3).
Comparison of growth between species within each treatment
The patterns of growth over time were different between spe-
cies in the same treatment (Fig 4). Xanthoparmelia cumberlandia
produced more mycelium on granodiorite than X. viriduloum-
brina initially, and both growth curves merged at about 5.5
weeks with maximum cover of 40 % (Fig 4A). Growth of both
species fluctuated on dolostone over the 9 weeks with a negli-
gible increase in mycelium reaching no more than 10 % cover
(Fig 4B). Both species showed very similar growth in basalt
with a steady increase over 9 weeks reaching a maximum of
about 30 % cover at week 9 (Fig 4C). Xanthoparmelia cumberlan-
dia showed an increase in growth on mica schist after 3 weeks
reaching a maximum of about 70 % cover after 6.5 weeks
(Fig 4D). In contrast, X. viriduloumbrina remained below 10 %
cover on mica schist until about week 6 when it began to in-
crease reaching no more than 40 % cover. Lastly, X. cumberlan-
dia showed greater percent cover than X. viriduloumbrina in the
control medium until about week 7 when the growth curves
for both species merged, and reached a maximum of 40 %
cover at 9 weeks (Fig 4E). Statistical comparisons for treat-
ments between the two species showed that growth rates
were similar across all treatments except for X. cumberlandia,
which was found to grow significantly better on mica schist
compared to X. viriduloumbrina (Fig 4).
Photobiont and haplotype network
The 28 sequences used in this study (Table 4) were comprised
of three Xanthoparmelia viriduloumbrina, three X. cumberlandia,
10 A. centrifuga, and 12 sequences from GenBank. BLAST re-
sults for the actin gene of X. viriduloumbrina showed the se-
quence was most similar to that of Trebouxia jamesii (Query
Coverage: 96 %e98 %; E-value: 3e-63 to 6e-85; Identity: 79 %e
87 %; Sequence Length: 263 bp to 267 bp). BLAST results for
X. cumberlandia showed the sequence was most similar to
that of T. jamesii (Query Coverage: 96 %e100 %; E-value: 3e-
61 to 6e-76; Identity: 84 %e98 %; Sequence Length: 172 bp to
230 bp). BLAST results for Arctoparmelia centrifuga showed
the sequence was most similar to that of T. jamesii (Query

Please cite this article in press as: Deduke C, Piercey-Normore MD, Substratum preference of two species of Xanthoparmelia, Fun-
gal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.05.005
Substratum preference of Xanthoparmelia 7

Fig 3 e Growth of fungal mycelium by percent cover of the growth medium over time (weeks) for each of A) X. cumberlandia
and B) X. viriduloumbrina treatments. Granodiorite (solid black line), Dolostone (black dash line), Basalt (black dotted line),
Mica Schist (solid grey line) and Malt yeast agar control (grey dash line). Each point represents the mean ranging between 3
and 61 replicates and the vertical bars represent standard error.

Coverage: 83 %e98 %; E-value: 2e-54 to 1e-105; Identity: 83 %e
98 %; Sequence Length: 265 bp to 267 bp) and T. simplex (Query
Coverage: 81 %; E-value: 1e-26; Identity: 81 %; Sequence
Length: 262 bp). The haplotype network is comprised of 24 dis-
tinct haplotypes (Fig 5). There were two haplotypes that had
more than one individual making up the haplotype (larger cir-
cles). These two haplotypes were from A. centrifuga (8332,
8511, 8703 and 8911) and X. cumberlandia (2112 and 2321).
The majority of algal actin haplotypes were closely related
with the exception of two A. centrifuga haplotypes ((7403 and
8101) blue circles). These two A. centrifuga photobiont haplo-
types were closely related to the algae, T. simplex (gray circle)
and T. jamesii (brown circle), which were associated with the
lichen fungi, Tephromela atra and Cetraria aculeata, respec-
tively. Rock substratum showed no apparent association
with algal haplotype relationships or fungal species.
Discussion
Species-specific substratum preference
This study showed evidence to support a strong preference by
Xanthoparmelia cumberlandia for the mica schist treatment
over all other treatment types (Table 3) but there was also
a significant effect of the interaction between substratum
and time. Xanthoparmelia viriduloumbrina showed the same
growth on granodiorite as it did on the control (malt yeast
agar), but the absence of a time effect suggested a more uni-
form growth. Non-lichenized fungi have also been shown to
exhibit rock substratum associations at the genus level in na-
ture (Burford et al. 2003a, 2003b; Gadd 2007). The faster growth
of X. cumberlandia than X. viriduloumbrina in the first five weeks
of growth for granodiorite, mica schist and the control treat-
ments may reflect their life history strategies, which were pre-
viously characterized by Deduke et al. (2014). The faster
growth rate of X. cumberlandia at early stages of growth may
support the contention that X. cumberlandia is a ruderal spe-
cies (Deduke et al. 2014). However, the slower grow rate of X.
viriduloumbrina on both element rich and poor substrata
(Fig 4) supports a stress tolerant life history strategy and a bet-
ter competitor (Grime 2002). According to Grime (2002) be-
cause faster growing species are prone to quickly exploit
their resource pools; whereas stress tolerant species grow
slower and are more persistent in their environments. Previ-
ous studies reporting that X. cumberlandia is a poor colonizer
on granite surfaces (Giordani et al. 2002; Golm et al. 1993),
may be explained if X. cumberlandia begins as a fast growing
species, as on granodiorite (Fig 3A), and then becomes slower
relative to other species, and eventually will become outcom-
peted in nature. The poor growth on the dolostone treatment
by both species supports the observations that these species

Please cite this article in press as: Deduke C, Piercey-Normore MD, Substratum preference of two species of Xanthoparmelia, Fun-
gal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.05.005
8 C. Deduke, M. D. Piercey-Normore

Fig 4 e Growth of fungal mycelium by percent cover of the growth medium over time (weeks) for each of X. cumberlandia
(black line) and X. viriduloumbrina (grey line) on five treatments: A) Granodiorite; B) Dolostone; C) Basalt; D) Mica schist; and E)
Malt yeast agar control. Each point represents the mean ranging between 3 and 61 replicates and the vertical bars represent
standard error.

have not been found on calcium rich substrata (Rizzi &
Giordani 2013). It is more likely that the total pH of the substra-
tum, not the Ca content alone, determines the ability to grow
(Ascaso and Galvan, 1976; Iskandar & Syers 1972), but this re-
mains to be tested. Since a wide range of non-lichenized and
lichenized fungi are capable of weathering rocks (Gadd 2007,
2013; Gadd et al. 2012), it is not surprising that some specializa-
tion has been reported by fungal species to alter the diverse
range of chemical bonds found in different types of minerals
(Scarciglia et al. 2012).
In nature, mineral size may also influence the ability for li-
chens to sequester elements from the rock substratum
(St John et al. 1983). Even though basalt and mica schist have
similar quantities of Fe and Co (Fig 1 and Table 1), other ele-
ments and mineral sizes are different between rock types. Ba-
salt has small aphanitic (not visible to the naked eye) minerals
while the mica schist has larger phaneritic (visible to the na-
ked eye) minerals, organized in layers (foliation). Granodiorite,
like mica schist, has phaneritic minerals. Rocks composed of
phaneritic or aphanitic minerals would comprise a substratum
mosaic on which fungi grow, creating patches of both unfav-
ourable and favourable elements and their availability in na-
ture. When mineral sizes are altered, as in this study where
rocks were pulverized to homogenize the naturally formed
mineral mosaic, it potentially exposed germinating asco-
spores to all elements in the rock. While some elements serve
as nutrients, others may be toxic to the fungus. The dense
growth with increased ramification of hyphae in granodiorite
and mica schist treatments by X. viriduloumbrina is consistent
with the toxic effects of La (Mu et al. 2006). This growth pattern
was not present in X. cumberlandia and may be explained if
levels of La in the treatment (Table 1) were tolerated by X. cum-
berlandia. Fungal growth patterns may also be related to their
ability to obtain nutrients. Hyphal length is maximized when
suitable nutrients are present (Paustian & Schnu € rer 1987) but
lateral expansion of fungal hyphae by branching is considered
a secondary growth stage (St John et al. 1983) and occurs after
length extension. Lateral growth would allow the fungus to in-
crease surface area into previously unexplored space and ex-
tract nutrients. The exhibition of different growth patterns by
each species in the same treatments may indicate that the two
species have separate nutrient requirements or tolerances.
Photobiont selectivity
The photobiont guild hypothesis (Ohmura et al. 2006; Peksa &

Skaloud 2011; Rikkinen et al. 2002; Yahr et al. 2006) was not
supported by the findings in this study where the algal actin
DNA sequences did not correspond with rock type. In contrast,
photobiont preference for type of substratum has been found

to occur for lichenized Asterochloris (Peksa & Skaloud 2011) but

Peksa & Skaloud (2011) compared broadly defined substrata

Please cite this article in press as: Deduke C, Piercey-Normore MD, Substratum preference of two species of Xanthoparmelia, Fun-
gal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.05.005
Substratum preference of Xanthoparmelia 9

Fig 5 e Haplotype network based on the algal actin gene showing the distribution of lichenized photobionts in A. centrifuga
(blue), X. viriduloumbrina (red), X. cumberlandia (green), E. mesomorpha (yellow), C. aculeata (brown), Letharia vulpina (purple),
and Tephromela atra (gray) relative to rock type. The rock type is indicated by the shapes overlaying the blue, red and green
dots, with granitic rock indicated by a black triangle; mafic metavolcanic rock indicated by a black diamond; metasedi-
mentary rock indicated by a black circle; and granitic and mafic metavolcanic rock indicated by a black square. The double
slash with numbers indicate the number of nucleotide differences between haplotypes. Black circles interconnected by lines
indicate nucleotide differences between haplotypes. The dashed lines represent connections between haplotype lineages in
the network. Tja represents Trebouxia jamesii; Tjv represents T. jamesii ‘vulpinae’; Tsi represents T. simplex. The four digit
numbers represent the collection numbers (see methods). (For interpretation of the references to colour in this figure legend,
the reader is referred to the web version of this article.)

such as tree bark and rock substrata. The rock substrata in this
study may have been too narrow to differentiate algal prefer-
ence. On the other hand, the substratum preference by the al-
gae may have been present before lichen formation when the
algae were growing freely directly on the rock. If there was
high level of specificity to the rock type, only certain algal hap-
lotypes would have been available for fungal selection. But if
there was a moderate or low level of specificity to the rock
type, the pool of available algal haplotypes would be large
and only a larger sample size would reveal support for the
photobiont guild hypothesis.
The Xanthoparmelia species in this study did not associate
with specific algal actin haplotypes since the algal haplotypes
were shared between fungal species (Fig 5). However, high se-
lectivity of the photobiont among divergent fungal species on
the same substratum was reported for lichenized Trebouxia
(Beck et al. 1998). The phylogenetic relationship between Xan-
thoparmelia species in this study may have been too close to
differentiate among algal haplotypes. Low algal selectivity
would provide a wider range of habitat conditions available
to Xanthoparmelia species. This study determined the Tre-
bouxia photobiont for A. centrifuga by similarity of the actin
sequence to known sequences of T. jamesii. It further
corroborated previous findings that photobionts for the X. vir-
iduloumbrina and X. cumberlandia are closely associated with T.
jamesii and members of the T. gigantea/T. arboricola clade
(Leavitt et al. 2013). While the actin gene sequence is not
known to be the best gene for species determination or bar-
coding in algae (Buchheim et al. 2011; Saunders & Kucera
2010; Saunders & McDevit 2012), it provides an indication of
similarity in identity and has been used to infer phylogenetic
relationships in other studies (Ferna ndez-Mendoza et al. 2011;
Muggia et al. 2010; Piercey-Normore 2006, 2009; Kroken and
Taylor 2000).
In conclusion, X. cumberlandia showed a preference for the
pulverized mica schist agar treatment, while X. viriduloum-
brina grew better on granodiorite and the control than the
dolostone treatment. The results of the growth rates over
time support the previous classification of a ruderal life his-
tory strategy for X. cumberlandia and a stress tolerant life his-
tory strategy for X. viriduloumbrina. The two distinct patterns
of mycelial growth on granodiorite and mica schist treat-
ments, may also suggest different nutrient acquisition strate-
gies or sensitivity to some elements such as La. While the
mycobiont showed preferences for rock type, the photobiont
haplotypes did not support the photobiont guild hypothesis

Please cite this article in press as: Deduke C, Piercey-Normore MD, Substratum preference of two species of Xanthoparmelia, Fun-
gal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.05.005
10
for these lichens. However, the photobiont was located within
the lichen thallus which may have offered some protection
from direct effects of the substratum. The low level of algal se-
lection by the fungal partner and the low level of algal specific-
ity by the substratum may provide a broad range of conditions
conducive to survival of these lichens. While these controlled
laboratory conditions cannot reflect the substratum variabil-
ity found in nature, studies such as this one provide insights
into the establishment of lichen thalli at early stages of
growth, which depend on the success of ascospore germina-
tion and the suitability of the substratum for further lichen de-
velopment. Knowledge of ascospore germination and
substratum type can lead to a better understanding of ecolog-
ical preferences, habitat adaptation, and the potential for
lichenization in the natural environment.
Acknowledgements
We thank T. Booth and K. Fontaine for assistance with lichen
and rock collection, M. Sumner and A. Dufresne for the use of
microscope camera equipment and N.H. Halden for geology
guidance and confirmation of rock identification. Funding
for this study was provided by the Natural Sciences and Engi-
neering Research Council of Canada (Discovery Grant for
MPN), and the University of Manitoba Graduate Funding and
University of Manitoba Faculty of Science Award (for CD).
references
Actlabs, 2014. Sample Preparation Online. http://www.actlabs.
com/page.aspx?menu=72&app=239&cat1=603&tp=2&lk=no
Accessed 12.06.15.
Ahmadjian V, 1993. The Lichen e What can it tell us about lichen
systematic? Bryologist 96: 310e313.
Ascaso C, Galvan J, 1976. Studies on the pedogenic action of
lichen acids. Pedobiologia 16: 321e331.
Athukorala SNP, Huebner E, Piercey-Normore MD, 2014. Identifi-
cation and comparison of the 3 early stages of resynthesis of
the lichen Cladonia rangiferina. Canadian Journal of Microbiol-
ogy 60: 41e52.
Beck A, Friedl T, Rambold G, 1998. Selectivity of photobiont choice
in a defined lichen community: inferences from cultural and
molecular studies. New Phytologist 139: 709e720.
Beck A, 1999. Photobiont inventory of a lichen community grow-
ing on heavy-metal-rich rock. Lichenologist 31: 501e510.
Bellemere A, Letrouit-Galinou MA, 2000. Asci, ascospores and
ascomata. In: Galun M (ed.), CRC Handbook of Lichenology, vol. 2.
CRC Press Inc, Boca Raton, pp. 161e180.
Benedict JB, Nash TH, 1990. Radial growth and habitat selection
by morphologically similar chemotypes of Xanthoparmelia.
Bryologist 93: 319e327.
Blaha J, Baloch E, Grube M, 2006. High photobiont diversity asso-
ciated with the euryoecious lichen-forming ascomycete Leca-
nora rupicola (Lecanoraceae, Ascomycota). Biological Journal of
the Linnean Society 88: 283e293.
Brodo I, Sharnoff SD, Sharnoff S, 2001. Lichens of North America.
Yale University Press, New Haven.
Buchheim MA, Keller A, Koetschan C, Fo € rster F, Merget B, Wolf M,
2011. Internal transcribed spacer 2 (nu ITS2 rRNA) sequence-
structure phylogenetics: towards an automated reconstruc-
tion of the green algal tree of life. PLoS One 6: e16931, 1e10.
Please cite this article in press as: Deduke C, Piercey-Normore MD, Substratum preference of two species of Xanthoparmelia, Fun-
gal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.05.005
C. Deduke, M. D. Piercey-Normore
Bu€ del B, Scheidegger C, 2008. Thallus morphology and anatomy.
In: Nash III TH (ed.), Lichen Biology, 2nd edn. Cambridge Uni-
versity Press, Cambridge, pp. 40e68.
Burford EP, Kierans M, Gadd, 2003a. Geomycology: fungi in min-
eral substrata. Mycologist 17: 98e107.
Burford EP, Fomina M, Gadd, 2003b. Fungal involvement in bio-
weathering and biotransformation of rocks and minerals.
Mineralogical Magazine 67: 1127e1155.
Clement M, Posada D, Crandall KA, 2000. TCS: a computer pro-
gram to estimate gene genealogies. Molecular Ecology 9:
1657e1659.
Cordeiro LMC, Iacomini M, Stocker-Wo € rgo
€ tter E, 2004. Culture
studies and secondary compounds of six Ramalina species.
Mycological Research 108: 489e497.
Cotter DA, 1981. Spore activation. In: Turian A, Hohl HR (eds), The
Fungal Spore. Academic Press, New York, pp. 385e411.
Cotter DA, Raper KB, 1968a. Factor affecting the rate of heat-
induced spore germination in Dictyostelium discoideum.
Journal of Bacteriology 96: 86e92.
Cotter DA, Raper KB, 1968b. Properties of germinating spores of
Dictyostelium discoideum. Journal of Bacteriology 96:
1680e1689.
Deduke C, Booth J, Piercey-Normore MD, 2014. Lichen fecundity
on the Precambrian Shield: an alternative life history strategy
approach. Botany 92: 723e735.
Denison WC, 2003. Apothecia and ascospores of Lobaria oregana
and Lobaria pulmonaria investigated. Mycologia 95: 513e518.
 ndez-Mendoza F, Domaschke S, Garcıa MA, Jordan P,
Ferna
Martın MP, Printzen C, 2011. Population structure of myco-
bionts and photobionts of the widespread lichen Cetraria
aculeata. Molecular Ecology 20: 1208e1232.
Gadd GM, 2007. Geomycology: biogeochemical transformations of
rocks, minerals, metals and radionuclides by fungi, biowea-
thering and bioremediation. Mycological Research 111: 3e49.
Gadd GM, Rhee YJ, Stephenson K, Wei Z, 2012. Geomycology:
metals, actinides and biominerals. Environmental Microbiology
Reports 4: 270e296.
Gadd GM, 2013. Geomycology: fungi as agents of biogeochemical
change. Biology and Environment: Proceedings of the Royal Irish
Academy 113B: 139e153.
Giordani P, Nicora P, Rellini I, Brunialiti Elix JA, 2002. The lichen
genus Xanthparmelia (Ascomycotina, Parmeliaceae) in Italy.
Lichenologist 34: 189e198.
Golm GT, Hill PS, Wells H, 1993. Life expectancy in a Tulsa cem-
etery: growth and population structure of the lichen Xantho-
parmelia cumberlandia. American Midland Naturalist 129:
373e383.
Grime JP, 2002. Plant Strategies, Vegetation Process, and Ecosystem
Properties, 2nd edn. John Wiley, New York.
Gruebe M, DePriest PT, Gargas A, Hafellner J, 1995. DNA isolation
from lichen ascomata. Mycological Research 99: 1321e1324.
Hale ME, 1967. The Biology of Lichens. Edward Arnold, London.
Hale ME, 1990. A synopsis of the lichen genus Xanthoparmelia
(Vainio) Hale (Ascomycotina, Parmeliaceae). Smithsonian Con-
tributions to Botany 74: 1e250.
Helms G, 2003. Taxonomy and symbiosis in associations of Physcia-
ceae and Trebouxia. Inauguraldissertation am Albrecht-von-
Haller Institut fu€ r Pflanzenwissenschaften, Experimentelle
Phykologie und Sammlung von Algenkulturen der Georg-Au-
gust-Universita € t Go€ ttingen, Go
€ ttingen 1e156.
Honegger R, 2008. Morphogenesis. In: Nash III TH (ed.), Lichen
Biology, 2nd edn. Cambridge University Press, Cambridge,
pp. 69e93.
Iskandar IK, Syers JK, 1972. Metal-complex formation by lichen
compounds. Journal of Soil Science 23: 255e265.
Jeong M-H, Kim JA, Yu NH, Jung JS, Hong SG, Cheong YH, Hur J-S,
2015. Isolation and characterization of non-reducing polyketide
synthase gene in Cladonia macilenta. Mycoscience 56: 49e57.
Substratum preference of Xanthoparmelia
Klein C, Dutrow B, 2007. The Manual of Mineral Science, 23rd edn.
John Wiley and Sons, Inc, United States.
Kofler L, 1970. A method to use lichen spores in quantitative
studies on germination. Bryologist 73: 602e606.
Kranner I, Cram WJ, Zorn M, Wornik S, Yoshimura I,
Stabentheiner E, Pfeifhofer HW, 2005. Antioxidants and pho-
toprotection in a lichen as compared with its isolated symbi-
otic partners. PNAS 102: 3141e4146.
Kroken S, Taylor JW, 2000. Phylogenetic species, reproductive
mode, and specificity of green algae Trebouxia forming lichens
with the fungal genus Letharia. Bryologist 103: 645e660.
Leavitt SD, Nelson MP, Lumbsch TH, Johnson LA, St. Clair LL, 2013.
Symbiont flexibility in subalpine rock shield lichen commu-
nities in the Southwestern USA. Bryologist 116: 149e161.
Lendemer JC, 2005. Xanthoparmelia viriduloumbrina, a neglected
species from eastern North America. Mycotaxon 92: 441e442.
Lisci M, Monte M, Pacini E, 2003. Lichens and higher plants on
stone: a review. International Biodeterioration & Biodegradation
51: 1e17.
McCune B, Mefford J, 2011. PC-ORD. Multivariate Analysis of Eco-
logical Data. Version 6.08. MjM Software, Glendon Beach.
Molina MC, Divakar PK, Gonza  lez N, 2015. Success in the isolation
and axenic culture of Anaptychia ciliaris (Physciaceae, Leca-
noromycetes) mycobiont. Mycoscience 56: 351e358.
Molina MC, Crespo A, 2000. Comparison of development of axenic
cultures of five species of lichen-forming fungi. Mycological
Research 104: 595e602.
Mu K, Zhao X, Hu L, Zhang F, Zhang W, Cui J, 2006. Toxicity of
Lanthanum to pathogenic fungi and its morphological char-
acteristics. Journal of Rare Earths 24: 607e612.
Muggia L, Zellnig G, Rabensteiner J, Grube M, 2010. Morphological
and phylogenetic study of algal partners associated with the
lichen-forming fungus Tephromela atra from the Mediterra-
nean region. Symbiosis 51: 149e160.
Ohmura Y, Kawachi M, Kasai F, Watanabe MM, Takeshita S, 2006.
Genetic combinations of symbionts in a vegetatively repro-
ducing lichen, Parmotrema tinctorum, based on ITS rDNA se-
quences. Bryologist 109: 43e59.
Orange A, James PW, White FJ, 2001. Microchemical Methods for the
Identification of Lichens. British Lichen Society, London.
Paustian K, Schnu € rer J, 1987. Fungal growth response to carbon
and nitrogen limitation: a theoretical model. Soil Biology and
Biochemistry 19: 613e620.
Please cite this article in press as: Deduke C, Piercey-Normore MD, Substratum preference of two species of Xanthoparmelia, Fun-
gal Biology (2015), http://dx.doi.org/10.1016/j.funbio.2015.05.005
11
Peck JE, 2010. Multivariate Analysis for Community Ecologist. MjM
Software Design, Glenedon Beach, Oregon.

Peksa O, Skaloud P, 2011. Do photobionts influence the ecology of
lichens? A case study of environmental preferences in sym-
biotic green alga Asterochloris (Trebouxiophyceae). Molecular
Ecology 20: 3936e3948.
Piercey-Normore MD, 2006. The lichen-forming ascomycete
Evernia mesomorpha associates with multiple genotypes of
Trebouxia jamesii. New Phytologist 169: 331e344.
Piercey-Normore MD, 2009. Vegetatively reproducing fungi in
three genera of the Parmeliaceae share divergent algal part-
ners. Bryologist 112: 773e785.
Rikkinen J, Oksanen I, Lohtander K, 2002. Lichen guilds share re-
lated cyanobacterial symbionts. Science 19: 357.
Rizzi G, Giordani P, 2013. The ecology of the lichen genus Xan-
thoparmelia in Italy: an investigation throughout spatial scales.
Plant Biosystems 147: 33e39.
Saunders GW, Kucera H, 2010. An evaluation of rbcL, tufA, UPA,
LSU and ITS as DNA barcode markers for the marine green
marcoalgae. Cryptogramie, Algologie 31: 487e528.
Saunders GW, McDevit DC, 2012. Methods for DNA barcoding
photosynthetic protists emphasizing the macroalgae and
diatoms. In: Lopez I, Erickson DL (eds), DNA Barcoding:
methods and protocols, methods in molecular biology, vol. 858,
pp. 207e222.
Scarciglia F, Saporito N, La Russa MF, Le Pera E, Macchione M,
Puntillo D, Crisci GM, Pezzino A, 2012. Role of lichens in
weathering of granodiorite in the Sila uplands (Calabria,
southern Italy). Sedimentary Ecology 280: 119e134.
St John TV, Coleman DC, Reid CCP, 1983. Growth and
spatial distribution of nutrient-absorbing organs:
selective exploitation of soil heterogeneity. Plant and Soil 71:
487e493.
Stocker-Wo € rgo
€ tter E, 2002. Resynthesis of Photobiodemes. In:
Kranner I, Beckett RP, Varma AK (eds), Protocols in Lichenology.
Springer-Verlag Berlin, Heidelberg, Germany, pp. 51e52.
Yahr R, Vilgalyis R, DePriest PT, 2006. Geographic variation in
algal partners of Cladonia subtenuis (Cladoniaceae) highlights
the dynamic nature of a lichen symbiosis. New Phytologist 171:
847e860.
Zar JH, 2010. Biostatistical Analysis, 5th edn. Prentice Hall, New
Jersey.