Вы находитесь на странице: 1из 8

MEEGID-02926; No of Pages 8

Infection, Genetics and Evolution xxx (2016) xxx–xxx

Contents lists available at ScienceDirect

Infection, Genetics and Evolution

journal homepage: www.elsevier.com/locate/meegid

Research paper

Molecular characterization of multidrug-resistant Mycobacterium tuberculosis isolates


from high prevalence tuberculosis states in Mexico
Dulce Maria Juarez-Eusebio a, Daniela Munro-Rojas a,h, Raquel Muñiz-Salazar b,f, Rafael Laniado-Laborín c,d,f,
Jose Armando Martinez-Guarneros f,g, Carlos A. Flores-López e,f, Roberto Zenteno-Cuevas a,f,⁎
a
Instituto de Salud Pública, Universidad Veracruzana, Av. Luis Castelazo Ayala s/n, Col. Industrial Animas, CP 91190 Jalapa, Veracruz, Mexico
b
Laboratorio de Epidemiología y Ecología y Molecular, Escuela de Ciencias de la Salud, Universidad Autónoma de Baja California, Ensenada, Baja California, Mexico
c
Clínica de Tuberculosis, Hospital General de Tijuana, ISESALUD, Tijuana, Baja California, Mexico
d
Facultad de Medicina y Psicología, Universidad Autónoma de Baja California, Baja California, Mexico
e
Facultad de Ciencias, Universidad Autónoma de Baja California, Ensenada, Baja California, Mexico
f
Red Multidisciplinaria de Investigación en Tuberculosis (www.remitb.org), Mexico
g
Departamento de Mycobacterias, Instituto Nacional de Diagnóstico y Referencia Epidemiológica, Mexico
h
Instituto de Ciencias de Salud, Universidad Veracruzana, Veracruz, Mexico

a r t i c l e i n f o a b s t r a c t

Article history: Mexico is one of the most important contributors of multidrug resistance tuberculosis (MDR-TB) in Latin-Amer-
Received 17 May 2016 ica, however little is known about the molecular characteristics of these strains. For this reason, the objective of
Received in revised form 20 August 2016 this work was to determine the genotype and characterize polymorphisms in genes associated with resistance to
Accepted 12 September 2016
rifampicin, isoniazid, and second-line drugs in isolates from two regions of Mexico with high prevalence of drug
Available online xxxx
resistant tuberculosis.
Keywords:
Clinical isolates from individuals with confirmed MDR-TB were genotyped using MIRU-VNTR 12 loci. To charac-
Multidrug resistance terize the polymorphisms in genes associated with resistance to rifampicin, isoniazid and second-line drugs;
Tuberculosis rpoB, katG, inhA, rrs, eis, gyrA, gyrB and tlyA were sequenced.
Veracruz 22 (41%) of the 54 MDR-TB isolates recovered were from the state of Baja California, while 32 (59%) were from
Baja California Veracruz. The results show the katGS315T mutation was observed in 20% (11/54) of the isolates, while rpoBS315L
was present in 33% (18/54). rrs had three polymorphisms (T1239C, ntA1401C and ntA1401G), gyrB presented no
modifications, whereas gyrA showed five (S95T, F60Y, A90V, S91P and P124A), eis two (G-10A and A431G) and
tlyA one (insertion at codon 67). Only 20% (11/54) of isolates were confirmed as MDR-TB by sequencing, and no
mutations at any of the genes sequenced were observed in 43% (23/54) of the strains. Two isolates were recog-
nized with the proper set of mutations like pre-XDR and one was XDR-TB. Eighteen isolates were classified as or-
phans and the remaining thirty-six were distributed in fourteen lineages, the most frequent were S (11%),
Haarlem (9%), Ghana (9%) and LAM (7%). Out of the fourteen clusters identified, seven included unknown geno-
types and nine had lineages.
This is one of the most detailed analyses of genotypic characteristics and mutations associated with drug resis-
tance to first and second-line drugs in MDR-TB isolates from Mexico. An important genetic variability and signif-
icant discrepancy between phenotypic tests and polymorphisms was observed. Our results set the need to screen
additional loci as well as implement a molecular epidemiological surveillance system of MDR-TB in the country.
© 2016 Published by Elsevier B.V.

1. Introduction inadequate administration of antimicrobial therapy are the most impor-


tant factors contributing to the development of tuberculosis drug resis-
The 2015 World Health Organization (WHO) Tuberculosis (TB) Re- tance (DR-TB). According to the WHO, DR-TB has become a major
port estimated 9.6 million new cases of TB in 2014 and 1.5 million public health problem in several countries. It is estimated that close to
deaths caused by the disease. Mismanagement of patients and half a million cases exhibit simultaneous resistance to isoniazid and ri-
fampicin, an aggravated form of TB resistance defined as MDR-TB. Re-
cently, the emergence of a more aggressive form of MDR-TB showing
⁎ Corresponding author at: Instituto de Salud Pública, Universidad Veracruzana, Av. Luis
additional resistance to any fluoroquinolone and at least one of the
Castelazo Ayala s/n, A.P. 57, Col. Industrial Animas, Jalapa, Veracruz CP 91190, México. three second-line injectable drugs (i.e. amikacin, capreomycin, or kana-
E-mail address: robzencue@gmail.com (R. Zenteno-Cuevas). mycin) has been reported. This form has been labeled extensively drug-

http://dx.doi.org/10.1016/j.meegid.2016.09.012
1567-1348/© 2016 Published by Elsevier B.V.

Please cite this article as: Juarez-Eusebio, D.M., et al., Molecular characterization of multidrug-resistant Mycobacterium tuberculosis isolates from
high prevalence tuberculosis states in Mexico..., Infection, Genetics and Evolution (2016), http://dx.doi.org/10.1016/j.meegid.2016.09.012
2 D.M. Juarez-Eusebio et al. / Infection, Genetics and Evolution xxx (2016) xxx–xxx

resistant TB (XDR-TB) and possess a major threat to TB control (WHO, from this study were overseen by the respective committee of the Public
2015). Health Institute of the University of Veracruz.
According to the 2014 Report on TB by the National Mycobacteriosis
Program, out of the 19,000 cases of pulmonary TB diagnosed each year
2.2. DNA extraction and drug resistant genes amplification
in Mexico, close to 200 (1.3%) are caused by drug resistant strains. The
number of MDR-TB and XDR-TB cases reported is increasing especially
A loop of fresh culture isolate was suspended in 500 μL of TE buffer
in five states: Nuevo Leon, Tamaulipas, Guerrero, Veracruz, and Baja Cal-
[10 mM Tris/HCl (pH 8.0), 1 mM EDTA] and DNA was further purified
ifornia, the former three contributing with 50%, and the latter two with
according to Van Soolingen (van Soolingen et al., 1991). The DNA con-
80% of the total number of DR-TB and MDR-TB cases (Castellanos-Joya,
centration was measured by a Nanodrop 100 (ThermoScientific, USA)
2014).
and stored at −20 °C, until use.
Recent reports on the characterization of genotypic features and mu-
Table 1 shows the list of primers used for the amplification of the
tations associated with resistance to rifampicin (rpoB); isoniazid (katG
eight genes related to resistance to both rifampicin (rpoB) and isoniazid
and inhA); fluoroquinolones (gyrA and gyrB); as well as to kanamycin,
(katG and inhA); fluoroquinolones (gyrA and gyrB); amikacin, kanamy-
amikacin, and capreomycin (rrs, eis and tlyA) in MDR-TB and XDR-TB
cin, and capreomicin (tlyA, eis and rrs). The PCR reaction mix contained:
isolates show variations among geographical regions (Bhembe et al.,
10 mM Tris pH 8; 1.5 mM MgCl2; 0.2 mM of each deoxynucleotide tri-
2014; Chaoui et al., 2009; Chen et al., 2014; Feuerriegel et al., 2009;
phosphate; 10 μM of forward and reverse primers; 1.25 U Taq polymer-
Flores-Trevino et al., 2014; Jugheli et al., 2009; Morlock et al., 2003;
ase (Promega, USA); 5% glycerol; 100 ng DNA template; and water free
Perdigao et al., 2010; Sandgren et al., 2009; Sekiguchi et al., 2007;
nuclease to a final volume of 25 μL. The amplifications were performed
Siddiqi et al., 2002; Sowajassatakul et al., 2014; Surcouf et al., 2011;
individually for each gene in a Verity thermocycler (Applied Biosystems,
Zenteno-Cuevas et al., 2009). In addition, description of genotypes and
USA) according to the following conditions: initial denaturation step of
polymorphisms in genes related to drug resistance in TB isolates from
95 °C for 3 min; 35 cycles of 95 °C for 40 s; 57 °C for 30 s and 72 °C for
Mexico is somewhat limited (Flores-Trevino et al., 2014;
1 min; and 72 °C for 3 min. Amplicon sizes were verified by electropho-
Martinez-Guarneros et al., 2013; Nava-Aguilera et al., 2011;
resis in 1.5% agarose gel and further purified by using ExoSap (USB).
Ramaswamy et al., 2004; Zenteno-Cuevas et al., 2015; Zenteno-Cuevas
Final DNA concentration was determined by electrophoresis by using
et al., 2009). For these reasons, the goal of this work was to determine
the Mass Ruler low-range DNA Ladder (Fermentas, Thermo Fisher Sci-
the genotypes and polymorphisms presented in genes associated to
entific, Pittsburgh, PA, USA).
first and second line drugs in a set of MDR-TB isolates from Veracruz
and Baja California, two of the states with the highest prevalence and in-
cidence of DR-TB and MDR-TB in Mexico. 2.3. DNA sequencing and sequence analysis

The sequencing reactions were performed in forward directions


2. Methods using 6 μL of Big Dye Terminator Cycle Sequencing Kit V3.1 (Applied
Biosystems, USA); 3.2 pM of forward primers and 20 ng of purified
2.1. Collection of clinical samples, isolation of Mycobacterium tuberculosis PCR product to a final volume of 20 μL. Amplification conditions were
and drug susceptibility test 25 cycles of 95 °C for 30 s; 50 °C for 15 s; and 60 °C for 4 min. The prod-
ucts were purified using the ZR DNA sequencing clean-up kit™ (Zymo
Fifty-four sputum samples from the same number of patients con- Research, USA); re-suspended in Hi-Di formamide (Applied Biosystems,
firmed as MDR-TB cases by the tuberculosis state programs from Vera- USA); heated to 95 °C for 5 min; cooled on ice; and finally loaded into a
cruz and Baja California were collected from January 2010 to July 2013. 96-well plate MicroAmp reaction plate (Applied Biosystems, USA). The
The samples were processed by standard methods (N-acetyl-L-cysteine- sequencing of the DNA products was done by capillary electrophoresis
sodium hydroxide), and their isolates were recovered in Löwenstein- and analyzed in a Genetic Analyzer 3500 (Applied Bio-systems, USA).
Jensen media. Drug susceptibility against first-line drugs—streptomycin Fluorescence spectra were analyzed with software Data Collection
(S), isoniazid (H), rifampin (R), ethambutol (E), and pyrazinamide V1.01 (Applied Bio-systems, USA). Sequence Analysis and mutation
(Z)—was confirmed by the fluorometric method (MGIT 960; Becton identification were performed via Sequencing Analysis V5.4 and
Dickinson, Franklin Lakes, NJ, USA). No physical interventions were de- SeqScape V2.7 programs (Applied Bio-systems, USA), respectively.
veloped in the patients. All information collected was confidential and Wild-type genes from Mycobacterium tuberculosis H37Rv were used
written consent was obtained from each patient. Ethical issues derived as reference sequences and all mutations found were compared against

Table 1
Primers used in this study.

Drug Gen Primers Sequence Product (pb) Amplified region Reference

Isoniazid (H) katG 1 katG-F 5_GCAGATGGGGCTGATCTACG_3 555 From codon 224–407 Zenteno-Cuevas et al. (2009)
katG-R 3_AACTCGTCGGCCAATTCCTC_5
inhA inhA-F 5_AGGTCGCCGGGGTGGTCAGC_3 517 From −115 to 134 Morlock et al. (2003)
inhA-R 3_AGCGCCTTGGCCATCGAAGCA_5
Rifampicin (R) rpoB 1 rpoB-F 5_AGCGGATGACCACCCAGGAC_3 266 From codón 478 to 564 Zenteno-Cuevas et al. (2009)
rpoB-R 3_TCAGGGGTTTCGATCGGGCA_5
Ofloxacin (Q) gyrA gyrA-F 5_GATGACAGACACGACGTTGC_3 398 From codon 1 to 132 Perdigao et al. (2013)
gyrA-R 3_GGGCTTCGGTGTACCTCAT_5
gyrB gyrB-F 5′_ACGCGAAAGTCGTTGTGACA_3 520 From codon 408 to 584
gyrB-R 5′_TACAAACTCAAGTGGCAGCG_3′
Capreomycin (C) tlyA tlyA-F 5′ GTTGTTGGCCGCCCTGGAGT 3′ 807 From codon 1 to 269 Perdigao et al. (2010, 2013)
tlyA-R 5′ GGTCTCGGTGGCTTCGTCGC 3′
Amikacin Kanamicin (A/K) rrs rrs2-F 5′ TGCCGGGGTCAACTCGGAGG 3′ 440 From nucleotide 1151 to 1591
rrs2-R 5′ GAACCCCTCACGGCCTACGC 3′
eiS eis-F 5′ GCCATGGGACCGGTACTTGC 3′ 601 From nucleotide 1 to 601
eis-R 5′ GTAGATGCCGCCCTCGCTAG 3′ Bhembe et al. (2014)

Please cite this article as: Juarez-Eusebio, D.M., et al., Molecular characterization of multidrug-resistant Mycobacterium tuberculosis isolates from
high prevalence tuberculosis states in Mexico..., Infection, Genetics and Evolution (2016), http://dx.doi.org/10.1016/j.meegid.2016.09.012
D.M. Juarez-Eusebio et al. / Infection, Genetics and Evolution xxx (2016) xxx–xxx 3

those included in the TB Drug resistance Mutation Database (Sandgren observed in the same number of isolates, however, no mutations were
et al., 2009). observed in the remaining 51 (94%) isolates. Only 15 (30%) strains pre-
sented a mutation in one of the two genes analyzed, the remaining 39
2.4. MIRU-VNTR12 loci typing and clustering (70%) were absent of any change in katG and inhA (Table 2).
According to the rifampicin resistance, we detected ten different
MIRU-VNTR 12 loci was performed as described elsewhere (Supply polymorphisms in six codons of rpoB in 27 isolates (50%), the most com-
et al., 2006). Amplified products were size-analyzed via an ABI 310 au- mon was S315L (G163T) found in 18 isolates (33%), followed by two
tomated DNA sequencer (Applied Biosystems), and alleles visualized (4%) mutations in codon 531 (S531W and S531V). Three (6%) different
and scored by means of the program GeneMarker 1.97 (Softgenetics). mutations in codon 526 (H526Y, H526D and H526R) were observed in
The number of repeats in each locus was calculated by applying the cor- the same number of isolates. On the other hand, polymorphisms were
responding conversion table (Weniger et al., 2010). Genotypes were observed in codons Q513P and S522L, and two deletions of fourteen
expressed as numerical codes representing the number of MIRU-VNTR and two nucleotide at codons 508 and 514 respectively. Finally, 27
for each loci. Lineages were identified individually by using the similar- (50%) isolates were absent of any mutation in rpoB (Table 2).
ity search module, dendogram and clustering was constructed by the
unweighted-pair group method by using average linkages (UPGMA) 3.3. MDR-TB phenotypic vs. genotypic characterization
after pairwise comparison of strains by calculation of the Jaccard index
(Allix-Beguec et al., 2008; Weniger et al., 2010). Considering the 54 MDR isolates that were analyzed, only 20% (11/
54) had simultaneous mutations in rpoB, katG and inhA genes, locating
3. Results to those isolates as genotypically resistant to rifampicin and isoniazid,
i.e. MDR-TB. Out of these 11 isolates, 4% (2/54) showed simultaneous
3.1. Population characteristics mutations in inhA (codons 21 and 40) and rpoB (codons: 531/526). Si-
multaneous mutations at katG (codon 315) and rpoB (codons: 531 and
In this study, 54 MDR isolates of M. tuberculosis were recovered. Baja 526), were observed in 15% (8/54) isolates. Only 1% (1/54) of the iso-
California provided 22 (41%) samples and Veracruz the remaining 32 lates showed changes in the three genes. The reaming 80% (43/54) iso-
(59%). The average age of the population was 43 ± 15 years and 57% lates did not present the simultaneous mutations to confirm its
(31) of individuals were male. The most frequent co-morbidities were genotypic classification as MDR-TB. Finally 43% (23/54) of strains were
type 2 diabetes mellitus with 26% (14), followed by HIV with 14% (8). absent of any mutation at the eight loci sequenced.
Only 7% (4) of patients mentioned alcohol consumption. 54% (29) men-
tioned TB as primary diagnosis and 35% (19) reported a previous drug 3.3.1. rrs, gyrA, gyrB, eis, tlyA mutations
treatment. The average number of drug resistance was 3.8 ± 1.2. In ad- Three polymorphisms were observed in rrs, and the most common
dition to R and H, 59% (32) of isolates were resistant to E + S + Z; 48% was T1239C located in five (9%) isolates, followed by changes in nucle-
(26) to the combination H + R + E + Z; 16% (9) to H + R + E + S, and otides ntA1401C and nt1401G. No changes were observed in 47 (87%)
9% (5) to H + R + Z + S. isolates (Table 3).
Gene gyrA showed five mutations in the same number of codons.
3.2. katG, inhA and rpoB mutations The most frequent was S95T (G284C) found in 42 (78%) isolates;
F60Y, A90V and S91P polymorphisms were found in one isolate each
For isoniazid resistance, only 13 (22%) isolates carried mutations in and P124A in two of them. Only seven (15%) isolates did not show
katG, of which the most prevalent was in codon S315T (G276C) found any changes. In gene gyrB no changes were observed (Table 3). Two iso-
in 11 (20%) isolates, while 41 (76%) isolates were absent of any muta- lates showed changes in gene eis, G-10A and A431G. Gene tlyA present-
tion in this gene. On the other hand, only three inhA mutations were ed only one insertion at nucleotide 67 in a single isolate (Table 3).

3.4. Genotypes, clustering and drug resistance polymorphisms


Table 2
Detection of mutations at first line drug resistance genes in MDR-TB isolates from Mexico,
The MIRU-VNTR 12-loci analysis showed twenty-four different ge-
(n = 54).
notypes and fourteen lineages in the 54 MDR-TB isolates characterized.
Frequency Dendogram (Fig. 1) showed nine (17%) singletons and 14 clusters
Gene (resistance) Codon Amino acid Polymorphism N (%)

katG (H) 315 S→T 276 G/C 11 (20) Table 3


315 S→N 276 G/A 1 (2) Detection of at second line drug resistance genes in MDR-TB isolates from Mexico, (n = 54).
238 N→G 45/G* ƛ 1 (2)
333 L→V 329 G/C*ƛ Frequency
No mutation 41 (76)
Codon Amino acid Polymorphism N (%)
inhA (H) 40 G→W 120 G/T 1 (2)
59 I→V 177 A/G 1 (2) rrs – T1239Cƛ 5 (9)
137 M→I 410 G/K 1 (2) – A1401C 1 (2)
No mutation 51 (94) – A1401G 1 (2)
rpoB (R) 508 Del 93–107 Del 93–107 1 (2) No mutation 47(87)
514 Del 112–114 Del 112–117 1 (2) gyrA 60 F→Y TC179ATƛ 1 (2)
513 Q→P 109 A/C* 1 (2) 90 A→V C269T 1 (2)
522 S→L 136 C/T 1 (2) 91 S→P T271C 1(2)
526 H→Y 147 C/T 1 (2) 95 S→T G284C 42 (78)
H→D 147 C/G 1 (2) 124 P→A C370Gƛ 2 (2)
H→R 148 A/G 1 (2) No mutation 7 (15)
531 S→L 163 C/T 18 (33) eis – G-10A 1 (2)
S→W 163 C/G 1 (2) V→M A431Gƛ 1 (2)
S→V 164 C/G* 1 (2) No mutation 52
No mutation 27 (49%) tlyA Ins67ƛ 1 (2)
No mutation 53
*) Single isolated with two mutations, ƛ) no associated with resistance against first line
ƛ
drug. ) No associated with resistance against second line drug.

Please cite this article as: Juarez-Eusebio, D.M., et al., Molecular characterization of multidrug-resistant Mycobacterium tuberculosis isolates from
high prevalence tuberculosis states in Mexico..., Infection, Genetics and Evolution (2016), http://dx.doi.org/10.1016/j.meegid.2016.09.012
4 D.M. Juarez-Eusebio et al. / Infection, Genetics and Evolution xxx (2016) xxx–xxx

Fig. 1. Dendogram showing MIRU-VNTR (mycobacterial interspersed repetitive units-variable number tandem repeats) analysis of 54 multi-drug resistant M. tuberculosis isolates (n = 53)
from Mexico.

conformed by forty five isolates. Five clusters including thirteen (24%) lineage had the single mutation katGS315T. The isolate with Uganda lin-
isolates were classified as unknown, and nine clusters including 32 eage was absent of any mutation. Finally, the strain with LAM3 lineage
(59%) isolates with lineage. (Table 4 and Fig. 1). was identified as XDR-TB as it is described later (Table 4).
Four isolates were considered as singleton orphans (Table 4). Three The third group had five clusters including thirteen isolates with a ge-
mutations at rpoBS531L, one at katGS315T and rrsntA1401G, and five notype considered as unknown: The cluster 1 with the MIRU-12 code
changes not related to drug-resistance were observed in inhAG40W, 224425093020 includes two isolates, with the mutations rpoBS531L
katGN238G katGL333V, rrsntT1239C and tlyins671G. (Table 4). and katGS315T in one strain. The cluster 2 with the MIRU-12 code
The second group included five singletons with lineage: The first one 223425154322; includes two isolates and a single mutation rpoBS531L.
was a M. bovis, bearing mutations rpoBA513P and eisntA431G. The iso- The cluster 3 with the MIRU-12 code 225326082023; includes two iso-
late with T lineage had a mutation rpoBS531L. The strain with New 1 lates, with two mutations rpoBS522L and rrsntT1239C. The cluster 4

Please cite this article as: Juarez-Eusebio, D.M., et al., Molecular characterization of multidrug-resistant Mycobacterium tuberculosis isolates from
high prevalence tuberculosis states in Mexico..., Infection, Genetics and Evolution (2016), http://dx.doi.org/10.1016/j.meegid.2016.09.012
D.M. Juarez-Eusebio et al. / Infection, Genetics and Evolution xxx (2016) xxx–xxx 5

Table 4
Genotypic characteristics, MIRU-VNTR loci 12, and mutations related to drug resistance in MDR-TB isolates from Mexico.

Polymorphism
Isolate/drug resistance Isolation
No MIRUVNTR 12 profile site katG inhA rpoB eis rrs tlyA gyrA

Singletons orphan
N238G (45
A/G)ƛ
L333V (329
1 223315482513 215–14/SHREZ VER C/G)ƛ ±
1239 Ins 671
2 220425063024 331–14/HR VER S531L (163 C/T) T/Cƛ Gƛ ±
G40W (120
3 223225142325 323–14/HR VER G/T)ƛ S531L (163 C/T) ±
S315T (276 1401
4 325226152211 541–14/HRZ* VER G/C) S531L (163 C/T) A/G ±

Singletons with lineages


5 233324253322 (M. 189-14/HRZ VER Q513P (110 A/G) 431 ±
bovis) A/Gƛ
6 324536254522 (T) 109-14/SHREZ VER S531L (163 C/T)
7 324437284021 188-14/SHREZ** VER S315T (276 M137I (410 S531L (163 C/T) −10 1401 S91P (271
(LAM3) G/C) G/K) G/A A/C T/C)
8 225225143223 288-14/SHRE VER S315T (276 ±
(NEW1) G/C)
9 223324153223 C078/SHREZ BC ±
(Uganda I)

Cluster 1: unknown
10 224425093020 264-14/SHRZ VER S315T (276 S531L (163 C/T) ±
G/C)
11 213425091010 286-14/HR VER ±

Cluster 2: unknown
12 223425154322 63-14/HR VER S531L (163 C/T) ±
13 213425154322 C304/SHREZ BC ±

Cluster 3: unknown
14 225326082023 31-14/HR VER S522L (136 C/T)
15 224325482025 276-14/HRZ VER 1239
T/Cƛ

Cluster 4: unknown
16 224325143323 C307/SHESZ BC
17 223325143323 C093/HRE BC 1239 ±
T/Cƛ P124A
(C370G)ƛ
18 224425143323 122-14/HR VER Del 112–117
TCATGG

Isolate/drug resistance Isolation


No MIRUVNTR 12 profile site katG inhA rpoB eis rrs tlyA gyrA

19 223325143323 266-14/HR VER


Cluster 5: unknown
20 223125153324 271-14/HR VER S531L (163 C/T) ±
F60Y
(TC179AT)ƛ
21 223325153324 518-14/SHREZ VER S315T (276 G/C) S531L (163 C/T) 1239 ±
T/Cƛ
22 223325153321 120-14/HREZ VER S315T (276 G/C) S531L (163 C/T) ±

Cluster 6: X
23 224325153325 300-14/HR VER S531L (163 C/T) ±
24 224325153225 42-14/SHR VER S315T (276 G/C) S531W (163 C/G) ±

Cluster 7: EAI
25 224427163591 63-07/HREZ VER I21V (61 H526D (147 C/G) ±
A/G)
26 224427163591 53-07/HREZ VER S531L (163 C/T) ±

Cluster 8: Cameroon
27 223315153313 241-14/HRE VER S531L (163 C/T) 1239 ±
T/Cƛ
28 223315153323 220-14/HR VER Del 93–107 ±
ACCAGCCAGCTGAGC

Cluster 9: Beijing
29 223325153533 C075/SHREZ BC ±
30 223325171531 61-14/SHREZ* VER S315T (276 G/C) S531L (163 C/T) A90V (269 C/T)
31 223325173533 C314/SHREZ BC S315T (276 G/C) H526R (148 A/G) ±

(continued on next page)

Please cite this article as: Juarez-Eusebio, D.M., et al., Molecular characterization of multidrug-resistant Mycobacterium tuberculosis isolates from
high prevalence tuberculosis states in Mexico..., Infection, Genetics and Evolution (2016), http://dx.doi.org/10.1016/j.meegid.2016.09.012
6 D.M. Juarez-Eusebio et al. / Infection, Genetics and Evolution xxx (2016) xxx–xxx

Table 4 (continued)

Isolate/drug resistance Isolation


No MIRUVNTR 12 profile site katG inhA rpoB eis rrs tlyA gyrA

Cluster 10: X3
32 332326362344 659-08/HREZ VER S531L (163 C/T) ±
33 332326362344 687-09/HREZ VER S531L (163 C/T)
34 332326362344 701-09/SHRE VER H526Y (147 C/T)

Cluster 11: LAM


35 224226153321 C175/SHREZ BC ±
36 224236153321 C062/SHREZ BC ±
37 224226153221 C168/SHREZ BC ±
38 224326153321 262-14/SHRE VER S531L (163 C/T)

Cluster 12: Ghana


39 223325164333 C057/SHREZ BC ±
40 223325164333 C171/SHRE BC ±
41 223325164333 C309/SHREZ BC ±
42 223325153334 62-14/HR VER S531L (163 C/T) ±
43 223325163333 297-14/HR VER

Cluster 13: Haarlem


44 225313153323 C303/SHRESZ BC ±
45 225325153323 C169/SHREZ BC ±
46 225325153323 C305/SHREZ BC ±
47 225325153323 C308/SHREZ BC ±
48 225225153323 07-14/SHREZ VER S315N (276 S531L (163 C/T) ±
G/A)

Cluster 14: S
49 333325155222 C311/SHREZ BC ±
50 333325153222 C038/HRE BC S315T (276 G/C) ±
51 333325153222 C067/SHREZ BC
52 333325153222 C310/SHREZ BC ±
53 333325153322 C167/SHREZ BC
54 334325153322 C306/SHREZ BC S315T (276 G/C) ±

*) pre-XDR-TB isolates. **) XDR-TB isolate. ±) S95T mutation. VER) Veracruz. BC) Baja California. ƛ) No associated with resistance against first or second line drugs. S).

with the MIRU-12 code 224325143323; includes four isolates, with the phenotypic resistant against isoniazid, rifampicin and pyrazinamide.
deletion rpoB112–117 (TCATGG), and mutations rrs ntT1239C and The mutations katGS315T, rpoBS531L and rrsntA1401G were observed,
gyrAP124A. The cluster 5 with the MIRU-12 code 223125153324; in- all associated with resistance against isoniazid, rifampicin and kanamy-
cludes three isolates and three mutations at rpoBS531L, two at katGS315T cin/amikacin. The second pre-XDR isolate, 61-14, was found in cluster 9
and one change at rrsntT1239C and gyrAF60Y (Table 4). with a MIRU-12 code 223325171531 and Beijing lineage; show resis-
The fourth group considers 9 clusters and includes 32 (59%) isolates tance against all first-line drugs and mutations at katGS315T,
with 9 lineages. The Cluster 6 with MIRU-12 code 224325153325; in- inhAM137I, rpoBS531L and gyrAA90V, all confirmed as participating in
cludes two (4%) isolates with X lineage, with two mutations in rpoBS531L resistance against isoniazid, rifampicin and fluoroquinolones.
and one in katGS315T. The cluster 7 with MIRU-12 code 224427163591; The XDR-TB isolate, 188-14, was a singleton with a LAM3 lineage
contains two (4%) isolates with EAI lineage, and three mutations, and resistance against all first-line drugs. The mutations observed
rpoBH526D, rpoBS531L and inhAI21V. The cluster 8 had the MIRU-12 katGS315T, rpoBS531L, eis10G/A, rrsntA1401C and gyrAS91P, are associ-
code 223315153313; comprise two (4%) strains with Cameroon lineage, ated with resistance against isoniazid, rifampicin, kanamycin-amikacin-
and polymorphisms rpoBS531L, rrsntT1239C and one deletion at rpoB93– capreomicin and fluoroquinolones (Table 4).
107. The cluster 9 with MIRU-12 code 223325153533; embraces three
(6%) isolates having a Beijing lineage, two mutations at katGS315T, and 4. Discussion
mutations at rpoBS531L, rpoBH526R and gyrAA90V. The cluster 10 had
the MIRU-12 code 332326362344; includes three (6%) isolates with X3 Mexico has the fourth place for incidence of TB and TB-DR in Latin
lineage, with two rpoBS531L and one rpoBH526Y mutation. The cluster America. Official reports indicate that out of the 19,000 TB cases annual-
11 had the MIRU-12 code 224226153321; includes four (7%) isolates ly reported, near to 1.5% are DR-TB, 0.4% are MDR-TB and 0.04% are
with LAM lineage, and only one rpoBS531L mutation. The cluster 12 XDR-TB. In addition, Veracruz and Baja California are placed within
with MIRU-12 code 223325164333; includes five (9%) isolates with the first five states with the highest number of MDR-TB cases
Ghana lineage, and one rpoBS531L mutation. The cluster 13 with the (Castellanos-Joya, 2014). This figures place to the DR-TB in Mexico as
MIRU-12 code 225313153323; contains five (9%) isolates with Haarlem a growing problem that require immediate attention.
lineage, and one mutation at katGS315T and rpoBS531L. The cluster 14 Among the individuals exhibiting MDR-TB a vast 54% (29/54) had
had the MIRU-12 code 333325155222; contains six (11%) isolates with never been treated against TB, and showed resistance to at least three
S lineage (11%), and only two katGS315T mutations. (Table 4). first-line drugs. This suggests that the patients acquired a MDR-TB strain
previously developed; this could be explained by the high prevalence of
3.5. Molecular characterization of preXDR- and XDR-TB isolates TB-MDR previously mentioned in both states. This deems necessary to
genotipically confirmed strengthen the TB surveillance systems, and closely monitor contacts
of individuals with MDR-TB with aim to avoid the dispersion of these
Two isolates presented the mutations that confirm their condition of aggravated forms of TB.
being preXDR-TB and one XDR-TB. The first preXDR-TB isolate, 541-14, The mutation 531 in rpoB, was observed in 35% (19/54) of rifampicin
MIRU-12 code 325226152211; was an orphan singleton, with resistant isolates, rendering this mutation as the most frequent. This is

Please cite this article as: Juarez-Eusebio, D.M., et al., Molecular characterization of multidrug-resistant Mycobacterium tuberculosis isolates from
high prevalence tuberculosis states in Mexico..., Infection, Genetics and Evolution (2016), http://dx.doi.org/10.1016/j.meegid.2016.09.012
D.M. Juarez-Eusebio et al. / Infection, Genetics and Evolution xxx (2016) xxx–xxx 7

in agreement with previous reports that have established this polymor- the A431G polymorphism, so are necessary more studies to confirm
phism as the most frequent in isolates resistant to rifampicin in Mexico its real role.
and other countries (Flores-Trevino et al., 2015; Kozhamkulov et al., 36% of the changes associated with resistance to capreomycin have
2011; Poudel et al., 2012; Ramaswamy et al., 2004; Zenteno-Cuevas et been described in tlyA. However, only one insertion was identified in
al., 2015; Zenteno-Cuevas et al., 2009). However, 50% (27/54) of the iso- nucleotide 67, even though deletions have been associated with resis-
lates did not show any change, further corroborating efforts need to be tance to capreomycin in this nucleotide (Feuerriegel et al., 2009;
done in order to uncover potential polymorphism associated with the Georghiou et al., 2012).
resistance phenotype that may be present outside the sequenced region One of the major limitations of this study was the incapacity to per-
of rpoB and other genes, such as rpoA and rpoC (Comas et al., 2012; Siu et form a phenotypic analysis of sensitivity against second line drugs,
al., 2011). which arises the issue that more studies need to be done in order to
Only 14% (13/54) of the isolates resistant to isoniazid presented evaluate the participation of the five polymorphisms reported for the
polymorphisms in katG, which make it the lowest average value report- first time. Undoubtedly, the identified polymorphisms help to assess
ed so far (Flores-Trevino et al., 2015; Jagielski et al., 2013; Kozhamkulov the degree of development that is present in these MDR-TB isolates in
et al., 2011; Poudel et al., 2012; Sandgren et al., 2009; Zenteno-Cuevas et order to establish it first as pre-XDR and finally as XDR in the popula-
al., 2015). On the other hand, only 6% (3/54) showed genetic polymor- tion. The point described above creates a need to closely monitor at
phisms in inhA, which coincides with values reported for Mexico the molecular level the MDR-TB cases and the occurrence of these
(Flores-Trevino et al., 2015). It was only possible to explain the resis- polymorphisms.
tance against isoniazid in 27% (15/54) of isolates, by considering the The genotype analysis showed marked diversity of TB-MDR lineages.
changes observed in katG and inhA, making it necessary to analyze There was no noticeable predominance neither of a clone nor genotype;
other genes reported as participants in the resistance against this this is corroborated by previous data that showed a high genetic diver-
drug, such as oxyR-ahpC, katG-furA and kasA (Sandgren et al., 2009; sity of DR- and MDR-TB isolates circulating in Mexico (Flores-Trevino et
Zhang and Yew, 2015). al., 2014; Martinez-Guarneros et al., 2013; Zenteno-Cuevas et al., 2009).
It is important to mention that out of the 54 isolates with a resistance Five shared clusters were identified (clusters: 2, 4, 9 and 11–13) and
confirmed by MGIT against rifampicin and isoniazid, MDR-TB, 94% (51/ eight were composed by lineages originated in one state (clusters: 1,
54) were absent of changes at inhA, 76% (41/54) at katG, 50% (27/54) at 3, 5–8, 10 and 14). For instance, we have identified the existence of in-
rpoB and 43% (23/54) did not show any mutations at rpoB, katG and inhA dividuals affected by TB isolates that promotes their spread between the
in a combined way. Only 20% (11/54) of the isolates could be explained two states; and individuals affected by strains limited to specific
as MDR-TB, in terms of the mutations presented in rpoB, and katG/inhA regions.
genes. This is an example of the discrepancies between phenotypic Shared clusters had also profiles of differentiated mutations by state,
and genotypic methods for diagnosing TB resistance and questions the suggesting that these genotypes: 1) disperse prior to the development
usefulness, not only of sequencing small fragments of genes associated of resistance; 2) had a marked tendency to develop resistance, and 3)
with drug resistance, but also all the molecular tests based on identify- geographical factors might be playing a role in the selection of resis-
ing polymorphisms within specific gene regions, such as GeneXpert tance-generating polymorphisms. Considering the above, migration of
MTB/RIF, InnoLipaRif, MTBDRsl, etc. It is evident that there is a need to individuals affected by TB is a factor that needs to be carefully consid-
develop more sequencing studies in order to search for the genes partic- ered in further studies to be able to evaluate how these strains are
ipating in the resistance in those isolates, and also to assess the diagnos- spreading in the specific areas and how the environment could influ-
tic value of these procedures in isolates from Mexico. ence in generating the polymorphisms that induce resistance.
Reports describing mutations responsible for resistance against first Four lineages frequently associated with MDR-TB in México were
and second line drugs in MDR-TB isolates from South and Central Amer- identified: X, EAI, LAM and Beijing, however the absence of lineage T
ica are scarce (Sandgren et al., 2009; Zenteno-Cuevas et al., 2015), was noteworthy, since it is one of the most frequently described in Mex-
predominating descriptions from regions where prevalence of MDR- ico (Flores-Trevino et al., 2014; Martinez-Guarneros et al., 2013;
TB and XDR-TB is high, such as Eastern Europe, South Africa and Asia Zenteno-Cuevas et al., 2015). The absence of detailed MIRU-VNTR pat-
(Ali et al., 2011; Bhembe et al., 2014; Du et al., 2013; Feuerriegel et al., terns makes it impossible to compare the genotypes here obtained
2009; Jugheli et al., 2009; Lau et al., 2011; Maus et al., 2005; Perdigao against the ones described in previous reports from MDR-TB isolates
et al., 2010; Perdigao et al., 2013; Siddiqi et al., 2002; Sirgel et al., from Mexico (Flores-Trevino et al., 2014; Martinez-Guarneros et al.,
2012; Sowajassatakul et al., 2014). 2013; Zenteno-Cuevas et al., 2015), and makes it difficult to evaluate
Out of the three mutations that were observed in rrs, only ntA1401C the dispersion of these isolates in the country. This strongly suggests
and ntA1401G are related to amikacin and kanamycin resistance in the need to implement a molecular surveillance system on TB in Mexico.
XDR-TB isolates (Du et al., 2013; Jugheli et al., 2009; Maus et al., The information retrieved from such system would be of great value to
2005), making it necessary to evaluate the participation of the TB programs since it will help to design and implement procedures to
ntT1239C polymorphism here described. detect, supervise, and monitor TB in a fast, effective and personalized
None of the analyzed isolates showed changes in gyrB, while 80% manner, lowering the transmission of DR-, MDR- and XDR-TB.
(42/54) showed the S95T mutation in gyrA, which has been described Two of the isolates showed mutations that characterized them as
as natural polymorphism and it is not associated with resistance against pre-XDR, and one as XDR-TB. However, 21 (38%) isolates did not
fluoroquinolones (Ali et al., 2011; Lau et al., 2011). On the other hand, show the mutations that would explain their MDR-TB condition. The
A90V and S91P polymorphisms are associated with resistance and are whole genome sequence will undoubtedly allow the analysis of all
frequently found in XDR-TB isolates (Chen et al., 2014; Perdigao et al., genes that may be involved in developing drug resistance, thus
2013; Siddiqi et al., 2002; Sirgel et al., 2012; Surcouf et al., 2011). This impacting the diagnosis, treatment, and monitoring of patients affected
is the first description of polymorphisms gyrAF60Y and gyrAP124A, with TB, DR- and MDR-TB (Colijn and Cohen, 2016; Comas et al., 2012).
however, the absence of phenotypic resistant test against aminoglyco- In conclusion, this is one of the most thorough studies about geno-
side does not allow any kind of association. typic features and mutations related to first and second line drug resis-
The analysis of eis, which included its promoter region, showed two tance in MDR-TB isolates from Mexico. The genetic variability and
polymorphisms: −10 G/A and A431G. The first mutation is often asso- polymorphisms that were found, establishes the need to thoroughly
ciated with amikacin/kanamycin resistance (Banerjee et al., 2008; evaluate the clinical value of drug resistance molecular diagnosis proce-
Bhembe et al., 2014; Du et al., 2013; Georghiou et al., 2012; Perdigao dures, and to implement a molecular epidemiology surveillance system
et al., 2013; Sandgren et al., 2009), and this is the first description of to monitor TB in the country, with an emphasis in MDR-TB.

Please cite this article as: Juarez-Eusebio, D.M., et al., Molecular characterization of multidrug-resistant Mycobacterium tuberculosis isolates from
high prevalence tuberculosis states in Mexico..., Infection, Genetics and Evolution (2016), http://dx.doi.org/10.1016/j.meegid.2016.09.012
8 D.M. Juarez-Eusebio et al. / Infection, Genetics and Evolution xxx (2016) xxx–xxx

Competing interests Mycobacterium tuberculosis: functional analysis of gyrA mutation at position 74.
Antimicrob Agents Chemother 55, 608–614.
Martinez-Guarneros, A., Rastogi, N., Couvin, D., Escobar-Gutierrez, A., Rossi, L.M., Vazquez-
The authors declare that they have no competing interests. Chacon, C.A., Rivera-Gutierrez, S., Lozano, D., Vergara-Castaneda, A., Gonzalez,
Y.M.J.A., Vaughan, G., 2013. Genetic diversity among multidrug-resistant Mycobacte-
rium tuberculosis strains in Mexico. Infection, genetics and evolution: journal of mo-
lecular epidemiology and evolutionary genetics in infectious diseases 14, 434–443.
Acknowledgements Maus, C.E., Plikaytis, B.B., Shinnick, T.M., 2005. Molecular analysis of cross-resistance to
capreomycin, kanamycin, amikacin, and viomycin in Mycobacterium tuberculosis.
This work was supported by the Consejo Nacional de Ciencia y Antimicrob Agents Chemother 49, 3192–3197.
Morlock, G.P., Metchock, B., Sikes, D., Crawford, J.T., Cooksey, R.C., 2003. ethA, inhA, and
Tecnología-Proyecto de desarrollo científico para atender problemas
katG loci of ethionamide-resistant clinical Mycobacterium tuberculosis isolates.
nacionales No. 213712: Desarrollo de un sistema de vigilancia Antimicrob Agents Chemother 47, 3799–3805.
epidemiológico molecular de TB. CONACyT grant No. 166624 Nava-Aguilera, E., Lopez-Vidal, Y., Harris, E., Morales-Perez, A., Mitchell, S., Flores-Moreno,
M., Villegas-Arrizon, A., Legorreta-Soberanis, J., Ledogar, R., Andersson, N., 2011. Clus-
“Epidemiología molecular de Mycobacterium tuberculosis en la frontera
tering of Mycobacterium tuberculosis cases in Acapulco: spoligotyping and risk factors.
Noroeste México-Estados Unidos”. The authors would like to thank Clin Dev Immunol 2011, 408375.
Andres Beltrán-Ureña for his technical support. Perdigao, J., Macedo, R., Malaquias, A., Ferreira, A., Brum, L., Portugal, I., 2010. Genetic
analysis of extensively drug-resistant Mycobacterium tuberculosis strains in Lisbon,
Portugal. J Antimicrob Chemother 65, 224–227.
Perdigao, J., Macedo, R., Silva, C., Machado, D., Couto, I., Viveiros, M., Jordao, L., Portugal, I.,
References 2013. From multidrug-resistant to extensively drug-resistant tuberculosis in Lisbon,
Portugal: the stepwise mode of resistance acquisition. J Antimicrob Chemother 68,
Ali, A., Hasan, R., Jabeen, K., Jabeen, N., Qadeer, E., Hasan, Z., 2011. Characterization of mu- 27–33.
tations conferring extensive drug resistance to Mycobacterium tuberculosis isolates in Poudel, A., Nakajima, C., Fukushima, Y., Suzuki, H., Pandey, B.D., Maharjan, B., Suzuki, Y.,
Pakistan. Antimicrob Agents Chemother 55, 5654–5659. 2012. Molecular characterization of multidrug-resistant Mycobacterium tuberculosis
Allix-Beguec, C., Harmsen, D., Weniger, T., Supply, P., Niemann, S., 2008. Evaluation and isolated in Nepal. Antimicrob Agents Chemother 56, 2831–2836.
strategy for use of MIRU-VNTRplus, a multifunctional database for online analysis Ramaswamy, S.V., Dou, S.J., Rendon, A., Yang, Z., Cave, M.D., Graviss, E.A., 2004. Genotypic
of genotyping data and phylogenetic identification of Mycobacterium tuberculosis analysis of multidrug-resistant Mycobacterium tuberculosis isolates from Monterrey,
complex isolates. J Clin Microbiol 46, 2692–2699. Mexico. J Med Microbiol 53, 107–113.
Banerjee, R., Allen, J., Westenhouse, J., Oh, P., Elms, W., Desmond, E., Nitta, A., Royce, S., Sandgren, A., Strong, M., Muthukrishnan, P., Weiner, B.K., Church, G.M., Murray, M.B.,
Flood, J., 2008. Extensively drug-resistant tuberculosis in California, 1993–2006. Clin- 2009. Tuberculosis drug resistance mutation database. PLoS Med 6, e2.
ical infectious diseases: an official publication of the Infectious Diseases Society of Sekiguchi, J., Miyoshi-Akiyama, T., Augustynowicz-Kopec, E., Zwolska, Z., Kirikae, F.,
America 47, 450–457. Toyota, E., Kobayashi, I., Morita, K., Kudo, K., Kato, S., Kuratsuji, T., Mori, T., Kirikae,
Bhembe, N.L., Nwodo, U.U., Govender, S., Hayes, C., Ndip, R.N., Okoh, A.I., Green, E., 2014. T., 2007. Detection of multidrug resistance in Mycobacterium tuberculosis. J Clin
Molecular detection and characterization of resistant genes in Mycobacterium tuber- Microbiol 45, 179–192.
culosis complex from DNA isolated from tuberculosis patients in the Eastern Cape Siddiqi, N., Shamim, M., Hussain, S., Choudhary, R.K., Ahmed, N., Prachee, Banerjee, S.,
province South Africa. BMC Infect Dis 14, 479. Savithri, G.R., Alam, M., Pathak, N., Amin, A., Hanief, M., Katoch, V.M., Sharma, S.K.,
Castellanos-Joya, M., 2014. Actual Situation of Tuberculosis in Mexico, 2014. http://www. Hasnain, S.E., 2002. Molecular characterization of multidrug-resistant isolates of My-
cenaprece.salud.gob.mx/programas/interior/micobacteriosis/descargas/pdf/ cobacterium tuberculosis from patients in North India. Antimicrob Agents Chemother
SituacionActualTbMexico.pdf. 46, 443–450.
Chaoui, I., Sabouni, R., Kourout, M., Jordaan, A.M., Lahlou, O., Elouad, R., Akrim, M., Victor, Sirgel, F.A., Warren, R.M., Streicher, E.M., Victor, T.C., van Helden, P.D., Bottger, E.C., 2012.
T.C., El Mzibri, M., 2009. Analysis of isoniazid, streptomycin and ethambutol resis- gyrA mutations and phenotypic susceptibility levels to ofloxacin and moxifloxacin in
tance in Mycobacterium tuberculosis isolates from Morocco. J Infect Dev Ctries 3, clinical isolates of Mycobacterium tuberculosis. J Antimicrob Chemother 67,
278–284. 1088–1093.
Chen, Q., Pang, Y., Liang, Q., Lin, S., Wang, Y., Lin, J., Zhao, Y., Wei, S., Zheng, J., Zheng, S., Siu, G.K., Zhang, Y., Lau, T.C., Lau, R.W., Ho, P.L., Yew, W.W., Tsui, S.K., Cheng, V.C., Yuen,
2014. Molecular characteristics of MDR Mycobacterium tuberculosis strains isolated K.Y., Yam, W.C., 2011. Mutations outside the rifampicin resistance-determining re-
in Fujian, China. Tuberculosis 94, 159–161. gion associated with rifampicin resistance in Mycobacterium tuberculosis. J
Colijn, C., Cohen, T., 2016. Whole-genome sequencing of Mycobacterium tuberculosis for Antimicrob Chemother 66, 730–733.
rapid diagnostics and beyond. The Lancet Respiratory medicine 4, 6–8. Sowajassatakul, A., Prammananan, T., Chaiprasert, A., Phunpruch, S., 2014. Molecular
Comas, I., Borrell, S., Roetzer, A., Rose, G., Malla, B., Kato-Maeda, M., Galagan, J., Niemann, characterization of amikacin, kanamycin and capreomycin resistance in M/XDR-TB
S., Gagneux, S., 2012. Whole-genome sequencing of rifampicin-resistant Mycobacteri- strains isolated in Thailand. BMC Microbiol 14, 165.
um tuberculosis strains identifies compensatory mutations in RNA polymerase genes. Supply, P., Allix, C., Lesjean, S., Cardoso-Oelemann, M., Rusch-Gerdes, S., Willery, E.,
Nat Genet 44, 106–110. Savine, E., de Haas, P., van Deutekom, H., Roring, S., Bifani, P., Kurepina, N.,
Du, Q., Dai, G., Long, Q., Yu, X., Dong, L., Huang, H., Xie, J., 2013. Mycobacterium tuberculosis Kreiswirth, B., Sola, C., Rastogi, N., Vatin, V., Gutierrez, M.C., Fauville, M.,
rrs A1401G mutation correlates with high-level resistance to kanamycin, amikacin, Niemann, S., Skuce, R., Kremer, K., Locht, C., van Soolingen, D., 2006. Proposal
and capreomycin in clinical isolates from mainland China. Diagn Microbiol Infect for standardization of optimized mycobacterial interspersed repetitive unit-var-
Dis 77, 138–142. iable-number tandem repeat typing of Mycobacterium tuberculosis. J Clin
Feuerriegel, S., Cox, H.S., Zarkua, N., Karimovich, H.A., Braker, K., Rusch-Gerdes, S., Microbiol 44, 4498–4510.
Niemann, S., 2009. Sequence analyses of just four genes to detect extensively drug- Surcouf, C., Heng, S., Pierre-Audigier, C., Cadet-Daniel, V., Namouchi, A., Murray, A.,
resistant Mycobacterium tuberculosis strains in multidrug-resistant tuberculosis pa- Gicquel, B., Guillard, B., 2011. Molecular detection of fluoroquinolone-resistance in
tients undergoing treatment. Antimicrob Agents Chemother 53, 3353–3356. multi-drug resistant tuberculosis in Cambodia suggests low association with XDR
Flores-Trevino, S., Mendoza-Olazaran, S., Garza-Gonzalez, E., 2014. Drug resistance and phenotypes. BMC Infect Dis 11, 255.
molecular epidemiology of Mycobacterium tuberculosis in Mexico: a systematic re- van Soolingen, D., Hermans, P.W., de Haas, P.E., Soll, D.R., van Embden, J.D., 1991. Occur-
view. Salud Publica Mex 56, 63–77. rence and stability of insertion sequences in Mycobacterium tuberculosis complex
Flores-Trevino, S., Morfin-Otero, R., Rodriguez-Noriega, E., Gonzalez-Diaz, E., Perez- strains: evaluation of an insertion sequence-dependent DNA polymorphism as a
Gomez, H.R., Bocanegra-Garcia, V., Vera-Cabrera, L., Garza-Gonzalez, E., 2015. Genetic tool in the epidemiology of tuberculosis. J Clin Microbiol 29, 2578–2586.
diversity of Mycobacterium tuberculosis from Guadalajara, Mexico and identification Weniger, T., Krawczyk, J., Supply, P., Niemann, S., Harmsen, D., 2010. MIRU-VNTRplus: a
of a rare multidrug resistant Beijing genotype. PLoS One 10, e0118095. web tool for polyphasic genotyping of Mycobacterium tuberculosis complex bacteria.
Georghiou, S.B., Magana, M., Garfein, R.S., Catanzaro, D.G., Catanzaro, A., Rodwell, T.C., Nucleic Acids Res 38, W326–W331.
2012. Evaluation of genetic mutations associated with Mycobacterium tuberculosis re- WHO, 2015. Global Tuberculosis Report 2015. http://apps.who.int/iris/bitstream/10665/
sistance to amikacin, kanamycin and capreomycin: a systematic review. PLoS One 7, 191102/1/9789241565059_eng.pdf?ua=1 (2015 ed. World Health Organizaiton).
e33275. Zenteno-Cuevas, R., Zenteno, J.C., Cuellar, A., Cuevas, B., Sampieri, C.L., Riviera, J.E., Parissi,
Jagielski, T., Grzeszczuk, M., Kaminski, M., Roeske, K., Napiorkowska, A., Stachowiak, R., A., 2009. Mutations in rpoB and katG genes in Mycobacterium isolates from the South-
Augustynowicz-Kopec, E., Zwolska, Z., Bielecki, J., 2013. Identification and analysis east of Mexico. Mem Inst Oswaldo Cruz 104, 468–472.
of mutations in the katG gene in multidrug-resistant Mycobacterium tuberculosis clin- Zenteno-Cuevas, R., Xochihua-Gonzalez, O., Cuevas-Cordoba, B., Victoria-Cota, N.L.,
ical isolates. Pneumonol Alergol Pol 81, 298–307. Muniz-Salazar, R., Montero, H., Hamsho-Diaz, P., Lauzardo, M., 2015. Mutations con-
Jugheli, L., Bzekalava, N., de Rijk, P., Fissette, K., Portaels, F., Rigouts, L., 2009. High level of ferring resistance to first- and second-line drugs in multidrug-resistant Mycobacteri-
cross-resistance between kanamycin, amikacin, and capreomycin among Mycobacte- um tuberculosis clinical isolates in Southeast Mexico. Int J Antimicrob Agents 45,
rium tuberculosis isolates from Georgia and a close relation with mutations in the rrs 671–673.
gene. Antimicrob Agents Chemother 53, 5064–5068. Zhang, Y., Yew, W.W., 2015. Mechanisms of drug resistance in Mycobacterium tuberculo-
Kozhamkulov, U., Akhmetova, A., Rakhimova, S., Belova, E., Alenova, A., Bismilda, V., sis: update 2015. The internati6onal journal of tuberculosis and lung disease: the of-
Chingissova, L., Ismailov, S., Ramanculov, E., Momynaliev, K., 2011. Molecular charac- ficial journal of the International Union against Tuberculosis and Lung Disease 19,
terization of rifampicin- and isoniazid-resistant Mycobacterium tuberculosis strains 1276–1289.
isolated in Kazakhstan. Jpn J Infect Dis 64, 253–255.
Lau, R.W., Ho, P.L., Kao, R.Y., Yew, W.W., Lau, T.C., Cheng, V.C., Yuen, K.Y., Tsui, S.K., Chen,
X., Yam, W.C., 2011. Molecular characterization of fluoroquinolone resistance in

Please cite this article as: Juarez-Eusebio, D.M., et al., Molecular characterization of multidrug-resistant Mycobacterium tuberculosis isolates from
high prevalence tuberculosis states in Mexico..., Infection, Genetics and Evolution (2016), http://dx.doi.org/10.1016/j.meegid.2016.09.012