Вы находитесь на странице: 1из 12
Chapitre IV ANATOMIE MOLECULAIRE DES GENES DES EUCARYOTES L. Apergu général de Porganisation des génes des cucaryotes (cas du génome humain). a Gene Gane Transcription Transcription | Transcription ARIN poi Il ARN pol ! ARN pal Ill oa ARNr ARNt —— traduction protéing — <\_-—-A_ Anatomi 'un gene codant pour une protéine Iln'existe pas de structure définie absolue. Un gene ne se limite pas a sa partie transctite et encore moins a sa pattie codante. Diaulre part information est presque toujours morcelée. Tout cela fait quil est devenu difficile de donner une définition spatiale ou fonctionnelle trés précise. II nlen reste pas moins qu’un modéle est le plus fréquent. Rovonshytatves ——Stodadibuldo ‘Sie de dteat Stott dy raeamate ran Spann icine Siegen ‘eatin Sequences roqautiens SO / Sa | 7) “owtvadlation = "Ban ney ran aac Paro uate adetos 31 ‘On peut classer les génes codant pour les protéines selon le nombre de leurs copies + Les génes uniques ou quasi uniques: la trés grande majorité des génes appartient a cette classe. Leur structure correspond au modéle qui vient détre décrit La séquence CAAT est sonvent absente. Certains génes ont été dupliqués au cours de I'évohution, Les deux copies peuvent étre complétement interchangeables, comme c’est le cas des genes a de la globine. Dans d'autres cas les deux copies ont quelque pew divergé, donnant deux protéines aux propriétés proches mais différentes, Liexpression de Ihe ou l'autre de ces copies peut étre fonction de du tissu ou du stade de développement + Les familles de genes: il sagit la le plus souvent d'une extension du phénoméne de duplication / divergence: Un géne pent avoir été plusieurs fois dupliqué tot dans la phylogenése, chaque copie ayant divergé indépendamment.Il_ en résulte toute ume série de génes codant pour des protéines grossiérement analogues. L'expression de chaque copie dépend du type ou de l'état cellulaire + Pamni les exemples les mieux connus, citons + -la famille des génes globine, + -1a famille des génes actine , + -1a famille des genes myosine . Les superfamilles : Elles résultent d'un phénoméne analogue mais s'étant produit bien plus tot dans l'évolution, La divergence est telle que la relation entre les différents génes est difficile 4 mettre en évidence. exemple la superfamille des génes codant pour les sécepteurs nucléaires des hormones. + La superfamille des génes de Yimmunité, en est le plus bel exemple: les génes des immunoglobulines, des récepteurs T, des protéines dhistocompatibilité de classe I, II et III dérivent de duplications en nombre variable d'un méme motif ancestral Le nombre de motifs répétés est variable et la divergence a été considérable. En fait ce qui est conservé c'est la structure tertiaire de l'unité de base. 32 Sewn Gantgtiogten aNSodaneet FoR tease Figure 82. ac mambo son a.pcamitecoimutichnas sont oa proines de sue dort la tnctre des comanes st ‘he Sh ipars GAS este la un soeue sro vagte fe asepoe iar e seyoce since an wageren Wace cane + Les génes domestiques (house-keeping genes) Certains génes ne s'expriment que dans certains tissus, clest la base de la différenciation. D’auttes codent pour des protéines ubiquitaires, indispensables a la survie de chaque cellule, comme par exemple les génes des enzymes de la glycolyse, de la respiration et des métabolismes intermédiaires. Ces génes, appelés génes domestiques (ouse-keeping), ont en commun une série de caractéristiques + un taux de transcription en général faible et continu, + Vabsence de TATA box. + la présence dans la région 5' non codante de une ou plusieurs séquences GGGGCGGG (GChox) qui sont des sites potentiels de fixation pour les protéines de transcription. + une grande richesse en séquences CG hypo-méthylées. sont précédés par et contiennent de tr8s nombreuses répétitions du doublet CG, non méthylés. Is sont rassemblés en ilots appelés HTF (Hpa Tiny Fragments), ainsi appelés car ils contiennent de nombreux sites CG dont le clivage par l'enzyme de restriction Hpall atteste de leur non-méthylation. Ce type dilots s'étend sur 500 a 2000 pb, et le génome humain en contient environ une vingtaine de mille. + les pseudogenes Lorsque Yon hybride du DNA génomique total avec une sonde marquée dun géne par la technique de Southern, il est parfois possible de mettre en évidence des séquences qui ne shybrident qua faibles stringence. Le clonage de ces séquenees, et l’analyse de leur sSquence nucléotidique, montre Je plus souvent une grande homologie de séquence avec le gene qui a servi de sonde. Ces séquences ne sont pas fonetionnelles, car elles ne sont ni transerites ni traduites, ce sont des pseudogenes. Deux types de pseudogenes ‘+ Pseudogene conventionné correspond a des génes dupliqués qui ont perdu leur fonctionnalité, soit au départ parce que la duplication n’était pas parfaite, soit au cours de 'évolution par apparition de mutations (perte dATG, de promoteur fonetionnel ou apparition de codon stop). Ce sont des pseudogenes avec introns 33 + Pseusogéne processé de nombreux autres génes ARN qui codent un groupe particulier de petits ARN nucléaires (ARNsn, pour small nuclear) et de petits ARN cytoplasmiques qui 35 participent I'épissage des ARN et jouent de nombreux autres réles tel le transport intracellulaire Diversité de l'organisation interne a) se ie 0 (yee 10 112848 87 8 8 HO Dm ao HH mH © OH nia” 008.190 | ee cfr amine 2100 i te Hono 107100 cotati 109 eet hrc 1000 tbo es ier st fae stem sogisn $store np 100 fe ere 380.100 cart pak) a ici: 0100 ee *renasep.100 ©) Pus scone 9 to eo ako 40 s0 en 790 sc HD ine Ee 10 eon ign, Hen 2E0 rtm ‘ae 00 it tet i ttc i iii cirmino staves” Nee ee Une trés petite minorité de génes humains, généralement de trés petits genes, ne posséde pas diintrons. Dans les génes qui possédent des introns, le contenu en exons en pourcentage de Jongueur du géne tend a étre trés faible dans les grands genes. Ia taille moyeme dun exon dans les genes humains est d'environ 170 pb et, bien que de trés grands exons soient connus, leur taille est comparativement indépendante de la taille des génes. Ceci est du limmense variation de la taille des introns : les grands génes tendent a avoir de trés grands introns. La relation entre la longueur du géne et celle des introns nlest cependant pas si simple le géne du collagéne humain de type 7 (COL7AJ) est de taille intermédiaire (31 kb), mais il posséde 118 exons (le plus grand nombre pour un géne caractérisé, et significativement plus que le gene géant de la dystrophine), et une taille moyenne dintrons de seulement 188 pb. Génes dans les génes Exon 26 Exon 27 Brin sens da gonener 3 as Ean aresens s¢ 9 yp pg sone --— +— OGMP VIZ Evi2a 10ke ai 36 Genes dans les génes' 'intron 26 du gane de la neurofibromatose de type 1 (NF) contient trois génes interes contenant chacun deux exons. Noter que les trois génes interes sont transerits sur les brins opposés a celui quit est utilisé pour la transcription du gene NFI IL. Famille Multigénique. Les séquences dADN du génome diploide nucléaire existent habituellement sous forme de deux copies alléliques (sur les chromosomes homologues paternel et maternel), Outre ce degré de répétition, approximativement 40 % du génome nucléaire hnmain est composé de groupes de séquences dADN non alléliques tres analogues (familles de séquences dADN ou ADN reépétitif). Parmi ces séquences répétitives différentes et extrémement variées, on retrouve + des familles dont les membres comprennent des génes fonctionnels (familles multigéniques) + également de nombreux exemples de familles de séquences répétitives non géniques. Un grand degré d'homologie de séquence entre deux membres dune famille de séquences ADN répétitif témoigne ame oigine commune aut cours de I’évolution. + les familles de séquences d'ADN présentent des variations considérables dans : — lenombre des différentes unités répétées des différents membres, — lataille de Hhmité répétée, — lalocalisation chromosomique, — son mode de répétition — sa capacité dlexpression. Deux catégories de génes homologues + - orthologues: de deux espéces différentes Leur identité de séquence suggére qu’il s’agit de deux versions d’un méme géne, ayant la méme fonction dans deux espéces différentes. Le minimum @identité pour étre orthologue dépend du degré d’éloignement des espéces comparées + - paralogues: au sein d'une méme espece L’ensemble de ces génes constitue une famille de genes. Les identités sont souvent concentrées dans des régions que l’on appelle des boites d’homologies. Les boites @homologie codent souvent pour des domaines fonctionnels Des génes paralogues peuvent avoir une méme fonction (redondants) ou des fonctions partiellement différentes 37 Srossing-over > Echange inégal inégai en i Selchrsnancles Sours on B é Ss ag Lea ee + 1i2s 13 1. Structure et expression des génes Globine (voir planche). Quelques exemples de délétions observées dans le domaine des génes de I'a.-globine. e WG) yo yous wa _— alent =_—m—! cit (Gel. d0it6) eee a) (02). RUC E) IE ge ce A a? Bassin rs mediterraneen eR ao” Philippines: 38 Lthémoglobine Lepore est formée par une fusion des génes d et b, la situation réciproque tant trouvée dans 'hémoglobine anti-Lepore. Dans hémoglobine Kenya il y a fusion des génes Ag et b avec délétion de la séquence intermédiaire, La réciproque anti-Kenya nla pas été observée Phylogénie des genes globines humaines. = 600 nye =~ “wa, Se ° ' + v4 Myoacbine % 38.100 Lévolution du groupe de génes b-globine de mamuniféres a comporté de fiéquents événements de duplication génique, de conversion et de perte ou d'inactivation de génes. 39 jz Te a II. ADN moyennement répété codant pour des protéines. 1. Cas des génes Histones Organisation de groupes de génes d'histones Repeating units of histone gene clusters vary in organization. aa ee Sn B mitiaris _ a eee cearty> SS Ce a icon pict a a a a Carw erate is esas saat 000 be = Niviridecens i ig] 2000 oe — Cmte: EEE cove [7] Spacer > Direction of transcription Exemples caractéristiques de groupes de génes d'histones liés chez différentes espéces. 40 Dans une espéce donnée, tous les groupes ne sont pas nécessairement identiques. Chez les humains, et peut-étre chez dlautres espéces, certaines séquences sont des pseudogénes eepece | Gihistonos O°" “Slee |e Zoples | er 500 (précoces) SP ourpurerue | 10 (harales) € Haa'ha- haa" hoe 218 H3 coxpe es erythro : Cvies Sn rompiasenent de ht) homme HS: HaHa Ha-Ha. Ho 20 30-20 HaHa BY nae" naa 8 8 He AER: AaB- AT ° ineonnu 2, Genes répétés des ARNt et des ARNr. — A) Génes ARNr 18s et 28s. Moi pata dora aues fis Sens de ranscpien ONAineralave 208 50K Egucatr ‘non codant Organisation des génes codant pour le RNA des ribosomes chez "homme (génes de classe 1) 4L Unita de transcription ’AON E-spaceurintergénique ' Tako 0 S27 ke 4 1 ist is Ts as sa as ‘ss + es Les principaux ARNr humains sont synthétisés par clivage dine unité de transcription comme de 13 kb qui appartient a une unité de répétition en tandem de 40 kb. Les petite fléches indiquant les lettre A a D correspondent aux positions des sites de clivage des précurseurs par les endonucléases. Le clivage du précurseur 41S en B engendre deux produits: 208 + 32S. Aprés clivage en D du précurseur 32S et excision du petit ARNr 5,88, une liaison hydrogéne se crée entre ! ARNr 5,88 et une région complémentaize de I'ARNr 288, La séquence d'ARN denviron 6 kb commengant au niveau des espacews exteme et intemes (ETS, ITS1 et ITS2, pour externat ou internat transcribed spacers) est dégradée dans le noyau. VI. Cas de génes formés par des répétitions en tandem de segments @ADN 1. Structure des protéines et genes de l’a-foetoprotéine et de serumalbumine (voir planche). 2. Structure du géne Sgs4 chez Drosophila melanogaster (a) EERE ERE EERE EEE mt 200 400 600 200 bp AcaTacaaaactaaccca cee () Séquence canoniaue (@) repetitions individuelles TGC TGTAAAAGTGAACCAGCE cys cys Ive the glu pro pro AGATGGAGAAGTGAGCCACGC (a) La structure du géne Sgs 4 d'une souche de Drosophila, avec 19 répétitions en tandem d'un motif de 21 pb. La séquence canonique du motif répété (b), ainsi que celle de plusieurs répétitions individuelles (c) sont représentées. a

Оценить