Академический Документы
Профессиональный Документы
Культура Документы
Volume 8
In this thesis a metabolic model of S. cerevisiae was enhanced with the biochemistry
of volatile metabolites that have been found by a literature investigation. Not only the
volatile metabolites in question have been added, but also substances and reactions that Christoph Halbfeld
connect them to metabolites already present in the model. In total, 225 metabolites and
Additionally, volatile metabolite dynamics during the induction of the Crabtree effect in
a fully respiratory growing continuous culture of S. cerevisiae were explored with real-
the Crabtree effect?
time analyses of the fermentation off-gas. Secondary electrospray ionization-Orbitrap-
mass spectrometry was used for this endeavor. In these measurements, I detected about An investigation of S. cerevisiae’s
2,500 signals of which 16 showed a response to the perturbation of the metabolic state
prior to the detection of ethanol. volatile space
Furthermore, the possibility of online volatile metabolite monitoring due to multi capil-
lary column–ion mobility spectrometry (MCC-IMS) analysis of yeast fermentation off-gas
The MCC-IMS in its optimized configuration was applied to monitor volatile metabolite
changes of a laboratory and an industrial yeast strain during the Crabtree effect. In ad-
dition, metabolic differences in this setting were examined on transcriptional level using
a cDNA microarray. The metabolic shift could be observed in the volatile space of both
strains and in all tested conditions. The transcriptome showed differences in the leucine
and isoleucine pathways, as well as in genes related to the TCA cycle and the respiratory
pathways. Interestingly, the expression data indicated that the industrial strain upregula-
ted its respiration during the shift, while it was downregulated in the laboratory strain.
Lastly, possible applications for the knowledge gained and methods developed in this
work are discussed. This thesis provides a blueprint for studies of the volatile space in
other organisms. For example, the knowledge gained about the changes in the vola-
tilome during metabolic transitions could be used to online determine and potentially
control the metabolic state of a yeast.
Christoph Halbfeld
“What happens in yeast during the Crabtree effect?
An investigation of S. cerevisiae's volatile space”
Von der Fakultät für Mathematik, Informatik und Naturwissenschaften der RWTH Aachen
University zur Erlangung des akademischen Grades eines
Doktors der Naturwissenschaften genehmigte Dissertation
vorgelegt von
aus
Diese Dissertation ist auf den Internetseiten der Universitätsbibliothek online verfügbar.
Bibliografische Information der Deutschen Nationalbibliothek
Die Deutsche Nationalbibliothek verzeichnet diese Publikation in der Deutschen
Nationalbibliografie; detaillierte bibliografische Daten sind im Internet
über https://portal.dnb.de abrufbar.
Christoph Halbfeld:
1. Auflage, 2018
Printed in Germany
ISBN 978-3-86359-635-4
Zuerst möchte ich mich bei Prof. Lars M. Blank für die Erstkorrektur meiner Arbeit und all die
Unterstützung, die ich von ihm erhalten habe bedanken. Außerdem möchte ich mich für die
Möglichkeit meine Arbeit am iAMB durchführen zu dürfen bedanken.
Mein Dank gilt ebenfalls Prof. Jörg-Ingo Baumbach für die Zweitkorrektur meiner Arbeit. Außerdem
möchte ich mich dafür bedanken, dass ich in der B&S Analytik die Möglichkeit hatte erste
Erfahrungen mit dem IMS zu sammeln und jederzeit für weitere Messungen willkommen war.
Außerdem möchte ich mich für die vielen aufschlussreichen Gespräche über das IMS bedanken.
Ich möchte mich ebenfalls bei Prof. Alan Slusarenko für die Übernahme der Drittprüferschafft
bedanken.
Ich danke ebenfalls meiner Betreuerin Dr. Birgitta E. Ebert an die ich mich jederzeit wenden konnte.
Durch ihre Unterstützung war ich in der Lage die Art, wie ich Experimente plane und Texte schreibe
wesentlich zu verbessern.
Vielen Dank ebenfalls an alle Projektpartner für die gute Zusammenarbeit. Jessica Kuhlmann danke
ich für die gute Zusammenarbeit bei der Verbesserung des IMS und der IMS-Analytik. Ann-Kathrin
Sippel möchte ich für die Zusammenarbeit bei der IMS-Analytik und der Vermessung von GC-
Proben danken. Prof. Sven Rahmann und Elias Kuthe möchte ich für die Hilfe bei der Auswertung
der cDNA-Microarrays danken. Sven Wegerhoff und Prof. Sebastian Engell möchte ich für die
interessanten Diskussionen während den Projekttreffen danken. Dr. Michael Quantz und Dr. Erik
Pollmann möchte ich für die immerwährende Hilfe in der Erkundung der unendlich großen
Hefeliteratur, für die Hilfe bei Fermentationsproblemen sowie für die gute Zusammenarbeit und die
Unterbringung bei der VH-Berlin danken.
Mein Dank gilt ebenfalls Prof. Pablo Martinez-Lozano Sinues für die Möglichkeit Experimente an
der SESI-Orbitrap-MS in Zürich durchzuführen. Ebenfalls danke ich der Zenobi-Gruppe für die
freundliche Arbeitsatmosphäre.
Außerdem danke ich allen Studenten, die im Verlauf meiner Arbeit mit mir zusammengearbeitet
haben: Christina Redmers, Daniela Dey, Christiane Sonntag, Sandrine Nankia Tatepo, Kai Büchner,
Mathis Wolter, Niklas Kitschen und Birthe Halmschlag. Durch sie wurde meine Arbeit bereichert, da
mehr Arbeitspakete bearbeitet werden konnten, als ich alleine hätte schaffen können.
Ebenfalls danke ich allen, die während meiner Zeit am iAMB gearbeitet haben, durch alle wurde eine
einzigartige Arbeitsatmosphäre geschaffen, die die oftmals langen Tage teils sehr unterhaltsam
gemacht haben. Besonders möchte ich hierbei Dr. Thiemo Zambanini, Benedikt Wienands, Hamed
Tehrani, Mathias Lehnen, Vanessa Bayer und Birthe Halmschlag danken, durch sie wurde die Zeit
unvergesslich. Ebenfalls möchte ich mich bei Eik Czarnotta für die Starthilfe bei Hefefermentationen
bedanken.
Ein besonderer Dank gilt Dr. Martin Zimmermann, der mich schon während meines Studiums, aber
auch in der Phase der Promotion immer wieder mit motivierenden Gesprächen auf dem Weg begleitet
hat.
Ich möchte mich auch bei den Mitarbeitern der Mechanischen und Elektrotechnik Werkstatt
bedanken. Mit Hilfe des Teams war ich dazu in der Lage Ideen zu realisieren, die ich alleine nicht
hätte umsetzen können.
Ich möchte ebenfalls meiner Freundin Dr. Sandra Jumpertz danken, sie hat mich auch in schwierigen
Phasen der Promotion immer aufgebaut und mir die Stärke gegeben die Promotion erfolgreich
abzuschließen.
Zuletzt möchte ich meiner Familie danken, die es mir ermöglicht hat diesen Weg zu beschreiten und
mir immer Rückhalt gegeben haben.
Funding
The project was funded by the German Federal Ministry of Education and Research (BMBF).
Eidesstattliche Erklärung
„Hiermit erkläre ich, Christoph Halbfeld, an Eides statt, dass ich die vorliegende Dissertation
selbstständig verfasst und keine anderen als die angegebenen Quellen und Hilfsmittel benutzt habe.“
Table of Contents
SUMMARY ....................................................................................................................................... V
RESULTS ................................................................................................................................ 33
EXPANDING THE CONSENSUS YEAST MODEL BY VOLATILE METABOLISM ......................... 33
SUMMARY ........................................................................................................................ 33
INTRODUCTION................................................................................................................. 34
MATERIAL AND METHODS ............................................................................................... 35
Software tools for pathway prediction ................................................................... 35
Strains, media and plasmids used .......................................................................... 35
I
Table of Contents
OUTLOOK............................................................................................................................ 113
III
Summary
Summary
The baker’s yeast Saccharomyces cerevisiae is one of the best investigated organisms and widely used in
science. This scientific interest is partially based on the yeast’s use in the industrial production of
pharmaceuticals, beverages and food. Even though the taste of food and beverages is clearly influenced by
volatiles, the yeast’s volatilome, i.e., the entirety of the volatile metabolites produced, is to date largely
uncharted, with ethanol and acetaldehyde being prominent exceptions.
In this thesis, in chapter 2.1, a metabolic model of S. cerevisiae was enhanced with the biochemistry of volatile
metabolites that have been found by a literature investigation. Not only the volatile metabolites in question
have been added, but also substances and reactions that connect them to metabolites already present in the
model. In total, 225 metabolites and 219 reactions were added to the model. Furthermore, 12 metabolic
reactions could be verified by physiological and enzyme assays of knockout mutants. These mutants were
created using the CRISPR-Cas9 method and contained only one gene coding for a protein with alcohol
dehydrogenase activity.
In chapter 2.2, volatile metabolite dynamics during the induction of the Crabtree effect in a fully respiratory
growing continuous culture of S. cerevisiae were explored with real-time analyses of the fermentation off-gas.
SESI (secondary electrospray ionization)-Orbitrap-mass spectrometry (MS) was used for this endeavor. In
these measurements, we detected about 2,500 signals of which 16 showed a response to the perturbation of the
metabolic state prior to the detection of ethanol. These observations not only revealed the extent of the yeast’s
volatilome, but also indicated that volatile metabolite dynamics correlate with the metabolic state of the cell
culture and hence might be a noninvasive and fast online analytical method to monitor and later control
fermentation processes.
In chapter 2.3, to evaluate the possibility of online volatile metabolite monitoring, multi capillary column–ion
mobility spectrometry (MCC-IMS) analysis of yeast fermentation off-gas was established. This analytical
device was chosen because it runs at ambient temperature and pressure resulting in lower investment and
operating costs compared to SESI-Orbitrap-MS. The MCC-IMS used was developed for the detection of
volatiles in human breath, and several technical adaptations were required to allow robust detection of volatiles
in the headspace of yeast fermentations.
In chapter 2.4, the MCC-IMS in its optimized configuration was applied to monitor volatile metabolite changes
of a laboratory and an industrial yeast strain during the transition from fully respiratory to respiro-fermentative
metabolism (Crabtree effect). In addition, metabolic differences in this setting were examined on
transcriptional level using a cDNA microarray. The metabolic shift could be observed in the volatile space of
both strains and in all tested conditions. The transcriptome showed differences in the leucine and isoleucine
pathways, as well as in genes related to the TCA cycle and the respiratory pathways. Interestingly, the
expression data indicated that the industrial strain upregulated its respiration during the shift, while it was
downregulated in the laboratory strain.
Lastly, possible applications for the knowledge gained and methods developed in this work are discussed.
This thesis provides a blueprint for studies of the volatile space in other organisms. The extended metabolic
model could be used to generate yeast strains with special flavors or for the production of fragrances, perfumes
or precursors of pharmaceuticals. Also, the knowledge gained about the changes in the volatilome during
metabolic transitions could be used to online determine and potentially control the metabolic state of a yeast.
Finally, the analytical methods developed in this work might be used for online flux analysis, if some more of
the detected volatiles can be identified.
V
Zusammenfassung
Zusammenfassung
Die Bäckerhefe Saccharomyces cerevisiae ist einer der am besten untersuchten Organismen und wird häufig in der
Wissenschaft genutzt. Dieses wissenschaftliche Interesse beruht teilweise auf der industriellen Nutzung von Hefe
bei der Produktion von Medikamenten, Getränken und Nahrungsmitteln. Obwohl der Geschmack von
Nahrungsmitteln und Getränken deutlich von flüchtigen Metaboliten beeinflusst wird, ist das Volatilom, also die
Gesamtheit der produzierten flüchtigen Metabolite, bei Hefen bisher noch weitgehend unerforscht, mit Ausnahme
der prominenten Ausnahmen Ethanol und Acetaldehyd.
In dieser Arbeit wurde in Kapitel 2.1 die Literatur nach flüchtigen Metaboliten durchsucht und ein metabolisches
Modell von S. cerevisiae durch deren Integration verbessert. Zusätzlich zu den gefundenen Metaboliten wurden
Substanzen und Reaktionen in das Modell eingepflegt, um die hinzugefügten volatilen Metaboliten mit dem bereits
vorhandenen Netzwerk zu verbinden. Insgesamt wurden 225 Metaboliten und 219 Reaktionen zu dem Modell
hinzugefügt. Zudem konnten 12 metabolische Reaktionen durch physiologische und enzymatische Versuche mit
knockout-Mutanten verifiziert werden. Die Mutanten wurden durch Anwendung des CRISPR-Cas9-Systems
erzeugt und enthalten jeweils nur ein Gen, welches für ein Protein mit Alkoholdehydrogenaseaktivität kodiert.
In Kapitel 2.2 wurden die flüchtigen Metabolite einer kontinuierlichen, respiratorischen Saccharomyces cerevisiae-
Kultur während der Induktion des Crabtree-Effekts untersucht. Dafür wurden die Abluft der Fermentation direkt in
ein SESI (Sekundäre Elektrospray-Ionisation)-Orbitrap Massenspektrometer (MS) geleitet, wo sie in Echtzeit
analysiert wurde. Pro Experiment wurden ca. 2.500 Signale aufgenommen, 16 von diesen zeigten nach der
Perturbation des metabolischen Zustandes, noch bevor Ethanol detektiert wurde, eine Änderung in der
Signalintensität. Diese Ergebnisse verdeutlichen nicht nur die Größe des Hefe-Volatiloms, sondern zeigen ebenfalls,
dass die Dynamiken der volatilen Metabolite im Gasraum über Hefefermentationen mit dem metabolischen Zustand
der Zellen korrelieren. Daher könnte eine nicht-invasive und schnelle online-Analysemethode für das Überwachen
von Hefekulturen dazu geeignet sein, Fermentationsprozesse zu kontrollieren.
Genau dies wurde in Kapitel 2.3 untersucht, dazu wurde die Analyse des Gasraums über einer Hefefermentation
mit einem Multikapillarsäulen-Ionen-Mobilitäts-Spektrometer (MCC-IMS) etabliert. Dieses analytische Gerät
wurde ausgewählt, da es bei Normaldruck und Raumtemperatur betrieben werden kann. Im Vergleich zur SESI-
Orbitrap-MS sind für das MCC-IMS geringere Wartungskosten aufzubringen und auch die Anschaffungskosten des
MCC-IMS liegen deutlich unter denen der SESI-Orbitrap-MS. Das hier verwendete MCC-IMS wurde für die
Detektion von Metaboliten in menschlicher Ausatemluft konzipiert, so dass einige technische Anpassungen
vorgenommen werden mussten, um eine robuste Detektion der volatilen Metaboliten von Hefefermentationen zu
ermöglichen.
In Kapitel 2.4 wurde das optimierte MCC-IMS verwendet, um Metabolitkonzentrations-Veränderungen im
Gasraum über Hefefermentationen während dem Übergang von ausschließlich respirativem hin zu
respirofermentativem Wachstum (Crabtree-Effekt) zu untersuchen. Unter diesen Bedingungen wurde auch mithilfe
eines cDNA-Microarrays die Änderungen auf transkriptioneller Ebene untersucht. Für diese Versuche wurde ein
Laborstamm und ein industriell genutzter Stamm verwendet. Die metabolischen Veränderungen spiegelten sich im
Gasraum der beiden unterschiedlichen Hefestämme deutlich wieder. Im Transkriptom konnten Unterscheide in der
Regulation der Gene, die mit dem Leucin- und Isoleucin-Metabolismus zusammenhängen, sowie bei den für die
Atmung und den Citratzyklus zuständigen Genen festgestellt werden. Überraschend war, dass die mit der Atmung
assoziierten Gene im Industriestamm mit Änderung des metabolischen Zustandes hochreguliert wurden, während
die gleichen Gene im Laborstamm herunterreguliert wurden.
Im letzten Teil der Arbeit werden mögliche Anwendungen für das in dieser Arbeit generierte Wissen diskutiert. So
könnte diese Dissertation als Vorlage für die Untersuchung von Volatilen anderer Organismen genutzt werden. Das
erweiterte metabolische Modell könnte dazu verwendet werden, Hefestämme mit besonderen Aromen für die
Produktion von Duftstoffen, Parfums oder als Vorläufer für Medikamente, zu entwerfen. Darüber hinaus könnte
das hier generierte Wissen über die Veränderung flüchtiger Metabolite während einer metabolischen
Zustandsänderung ebenfalls dazu verwendet werden, um eine Fermentation mittels online-Analytik zu
kontrollieren. Letztlich könnten die hier entwickelten analytischen Methoden zur online-Flussanalyse genutzt
werden, falls noch weitere der hier detektierten flüchtigen Metabolite identifiziert werden.
VII
List of Abbreviations
List of Abbreviations
Abbreviations
% percent
(NH4)2HPO4 diammonium phosphate
(NH4)2SO4 ammonium sulfate
μF microfarad
μL microliter
μm micrometer
ACO aconitase
ADH alcohol dehydrogenase
AIMS aspiration IMS
BAT branched-chain amino acid transmaniase
BNICE biochemical network integrated computational explorer
CaCl2 2H2O calcium chloride diydrate
Ca-pantheonate calcium-pantheonate
Cas9 CRISPR associated protein 9
cDNA copy desoxyribonucleic acid
CDW cell dry weight
CFME continuous flow microextraction
CHA1 catabolic L-serine deaminase
CIT citrate synthase
cm centimeter
CO2 carbondioxide
CoA conenzyme A
COB cytochrome b
CoCl2 7H2O cobalt(II) chloride heptahydrate
COR core protein of QH2 cytochrome c reductase
COX cytochrom oxidase
CRISPR clustered regulatory interspaced short palindromic repeats
CuSO4 5H2O copper(II) sulfate pentahydrate
CYT1 cycochrome c1
D dimer
DI direct immersion
DMA differential mobility analyzer
DNA desoxyribonucleic acid
DO dissolved oxygen
DTIMS drift time IMS
DTT dithiothreitol
E. coli Escherichia coli
e.g. exempli gratia
EDTA ethylendiamintetraacetic acid
ESI electrospray ionization
et al. et alia
FAEE fatty acid ethyl esters
FAIMS high field asymmetric waveform IMS
IX
List of Abbreviations
XII
List of Figures
List of Figures
Figure 1: Overview of volatile metabolites released by yeast. Depicted are few representatives and their origin from
central carbon metabolism [1]. ................................................................................................................ 9
Figure 2: The Ehrlich pathway. Biochemistry and main genes involved in amino acid degradation (A) and
intermediates and products derived from involved amino acids (B). Figure adapted from [2, 3]. Figure
previously published in [1]. ................................................................................................................... 11
Figure 3: Mitochondrial monoterpene biosynthesis via the leucine catabolic MCC pathway and possible relationships
with sterol formation in Saccharomyces cerevisiae as proposed by Carrau et al. [4]. Figure adapted from
[4]. Previously published in [1]. ............................................................................................................ 13
Figure 4: Working principle of a drift tube-IMS; adapted with permission of Journal of Physiology and Pharmacology
from [5], previously published in [1, 6]. ............................................................................................... 15
Figure 5: Schematic representation of a secondary electrospray ionization source. The here indicated DMA is
interchangeable with an Orbitrap. DMA= differential mobility analyzer. Reprinted with permission
from [300]. Copyright 2012 American Chemical Society..................................................................... 57
Figure 6: Influence of mass resolution on peak separation. Taken from [133]. ........................................................... 58
Figure 7: Schematic view (A) and picture (b) of the mini-bioreactor setup connected to the SESI-Orbitrap-MS
(Bioreactor constructed by Eik Czarnotta and Suresh Sudarsan, RWTH Aachen University). ............ 60
Figure 8: Data evaluation of SESI Orbitrap analyses of the off-gas of a continuous glucose-limited yeast culture at
steady state which was disrupted with a 27 mM glucose pulse. The filtered data is displayed as a
clustered heatmap in which the scaled intensity of single masses (m/z value) are plotted over time (A),
zoom-in excerpt of the heatmap shown in A (B). Smoothed data of interesting signal traces (blue line)
identified in the heatmap are plotted against time together with the signal of ethanol (black line). The
left black vertical line indicates the timepoint of the glucose pulse injection, while the right line indicates
the timepoint of the first detection of ethanol (C-F). ............................................................................. 64
Figure 9: Experimental set-up for the online MCC-IMS measurements of fermenter off-gas. Previously published in
[185]. ..................................................................................................................................................... 76
Figure 10: MCC-IMS topographic plot of sterile Verduyn medium. The reaction ion peak (1/K 0 = 0.5 Vs cm−2) was
compensated by the software VisualNow. ............................................................................................ 77
Figure 11: MCC-IMS topographic plot of S. cerevisiae during the early stationary phase of a batch fermentation.
Boxes indicate signals that showed the most significant changes during the growth (perturbation)
experiments. .......................................................................................................................................... 78
Figure 12: (A) Fermentation profile of S. cerevisiae during batch growth in glucose minimal medium, (B) trends in
intensity, (C) heat map of selected peaks detected by MCC-IMS analysis of the fermentation off-gas.
Areas in the heat map show the detected signal peak and the surrounding area; DO = dissolved oxygen.
............................................................................................................................................................... 79
Figure 13: (A) Fermentation profile of S. cerevisiae adh1Δ during batch growth in glucose minimal medium and (B)
trends in intensity and (C) heat map of selected peaks detected by MCC-IMS analysis of the
fermentation off-gas. The areas in the heat map show the detected signal peak and the surrounding area;
DO = dissolved oxygen. ........................................................................................................................ 80
Figure 14: MCC-IMS topographic plot of the off-gas of a glucose-limited continuous cultivation of S. cerevisiae.
Boxes indicate signals that showed the most significant changes during the growth (perturbation)
experiments. The reaction ion peak (1/K0 = 0.5 Vs cm−2) was compensated for by the VisualNow
software. ................................................................................................................................................ 81
Figure 15: (A) Fermentation profile of S. cerevisiae during growth in a glucose-limited chemostat and (B) trends in
intensity and (C) heat map of selected peaks detected by MCC-IMS measurements of the fermentation
off-gas after perturbation of the metabolic steady state with a pulse of 22 mmol glucose; DO = dissolved
oxygen. .................................................................................................................................................. 82
Figure 16: (A) Fermentation profile of S. cerevisiae during growth in a glucose-limited chemostat and (B) trends in
intensity and (C) heat map of selected peaks detected by MCC-IMS measurements of the fermentation
off-gas during transition to anaerobic conditions; DO = dissolved oxygen. ......................................... 83
Figure 17: Volatile signals of Saccharomyces cerevisiae CEN.PK 113-7D (A) and Saccharomyces cerevisiae DHW
(B) in a fed-batch that was slowly overfed to trigger the Crabtree effect. The grey background represents
XIII
List of Figures
the feed rate. The commercially available Alcoline sensor form Biotechnology Kempe was used for
ethanol quantification in the fermentation broth along with the MCC-IMS Breath Discovery from B&S
Analytik for the monitoring of volatile metabolites in the fermentation head space. The black dotted line
indicates the start of the overfeeding process, the red dotted lines indicate the division into early (left)
mid (middle) and late (right) phase. D and M behind the substance names describe the measured dimer
and monomer respectively. ................................................................................................................... 96
Figure 18: Transcriptional alterations of the most differing pathways based on expressional changes between
Saccharomyces cerevisiae CEN.PK 113-7D (left) and Saccharomyces cerevisiae DHW (right). The two
strains were run in fed-batch fermentations and overfeed gradually. The respiration pathway (A), the
TCA-cycle (B) and the branched-chain amino acid production (C) are depicted. The genes without color
coding are not displayed, since it had a false discovery rate of more than 5% in at least one of the tested
strains. ................................................................................................................................................... 99
XIV
List of Tables
List of Tables
Table 1. Features of different analytical devices for volatile compound measurement. Data on resolving power taken
from [181-184], all other data taken from product sheets of current devices; LOD, limit of detection.
Previously published in [1]. .................................................................................................................. 22
Table 2: Microbial strains ............................................................................................................................................ 36
Table 3: Primers (table continues over multiple pages) ............................................................................................... 37
Table 4: Oligonucleotides for homologous recombination .......................................................................................... 39
Table 5: Volatile organic compounds emitted from S. cerevisiae fermentations. Compounds that are included in the
latest yeast genome scale metabolic reconstruction (Yeast 7.11) and in the Saccharomyces Genome
Database SGD [185] are categorized. (Table continues over multiple pages.) ..................................... 41
Table 6: Volatile metabolites added to the metabolic yeast model. The column reference indicates, whether the
pathway was taken from KEGG, a scientific publication, that the pathway was inferred by pathway
prediction tools (blank space), or predicted by established yeast enzymes with reactions similar to those
needed to establish the pathway (also blank space). (Table continues over multiple pages.) ............... 44
Table 7: Enzymatic capacity of sADH mutants. The strains were tested for their ability to convert alcohols, ketones,
and aldehydes in enzymatic assays. The mutants showed either clear conversion (+), slight conversion
(+/-) or no conversion of the substrate (-). Green indicates accordance to literature data, red indicates
contrariety. ............................................................................................................................................ 49
Table 8: Mass to charge ratio (m/z) of the most interesting signals recorded during the metabolic transient state in a
continuous glucose-limited fermentation after setting a glucose pulse. + and # indicate masses whose
signal intensity linear correlated with each other and which probably originate from the same metabolite.
m/z 69.0701 and 89.0962 have been tentatively identified as 3-methyl-1-butanol and isoprene,
respectively. .......................................................................................................................................... 63
Table 9: Volatile organic compounds detected in fermentations of S. cerevisiae via GC-MS measurements growing in
glucose minimal salt medium. ND, not detected. .................................................................................. 85
Table 10: Profiles of fermentation parameters of the fed-batch fermentations. ........................................................... 94
XV
Chapter 1
General introduction
Exploration and Exploitation of the Yeast Volatilome
Contributions:
The introduction was written by Christoph Halbfeld. Birgitta E. Ebert contributed 1.2.4 to
1.3 and 1.4. Lars Blank critically read the text.
Chapter 1
General introduction
Summary
Volatile organic compounds (VOCs) are small molecular mass substances, which exhibit high-vapor
pressures, low boiling points, and lipophilic character. VOCs are produced by all organisms including
eukaryotic microbes like yeast. Volatile metabolites are for centuries exploited, for examples as
flavors in bread, beer, and wine. Notably, while the applications of VOCs are many, the knowledge
on their biochemical synthesis is still limited.
This introduction reviews the current information of yeast volatile metabolites and techniques to
further explore the VOC landscape made possible by improvements of the analytical possibilities,
regarding sampling frequency, identification, and quantification and the development to
computationally interpret (high-throughput) data. Especially possibilities for online and even real-
time analysis should trigger new experimental approaches that elucidate the biochemistry as well as
the regulation of VOC synthesis. Baker’s yeast is here the organism of choice as the genetic inventory
can be linked to VOC formation and with this in hand improved applications can be envisaged. The
physical, chemical or biological properties make many VOCs interesting targets for different
industrial sectors, while their natural function as semiochemicals or in defense mechanisms can be
exploited to engineer synthetic microbial communities or to develop new antibiotics.
VOCs produced by microbes including yeast are a chemical diverse group of compounds with
highly different applications. The new analytical techniques briefly summarized here will enable the
use of VOCs in even broader applications including human health monitoring and bioprocess control.
We envisage a bright future for VOC research and for the resulting applications.
Introduction
Volatile organic compounds
Volatile organic compounds (VOCs) are small molecular mass substances (<300 Da), which exhibit
high-vapor pressures, low boiling points and lipophilic character. VOCs encompass various chemical
classes, e.g., low molecular weight fatty acids and their derivatives (hydrocarbons, alcohols,
aldehydes and ketones), terpenoids, aromatic compounds, nitrogen containing compounds, and
volatile sulphur compounds.
VOCs are ubiquitous in nature and play an important role in all domains of life, especially in the
intra- and interspecies communication and self-protection. Plants, for example, use VOCs as direct
or indirect defense mechanism to repel herbivores or attract carnivores that exterminate herbivore
populations [7]. Likewise, animals use pheromones as means of communication or behavior-altering
agents, while humans use VOCs formed by microbes as an indicator of spoiled food, another form of
interspecies communication [5][8]. Taste perception is also determined by volatiles since the papillae
in the human mouth can only distinguish between salty, sweet, bitter, sour and, umami and what we
experience as flavor is created through the binding of volatiles to sensory receptors [6]. It is for this
reason that volatiles play an important role in the food and beverage industry, where they are often
5
General introduction
Bread
Bread has been consumed by humankind for millennia as it is essential food and is well known for
its rich flavor. Its odor and flavor depend on a multitude of factors like dough-composition,
fermentation and baking parameters. While wheat flour contributes only little to the aroma of bread,
enzymes and yeast contribute a better part to it [9-12]. To investigate VOC pattern in dough
fermentation, Frasse et al. analyzed the headspace of first yeasted, secondly yeasted and fermented,
and thirdly non-yeasted doughs. The experiments showed that alcohols, esters, ketones, lactones and
sulfur compounds were produced during yeast fermentation, while aldehydes were consumed in the
process [12].
The main compounds contributing to the flavor prior to baking were mostly fusel alcohols (isoamyl
alcohol, 2-methyl-1-butanol, 2-Phenylethanol), but also aldehydes (diacetyl, methional) due to a high
odor threshold [12]. During the baking process the flavor changes, the caramelization reaction of the
sugars, and especially the Maillard reaction play an important role in changing the flavor profile [9,
13-15]. Depending on the composition of amino acids in the dough, the Maillard reaction will lead to
the production of acetaldehyde, phenylacetaldehyde, 2-methylebutanal and other carbonyl
compounds. Leucine, isoleucine and lysine lead to a pleasing aroma, while phenylalanine and
methionine lead to an unpleasant odor in a model Browning system, while phenylalanine led to a rose
oil like odor in baked bread. Especially lysine, arginine, histidine, and tryptophan lead to the browning
of the crumb [16, 17]. After the baking process, the aroma of fresh baked bread unfolds. This aroma
has been investigated in versatile studies, it is created mainly by a mixture of aldehydes (e.g., 3-
methylbutanal, 2-methylpropanal, (2E,4E)-deca-2,4-dienal, hexanal, 2-phenylacetaldehyde, 3-
methylsulfanylpropanal, 2-methylbutanal, non-2-enal), ketones (butane-2,3-dione, oct-1-en-3-one)
and acids (e.g., acetic acid, 2-methylbutanoic acid, 3-methylbutanoic acid) [18-22]. The aroma of the
baked bread will change over time and the desirable flavor will disappear, this is also caused by
volatiles that slowly fade (e.g., 2-acetyl-1-pyrroline, 3-methylbutanal), while other compounds
formed through lipid peroxidation are formed [20, 23].
Wine
Wine flavors
Many studies have been conducted in the field of volatile wine metabolites, since these compounds
are responsible for the rich wine aroma. Welke et al. investigated the volatile profile of Merlot wines
and tentatively identified a total of 334 compounds; the article also gives a good overview of volatile
metabolites that were identified in other studies [24]. The aroma is influenced by the different stages
of wine making: first the choice and processing of the grapes (pre-fermentative flavor), then the
6
Chapter 1
fermentative conditions, choice of the yeast and amount of inoculum (fermentative flavor) and finally
the post-fermentative flavor that comes from enzymatic or chemical reactions while storage in the
barrel and bottle [25-30]. The wine grapes differ in a multitude of aroma compounds; especially
important roles play hereby the monoterpenes. There are about 70 monoterpenes known at this time
and differences in their concentration can be used for varietal characterization. The most prominent
monoterpenes in grape aromas are linalool, geraniol, nerol, citronellol, 3,6-dimethyl-1,5-octadien-
1,7-diol, and α-terpineol [30].
In 2001, Mateo et al. showed that a different inoculum concentration of the same yeast strain can
influence the volatile composition of wine. They showed that the quantity of the yeast inoculum is
positively correlated to the amount of higher alcohols that can be found later in the wine, while higher
alcohols above 400 mg/L are regarded as negative factor in the final product [27, 31]. Other than
higher alcohols the amount of long chain esters is strain dependent which has to be considered because
the amount of higher alcohols and long chain esters relate to each other by the equation:
ͶͲͲ (1)[27]
ሾ݈ݏݎ݁ݐݏ݄݁݊݅ܽܿ݃݊ሿݔ
ሾ݄݄݅݃݁ݏ݈݄݈ܿܽݎሿ
The choice of the correct strain is also important because of different amount of alcohols, organic
acids and esters that are also important for the bouquet in the resulting wines [27].
During the aging in a bottle different reactions take place that have an influence on the aroma: the
ester content changes, the acetate concentration decreases, mono- and dicarboxylic acid ethyl esters
increase, carotenes and carbohydrates break down and monoterpenes react in the sour conditions.
Especially the acetates decrease over a period of about six years until an equilibrium between alcohol,
acetic acid and acetate is reached. All these factors have an influence to the taste difference between
young and aged wine, e.g., the acetates distribute the fresh and fruity note of young wine [30]. Also
a connection between D,L-piperitone [32] and 1,8-cineole [33] and the positive aging effects of red
wine could be associated.
Off-flavors
The following section will focus on the negative flavor compounds in wine. These compounds are
perceived as negative, if their concentration exceeds a certain sensory threshold. The first off-flavor
was detected in Europe, when European cultivars of Vitis vinifera were cross-bread with wild
American wine plants to increase the fungal resistance. This off flavor can be tracked back to 2,5-
dimethyl-4-hydroxy-2,3-dihydro-3-furanone (furaneol) [30, 34]. The sensorial detection limit for
furaneol lies in the range between 30 and 300 ppb [30, 35, 36]. Another undesirable off-flavor is 2-
iso-butyl-3-methoxy-pyrazine that has a low perception threshold of about 0.002 to 0.4 ppb. It smells
like herbs or potatoes and is enriched in ripening Sauvignon grapes [30, 37-39]. 2-
ethyltetrahydropyridine, 2-acetyl-tetrahydropyridine and 2-acetylpyroline are responsible for a
mousy (taste of mouse urine) like flavor in wine [40-46]. An amount of more than 800 μg/L of the
pure substances or a mixture of 4-vinylguajacol and 4-vinylphenol leads to a medicinal or Elastoplast
like off-flavor. This flavor is developed, especially if the grapes were exposed directly to sunlight in
7
General introduction
warmer regions. A similar effect occurs if the sum of more than 400 μg/L of 4-ethylphenol and 4-
ethylguajacol are exceeded, these compounds however have leathery and respectively horse sweat
aroma [30, 47]. The corky off-note that some wines develop during the aging process are associated
with several components such as 2,3,6-trichloroanisole, 2,3,4-trichloroanisole, 2,3,5,6-
tetrachloroanisole, pentachloroanisole, 2,4,6-tribromoanisole, 2-methylisoborneol, ethylenguaiacol,
4-ethylenphenol and 2,4,6-trichloroanisole. The single compounds show earthy, mushroom and
cardboard-like aromas. The olfactory threshold for 2,4,6-trichlooanisole is about 4-10 ng/L and thus
way lower than that of 4-vinylguajacol, 4-vinylphenol, 4-ethylphenol and 4-ethylguajacol [48-52].
It is not possible to sum up the complete literature of wine flavors in this thesis. To learn more
about wine flavors, the research of Prof. Rapp and the book “Flavour and Fragrances” from 2007
provides a useful basis [30, 53, 54].
Fungal VOCs
On the contrary to the general capability of microorganisms, the production of volatiles has not been
thoroughly explored so far but is receiving increased attention because of a growing awareness of the
potential of volatile metabolites as antimicrobial agents, biofuels or plant growth promoting
compounds. Also, it has been shown that the volatile footprint is specific for different organisms,
allowing VOC analysis to be used for diagnostic purposes, the detection of food spoilage, and hidden
growth of molds in buildings [7, 55-60]. By the same token, VOC synthesis depends on growth
condition, carbon source and carbon source availability [61, 62], hence can be used in fermentation
process monitoring.
The synthesis of microbial VOCs has long been seen as a cellular detoxification or waste disposal
mechanism, but analogous to plant hormones or pheromones they have important ecological roles
and are released into the environment, to impact metabolism and growth of competing or symbiotic
organisms. Research on these microbial semio- or infochemicals is of interest in basic research but
also in applied sciences, e.g., for the design of synthetic microbial communities tailored for the
production of chemicals, degradation of pollutants, and wine manufacturing [55].
Still, the spectrum of fungal volatile metabolites, also referred to as volatilome [63], is today not
broadly and systematically explored. This becomes apparent when comparing known fungal VOCs
with the number identified from the plant and animal kingdom. While databases for the latter list up
to 8000 compounds [64, 65], the microbial specific VOC database, mVOC [66], contains 1174
metabolites, out of which 500 are of fungal origin (as of May 2016). The current knowledge about
the VOC biosynthesis pathways and their regulation is even scarcer. This might be attributed to
challenges in detection and identification of these mainly low abundant metabolites and their
chemical diversity which requires complimentary sampling and analytical techniques to capture the
complete VOC space. Furthermore, the synthesis of VOCs originating from secondary metabolism
might only be activated under special growth conditions different from those the cells encounter
during cultivation in laboratory settings. Advances in system-wide analytical techniques [67] and
methods for the identification and awakening of secondary biosynthetic pathways pave the way for
comprehensive elucidation of yeast’s metabolic potential for volatile metabolite synthesis [68-70].
8
Chapter 1
Figure 1: Overview of volatile metabolites released by yeast. Depicted are few representatives and
their origin from central carbon metabolism [1].
In the following we give a coarse overview about currently known volatile metabolites and the
biosynthetic pathways of yeast. Given the focus of prior volatile research the presented volatile
spectrum is biased for VOCs impacting on the flavor of fermented food as previously mentioned.
also been reported that acetoin, in a mix with other yeast VOCs, attracts the fruit fly Drosophila
melanogaster with which some yeasts undergo a symbiotic relationship [78].
10
Chapter 1
Figure 2: The Ehrlich pathway. Biochemistry and main genes involved in amino acid degradation
(A) and intermediates and products derived from involved amino acids (B). Figure adapted from [2,
3] . Figure previously published in [1].
Diacetyl and 2,3-pentanediol, VOCs with butter or toffee-like flavor are undesired byproducts (off-
flavors) in beer fermentation and are formed when 2-acetolactate or 2-oxobutyrate, intermediates of
valine and isoleucine biosynthesis, accumulate. When these compounds diffuse into the medium, they
are non-enzymatically decarboxylated to diacetyl and 2,3-pentanediol [89]. As long maturation times
are required for diacetyl degradation, minimizing the synthesis of this byproduct is desired. This can
be achieved by adjusting the valine concentration in the wort as valine uptake results in feedback
inhibition of acetohydroxy acid synthase, responsible for the catalysis of the diacetyl and 2,3-
pentanediol precursors [90].
11
General introduction
12
Chapter 1
Aspergillus nidulans [102] and it is known to be present in the mitochondria of plants and mammals
[103, 104]. The further conversion of geraniol to linalool, nerol, and citronellol is proposed to take
place in the vacuole as the low pH might favor these reactions [105]. Again, no genes have been
identified yet [100]. The missing information in the VOC biochemistry is in our opinion also strongly
linked to the somewhat cumbersome experimental protocols consisting of sample preparation and
analysis. The increasing interest in VOCs develops parallel with the advancements of analytical
techniques, which are summarized briefly.
Figure 3: Mitochondrial monoterpene biosynthesis via the leucine catabolic MCC pathway and
possible relationships with sterol formation in Saccharomyces cerevisiae as proposed by Carrau et
al. [4]. Figure adapted from [4] . Previously published in [1].
13
General introduction
14
Chapter 1
Compared to gas chromatography the ion mobility spectrometry is a relatively unknown technique
in life sciences. There are eight main methods that can be used to measure the ion mobility: 1. Drift
time IMS (DTIMS), 2. Traveling–wave IMS (TWIMS), 3. High field asymmetric waveform IMS
(FAIMS), 4. Trapped IMS (TIMS), 5. Open loop IMS (OLIMS) also called Aspiration IMS (AIMS),
6. Differential mobility analyzers (DMA), 6. Transversal modulation IMS (TMIMS) and 8. Overtone
mobility spectrometers (OMS). Since this is not the focus of this thesis, only the basic DTIMS will
be illuminated in more detail. For further information concerning ion mobility spectrometry, the
review “Review on Ion Mobility Spectrometry” in two parts is recommended [108, 117].
Solid, liquid and gaseous samples can be analyzed by IMS. After injection of the sample, the
analytes are ionized in the ion source. Radioactive sources [118], corona dischargers [119],
photoionization sources [120, 121], matrix assisted laser desorption ionization (MALDI) sources
[122], and electrospray ionizers [123] are most commonly used for analyte ionization. The ionized
molecules are guided by an electric field and are usually held back by an ion shutter [124, 125]. The
shutter opens periodically and releases the bundled ions into the drift tube. In the classic DTIMS the
electric field constantly pulls the ions towards the detector, located at the end of the drift tube. The
detector is classically a faraday plate but MS detectors are becoming more common (Figure 4) [116].
Figure 4: Working principle of a drift tube-IMS; adapted with permission of Journal of Physiology
and Pharmacology from [5], previously published in [1, 6].
In detail, in the classic DTIMS, the drift tube is constantly flushed by drift gas, opposing the ions.
Based on the attributes of an ion more or less collisions occur and some ions travel faster through the
drift tube than others. This relationship is called ion mobility and defined as K. The ion mobility is
dependent on the electric field intensity E. The drift velocity (ߴ݀ሻ is directly proportional to the ion
mobility and the electric field intensity [126]:
ߴ݀ ൌ ܧܭ (2)
15
General introduction
The ion mobility can also be calculated using the length of the drift tube (L), the voltage drop
across L, and the time it takes an ion to move through the drift tube (td):
ܮଶ (3)
ܭൌ
ܸ ଶ ݐௗ
At the molecular level K can be defined as fundamental relationship between ion mobility and the
collisions that occur.
With q as charge of ions, N as number density of the drift gas, k as Boltzmann’s constant, T as
absolute temperature, m as mass of the ion, M as mass of the drift gas, and Ω collision cross section
of the ion in the drift gas. Since the temperature and the pressure are often different in different
devices, respectively locations, the reduced ion mobility was introduced:
ܲଵ ܶ (5)
ܭ ൌ ܭ
ܲ ܶଵ
In classical DTIMS the drift gas is also ionized and in combination with residual water, reaction
ion peaks (RIP) form. These peaks do not represent pure nitrogen or water, but ion clusters that are
dependent on the used drift gas. For nitrogen containing gasses e.g., air, this is how the measured
clusters are formed [129]:
N2 + e Æ N2+ + 2e (1)
N2+ + 2N2 Æ N4+ + N2 (2)
N4+ + H2O Æ H2O+ + 2N2 (3)
H2O+ + H2O Æ H3O+ + OH (4)
H3O+ + H2O + N2 Æ H+(H2O)2 + N2 (5)
H+(H2O)n-1 + H2O + N2 Æ H+(H2O)n + N2 (6)
The choice of drift gas and to some extent the water content can be influenced by the experimenter.
Higher water concentrations cause the formation of larger ion clusters that have a lower ion mobility,
and hence lead to longer drift times [130]. Thus, for IMS applications such as online process control
varying water content has to be avoided. This can be achieved using a chromatographic pre-separation
of the sample, for example using a multi capillary column (MCC), which separates water from other
analytes [131].
16
Chapter 1
MCCs consist of about 1000 parallel short columns of 20 cm to 1 m length each. Because of the
large cross-sectional area of these parallel columns, it is possible to work with high gas flow rates (up
to 250 mL/min) resulting in much shorter separation times of MCCs compared to classical GC
capillary columns. The water in the samples does not interact with the column material, it thus directly
passes the MCC and is flushed out of the system while other components have longer retention times
and are introduced into the IMS. This pre-separation step increases the overall separation performance
and is equally suited for online measurements as unhyphenated IMS as it can be used without prior
sample preparation [131].
and PTR-MS (usually equipped with a quadrupole mass analyzer) devices have been used to detect
microorganisms, including human and plant pathogens [138-143]. Also lactic acid fermentation
during the production of yogurt and the storage processes of milk and meat were monitored [139,
144-147]. Moreover, VOC profiles of dough fermentations with various yeasts and flours were used
to determine product quality. For example, specific masses of three unidentified compounds were
suggested as biomarkers for the optimization of the aromatic quality of bread dough [139, 148-150].
18
Chapter 1
Offline-sampling
IMS, PTR-TOF-MS, SESI-MS and - in limited applications - GC-Q-MS are suited for online
measurements without any upstream sample preparation. While often advantageous, depending on
the scientific problem, online measurements are not always necessary and sample preparation can be
useful to concentrate low abundant analytes. Subject to the extraction method used, it is possible to
selectively concentrate compound classes. On the downside, this selective binding leads to loss of
analytes that do not interact with the solvent or fiber.
A common technique for sample preparation is thermal desorption spectroscopy (TDS) in which
a column packed with adsorbent is flushed with the gaseous sample. Depending on gas flow rate and
sampling time the amount of analyte adsorbed to the packing material can be adjusted. It is also
possible to directly adsorb metabolites during the fermentation process by using special stirring bars,
made of adsorbing material. This technique was previously used to measure off-flavor producing
components in wine and to profile the metabolites of different fungi [163, 164].
Analyte extraction via purge and trap is achieved by stripping the liquid sample with an inert gas,
which is then passed through a sorbent trap to bind the extracted metabolites. These traps are filled
with equivalent adsorbent material as used in TDS. The analytes are released by thermal desorption
and transferred onto the GC column. This approach has been used to measure volatiles in red wine or
to determine the impact of altered alcohol acetyltransferase expression on the synthesis of esters and
alcohols of different yeast strains [165, 166].
In solid phase microextraction (SPME), a fiber of the adsorbing material is loaded with volatile
metabolites by introducing it into the headspace of the liquid sample. SPME has been used to analyze
diverse biological samples including fungi and human samples for cancer marker detection [159, 167,
168]. After loading of the adsorbent, the TDS column or SPME fiber is connected to a gas flow
leading to a GC-MS system. For efficient desorption of the bound analytes, the adsorbent is heated.
The disadvantage of this sample preparation approach is that all analytes are desorbed and the sample
can only be measured once [167]. Common adsorbents are polyacrylate, CARBOWAXTM
(polyethylene glycols, methoxypolyethylene glycols), CarboxensTM (carbon molecular sieve),
polydimethylsiloxane, Tenax® TA (poly(2,6-diphenyl-p-phenylenoxid)), and silica gel [164, 168].
Direct immersion single drop microextraction (DI-SDME) is a miniaturization of classical liquid-
liquid extraction which greatly reduces the extractant to sample ratio and achieves higher analyte
concentrations [169-172]. A water-immiscible drop hanging at the tip of a needle is submersed into
the liquid sample. The drop is not mixed with the liquid but keeps attached to the needle. When the
extraction is at equilibrium the drop is withdrawn back into the needle and directly injected into the
GC-MS. The extraction efficiency can be enhanced by continuously pumping the fluid sample
alongside the drop as it is done in continuous flow microextraction (CFME) [169, 173]. A variant of
this technique for gaseous analytes is headspace single drop microextraction (HS-SDME) in which
the drop is placed in the headspace of the liquid sample and only volatile metabolites present in the
gas phase are extracted [169, 174]. SDME theoretically allows extraction of all volatile metabolites
as the solvents can be freely chosen. Only the following requirements apply: The viscosity of the
extraction solvent has to be high enough to form a drop that sticks to the needle. The solvent used in
19
General introduction
DI-SDME and CFME has to be insoluble in the aqueous sample and the extractant for HS-SDME has
to have a sufficiently low vapor pressure to prevent evaporation at the applied temperature.
Commonly used solvents are toluene, n-octanol, decane and benzyl alcohol. Automated SDME
workflows have been reported, but the technique is still not routinely used in many laboratories [169,
175]. For more detailed information about SDME the review by Xu et al. is recommended [169].
20
Chapter 1
21
General introduction
mass resolution, it is possible to separate peaks that even in TOF detectors are measured as one peak.
The higher mass accuracy results in improved determination of the elemental composition, and
consequently more conclusive compound identification. Structural identification can further be
achieved by fragmentation of selected compounds. However, since there is usually no pre-separation
it is not useful to fragment all metabolites while measuring complex samples.
Table 1. Features of different analytical devices for volatile compound measurement. Data on
resolving power taken from [181-184], all other data taken from product sheets of current devices;
LOD, limit of detection. Previously published in [1].
SESI-
Device IMS GC-Q-MS PTR-TOF
Orbitrap
Price category $ $$ $$$ $$$$
Resolving power 60 2,8 up to 5,000 60,000 to
>100,000
Scanning speed 20 Hz 97 Hz 10 Hz (TOF 20 Hz
200 kHz)
Portability limited none none none
LOD ppt ppt ppt ppt
Application Environmental (Online) Real-time analyses
examples monitoring (e.g., VOC analyses of monitoring of of plant VOC
water plant or human microbial emission,
contamination), samples, pesticide contamination of breath analysis,
breath analysis screening [186- food, detection of [133, 134]
(biomarker 188] bacterial infections
detection), and drug level
detection of control via breath
chemical warfare analysis [138, 139,
agents [109, 113, 141, 144, 147,
131, 185] 189]
database [66]. These knowledge gaps even exist for the industrial workhorse and eukaryotic model
organism S. cerevisiae. Having been investigated in numerous scientific studies and 78% of its 6,604
ORFs been assigned to an enzymatic, regulatory or further cellular function [190], its biochemistry
is generally well established, documented in several databases [191-193], and well-curated genome-
scale models exist [194-196]. Remarkably, however, biosynthetic pathways of volatile metabolites
are only moderately covered. This incompleteness of metabolic models and databases became
apparent when checking VOC coverage of metabolic pathway databases and models: Of 100 VOCs
identified in the literature to be synthesized by yeast only 20% were contained in yeast specific
metabolic databases and the S. cerevisiae latest genome-scale model [185].
A suite of computational and experimental methods is available to close this lack of knowledge,
i.e., to identify the metabolic network underlying the synthesis of these metabolites. For the in silico
identification two approaches exist: The bottom-up network reconstruction aims to predict possible
pathways from available metabolic reaction networks or databases, while the top-down approach
takes condition-specific omics data and extracts possible networks using statistical and bioinformatics
analyses. The latter does not rely on a priori knowledge of network component interactions and is
therefore well suited for the prediction of less studied biosynthetic pathways and regulatory networks
such as those of volatile metabolites. Also, powerful methods exist that combine both approaches
[197-199]. Metabolic networks predicted by either approach still have to be manually pruned and
experimentally verified.
After integration of the novel pathways into an existing metabolic model, the extended model can
be used for the computation of engineering strategies to improve or prohibit VOC synthesis or to
interrogate interactions between VOC synthesis and the overall metabolic behavior of the cell.
Metabolic models further allow to address questions, such as to why the organism releases volatile
metabolites. For example, the occurrence of the Crabtree effect in S. cerevisiae, that is aerobic ethanol
formation, was in silico reproduced by stoichiometric models taking into account the investment costs
for the synthesis of enzymes or mitochondria. These simulations disclosed a trade-off between these
anabolic costs and the metabolic yield of alternative fermentative pathways [200, 201] at high
glycolytic fluxes. In this way, experimentally testable hypotheses can be generated and engineering
strategies derived to improve the metabolic activity towards a defined target function. For a detailed
description of the use of metabolic models, we refer to [202, 203].
Bottom-up approaches
The basis of bottom-up approaches for the prediction of biosynthetic pathways is a (genome-scale)
metabolic model of the organism under study. Such a metabolic model is generated based on the
information provided by the annotated genome and experimental data, gathered from databases and
the scientific literature and rationalizes and structures the existing knowledge, scattered in these
resources. For metabolic pathway prediction, stoichiometric models, which do not capture kinetic
properties, are sufficient. These models store the stoichiometry of the enzymatic repertoire of the cell
and the gene-enzyme-reaction relationship and thereby allow to explore the metabolic capabilities of
an organism and the effect of environmental or genetic perturbations.
23
General introduction
To comprehend metabolic models with enzymatic capabilities for the synthesis of additional
metabolites, a retrosynthetic approach is employed which parses species-unspecific metabolic
databases such as KEGG, MetaCyc or BiGG [204-206] for enzymatic transformations that allow
connecting the novel metabolite to the existing network. Several publicly available or web-based tools
exist for this bottom-up prediction of metabolic pathways [207-209].
The approach presented by Christian et al. [197] differs from these pathway prediction tools in
that it directly derives models that allow the synthesis of a novel compound from a defined carbon
and energy source instead of isolated pathways. The original network is first appended with all
reactions of a universal metabolic database and then stepwise reduced by eliminating previously
added but non-essential reactions to eventually derive at a minimally extended model capable of
target compound synthesis. As the order of reaction removal impacts the model extension, a huge
number of parallel runs is performed. In order to increase the number of biologically meaningful
models in this set and to reduce a posteriori pathway selection and verification, the algorithm
integrates pathway prioritization into the pathway prediction process. This is enabled by ranking all
foreign reactions according to the probability that the catalyzing enzyme is encoded in the organism’s
genome and a preferential extension with high-ranked reactions.
The Biochemical Network Integrated Computational Explorer, BNICE, [210] goes beyond
reconfiguring known enzymatic reactions and uses instead a set of generalized enzymatic reaction
rules to generate metabolic networks built of existing and novel, i.e., previously unobserved,
biochemical reactions and compounds. The use of reaction rules is organized according to the enzyme
classification system but reduced to the first three digits that define the reaction mechanism but do
not constrain the substrate. This approach eases the identification of enzyme candidates for de novo
biochemical reactions. Not relying on metabolic reaction databases, this approach can also predict
non-enzymatic reactions such as decarboxylations or oxgenations. The drawback of BNICE is the
extensive pathway extraction and validation procedure, which follows the network inference step.
Although mainly applied to predict novel pathways for the heterologous synthesis of industrially
interesting products, the general applicability of BNICE allows to equally apply it for the delineation
of uncharted metabolic pathways as recently shown on the example of lipid metabolism [211].
The integration of systems-wide omics data, mRNA, protein or metabolite levels into metabolic
modeling constrains the model to more physiological relevant solutions that is reaction rates more
likely reflecting the in vivo enzymatic activities for the specific experimental setup [212-217]
Embedding such constraints into the pathway computation procedure is desirable as this would
significantly reduce the number of predicted pathways and aid in filtering out meaningful solutions.
24
Chapter 1
has been observed. This can be verified by (thermodynamics-based) flux balance analysis [218, 219]
and models shown to be stoichiometrically or thermodynamically infeasible are to be rejected.
Experimental identification of pathway specific intermediates by targeted metabolite profiling
gives strong indications for pathway activity. This method is applicable for secondary metabolites,
produced by linear pathways, whose intermediates do not participate in other reactions but less
informative for pathways involving highly connected metabolites. A powerful alternative for the
discrimination of active pathways is an isotope labeling experiment. In the early days of biochemical
pathway analysis, the conversion of metabolites has been traced by tracking the incorporation of
heavy, radioactive isotopes. Today, stable isotopes are used and the resulting isotope isomers
(isotopomers) analyzed by MS or NMR techniques. The introduced tracer has to be carefully designed
so that the activity of alternative pathways results in distinct labeling pattern of pathway intermediates
or end products. Computational methods exist that aid in the design of informative tracer experiments
and data evaluation [220-223].
Top-down approaches integrating transcriptome and/or proteome data directly yield predictions
about genes and enzymes involved in VOC synthesis, while for many bottom-up prediction tools,
gene candidates have to be defined a posteriori. BridgIT is such a computational framework that
builds on BNICE results and suggests enzyme candidates for novel reactions identified in the pathway
prediction process [224]. Following this, BLAST searches are applied to identify gene candidates
encoding these enzymes. The proposed gene-enzyme-reaction relationships are to be validated
experimentally. For this purpose, gene deletion mutants are generated and subsequently evaluated for
VOC synthesis or screened for the accumulation of proposed pathway intermediates. While verifying
or disproving alternative one-step pathways catalyzed by single enzymes is straightforward, finding
gene knockout targets of intertwined and longer pathway alternatives is less intuitive. Computational
tools such as the forced coupling algorithm FOCAL support the identification of genetic and
environmental conditions for conclusive model discrimination [225].
Aims
The overall goal of this thesis was the exploration of the volatile metabolites of baker´s yeast.
Although well known to many of us from daily life, as outlined in the introduction, much is unknown
and only limited information about the interrelationship between phenotype and genotype exist.
To close the gap this thesis shall be listing the known volatile metabolites from the literature and
combine this information with the massive information on the biochemistry of known-volatiles. The
information gathered shall be used for the enhancement of the consensus metabolic yeast model. The
environmental driven production of volatiles shall be investigated, to be able to exploit this non-
invasive signal from yeast metabolism in industrial applications. Here, finding a reporter metabolite
that indicates the metabolic shift from respiratory to respiro-fermentative metabolism. This reporter
shall be used in the YeastScent project, to regulate the feed rate of a yeast fed-batch fermentation to
maximize the biomass yield while maximizing the growth rate, hence by operating the fed-batch
below the critical growth rate that triggers the Crabtree effect.
This transition point was investigated in great detail, but not in respect of volatile production. Here,
the transition from respiratory to respiro-fermentative growth (Crabtree effect) was investigation in
25
General introduction
industrial-like conditions by volatile and transcriptome analyses. These aims are connected by the
YeastScent project that uses a process model based prediction for fed-batch pump control with a
volatile reporter metabolite as proxy for yeast metabolism.
26
Chapter 2
Results
Expanding the consensus yeast model by volatile metabolism
Contributions:
The study was designed by Christoph Halbfeld, Birgitta E. Ebert and Lars M. Blank. The experiments
were performed by Christoph Halbfeld, Birthe Halmschlag and Niklas Kitschen. The data was
evaluated by Christoph Halbfeld and Birgitta E. Ebert.
Chapter 2
Results
Expanding the consensus yeast model by volatile metabolism
Summary
The consensus metabolic yeast model has so far been lacking the representation of the volatile
metabolite space. To overcome this shortcoming, a literature investigation of all known volatile
metabolites produced by S. cerevisiae was performed and 92 volatile metabolites were found
of which 78 did not exist in the latest metabolic model. To connect the newly found metabolites
to the metabolic network, 219 reactions were added to the consensus yeast metabolic model
using computational tools as well as manual integration of pathways. Stoichiometric and
thermodynamic feasibility of steady state production of the amended volatile metabolites was
verified with flux balance analysis and thermodynamics-based flux analysis. 12 reactions were
further experimentally verified by enzymatic assays of knockout mutants, which contained only
one enzyme with alcohol dehydrogenase activity. The new version of the consensus yeast
model, Yeast8, covers the yeast volatile metabolite space and represents the necessary basis to
shed light on the metabolic constraints underlying volatile metabolite formation, offering new
possibilities in modeling for example to create yeasts with a special aroma.
33
Results
Introduction
Through computational advancements it became possible to simulate microbial behavior in
silico. However, performing these simulations requires comprehensive knowledge about the
biochemical reactions that occur inside a cell. For the well investigated baker’s yeast
Saccharomyces cerevisiae, such knowledge is already accessible and has been converted into a
metabolic model in a standardized informatic language, the systems biology markup language
(SBML). The first consensus yeast model was based on two older models the iMM904 [226]
and the iLL672 [196]. The new model was created using SBML and MIRIAM standards. The
new model introduced name conventions as well as identifiers and is based on S. cerevisiae
S288C [227]. The first major enhancements were made, with version 4 of the model, which
was appended with lipid metabolism [228]. In version 5 of the model, the sphingolipid
metabolism was added. Also, a script to test for anaerobic growth conditions was added. As
well in version 5, an apportionment in genome scale models (GEMs) and genome scale network
reconstructions (GENRES) was introduced. This enables the possibility to use models based on
a specific task. For modeling approaches GEMs are used, where assumptions are made that
enable modeling but have no experimental evidence. GENREs can be used if established
knowledge that has been verified experimentally is needed [229]. In version 6 of the model
general enhancements were included, such as the manual curation of the model [194]. In the
7th and still current model, the fatty acid, glycolipid, and glycerophospholipid metabolism of
the yeast model was curated in great detail [230].
Even though the model was constantly updated in the past, the representation of the volatile
space was not yet tackled. Except for the well investigated volatiles ethanol and acetaldehyde
only few volatile metabolites could be found in the model representation [185]. The lack of
volatiles in the model is most likely based on difficulties that come along with detecting volatile
organic compounds (VOCs). Recently better analytical techniques have become available and
thus more and more detailed information on the volatile space of S. cerevisiae will emerge by
time. To fully understand the metabolic processes inside of S. cerevisiae the inclusion of volatile
metabolites to the consensus metabolic yeast model is crucial, therefore here the model is
enhanced by the VOCs that were found by a literature investigation [185].
The addition of new pathways to a model is always challenging. The information gaps
between the added metabolites and the already existing network have to be closed by the most
probable reactions. To close the gaps several tools are available for example, FMM, Pathpred
and Metaroute [207-209]. These tools search for possible pathways using already known
reactions from a database listing data of multiple organisms, e.g., KEGG [231-233]. The
Biochemical Network Integrated Computational Explorer (BNICE) is a tool that suggests new
routes based on biochemical rules. It does not rely on known reactions and, hence, completely
novel pathways can be created [234]. In addition, manual integration of new reactions is an
option. Therefore, enzymes catalyzing similar reactions need to be identified as they could
potentially act on more than one substrate, thereby contributing to novel pathways. Ideally, new
pathways are also experimentally verified, e.g., by 13C-tracer experiments or biochemical
assays.
Here, we set out to comprehensively append the Yeast 7 model with biosynthetic pathway
for volatile metabolites based on extensive scientific literature and database searches as well as
computational analyses. Pathway predictions were checked for thermodynamic feasibility and
34
Chapter 2
partially verified by wet-lab experiments.[219, 235] Another way and more solid is
experimental verification of added reactions, was partially performed here. We focused on
reactions catalyzed by alcohol dehydrogenases (Adhps) as their biocatalytic spectrum of
volatile alcohols or aldehydes synthesis has already been investigated. Although industrial
alcohol production is a highly valuable yeast process; the single enzymes were biochemically
characterized for all tested alcohols.
35
Results
S. cerevisiae
MATα; ura3-52; leu2-3_112; TRP1; HIS3; MAL2-8C;
CEN.PK113-17a Eurofins
SUC2
CEN.PK113-17a
CEN.PK-113-17a bearing pCfB2312 this work
pCfB2312
sADH1 Δadh2 Δadh3 Δadh4 Δadh5 Δadh6 Δgre2 Δsfa1 this work
sADH2 Δadh1 Δadh3 Δadh4 Δadh5 Δadh6 Δgre2 Δsfa1 this work
sADH3 Δadh1 Δadh2 Δadh4 Δadh5 Δadh6 Δgre2 Δsfa1 this work
sADH4 Δadh1 Δadh2 Δadh3 Δadh5 Δadh6 Δgre2 Δsfa1 this work
sADH5 Δadh1 Δadh2 Δadh3 Δadh4 Δadh6 Δgre2 Δsfa1 this work
sADH6 Δadh1 Δadh2 Δadh3 Δadh4 Δadh5 Δgre2 Δsfa1 this work
sSFA1 Δadh1 Δadh2 Δadh3 Δadh4 Δadh5 Δadh6 Δgre2 this work
sGRE2 Δadh1 Δadh2 Δadh3 Δadh4 Δadh5 Δadh6 Δsfa1 this work
36
Chapter 2
Germany).
Table 3: Primers (table continues over multiple pages)
Primer name Primer sequence Properties
amplification of adh1 for sequencing.
A1 seq fw CTACGAATCCCACGGTAAG
Annealing at: 48 °C
amplification of adh1 for sequencing.
A1 seq rv CTGGCGAAGAAGTCCAAAGC
Annealing at: 48 °C
amplification of adh2 for knockout
A2B_seq fw CGTCTTCAGAGCTCATTG
confirmation. Annealing at: 46 °C
amplification of adh2 for knockout
A2B_seq rv GGCATCCTTGACACATTC
confirmation. Annealing at: 46 °C
amplification of adh3 for sequencing
A3 seq fw GCAATCCACAGCTGCAATC
Annealing at: 48 °C
amplification of adh3 for sequencing.
A3 seq rv CGGTACCACATGGTCTAAC
Annealing at: 48 °C
amplification of adh4 for knockout
A4B_seq fw CGTAGTGCGTTACAGTTC
confirmation. Annealing at: 46 °C
amplification of adh4 for knockout
A4B_seq rv ATATTGCGGCTGGTAAGG
confirmation. Annealing at: 46 °C
amplification of adh5 for sequencing.
A5 seq fw GCCTTCGCAAGTCATTCC
Annealing at: 48 °C
amplification of adh5 for sequencing.
A5 seq rv CAGGACGACAGTACCATTG
Annealing at: 48 °C
amplification of adh6 for sequencing.
A6 seq fw CAATCACACGAAGATTGG
Annealing at: 43 °Cv
amplification of adh6 for sequencing.
A6 seq rv GGAACCTAAAGCACTGTAAG
Annealing at: 43 °C
amplification of gre2 for knockout
Gre2C_seq fw CAACAATTGGCCCTCACCTC
confirmation. Annealing at: 52 °C
amplification of gre2 for knockout
Gre2C_seq rv TGTGGGGAGACGGGTAGAAG
confirmation. Annealing at: 52 °C
amplification of sfa1 for sequencing.
S1 seq fw GCTGCTGTTGCGTATGATG
Annealing at: 49 °C
amplification of sfa1 for sequencing.
S1 seq rv CAGGCTTCCAAAGCATCTC
Annealing at: 49 °C
37
Results
38
Chapter 2
Commercial kits
DNA fragments were purified using the GenepHlow Gel/PCR Kit from Geneaid (New Taipei
City, Taiwan). Plasmid purification was carried out using the QiaPrep Spin Miniprep Kit from
Qiagen (Hilden, Germany). Plasmids were extracted using the QiaPrep Miniprep Kit (Qiagen,
Hilden, Germany).
bp ds oligonucleotides (see Table 4), was transformed into chemically competent S. cerevisiae
cells [241]. The oligonucleotides were used as template for homologous recombination. The 90
bp oligonucleotides were used for the first successful disruptions and lead to the introduction
of a stop codon into the gene sequences of ADH1,3,5,6 and SFA1. The 120 bp oligonucleotides
were used for complete deletion of ADH2, ADH4 and GRE2. The deletions were confirmed
using PCR (for the complete deletions) and subsequently by sequencing (see Table 3).
Biotransformation assay
The biotransformation of different aldehydes and alcohols was tested using the knockout
mutants that contained only one of the seven known Adhp encoding genes. The mutants were
cultivated in shake flasks using YEP medium and fed again with a 50 % (w/w) glucose solution,
14 h prior to harvest. Equal amounts of biomass of 0.04 g CDW were harvested from the culture
by centrifugation of appropriate volumes of the culture at a timepoint when excess glucose was
still present in the medium. The pellet was washed twice with 0.9% NaCl. The cells were
disrupted by incubating the cells for 1 h with Zymolyase 20T (5 mg in 500 μL, WAK-Chemie
Medical GmbH, Steinbach (Taunus), Germany) at 37 °C in lysis buffer (1 M sorbit, 10 mM
DTT, 10 μL protease inhibitor (Protease Inhibitor Cocktail, Merck, Darmstadt, Germany) and
subsequent treatment with 0.5 mm glass beads in the VXR basic Vibrax (IKA Wilmington,
USA) at 4 °C. After cell disruption, the suspension was filtered through a 4 μm filter and the
filtrate was kept on ice until further use. For the enzymatic assay, 10 μL of the extracted proteins
were mixed with 170 μL potassium phosphate buffer (pH 8 for Adh3p and Adh4p, pH 7 for all
other enzymes) and 10 μL of 5 mM NAD+/NADP+ for alcohols or NADH/NADPH for
aldehydes. The assays were performed in 96-well microtiter plates and the consumption or
production of the redox cofactors monitored by reading the absorbance change at 340 nm using
the well plate reader Synergy MX (BioTek, Friedrichshall, Germany). The final volume of the
assay added up to 200 μL in each well. The assay was started when the absorbance stabilized
by adding 10 μL of 1 M substrate and stopped when the absorbance stabilized.
All assay substrates and the redox cofactors were purchased from Carl Roth (Karlsruhe,
Germany), Merck (Kenilworth, NJ, USA), VWR (Radnor, PA, USA) or Alpha Aesar
(Haverhill, MA, USA) and were of < 97% purity (for biochemistry).
Data evaluation
The absorbance data was corrected with the data of the control experiment, which included
everything but the substrate. The control was included on each 96-well plate and for each time
point. The absorbance values obtained after the addition of substrate were subtracted from the
last value recorded prior to the addition of the substrate. The resulting data was evaluated for
values above zero indicating a change in NAD+/NADP+ concentrations higher than that of the
control. For values close to zero, the plot of raw absorbance data over time was visually
inspected to check if the slope of the assay data was larger than that of the control.
40
Chapter 2
Table 5: Volatile organic compounds emitted from S. cerevisiae fermentations. Compounds that
are included in the latest yeast genome scale metabolic reconstruction (Yeast 7.11) and in the
Saccharomyces Genome Database SGD [185] are categorized. (Table continues over multiple
pages.)
included in
Compound PubChem
Compound Yeast Reference #
class ID SGD
7.11
(2-phenylcyclopropyl)
alcohols 317540 no no [246]
methanol
1,2-benzene dicarboxylic
acids 1017 no no [66, 247]
acid
1,3-butanediol alcohols 6440 no no [246]
1-butanol alcohols 263 no no [246]
1-heptanol alcohols 8129 no no [246]
1-hexanol alcohols 8103 no no [248-251]
1-propanol alcohols 1031 no no [248-251]
2,3-butanediol alcohols 262 yes yes [250, 251]
2,5-dimethylpyrazine * pyrazines 31252 no no [66, 247]
2-ethyl-1-hexanol alcohols 7720 no no [66, 247, 248]
2-furfuraldehyde aldehydes 7362 no no [249]
2-hexanol alcohols 12297 no no [246]
2-methyl-2-butanol * alcohols 6405 no no [248-250]
2-methylbutanal * aldehydes 7284 yes no [66, 247]
2-methylbutanoic acid acids 8314 no no [66, 247]
2-methylbutanol alcohols 8723 yes yes [248-250]
2-pentanone ketones 7895 no no [66, 247]
[66, 247, 249-
2-phenylethanol * benzenoids 6054 yes yes
252]
2-phenylethyl acetate esters 7654 no no [249, 252]
2-propane alkanes 6334 no no [248]
2-propanol alcohols 3776 no no [66, 247, 248]
2-xylene benzenoids 7237 no no [66, 247]
3-methylbutanal * aldehydes 11552 yes yes [248]
[66, 247, 249,
3-methylbutanoic acid * acids 10430 no no
250]
41
Results
42
Chapter 2
[66, 247-251,
isobutanol alcohols 6560 yes yes
253]
isobutyl acetate esters 8038 yes no [248, 249]
limonene terpenes 22311 no no [66, 247]
linalyl propionate esters 61098 no no [251]
methanol * alcohols 887 no no [249, 250]
methyl acetate esters 76214 no no [249]
methylpropanoic acid * acids 6590 no yes [66, 247, 250]
monoethyl succinate esters 70610 no no [251]
n-butyl acetate esters 31272 no no [248, 249]
nonanal aldehydes 31289 no no [248]
nonanoic acid carboxylic acids 8158 no no [249]
n-propyl acetate esters 7997 no no [248, 249]
octanoic acid * carboxylic acids 379 no no [249-252]
pentanal aldehydes 8063 no no [248]
propionic acid carboxylic acids 1032 no no [250]
pyrazine pyrazines 9261 no no [66, 247]
undecane alkanes 14257 no no [66, 247]
α-terpineol terpenes 17100 no no [249]
β-phenylethyl formate esters 7711 no no [248]
* These compounds were also detected in yeast extract [254]. In reference [247],
yeast was cultivated in malt extract and tryptone soya, in reference [248] yeast
extract, plus bactopeptone and glucose was used. All other references reported
volatiles from wine fermentations.
To find the pathways that connect each of the 92 metabolites to the reactions already existing
in the consensus model, the computational tools FMM, PathPred and MetaRoute were used. In
addition, a manual search for metabolic pathways in the literature and the manual addition of
possible reactions was performed (Table 6) [207-209]. Apart from seven metabolites
(acetaldehyde diethyl acetal, acetic acid 2-propenyl ester, acetic acid ethenyl ester, undecane,
(2-phenylcyclopropyl)methanol, 2-ethyl-1-hexanol and 2-xylene), all metabolites could be
connected to the metabolic pathways using these tools. For the pathway prediction of two of
the missing seven metabolites, 2-ethyl-hexanol and 2-xylene, BNICE [234] was used. BNICE
predicts possible pathways using generic enzyme reaction rules and here was confined to the
use of compounds present in the KEGG database [231, 232, 255]. To make sure that
S. cerevisiae is capable of catalyzing the added reactions, gene sequences coding for enzymes
known to catalyze those reactions were blasted against the yeast genome of S. cerevisiae S288C.
Flux Balance Analysis (FBA) and thermodynamics-based flux analysis (TFBA) [219, 235, 256]
were performed on 36 of the newly introduced pathways to further verify stoichiometric and
thermodynamic feasibility of the biosynthetic pathways of the volatile metabolites. All 36 tested
pathways yielded feasible reactions for both FBA and TFBA. Using TFBA it was possible to
correct pathways that would have not been thermodynamically feasible. An example for this is
the production of methanol. Methanol was first proposed to be produced during the reduction
of formaldehyde, this reaction however, turned out not to be thermodynamically feasible.
Instead the decarboxylation of glycolate was added to the model. Stoichiometric and
thermodynamic feasibility was confirmed by FBA and TFBA.
43
Results
Table 6: Volatile metabolites added to the metabolic yeast model. The column reference
indicates, whether the pathway was taken from KEGG, a scientific publication, that the pathway
was inferred by pathway prediction tools (blank space), or predicted by established yeast
enzymes with reactions similar to those needed to establish the pathway (also blank space).
(Table continues over multiple pages.)
PubChe Pathway based
Substance KEGG Literature
m on
1,2-benzenedicarboxylic
1017 C01606
acid another organism KEGG
1,3-butanediol 6440 C20335 another organism KEGG
1-butanol 263 C06142 literature data [257]
pathway
1-heptanol 8129
prediction
pathway
1-hexanol 8103
prediction
1-propanol 1031 C05979 literature data [257]
2-furfuraldehyde 7362 C14279 another organism KEGG
2-methylbutanoic acid 8314 C18319 literature data [258]
2-pentanone 7895 C01949 another organism KEGG
2-phenylethyl acetate 7654 C12303 literature data [259, 260]
2-propane 6334 C20783 another organism KEGG
pathway
2-propanol 3776 C01845
prediction
2-xylene 7237 C07212 another organism KEGG
3-methylbutanoic acid 10430 C08262 literature data [258]
3-methylheptyl acetate 537686 literature data [259, 260]
5-methyl-2-
12097 C11115
furfuraldehyde another organism KEGG
pathway
acetone 180 C00207
prediction
acetophenone 7410 C07113 another organism KEGG
pathway
benzaldehyde 240 C00261
prediction
benzyl acetate 8785 C15513 literature data [259, 260]
pathway
benzyl alcohol 244 C00556
prediction
butanal 261 C01412 literature data [257]
butanone 6569 C02845 another organism KEGG
butyric acid 264 C00246 literature data [257]
pathway
cis-3-hexen-1-ol 5281167 C08492
prediction
pathway
diacetyl 650 C00741
prediction
pathway
diethyl succinate Knoll 1994
31249 prediction
dimethyl disulfide 12232 C08371 literature data [261]
C02679 pathway
dodecanoic acid 3893
prediction
pathway
ethyl 2-methylbutyrate Knoll 1994
7945 prediction
44
Chapter 2
pathway
ethyl benzoate Knoll 1994
7165 C01839 prediction
pathway
ethyl butyrate Knoll 1994
7762 prediction
pathway
ethyl caproate Knoll 1994
31265 prediction
pathway
ethyl caprylate Knoll 1994
7799 C12292 prediction
pathway
ethyl decanoate Knoll 1994
7799 prediction
pathway
ethyl furoate Knoll 1994
11980 prediction
pathway
ethyl heptanoate Knoll 1994
7797 prediction
pathway
ethyl isobutyrate Knoll 1994
7342 prediction
pathway
ethyl isovalerate Knoll 1994
7945 C12290 prediction
pathway
ethyl lactate Knoll 1994
7344 prediction
pathway
ethyl phenylacetate Knoll 1994
7590 prediction
pathway
ethyl propanoate Knoll 1994
7749 prediction
pathway
ethyl pyruvate Knoll 1994
12041 prediction
pathway
ethyl valerate Knoll 1994
10882 prediction
ethyl-2-hydroxy pathway
propionate 45258 C01013 prediction
furfuryl alcohol 7360 C20441 another organism KEGG
guaiacol 460 C01502 another organism KEGG
pathway
heptanal 8130 C14390
prediction
pathway
heptanoic acid 8094 C17714
prediction
pathway
hexanal 6184
prediction
pathway
hexanoic acid 8892 C01585
prediction
hexyl acetate 8908 literature data [259, 260]
Isobutanal 6561 literature data [258]
limonene 22311 C00521 another organism KEGG
pathway
linalyl propionate
61098 prediction
pathway
methanol 887 C00132
prediction
methyl acetate 6584 literature data [259, 260]
methylpropanoic acid
6590 C02632 [258]
(isobutyrate) literature data
45
Results
pathway
monoethyl succinate 70610 [262]
prediction
n-butyl acetate 31272 C12304 literature data [259, 260]
n-propyl acetate 7997 C14928 literature data [259, 260]
propionic acid 1032 C00163 literature data [257]
α-terpineol 17100 C16772 another organism KEGG
pathway
β-phenylethyl formate
7711 prediction
While the positive BLAST and FBA results increased reliability of the introduced pathways,
confirmation requires experimental verification. Here, we aimed for biochemical confirmation
of those new reactions that are catalyzed by alcohol dehydrogenases but which could not be
assigned to specific genes, yet. The Yeast 7.11 model already contained 8 genes encoding
alcohol dehydrogenases and 7 Adhp catalyzed reactions. This set of reactions was extended to
17 in this study.
Because the ADHs are well investigated, the probability of unknown isoenzymes that need
to be knocked out additionally was extremely low. Another reason for choosing the ADHs was
their importance, as fermentative growth on hexoses is not possible for yeast lacking Adhs. To
do both, verify new reactions and to assign enzymes and genes, we generated S. cerevisiae
mutants deficient in all but one of the known Adhp encoding genes. As we used S. cerevisiae
CEN.PK113-17a in this study, which in contrast to S. cerevisiae S288c does not possess ADH7,
in total 9 mutants were created (Table 2). The nomenclature of these mutants is s, for single,
plus the name of the remaining Adhp gene, e.g., sADH1 refers to the mutant possessing only
the ADH1 gene; the S. cerevisiae strain void of all 8 Adhp enzymes was named sKO8. The wild
type strain and the sKO8 strain were tested twice for their biocatalytic activity. Three alcohols,
seven aldehydes, and 3 ketones were tested (Table 7) and depending on the cofactor specificity
either NAD(H) or NADP(H) were used in the assay.
The wild type S. cerevisiae strain showed activity for all substrates but isovaleraldehyde in
the assays complemented with NAD(+/H). Like the wild type, sADH1 also showed a broad
substrate specificity and converted all tested substrates except of acetone. However, Adh1p is
known mostly for the conversion of acetaldehyde to ethanol [263-265]. Interestingly, sADH1
showed activity in the assay with isovaleraldehyde, while no activity could be detected for the
wildtype, although both strains were cultivated under identical conditions and harvested during
exponential growth in the presence of glucose excess. sADH2 only showed activity with half
of the here tested substrates (Table 7). In accordance with literature, Adh2p oxidized
acetaldehyde and propanol [263]. Another mutant with an interesting substrate spectrum was
sADH3 which accepted acetaldehyde, 2,3-butanedione, 2-butanone, propanol, and
formaldehyde. The discrepancy to Adh1p, Adh2p and Adh5p is surprising as we expected a
similar substrate spectrum for these enzymes given Adh3p shares 80% of amino acids with
Adh2p and Adh1p, a paralog of Adh5p. The role of these enzymes is reported to be similar,
while a big discrepancy in the biocatalytic activity has been shown here. Adh5p is not well
investigated and no substrate spectrum has been recorded so far. From the here tested
substances only acetaldehyde has been tested before and contrary to the investigation here, it
was converted by a mutant lacking Adh1p-Adh4p, however all other enzymes with Adh
function were still active. [263, 266-268]. Dickinson et al. tested in 2002 the possibility of
46
Chapter 2
knockout mutants to produce isoamyl alcohol and 2-phenylethanol, however they failed to
create knockout mutants carrying only 1 single gene with ADH activity [258]. However, these
findings are not in any way contradicting the here created results, since mutants with more than
one ADH gene still active were tested. Of the 13 tested compounds, sADH4, solely showed
activity with 1,3-butanediol. In the literature ADH4 is described to possess formaldehyde
dehydrogenase activity, as well as being able to convert butanol [263, 265], however this could
not be confirmed here.
sSFA1 and sADH5 showed no activity on either of the tested substrates, while a slight
conversion of 2-hexanone was found in both strains, a slightly stronger activity was found in
the sKO8 mutant. The latter observation indicates that there were still other enzymes active,
which could convert 2-hexanone. In contrast to literature [265, 269], sADH5 was not able to
catalyze the reaction from acetaldehyde to ethanol and sSFA1 was not able to convert
formaldehyde. However, the published data was collected using knockout strains which still
contained other enzymes with ADHAdh6p and Gre2p use NADP(H) instead of NAD(H).
Therefore, experiments with NADP(H) were performed with sADH6 and sGRE2 as well as the
wild type and the sKO8 mutant (Table 7). With this cofactor, the wild type was able to catalyze
the conversion of every tested substrate. Surprisingly, the sADH6 mutant showed a strong
conversion of 2,3-butanedione, while in literature it is only reported that Adh6p is involved in
fusel alcohol production [270, 271]. This could be explained by upregulation of another enzyme
(possibly Bdh1p) that converts 2,3-butanedione since a slightly lower activity is also found in
sGRE2 and even in the sKO8. However, the activity with sADH6 and sGRE2 was higher than
in sKO8, indicating that these enzymes contribute to the conversion of 2,3-butanedione but are
not concentrated high enough in the wild type to make an impact on activity. The sADH6 mutant
was also able to convert hexanal, 2-butanone, 1-heptanal, acetone and isobutyraldehyde. The
sGRE2 mutant showed lower conversion rates of hexanal and 2-butanone in comparison to the
sADH6 mutant and even lower rates than seen with the sKO8 mutant. Therefore, it can be
assumed that these two metabolites were converted by other enzymes and not by Gre2p. sGRE2
was also able to convert isovaleraldehyde in accordance with Hauser et al. [272].
Here it was demonstrated that sADH1,2,3,4,6 and sGRE2 showed activity for some of the
tested substances. However, the substances are not protein specific but mostly are converted by
multiple enzymes. Adh5p and Sfa1p do not seem to be involved in the here tested fusel
alcohol/aldehyde metabolism at all. One explanation for this discrepancy could be that in
literature other S. cerevisiae strains (S288C, YPH499) have been used whose enzymatic make-
up might differ from CEN.PK 113-7D. Another possible explanation is moonlighting or
promiscuity of Adhps, the ability of enzymes to harbor separate functions or convert diverse
substrates [273, 274]. A moonlighting function could be the inhibition or activation of another
enzyme and therefore have a regulatory effect (e.g., S. cerevisiae’s arginase inhibits the
ornithine transcarbamylase, when arginine and ornithine are both present [275, 276]). Here it is
possible that one of the Adhps is only expressed or active if one of the other ADH genes is being
expressed. Since all other ADH genes are knocked out this could explain the results shown for
sADH5 and sGRE2. Since Adh5p is an Adh1p paralog it would have been expected to have
similar functions to the ones of Adh1p [277].
It is important to notice that all here discussed results have been evaluated for yeast in the
exponential growth phase in a shake flask. Therefore, the cells were oxygen limited with excess
47
Results
glucose. It is possible that yeasts in a stationary growth phase, or yeasts that have excess oxygen
and that are glucose limited, show different results. However, since the here tested conditions
lead to yeast fermentation, it is unlikely that alcohol dehydrogenases are expressed higher under
aerobic conditions.
It was surprising that the main activity not only in the conversion of acetaldehyde to ethanol,
but also in the conversion of most of the tested substrates could be detected in S. cerevisiae´s
main ADH. Not only Adh1p, but most of the tested enzymes (all but Adh4p, Adh5p and Sfa1p)
showed catalytic activity with a number of the tested substrates. Single enzymes are not
responsible for the production of specific substances. The conversion of the 13 investigated
substrates by alcohol dehydrogenases or enzymes with alcohol dehydrogenase activity,
respectively, was confirmed.
48
Table 7: Enzymatic capacity of sADH mutants. The strains were tested for their ability to convert alcohols, ketones, and aldehydes in
enzymatic assays. The mutants showed either clear conversion (+), slight conversion (+/-) or no conversion of the substrate (-). Green
indicates accordance to literature data, red indicates contrariety.
cofactor NAD(H) NADP(H)
substrate WT sADH1 sADH2 sADH3 sADH4 sADH5 sSFA1 sKO8 WT sADH6 sGRE2 sKO8
acetaldehyde + + + + - - - - + - - -
hexanal + + - - - - - - + + - -
2,3-butanedione - + + + - - - - + - + +/-
2-butanone + + + + - - - - + + - -
1-heptanal + + - - - - - - + + - -
1,3-butanediol + + + - + - - - + - + +/-
propanol + + +/- + - - - - + - - +/-
2-hexanone + + + - - - - +/- + - - +/-
acetone + - - - - - - - + + + -
isobutyraldehyde + + - - - - - - + + + +/-
isovaleraldehyde - + - - - - - - + - + +/-
formaldehyde + + + + - - - - + - - -
2-methylbutanal + + +/- - - - - - + - + +/-
49
Chapter 2
Results
Computational models enable us to structure the vast field of knowledge related to an organism,
the enhancement of a model helps to close gaps in this accessible knowledge. All here made additions
to the model are non-essential for growth of the organism. The majority of amendments made here
are based on computational predictions and were only substantiated by BLAST searches and (T)FBA
analyses. To increase the reliability of the here expanded model, experimental verification of the new
pathways is required. To this end, analyses of pathway intermediates by, e.g., LC or GC combined
with mass spectrometry [278, 279], besides enzymatic assays of know-out mutants, as done here, can
be applied. The here added reactions could be especially interesting, when a yeast shall be enhanced
for the production of volatiles that may alter the taste of the food produced. It would be possible to
construct yeasts that have a fruity taste by enhancing the production of some esters. For example, the
upregulation of genes producing 2-phenylacetate would lead to a rose like odor. These aroma
properties could even be transferred from yeast to the final product, e.g., a bread that smells like apple
or banana, or a wine that has a rose-like bouquet. Also, it would be possible to create yeasts that
produce industrially relevant products, such as fuels or precursors for fuel production, such as butanol
(biofuels) [280] or 2,3-butanediol (bioplastic) [281].
50
Yeast volatilome dynamics during metabolic shifts
Contributions:
The study was designed by Christoph Halbfeld, Birgitta E. Ebert, Lars M. Blank and Pablo Martinez-
Lozano Sinues. The experiments were performed by Christoph Halbfeld and Pablo Martinez-Lozano
Sinues. The data was evaluated by Christoph Halbfeld, Henrik Cordes and Birgitta E. Ebert.
Results
55
Chapter 2
Introduction
The baker’s yeast Saccharomyces cerevisiae has been in the focus of research and industrial
production ever since industrialization has started. It has been used to produce beverages like beer
and wine since ancient times [282-286] but has also been in the focus of scientific research and was
the first eukaryotic organism for which the complete genome has been sequenced [287, 288]. A
specific trait of baker’s yeast is the Crabtree effect, which represents a metabolic shift from respiration
to aerobic fermentation when high sugar concentrations are supplied in the growth medium [289].
This shift has significant, economic relevance in baking yeast production since fermentation with
high initial sugar concentration or excess glucose feeding mainly leads to the production of ethanol
instead of biomass and worsens baking and storage ability of the product (Dr. Quantz, VH-Berlin,
personal communication). The Crabtree effect can easily be induced by overfeeding of glucose and
has been studied in nearly every aspect. However, the impact of the Crabtree effect on the formation
of volatile metabolites has not been investigated so far. While there are plenty of studies covering
volatile flavor compounds of yeast products, e.g., bread or wine [9, 290-293], almost no studies
exploring volatile metabolite formation during yeast growth in minimal salt medium exist. This trend
is changing lately with scientific investigations putting the focus on Saccharomyces’ volatile space
[1, 91, 185].
Changing the metabolic state is required for an organism to adapt to altered environmental
conditions for example by enzymatic adaptation to new nutrition sources or the production of
metabolites that fend off enemies. Here we used the induction of the Crabtree effect, i.e., the transition
from respiration to aerobic fermentation, as an example for a metabolic shift. Induction of the
Crabtree effect results in an increased flux through glycolysis and reduction of the relative
(normalized to the glucose uptake rate) pentose phosphate pathway flux. The major change, however,
is a downregulation of the citric acid cycle, the respiratory pathway, and the strong increase in
cytosolic pyruvate transformation to ethanol [294]. These changes in the central carbon metabolism
are well investigated but not necessarily the only changes that occur in the cell and additional changes
of the fluxes through the pathways responsible for the synthesis of amino acids, fatty acid synthesis
and degradation as well as terpene biosynthesis involving also volatile metabolites might occur.
56
Results
electrode is applied. The ions in the formic acid solution are pulled towards the negative charge in
the electric field and thus form a cone, where all ions are collected at the tip of the cone. When the
charge is high enough at the tip of the cone, droplets are formed that dissociate from the rest of the
water. The droplets are multiply charged and become smaller over time since the water evaporates
until the electrostatic repulsion in the drops becomes larger than the surface tension. The droplets thus
undergo Coulomb fission and smaller droplets are formed. This continues until one or no charge is
left per droplet [298]. The sample is introduced into the charged droplets. Through collisions of the
uncharged volatiles with the charged droplets, charges are transferred and the volatile molecules are
ionized. Since this happens instantaneously, a constant flow of ionized molecules can directly be
transferred to the Orbitrap [299]. The ionized gas is bundled by an electric field (focusing electrode)
and led through the impaction slit. Here the ionized gas collides with a counter flow of clean gas and
the charged ions are dragged further along the electric field while uncharged particles are flowing out
of the system (Figure 5). Fast and continuous ionization makes SESI-Orbitrap-MS especially
interesting for fermentation off-gas analysis as samples can be withdrawn and measured without any
sample preparation.
Figure 5: Schematic representation of a secondary electrospray ionization source. The here indicated
DMA is interchangeable with an Orbitrap. DMA= differential mobility analyzer. Reprinted with
permission from [300]. Copyright 2012 American Chemical Society.
The Orbitrap system analyzes the samples with a frequency of up to 20 Hz. This enables the
detection of real time changes and to resolve even very fast dynamics. Because of the high resolving
power of the device (100,000 to 1,000,000 depending on the device and m/z) (see Figure 6), no
chromatographic pre-separation is necessary [301]. The high mass resolution gives the possibility to
distinguish isobaric ions and the fast measurements allow to record a complete mass spectrum in each
measurement. Depending on the concentration and stability of the metabolite, single interesting
masses can be further fragmented if the machine is equipped with a collision chamber and thus be
identified based on their fragment spectrum.
57
Chapter 2
SESI-MS has been used to investigate the dynamics of volatile compounds excreted by Begonia
semperflorens [297]. These measurements allowed to elucidate diurnal changes of 400 volatile
metabolites released by these plants. As consequence of mechanical damage 1200 volatile metabolites
were detected that showed changes compared to non-damaged plants. Some of the changes could not
have been detected with a lower sampling frequency, hence the direct ionization and high sampling
frequency were needed [297]. Similar studies have been conducted for the human exhalome by Sinues
et al. who reported that 40% of the 111 detected signals showed significant circadian modulation
[302, 303]. In yet another study Gaugg et al. showed that smokers and non-smokers could be
distinguished based on breath analysis [133].
In this study, we focused on off-gas analysis of fermentations of baker’s yeast. Here we set out to
exploit the SESI-Orbitrap-MS technology to investigate rapid changes in the volatilome of a
continuous culture after targeted perturbations of the metabolic steady-state and induction of the
Crabtree effect. We show that it is possible to distinguish metabolic states using the SESI-Orbitrap
and to monitor the transition from one metabolic state to another.
Identification of volatile metabolites correlating with metabolic shifts and their biosynthetic
pathways will shed new light on the regulatory mechanisms associated with the Crabtree effect.
mM potassium hydrogen phthalate and the pH was adjusted to 5 using KOH prior to autoclavation,
while the vitamin solution and the trace elements were sterile filtered. The glucose was separately
autoclaved.
The pre-culture was incubated at room temperature and stirred with a stirrer bar at low rpm. The
continuous cultivation was performed with 4 parallel self-made 10 mL bioreactors (Seele
Glasapparatebau & Laborservice, Swisttal-Straßfeld, Germany). Mixing of each reactor was achieved
by a stirrer bar (10x3 mm, Karl Roth, Karlsruhe Germany) powered by a second magnet below the
glass vessel, which itself was driven by a motor. The fermentations were run at 30 °C; the temperature
was controlled by a water jacket connected to a Thermomix 1420 (B. Braun, Bethlehem, PA, USA).
The pH was not actively controlled but kept at pH 5 due to buffer and the incoming fresh medium.
The dilution rate and thus the specific growth rate, was set to 0.15 h-1 (below the critical dilution
rate of both strains in Verduyn minimal medium). For the medium feed an Ismatec Reglo ICC (Cole-
Parmer GmbH, Wertheim, Germany) and Ismatec Pharmed tubing with 0.25 mm ID (Cole-Parmer
GmbH, Wertheim, Germany) was used. The fermentation volume was kept constant at 10 mL by
adjusting the efflux tubing to a predefined height. For the efflux an Ismatec Reglo ICC pump (Cole-
Parmer GmbH, Wertheim, Germany) and Ismatec Pharmed tubing with 1.02 mm ID (Cole-Parmer
GmbH, Wertheim, Germany) were used. The reactor was aerated with 500 mL/min (50 vvm) of
compressed air via a Sho-Rate Series rotameter (Books Instruments, PA, USA). The air was filtered
and humidified prior to its introduction into the reactor (Figure 7). Safeflow connectors (B. Braun,
Melsungen Germany) were used for sampling. The gas outlet was coupled to a SESI-Orbitrap via a
transfer line that was heated to 130 °C.
The off-gas of the cultivation was continuously monitored by the SESI-Orbitrap. The
measurements were started when the fully respiratory, continuous culture had reached a metabolic
steady state. To capture potentially fast dynamics of volatile metabolites, the SESI-Orbitrap
measurement frequency was set to one full spectrum every 5 seconds. The S. cerevisiae culture was
perturbed by injecting a pulse of a sterile glucose solution (50 mg ؙ27.7 mM) and measurements
were taken until the ethanol signal reached its maximum. After the pulse, the system was left
undisturbed for 48 hours to re-establish a metabolic steady state.
59
Chapter 2
Figure 7: Schematic view (A) and picture (b) of the mini-bioreactor setup connected to the SESI-
Orbitrap-MS (Bioreactor constructed by Eik Czarnotta and Suresh Sudarsan, RWTH Aachen
University).
60
Results
Lozano Sinues and is commercially available (SEADM, Boecillo, Spain). The Thermo Finnigan LTQ
Orbitrap (Thermo Fisher Scientific, Waltham, MA, USA) was used as detector.
The SESI and Orbitrap settings were similar to those used by Rioseras et al. 2017 [295]. The SESI
used a 0.1% formic acid solution that was infused at ~100 nL/min through a 20 μm ID silica capillary.
The voltage of the electrospray was set to 5.4 kV.
The mass range was 50-500 m/z, with an acquisition rate of 0.20 spectra/s. The pre-set resolution
of the device was 30,000, while the mass accuracies were typically within 2 ppm. After connecting
the bioreactor off-gas to the SESI-Orbitrap, a quick decline of the total ion current (TIC) could be
observed. Measurements were only started when the TIC had stabilized.
Data evaluation:
Data was acquired in Thermo Scientific’s .raw format and converted to mzXML files using the
ProteoWizards msconvert tool [304]. The data was imported into MATLAB R2012b (Mathworks,
Natick, MA, USA) and each dataset was interpolated linearly (106 points in the range of 50-500 Da);
interpolated profile mass spectra were then centroided (intensity threshold of 50 a.u.) as described by
Rioseras et al. [295]. The mass spectral data was evaluated using a self-written MATLAB script (see
Appendix). The data was first processed using the medfilt1 (equation 1) and sgolayfilt filter for
smoothing. Those processed datasets were used to detect signals whose concentration changed in the
period between glucose pulse injection and the increase of the smoothed ethanol signal above a
defined threshold. For visual inspection, two clustergrams were created (see Figure 8 A and B). The
first one shows all signals which displayed a maximum intensity between the glucose pulse and the
appearance of ethanol. The second one shows those signals having a maximum later than the
appearance of ethanol but that changed after the injection of the glucose pulse. In addition, the
normalized data was plotted against time, one plot per signal, and overlaid with the normalized
ethanol signal (see Figure 8 C).
݅ݔെ ݊݅݉ݔ Equation 1
ܺൌ
ݔܽ݉ݔെ ݊݅݉ݔ
The signals left after filtering, were further evaluated manually by scanning the clustergram for
changes in the timeframe between the glucose pulse and ethanol formation. In case the masses showed
interesting dynamics in more than 5 of the eight experiments they were considered to correlate with
the metabolic changes induced by the glucose pulses. One exception was the mass most likely
representing isoamyl alcohol (3-methyl-1-butanol), which was included in the list of relevant masses
although it only showed a rapid change in 5 of the 8 performed experiments.
61
Chapter 2
volatiles that were either consumed or produced in this transient state prior to the production of
ethanol were in the focus of this study. Per experiment about 2,500 signals were recorded (see Figure
8 A and B) that show clearly individual trends during the course of the experiment. Due to the large
amount of signals, the data had to be software filtered for interesting signals since manual evaluation
of the complete datasets would be cumbersome. The data recorded during the steady state clearly
differentiated from the data recorded after the glucose solution was injected, therefore the two
metabolic states could be clearly distinguished using the SESI-Orbitrap. After the computational
evaluation about 200 to 300 signals of each dataset were left that were subsequently evaluated
manually by plotting these signals against the ethanol signal. Most of the here found signals were
increasing in intensity after the glucose pulse, while only few were decreasing. Therefore, it can be
assumed that the flux rates during aerobic fermentation are higher than during respiratory growth. All
interesting signals were added to a list and a score, based on the number of experiments, the signal
resulted to be interesting, was generated. The most 16 interesting signals were evaluated further
(Table 8).
62
Results
Table 8: Mass to charge ratio (m/z) of the most interesting signals recorded during the metabolic
transient state in a continuous glucose-limited fermentation after setting a glucose pulse. + and #
indicate masses whose signal intensity linear correlated with each other and which probably
originate from the same metabolite. m/z 69.0701 and 89.0962 have been tentatively identified as 3-
methyl-1-butanol and isoprene, respectively.
percentage of experiments in which the
m/z signal was detected (%) comment
57.0700 87.5
58.0735 87.5
69.0701 100 (+) isoprene
70.0732 100 (+) isoprene (protonated)
71.0857 100 cyclopentane
72.0887 100
73.0649 87.5 ethoxy ethene
74.0680 87.5
89.0962 75 3-methyl-1-butanol
118.0962 75
119.0885 100
127.1117 75 1-octen-3-one
128.1152 75
166.9860 100 (#)
177.0763 100
196.1123 100 (#)
Most signals have not been identified yet, but we speculate that they have not even been observed
and be linked to the Crabtree effect so far as detection of these low abundant molecules and
monitoring of the fast dynamics is only possible today with highly sensitive and fast analytics such
as SESI-Orbitrap-MS.
63
Chapter 2
Figure 8: Data evaluation of SESI Orbitrap analyses of the off-gas of a continuous glucose-limited
yeast culture at steady state which was disrupted with a 27 mM glucose pulse. The filtered data is
displayed as a clustered heatmap in which the scaled intensity of single masses (m/z value) are plotted
over time (A), zoom-in excerpt of the heatmap shown in A (B). Smoothed data of interesting signal
traces (blue line) identified in the heatmap are plotted against time together with the signal of ethanol
(black line). The left black vertical line indicates the timepoint of the glucose pulse injection, while
the right line indicates the timepoint of the first detection of ethanol (C-F).
Two compounds were tentatively identified as isoprene and 3-methyl-1-butanol (isoamyl alcohol).
Isoamyl alcohol is produced during the degradation of leucine via the Ehrlich pathway. Possibly
during the metabolic transition from aerobic respiration to aerobic fermentation, amino acids are
required in large quantities because of an increased reproduction and production of biomass.
Therefore, leucine might have exceeded a threshold that triggers leucine degradation resulting in
isoamyl alcohol production. However, the definite role of isoamyl alcohol remains unclear.
64
Results
Isoprene is not known to be naturally produced by S. cerevisiae, however precursors of it are native
to S. cerevisiae’s metabolism and metabolic engineering has been performed to create isoprene
production strains [305]. It would be more likely that the measured volatile is not isoprene but another
volatile with the same molecular weight. However, since the volatile space in yeast fermentations has
been neglected thus far widely, it is possible that isoprene has not been detected before. The direct
precursor of isoprene, dimethylallyl pyrophosphate, is a part of S. cerevisiae’s mevalonate pathway
[306]. The possibility of spontaneous conversion in low quantities is given. While there were studies
that have investigated the volatile space of yeast in the recent past, they have not detected the presence
of isoprene [91, 307]. This could be due to the used indirect measurement methods that included
adsorption prior to the measurement, as isoprene might not be adsorbed due to its high volatility.
Nevertheless, as mentioned before it is more likely that the tentatively identified isoprene signal is
another compound.
capillary that feeds the SESI and high vacuum that is needed for measurements. A less costly and
more robust system is given with the multicapillary column ion-mobility spectrometer as explained
in detail in the next chapter.
66
Multicapillary column-ion mobility spectrometry of volatile metabolites
emitted by Saccharomyces cerevisiae
Contributions:
Christoph Halbfeld performed the experiments. Christoph Halbfeld and Birgitta E. Ebert
analyzed the results. Christoph Halbfeld and Birgitta E. Ebert wrote the manuscript with the
help of Lars M. Blank. We thank Marco Fraatz (Justus-Liebig-University Gießen, Germany)
for GC-MS measurements and help with data evaluation and Jörg I. Baumbach (Reutlingen
University, Germany) for fruitful discussions. We also thank Peter Kaiser (B&S Analytik,
Dortmund, Germany) for technical support and Mathis Wolter (RWTH Aachen, Germany)
for assistance with MCC-IMS-measurements and implementation of the experimental set-up.
Results
71
Chapter 2
Introduction
Yeasts are key model organisms in eukaryotic research and play a significant role in many
biotechnological processes. The use of yeast for biotechnological processes dates back to 7000–5000
BC, where it has been used for wine fermentation and in food processing [284, 310-312]. Today,
yeast strains are used in the chemical, food, and pharmaceutical industry for the synthesis of a broad
range of products from bakery products to bioethanol and pharmaceuticals [313-316]. With 4 million
tons of yeast biomass produced for baking worldwide in 2009 and an estimated yearly increase of 7%
[317], the yeast biomass market is in the top 10 of biotechnology products. The so far most often used
yeast cell factory is the baker’s yeast Saccharomyces cerevisiae. This yeast is not only the most
widely used yeast in biotechnology, but is additionally the model system for eukaryotic organisms.
Accordingly, much research has been conducted with S. cerevisiae and many of the today state-of-
the-art analytical techniques and molecular biology methods have been first developed for and with
this yeast. The simple and rapid cultivation, genetic accessibility, and industrial importance were and
still are drivers to maintain its lead in the yeast community in many disciplines of science.
As mentioned above, the volatile metabolites produced by yeast have been mainly neglected in
yeast research with the most prominent exceptions of acetaldehyde and ethanol. This can be attributed
to the limited knowledge of the biochemistry due to the complex analysis of volatiles. In addition,
genetics involved in the formation of volatile metabolites hinder the general incorporation in systems
biology studies. By far, most reports of volatile metabolites from yeast originate from researchers
interested in high quality wine making [249-252, 291, 318, 319], as the scent of wine impacts its
organoleptic properties [291]. The main classes of volatile metabolites observed are alcohols,
aldehydes, and esters (Table 5); while depending on grape and yeast strain used, many others can be
found. Notably, most studies were carried out on media that have wine-like compositions. Thus, the
media are most often complex, with alternative carbon and nitrogen sources present. The observed
volatile metabolites can therefore originate from glucose catabolism or are products from
biotransformation, i.e., do not originate from sugar (the carbon and energy source), but rather from
grape metabolites that were only modified by yeast enzymes.
One of the key bottlenecks in VOC research, and one of the reasons why these have not been
studied broadly so far, is that sample preparation of gaseous chemicals requires additional care and
that the analysis of volatiles is challenging. Most often, VOCs are extracted and enriched using head-
space/solid phase microextraction (HS/SPME) methods and analyzed with gas chromatography
coupled to advanced mass spectrometers [5, 159]. In the previous chapter, the use of a SESI-Orbitrap
was reported, but because of the high invest cost, this device is unlikely to be used in industrial
applications. As described in the next chapter, industrial applicability of the analytical system is of
interest, therefore an alternative to the SESI-Orbitrap had to be investigated to monitor the yeast’s
volatile space. For this purpose, the ion mobility spectrometry that was already explained broadly in
the general introduction was used here. The MCC-IMS’s characteristics, high time resolution, low
cost, and low maintenance, together with the high sensitivity perfectly suit this analytical technique
for online measurements of dilute volatile metabolites in the headspace of microbial fermentations.
GC-MS devices are suited for the identification of metabolites, but come with the disadvantage of
longer sampling times, although rapid GC techniques exist. Furthermore, GC-MS instruments require
special gases such as helium and high vacuum, hence come with relatively high operating costs and
technical expenditure. In contrast, MCC-IMS can be operated with nitrogen or air (not necessarily
72
Results
synthetic air), at ambient temperature and pressure. In addition, handheld, mobile devices are
available underlining that MCC-IMS can be used flexible as they can be robust.
The potential of MCC-IMS analyses for fermentation monitoring has already been shown for
measurements of mVOCs produced during batch cultivation of Escherichia coli and Pseudomonas
aeruginosa in shake flasks [320, 321]. Also, MCC-IMS measurements of yeast fermentation have
been reported in which online measurements of the off-gas of yeast fermentations were performed.
While Kotiaho [322] focused on the quantification of one single metabolite, ethanol, Kohlemainen et
al. measured patterns of off-gas metabolites without any analyte identification [323]. The potential
of IMS analyses for quality control during beer fermentation was shown by Vautz et al. [324] by
monitoring the ripening indicators diacetyl and 2,3-pentanedione.
In this contribution, we evaluated the capabilities of MCC-IMS for online monitoring of mVOCs
produced by S. cerevisiae. Different growth conditions were tested and special emphasis was put on
the dynamics of the VOC profiles during transient metabolic conditions, i.e., the shift from respiratory
to fermentative metabolism.
volume and connecting it to a separate pump that removed excess fluid. Both batch and continuous
cultivations were single experiments.
To check for possible contamination during fermentations, samples were examined daily under
the microscope (Leica DM750) with a 10X ocular and a 100X oil immersion objective.
Analytics
The optical density was determined with an Ultrospec 10 photometer (Amersham Bioscience,
Amersham, Switzerland) with a fixed wavelength of 600 nm. When necessary, the samples were
diluted using demineralized water.
For the determination of glucose and fermentative byproducts, samples were taken directly out of
the fermenter using a syringe and a steel pipe. Samples were harvested by centrifugation (Heraeus
Megafuge 16R, Thermo Fisher Scientific, Marietta, Ohio, USA) at 5,000 rpm for 5 min at 4 °C. The
supernatant was stored at −20 °C until further analysis. Analytes were separated using an organic acid
resin column (C-S Chromatography, Langerwehe, Germany) at 50 °C. 5 mM H 2SO4 was used as
eluent at a flow rate of 0.8 mL min−1 (System Gold 125 Solvent Module). Analytes were detected
with a UV detector (166 Detector, (Beckman Coulter, Krefeld, Germany) at a wavelength of 210 nm
and a RI detector (Melz Differential Refractometer LDC 201) operated at 50 °C. Standard solutions
of the analytes were measured in concentrations of 0.1, 0.5, 1, 5, 10, 20, 40 and 50 g L−1.
MCC-IMS measurements
The MCC-IMS used was a BreathDiscovery (B&S Analytics, Dortmund, Germany) with an upstream
multi capillary column type OV-5 (Multichrom Ltd. Novosibirsk, Russia) of 17 cm length consisting
of approx. 1000 capillaries. The capillaries have an inner diameter of 40 μm and are coated with OV-
5 stationary phase with a film thickness of 0.2 μm. The column temperature was set to 40 °C. Samples
were ionized with a 550 MBq 63Ni ion source. The ionized analytes were introduced into the drift
column (length, 120 mm) through a shutter that had a pulse frequency of 50 ms and an opening time
of 30 μs. Separation in the drift chamber was carried out in a negative coaxial electric field with an
intensity of 300 Vcm−1 (positive measurement mode). The MCC-IMS was operated at ambient
74
Results
temperature and pressure (i.e., laboratory conditions). Raw data of mVOCs was acquired using
VOCan (B&S Analytik) with a frequency of 10 Hz, 5 consecutive single spectra were averaged. A
single round of data acquisition required 0.5 s. The program was used to control all parameters of the
MCC-IMS like gas flow and temperature, and to program measurement sequences.
Nitrogen 5.0 (Westfalen, Münster, Germany) was used both as drift gas in the MCC-IMS and as
carrier gas in the MCC. The drift gas flow rate was set to 100 mL min−1; the carrier gas flow rate was
set to 150 mL min−1 during batch and 50 mL min−1 during continuous fermentation. The fermenter
off-gas was introduced into the system through a 10 mL stainless steel sampling loop coupled to a
six-port valve. Between single measurements the MCC-IMS and the sampling line was purged with
a nitrogen flow of 100 mL min−1.
The MCC-IMS topographic plots were evaluated using the software VisualNow (B&S Analytik).
Reduced inverse ion mobilities, 1/K0 (Vs cm−2), were calculated by normalizing the measured drift
velocities (drift time per drift distance) to the electric field, temperature, and pressure. This reduced
ion mobility is characteristic for the ion and independent of the experimental conditions. The program
allowed the definition of peak regions and comparison of the peak intensities in different datasets.
The intensities of detected peak regions, the reduced ion mobility and retention time were exported
to Excel for further data evaluation [328].
The MCC-IMS was connected to the fermenter off-gas with a Teflon tube (ID, 1.58 mm; length,
1000 mm). To prevent overloading of the MCC-IMS, the off-gas was diluted with sterile, moisturized
air or nitrogen at a flow rate of 2.4 mL min−1. The air was filtered with a 0.2 μm sterile filter. Mixing
was achieved by introducing both gas streams into a 500 mL Schott bottle.
75
Chapter 2
from the environment as no impurities were observed in the MCC-IMS during abiotic operation of
the bioreactor.
Figure 9: Experimental set-up for the online MCC-IMS measurements of fermenter off-gas.
Previously published in [185].
76
Results
Figure 10: MCC-IMS topographic plot of sterile Verduyn medium. The reaction ion peak
(1/K0 = 0.5 Vs cm−2) was compensated by the software VisualNow.
After inoculation to a starting OD600 of 0.1, MCC-IMS analyses were performed throughout the
growth experiment in one hour intervals. In addition to the signals detected in the sterile medium, 19
peaks emerged during the batch growth experiment, at retention times between 1 and 190 s (Figure 11).
The time course of the six most distinctive peaks is shown in Figure 12 B, C. To correlate the MCC-
IMS patterns of the volatile metabolites to the yeast physiology, the optical cell density, carbon source
consumption, and byproduct formation (ethanol, glycerol) were quantified in parallel to the MCC-
IMS measurements (Figure 12 A).
77
Chapter 2
Figure 11: MCC-IMS topographic plot of S. cerevisiae during the early stationary phase of a batch
fermentation. Boxes indicate signals that showed the most significant changes during the growth
(perturbation) experiments.
In the single fermentation experiment, the profile of signal C3-5 correlated with the growth rate
since its signal increased after the lag phase and reached its maximum during the exponential growth
phase. In the stationary phase, the peak intensity of C3-5 decreased again. Peak C3-9 was detected at
the same time as ethanol, measured in the fermentation broth, and its signal diminished
simultaneously with complete ethanol consumption. The signal of C3-8 showed an increasing trend
in the late exponential to early stationary phase, when ethanol was nearly consumed. Signal C3-15
showed a rather peculiar profile. The signal intensity first increased, but rapidly decreased after 5 h
and maintained a constant level for about 11 h. After this period, the intensity of C3-15 abruptly
increased and reached its prior maximal value followed by a steady decrease at the end of the batch.
This behavior might be explained by incomplete ionization of the analyte molecules. The intensity of
the two signals decreased when the intensity of peak C3-5 increased. This signal might have a higher
proton affinity and therefore be preferably ionized to substance C3-15. This hypothesis is
substantiated by the low reaction ion peak (RIP) in the MCC-IMS chromatograms for the period
between 5 h–21 h (data not shown). The RIP consists of reaction ion molecules originating from the
drift gas, here nitrogen. In the ionization chamber, water molecules react with positively charged
nitrogen ions to a cluster of the type (H2O)nH+. These ions form the RIP and transfer the charge to
molecules with a higher proton affinity. Hence, with increasing analyte concentration the RIP
diminishes. For more detailed information about the charge transfer reactions, the reader is referred
to [128]. Note that the data presented here originates from single experiments and are thus not based
on statistics. The intention of this work was the development of a set-up for online MCC-IMS
measurements of volatile metabolites in the off-gas of yeast fermentations, with which we will
generate more comprehensive datasets in future experiments.
78
Results
Figure 12: (A) Fermentation profile of S. cerevisiae during batch growth in glucose minimal medium,
(B) trends in intensity, (C) heat map of selected peaks detected by MCC-IMS analysis of the
fermentation off-gas. Areas in the heat map show the detected signal peak and the surrounding area;
DO = dissolved oxygen.
To elucidate the potential of MCC-IMS analyses for the differentiation of different S. cerevisiae
strains or mutants we compared the MCC-IMS chromatograms of S. cerevisiae CEN.PK 117
YOL086c::kanMX4, deficient in the major alcohol dehydrogenase Adh1p, with its isogenic reference
strain. Again, we want to stress that in this proof-of-principle work, only single experiments were
performed to show the general applicability of MCC-IMS for online measurements of fermentation off-
gas.
The ADH1 deletion mutant had a reduced growth rate and biomass yield, about 56% and 42% of
the reference values. The ethanol formation was clearly reduced (maximal accumulation of 0.8 g L−1
vs. 6 g L−1 for the reference strain), while glycerol production was increased (Figure 13 A). These
differences in the strain physiology were also reflected in the MCC-IMS pattern (Figure 13 B,C).
While no new peaks compared to the reference strain chromatograms were detected, the profiles of
several peaks differed. Peak C3-15 increased much slower compared to the reference strain
fermentation. The signal of C3-5 rose in the beginning, stagnated within the 5th–20th h after
inoculation and increased afterwards. While the absolute intensity of peak C3-6 was lower in the
measurements of the mutant strain compared to the reference strain, the time profile was similar for
both cultivations. The profile of peak C3-20 was similar to that in the reference strain cultivation but
showed a shallower increase at the start of the fermentation, while the intensity of C3-8 rose faster.
Although replicate experiments are required for a statistically valid statement, we hypothesize that
these distinct mVOC derived MCC-IMS signals allow differentiation of the two yeast strains.
Similarly, species specific volatile footprints or markers have are already used to detect cancer via
breath analysis of patients [113] or fungal contaminants in buildings [329].
79
Chapter 2
Figure 13: (A) Fermentation profile of S. cerevisiae adh1Δ during batch growth in glucose minimal
medium and (B) trends in intensity and (C) heat map of selected peaks detected by MCC-IMS analysis
of the fermentation off-gas. The areas in the heat map show the detected signal peak and the
surrounding area; DO = dissolved oxygen.
These measurements gave first valuable information about the volatile metabolite patterns
produced by yeast and their dynamics during growth on glucose minimal medium. However, because
of the high signal of volatiles, most likely ethanol and acetaldehyde, in the off-gas and probable
incomplete ionization of metabolites, data interpretation and thorough metabolite detection under
these conditions was limited. To make batch observation possible, other column materials or longer
columns would be needed, however, longer columns would increase the analysis time by far [324].
80
Results
Figure 14: MCC-IMS topographic plot of the off-gas of a glucose-limited continuous cultivation of
S. cerevisiae. Boxes indicate signals that showed the most significant changes during the growth
(perturbation) experiments. The reaction ion peak (1/K0 = 0.5 Vs cm−2) was compensated for by the
VisualNow software.
To induce a shift from respiratory to fermentative metabolism, the steady state culture was
perturbed once with a pulse of 22 mmol glucose, which was rapidly injected into the bioreactor.
Immediately after the glucose pulse, ethanol accumulated in the fermentation broth (Figure 15 A).
Acetate (data not shown) and glycerol were detected as well and showed a similar profile as ethanol.
The surplus glucose was consumed within 75 min after which ethanol was catabolized and diminished
about 3 h after the pulse. The optical density (OD600) increased from 31–39. The intensity of several
signals detected with the MCC-IMS increased after the pulse and decreased again after about 2 h
(Figure 15 B,C). The most prominent changes were observed for the signals marked in Figure 14,
these are the same peaks as in the batch cultivation of the wild type yeast and the ADH1 mutant. Peak
C3-15 showed a strong correlation with the ethanol concentration determined in the fermentation
broth. However, other peaks, like C3-6 and C3-8, did not resume the intensities prior to the
perturbation, but maintained a higher level within the 7 h of MCC-IMS monitoring, hence, correlated
81
Chapter 2
with the increase in biomass concentration. C3-5 was the only peak whose intensity decreased upon
glucose addition. About 3 h after the glucose pulse, its intensity increased again and regained its
original value in the next 3 h. C3-20 showed a rapid decrease directly after the pulse, remained at a
constant level and showed a decreasing trend after about 2 h and 30 min.
The physiological response of S. cerevisiae to limited oxygen availability is very similar to that of
the Crabtree effect. In both cases, the fluxes through glycolysis are upregulated, while the fluxes
through the TCA are downregulated and as a consequence ethanol is produced [294, 335]. To
elucidate possible differences in the volatile metabolite patterns of yeast cultures responding to a
glucose pulse and anaerobiosis, respectively, in a second perturbation experiment gassing was
switched from air to nitrogen. In this single perturbation experiment, the dissolved oxygen (DO)
concentration dropped to zero within 10 min. Simultaneously with this drop, ethanol and glycerol
accumulated in the fermentation broth, while only little acetate which accumulated only after 1 h of
anaerobic growth (Figure 16 A). The biomass concentration decreased slowly during anaerobiosis.
Note that the data of this perturbation experiment cannot be directly compared to the glucose pulse
as the air supply was permanently replaced by the same flow rate of nitrogen.
82
Results
Figure 16: (A) Fermentation profile of S. cerevisiae during growth in a glucose-limited chemostat
and (B) trends in intensity and (C) heat map of selected peaks detected by MCC-IMS measurements
of the fermentation off-gas during transition to anaerobic conditions; DO = dissolved oxygen.
As in the glucose pulse perturbation experiment, peak C3-15 increased as soon as ethanol was
produced (Figure 16 B, C). The increase flattened after about 60 min and decreased after about 2 h.
Again, incomplete ionization and possible incomplete evaluation of the peak area might be
responsible for this trend. The intensities of peak C3-6 and C3-8 increased rapidly in the first 30 min
after the shift to nitrogen gassing, considerably faster than in the glucose pulse experiment. C3-9
showed a slight increase, while peak C3-5 stayed constant over the period of 3 h. Peak C3-20 showed
a similar trend as in the glucose pulse perturbation, a rapid decrease after the shift to nitrogen gassing
followed by a steady intensity during the 3 h of monitoring. The dynamics of the MCC-IMS signals
were very similar to that observed during the imposed Crabtree effect and no new peaks were
detected. However, S. cerevisiae responded faster to anaerobic than to glucose excess conditions.
Changes in the peak intensities of, for example, C3-15 were already observed 7 min after the shift to
nitrogen gassing, i.e., before complete anaerobiosis, while the first changes in the MCC-IMS peak
intensities after the rapid glucose pulse were observed only after 17 min.
In both perturbation experiments, samples were measured in intervals of 215 s over a period of
about 30 min. These rapid measurements show the potential of MCC-IMS analysis for online
monitoring and control of bioprocesses.
83
Chapter 2
hexanedione, which is reported as a metabolite of brewer’s yeast with a cheesy aroma [193] and has
recently been detected in the headspace of agar plates cultures of Corynebacterium glutamicum [344].
The low recovery rate of metabolites identified by GC-MS might partially be explained by the
different sampling procedures. While for the MCC-IMS measurements 10 mL of the off-gas were
directly measured, for GC-MS analyses, VOCs were extracted from the culture broth at 50 °C and
were preconcentrated. Furthermore, GC-MS peaks were only tentatively identified by comparison
with databases and require validation by pure standard analyte measurements. However, 2,3-
butanediol and acetoin have also been found in the SESI-Orbitrap measurements and therefore
support the designation as identified (Table 9) [295]. To broaden the spectrum of analyte detection in
the MCC-IMS, measurements with both negative and positive ion mode are useful. Our future
experiments will focus on the identification of unknown MCC-IMS signals, including thorough
verification by GC-MS measurements of pure standard substances. Ideally, feeding experiments with
labelled precursors should be performed to conclusively prove whether the identified compounds are
actually produced by S. cerevisiae, this verification needs to be carried out using a suitable MS.
85
Chapter 2
However, limitations of the device were apparent, when small amounts of ethanol lead to an
overloading of the device with problems in overall detection. Therefore, the setup cannot be used in
batch fermentations. Another problem is that all signals accumulate at low 1/k0 values and low
retention times. To increase the resolvability and to prevent overloading the MCC-IMS configuration
has to be optimized by, e.g., installation of a sample loop of lower volume or a more polar MCC.
In the following chapter, the investigation of VOCs is taken to another level, by adding a
transcriptome analysis to the MCC-IMS measurements. Also, the focus was shifted from solely
laboratory to near industrial conditions and a comparison of these two conditions.
86
The Crabtree effect revisited
A comparative study on the transcriptional changes during the Crabtree
effect using laboratory and industrial strains and conditions
Contributions:
This study was designed by Christoph Halbfeld, Birgitta E. Ebert, Sven Rahman, Erik Pollmann and
Lars M. Blank. The experiments were performed by Christoph Halbfeld, Erik Pollmann, Ann-Kathrin
Sippel and Michael Quantz. The data was evaluated by Christoph Halbfeld, Ann-Kathrin Sippel, Sven
Rahmann and Birgitta E. Ebert. Here the microarray-data was statistically evaluated by Sven
Rahmann and checked for biological relevance by Christoph Halbfeld and Birgitta E. Ebert. The
MCC-IMS data analysis was performed by Ann-Kathrin Sippel, Christoph Halbfeld and Birgitta E.
Ebert evaluated the data. The chapter was written by Christoph Halbfeld.
Results
91
Chapter 2
Introduction
The Crabtree effect describes alcoholic fermentation by Crabtree positive yeasts under aerobic
conditions with high sugar concentrations [289]. This metabolic shift causes a rerouting of the relative
central carbon metabolism fluxes from the pentose phosphate pathway to the glycolysis [294]. In
addition, high glucose concentrations repress parts of the electron transport chain and therefore
respiration, an effect called glucose catabolite repression. Beyond respiration, also the non-glucose
sugar metabolism as well as the hexose metabolism are specifically up- or downregulated on
transcriptional level, depending on the amount of available sugar [345, 346]. However, metabolic
effects outside the central carbon metabolism, especially on volatile compound synthesis, have not
yet been investigated in detail.
To gain insight into pathways that are differentially activated prior to and past a metabolic shift, it
is useful to investigate the transcriptome. For this purpose, microarray analysis is a powerful method
to generate a broad overview of transcriptional differences. In microarrays, probes consisting of
specific DNA sequences, representing the genotype of the specific strain, are spotted on a glass slide.
For the microarray, DNA is required, however, mRNA describes the expression state of the cell. To
convert mRNA into cDNA a reverse transcriptase is used. In the same step, the cDNA is also marked
with a fluorescent dye and subsequently applied to the microarray. The fluorescence intensity of the
single spots on the microarray correlates with the amount of bound cDNA, and thus the expression
level of the gene [347-349].
To cope with changing environmental conditions, the cells need to quickly adapt their repertoire
of enzymes. Here it is possible that the required enzymes are either needed to be produced or are
already dormant inside the cell and have to be activated by posttranslational modification (PTM).
Phosphorylation is the most used PTM in S. cerevisiae [350, 351]. If the enzymes need to be produced
de novo, a large amount of mRNA will be existent in the cell, and even if an enzyme is constitutively
present in the cells there is still some mRNA since the cell’s proteome is not static. Therefore, by
using DNA microarrays it is possible to get an in-depth insight into the transcriptional state of the cell
and based on that an estimation of the metabolic state.
The transcriptional changes of yeast during the Crabtree effect have been investigated before [352]
as well as the shift from aerobic to anaerobic conditions [353]. Kresnowati et al. found out that
transcripts of the TCA cycle genes are decaying one order of magnitude quicker than previously
expected leading to a quick metabolic transition [352]. However, all studies on S. cerevisiae’s
metabolic shift, the Crabtree effect, previous to this thesis have been based on chemostat experiments,
Regenber et al. reported that the growth rate in chemostats has an influence on the transcriptome
[354]. Even though a multitude of studies investigated the yeast transcriptome [352, 354, 355] there
has not been any study that investigated the Crabtree effect during fed-batch experiments and that
compares laboratory and industrial strains, however other comparisons between industrial and
laboratory strains have been performed [356].
Because of S. cerevisiae’s importance in both, scientific studies as well as industrial processes, it
is important to investigate and compare the yeast metabolism under both conditions. Many scientific
studies have been carried out with focus only on laboratory conditions, however in applied
microbiology the industrial aspect and therefore industry-near conditions should also be considered
because the behavior of the microorganism might change. Therefore, a laboratory strain in minimal
medium was compared to an industrial strain in molasses medium in this study.
92
Results
To find out more about the regulation of the volatile metabolism at the onset of the Crabtree effect,
custom microarrays based on the here measured samples were run. Samples were taken during
carbon-limited fed-batch fermentations while the feed rate was gradually increased to induce a
metabolic shift. This experiment was performed with a laboratory strain on minimal salt medium as
well as with an industrial strain on industrial molasses medium.
subsequently frozen in liquid nitrogen. These samples were used later for the microarray analysis.
When ethanol was detected in the IMS signals, samples were taken every other minute. Based on the
ethanol sensor and IMS data, it was decided which samples were to be used for microarray
experiments. In total, 40 samples were sent to Oaklabs (Hennigsdorf, Germany), where transcriptome
analyses were performed with custom microarrays.
MCC-IMS analysis
The ion mobility spectrometer Breath Discovery (B&S Analytik, Dortmund Germany) was used for
the detection of volatile metabolites in the fermentation off-gas. The MCC-IMS device was enhanced
by B&S analytic especially for the measurements in a yeast fermentation headspace. In comparison
to the device used in chapter 2.3, the multicapillary column was replaced by the MCC OV-1701 with
a film thickness of 0.6 μm. Also, the sample loop was shortened from 10 mL to 50 μL. The MCC-
IMS analysis measurements were performed as described in chapter 2.3 with the exception that the
gas mixing flask was not used and the device was directly coupled with the bioreactor with a
polytetrafluoroethylene tubing connected to the head plate of the bioreactor. Measurements were
taken every 5 minutes.
5% in both strains were analyzed using BioCyc’s omics viewer [358]. For identified interesting
pathways the fold changes were also considered, even if the FDR was above 5%. However, these
results were evaluated cautiously and are not shown in the figures but descried in the text. Since the
FDR rates are partially very high, some trends are indicated, but these data cannot be taken for a fact.
All of the here indicated FDR values are listed in Supplementary table 1.
95
Chapter 2
Figure 17: Volatile signals of Saccharomyces cerevisiae CEN.PK 113-7D (A) and Saccharomyces
cerevisiae DHW (B) in a fed-batch that was slowly overfed to trigger the Crabtree effect. The grey
background represents the feed rate. The commercially available Alcoline sensor form Biotechnology
Kempe was used for ethanol quantification in the fermentation broth along with the MCC-IMS Breath
Discovery from B&S Analytik for the monitoring of volatile metabolites in the fermentation head
space. The black dotted line indicates the start of the overfeeding process, the red dotted lines indicate
the division into early (left) mid (middle) and late (right) phase. D and M behind the substance names
describe the measured dimer and monomer respectively.
96
Results
The data was investigated for differences between the laboratory and the industrial strain. To
identify changes that might be based on the medium rather than on the strain, transcriptional changes
of the laboratory strain on molasses medium were evaluated as well. So far, this comparison has not
been performed in any other study that we know of. The strongest differences in single pathways
were detected in respiration, the TCA cycle and the metabolism of leucine and isoleucine. Some
changes could be observed between the early and the mid samples, however the strongest changes
were observed between the early and late samples. In the laboratory strain, the aerobic respiratory
pathway was downregulated alongside with the tricarboxylic acid pathway (Figure 18). This is
conform with the Crabtree effect induced changes described in the yeast literature [289, 359].
However, the industrial strain showed opposing result: In this strain, the genes of the TCA cycle and
the respiratory chain, indicated in Figure 18 A and B by an orange color, were upregulated. Such a
behavior has up to now not been described. In the aerobic respiratory pathway, the indicated genes
that did not show a strong transcriptional change (SDH3, SDH2, QCR10, QCR9, QCR8, QCR7,
QCR6, RIP1, COX11, COX19, COX16, COX20 and COX5B) had a FDR above 5%. However, the
trends followed the indicated ones for all genes but COX19 in the laboratory conditions and COX20
and COX5B in the industrial conditions. This means that these genes were downregulated in the
laboratory strain and upregulated in the industrial strain, while the exceptions showed the opposite
behavior. It also should be noted that the FDR values for COX20 and COX5B were above 50%,
indicating these values, as all values not indicated in Figure 18, only display tendencies and not hard
facts. In summary, respiration was downregulated in the laboratory strain, while it was upregulated
in the industrial yeast strain.
The TCA cycle genes showed a similar gene expression pattern as those of the respiratory chain,
i.e., downregulation of all genes of the lab strain and 4 genes of the industrial strain and upregulation
of zero genes of the lab strain and 3 genes of the industrial strain. In addition to the expression changes
indicated in Figure 18 B, the genes PYC1, PYC2, CIT1, LPD1, KGD1, KGD2, MDH1 also showed a
similar regulation as the in Figure 18 indicated ones for each strain, i.e., downregulation in the lab
strain and upregulation in the industrial strain, they were however not plotted, since their FDR was
above 5%. ACO2, IDH1 and IDH2 showed a different expression profile. ACO2 was upregulated in
the laboratory strain and downregulated in the industrial strain and therefore opposing the regulation
pattern of the other genes in the TCA cycle, IDH1 and IDH2 were upregulated in the lab strain.
However, the expression data of the IDH genes showed a 30% FDR value and might therefore not be
as reliable as the other trends indicated in Figure 18.
In experiments with the laboratory strain on industrial molasses medium, it was observed that the
laboratory strain had a much lower critical growth rate (about 0.13 h-1) in comparison to the industrial
strain (about 0.19 h-1) in 1 L fed-batch experiments (data not shown). These results in combination
with the microarray data evaluation (Figure 18 A and B) indicate that the industrial strain might not
slow down its respiration as the laboratory strain does, since the industrial strain did not seem to be
affected by the glucose repression as the laboratory strain was. Thus, in the industrial strain, the
biomass yield is theoretically higher, since more of the glucose could be channeled through the
respiratory pathway instead of the fermentative pathway compared to the laboratory strain. This
makes the industrial strain theoretically much more suitable for biomass production compared the
laboratory strains. However, as ethanol was still produced, it has to be shown if this negatively affects
the baking ability. This result also gives hints about the importance of the Crabtree effect in industrial
yeast production. Since the Crabtree effect seems not to be as distinctive in the industrial conditions
97
Chapter 2
as anticipated from the laboratory results [294], its impact on the industrial yeast production might
not be as big as could be anticipated from experiments with laboratory strains. However, higher yields
could be achieved, if the Crabtree effect is avoided, since fermentative growth yields less biomass
compared to respiratory growth. Since the transcriptome could also vary from the proteome and
fluxome, further experiments would be necessary to proof this theory.
The leucine biosynthesis was upregulated in the laboratory strain but was downregulated in the
industrial strain. This is an interesting finding, since in both strains the production of the leucine
degradation product 3-methyl-1-butanol increases during aerobic fermentation. The downregulation
in the industrial strain however, might be attributed to the medium because the laboratory strain on
industrial molasses medium indicated also a downregulation of the leucine metabolism (data not
shown). Not depicted in Figure 18 C are the values for the genes ILV5, LEU9, LEU2 and BAT1
because their calculated false discovery rate was in at least one of the data sets above the threshold
of 5%. However, the data still indicates a vague change of expression. All genes not indicated in
Figure 18 C are upregulated in the laboratory strain and downregulated in the industrial strain. The
only exception is LEU5, which was upregulated in both strains, however, the FDR of the industrial
strain data was very high (55%) and might give a wrong indication.
LEU4 codes for the major isoenzyme of α-isopropylmalate synthase as described by Casalone et
al. in 2000 [360]. Therefore, it would be expected that the major gene coding for the enzyme
catalyzing 3-methyl-2-oxobutanoate to 2-isopropylmalate would show a similar expression pattern
compared to the other genes in the pathway, but this was not the case here. One possible explanation
is that in the here tested laboratory strain, LEU9 codes for the major isoenzyme, another possibility
is that based on the growth conditions either LEU9 or LEU4 is expressed as known for BAT1 and
BAT2 [361].
BAT2 codes for the major branched-chain amino acid aminotransferase isoenzyme in the stationary
phase, while the BAT1 encoded enzyme dominates in the exponential growth phase [361]. Here in
both strains BAT2 was downregulated, while BAT1 was upregulated in the laboratory strain. This
reflects the activity of the rest of the pathway, where genes were upregulated in the laboratory strain.
The transaminases encoded by BAT1 and BAT2 are both, involved in the leucine biosynthesis and
degradation. This and an indication based on the microarray data of higher THI3 (ketoisocaproate
decarboxylase) expression, both enzymes involved in the degradation of leucine, can explain the
higher levels of 3-methyl-1-butanol in the samples during the Crabtree effect at least for the laboratory
strain.
98
Results
Figure 18: Transcriptional alterations of the most differing pathways based on expressional changes
between Saccharomyces cerevisiae CEN.PK 113-7D (left) and Saccharomyces cerevisiae DHW
(right). The two strains were run in fed-batch fermentations and overfeed gradually. The respiration
pathway (A), the TCA-cycle (B) and the branched-chain amino acid production (C) are depicted. The
genes without color coding are not displayed, since it had a false discovery rate of more than 5% in
at least one of the tested strains.
99
Chapter 2
100
Chapter 3
General discussion
General discussion and outlook
General discussion
Possible impact of this thesis
The insights into yeast metabolism gained in this thesis could be used in many applications. The here
introduced methods could have a major influence on future studies and the production of volatile
compounds. These methods could be used as a blueprint for future studies in other organisms. Instead
of implementing completely new pathways, the here generated knowledge could be used to simplify
the production of volatiles. It would also be possible to use online metabolic flux analysis with the
methods developed here. Lastly, the differentiation of metabolic states through the headspace could
be used in process control along with product quality analysis and the possibility to detect possible
contaminations.
105
Chapter 3
before they can be assumed correct. FBA and TFBA can be used to increase the plausibility of added
reactions as described in chapter 2.1 [219, 235].
It was also attempted to calculate which metabolites are volatile at room temperature based on
their molecular weight. However, structural complexity and other factors like functional groups have
a big influence on volatility, making a priori estimation of volatility difficult [363-365], although
highly interesting for basic research and applications.
106
General discussion and outlook
Conclusion
In this thesis, the volatile space of S. cerevisiae has been investigated. Therefore, computational
methods, novel analysis techniques and finally transcriptome analyses have been performed. Since
volatile metabolites are of high value and are important in industrial processes (aroma, taste), not only
laboratory, but also near industrial conditions have been examined in this thesis. Finally, we were
able to enhance the yeasts metabolic network, to increase the number of tools available for the
investigation of volatile compounds in microorganisms and to use the newly gained knowledge to
compare laboratory with industrial conditions.
107
Chapter 3
Moonlighting describes enzymes with more than one catalytic activity, making it possible to have a
smaller number of enzymes carrying out more reactions than anticipated up to this day [273, 276]. In
conclusion, the metabolic yeast model covers now volatile compounds, and includes reactions that
connect the volatiles with the know biochemistry. Novel experimental evidence can be easily used to
curate the model in the future.
Sesi-Orbitrap
To examine the volatile space of S. cerevisiae, new analytical tools have been used. The SESI-
Orbitrap combines high time resolution with high mass resolving power and high mass accuracy,
making online investigation of volatile dynamics in near real time possible. The Crabtree effect was
examined as distinct metabolic shift with industrial importance in food production. Using the SESI-
Orbitrap it was possible to investigate the Crabtree effect in a detail that it has never been investigated
in before. It was possible to investigate sub-minute changes of metabolism for the first time and to
observe metabolic network operation in near real time. Due to the new technology and the high
redundancy of the measurements, the system delivers robust data. Up to now there are no comparable
measurements with such high time resolution and mass accuracy. However, due to the high cost and
high maintenance of an Orbitrap, its use outside of the lab is limited. For industrial applications
another device, the MCC-IMS, was considered for the evaluation of quick changes in the volatile
yeast space.
MCC-IMS
The MCC-IMS was used for measurements of yeast fermentations, since it can operate non-invasive,
online, is a low-cost device and requires a relatively low maintenance [109, 381, 382]. Because of
these properties, the IMS is already used in industrial applications, such as air quality control, food
quality analysis, medical diagnostics, scanning for drugs, chemical warfare agents and explosives in
the military and for airport safety controls [109, 115, 117, 383-388]. Here it was shown that the two
metabolic conditions of aerobic respiration and aerobic fermentation could be distinguished in yeast
using an MCC-IMS. In the beginning, there were problems with too high ethanol concentrations in
the MCC-IMS, these problems could be solved by introducing a shorter sample loop and changing
the MCC in cooperation with the B&S Analytik (Dortmund Germany). In its final state, the MCC-
IMS could successfully distinguish different metabolic conditions in yeast. This has been reported
before, but never with an MCC-IMS [61, 62, 185]. Through its high sensitivity the device was even
able to detect metabolic changes prior to an industrial ethanol sensor. Additionally, to its fast
detection, the measurement is also more robust since two reporter metabolites that are produced early
during the metabolic change, can be used to predict the alteration in metabolism. As shown by Vautz
and Baumbach in 2008, the IMS is also suitable for process control [389].
minimal salt medium as well as in industrial molasses medium, the industrial strain S. cerevisiae
DHW was solely tested under industrial conditions. All tests were carried out in pilot scale with a
volume for the fed batch of 8-11 L. Distinguishing between the metabolic states aerobic respiration
and aerobic fermentation was possible in all conditions. This is based on the robust measurements
that did not only yield one, but two distinct metabolic reporters at an early stage. The advantage of
two reporters is that the system becomes more stable, if for example the drift gas flask is dirty and
one reporter cannot be detected anymore, it is likely that the other reporter will still show up.
In addition to the volatile space, the transcriptome of the cells was also investigated to compare
the two conditions. Here it turned out that the gene regulation of the two strains was essentially similar
with exceptions in leucine and isoleucine metabolism, the TCA cycle and the respiratory pathway.
This is especially interesting for industrial yeast production, since it indicates that the Crabtree effect
might not be as significant in industrial yeast fermentations as it is in the laboratory.
109
Chapter 4
Outlook
Outlook
Outlook
The results generated in this thesis might contribute to future studies. First of all, the expansion of the
metabolic model will be helpful for studies concerning the metabolic network of yeast. The yeast
community will benefit from these new pathways especially if solutions need to be found to produce
large amounts of volatile organic compounds. However, for a rich aroma it is important to take into
consideration that not only one compound is responsible. Therefore, further investigations need to be
performed to find out what combination of metabolites will produce a pleasant aroma. Once the aroma
is constructed, metabolically engineered yeasts could be used to produce the flavor and positively
alter the aroma of a finished product. The final strains will have to be adjusted repeatedly, to ensure
that the intended flavor is achieved in the final product.
The data generated using the SESI-Orbitrap is very rich. In this thesis, the data has been evaluated
for effects during the Crabtree effect, however due to the high time resolution and excellent mass
resolution of the single time points, it is possible to gain even more insight without the need of further
experiments. For example, it should be possible to detect enzymatic activity based on mass transfers
and the accompanying increase respectively decrease of masses involved in the enzymatic reaction.
In the best case, it is even possible to determine reaction rates based on this dataset.
The here identified “reporter” volatile compounds could be interesting in industrial processes that
need to monitor yeast fermentations, since the reporters can indicate the change of the metabolic state.
The system could be checked online for example using the MCC-IMS described in chapter 2.3 and
based on the desired product the feed could be adjusted to gain biomass or the production of ethanol.
However, the use of the MCC-IMS is not only limited to yeast fermentations, using this thesis as
blueprint, it would also be possible to adjust the systems to other industrial processes. In addition,
MCC-IMS data would enable yeast producers to detect contaminations in very low concentrations
and early in an industrial process and contribute to avoid unnecessary costs.
113
Appendix
Appendix
Driver:
%% Script for loading the data and running the analysis automatically for the file that equals n
% Order as indicated in Exps
%Creates two clustergrams, the first shows all masses that are changing between the glucose pulse
%and the rise of the ethanol signal, the second shows all masses that rise after the increase of the
%ethanol signal
%%
cd('C:\Measurements');
Data = load('Filename');
Exps = {'id20160513_Mini6TestR1'; 'id20160513_Mini6TestR4'; 'id20160513_Mini6TestR3';
'id20160517_WachstumCENR1Puls1'; 'id20160518_WachstumCCENR2Puls110muL';
'id20160518_WachstumVHR4Puls1_100muL'; 'id20160519_PulsVHR3mit100mgGlc_160518172415';
'id20160519_PulsCENR1mit100mgGlc_160518172415'; 'id20160520_PulsVHR4_100mgGLc_160518172415';
'id20160520_PulsCENR2_100mgGLc_160518172415'};
PulsTimes = [23.4; 13.5; 20.1; 21.1; 50.4; 58; 40.5; 50; 44.5; 45]/60;
% Conversion of minutes to hours for each timepoint after that the glucose pulse was applied
ExpNames = fieldnames(Data.mz);n=4
[ClustergramMaxInInterval, ClustergramMaxPastInterval,...
resi, mz, tt, tPuls, tEtOHSig] = Analyse_Glc_Puls(Data,...
Exps(n), PulsTimes(n));
PosEtOH = find(roundn(Data.mz.(Exps[96]), -3) == 93.0910);
PosPuls = min(find(roundn(Data.tiempo.(Exps[96]), -3) > roundn(PulsTimes(n),-3)));
time = transpose(Data.tiempo.(Exps{n}))*60;
Analysis:
function [ClustergramMaxInInterval, ClustergramMaxPastInterval, resi, mz, tt, tPuls, tEtOHSig] =
Analyse_Glc_Puls(Data, Exps, PulsTimes)
%% Script for data analysis of high resolution SESI-Orbitrap data
% we are searching for a timeseries the slope of which rises or falls sooner over the threshold than
that of EtOH
% rawdata time in h
%%
Res = struct();
for e = 1: length(Exps)
PosEtOH = find(roundn(Data.mz.(Exps[79]), -3) == 93.0910);
tPuls = min(find(roundn(Data.tiempo.(Exps{e}), -3) > roundn(PulsTimes(e),-3)));
% deltas between 2 data points
RawData = Data.tt.(Exps{e});
%% smoothing of the data using “moving average” and “sgolay”
MyNormedData = medfilt1(RawData(:,:),27,[],2);
DeltaSig = diff(MyNormedData,1,2);
tEtOHSig = min(find(DeltaSig(PosEtOH,:) > max(DeltaSig(PosEtOH,1:tPuls))));
minEtOHSig = MyNormedData(PosEtOH, tEtOHSig+1); % detections threshold
MyNormedData(abs(MyNormedData) < minEtOHSig) = 0;
%% finds signals that have larger changes during the measurements than the minimal EtOH
% signal
MinMaxSignalPrePuls = iqr(MyNormedData(:,1:tPuls),2);
MinMaxSignalPostPuls = iqr(MyNormedData(:,PosEtOH:end),2);
RelevantSignals = abs(MinMaxSignalPrePuls - MinMaxSignalPostPuls) > minEtOHSig;
%create variable mz for plotting
mz=Data.mz.(Exps{e});
tt=Data.tt.(Exps{e});
res = zeros(size(MyNormedData));
for i = 1: size(res,1)
res(i,:) = sgolayfilt(MyNormedData(i,:),1,35);
end
MyNormedData=res;
resi = zeros(size(MyNormedData));
for i = 1: size(MyNormedData,1)
xmin = min(MyNormedData(i,:),[],2);
xmax = max(MyNormedData(i,:),[],2);
xdiff2 = xmax - xmin;
for o= 1: size(MyNormedData,2)
xi = MyNormedData(i,o);
xdiff1 = xi-xmin;
117
Appendix
xdiff = xdiff1 / xdiff2;
resi(i,o) = xdiff ;
end
end
%% find relevant signals that max between tpulse and t EtOH
MaxInInerval = max(resi(:,tPuls:tEtOHSig),[],2) > max(resi(:,tEtOHSig:end),[],2);
MinInInerval = min(resi(:,tPuls:tEtOHSig),[],2) < min(resi(:,tEtOHSig:end),[],2);
x = find(RelevantSignals & MaxInInerval);
lables = cellstr(num2str(Data.mz.(Exps{e})));
lables = cellstr(num2str([1:length(Data.mz.(Exps{e}))]'));
ClustergramMaxInInterval.(Exps{e}) = clustergram(resi(x,
tPuls:tEtOHSig),'RowLabels',lables(x),'Cluster', 'Column','LogTrans','false');
%% Find signal with max after t EtOH signal but have a signal before t EtOH
MaxPostEtOH = max(resi(:,tEtOHSig:end),[],2) > max(resi(:,tPuls:tEtOHSig),[],2);
x = find(RelevantSignals & MaxPostEtOH);
lables = cellstr(num2str(Data.mz.(Exps{e})));
lables = cellstr(num2str([1:length(Data.mz.(Exps{e}))]'));
ClustergramMaxPastInterval.(Exps{e}) = clustergram(resi(x,
tPuls:tEtOHSig),'RowLabels',lables(x),'Cluster', 'Column','LogTrans','false');
end
end
Plot:
%x = vector of masses that will be plotted against ethanol
X=[57.0700 58.0735 69.0701 70.0732 71.0857 72.0887 73.0649 74.0680 118.0652 119.0885 127.1117
128.1152 166.9860 177.0763 196.1123]';
for i = 1: size(X,1)
figure;plot((time),resi(PosEtOH,:),'k','LineWidth', l)
hold on
%PlotX
a = find(roundn(mz,-4) == X(i,:));
tPulsi=time(tPuls) %transforms time value from column number to value
tEtOHSigi=time(tEtOHSig) %transforms time value from column number to value
b=mz(a,:);
plot((time),resi(a,:),'LineWidth', l)
plot([tPulsi;tPulsi],[0,1],'k','LineWidth', l)
plot([tEtOHSigi;tEtOHSigi],[0,1],'k','LineWidth', l)
legend('Ethanol',num2str(b))
xlabel('time [min]','fontsize', 15)
ylabel('normalized data','fontsize', 15)
set(gca,'fontsize',15)
%xlim([40 90]); %sets x axis to the wanted time
figure;plot(tt(a,:),'LineWidth', l)
Correlation:
%% a and b are the m/z fragments that are to compare
a = find(roundn(Data.mz.(Exps{n}),-4) == 89.0962);
b = find(roundn(Data.mz.(Exps{n}),-4) == 71.0857);
%normalization of the data
xmina = min(Data.tt.(Exps{n})(a,:),[],2);
xmaxa = max(Data.tt.(Exps{n})(a,:),[],2);
xdiff2 = xmaxa - xmina;
for o= 1: size(Data.tt.(Exps{n}),2)
xi = Data.tt.(Exps{n})(a,o);
xdiff1 = xi-xmina;
xdiffa = xdiff1 / xdiff2;
resia(1,o) = xdiffa ;
end
xminb = min(Data.tt.(Exps{n})(b,:),[],2);
xmaxb = max(Data.tt.(Exps{n})(b,:),[],2);
xdiff2 = xmaxb - xminb;
for o= 1: size(Data.tt.(Exps{n}),2)
xi = Data.tt.(Exps{n})(b,o);
xdiff1 = xi-xminb;
xdiffb = xdiff1 / xdiff2;
resib(1,o) = xdiffb ;
end
118
Appendix
119
Appendix
Supplementary data
Supplementary table 1: FDR Values of transcript level changes between early and late group. FDR-
LS describes the FDR values in the laboratory strain, while FDR-IS describes the FDR value in the
industrial strain.
Name FDR-LS [%] FDR-IS [%]
SDH4 0,12 0,04
SDH3 0,08 10,40
SDH2 3,65 34,23
SDH1 0,36 0,61
YJL045W 0,02 1,49
NDE2 0,02 0,10
NDI1 10,80 58,28
NDE1 93,21 10,13
QCR10 3,73 15,58
QCR9 0,70 10,40
QCR8 1,84 24,29
QCR7 6,75 28,01
QCR6 5,36 15,56
QCR2 0,92 0,93
COR1 0,08 1,79
CYT1 0,34 1,15
RIP1 0,20 5,43
COB 100,00 88,52
COX11 10,45 12,38
COX19 7,51 37,47
COX16 0,01 60,03
COX23 0,50 3,09
COX18 83,57 45,83
COX20 0,02 76,23
COX5B 0,09 53,37
PYC1 0,06 9,93
PYC2 11,27 15,10
CIT3 0,01 0,03
CIT1 0,05 48,23
ACO1 1,02 3,11
ACO2 0,09 45,97
IDH1 29,01 5,04
IDH2 30,80 12,36
LPD1 2,83 60,74
KGD1 0,02 14,72
KGD2 0,09 35,94
LSC1 0,03 1,42
LSC2 0,00 11,41
MDH1 13,22 2,45
ILV2 0,51 2,26
120
Appendix
121
References
References
1. Ebert, B.E., C. Halbfeld, and L.M. Blank, Exploration and exploitation of the yeast volatilome.
Current Metabolomics, 2016. 4: p. 1-17.
2. Hazelwood, L.A., et al., The Ehrlich pathway for fusel alcohol production: a century of research
on Saccharomyces cerevisiae metabolism. Applied and Environmental Microbiology, 2008. 74(8): p.
2259-2266.
3. Pires, E.J., et al., Yeast: the soul of beer's aroma - a review of flavour-active esters and higher
alcohols produced by the brewing yeast. Applied Microbiology and Biotechnology, 2014. 98(5):
p. 1937-49.
4. Carrau, F.M., et al., De novo synthesis of monoterpenes by Saccharomyces cerevisiae wine yeasts. FEMS
Microbiology Letters, 2005. 243(1): p. 107-15.
5. Baumbach, J.I. and G.A. Eiceman, Ion mobility spectrometry: Arriving on site and moving
beyond a low profile. Applied Spectroscopy, 1999. 53(9): p. 338a-355a.
6. Halbfeld, C., B. Ebert, and L. Blank, Multi-capillary column-ion mobility spectrometry of volatile
metabolites emitted by Saccharomyces cerevisiae. Metabolites, 2014. 4(3): p. 751-774.
7. Schmidt, R., et al., Volatile affairs in microbial interactions. The ISME Journal, 2015. 9(11): p.
2329-2335.
8. Dulac, C. and A.T. Torello, Molecular detection of pheromone signals in mammals: from genes
to behaviour. Nature Reviews: Neuroscience, 2003. 4(7): p. 551-62.
9. Cho, I.H. and D.G. Peterson, Chemistry of bread aroma: a review. Food Science and
Biotechnology, 2010. 19(3): p. 575-582.
10. Baardseth, P., et al., The effects of bread making process and wheat quality on french baguettes.
Journal of Cereal Science, 2000. 32(1): p. 73-87.
11. MartinezAnaya, M.A., Enzymes and bread flavor. Journal of Agricultural and Food Chemistry,
1996. 44(9): p. 2469-2480.
12. Frasse, P., et al., The influence of fermentation on volatile compounds in french bread dough.
Food Science and Technology-Lebensmittel-Wissenschaft & Technologie, 1993. 26(2): p. 126-
132.
13. Bertram, G.L., Studies on crust color .1. The importance of the browning reaction in determining
the crust color of bread. Cereal Chemistry, 1953. 30(2): p. 127-139.
14. Barnes, H.M. and C.W. Kaufman, Industrial aspects of browning reaction. Industrial and
Engineering Chemistry, 1947. 39(9): p. 1167-1170.
15. Zentner, H., Influence of glycine and lysine on dough fermentation. Journal of the Science of
Food and Agriculture, 1961. 12(12): p. 812.
16. Rooney, L.W., A. Salem, and J.A. Johnson, Studies of carbonyl compounds produced by sugar-
amino acid reactions .I. Model systems. Cereal Chemistry, 1967. 44(5): p. 539.
17. Salem, A., L.W. Rooney, and J.A. Johnson, Studies of carbonyl compounds produced by sugar-
amino acid reactions .2. In bread systems. Cereal Chemistry, 1967. 44(6): p. 576.
18. Chang, C.Y., L.M. Seitz, and E. Chambers, Volatile flavor components of breads made from hard
red winter-wheat and hard white winter-wheat. Cereal Chemistry, 1995. 72(3): p. 237-242.
19. Kirchhoff, E. and P. Schieberle, Determination of key aroma compounds in the crumb of a three-
stage sourdough rye bread by stable isotope dilution assays and sensory studies. Journal of
Agricultural and Food Chemistry, 2001. 49(9): p. 4304-4311.
20. Schieberle, P. and W. Grosch, Changes in the concentrations of potent crust odourants during
storage of white bread. Flavour and Fragrance Journal, 1992. 7(4): p. 213-218.
21. Zehentbauer, G. and W. Grosch, Crust aroma of baguettes - I. Key odorants of baguettes
prepared in two different ways. Journal of Cereal Science, 1998. 28(1): p. 81-92.
22. Zehentbauer, G. and W. Grosch, Crust aroma of baguettes II. Dependence of the concentrations
of key odorants on yeast level and dough processing. Journal of Cereal Science, 1998. 28(1): p.
93-96.
23. Heenan, S.P., et al., Characterisation of fresh bread flavour: Relationships between sensory
characteristics and volatile composition. Food Chemistry, 2009. 116(1): p. 249-257.
125
References
24. Welke, J.E., et al., Characterization of the volatile profile of Brazilian Merlot wines through
comprehensive two dimensional gas chromatography time-of-flight mass spectrometric
detection. Journal of Chromatography A, 2012. 1226: p. 124-139.
25. Swiegers, J.H., et al., Yeast and bacterial modulation of wine aroma and flavour. Australian Journal
of Grape and Wine Research, 2005. 11(2): p. 139-173.
26. Patrignani, F., et al., Production of volatile and sulfur compounds by 10 Saccharomyces cerevisiae
strains inoculated in Trebbiano must. Frontiers in Microbiology, 2016. 7: p. 243.
27. Mateo, J.J., et al., Yeast starter cultures affecting wine fermentation and volatiles. Food Research
International, 2001. 34(4): p. 307-314.
28. Schreier, P., Flavor composition of wines: a review. CRC Critical Reviews in Food Science and
Nutrition, 1979. 12(1): p. 59-111.
29. Boulton, R.B., Principles and practices of winemaking. The Chapman & Hall enology library.
1996, New York: Chapman & Hall. xiv, 604 p.
30. Rapp, A., Volatile flavour of wine: correlation between instrumental analysis and sensory
perception. Nahrung, 1998. 42(6): p. 351-63.
31. Rapp, A. and H. Mandery, Wine aroma. Experientia, 1986. 42(8): p. 873-884.
32. Picard, M., et al., Identification of piperitone as an aroma compound contributing to the positive
mint nuances perceived in aged red Bordeaux wines. Journal of Agricultural and Food Chemistry,
2016. 64(2): p. 451-460.
33. Capone, D.L., et al., Evolution and occurrence of 1,8-cineole (eucalyptol) in australian wine.
Journal of Agricultural and Food Chemistry, 2011. 59(3): p. 953-959.
34. Rapp, A., et al., Fremdkomponenten im Aroma von Trauben und Weinen interspezifischer
Rebsorten. Vitis, 1980. 19: p. 13-23.
35. Rapp, A., Aromastoffe des Weines. Chemie in unserer Zeit, 1992. 6: p. 273-284.
36. Rapp, A., P. Pretorius, and D. Kugler, Foreign and undesirable flavours in wine, in Developments
in Food Science, C. George, Editor. 1992, Elsevier. p. 485-522.
37. Romano, F., et al., Approccio psicofisico allanalisi sensoriale dei vini, in The Aromatic Substances in
Grapes and Wines, A. Scienza, G. Versini, and M. all´Adige, Editors. 1989. p. 427-440.
38. Augustyn, O.P.H., A. Rapp, and C.J. van Wyk, Some volatile aroma components of Vitis vinifera
L. cv. Sauvignon blanc. South African Journal of Enology and Viticulture, 1982(3): p. 53-59.
39. Bayonove, C., C. Cordonnier, and P. Dubois, etude d´une fraction caractéristique de l'arôme du
raisin de la variete cabernet sauvignon mise en evidence de la 2-methoxy-3-isobutylpyrazine.
Comptes Rendus de l'Académie des Sciences, 1975(281): p. 75-78.
40. Snowdon, E.M., et al., Mousy off-flavor: a review. Journal of Agricultural and Food Chemistry,
2006. 54(18): p. 6465-6474.
41. Strauss, C.R., 2-Acetyltetrahydropyridines a cause of the “mousy” taint in wine. Chemistry and
Industry, 1984: p. 109-110.
42. Heresztyn, T., Formation of substituted tetrahydropyridines by species of Brettanomyces and
Lactobacillus isolated from mousy wines . American Journal of Enology and Viticulture, 1986.
37(2): p. 127-132.
43. Herderich, M., The occurrence of 2-acetyl-1-pyrroline in mousy wines. Natural Product Letters,
1995. 7: p. 129-132.
44. Grbin, P.R., P.J. Costello, and M. Herderich, Developments in the sensory, chemical and
microbiological basis of mousy taint in wine. Sonoma County Wine Library. 1995: Proceedings
of the Ninth Australian Wine Industry Technical Conference.
45. Grbin, P.R. and P.A. Henschke, Mousy off-flavour production in grape juice and wine by
Dekkera and Brettanomyces yeasts. Australian Journal of Grape and Wine Research, 2000. 6(3): p.
255-262.
46. Tucknott, O.G., Taints in fermented juice products: mousy taint in cider, in Annual Report 1977.
1978: University of Bristol, 1978.
47. Rapp, A. and G. Versini, Flüchtige phenolische Verbindungen in Wein. Deutsche Lebensmittel-
Rundschau, 1996. 92(2): p. 42-48.
126
References
48. Sefton, M.A. and R.F. Simpson, Compounds causing cork taint and the factors affecting their
transfer from natural cork closures to wine - a review. Australian Journal of Grape and Wine
Research, 2005. 11(2): p. 226-240.
49. The chemistry of wine: stabilization and treatments. Handbook of Enology, ed. P. Ribereau-
Gayon, et al. Vol. 2. 2006: Wiley.
50. Riu, M., et al., Quantification of chloroanisoles in cork using headspace solid-phase
microextraction and gas chromatography with electron capture detection. Journal of
Chromatography A, 2006. 1107(1-2): p. 240-7.
51. Vieira, P., S.M. Rocha, and A.J.D. Silvestre, Simultaneous headspace solid phase microextraction
analysis of off-flavour compounds from Quercus suber L. cork. Journal of the Science of Food and
Agriculture, 2007. 87(4): p. 632-640.
52. Vlachos, P., et al., Matrix effect during the application of a rapid method using HS-SPME
followed by GC-ECD for the analysis of 2,4,6-TCA in wine and cork soaks. Food Chemistry,
2007. 105(2): p. 681-690.
53. Fischer, U., Wine aroma, in Flavours and Fragrances, R.G. Berger, Editor. 2007, Springer-Verlag:
Berlin Heidelberg. p. 241-267.
54. Christoph, N. and C. Bauer-Christoph, Falvour and spirit drinks: raw materials, fermentation,
destillation, and ageing, in Flavours and Fragrances, R.G. Berger, Editor. 2007, Springer: Berlin-
Heidelberg. p. 219-239.
55. Morath, S.U., R. Hung, and J.W. Bennett, Fungal volatile organic compounds: a review with
emphasis on their biotechnological potential. Fungal Biology Reviews, 2012. 26(2-3): p. 73-83.
56. Kanchiswamy, C.N., M. Mainoy, and M.E. Maffei, Chemical diversity of microbial volatiles and
their potential for plant growth and productivity. Frontiers in Plant Science, 2015. 6.
57. Alpha, C.J., et al., Mycofumigation by the volatile organic compound-producing fungus Muscodor
albus induces bacterial cell death through DNA damage. Applied and Environmental
Microbiology, 2015. 81(3): p. 1147-1156.
58. Bitas, V., et al., Sniffing on microbes: diverse roles of microbial volatile organic compounds in
plant health. Molecular Plant-Microbe Interactions, 2013. 26(8): p. 835-43.
59. Hertel, M., et al., Detection of signature volatiles for cariogenic microorganisms. European
Journal of Clinical Microbiology & Infectious Diseases, 2016. 35(2): p. 235-44.
60. Piechulla, B. and J. Degenhardt, The emerging importance of microbial volatile organic
compounds. Plant, Cell & Environment, 2014. 37(4): p. 811-2.
61. Bruce, A., et al., Production of volatile organic compounds by Trichoderma in media containing
different amino acids and their effect on selected wood decay fungi. Holzforschung, 2000. 54(5):
p. 481-486.
62. Blom, D., et al., Production of plant growth modulating volatiles is widespread among rhizosphere
bacteria and strongly depends on culture conditions. Environmental Microbiology, 2011. 13(11):
p. 3047-3058.
63. Maffei, M.E., J. Gertsch, and G. Appendino, Plant volatiles: production, function and
pharmacology. Natural Product Reports, 2011. 28(8): p. 1359-1380.
64. Arn, H. and T.E. Acree, Flavornet: a database of aroma compounds based on odor potency in
natural products, in Developments in Food Science, C.T.H.C.J.M.T.H.P.F.S. E.T. Contis and A.M.
Spanier, Editors. 1998, Elsevier: Amsterdam. p. 27.
65. de Lacy Costello, B., et al., A review of the volatiles from the healthy human body. Journal of
Breath Research, 2014. 8(1): p. 014001.
66. Lemfack, M.C., et al., mVOC: a database of microbial volatiles. Nucleic Acids Research, 2014.
42(D1): p. D744-D748.
67. Simó, C., A. Cifuentes, and V. García-Cañas, Fundamentals of advanced omics technologies:
from genes to metabolites. 1st ed. Comprehensive analytical chemistry. 2014, Amsterdam; Boston:
Elsevier. 467 pages.
68. Lim, F.Y., et al., Toward awakening cryptic secondary metabolite gene clusters in filamentous
fungi. Methods in Enzymology, 2012. 517: p. 303-324.
127
References
69. Breitling, R., et al., Metabolomics for secondary metabolite research. Metabolites, 2013. 3(4): p.
1076-1083.
70. Spraker, J. and N. Keller, Waking sleeping pathways in filamentous fungi, in Natural Products.
2014, John Wiley & Sons, Inc. p. 277-292.
71. Claeson, A.S., M. Sandstrom, and A.L. Sunesson, Volatile organic compounds (VOCs) emitted
from materials collected from buildings affected by microorganisms. Journal of Environmental
Monitoring, 2007. 9(3): p. 240-245.
72. Korpi, A., J. Jarnberg, and A.L. Pasanen, Microbial volatile organic compounds. Critical Reviews
in Toxicology, 2009. 39(2): p. 139-193.
73. Herwig, C. and U. von Stockar, A small metabolic flux model to identify transient metabolic
regulations in Saccharomyces cerevisiae. Bioprocess and Biosystems Engineering, 2002. 24(6): p. 395-
403.
74. Ferreira, B.S., et al., Recombinant Saccharomyces cerevisiae strain triggers acetate production to fuel
biosynthetic pathways. Journal of Biotechnology, 2004. 109(1-2): p. 159-167.
75. Miyake, T. and T. Shibamoto, Quantitative analysis of acetaldehyde in foods and beverages.
Journal of Agricultural and Food Chemistry, 1993. 41(11): p. 1968-1970.
76. Margalith, P., Flavor microbiology. 1st ed. 1981, Springfield, Ill.: Thomas. xiii, 309 p.
77. Cheraiti, N., F.X. Sauvage, and J.M. Salmon, Acetaldehyde addition throughout the growth phase
alleviates the phenotypic effect of zinc deficiency in Saccharomyces cerevisiae. Applied Microbiology
and Biotechnology, 2008. 77(5): p. 1093-1109.
78. Becher, P.G., et al., Yeast, not fruit volatiles mediate Drosophila melanogaster attraction, oviposition
and development. Functional Ecology, 2012. 26(4): p. 822-828.
79. Ehrlich, F., Über die bedingungen der Fuselölbildung und über ihren Zusammenhang mit dem
Eiweißaufbau der Hefe. Berichte der deutschen chemischen Gesellschaft, 1907. 40(1): p. 1027-
1047.
80. Styger, G., B. Prior, and F.F. Bauer, Wine flavor and aroma. Journal of Industrial Microbiology
& Biotechnology, 2011. 38(9): p. 1145-1159.
81. Styger, G., et al., Genetic analysis of the metabolic pathways responsible for aroma metabolite
production by Saccharomyces cerevisiae. Applied Microbiology and Biotechnology, 2013. 97(10): p.
4429-4442.
82. Van Dijken, J.P. and W.A. Scheffers, Redox balances in the metabolism of sugars by yeasts.
FEMS Microbiology Letters, 1986. 32(3-4): p. 199-224.
83. Park, S.-H., S. Kim, and J.-S. Hahn, Metabolic engineering of Saccharomyces cerevisiae for the
production of isobutanol and 3-methyl-1-butanol. Applied Microbiology and Biotechnology,
2014. 98(21): p. 9139-9147.
84. Chen, E.C.H., The relative contribution of Ehrlich and biosynthetic pathways to the formation
of fusel alcohols. Journal of the American Society of Brewing Chemists, 1978. 36(1): p. 39-41.
85. Saerens, S.M., et al., Production and biological function of volatile esters in Saccharomyces cerevisiae.
Microbial Biotechnology, 2010. 3(2): p. 165-177.
86. Malcorps, P. and J.P. Dufour, Short-chain and medium-chain aliphatic-ester synthesis in
Saccharomyces cerevisiae. European Journal of Biochemistry, 1992. 210(3): p. 1015-1022.
87. Vadali, R.V., G.N. Bennett, and K.Y. San, Applicability of CoA/acetyl-CoA manipulation system
to enhance isoamyl acetate production in Escherichia coli. Metabolic Engineering, 2004. 6(4): p.
294-299.
88. Cordente, A.G., et al., Modulating aroma compounds during wine fermentation by manipulating
carnitine acetyltransferases in Saccharomyces cerevisiae. FEMS Microbiology Letters, 2007. 267(2): p.
159-166.
89. Dillemans, M., et al., The amplification effect of the ILV5 gene on the production of vicinal
diketones in Saccharomyces cerevisiae. Journal of the American Society of Brewing Chemists, 1987.
45: p. 81.
128
References
90. Krogerus, K. and B.R. Gibson, Influence of valine and other amino acids on total diacetyl and
2,3-pentanedione levels during fermentation of brewer's wort. Applied Microbiology and
Biotechnology, 2013. 97(15): p. 6919-30.
91. Alves, Z., et al., Exploring the Saccharomyces cerevisiae volatile metabolome: indigenous versus
commercial strains. PloS One, 2015. 10(11): p. e0143641.
92. Penuelas, J., et al., Biogenic volatile emissions from the soil. Plant, Cell & Environment, 2014.
37(8): p. 1866-1891.
93. Lambrechts, M.G. and I.S. Pretorius, Yeast and its importance for wine aroma - a review. South
African Journal for Enology and Viticulture, 2000. 21: p. 97-129.
94. Tahara, S., K. Fujiwara, and J. Mizutani, Metabolites of Sporobolomyces odorus. 2. Neutral
constituents of volatiles in cultured broth of Sporobolomyces odorus. Agricultural and Biological
Chemistry, 1973. 37(12): p. 2855-2861.
95. Wache, Y., et al., Role of beta-oxidation enzymes in gamma-decalactone production by the yeast
Yarrowia lipolytica. Applied and Environmental Microbiology, 2001. 67(12): p. 5700-5704.
96. Nordström, K., Formation of esters from acids by Brewer‘s yeast IV. Effect of higher fatty acids
and toxicity of lower fatty acids. Journal of the Institute of Brewing, 1964. 70(3): p. 233-242.
97. Schewe, H., et al., Biotechnological production of terpenoid flavour and fragrance compounds in
tailored bioprocesses, in Developments in Food Science, L.P.B. Wender and P. Mikael Agerlin, Editors.
2006, Elsevier: Amsterdam. p. 45-48.
98. Rottava, I., et al., Microbial oxidation of (-)-alpha-pinene to verbenol production by newly isolated
strains. Applied Biochemistry and Biotechnology, 2010. 162(8): p. 2221-2231.
99. King, A. and J. Richard Dickinson, Biotransformation of monoterpene alcohols by Saccharomyces
cerevisiae, Torulaspora delbrueckii and Kluyveromyces lactis. Yeast, 2000. 16(6): p. 499-506.
100. Carrau, F., E. Boido, and E. Dellacassa, Yeast diversity and flavor compounds, in Fungal
Metabolites, J.-M. Mérillon and G.K. Ramawat, Editors. 2016, Springer International Publishing:
Cham. p. 1-29.
101. Dzubak, P., et al., Pharmacological activities of natural triterpenoids and their therapeutic
implications. Natural Products Reports, 2006. 23(3): p. 394-411.
102. Rodriguez, J.M., et al., Fungal metabolic model for 3-methylcrotonyl-CoA carboxylase deficiency.
Journal of Biological Chemistry, 2004. 279(6): p. 4578-4587.
103. Moss, J. and M.D. Lane, The biotin-dependent enzymes. Advances in Enzymology and Related
Areas of Molecular Biology, 1971. 35: p. 321-442.
104. Anderson, M.D., et al., 3-Methylcrotonyl-coenzyme A carboxylase is a component of the
mitochondrial leucine catabolic pathway in plants. Plant Physiology, 1998. 118(4): p. 1127-1138.
105. Oswald, M., et al., Monoterpenoid biosynthesis in Saccharomyces cerevisiae. FEMS Yeast Research,
2007. 7(3): p. 413-421.
106. von Reuss, S.H., et al., Octamethylbicyclo[3.2.1]octadienes from the rhizobacterium Serratia
odorifera. Angewandte Chemie, International Edition, 2010. 49(11): p. 2009-2010.
107. Weise, T., et al., VOC emission of various Serratia species and isolates and genome analysis of
Serratia plymuthica 4Rx13. FEMS Microbiology Letters, 2014. 352(1): p. 45-53.
108. Cumeras, R., et al., Review on Ion Mobility Spectrometry. Part 2: hyphenated methods and effects
of experimental parameters. Analyst, 2015. 140(5): p. 1391-1410.
109. Mäkinen, M.A., O.A. Anttalainen, and M.E.T. Sillanpää, Ion Mobility Spectrometry and Its
Applications in Detection of Chemical Warfare Agents. Analytical Chemistry, 2010. 82(23): p.
9594-9600.
110. Cable, A. Some aspects of the use of intelligent systems engineering in the design of airport
security programmes. in Intelligent Systems Engineering, 1992., First International Conference on (Conf.
Publ. No. 360). 1992. IET.
111. Eiceman, G.A., et al., Separation of ions from explosives in differential mobility spectrometry by
vapor-modified drift gas. Analytical Chemistry, 2004. 76(17): p. 4937-4944.
129
References
112. Westhoff, M., et al., Ion mobility spectrometry: a new method for the detection of lung cancer
and airway infection in exhaled air? First results of a pilot study. CHEST Journal, 2005.
128(4_MeetingAbstracts): p. 155S-a-155S.
113. Westhoff, M., et al., Ion mobility spectrometry for the detection of volatile organic compounds
in exhaled breath of patients with lung cancer: results of a pilot study. Thorax, 2009. 64(9): p.
744-8.
114. Ruzsanyi, V. and J. Baumbach, Analysis of human breath using IMS. International Journal for
Ion Mobility Spectrometry, 2005. 8: p. 5-7.
115. Baumbach, J.I., Process analysis using ion mobility spectrometry. Analytical and Bioanalytical
Chemistry, 2006. 384(5): p. 1059-70.
116. Collins, D. and M. Lee, Developments in ion mobility spectrometry–mass spectrometry.
Analytical and Bioanalytical Chemistry, 2002. 372(1): p. 66-73.
117. Cumeras, R., et al., Review on ion mobility spectrometry. Part 1: current instrumentation. Analyst,
2015. 140(5): p. 1376-90.
118. Hill, H.H. and G. Simpson, Capabilities and limitations of ion mobility spectrometry for field
screening applications. Field Analytical Chemistry and Technology, 1997. 1(3): p. 119-134.
119. Tabrizchi, M., T. Khayamian, and N. Taj, Design and optimization of a corona discharge
ionization source for ion mobility spectrometry. Review of Scientific Instruments, 2000. 71(6): p.
2321-2328.
120. Leasure, C.S., et al., Photoionization in air with ion obility spectrometry using a hydrogen
discharge lamp. Analytical Chemistry, 1986. 58(11): p. 2142-2147.
121. Sielemann, S., et al., Detection of alcohols using UV-ion mobility spetrometers. Analytica Chimica
Acta, 2001. 431(2): p. 293-301.
122. Gillig, K.J., et al., Coupling high-pressure MALDI with ion mobility/orthogonal time-of flight
mass spectrometry. Analytical Chemistry, 2000. 72(17): p. 3965-3971.
123. Shumate, C.B. and H.H. Hill, Coronaspray nebulization and ionization of liquid samples for ion
mobility spectrometry. Analytical Chemistry, 1989. 61(6): p. 601-606.
124. Bradbury, N.E. and R.A. Nielsen, Absolute values of the electron mobility in hydrogen. Physical
Review, 1936. 49(5): p. 388.
125. Tyndall, A.M. and C.F. Powell, The mobility of ions in pure gases. Proceedings of the Royal
Society of London Series A, 1930. 129(809): p. 162-180.
126. Revercomb, H. and E.A. Mason, Theory of plasma chromatography/gaseous electrophoresis.
Review. Analytical Chemistry, 1975. 47(7): p. 970-983.
127. Hill, H.H., W.F. Siems, and R.H. St. Louis, Ion mobility spectrometry. Analytical Chemistry,
1990. 62(23): p. 1201A-1209A.
128. Stach, J. and J.I. Baumbach, Ion mobility spectrometry-basic elements and applications.
International Journal for Ion Mobility Spectrometry, 2002. 5: p. 1-21.
129. Dzidic, I., et al., Comparison of positive ions formed in nickel-63 and corona discharge ion
sources using nitrogen, argon, isobutane, ammonia and nitric oxide as reagents in atmospheric
pressure ionization mass spectrometry. Analytical Chemistry, 1976. 48(12): p. 1763-1768.
130. Eiceman, G.A., et al., Positive reactant ion chemistry for analytical, high temperature ion mobility
spectrometry (IMS): effects of electric field of the drift tube and moisture, temperature, and flow
of the drift gas. International Journal for Ion Mobility Spectrometry, 1998. 1: p. 28-37.
131. Sielemann, S., et al., Determination of MTBE next to benzene, toluene and xylene within 90 s
using GC/IMS with multi-capillary column. Journal of Integrative Bioinformatics, 2001. 4(2): p.
69-73.
132. Vidal-de-Miguel, G., et al., Low-sample flow secondary electrospray ionization: improving vapor
ionization efficiency. Analytical Chemistry, 2012. 84(20): p. 8475-8479.
133. Gaugg, M.T., et al., Expanding metabolite coverage of real-time breath analysis by coupling a
universal secondary electrospray ionization source and high resolution mass spectrometry a pilot
study on tobacco smokers. Journal of Breath Research, 2016. 10(1): p. 016010.
130
References
134. Barrios-Collado, C.s., et al., Capturing in vivo plant metabolism by real-time analysis of low to high
molecular weight volatiles. Analytical Chemistry, 2016. 88(4): p. 2406-2412.
135. Perry, R.H., R.G. Cooks, and R.J. Noll, Orbitrap mass spectrometry: instrumentation, ion motion
and applications. Mass Spectrometry Reviews, 2008. 27(6): p. 661-699.
136. Barrios-Collado, C., G. Vidal-de-Miguel, and P.M.-L. Sinues, Numerical modeling and
experimental validation of a universal secondary electrospray ionization source for mass
spectrometric gas analysis in real-time. Sensors and Actuators B: Chemical, 2016. 223: p. 217-225.
137. Jordan, A., et al., A high resolution and high sensitivity proton-transfer-reaction time-of-flight
mass spectrometer (PTR-TOF-MS). International Journal of Mass Spectrometry, 2009. 286(2): p.
122-128.
138. Bunge, M., et al., On-line monitoring of microbial volatile metabolites by proton transfer reaction-
mass spectrometry. Applied and Environmental Microbiology, 2008. 74(7): p. 2179-2186.
139. Romano, A., et al., Proton transfer reaction–mass spectrometry: online and rapid determination
of volatile organic compounds of microbial origin. Applied Microbiology and Biotechnology,
2015. 99(9): p. 3787-3795.
140. Weise, T., et al., Volatile organic compounds produced by the phytopathogenic bacterium
Xanthomonas campestris pv. vesicatoria 85-10. Beilstein Journal of Organic Chemistry, 2012. 8(1):
p. 579-596.
141. Critchley, A., et al., The proton transfer reaction mass spectrometer and its use in medical science:
applications to drug assays and the monitoring of bacteria. International Journal of Mass
Spectrometry, 2004. 239(2): p. 235-241.
142. O'Hara, M. and C.A. Mayhew, A preliminary comparison of volatile organic compounds in the
headspace of cultures of Staphylococcus aureus grown in nutrient, dextrose and brain heart bovine
broths measured using a proton transfer reaction mass spectrometer. Journal of Breath Research,
2009. 3(2): p. 027001.
143. Zehm, S., et al., Detection of Candida albicans by mass spectrometric fingerprinting. Current
Microbiology, 2012. 64(3): p. 271-275.
144. Jaksch, D., et al., The effect of ozone treatment on the microbial contamination of pork meat
measured by detecting the emissions using PTR-MS and by enumeration of microorganisms.
International Journal of Mass Spectrometry, 2004. 239(2): p. 209-214.
145. Mayr, D., et al., Detection of the spoiling of meat using PTR–MS. International Journal of Mass
Spectrometry, 2003. 223: p. 229-235.
146. Silcock, P., et al., Microbially induced changes in the volatile constituents of fresh chilled
pasteurised milk during storage. Food Packaging and Shelf Life, 2014. 2(2): p. 81-90.
147. Soukoulis, C., et al., Proton transfer reaction time‐of‐flight mass spectrometry monitoring of the
evolution of volatile compounds during lactic acid fermentation of milk. Rapid Communications
in Mass Spectrometry, 2010. 24(14): p. 2127-2134.
148. Makhoul, S., et al., Proton‐transfer‐reaction mass spectrometry for the study of the production of
volatile compounds by bakery yeast starters. Journal of Mass Spectrometry, 2014. 49(9): p. 850-
859.
149. Makhoul, S., et al., Volatile compound production during the bread-making process: effect of
flour, yeast and their interaction. Food and Bioprocess Technology, 2015. 8(9): p. 1925-1937.
150. Capozzi, V., et al., PTR-MS characterization of VOCs associated with commercial aromatic
bakery yeasts of wine and beer origin. Molecules, 2016. 21(4): p. 483.
151. Grob, R.L., Theory of gas chromatography, in Modern Practice of Gas Chromatography. 2004, John
Wiley & Sons, Inc.: Hoboken, New Jersey. p. 23-63.
152. Colón, L.A. and L.J. Baird, Detectors in modern gas chromatography, in Modern Practice of Gas
Chromatography. 2004, John Wiley & Sons, Inc. p. 275-337.
153. Barry, E.F., Columns: packed and capillary; column selection in gas chromatography, in Modern
Practice of Gas Chromatography. 2004, John Wiley & Sons, Inc. p. 65-191.
131
References
154. Tranchida, P.Q., et al., Heart-cutting multidimensional gas chromatography: a review of recent
evolution, applications, and future prospects. Analytica Chimica Acta, 2012. 716: p. 66-75.
155. Marriott, P. and R. Shellie, Principles and applications of comprehensive two-dimensional gas
chromatography. TRAC Trends in Analytical Chemistry, 2002. 21(9–10): p. 573-583.
156. Seeley, J.V. and S.K. Seeley, Multidimensional gas chromatography: fundamental advances and
new applications. Analytical Chemistry, 2012. 85(2): p. 557-578.
157. Jagerdeo, E., et al., Analysis of ethyl carbamate in wines using solid-phase extraction and
multidimensional gas chromatography/mass spectrometry. Journal of Agricultural and Food
Chemistry, 2002. 50(21): p. 5797-5802.
158. van Ruth, S.M., Methods for gas chromatography-olfactometry: a review. Biomolecular
Engineering, 2001. 17(4–5): p. 121-128.
159. Zhang, Y., et al., Identification of potent odorants in a novel nonalcoholic beverage produced by
fermentation of wort with shiitake (Lentinula edodes). Journal of Agricultural and Food Chemistry,
2014. 62(18): p. 4195-4203.
160. Schmidt, R. and W.S. Cain, Making scents: dynamic olfactometry for threshold measurement.
Chemical Senses, 2010. 35(2): p. 109-20.
161. Campo, E., et al., Prediction of the wine sensory properties related to grape variety from dynamic-
headspace gas chromatography−olfactometry data. Journal of Agricultural and Food Chemistry,
2005. 53(14): p. 5682-5690.
162. Eiceman, G.A., H.H. Hill, and J. Gardea-Torresdey, Gas chromatography. Analytical Chemistry,
2000. 72(12): p. 137-144.
163. Franc, C., F. David, and G. de Revel, Multi-residue off-flavour profiling in wine using stir bar
sorptive extraction–thermal desorption–gas chromatography–mass spectrometry. Journal of
Chromatography A, 2009. 1216(15): p. 3318-3327.
164. Perl, T., et al., Detection of characteristic metabolites of Aspergillus fumigatus and Candida species
using ion mobility spectrometry–metabolic profiling by volatile organic compounds. Mycoses,
2011. 54(6): p. e828-e837.
165. Aznar, M. and T. Arroyo, Analysis of wine volatile profile by purge-and-trap–gas
chromatography–mass spectrometry: Application to the analysis of red and white wines from
different Spanish regions. Journal of Chromatography A, 2007. 1165(1–2): p. 151-157.
166. Verstrepen, K.J., et al., Expression levels of the yeast alcohol acetyltransferase genes ATF1, Lg-
ATF1, and ATF2 control the formation of a broad range of volatile esters. Applied and
Environmental Microbiology, 2003. 69(9): p. 5228-5237.
167. Rowan, D.D., Volatile metabolites. Metabolites, 2011. 1(1): p. 41-63.
168. Schmidt, K. and I. Podmore, Solid phase microextraction (SPME) method development in
analysis of volatile organic compounds (VOCS) as potential biomarkers of cancer. Journal of
Molecular Biomarkers & Diagnosis, 2015. 2015.
169. Xu, L., C. Basheer, and H.K. Lee, Developments in single-drop microextraction. Journal of
Chromatography A, 2007. 1152(1): p. 184-192.
170. Liu, H. and P.K. Dasgupta, Analytical chemistry in a drop. solvent extraction in a microdrop.
Analytical Chemistry, 1996. 68(11): p. 1817-1821.
171. Jeannot, M.A. and F.F. Cantwell, Solvent microextraction into a single drop. Analytical
Chemistry, 1996. 68(13): p. 2236-2240.
172. Ahmadi, F., et al., Determination of organophosphorus pesticides in water samples by single drop
microextraction and gas chromatography-flame photometric detector. Journal of
Chromatography A, 2006. 1101(1): p. 307-312.
173. Liu, W. and H.K. Lee, Continuous-flow microextraction exceeding1000-fold concentration of
dilute analytes. Analytical Chemistry, 2000. 72(18): p. 4462-4467.
174. Theis, A.L., et al., Headspace solvent microextraction. Analytical Chemistry, 2001. 73(23): p. 5651-
5654.
175. Ouyang, G., W. Zhao, and J. Pawliszyn, Kinetic calibration for automated headspace liquid-phase
microextraction. Analytical Chemistry, 2005. 77(24): p. 8122-8128.
132
References
176. Lapthorn, C., F. Pullen, and B.Z. Chowdhry, Ion mobility spectrometry-mass spectrometry (IMS-
MS) of small molecules: separating and assigning structures to ions. Mass Spectrometry Reviews,
2013. 32(1): p. 43-71.
177. Schneider, T., et al., An integrative clinical database and diagnostics platform for biomarker
identification and analysis in ion mobility spectra of human exhaled air. Journal of Integrative
Bioinformatics, 2013. 10: p. 218.
178. Eiceman, G.A., et al., Fragmentation of butyl acetate isomers in the drift region of an ion mobility
spectrometer. International Journal of Mass Spectrometry and Ion Processes, 1988. 85(3): p. 265-
275.
179. Becker, S., et al., Surfaced-enhanced laser desorption/ionization time-of-flight (SELDI-TOF)
differentiation of serum protein profiles of BRCA-1 and sporadic breast cancer. Annals of
Surgical Oncology, 2004. 11(10): p. 907-914.
180. Makarov, A., Electrostatic axially harmonic orbital trapping: a high-performance technique of
mass analysis. Analytical Chemistry, 2000. 72(6): p. 1156-1162.
181. Wu, C., et al., Construction and characterization of a high-flow, high-resolution ion mobility
spectrometer for detection of explosives after personnel portal sampling. Talanta, 2002. 57(1): p.
123-134.
182. Graus, M., M. Müller, and A. Hansel, High resolution PTR-TOF: quantification and formula
confirmation of VOC in real time. Journal of the American Society for Mass Spectrometry, 2010.
21(6): p. 1037-1044.
183. Fiehn, O., et al., Identification of uncommon plant metabolites based on calculation of elemental
compositions using gas chromatography and quadrupole mass spectrometry. Analytical
Chemistry, 2000. 72(15): p. 3573-3580.
184. Pagnotti, V.S., N.D. Chubatyi, and C.N. McEwen, Solvent assisted inlet ionization: an
ultrasensitive new liquid introduction ionization method for mass spectrometry. Analytical
Chemistry, 2011. 83(11): p. 3981-5.
185. Halbfeld, C., B.E. Ebert, and L.M. Blank, Multi-capillary column-ion mobility spectrometry of
volatile metabolites emitted by Saccharomyces cerevisiae. Metabolites, 2014. 4(3): p. 751-74.
186. Hamm, S., et al., A chemical investigation by headspace SPME and GC–MS of volatile and semi-
volatile terpenes in various olibanum samples. Phytochemistry, 2005. 66(12): p. 1499-1514.
187. Pragst, F., et al., Analysis of fatty acid ethyl esters in hair as possible markers of chronically
elevated alcohol consumption by headspace solid-phase microextraction (HS-SPME) and gas
chromatography-mass spectrometry (GC-MS). Forensic Science International, 2001. 121(1–2): p.
76-88.
188. Ochiai, N., et al., Optimization of a multi‐residue screening method for the determination of 85
pesticides in selected food matrices by stir bar sorptive extraction and thermal desorption GC‐
MS. Journal of Separation Science, 2005. 28(9‐10): p. 1083-1092.
189. Aprea, E., et al., Application of PTR-TOF-MS to investigate metabolites in exhaled breath of
patients affected by coeliac disease under gluten free diet. Journal of Chromatography. B:
Analytical Technologies in the Biomedical and Life Sciences, 2014. 966: p. 208-13.
190. Nguyen, N.N., et al., Megafiller: A retrofitted protein function predictor for filling gaps in
metabolic networks. Journal of Proteomics and Bioinformatics, 2014. S9: p. 003.
191. Engel, S.R., et al., Saccharomyces Genome Database provides mutant phenotype data. Nucleic Acids
Research, 2010. 38(Database issue): p. D433-6.
192. Karp, P.D., et al., Expansion of the BioCyc collection of pathway/genome databases to 160
genomes. Nucleic Acids Research, 2005. 33(19): p. 6083-6089.
193. Jewison, T., et al., YMDB: the yeast metabolome database. Nucleic Acids Research, 2012.
40(Database issue): p. D815-20.
194. Heavner, B.D., et al., Version 6 of the consensus yeast metabolic network refines biochemical
coverage and improves model performance. Database: The Journal of Biological Databases and
Curation, 2013. 2013: p. bat059.
133
References
195. Forster, J., et al., Genome-scale reconstruction of the Saccharomyces cerevisiae metabolic network.
Genome Research, 2003. 13(2): p. 244-253.
196. Kuepfer, L., U. Sauer, and L.M. Blank, Metabolic functions of duplicate genes in Saccharomyces
cerevisiae. Genome Research, 2005. 15.
197. Christian, N., et al., An integrative approach towards completing genome-scale metabolic
networks. Molecular Biosystems, 2009. 5(12): p. 1889-1903.
198. Cakir, T. and M.J. Khatibipour, Metabolic network discovery by top-down and bottom-up
approaches and paths for reconciliation. Frontiers in Bioengineering and Biotechnology, 2014. 2:
p. 62.
199. Shahzad, K. and J.J. Loor, Application of top-down and bottom-up systems approaches in
ruminant physiology and metabolism. Current Genomics, 2012. 13(5): p. 379-394.
200. Simeonidis, E., et al., Why does yeast ferment? A flux balance analysis study. Biochemical Society
Transactions, 2010. 38(5): p. 1225-1229.
201. Molenaar, D., et al., Shifts in growth strategies reflect tradeoffs in cellular economics. Molecular
Systems Biology, 2009. 5: p. 323.
202. Machado, D. and M.J. Herrgård, Co-evolution of strain design methods based on flux balance
and elementary mode analysis. Metabolic Engineering Communications, 2015. 2: p. 85-92.
203. Lewis, N.E., H. Nagarajan, and B.O. Palsson, Constraining the metabolic genotype-phenotype
relationship using a phylogeny of in silico methods. Nature Reviews: Microbiology, 2012.
204. Kanehisa, M., et al., The KEGG databases at GenomeNet. Nucleic Acids Research, 2002. 30(1):
p. 42-46.
205. Caspi, R., et al., MetaCyc: a multiorganism database of metabolic pathways and enzymes. Nucleic
Acids Research, 2006. 34(Database issue): p. D511-6.
206. Schellenberger, J., et al., BiGG: a biochemical genetic and genomic knowledgebase of large scale
metabolic reconstructions. BMC Bioinformatics, 2010. 11: p. 213.
207. Chou, C.H., et al., FMM: a web server for metabolic pathway reconstruction and comparative
analysis. Nucleic Acids Research, 2009. 37(Web Server issue): p. W129-34.
208. Blum, T. and O. Kohlbacher, MetaRoute: fast search for relevant metabolic routes for interactive
network navigation and visualization. Bioinformatics, 2008. 24(18): p. 2108-2109.
209. Moriya, Y., et al., PathPred: an enzyme-catalyzed metabolic pathway prediction server. Nucleic
Acids Research, 2010. 38: p. W138-W143.
210. Hatzimanikatis, V., et al., Exploring the diversity of complex metabolic networks. Bioinformatics,
2005. 21(8): p. 1603-1609.
211. Hadadi, N., et al., A computational framework for integration of lipidomics data into metabolic
pathways. Metabolic Engineering, 2014. 23C: p. 1-8.
212. Brunk, E., et al., Characterizing strain variation in engineered E. coli using a multi-omics-based
workflow. Cell Systems, 2016. 2(5): p. 335-346.
213. Zur, H., E. Ruppin, and T. Shlomi, iMAT: an integrative metabolic analysis tool. Bioinformatics,
2010. 26(24): p. 3140-3142.
214. Jensen, P.A. and J.A. Papin, Functional integration of a metabolic network model and expression
data without arbitrary thresholding. Bioinformatics, 2011. 27(4): p. 541-7.
215. van Berlo, R.J.P., et al., Predicting metabolic fluxes using gene expression differences as
constraints. IEEE/ACM Transactions on Computational Biology and Bioinformatics, 2011. 8(1):
p. 206-216.
216. Faria, J.P., et al., Genome-scale bacterial transcriptional regulatory networks: reconstruction and
integrated analysis with metabolic models. Briefings in Bioinformatics, 2014. 15(4): p. 592-611.
217. Machado, D. and M. Herrgard, Systematic evaluation of methods for integration of
transcriptomic data into constraint-based models of metabolism. PLoS Computational Biology,
2014. 10(4): p. e1003580.
218. Orth, J.D., I. Thiele, and B.O. Palsson, What is flux balance analysis? Nature Biotechnology,
2010. 28(3): p. 245-8.
134
References
219. Henry, C.S., L.J. Broadbelt, and V. Hatzimanikatis, Thermodynamics-based metabolic flux
analysis. Biophysical Journal, 2007. 92(5): p. 1792-805.
220. Crown, S.B., W.S. Ahn, and M.R. Antoniewicz, Rational design of 13C-labeling experiments for
metabolic flux analysis in mammalian cells. BMC Systems Biology, 2012. 6.
221. Yang, H., D.E. Mandy, and I.G. Libourel, Optimal design of isotope labeling experiments.
Methods in Molecular Biology, 2014. 1083: p. 133-47.
222. Noh, K., A. Wahl, and W. Wiechert, Computational tools for isotopically instationary C-13
labeling experiments under metabolic steady state conditions. Metabolic Engineering, 2006. 8(6):
p. 554-577.
223. Mollney, M., et al., Bidirectional reaction steps in metabolic networks: IV. optimal design of
isotopomer labeling experiments. Biotechnology and Bioengineering, 1999. 66(2): p. 86-103.
224. Seijo, M., K.C. Soh, and V. Hatzimanikatis, A novel approach to find the missing links in genome-
scale metabolic models: The BridgIT method, in FOSBE 2012. 2012: Tsuruoka, Japan.
225. Tervo, C.J. and J.L. Reed, FOCAL: an experimental design tool for systematizing metabolic
discoveries and model development. Genome Biology, 2012. 13(12).
226. Mo, M.L., B.Ø. Palsson, and M.J. Herrgård, Connecting extracellular metabolomic measurements
to intracellular flux states in yeast. BMC Systems Biology, 2009. 3.
227. Herrgard, M.J., et al., A consensus yeast metabolic network reconstruction obtained from a
community approach to systems biology. Nature Biotechnology, 2008. 26(10): p. 1155-60.
228. Dobson, P.D., et al., Further developments towards a genome-scale metabolic model of yeast.
BMC Systems Biology, 2010. 4(1): p. 145.
229. Heavner, B.D., et al., Yeast 5 – an expanded reconstruction of the Saccharomyces cerevisiae metabolic
network. BMC Systems Biology, 2012. 6(1): p. 55.
230. Aung, H.W., S.A. Henry, and L.P. Walker, Revising the representation of fatty acid, glycerolipid,
and glycerophospholipid metabolism in the consensus model of yeast metabolism. Industrial
Biotechnology, 2013. 9(4): p. 215-228.
231. Kanehisa, M., et al., KEGG: new perspectives on genomes, pathways, diseases and drugs. Nucleic
Acids Research, 2017. 45(D1): p. D353-D361.
232. Kanehisa, M. and S. Goto, KEGG: Kyoto encyclopedia of genes and genomes. Nucleic Acids
Research, 2000. 28(1): p. 27-30.
233. Kanehisa, M., et al., From genomics to chemical genomics: new developments in KEGG. Nucleic
Acids Research, 2006. 34.
234. Soh, K.C. and V. Hatzimanikatis, DREAMS of metabolism. Trends in Biotechnology, 2010.
28(10): p. 501-8.
235. Jankowski, M.D., et al., Group contribution method for thermodynamic analysis of complex
metabolic networks. Biophysical Journal, 2008. 95(3): p. 1487-99.
236. Hyduke, D., et al., COBRA toolbox 2.0. 2011.
237. Verduyn, C., et al., Effect of benzoic acid on metabolic fluxes in yeasts: a continuous-culture study
on the regulation of respiration and alcoholic fermentation. Yeast, 1992. 8(7): p. 501-517.
238. Jakociunas, T., et al., Multiplex metabolic pathway engineering using CRISPR/Cas9 in
Saccharomyces cerevisiae. Metabolic Engineering, 2015. 28: p. 213-22.
239. Electrocompetent E. coli. 2017 [cited 2017 10.10.2017]; Available from:
http://barricklab.org/twiki/bin/view/Lab/ProtocolsElectrocompetentCells.
240. Jessop-Fabre, M.M., et al., EasyClone-MarkerFree: A vector toolkit for marker-less integration of
genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnology Journal, 2016. 11(8): p. 1110-7.
241. Joska, T.M., et al., A universal cloning method based on yeast homologous recombination that is
simple, efficient, and versatile. Journal of Microbiological Methods, 2014. 100: p. 46-51.
242. Bitinaite, J., et al., USER friendly DNA engineering and cloning method by uracil excision.
Nucleic Acids Research, 2007. 35(6): p. 1992-2002.
243. Bitinaite, J. and N.M. Nichols, DNA cloning and engineering by uracil excision, in Current Protocols
in Molecular Biology. 2001, John Wiley & Sons, Inc.
135
References
136
References
264. Drewke, C., J. Thielen, and M. Ciriacy, Ethanol formation in adh0 mutants reveals the existence
of a novel acetaldehyde-reducing activity in Saccharomyces cerevisiae. Journal of Bacteriology, 1990.
172(7): p. 3909-3917.
265. Smith, M.G., S.G. Des Etages, and M. Snyder, Microbial synergy via an ethanol-triggered
pathway. Molecular and Cellular Biology, 2004. 24(9): p. 3874-3884.
266. de Smidt, O., J.C. du Preez, and J. Albertyn, The alcohol dehydrogenases of Saccharomyces cerevisiae:
a comprehensive review. FEMS Yeast Research, 2008. 8(7): p. 967-78.
267. Wenger, J.I. and C. Bernofsky, Mitochondrial alcohol dehydrogenase from Saccharomyces cerevisiae.
Biochimica et Biophysica Acta (BBA) - Enzymology, 1971. 227(3): p. 479-490.
268. Wills, C., P. Kratofil, and T. Martin, Functional mutants of yeast alcohol dehydrogenase, in Genetic
Engineering of Microorganisms for Chemicals, A. Hollaender, et al., Editors. 1982, Springer US: Boston,
MA. p. 305-329.
269. Weimer, E.P., E. Rao, and M. Brendel, Molecular structure and genetic regulation of SFA, a gene
responsible for resistance to formaldehyde in Saccharomyces cerevisiae, and characterization of its
protein product. Molecular and General Genetics MGG, 1993. 237(3): p. 351-358.
270. Larroy, C., et al., Properties and functional significance of Saccharomyces cerevisiae ADHVI.
Chemico-Biological Interactions, 2003. 143: p. 229-238.
271. Larroy, C., et al., Characterization of the Saccharomyces cerevisiae YMR318C (ADH6) gene product
as a broad specificity NADPH-dependent alcohol dehydrogenase: relevance in aldehyde
reduction. Biochemical Journal, 2002. 361(1): p. 163-172.
272. Hauser, M., et al., A transcriptome analysis of isoamyl alcohol-induced filamentation in yeast
reveals a novel role for Gre2p as isovaleraldehyde reductase. FEMS Yeast Research, 2007. 7(1):
p. 84-92.
273. Gancedo, C., C.L. Flores, and J.M. Gancedo, The expanding landscape of moonlighting proteins
in yeasts. Microbiology and Molecular Biology Reviews, 2016. 80(3): p. 765-77.
274. Hult, K. and P. Berglund, Enzyme promiscuity: mechanism and applications. Trends in
Biotechnology, 2007. 25.
275. Messenguy, F. and J.M. Wiame, The control of ornithinetranscarbamylase activity by arginase in
Saccharomyces cerevisiae. FEBS Letters, 1969. 3(1): p. 47-49.
276. Gancedo, C. and C.-L. Flores, Moonlighting proteins in yeasts. Microbiology and Molecular
Biology Reviews, 2008. 72(1): p. 197-210.
277. Doerks, T., et al., Systematic identification of novel protein domain families associated with
nuclear functions. Genome Research, 2002. 12(1): p. 47-56.
278. Fischer, E., N. Zamboni, and U. Sauer, High-throughput metabolic flux analysis based on gas
chromatography–mass spectrometry derived 13C constraints. Analytical Biochemistry, 2004.
325(2): p. 308-316.
279. Rühl, M., et al., Collisional fragmentation of central carbon metabolites in LC-MS/MS increases
precision of 13C metabolic flux analysis. Biotechnology and Bioengineering, 2012. 109(3): p. 763-
771.
280. Jin, C., et al., Progress in the production and application of n-butanol as a biofuel. Renewable and
Sustainable Energy Reviews, 2011. 15(8): p. 4080-4106.
281. Adkins, J., et al., Engineering microbial chemical factories to produce renewable “biomonomers”.
Frontiers in Microbiology, 2012. 3: p. 313.
282. McGovern, P.E., et al., Fermented beverages of pre- and proto-historic China. Proceedings of the
National Academy of Sciences of the United States of America, 2004. 101(51): p. 17593-8.
283. Sicard, D. and J.-L. Legras, Bread, beer and wine: Yeast domestication in the Saccharomyces sensu
stricto complex. Comptes Rendus Biologies, 2011. 334(3): p. 229-236.
284. McGovern, P.E., et al., Neolithic resinated wine. Nature, 1996. 381(6582): p. 480-481.
285. Mortimer, R.K., Evolution and variation of the yeast (Saccharomyces) genome. Genome Research,
2000. 10(4): p. 403-9.
286. McGovern, P.E., A. Mirzoian, and G.R. Hall, Ancient Egyptian herbal wines. Proceedings of the
National Academy of Sciences of the United States of America, 2009. 106(18): p. 7361-6.
137
References
287. Goffeau, A., et al., Life with 6000 genes. Science, 1996. 274(5287): p. 546-567.
288. Ro, D.K., et al., Production of the antimalarial drug precursor artemisinic acid in engineered yeast.
Nature, 2006. 440(7086): p. 940-3.
289. de Deken, R.H., The Crabtree effect: a regulatory system in yeast. Microbiology, 1966. 44(2): p.
149-156.
290. Torrens, J., et al., Volatile compounds of red and white wines by headspace--solid-phase
microextraction using different fibers. Journal of Chromatographic Science, 2004. 42(6): p. 310-
6.
291. Polaskova, P., J. Herszage, and S.E. Ebeler, Wine flavor: chemistry in a glass. Chemical Society
Reviews, 2008. 37(11): p. 2478-89.
292. Stevens, R., Beer flavour: I. Volatile products of dermentation: a review. Journal of the Institute
of Brewing, 1960. 66(6): p. 453-471.
293. Kobayashi, M., H. Shimizu, and S. Shioya, Beer volatile compounds and their application to low-
malt beer fermentation. Journal of Bioscience and Bioengineering, 2008. 106(4): p. 317-323.
294. Frick, O. and C. Wittmann, Characterization of the metabolic shift between oxidative and
fermentative growth in Saccharomyces cerevisiae by comparative 13C flux analysis. Microbial Cell
Factories, 2005. 4: p. 30.
295. Tejero Rioseras, A., et al., Comprehensive real-time analysis of the yeast volatilome. Scientific
Reports, 2017. 7(1): p. 14236.
296. Wu, C., W.F. Siems, and H.H. Hill, Secondary electrospray ionization ion mobility
spectrometry/mass spectrometry of illicit drugs. Analytical Chemistry (Washington), 2000. 72(2):
p. 396-403.
297. Barrios-Collado, C., et al., Capturing in vivo plant metabolism by real-time analysis of low to high
molecular weight volatiles. Analytical Chemistry, 2016. 88(4): p. 2406-12.
298. Cole, R.B., Some tenets pertaining to electrospray ionization mass spectrometry. Journal of Mass
Spectrometry, 2000. 35(7): p. 763-772.
299. Barrios-Collado, C., G. Vidal-de-Miguel, and P. Martinez-Lozano Sinues, Numerical modeling
and experimental validation of a universal secondary electrospray ionization source for mass
spectrometric gas analysis in real-time. Sensors and Actuators B: Chemical, 2016. 223: p. 217-225.
300. Vidal-de-Miguel, G., et al., Low-sample flow secondary electrospray ionization: improving vapor
ionization efficiency. Analytical Chemistry, 2012. 84(20): p. 8475-9.
301. Bateman, K.P., et al., Quantitative-qualitative data acquisition using a benchtop Orbitrap mass
spectrometer. Journal of the American Society for Mass Spectrometry, 2009. 20(8): p. 1441-50.
302. Martinez-Lozano Sinues, P., et al., Circadian variation of the human metabolome captured by
real-time breath analysis. PloS One, 2014. 9(12): p. 114422.
303. Sinues, P.M., M. Kohler, and R. Zenobi, Monitoring diurnal changes in exhaled human breath.
Analytical Chemistry, 2013. 85(1): p. 369-73.
304. Kessner, D., et al., ProteoWizard: open source software for rapid proteomics tools development.
Bioinformatics, 2008. 24(21): p. 2534-6.
305. Hong, S.Y., A.S. Zurbriggen, and A. Melis, Isoprene hydrocarbons production upon
heterologous transformation of Saccharomyces cerevisiae. Journal of Applied Microbiology, 2012.
113(1): p. 52-65.
306. Anderson, M.S., et al., Farnesyl diphosphate synthetase. Molecular cloning, sequence, and
expression of an essential gene from Saccharomyces cerevisiae. Journal of Biological Chemistry, 1989.
264(32): p. 19176-19184.
307. Morales, M.L., et al., Monitoring volatile compounds production throughout fermentation by
Saccharomyces and non-Saccharomyces strains using headspace sorptive extraction. Journal of Food
Science and Technology, 2017. 54(2): p. 538-557.
308. Fan, J., et al., Quantitative flux analysis reveals folate-dependent NADPH production. Nature,
2014. 510(7504): p. 298-302.
309. Link, H., et al., Real-time metabolome profiling of the metabolic switch between starvation and
growth. Nature Methods, 2015. 12(11): p. 1091-7.
138
References
310. Mortimer, R.K., Evolution and variation of the yeast (Saccharomyces) genome. Genome Research,
2000. 10(6): p. 891-891.
311. McGovern, P.E., et al., Fermented beverages of pre- and proto-historic China. Proceedings of the
National Academy of Sciences of the United States of America, 2004. 101(51): p. 17593-17598.
312. Sicard, D. and J.L. Legras, Bread, beer and wine: Yeast domestication in the Saccharomyces sensu
stricto complex. Comptes rendus: Biologies, 2011. 334(3): p. 229-236.
313. Paddon, C.J., et al., High-level semi-synthetic production of the potent antimalarial artemisinin.
Nature, 2013. 496(7446): p. 528-32.
314. Kjeldsen, T., Yeast secretory expression of insulin precursors. Applied Microbiology and
Biotechnology, 2000. 54(3): p. 277-86.
315. Thim, L., et al., Secretion and processing of insulin precursors in yeast. Proceedings of the
National Academy of Sciences of the United States of America, 1986. 83(18): p. 6766-70.
316. Basso, L.C., et al., Yeast selection for fuel ethanol production in Brazil. FEMS Yeast Research,
2008. 8(7): p. 1155-63.
317. Quantz, M., Versuchsanstalt der Hefeindustrie e.V., Berlin, Germany. 2014.
318. Paczia, N., et al., Extensive exometabolome analysis reveals extended overflow metabolism in
various microorganisms. Microbial Cell Factories, 2012. 11.
319. Suomalainen, H. and L. Nykänen, The aroma components produced by yeast in nitrogen-free
sugar solution. Journal of the Institute of Brewing, 1966. 72(5): p. 469-474.
320. Maddula, S., et al., Detection of volatile metabolites of Escherichia coli by multi capillary column
coupled ion mobility spectrometry. Analytical and Bioanalytical Chemistry, 2009. 394(3): p. 791-
800.
321. Kunze, N., et al., Detection and validation of volatile metabolic patterns over different strains of
two human pathogenic bacteria during their growth in a complex medium using multi-capillary
column-ion mobility spectrometry (MCC-IMS). Applied Microbiology and Biotechnology, 2013.
97(8): p. 3665-76.
322. Kotiaho, T., et al., Membrane inlet ion mobility spectrometry for online measurement of ethanol
in beer and in yeast fermentation. Analytica Chimica Acta, 1995. 309(1-3): p. 317-325.
323. Kolehmainen, M., P. Ronkko, and A. Raatikainen, Monitoring of yeast fermentation by ion
mobility spectrometry measurement and data visualisation with self-organizing maps. Analytica
Chimica Acta, 2003. 484(1): p. 93-100.
324. Vautz, W., J.I. Baumbach, and J. Jung, Beer fermentation control using ion mobility spectrometry
- Results of a pilot study. Journal of the Institute of Brewing, 2006. 112(2): p. 157-164.
325. van Dijken, J.P., et al., An interlaboratory comparison of physiological and genetic properties of
four Saccharomyces cerevisiae strains. Enzyme and Microbial Technology, 2000. 26(9-10): p. 706-714.
326. Blank, L.M., L. Kuepfer, and U. Sauer, Large-scale 13C-flux analysis reveals mechanistic principles
of metabolic network robustness to null mutations in yeast. Genome Biology, 2005. 6(6): p. R49.
327. Eiceman, G.H., Z. Karpas, and H.H. Hill, Ion mobility spectrometry. Third Edition. ed. xvi, 428
pages.
328. Bödeker, B., W. Vautz, and J. Baumbach, Peak finding and referencing in MCC/IMS data.
International Journal for Ion Mobility Spectrometry, 2008. 11(1-4): p. 83-87.
329. Ruzsanyi, V., J.I. Baumbach, and G.A. Eiceman, Detection of the mold markers using ion
mobility spectrometry. International Journal for Ion Mobility Spectrometry, 2003. 6: p. 53-57.
330. Crabtree, H.G., Observations on the carbohydrate metabolism of tumours. Biochemical Journal,
1929. 23(3): p. 536-45.
331. Randez-Gil, F., I. Corcoles-Saez, and J.A. Prieto, Genetic and phenotypic characteristics of
baker's yeast: relevance to baking. Annual Review of Food Science and Technology, 2013. 4: p.
191-214.
332. Ejiofor, A.O., N. Okafor, and E.N. Ugwueze, Development of baking yeast from Nigerian palm-
wine yeasts. World Journal of Microbiology & Biotechnology, 1994. 10(2): p. 199-202.
333. Fischer, K. Straightforward prognostication of durability of baker’s yeast. in 18th VH Yeast
Conference. 2005. Research Institute for Baker's Yeast, Berlin (self-published).
139
References
334. Porro, D., et al., Recombinant protein production in yeasts. Molecular Biotechnology, 2005. 31(3):
p. 245-59.
335. Jouhten, P., et al., Oxygen dependence of metabolic fluxes and energy generation of Saccharomyces
cerevisiae CEN.PK113-1A. BMC Systems Biology, 2008. 2.
336. Chen, G.C. and F. Jordan, Brewers-yeast pyruvate decarboxylase produces acetoin from
acetaldehyde - a novel tool to study the mechanism of steps subsequent to carbon-dioxide loss.
Biochemistry, 1984. 23(16): p. 3576-3582.
337. Heidlas, J. and R. Tressl, Purification and properties of two oxidoreductases catalyzing the
enantioselective reduction of diacetyl and other diketones from baker's yeast. European Journal
of Biochemistry, 1990. 188(1): p. 165-74.
338. Romano, P. and G. Suzzi, Origin and production of acetoin during wine yeast fermentation.
Applied and Environmental Microbiology, 1996. 62(2): p. 309-15.
339. Bartowsky, E.J. and P.A. Henschke, The 'buttery' attribute of wine-diacetyl-desirability, spoilage
and beyond. International Journal of Food Microbiology, 2004. 96(3): p. 235-252.
340. Gonzalez, E., et al., Characterization and functional role of Saccharomyces cerevisiae 2,3-butanediol
dehydrogenase. Chemico-Biological Interactions, 2001. 130-132(1-3): p. 425-34.
341. Pronk, J.T., H.Y. Steensma, and J.P. vanDijken, Pyruvate metabolism in Saccharomyces cerevisiae.
Yeast, 1996. 12(16): p. 1607-1633.
342. Ng, C.Y., et al., Production of 2,3-butanediol in Saccharomyces cerevisiae by in silico aided metabolic
engineering. Microbial Cell Factories, 2012. 11: p. 68.
343. Walker, V. and G.A. Mills, 2-Pentanone production from hexanoic acid by Penicillium roqueforti
from blue cheese: Is this the pathway used in humans? Scientific World Journal, 2014.
344. Dickschat, J.S., et al., Pyrazine biosynthesis in Corynebacterium glutamicum. European Journal of
Organic Chemistry, 2010(14): p. 2687-2695.
345. Gancedo, J.M., Yeast carbon catabolite repression. Microbiology and Molecular Biology Reviews,
1998. 62(2): p. 334-361.
346. Kayikci, O. and J. Nielsen, Glucose repression in Saccharomyces cerevisiae. FEMS Yeast Research,
2015. 15(6).
347. DeRisi, J.L., V.R. Iyer, and P.O. Brown, Exploring the metabolic and genetic control of gene
expression on a genomic scale. Science, 1997. 278(5338): p. 680-686.
348. Shalon, D., S.J. Smith, and P.O. Brown, A DNA microarray system for analyzing complex DNA
samples using two-color fluorescent probe hybridization. Genome Research, 1996. 6(7): p. 639-
645.
349. Schena, M., et al., Quantitative monitoring of gene expression patterns with a complementary
DNA microarray. Science, 1995. 270(5235): p. 467-470.
350. Bodenmiller, B., et al., PhosphoPep[mdash]a database of protein phosphorylation sites in model
organisms. Nature Biotechnology, 2008. 26(12): p. 1339-1340.
351. Oliveira, A.P. and U. Sauer, The importance of post-translational modifications in regulating
Saccharomyces cerevisiae metabolism. FEMS Yeast Research, 2012. 12(2): p. 104-17.
352. Kresnowati, M.T., et al., When transcriptome meets metabolome: fast cellular responses of yeast
to sudden relief of glucose limitation. Molecular Systems Biology, 2006. 2: p. 49.
353. ter Linde, J.J.M., et al., Genome-Wide Transcriptional Analysis of Aerobic and Anaerobic
Chemostat Cultures of Saccharomyces cerevisiae. Journal of Bacteriology, 1999. 181(24): p. 7409-7413.
354. Regenberg, B., et al., Growth-rate regulated genes have profound impact on interpretation of
transcriptome profiling in Saccharomyces cerevisiae. Genome Biology, 2006. 7(11): p. 107-107.
355. Martinez, J.L., et al., Gcn4p and the Crabtree effect of yeast: drawing the causal model of the
Crabtree effect in Saccharomyces cerevisiae and explaining evolutionary trade-offs of adaptation to
galactose through systems biology. FEMS Yeast Research, 2014. 14(4): p. 654-62.
356. Bell, P.J.L., V.J. Higgins, and P.V. Attfield, Comparison of fermentative capacities of industrial
baking and wild-type yeasts of the species Saccharomyces cerevisiae in different sugar media. Letters
in Applied Microbiology, 2001. 32(4): p. 224-229.
140
References
357. Benjamini, Y. and Y. Hochberg, Controlling the false discovery rate: a practical and powerful
approach to multiple testing. Journal of the Royal Statistical Society. Series B, 1995. 57(1): p. 289-
300.
358. Paley, S.M. and P.D. Karp, The pathway tools cellular overview diagram and omics viewer.
Nucleic Acids Research, 2006. 34(13): p. 3771-8.
359. Broach, J.R., Nutritional control of growth and development in yeast. Genetics, 2012. 192(1): p.
73-105.
360. Casalone, E., et al., Identification by functional analysis of the gene encoding α-isopropylmalate
synthase II (LEU9) in Saccharomyces cerevisiae. Yeast, 2000. 16(6): p. 539-545.
361. Eden, A., G. Simchen, and N. Benvenisty, Two yeast homologs of ECA39, a target for c-Myc
regulation, code for cytosolic and mitochondrial branched-chain amino acid aminotransferases.
Journal of Biological Chemistry, 1996. 271(34): p. 20242-20245.
362. NIST chemistry webbook, NIST standard reference database number 69, ed. P.J. Linstrom and
W.G. Mallard. 2017, National Institute of Standards and Technology, Gaithersburg MD.
363. Donahue, N.M., et al., A two-dimensional volatility basis set – Part 2: Diagnostics of organic-
aerosol evolution. Atmospheric Chemistry and Physics (Print), 2012. 12(2): p. 615-634.
364. Donahue, N.M., et al., A two-dimensional volatility basis set: 1. organic-aerosol mixing
thermodynamics. Atmospheric Chemistry and Physics (Print), 2011. 11(7): p. 3303-3318.
365. Gross, J. and G. Sadowski, Perturbed-chain SAFT: An equation of state based on a perturbation
theory for chain molecules. Industrial & Engineering Chemistry Research, 2001. 40(4): p. 1244-
1260.
366. Stovicek, V., I. Borodina, and J. Forster, CRISPR–Cas system enables fast and simple genome
editing of industrial Saccharomyces cerevisiae strains. Metabolic Engineering Communications, 2015.
2: p. 13-22.
367. Zhang, G.-C., et al., Construction of a quadruple auxotrophic mutant of an industrial polyploid
Saccharomyces cerevisiae strain by using RNA-guided Cas9 nuclease. Applied and Environmental
Microbiology, 2014. 80(24): p. 7694-7701.
368. Wang, Y., et al., Simultaneous editing of three homoeoalleles in hexaploid bread wheat confers
heritable resistance to powdery mildew. Nature Biotechnology, 2014. 32(9): p. 947-51.
369. Ilc, T., D. Werck-Reichhart, and N. Navrot, Meta-analysis of the core aroma components of
grape and wine aroma. Frontiers in Plant Science, 2016. 7: p. 1472.
370. González-Barreiro, C., et al., Wine aroma compounds in grapes: a critical review. Critical Reviews
in Food Science and Nutrition, 2015. 55(2): p. 202-218.
371. He, Y., et al., Wort composition and its impact on the flavour-active higher alcohol and ester
formation of beer – a review. Journal of the Institute of Brewing, 2014. 120(3): p. 157-163.
372. Hua, D. and P. Xu, Recent advances in biotechnological production of 2-phenylethanol.
Biotechnology Advances, 2011. 29(6): p. 654-660.
373. Wang, H., et al., A continuous and adsorptive bioprocess for efficient production of the natural
aroma chemical 2-phenylethanol with yeast. Enzyme and Microbial Technology, 2011. 48(4-5):
p. 404-7.
374. Etschmann, M.M. and J. Schrader, An aqueous-organic two-phase bioprocess for efficient
production of the natural aroma chemicals 2-phenylethanol and 2-phenylethylacetate with yeast.
Applied Microbiology and Biotechnology, 2006. 71(4): p. 440-3.
375. Yilmaztekin, M., T. Cabaroglu, and H. Erten, Effects of fermentation temperature and aeration
on production of natural isoamyl acetate by Williopsis saturnus var. saturnus. BioMed Research
International, 2013. 2013: p. 870802.
376. Strobel, G.A., Bioprospecting--fuels from fungi. Biotechnology Letters, 2015. 37(5): p. 973-82.
377. Xue, J. and B.K. Ahring, Enhancing isoprene production by genetic modification of the 1-deoxy-
d-xylulose-5-phosphate pathway in Bacillus subtilis. Applied and Environmental Microbiology,
2011. 77(7): p. 2399-405.
378. Jansen, D.J. and R.A. Shenvi, Synthesis of medicinally relevant terpenes: reducing the cost and
time of drug discovery. Future Medicinal Chemistry, 2014. 6(10): p. 1127-48.
141
References
379. Dias, J., et al., On-line adaptive metabolic flux analysis: Application to PHB production by mixed
microbial cultures. Biotechnology Progress, 2009. 25(2): p. 390-398.
380. Yeastnet. 2014 [cited 2014 02 September]; Available from:
http://sourceforge.net/projects/yeast/files/.
381. Zimmermann, S., et al., Miniaturized low-cost ion mobility spectrometer for fast detection of
chemical warfare agents. Analytical Chemistry, 2008. 80(17): p. 6671-6676.
382. Harris, G.A., M. Kwasnik, and F.M. Fernandez, Direct analysis in real time coupled to
multiplexed drift tube ion mobility spectrometry for detecting toxic chemicals. Analytical
Chemistry, 2011. 83(6): p. 1908-15.
383. Mäkinen, M., M. Nousiainen, and M. Sillanpää, Ion spectrometric detection technologies for
ultra-traces of explosives: a review. Mass Spectrometry Reviews, 2011. 30(5): p. 940-973.
384. Palmer, P.T. and T.F. Limero, Mass spectrometry in the U.S. space program: past, present, and
future. Journal of the American Society for Mass Spectrometry, 2001. 12(6): p. 656-675.
385. Eiceman, G.A., et al., Monitoring volatile organic compounds in ambient air inside and outside
buildings with the use of a radio-frequency-based ion-mobility analyzer with a micromachined
drift tube. Field Analytical Chemistry & Technology, 2000. 4(6): p. 297-308.
386. Ewing, R.G., et al., A critical review of ion mobility spectrometry for the detection of explosives
and explosive related compounds. Talanta, 2001. 54(3): p. 515-529.
387. Bödeker, B., et al., Biomarker validation—room air variation during human breath investigations.
International Journal for Ion Mobility Spectrometry, 2010. 13(3): p. 177-184.
388. Verkouteren, J.R. and J.L. Staymates, Reliability of ion mobility spectrometry for qualitative
analysis of complex, multicomponent illicit drug samples. Forensic Science International, 2011.
206(1-3): p. 190-6.
389. Vautz, W. and J.I. Baumbach, Analysis of bio-processes using ion mobility spectrometry.
Engineering in Life Sciences, 2008. 8(1): p. 19-25.
142
Curriculum vitae
Curriculum vitae
Personal Data
Name: Christoph Halbfeld
Born: February 7th, 1988 in Moers, Germany
Nationality: German
Mobile: 0049 1520 4453659
Email: christoph.halbfeld@rwth-aachen.de
Education
2012-2017 Research assistant and doctoral candidate at the Institute of Applied
Microbiology of the RWTH Aachen University, Aachen, Germany
2012 Braunwald course: Biosystems Engineering Summer School Braunwald,
Switzerland
2010-2012 Master of Science in Biology at the RWTH Aachen University, Aachen,
Germany
2008-2011 Bachelor of Science in Biology at the RWTH Aachen University, Aachen,
Germany
2007 Abitur at the Anne-Frank-Gesamtschule Rheinkamp, Moers, Germany
Work Experience
2016 Research stay in the Zenobi Group at the Laboratory of Organic Chemistry at
the ETH Zürich, Switzerland
2013-2017 Research assistant and doctoral candidate at the Institute of Applied
Microbiology of the RWTH Aachen University, Aachen, Germany
2013 Research stay at B&S Analytik-GmbH Dortmund, Germany
Publications
Halbfeld, C.; Ebert, B.; Blank, L. Multi-capillary column-ion mobility spectrometry of volatile
metabolites emitted by Saccharomyces cerevisiae. Metabolites 2014, 4, 751-774.
Ebert, B.; Halbfeld, C.; Blank, L. Exploration and exploitation of the yeast volatilome. Current
Metabolomics 2017, 5, 102-118.
Oral Presentations
Halbfeld, C.; Ebert, E.; Blank, L. (14.04.2015) YeastScent – Volatile metabolites as quantitative
proxies for metabolic network operation of Saccharomyces cerevisiae. 28th VH-Yeast
Conference. Berlin, Germany
Halbfeld, C.; Ebert, E.; Blank, L. (30.07.2015) YeastScent – Volatile metabolites as quantitative
proxies for metabolic network operation of Saccharomyces cerevisiae. 24th Annual
ISIMS Conference. Cordoba, Spain
Halbfeld, C.; Ebert, E.; Blank, L. (23.09.2015) YeastScent – Volatile metabolites as quantitative
proxies for metabolic network operation of Saccharomyces cerevisiae. 6. Symposium
Metaboliten in Prozessabluft und Ausatemluft. Reutlingen, Germany
147
Curriculum vitae
Halbfeld, C.; Sippel, A.K.; Pollmann, E.; Ebert, E.; Quantz, M.; Zierow, J.; Baumbach, J.I.;
Blank, L. (25.04.2017) Investigation of the Crabtree effect using off-gas analysis. 30th
VH-Yeast Conference. Berlin, Germany
Poster presentations
Halbfeld, C.; Ebert, E.; Blank, L. (22.02.2016) YeastScent – Volatile metabolite measurements
for yeast fermentation control. Bioprocessing days 2016. Recklinghausen, Germany
(Poster award)
Halbfeld, C.; Ebert, B.; Martinez-Lozano Sinues, P.; Blank, L. (20.02.2017) Discovering
dynamics of volatile metabolites in yeast fermentations using SESI-Orbitrap-MS.
Bioprocessing days 2017. Recklinghausen, Germany
148