Вы находитесь на странице: 1из 290

I N I C I AT I VA

INOVA 2017
TALENTOS
RELATOS DE UMA GERAÇÃO DE INOVADORES

APOIO REALIZAÇÃO
INOVA TALENTOS:
RELATOS DE UMA GERAÇÃO DE INOVADORES
CONFEDERAÇÃO NACIONAL DA INDÚSTRIA – CNI apoio técnico na organização da publicação :
ROBSON BRAGA DE ANDRADE
Presidente INSTITUTO EUVALDO LODI
NÚCLEO REGIONAL ALAGOAS - IEL/AL
DIRETORIA DE EDUCAÇÃO E TECNOLOGIA - DIRET
R A FA E L E S M E R A L D O LU CC H E S I R A M ACC I OT T I INSTITUTO EUVALDO LODI
Diretor de Educação e Tecnologia NÚCLEO REGIONAL DISTRITO FEDERAL - IEL/DF

SERVIÇO SOCIAL DA INDÚSTRIA - SESI INSTITUTO EUVALDO LODI


JOÃO HENRIQUE DE ALMEIDA SOUZA NÚCLEO REGIONAL MARANHÃO - IEL/MA
Presidente do Conselho Nacional
INSTITUTO EUVALDO LODI
SESI – DEPARTAMENTO NACIONAL NÚCLEO REGIONAL MINAS GERAIS - IEL/MG
R A FA E L E S M E R A L D O LU CC H E S I R A M ACC I OT T I
Diretor-Superintendente INSTITUTO EUVALDO LODI
NÚCLEO REGIONAL PARANÁ - IEL/PR
M A R C O S TA D E U D E S I Q U E I R A
Diretor de Operações INSTITUTO EUVALDO LODI
NÚCLEO REGIONAL RIO DE JANEIRO - IEL/RJ
SERVIÇO NACIONAL DE APRENDIZAGEM INDUSTRIAL - SENAI
ROBSON BRAGA DE ANDRADE INSTITUTO EUVALDO LODI
Presidente do Conselho Nacional NÚCLEO REGIONAL RIO GRANDE DO SUL - IEL/RS
SENAI – DEPARTAMENTO NACIONAL INSTITUTO EUVALDO LODI
ROBSON BRAGA DE ANDRADE SÃO PAULO - IEL/SP
Diretor
R A FA E L E S M E R A L D O LU CC H E S I R A M ACC I OT T I
Diretor Geral
J U L I O S E R G I O D E M AYA P E D R O S A M O R E I R A
Diretor Adjunto
G U S TAV O L E A L S A L E S F I L H O
Diretor de Operações

INSTITUTO EUVALDO LODI – IEL


ROBSON BRAGA DE ANDRADE
Presidente do Conselho Superior

IEL – NÚCLEO CENTRAL


PA U L O A F O N S O F E R R E I R A
Diretor-Geral
PA U L O M Ó L J Ú N I O R
Superintendente
INOVA TALENTOS:
RELATOS DE UMA GERAÇÃO DE INOVADORES

BRASÍLIA
2017
© 2017. IEL – Núcleo Central
Qualquer parte desta obra poderá ser reproduzida, desde que citada a fonte.

IEL/NC
Diretoria de Inovação - DI

FICHA CATALOGRÁFICA

I59g

Instituto Euvaldo Lodi. Núcleo Central.


Inova talentos : relatos de uma geração de inovadores / Instituto Euvaldo Lodi. -- Brasília :
IEL/NC, 2017.
290 p. il.

1. Inovação 2. Relatos I. Título


CDU 005.591.6

IEL
Instituto Euvaldo Lodi – IEL
Núcleo Central

SEDE
Setor Bancário Norte
Quadra 1 – Bloco C
Edifício Roberto Simonsen
70040-903 – Brasília – DF
Tel.: (61) 3317-9001
Fax: (61) 3317-9190

http://www.portaldaindustria.com.br/iel/

Serviço de Atendimento ao Cliente - SAC


Tels.: (61) 3317-9989 / 3317-9992
sac@cni.org.br
O Instituto Euvaldo Lodi Núcleo Central (IEL/NC) agradece ao
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq),
ao Ministério da Ciência, Tecnologia, Inovações e Comunicações (MCTIC),
às empresas participantes e aos Núcleos Regionais do IEL, localizados
nos estados de Alagoas, Maranhão, Minas Gerais, Paraná, Rio de Janeiro, Rio
Grande do Sul e São Paulo, pelas contribuições que originaram esta publicação.
SUMÁRIO
10 APRESENTAÇÃO

13 01_ALINE DA SILVA SAMPAIO

47 02_JULIANA MARQUES BICALHO

57 03_LUCAS CAMPOS SILVA

89 04_FRANCIELLY APARECIDA FERREIRA DA SILVA

105 05_GUSTAVO SANTOS LOPES

135 06_ALESSANDRO WITCZAK

155 07_JAIRO VINÍCIUS LAVARDA

183 08_TITO FRANCISCO IANDA

207 09_ANA PAULA PERES DO NASCIMENTO

223 10_JULLEANE LUNARDI

249 11_DANIEL CANELLO PIRES

267 12_ ÁBIAS DE OLIVEIRA COSTA

281 13_MILENA ALVES


INOVA
TALENTOS
RELATOS DE UMA GERAÇÃO DE INOVADORES
O que existe em comum entre uma caixa térmica
sustentável, feita para o transporte de produtos
termossensíveis, e um produto capaz de remo-
ver a lipemia de amostras de soros caninos e
felinos? Quais as similaridades entre um equipa-
mento capaz de recuperar ouro nas placas de cir-
cuito impresso e um simulador computacional,
criado para melhorar o sistema pneumático de
ônibus urbanos e rodoviários? Como estabelecer
conexões entre a fabricação de suplementos ali-
mentares com baixo teor de lactose e o desenvol-
vimento de métodos laboratoriais mais baratos e
eficazes para a detecção da Salmonela?
O elo entre esses processos é o vínculo com
a inovação, que constitui a força-motriz da com-
petitividade de uma empresa e de um país. As 14
experiências exitosas listadas nesta publicação,
intitulada Inova Talentos: relatos de uma geração
de inovadores, se deram sob a égide da inovação.
Todos os trabalhos se baseiam na certeza de que
a tecnologia é a ferramenta estratégica capaz de
permitir às companhias competir, crescer, criar
produtos e se consolidar.
O novo cenário econômico exige uma política
industrial sustentável, razão pela qual não have-
rá condições para a retomada do crescimento
sem que se dê a devida relevância à inovação.

10
Para fazer parte do jogo da globalização, é pre- de uma aposta vencedora. A coletânea engloba
ciso melhorar a competitividade, acabar com 10 textos na versão impressa e 13 na versão di-
entraves burocráticos e eliminar barreiras tecno- gital, escritos por alguns dos profissionais que
lógicas. É necessário, também, adotar medidas passaram pelo programa. Neles, os bolsistas
de flexibilização e adequação às mudanças de descrevem como elaboraram projetos pionei-
comportamento do consumidor, além de acom- ros, solucionaram desafios, criaram produtos e
panhar as inovações e aproveitá-las, produzindo contribuíram, decisivamente, para a melhora da
itens de melhor qualidade por preços menores. competitividade da indústria brasileira.
A partir dessa convicção – em consonância Além de mostrar resultados em diversas áre-
com as iniciativas pioneiras da Mobilização Em- as do conhecimento, num reflexo da versatilida-
presarial pela Inovação (MEI) –, o Instituto Eu- de e do alcance do programa, o INOVA Talentos
valdo Lodi (IEL), em parceria com o Conselho é o testemunho vivo da capacidade dos profissio-
Nacional de Desenvolvimento Científico e Tecno- nais e das empresas de adotarem práticas inova-
lógico (CNPq) e com o apoio do Ministério da doras. As experiências demonstram claramente
Ciência, Tecnologia, Inovações e Comunicações que o futuro da indústria brasileira está, mais do
(MCTIC), apresenta o Inova Talentos 2017. O pro- que nunca, na pauta da ciência, da tecnologia e
grama tem sido, desde 2013, uma valiosa ponte da inovação.
entre jovens talentos e empresas inovadoras. Ações de sucesso, como o INOVA Talentos,
Em apenas cinco anos de vigência, seleciona- reforçam não só a importância de se multiplica-
mos 1.340 bolsistas que atuaram ou atuam em rem esforços no fomento à pesquisa e ao desen-
820 projetos, em 713 empresas por todo o Brasil. volvimento, como também a necessidade de se
Foram mais de 150 mil horas de treinamentos, que construírem mais pontes entre academia e in-
propiciaram o conhecimento de novas técnicas e o dústria. Os ganhos certamente virão na forma de
aprimoramento de habilidades cruciais ao profis- um Brasil mais próspero e competitivo.
sional contemporâneo, que precisa saber trabalhar
em equipe, e gerenciar tarefas e pessoas. A série
de artigos aqui publicados evidencia o resultado Boa leitura.

robson braga de andrade paulo afonso ferreira mário neto borges


Presidente CNI Diretor Geral do IEL Presidente do CNPq

11
01
TECNOLOGIA PARA
ACONDICIONAMENTO E
TRANSPORTE DE PRODUTOS
TERMOSSENSÍVEIS
A LINE DA S ILVA S A M PA IO
_
Graduada em Engenharia Química
Mestre em Engenharia Química
Universidade Federal de Alagoas, Maceió - AL
_
Pós Graduanda MBA em Liderança para Inovação
Faculdade da Indústria (IEL), Maceió - AL

Mestre em Engenheira Química, formada pela Universidade


Federal de Alagoas e cursando atualmente MBA em liderança
para inovação, Aline Sampaio, atuou, no início da carreira, como
Supervisora do Controle de Qualidade no Grupo Carlos Lyra
(Unidade Marituba), ingressando posteriormente na empresa
Norvinco Indústria de Embalagem pelo programa RHAE TRAINEE
CNPq - IEL Inova Talentos. Na Norvinco, Aline é responsável
pelo desenvolvimento do projeto da caixa ecotérmica, sendo
atualmente responsável pela gestão de projetos de inovação em
cold chain e pesquisadora PD&I.

O autor agradece a todos da equipe Norvinco Indústria de


Embalagem Nordeste que ajudaram a desenvolver este projeto,
em especial ao diretor Jurg Hassenstein pela confiança.

linesampaio01@hotmail.com

Travessa Coronel Paranhos, 555/


Jacintinho, Maceió – AL
CEP: 57040-005

(82)99925-7364
(82)99150-8496

13
R E SU M O

PALAVRAS CHAVE resíduos sólidos; reciclagem; conservação térmica; sustentabilidade

Com o crescente aumento da produção mundial de resíduos sólidos e o impacto am-

biental provocado pelo descarte inadequado desses materiais, desenvolvemos uma cai-

xa térmica sustentável e inovadora, produzida a partir de materiais 100% recicláveis e

reciclados, dobrável, utilizada para o transporte de produtos termossensíveis. Graças a

essa solução em embalagens, pretendemos incentivar a reciclagem, reduzir os impactos

ambientais e diminuir – por ser dobrável – os custos logísticos e de armazenamento. A

caixa ecotérmica, produto com patente requerida, foi produzida com papelão ondulado

e isolante térmico, proveniente de garrafas pet recicladas,. Foram realizados testes em-

píricos na Norvinco, em laboratório e instituto de pesquisa de referência, que atestaram

sua eficiência térmica. Seu lançamento no mercado ocorreu na feira FCE Pharma, onde o

produto foi considerado destaque em inovação.

14 INOVA TALENTOS
01

A BSTR ACT

KEYWORDS solid residues; recycling; thermal conservation; sustainability

With the growing increase in the production of solid waste in the world and the environ-

mental impact caused by the inadequate disposal of these materials, we developed a pa-

ckaging solution, a sustainable and innovative thermal box, made from 100% recyclable

and recyclable materials, foldable, used for the transport of fearsome products. We aim to

encourage recycling, reduce environmental impacts, and by being collapsible, reduce logis-

tical and storage costs. The ecothermic box was produced with corrugated cardboard and

thermal insulation from recycled pet bottles, the patent product required. Empirical tests

were performed at Norvinco, laboratory and research institute reference that confirmed

its thermal efficiency. Its market launch was in the FCE Pharma fair, being a highlight in

innovation.

PROGRAMA RHAE TRAINEE CNPq – IEL 15


balagens, o que dificulta a destinação correta
INTRODUÇÃO e geram um grande volume de lixo.
O Isopor (marca registrada da Knauf Iso-

A
produção de resíduos sólidos urba- por Ltda), um dos materiais mais utilizados
nos vem aumentando a cada ano, nos últimos anos, vem trazendo grandes
em decorrência do aumento da pro- problemas, devido ao aumento do consumo
dução industrial e do consumo no mundo. e utilização crescentes.
Estima-se que a produção mundial de resí- Seu emprego mais difundido é como iso-
duos sólidos da população urbana seja em lante térmico – mais comumente como em-
torno de 2 bilhões de toneladas/ano (GIRAR- balagem térmica, disponibilizada aos usuá-
DI, 2017). A quantidade produzida no Brasil rios sob a forma de caixas, que servem para o
em 2015 totalizou 79,9 milhões de toneladas, transporte de produtos que necessitam de ma-
1,7% a mais do que no ano anterior. No mes- nutenção de temperatura e refrigeração, como,
mo período, foi registrado também aumento por exemplo, alimentos e medicamentos.
de 0,8% na produção per capita (ABRELPE, O poliestireno expandido (EPS), popular-
2015), resultado que coloca o Brasil como o mente conhecido como Isopor®, é um pro-
quarto maior gerador mundial de resíduos duto sintético derivado do petróleo, composto
(ABRELPE, 2015). por 98% de ar e 2% de matéria-prima, o polies-
A gestão de resíduos sólidos é, portan- tireno. No Brasil, o consumo do isopor, que
to, um desafio para as sociedades. Estima- representa cerca de 1,5% do total consumido
-se que 3 bilhões de pessoas (quase 50% no mundo pulou de 9 mil toneladas, em 1992,
da população mundial) não contam com a para aproximadamente 40 mil toneladas, nos
destinação final adequada dos resíduos. No últimos anos (FRANCESCHI, 2017).
Brasil, mais da metade das cidades, aproxi- O resíduo de isopor gerado vem trazendo
madamente 60% (3,3 mil municípios), ainda sérios problemas ao meio ambiente, devido
destina o lixo inadequadamente, para lixões ao seu descarte inadequado – normalmente
ou aterros controlados. acaba indo parar no lixo comum (poluindo
Entre os principais “vilões”, que contri- o meio ambiente) ou em aterros (ocupando
buem para a geração do grande volume de muito espaço), que estão saturados e pode-
resíduos, destacam-se as embalagens pre- riam ser destinados a rejeitos. Estima-se que
sentes em praticamente todos os produtos. o isopor (poliestireno expandido) leve cerca
O descarte passou a preocupar empresas e de 150 anos para ser totalmente degradado.
sociedade, diante do excesso de utilização, Com o passar do tempo, os resíduos
dificuldade de reaproveitamento e recicla- de isopor ao chegar no meio ambiente se
gem. Outra questão relevante diz respeito ao quebra, dando origem aos microplásticos,
material utilizado para produção dessas em- que absorvem compostos químicos tóxicos

16 INOVA TALENTOS
01

(AMBROSI, 2009). Por ser impermeável e ecotérmica) destinada ao transporte de pro-


de decomposição muito lenta, o produto dutos termossensíveis, capaz de atender aos
prejudica o solo e impede a penetração de requisitos de sustentabilidade e minimizar
água. Além disso, muitos animais marinhos os impactos causados ao meio ambiente pe-
confundem esses pequenos pedaços com las embalagens tradicionais, o que represen-
organismos marinhos e se alimentam deles. ta uma opção inovadora no mercado de pro-
Ainda que reciclável, o isopor não é con- dutos termossensíveis, por trazer soluções
siderado material rentável para a reciclagem, para os problemas de transporte.
é leve e ocupa muito espaço por causa do ar O objetivo principal do projeto foi o de-
(98% de ar), possuindo baixo preço de venda. senvolvimento de uma solução térmica, pro-
Também não é uma opção viável para catado- duzida com caixa de papelão ondulado e iso-
res e cooperativas, visto ser um produto de lamento térmico reciclável, para substituir as
baixa densidade, que ocupa muito volume e caixas térmicas tradicionais de isopor, redu-
demanda alto custo com transportes. zindo seu consumo e, consequentemente, o
Além das caixas tradicionais de isopor, descarte irregular e o alto impacto ambiental
existem no mercado diversos modelos de causado. Também se almeja o incremento
caixas térmicas que utilizam materiais como na demanda por embalagens sustentáveis
o polietileno e poliuretano, com alto custo e e ecológicas. Outra vantagem competitiva
difícil reciclagem. é que a caixa térmica será comercializada
Além dos danos ambientais causados e transportada dobrada (de forma plana),
pelo tipo de material, os fabricantes, consu- o que reduzindo em até 50% o volume de
midores e transportadoras enfrentam vários estocagem, permitindo o transporte e arma-
problemas quanto ao transporte e armazena- zenamento de uma maior quantidade de cai-
mento, principalmente com as de isopor que xas e, por conseguinte, a redução dos custos
são de uso mais comum. Estas exigem gran- logísticos e de combustível. Dessa forma,
des espaços para transporte e armazenamen- teremos um ganho ambiental, graças à di-
to, uma vez que, o produto é guardado na minuição da poluição atmosférica.
sua forma estrutural final, gerando aumento As caixas térmicas atuais são constituídas
no custo logístico. O transporte é o principal somente pelo isolamento térmico, como, por
elemento dos custos logísticos, correspon- exemplo, o poliestireno expandido (isopor),
dendo de um a dois terços do total referente que muitas vezes é superdimensionado para
à logística, e impacta diretamente no preço atender estruturalmente à acomodação de
do produto final (BALLOU, 2005). produtos, ocupando grandes volumes cúbi-
Com base nos problemas relatados, ob- cos no transporte, por não ser dobrável.
servou-se a oportunidade de desenvolvi- O projeto permitiu o desenvolvimento de
mento de uma embalagem térmica (caixa um produto inédito, que representa uma ino-

PROGRAMA RHAE TRAINEE CNPq – IEL 17


vação disruptiva, ao inserir no mercado um ao transporte e exportação de produtos que
produto versátil, com uma série de atributos necessitam de uma embalagem térmica.
(como por exemplo, o de ser 100% persona- Além de reforçar as parcerias estratégicas
lizável), que visa solucionar múltiplos proble- e o desenvolvimento de competências dos
mas na cadeia fria (cold chain) como reduzir os colaboradores, o projeto é uma rica fonte de
impactos causados ao meio ambiente. melhoria de desempenho para a organiza-
Diferentemente das caixas térmicas tradi- ção, uma vez que trabalha com a criatividade
cionais, a caixa ecotérmica não utiliza isolan- e impulsiona a inovação, engajando e mobi-
tes tradicionais, como poliestireno expandi- lizando os colaboradores em torno do tema
do e poliuretano. Foi desenvolvido um novo sustentabilidade, o que trará para a empresa
tipo de isolante 100 % reciclável, permitindo visibilidade nacional e internacional, capaz
a inserção no mercado de uma nova tecnolo- de garantir sua sustentabilidade.
gia em isolamento térmico. Estima-se o aumento de 30% de receita
A caixa ecotérmica se enquadra nos prin- – através da concessão de uso do direito de
cípios e objetivos da Política Nacional de propriedade intelectual a terceiros no seg-
Resíduos Sólidos (Lei 12.305/2010) e nos re- mento de papelão ondulado e isolamento
quisitos técnicos expressos no Guia para a térmico – e o crescimento interno de 20%,
qualificação de transporte dos produtos bio- resultante do maior volume de produção,
lógicos da Anvisa (GUIA Nº 02/2017 – Versão haja vista que a caixa ecotérmica permitirá o
02). O produto irá atender desde o mercado atendimento de um novo mercado, trazendo
de alimentos até o de produtos farmacêuticos solução inovadora em cold chain.
(mais exigente), podendo oferecer soluções A Norvinco é uma empresa de desenvolvi-
completas, como etiquetas indicadoras de mento de solução em embalagens, a partir do
temperatura e opções de elementos refrige- papelão ondulado, com design sustentável e
rantes (gelos). funcionalidade. Tem como visão crescer com
Com a introdução do resultado do proje- inovação, design, sustentabilidade, eficiência
to, a empresa pretende aumentar em cerca operacional e um modelo de negócio inova-
de 20% a receita oriunda da produção, além dor, investindo na conquista e fidelização de
de ter a possibilidade de gerar outras recei- novos segmentos de clientes.
tas provenientes das vendas ou cessão, de
direito de uso. Estima-se a expansão das ati-
vidades, o aumento de visibilidade da marca
Norvinco e o crescimento no resultado ope-
racional na ordem de 30%.
A proposta possui ainda alcance no mer-
cado nacional e internacional, no que tange

18 INOVA TALENTOS
01

OBJETIVOS

OBJETIVO GERAL

O projeto visa ao desenvolvimento de uma caixa térmica sustentável, produzida a partir de


materiais 100 % recicláveis, para substituição de embalagens de poliestireno expandido
(isopor) no transporte de produtos termossensíveis.

OBJETIVOS ESPECÍFICOS

ԎԎ Desenvolver solução de embalagem térmica em papelão ondulado, com isolamento


térmico 100 % reciclável;

ԎԎ Desenvolver nova tecnologia em isolamento térmico;

ԎԎ Incentivar a reciclagem e a diminuição dos resíduos sólidos descartados;

ԎԎ Reduzir os impactos ambientais;

ԎԎ Estimular campanhas de sensibilização para a reciclagem;

ԎԎ Valorizar o trabalho de catadores, sucateiros e cooperativas, melhorando assim o


ambiente social;

ԎԎ Aumentar a demanda por embalagens sustentáveis;

ԎԎ Reduzir custos logísticos no transporte de medicamentos e alimentos, nos mercados


nacional e internacional;

ԎԎ Inserir a Norvinco em novo mercado consumidor: o de transporte de produtos


termossensíveis, principalmente para a indústria farmacêutica.

ԎԎ Aumentar significativamente a produção e faturamento, mediante a expansão das


atividades;

ԎԎ Aumentar a visibilidade da marca Norvinco para os mercados nacional e internacional;

MÉTODO

A concepção inicial do projeto se deve às ideias do diretor-comercial da Norvinco, Jurg Has-


senstein, que sempre teve a preocupação em desenvolver processos e produtos mais susten-
táveis, como forma de proteção ao meio ambiente. O projeto, com a duração de aproximada-
mente três anos, pode ser dividido em dois momentos principais:
primeiro momento: Conceito inicial, pesquisa de isolante biodegradável e desenvolvimen-
to do primeiro modelo da caixa ecotérmica.

PROGRAMA RHAE TRAINEE CNPq – IEL 19


segundo momento: Revisão do conceito
e reformulação do projeto, revisão biblio-
DESENVOLVIMENTO
gráfica mais aprofundada, levantamento da
LEVANTAMENTO BIBLIOGRÁFICO
produção de resíduos sólidos no Brasil e no
E DESENVOLVIMENTO DO
mundo, adequação do produto às normas e
ISOLANTE TÉRMICO;
legislações existentes, desenvolvimento de
nova tecnologia em isolamento térmico, re-
O principal desafio foi desenvolver um iso-
estruturação do modelo da caixa, testes, de-
lante térmico que atendesse às necessidades
finição do processo produtivo, inserção no
do projeto e do meio ambiente, obedecendo
mercado, participação em eventos técnicos
às normas da legislação vigente. A ideia ini-
e responsabilidade técnica do produto. De
cial era produzir uma caixa ecologicamente
forma geral, o desenvolvimento da caixa eco-
correta, constituída por materiais recicláveis
térmica estruturou-se nas seguintes etapas:
e/ou biodegradáveis. O material isolante se-
1 - Levantamento bibliográfico e ria proveniente de fontes renováveis.
desenvolvimento do isolante térmico; Realizou-se pesquisas bibliográficas em
artigos científicos e patentes, para levanta-
2 - Definição do modelo
mento de materiais sustentáveis e biodegra-
da caixa térmica;
dáveis, como fonte de matéria-prima para
3 - Montagem dos
fabricação do isolante térmico. Com base
protótipos e mockups;
nas informações presentes na literatura cien-
4 - Testes empíricos na Norvinco; tífica, os materiais selecionados foram fibra
de coco (figura 1) (SILVA, 2012) e amido
5 - Teste/ qualificação
de mandioca (MARENGO; VERCELHEZE;
em laboratório de referência
MALO, 2013).
6 - Testes de avaliação das
propriedades térmicas
em Instituto de pesquisa;

7 - Desenvolvimento
da marca Caixa Ecotérmica;

8 - Lançamento do produto, na Feira


Internacional de Tecnologia para a
Indústria farmacêutica (FCE Pharma
2017).

FIGURA 1: Placas de fibra de coco.


Fonte: Autor, 2016.

20 INOVA TALENTOS
01

Após um aprofundamento nas pesqui-


sas, foram observados problemas que invia-
bilizaram o uso de tais materiais:

ԎԎ Processo produtivo do isolante térmico oneroso


e tecnologicamente complicado,
para ser executado nacionalmente em
escala industrial;

ԎԎ Exigência de desenvolvimento de equipamentos FIGURA 2: Placas de poliuretano, obtidas


a partir do poliol proveniente do óleo da mamona.
e máquinas especiais Fonte: Autor, 2017.

para o processo produtivo;

ԎԎ Materiais requerem tratamento químico prévio


das fibras, o que resultaria em aumento do
custo do produto final e impacto ambiental
a) definir espessura e densidade do material iso-
(FLORENTINO, 2011).
lante; b) verificar a viabilidade desse material
ԎԎ Isolante térmico suscetível à absorção de (térmico, compressão, tração, entre outros); c)
umidade, o que reduzindo o isolamento térmico. avaliar o tempo de biodegradabilidade; d) com-
provar a eficácia da embalagem térmica; e e)
Como alternativa cogitou-se a utilização avaliar os custos do processo produtivo.
do poliuretano, comercialmente utilizado Seria, portanto, necessário o desenvol-
como isolante térmico. Ao longo das pesqui- vimento de uma formulação que produzisse
sas, descobriu-se a existência de poliuretano um material com uma composição ideal, ou
produzido com o poliol, proveniente do óleo seja, nas propriedades necessárias de coefi-
da mamona, substância que, além de apre- ciente térmico, espessura, densidade e bio-
sentar as características de isolamento dos degradabilidade, etapa que seria realizada
poliuretanos tradicionais, é proveniente de por institutos de pesquisas como: Instituto
fonte renovável (ROCHA, 2013). Nacional de Tecnologia (INT), ISI Polímeros
O poliol à base de óleo natural de mamo- e Senai/Cimatec.
na substitui as matérias-primas de origem Após uma análise criteriosa, percebeu-se
petroquímica (SILVA, 2003). É uma espuma que o desenvolvimento do poliuretano seria
rígida que garantiria a estabilidade da tem- extremamente oneroso, com tempo de con-
peratura no transporte de produtos, sendo clusão demasiadamente longo (por volta
completamente biodegradável (figura 2). de um ano e meio), não incluindo sequer a
Para utilização do poliuretano, faziam-se etapa de inserção do produto no mercado.
necessários testes para: Também existiriam os seguintes problemas:

PROGRAMA RHAE TRAINEE CNPq – IEL 21


ԎԎ Custo adicional relativo à etapa de não há conhecimento suficiente sobre a
desenvolvimento: Revertido no preço do eficiência do material nas condições oferecidas
produto final, o que possivelmente tornaria a nos lixões e mesmo em aterros sanitários.
caixa comercialmente não competitiva frente Além disso, as condições oferecidas por lixões
às caixas de isopor. e aterros propiciam uma biodegradação
anaeróbica, fazendo com que haja liberação
ԎԎ Poliuretano de óleo de mamona não poderia
do gás metano (em vez do CO2, gerado
ser desenvolvido pela Norvinco durante o
durante a biodegradação aeróbica). Sabe-
processo produtivo, pois a empresa não possui
se que o gás metano contribui cerca de 20
instalações, máquinas e equipamentos para
vezes mais para o efeito estufa que o CO2
isso. Seria necessário comprar o isolante
(ECYCLE, 2017). O processo libera gás
de algum fornecedor e ceder o direito de
metano proporcionalmente à velocidade de
produção, quando o ideal seria que a produção
degradação, ou seja, quanto mais rápido o
fosse realizada diretamente pela empresa.
produto se decompõe, mais gás ele libera no
ԎԎ Os plásticos biodegradáveis apresentam
ar (RICCHINI, 2017), sendo que o processo
as seguintes vantagens: não são
pode levar muito tempo para reabsorção pela
fabricados a partir do petróleo e sim de
natureza. A biodegradação e compostagem
fontes renováveis, sua decomposição
ocorrem idealmente, quando realizadas em
completa é bem mais rápida (desde que
usinas de compostagem e aterros sanitários,
respeitadas características de temperatura
onde existem as condições adequadas.
do ambiente e microrganismos) que os
ԎԎ Materiais biodegradáveis foram desenvolvidos
polímeros convencionais, contribuem para
para serem decompostos em aterros
a redução do volume resíduos sólidos,
sanitários, o que reduz rapidamente o volume
etc. (BRITO, 2011). Para o processo
dos resíduos sólidos. O gás proveniente da
de biodegradação e compostagem do
decomposição pode ser utilizado para gerar
material plástico é necessário ter condições
calor e energia, impactando menos o meio
específicas de temperatura, umidade, luz
ambiente. Infelizmente, a utilização de
e microorganismos suficientes para que a
aterros sanitários no Brasil como única forma
degradação do material ocorra, se não houver
única de descarte ainda é uma realidade
um grande cuidado no manejo, pode tornar-
distante. Conforme estudo realizado pela
se pior do que o plástico convencional no
Abrelpe (2015), publicado pela revista ÉPOCA
meio ambiente (BRITO, 2011).
(CALIXTO, 2015) em 2014, cerca de 41,6%
ԎԎ Afora esse problema, sua decomposição em
dos resíduos produzidos no país foram parar
lixões a céu aberto (destino mais comum do
em lixões ou em aterros controlados (meio
lixo aqui no Brasil) ainda é duvidosa, porque
termo entre os lixões e os aterros sanitários),

22 INOVA TALENTOS
01

ԎԎ Utilizando o poliuretano, produziríamos um Essa conclusão foi reforçada e embasada


material para ser descartado, propiciando através da participação no evento realizado
economia linear (ver figura 3), o que traria pelo CETEA (Centro de Tecnologia em Em-
aumento nos resíduos sólidos. O ideal para balagem) em Campinas - SP, que tratou do
a preservação do meio ambiente é utilizar perfil ambiental de produtos e embalagens,
um isolante térmico proveniente de material ressaltando a importância da reutilização e
reciclável (economia circular, figura 4), reciclagem de resíduos sólidos como alter-
retirando da natureza um resíduo que será nativa de proteção ao meio ambiente, em
reutilizado, diminuindo assim, a quantidade consonância com os itens previstos expres-
descartada e a utilização de matéria-prima samente na Política Nacional de Resíduos
virgem (ECYCLE, 2017). sólidos (Lei 12.305/2010).

ECONOMIA LINEAR

RECURSOS EXTRAÇÃO MANUFATURA DISPOSIÇÃO RESÍDUOS


NATURAIS FINAL

MISTURA DE MATERIAIS TÉCNICOS E BIOLÓGICOS


ENERGIA DE FONTES FINITAS FIGURA 3: Modelo
de economia linear.
Fonte: ECONOMIA
LINEAR, 2017.

ECONOMIA
CIRCULAR
M
AN
EM

UF

RECURSOS
LAG

AT
URA
RE CI C

RESÍDUOS FIGURA 4: Modelo


de economia circular.
C O NS U M O Fonte: ECONOMIA
CIRCULAR, 2016.

PROGRAMA RHAE TRAINEE CNPq – IEL 23


ԎԎ Outro ponto negativo diz respeito à tro material que fosse mais facilmente obtido
combustão do poliuretano, na medida e que atendesse às premissas do projeto. Na
em que os gases gerados pela queima são atual realidade brasileira, produtos biodegra-
altamente tóxicos. Devido ao isocianato dáveis mostraram não ser a melhor solução
presente na composição, a combustão libera para a proteção do meio ambiente. O mais
gases letais como monóxido de carbono, importante é reduzir o consumo e dar prefe-
óxidos de nitrogênio e cianeto de hidrogênio rência a produtos reutilizáveis e recicláveis.
(RAMOS, 2015). Portanto, realizou-se a substituição do poliu-
retano obtido a partir do poliol proveniente
Avaliando as desvantagens apresentadas do óleo da mamona pela lã de poliéster (lã de
pelo poliuretano de óleo de mamona, obser- PET)(figura 5, abaixo).
vou-se a necessidade de substituição por ou- A lã de politereftalato de etileno ou poliés-

FIGURA 5: Isolante térmico lã de PET.


Fonte: TRISOFT, 2017.

24 INOVA TALENTOS
01

ter (PET) é desenvolvida a partir de garrafas ԎԎ Melhor custo x benefício, em comparação


plásticas recicladas, compostas por 100% de à utilização de poliuretano como isolante
poliéster, produto reciclado e 100% reciclável. térmico. O preço do m2 da lã de pet é 55
Além de ser ecologicamente correta e susten- % menor, em comparação ao poliuretano
tável, atende ao conceito de economia circu- comercial, o que reduz o preço final do
lar, em conformidade com o objetivo principal produto;
da Lei 12.305/2010, que instituiu a Política Na-
ԎԎ Isolante de fácil obtenção, não necessitando
cional de Resíduos Sólidos (PNRS) e que tem
de etapa de pesquisa;
como prioridades a redução do volume de re-
ԎԎ Material lavável, que permite a reutilização;
síduos gerados e a ampliação da reciclagem,
aliada a mecanismos de coleta seletiva, com a ԎԎ Existência de vários fornecedores;
inclusão social de catadores e a extinção dos
ԎԎ Possibilidade de manufatura tanto pela
lixões. Produzida por meio de processos sus-
Norvinco como por qualquer outra empresa
tentáveis, a lã de PET cuida da preservação do
do Brasil ou do exterior;
meio ambiente, ao retirar da natureza um ma-
ԎԎ Material já desenvolvido e utilizado como
terial que demoraria mais de 100 anos para
isolante acústico na construção civil
se decompor (ECOEFICIENTE, 2017).
Além desses benefícios, a lã possui van-
tagens de leveza, facilidade de manuseio, re- Para utilização da lã de PET como isolan-
dução de custos de transporte, fácil armaze- te térmico de embalagens, determinamos
nagem – pelo alto poder de compactação – e e especificamos novas propriedades como
alto índice de resiliência, que faz com que a espessura, densidade, coeficiente térmico e
manta volte a suas dimensões originais ime- resistência térmica, criando uma formulação
diatamente. Não solta fibras, não irrita a pele patenteada. Desenvolveu-se um produto
(não alérgica), não é cancerígena, não traz inovador e sustentável, caracterizando uma
risco à saúde e, por ser inerte, não prolifera inovação no campo de embalagem térmica.
fungos e bactérias, podendo ser utilizada em Após uma série de testes, foi possível identi-
contato com alimentos. ficar a melhor composição, que resultou na
Estima-se que, a cada 1.000 m² de lã de obtenção de um material com eficiência em
pet (espessura de 50 mm e densidade de10 isolamento térmico superior à do poliestire-
kg/m³), retiram-se da natureza aproximada- no expandido.
mente 17 mil garrafas PET (garrafas de água
500 ml - 15,5g cada) (ECOEFICIENTE, 2017).
Além dos benefícios descritos, a utiliza-
ção da lã de pet trouxe vantagens adicionais
para o projeto:

PROGRAMA RHAE TRAINEE CNPq – IEL 25


DEFINIÇÃO DO MODELO DA CAIXA ECOTÉRMICA E MONTAGEM DOS PROTÓTIPOS E MOCKUPS;

Incialmente, idealizou-se um modelo de caixa térmica composto por três partes: caixa de pape-
lão ondulado, isolante térmico e substrato, cuja estrutura era composta por um material isolan-
te (1) preso a um substrato; (2) acoplado a uma caixa dobrável; e (3) estruturado em papelão
ondulado, conforme pode ser observado na figura 6. Seriam produzidas caixas nos tamanhos
de 3, 5, 12 e 24 litros.

revestimento
interno
2

isolante
térmico

FIGURA 6:
Caixa ecotérmica – composição.
Fonte: Autor, 2015.

caixa de
papelão
ondulado

FIGURA 7: FIGURA 8:
Caixa térmica – visão da caixa montada. Caixa térmica, modelo atual – composição.
Fonte: Autor, 2015. Fonte: Autor, 2016.

26 INOVA TALENTOS
01

Após uma análise critíca, o modelo pas- Como solução, as placas de isolantes são
sou por uma revisão. O novo modelo é com- soltas e não existe mais o substrato, o que
posto também por três partes: caixa de pa- tornou simples a montagem e desmonta-
pelão ondulado, isolante térmico em placas gem da caixa em qualquer tamanho. Tam-
segmentadas e revestimento interno, como bém com a utilização do substrato, qual-
observado na figura 8. quer tipo de perfuração poderia acarretar a
Nesse modelo, foram mantidas as princi- perda da caixa térmica, devido à passagem
pais características e preservado o conceito da umidade para a caixa de papelão, dani-
de desmontável e reciclável. A caixa de pape- ficando-a e reduzindo a eficiência térmica.
lão ondulado continuou planificada, sendo Utilizando o revestimento interno, esse risco
transportada desmontada, reduzindo assim é eliminado, pois, caso ocorra algum dano
a cubagem, volume de estoque, além de per- ao revestimento interno — mais resisten-
mitir o transporte de uma maior quantidade, te que o substrato — a umidade fica retida
o que diminui o custo logístico e o impacto no isolante, dificultando assim a passagem
ambiental. Possui fácil montagem e é produ- para a parte de papelão, caso em que o iso-
zida com materiais leves e recicláveis. lante servirá como segunda proteção. Além
A caixa de papelão ondulado, confeccio- disso, sem o substrato, é possível realizar
nada em papelão pardo e branco, poderá ter uma completa higienização da caixa térmi-
tratamento hidrorrepelente tornando-a imper- ca, pois as placas podem ser lavadas e secas
meável, resistente à umidade na capa interna separadamente, impedindo, dessa forma, a
e/ou externa e miolo. Será constituída de peça proliferação de microrganismos.
única, reduzindo a utilização de máquinas no O modelo atual requer ainda uma menor
processo e custos produtivos, além de gerar quantidade de papelão. Existe uma trava na
redução de preço do produto final. caixa, que aumenta a segurança, evitando a
O modelo atual vem com a propos- abertura de forma indesejada. Com a retira-
ta de tornar ainda mais fácil o manuseio e da do substrato, foram eliminadas etapas do
a montagem da caixa. No antigo, existia a processo produtivo, máquinas e quantidade
utilização do substrato, que servia para re- de material, reduzindo custo de processo.
ter a umidade onde as placas de poliuretano Definidas as alterações, foram construí-
seriam fixadas. No entanto, para tamanhos dos protótipos e mockpus nos tamanhos de 5,
maiores (por exemplo, 12, 24 e 48 l) esse ele- 14, 21 e 44 l, conforme observado nas figuras
mento dificultava a montagem e desmonta- 9, 10, 11 e 12. Os tamanhos foram definidos
gem, sendo necessária a utilização de mais após levantamento de mercado, que mostrou
de uma pessoa para fazê-lo. quais os tamanhos mais consumidos.

PROGRAMA RHAE TRAINEE CNPq – IEL 27


FIGURA 9:
Mockup caixa
térmica de 5 L.
Fonte: Autor, 2017.

FIGURA 10:
Mockup caixa
térmica de 14 L.
Fonte: Autor, 2017.

FIGURA 11:
Mockup caixa
térmica de 21 L.
Fonte: Autor, 2017.

28 INOVA TALENTOS
01

FIGURA 12:
Mockup caixa
térmica de 44 L.
Fonte: Autor, 2017.

A caixa térmica, transportada de forma plana, possui uma estrutura dobrável, montada no
ambiente do usuário, reduzindo o volume para transporte e armazenamento. A forma final do
produto, destinada à venda e distribuição, pode ser vista na figura 13, bem como a lâmina com
instrução de montagem e descarte.

FIGURA 13:
Caixa térmica
de 22 L
Fonte: Autor, 2017.

PROGRAMA RHAE TRAINEE CNPq – IEL 29


TESTES EMPÍRICOS NA NORVINCO
De posse dos mockups, iniciaram-se os testes de desempenho das caixas térmicas, em com-
paração com as caixas de isopor de mesmo volume. Esses testes foram realizados de forma
empírica na Norvinco, pois precisávamos de uma forma simples e barata, não só para definir
a melhor configuração a ser testada em laboratório de referência, como também para testar a
influência de cada elemento (tipo de papelão, espessura e densidade da lã de PET) no desem-
penho da caixa, em comparação com a de isopor dos fabricantes Isoplast e Fricalor.
Os testes foram realizados com garrafas de 500 mL, 1000 mL de água e uma proveta para
medição de volume. Os testes foram realizados da seguinte forma:

1 - Garrafas de água de 500 mL e de 1000 mL foram congeladas em um freezer, a uma


temperatura de -20°C por 48 horas;

2 - As garrafas foram colocadas na caixa ecotérmica e na de isopor, na mesma


quantidade e distribuição. A temperatura externa, interna e a umidade foram medidas;

3 - As caixas permaneceram fechadas por um período de 24 e 48 horas. Após esse


período foram abertas, e o volume de água proveniente do degelo das garrafas foi
medido, mediante a utilização de uma proveta,

4 - Os volumes de água foram comparados para avaliar o desempenho das caixas

FIGURA 14:
Teste de
desempenho da
caixa térmica em
comparação a de
isopor de 5 L.

Fonte: Autor, 2017.

30 INOVA TALENTOS
01

FIGURA 15:
Teste de
desempenho da
caixa térmica em
comparação à de
isopor de 14 L.

Fonte: Autor, 2017.

FIGURA 16:
Teste de
desempenho da
caixa ecotérmica em
comparação à de
EPS de 22 L.

Fonte: Autor, 2017.

FIGURA 17:
Teste de
desempenho da
caixa térmica em
comparação à de
isopor de 44 L.

Fonte: Autor, 2017.

PROGRAMA RHAE TRAINEE CNPq – IEL 31


Foram realizados testes para avaliar o A caixa térmica apresentou um desempe-
tipo de papelão, espessura, densidade e fa- nho superior. A tabela 2,à direita, mostra o
bricante da lã de PET, quanto ao desempe- percentual de eficiência, superior à do isopor.
nho da caixa térmica (ver tabela 1). A avalia- Observa-se que, além de produzir um produ-
ção de cada fornecedor foi necessária, para to com propriedades e desempenho térmico
avaliarmos qualidade da formulação, custo semelhantes ao do isopor, foi possível ainda
do material produzido e impacto no custo obter uma eficiência superior às caixas térmi-
do produto final. As informações técnicas da cas tradicionais utilizadas no mercado.
lã de PET e do papelão ondulado não serão
divulgadas, devido ao sigilo necessário ao
RESULTADOS E DISCUSSÕES
sucesso do projeto.

Graças aos testes empíricos, foi possível de-


PAPELÃO ONDULADO
finir o modelo e a melhor especificação técni-
Tipo de Onda B, C e BC
ca dos elementos que compõem a caixa, ob-
tendo-se a melhor configuração em termos
LÃ DE PET de eficiência térmica e custo.
Espessura 15, 20 e 30 mm
Da forma como foi estruturada, cons-
Fabricantes 1, 2 e 3
truímos um sistema de isolamento térmico
híbrido, composto por três elementos iso-
FABRICANTES CAIXA DE ISOPOR lantes: lã PET (isolante principal), papelão
Isoplast 5L ondulado e ar. O papelão possui também
Fricalor 14, 22 e 45 L propriedades de isolamento térmico, apre-
sentando baixo coeficiente de transferência
TABELA 1 - Informações testes. de calor (k = 0,07 W/m.K) (AMADEU, 2017),
Fonte: Autor, 2017.
além de permitir o acúmulo de ar em seu
interior, devido à espessura da onda tipo C.
Para cada configuração de caixa ecotérmi-
O ar, por sua vez, constitui também um bom
ca, foram realizadas três repetições. Avalian-
isolante térmico, por possuir baixa conduti-
do os resultados, verificou-se que a melhor
vidade térmica na ausência de convecção
configuração foi mediante a utilização de pa-
(k=0,026 W/m.K). Somados, o conjunto de
pelão onda C, com a espessura do isolante
papelão e ar presente no espaçamento da
variando de acordo com o tamanho da caixa,
onda aumentaram a eficiência térmica da
conforme observado na tabela 2. Na escolha
caixa térmica.
da melhor configuração, foi levada em consi-
O papelão ondulado é um material 100%
deração a que trouxe a melhor relação entre
reciclável, produzido a partir de fontes de ma-
custo/eficiência térmica.

32 INOVA TALENTOS
01

RESULTADOS DOS TESTES

TAMANHO ESPECIFICAÇÃO % EFICIÊNCIA

1º TESTE 2º TESTE 3º TESTE

5L Papelão: Onda C
Lã de PET: espessura = 15 mm. 1,8 1,9 3,1
Fabricante: 1

5L Papelão: Onda C
4,6 5,9 6,4
Lã de PET: espessura = 20 mm.
Fabricante: 1

5L Papelão: Onda C 13 5,4 9,3


Lã de PET: espessura = 20 mm.
Fabricante: 1

5L Papelão: Onda C 2,5 8,2 2,6


Lã de PET: espessura = 25 mm.
Fabricante: 1

TABELA 2 - Resultados dos testes.


Fonte: Autor, 2017.

térias-primas renováveis. Para a caixa térmica, testes/validação e confirmação da eficiência


será utilizado papelão ondulado proveniente térmica do produto, frente às caixas de iso-
de fornecedores detentores da certificação por. Os testes foram comparativos com as
FSC (Forest Stewardship Council), o que ga- caixas de isopor da Styrocorte (Knauf Isopor)
rante que a madeira utilizada para a produção de mesmo tamanho. Para sua execução, fo-
do papelão ondulado é oriunda de um proces- ram utilizados elementos refrigerantes, simu-
so produtivo sustentável, ecologicamente ade- lantes de medicamentos e dois dataloggers
quado, socialmente justo e economicamente por caixa, pertencentes ao Laboratório Vali-
viável, em conformidade com os mecanismos da. As caixas foram testadas na temperatura
regulatórios vigentes (SELO FSC, 2017). interna de 2° a 8°C, que é a temperatura de
Os mockups foram então enviados para o transporte para produto farmacêutico. Na fi-
laboratório de Ensaios Térmicos Valida do 1
gura 18, seguem as fotos dos testes.
grupo Polar Técnica, localizado em São Ber- Após aproximadamente 48 h, foram fei-
nardo do Campo (SP), para realização dos tas as leituras dos dataloggers, cujos resul-
tados compilados são mostrados na tabela
1  O laboratório Valida é especializado em ensaios térmi- 3 (ver próxima página). Enquanto a quarta e
cos, qualificação de embalagens e equipamentos, seguindo
os guias nacionais e internacionais. a quinta coluna da tabela se referem ao tipo

PROGRAMA RHAE TRAINEE CNPq – IEL 33


FIGURA 18 - Testes de eficiência térmica no laboratório Valida.
Fonte: Autor, 2017.

34 INOVA TALENTOS
01

de Ice Foam (elemento refrigerante da Polar produtos farmacêuticos, como vacinas.


Técnica) e a quantidade utilizada por caixa, a Essas caixas estão sendo testadas da
última coluna diz respeito à numeração de mesma forma que as anteriores, sendo que,
controle e rastreamento dos dataloggers. posteriormente, os dois projetos passarão
Por sua vez, a coluna 7 trata do tempo ne- pela qualificação do sistema de transporte
cessário para a temperatura interna da cai- (Qualificação de desenho, operação e de-
xa atingir 8 °C. (considera-se como a caixa sempenho) no perfil de temperatura verão e
mais eficiente aquela que levar mais tempo inverno conforme recomendação da Anvisa
para ultrapassar os 8°C). (Guia n° 02/2017 – versão 02).
Pode-se verificar que as caixas térmicas
de 5, 14 e 44 L tiveram desempenho térmico AVALIAÇÃO DAS PROPRIEDADES
semelhante ao das caixas de isopor da Styro- TÉRMICAS DA CAIXA NO INSTITUTO
corte. Apenas a caixa de 21 L teve um desem- DE PESQUISAS TECNOLÓGICAS (IPT)
penho inferior, em decorrência de o formato
da caixa ser mais horizontal (altura mais baixa Além dos testes de desempenho térmico,
e comprimento maior) que o da Styrocorte. foram realizados teste de caracterização das
Cumpre ressaltar que o formato horizon- propriedades térmicas da embalagem final,
tal possui uma péssima distribuição de tem- nos laboratórios de pesquisas do IPT em São
peratura interna, em decorrência de os ele- Paulo, a fim de comprovar sua eficiência tér-
mentos refrigerantes ficarem mais afastados mica, através da análise de suas proprieda-
do centro da caixa, aumentando a taxa de va- des físicas.
riação da temperatura da interna, reduzindo Foram realizados testes para determina-
o tempo de manutenção na temperatura de ção da condutividade térmica do isolante e
2° a 8°C e, consequentemente, baixando sua o coeficiente global de transmissão de calor.
eficiência térmica. Essa caixa foi substituída A condutividade do isolante lã de PET foi de
por outra de 21 L no formato vertical (altura k = 0,033 W/(m.K), comparando com a con-
maior, comprimento menor) e foi testada dutividade do poliestireno expandido (iso-
novamente, apresentando resultado similar por) que é de k=0,035 W/(m.K) (AUGUSTO,
às demais. Os resultados comprovaram a 2016), na temperatura de aproximadamente
eficiência térmica das caixas desenvolvidas. 24°C. Pôde-se comprovar que o material de-
Serão realizados novos testes para aumen- senvolvido realmente tem propriedades de
tar a eficiência para 48 h.Para atendimento isolamento térmico.
da cadeia fria de transporte de produtos A caixa Ecotérmica é constituída de um sis-
termossensíveis, está sendo desenvolvido tema híbrido de isolamento térmico (papelão
o projeto para 72 h, na temperatura de 2 a + ar + lã de PET), ou seja, existe mais de uma
8° C, considerada ideal para transporte de etapa de transferência de calor envolvida.

PROGRAMA RHAE TRAINEE CNPq – IEL 35


RESULTADOS COMPILADOS DOS TESTES NO LABORATÓRIO VALIDA.

MENOR
VOLUME FORNECEDOR QUANTIDADE TEMPO ATÉ 8°C
DATA DO TESTE ICE FOAM CARGA T < 2°C TEMPERATURA LOGGER
DA CAIXA DA CAIXA DE ICE FOAM (HORAS)
REGISTRADA

27.04.2017 05L Styrocorte IF-500 3 Máxima 33,5 1.4°C 1.4°C 287

33,0 1.6°C 1.6°C 604

27.04.2017 05L Norvinco IF-500 3 Máxima 34,5 1.0°C 1.0°C 359

35,0 -- 2.0°C 618

27.04.2017 12L Styrocorte IF-1050 3 Máxima 40,0 -- 4.8°C 588

39,0 -- 4.7°C 232

27.04.2017 14L Norvinco IF-1050 3 Máxima 38,5 -- 4.6°C 554

39,5 -- 3.8°C 294

27.04.2017 21L Styrocorte IF-1050 3 Máxima 32,5 -- 3.6°C 306

32,0 -- 2.9°C 494

27.04.2017 21L Norvinco IF-1050 3 Máxima 9,5 -- 6.7°C 575

19,0 -- 5.6°C 403

27.04.2017 44L Styrocorte IF-1050 5 Máxima 39,0 -- 3.2°C 564

44,0 -- 3.0°C 571

27.04.2017 44L Norvinco IF-1050 5 Máxima 41,0 -- 4.5°C 479

38,5 -- 4.2°C 638

Temperatura Mínima Externa 15.10°C


Temperatura Média Externa 21.82°C

Temperatura Máxima Externa 25.80°C

LOGGER EXTERNO 312

TABELA 3 - Testes de eficiência térmica no laboratório Valida.


Fonte: Laboratório Valida grupo Polar, 2017.

36 INOVA TALENTOS
01

Determinou-se o coeficiente global de transmissão de calor do conjunto, comparado às caixas de


poliestireno expandido (isopor), o que também foi determinado no mesmo ensaio. Esse ensaio
não foi realizado para a caixa de 21 L, devido ao resultado de eficiência térmica realizado na Polar
Técnica, que mostrou ser necessária uma readequação dimensional. Os resultados foram:

DETERMINAÇÃO DO COEFICIENTE GLOBAL DE TRANSMISSÃO DE CALOR.

VOLUME (L) COEFICIENTE GLOBAL DE TRANSFERÊNCIA DE CALOR MÉDIO (W/°C)

CAIXA ECOTÉRMICA CAIXA DE ISOPOR

5 0,268 0,358

14 0,501 0,568

41 0,762 0,899

TABELA 4 - Determinação do coeficiente global de transmissão de calor.


Fonte: Relatório de ensaios do IPT.

O coeficiente global de transmissão de calor para as caixas Ecotérmicas foi menor que as de
isopor. Quanto menor o coeficiente global de transmissão, melhor é o isolamento térmico da
caixa, ou seja, a caixa Ecotérmica apresenta um desempenho em isolamento térmico superior
ao das caixas tradicionais de isopor.

DESENVOLVIMENTO DA MARCA CAIXA ECOTÉRMICA


Finalizada a estrutura da caixa térmica e comprovada sua eficiência, foi contratada a empresa
de publicidade M&C, para realização da pesquisa de mercado, criação da marca e identidade
visual. Na pesquisa, evidenciou-se o interesse do mercado pelo produto, principalmente a caixa
em papelão branco, considerada mais atrativa pelo mercado, por conter os principais atributos
que mais interessam os consumidores. De posse das informações da pesquisa, foi desenvolvi-
da a Caixa Ecotérmica – marca com patente requerida – e o infográfico, contendo os principais
benefícios da caixa (ver figuras 19 e 20).

PROGRAMA RHAE TRAINEE CNPq – IEL 37


FIGURA 19: Marca Caixa Ecotérmica.
Fonte: Norvinco, 2017.

FIGURA 20: Infográfico Caixa Ecotérmica.


Fonte: Norvinco, 2017.

38 INOVA TALENTOS
01

A caixa Ecotérmica é um lançamento que vai inovar o transporte e armazenamento de pro-


dutos termossensíveis. Por ser desmontável e possuir impressão e tamanho personalizáveis,
adapta-se às necessidades da empresa, diferentemente das caixas de plásticos e de poliesti-
reno. Dessa forma, facilita a logística, economiza recursos e dá maior credibilidade à marca,
impressa na caixa da forma como a empresa precisa (figura 21).

FIGURA 21: Caixa Ecotérmica.


Fonte: Autor, 2017

PROGRAMA RHAE TRAINEE CNPq – IEL 39


A caixa Ecotérmica foi desenvolvida para LANÇAMENTO DA CAIXA ECOTÉRMICA
ser uma solução comercializável, com custo NA FEIRA INTERNACIONAL DE
e preço competitivos com os praticados no TECNOLOGIA PARA A INDÚSTRIA
mercado pelas embalagens tradicionais. Na FARMACÊUTICA (FCE PHARMA 2017).
tabela 4, são observados os preços das caixas
ecotérmicas, em comparação com as caixas
tradicionais de isopor. Pode-se observar que
os preços das caixas ecotérmicas são próxi-
mos e comercialmente competitivos com os
das caixas de isopor, existindo apenas dife-
rença mais acentuada na caixa de 5 L.
Essa diferença pode ser considerada acei-
tável, em especial devido aos benefícios e
atributos oferecidos pela caixa ecotérmica,
Fonte: Evento FCE Pharma, 2017.
como, por exemplo, ser desmontável e pos-
suir um volume de cubagem 40% menor, o
que irá reduzir significativamente os custos Para lançamento da caixa Ecotérmica, foi
com transporte. Estamos trabalhando para a escolhida a FCE Pharma 2017, Feira Interna-
redução ainda maior dos custos – e, conse- cional de Tecnologia para a Indústria Farma-
quentemente de preços –, de forma torná-la cêutica, que ocorreu entre os dias 23 a 25 de
ainda mais comercial. maio de 2017, em São Paulo. A FCE Pharma
é a feira mais importante do setor farmacêu-
tico realizada na América Latina, com papel
COMPARAÇÃO PREÇO CAIXA
ECOTÉRMICA VERSUS CAIXA DE ISOPOR. importante para a evolução do setor, não só
por meio do lançamento de tendências, em-
Preço Unitário Preço Unitário balagens, produtos e serviços, como também
VOLUME (L) CAIXA ECOTÉRMICA CAIXA DE ISOPOR
(R$) (R$)* pela exposição de cases, compartilhamento
5 de conteúdos e experiências nas conferências
9,17 6,44
e palestras.
14 15,47 15,00 A Norvinco foi destaque, por trazer uma
21 25,44 17,00 das principais inovações para o segmento de
41 logística e armazenamento de produtos ter-
45,00 43,68
mossensíveis. A caixa foi um sucesso, tendo
TABELA 5 - Comparação preço uma grande aceitação do mercado. Vários
Caixa Ecotérmica versus caixa de isopor. negócios foram engatilhados com inúmeros
1. Cotação na mesma condição comercial e impostos.
2. Fonte: Cotação empresa Isopor. laboratórios de grande porte e distribuidores.

40 INOVA TALENTOS
01

FIGURA 22 - LANÇAMENTO CAIXA ECOTÉRMICA – FCE PHARMA.


Fonte: Autor, 2017.

PROGRAMA RHAE TRAINEE CNPq – IEL 41


ser desmontável e possuir sistema de trava,
CONSIDERAÇÕES FINAIS que garante a segurança durante o transporte.
Graças a esse projeto, foi possível desen-
A caixa ecotérmica atende ao público que bus- volver uma nova tecnologia em isolante, a par-
ca uma solução confiável e sustentável para tir da reciclagem de resíduos sólidos, contri-
o armazenamento e transporte de produtos buindo assim, para a utilização de processos
que necessitem de controle de temperatura. e produtos sustentáveis na sociedade.
O projeto nos autorrealiza, devido à dimi- O desenvolvimento deste produto permi-
nuição dos impactos ambientais e inovação tiu a inserção da Norvinco em outro mercado
envolvidos no processo. A caixa de papelão consumidor que terá abrangência nacional e
ondulado com isolamento térmico foi pen- internacional, aumentando significativamen-
sada desde a concepção de forma, funciona- te a produção e o faturamento da empresa.
lidade até a necessidade ambiental, em con- A caixa Ecotérmica gerou vários pedidos
sonância com a demanda cada vez maior de de patentes, contribuindo para o desenvol-
produtos e meios produtivos, que reduzam vimento científico do País e estimulando a
os impactos causados ao meio ambiente. inovação:
A solução inovadora oferece ao mercado
uma embalagem térmica 100 % reciclável, ԎԎ Pedido de invenção do modelo utilidade da
reduzindo os impactos ambientais e garan- embalagem: BR 1020160303400;
tindo as propriedades térmicas exigidas. O
ԎԎ Registro de desenho industrial: BR
produto deverá atender à produção em es-
3020170024122;
cala local, regional, nacional e internacional,
ԎԎ Registro marca Ecotérmica: 912789751.
com a vantagem competitiva de poder ser
transportado e armazenado de forma plana,
o que traz ganhos econômicos e logísticos, Agradecemos o apoio do CNPq, através
devido ao melhor aproveitamento da cuba- do programa Inova Talentos e do recurso fi-
gem dos transportes, redução do consumo nanceiro do InovaCred da Finep, que contri-
de combustível e menor emissão de poluen- bui diretamente com a inovação no país.
tes na atmosfera. A inovação é um dos principais fatores de
Através dos resultados dos ensaios de desenvolvimento econômico e crescimento
caracterização realizados, comprovou-se sua sustentável das empresas, é a força-motriz
eficiência térmica e sua superioridade frente para a competitividade e o estímulo para a
às caixas tradicionais de isopor, pois agrega sustentabilidade do País.
uma série de atributos que vão além do isola- O programa Inova Talentos torna possível
mento térmico – que é superior – tais como contar com profissionais qualificados, volta-
ser personalizável no tamanho e impressão, dos ao desenvolvimento da inovação nas em-

42 INOVA TALENTOS
01

presas, possibilitando a inserção de pesquisadores no desenvolvimento de projetos PD&I de


grande complexidade e aproximando a Universidade e instituições de pesquisas das empresas.
Contribui ainda para o desenvolvimento tecnológico do país e para a formação de profissionais
cada vez mais qualificados para atuar no mercado.

ECONOMIA LINEAR. Ex Change 4 Change Bra-


REFERÊNCIAS sil. Disponível em: http://e4cb.com.br/?page_
BIBLIOGRÁFICAS id=161&lang=pb. 2017. Acessado em: 20/03/2017.

ECONOMIA CIRCULAR. ACV Brasil. Disponível em:


ABRELPE. Atlas Brasileiro de Emissões de GEE e
<http://www.acvbrasil.com.br/noticia/economia-cir-
potencial energético. Disponível em: < http://www.
cular>. 2016. Acessado em: 12/12/17.
abrelpe.org.br/arquivos/atlas_portugues_2015.pdf>.
2015. Acessado em: 16/02/2017.
E CYCLE. Economia circular: o modelo que propõe
um reaproveitamento sistemático de tudo o que é
AMADEU, B. J. A. S. Transferência de calor em emba-
produzido. Disponível em: http://bit.ly/2fFBVNP.
lagens para resfriamento de frango: uma abordagem
2017. Acessado em: 14/01/2017.
computacional (Dissertação) – Programa de pós-gra-
duação em engenharia de alimentos, Universidade
E CYCLE. Vantagens e desvantagens do saco plás-
Estadual de Campinas, Campinas, 2017.
tico compostável para embalar o lixo. Disponível
em: http://bit.ly/2xWbUEJ. 2017. Acessado em:
AMBROSI, T. Logística reversa de embalagens de
isopor. Trabalho de conclusão de curso (monografia) 12/08/2017.

– Programa de pós-graduação em administração,


ECOEFICIENTES - Informação sobre técnicas para
Universidade Federal do Rio Grande do Sul, Porto
a Construção Sustentável. Disponível em: < http://
Alegre, 2009.
ecoeficientes.com.br/guia-de-empresas/isosoft-iso-
AUGUSTO, C. O.; BRAGANÇA, L.; ALMEIDA, M. lante-termoacustico/>.Acessado em: 15/07/2017.
Building insulation materials: Beyond operational
FLORENTINO, W. M.et al. Biocompósitos de Poliure-
energy. Revista Hábitat Sustentable. Vol. 6, N°. 2, p.
tano reforçados com Fibras de Coco Verde. Cadernos
30-39, 2016.
UniFOA, nº 16, 2011.
BALLOU, Ronald H. Gerenciamento da cadeia de
suprimentos: Planejamento, organização e logística FRANCESCHI, F. R. A. et al. Panorama dos resíduos
empresarial. Porto Alegre: Bookman, 2005. sólidos no Brasil: uma discussão sobre a evolução
dos dados no período 2003 – 2014. Revista DAE,
BRITO, G. F. et al. Biopolímeros, Polímeros Biodegra- 2017.
dáveis e Polímeros Verdes. Revista Eletrônica de Mate-
riais e Processos (REMAP), v. 6. 2, p. 127-139, 2011. GIRARDI, Giovana. Brasil produz lixo como primeiro
mundo, mas faz descarte como nações pobres.
CALIXTO, Bruno. Lixão que não acaba mais. Dis- Disponível em: < http://tccnasnormasdaabnt.com.
ponível em: https://glo.bo/2jP8H3y. Acessado em: br/referencias-bibliograficas-abnt- 2017/>. 2016.
23/05/2017. Acessado em: 10/07/2017.

PROGRAMA RHAE TRAINEE CNPq – IEL 43


SILVA, G. O.; JERÔNIMO, C. E. Estudo de alterna-
tivas para o aproveitamento de resíduos sólidos da
industrialização do coco. Monografias ambientais, v.
10, nº 10, p. 2193 – 2208, 2012.

MARENGO, V. A.; VERCELHEZE, A. E. S.; MALO, S.


Compósitos biodegradáveis de amido de mandioca
e resíduos da agroindústria. Química Nova, Vol. 36,
N°. 5, 680-685, 2013.

RICCHINI, R. O que é plástico biodegradável?.


Materiais biodegradáveis. Disponível em: < http://
www.setorreciclagem.com.br/materiais-biodegra-
daveis/o-que-e-plastico- biodegradavel/>. 2017.
Acessado em: 12/07/2017.

ROCHA, R. J. et al. Síntese de poliuretanos modifica-


dos por óleo de mamona empregados em materiais
energéticos. Química Nova, v. 36, Nº 6, p. 793-799,
2013.

RAMOS, S. A. R. Estudo de retardantes de chama,


isentos de halogéneos, em espumas de poliuretano
monocomponente. Estágio de natureza profissional
para obtenção do Grau de Mestre em Engenharia
Química (Dissertação) - Instituto Superior de Enge-
nharia de Lisboa, 2015.

SILVA, R. V. Compósito de resina poliuretano deriva-


da de óleo de mamona e fibras vegetais. Trabalho de
conclusão de curso (Tese) – Universidade Federal de
São Carlos, São Carlos, 2003.

SELO FSC. Disponível em: https://br.fsc.org/pt-br/


faq. Acessado em: 25/07/2017. TRISOFT. Disponível
em: < http://www.trisoft.com.br/>. Acessado em:
01/07/2017.

44 INOVA TALENTOS
01

PROGRAMA RHAE TRAINEE CNPq – IEL 45


02
DelipVET: REMOVEDOR DA
INTERFERÊNCIA PELA LIPEMIA
NOS EXAMES BIOQUÍMICOS DE CÃES E GATOS
JU L I A NA MA R Q U E S B I CA L H O
_
Bacharel em Medicina Veterinária
UFMG
_
Mestre em Ciência Animal
UFMG

Bacharel em Medicina Veterinária (UFMG) e Mestre em


Ciência Animal (UFMG). Atualmente é doutoranda em Ciência
Animal (UFMG) e responsável técnica no Laboratório SaveLab
– Soluções em Análises Veterinárias. Bolsista na Labtest
Diagnóstica, pelo programa Inova Talentos (2015 - 2016).

julianambicalho@gmail.com

SaveLabRua Casablanca, 361,


Santa Terezinha. Belo Horizonte, MG.
CEP: 31365-160

(31) 33270036 / (31) 993531980

G U I L H E R ME H I DE KI YO S H I ZA NE C O STA
_
Bacharel em Farmácia
UFOP
_
Mestre em Bioquímica e Imunologia
UFMG

Bacharel em Farmácia (UFOP) e Mestre em Bioquímica e


Imunologia (UFMG). Atualmente é Pesquisador Pleno na Labtest
Diagnóstica. Tutor no programa Inova Talentos (2015 - 2016).

guilherme.costa@cdict.com.br

Labtest Diagnóstica,
Av. Paulo Ferreira da Costa, 600,
Vista Alegre, Lagoa Santa, MG.
CEP: 33400-000.

(31) 3689-6900

47
R E SU M O

PALAVRAS CHAVE saúde animal; exames bioquímicos; interferência pré-analítica; lipemia

A lipemia é o aumento de lipídeos no sangue, ocorrência comum nos laboratórios de pa-

tologia clínica veterinária. Essa alteração normalmente é causada pela não realização de

jejum pelos animais, o que aumenta a turbidez do soro e pode influenciar nos resultados

dos exames bioquímicos. Por isso, a amostra lipêmica deve ser rejeitada pelo laboratório,

sendo solicitada uma nova amostra. O objetivo do trabalho foi desenvolver e validar um

produto inovador, capaz de remover a lipemia de amostras de soros caninos e felinos,

reduzindo a interferência analítica causada pela turbidez. O produto desenvolvido remo-

veu a lipemia das amostras animais, sem influenciar na maioria dos exames bioquímicos,

garantindo resultados confiáveis. Além disso, possui preço acessível e fácil aplicação nos

laboratórios veterinários.

48 INOVA TALENTOS
02

A BSTR ACT

KEYWORDS animal healthy; biochemical tests; pre-analitycal interference; lipemia

Lipemia is the increment of lipids in blood, frequently observed in clinical veterinary

pathology laboratories. It is usually caused by the absence of previous fasting by the

animals that leads to an increasing of the serum sample turbidity, and can provoke

untrusted results of some biochemical analysis. Therefore, laboratories should be rejected

reject lipemic blood samples and request a new sample. This work aimed to develop and

to validate an innovative product able to remove the excess of lipids from canine and

feline serum samples. The final product was capable to reduce the lipemia from animal

serum samples, causing no changes of the biochemical tests, ensuring reliable results. In

addition, being cheap and easily applicable in a veterinary laboratory.

PROGRAMA RHAE TRAINEE CNPq – IEL 49


Além da ausência do jejum, a lipemia
INTRODUÇÃO pode ocorrer devido a algumas doenças, tais

A
como diabetes mellitus, obesidade, hipera-
ssim como acontece em humanos,
drenocorticismo, hipotireioidismo, pancrea-
cães e gatos devem realizar jejum
tite aguda e insuficiência renal (XENOULIS;
alimentar antes da coleta de sangue,
STEINER, 2010). Fatores genéticos também
para determinados tipos de exames labora-
podem desencadear dislipidemias em cães
toriais. Esse jejum é de até seis horas em
das raças Schnauzer Miniatura e Pastor de
filhotes e de oito horas em animais adultos
Shetland (MORI et al., 2010).
(KANEKO et al., 2008). O problema é que,
Os exames bioquímicos são normalmen-
diferentemente da medicina humana, a cole-
te realizados pela mensuração da absorbân-
ta de sangue dos animais normalmente não
cia por método espectrofotométrico, que
é programada e ocorre durante a consulta
nada mais é do que a medição da absorção
clínica com o médico veterinário. A não rea-
da luz pelo meio reacional.
lização do jejum pode levar à alteração na
Como o aumento da turbidez influencia na
amostra denominada lipemia, que consiste
maneira como a luz é absorvida, amostras li-
no aumento de lipídeos no sangue (princi-
pêmicas podem apresentar resultados bioquí-
palmente triglicérides), o que faz com que o
micos incorretos, o que compromete o diag-
soro ou plasma se tornem turvos e com as-
nóstico de doenças pelo médico veterinário
pecto leitoso. (Figura 1) (BRAUN et al., 2015;
(BRAUN et al., 2015), razão pela qual as amos-
XENOULIS; STEINER, 2015).
tras com lipemia acentuada não devem ser
utilizadas nas análises bioquímicas, devendo
ser solicitada a recoleta de sangue do animal.
Entretanto, a rejeição da amostra lipêmica
com a necessidade de obtenção de uma nova
amostra pode ser muito complexa na medi-
cina veterinária e, por isso, deve sempre ser
evitada. Muitos animais têm a coleta de san-
gue difícil pelo pequeno porte, estado de saú-
de ou agressividade, algumas vezes sendo
até necessária a utilização de sedação para a
coleta de sangue.
A lipemia é um problema no diagnóstico
veterinário difícil de ser evitado e que pode
comprometer a exatidão dos resultados dos
FIGURA 1 - Lipemia em soros de cães.
Fonte: Xenoulis e Steiner (2010) exames bioquímicos. Até o momento, não está

50 INOVA TALENTOS
02

disponível no mercado veterinário nacional e centrifugação, o sobrenadante formado é sóli-


internacional um produto capaz de remover a do, permitindo a pipetagem do soro límpido,
turbidez dos soros lipêmicos, para que pos- que foi utilizado conforme instrução de uso do
sam ser utilizados nas análises bioquímicas. reagente, utilizado conforme instrução de
uso do reagente. O resultado final do exame
bioquímico foi multiplicado pelo fator 1,05.
OBJETIVO
VALIDAÇÃO
O objetivo do trabalho foi desenvolver uma A validação do produto foi realizada com os
substância capaz de remover a lipemia de seguintes reagentes da Labtest Diagnóstica:
amostras de soro de cães e gatos, sem in- Albumina VET (Ref. 1007); ALT/GPT Liqui-
fluenciar nos reagentes bioquímicos da linha form VET (Ref. 1008); AST/GOT Liquiform
Veterinária da Labtest Diagnóstica S.A. VET (Ref. 1009); Creatinina K VET (Ref.
1010); Fosfatase Alcalina Liquiform VET (Ref.
1011); Gama GT Liquiform VET (Ref. 1058);
MÉTODO Glicose Liquiform VET (Ref. 1012); Frutosa-
mina VET (Ref. 1019) e Ureia UV Liquiform
AMOSTRAS
VET (Ref. 1013).
Foram utilizadas amostras de soros lipêmi-
Nos ensaios de validação, utilizou-se 1,0
cos de cães e gatos, cedidas pelo Laborató-
mL de soro canino ou felino lipêmico turvo.
rio de Patologia Clínica do Hospital Veteriná-
Em 0,5 mL foi realizada a delipidação, con-
rio da Universidade Federal de Minas Gerais
forme descrito no item “Protocolo de utiliza-
(UFMG).
ção”. O teste-controle e resultado de referên-
cia para comparação foi o obtido mediante a
utilização do soro, cuja remoção lipêmica se
ELABORAÇÃO DO REAGENTE
deu somente através do processo de centri-
O reagente foi elaborando utilizando polí-
fugação. Para isso, foi realizada a centrifuga-
mero orgânico aniônico (> 0,1 %), compos-
ção de 0,5 ml do soro lipêmico por 14.000
to catiônico (> 0.1 mmol/L) e azida sódica
RPM durante 15 minutos, com pipetagem do
(0,095%) em pH 7,0.
soro límpido. A quantificação do analito bio-
químico foi realizada seguindo as instruções
PROTOCOLO DE UTILIZAÇÃO de uso dos reagentes. O cálculo do erro sis-
Adicionou-se 0,025 mL do reagente em 0,5 mL temático (bias) entre os resultados obtidos
do soro lipêmico em um em um microtubo, com o soro centrifugado e o soro delipidado
que foi homogeneizado vigorasamente e cen- foi calculado para cada analito, segundo fór-
trifugado durante 15 minutos (RPM). Após mula descrita por Harr et al. (2013).

PROGRAMA RHAE TRAINEE CNPq – IEL 51


Bias % = Resultado do Soro Centrifugado – Resultado do Soro delipidado X 100
Resultado do soro centrifugado

Considerou-se que o pré-tratamento das Nos ensaios de validação, a delipidação


amostras lipêmicas não interfere nos rea- das amostras lipêmicas caninas e felinas com
gentes bioquímicos, se o bias calculado para o reagente desenvolvido não interferiu no re-
cada analito for inferior ao definido por Harr sultado dos reagentes: Albumina VET (Ref.
et al. (2013). 1007); ALT/GPT Liquiform VET (Ref. 1008);
AST/GOT Liquiform VET (Ref. 1009); Fosfata-
ESTABILIDADE
se Alcalina Liquiform VET (Ref. 1011); Glicose
O reagente foi submetido ao teste de de-
Liquiform VET (Ref. 1012); Frutosamina VET
gradação acelerada a que é a avaliação da
(Ref. 1019) e Ureia UV Liquiform VET (Ref.
remoção da lipemia no dia inicial (dia 0) e
1013). As tabelas 1 e 2 exemplificam o resulta-
nos dias 7, 14, 21 e 28. A partir dos dados
do do teste de validação, utilizando o reagente
obtidos, a estabilidade do produto, quan-
AST/GOT Liquiform VET (Ref. 1009).
do armazenado entre 2° e 8 °C, é calculada
segundo Anderson e Scott (1991).
QUANTIFICAÇÃO DE AST
SORO SORO SORO
RESULTADOS CENTRIFUGADO
(14.000 rpm)
LIPÊMICO DELIPIDADO

Nas amostras pré-tratadas com o produto AST (U/L) 247 11 243


desenvolvido após centrifugação, houve re- BIAS (%) -95,4% 1,6%
dução da turbidez e formação de um sobre-
TABELA 1 - Quantificação de AST em amostra de soro centrifugado
nadante sólido (Figura 1). (14.000 RPM), lipêmico e delipidado com o reagente desenvolvido.

Nota: O cálculo do bias foi realizado entre o


soro lipêmico e o pré-tratado, em relação ao
(a) (b) soro centrifugado.

CONCENTRAÇÃO DE TRIGLICÉRIDES
SORO SORO SORO
CENTRIFUGADO LIPÊMICO DELIPIDADO
(14.000 rpm)

TRIGLICÉRIDES
(mg/dL) 205 516 62
FIGURA 2 - Amostra de soro canina lipêmica (a) e pré-tratada com
o reagente desenvolvido após a etapa de centrifugação (b). Observar TABELA 2 - Concentração de triglicérides do soro centrifugado
o sobrenadante lipídico sólido (seta) (14.000 RPM), lipêmico e pré-tratado com o reagente desenvolvido.

52 INOVA TALENTOS
02

Por outro lado, o reagente não foi aprova- seu aumento no soro pode indicar lesão he-
do nos estudos de validação para utilização pática aguda (STOCKHAM; SCOTT, 2008).
com os reagentes Gama GT Liquiform VET Observa-se que o resultado de AST da
(Ref. 1058) e Creatinina K VET (Ref. 1010), amostra lipêmica é considerado normal. No
pois influenciou nos resultados. entanto, após a remoção da lipemia, verifica-
O produto ficou estável no teste de de- -se que o mesmo animal apresenta AST qua-
gradação acelerada a 37°C por 28 dias, o que se cinco vezes acima do valor de referência.
corresponde a uma estabilidade de 38 me- Esse resultado incorreto poderia levar a uma
ses, se mantido entre 2° a 8 °C. falha no diagnóstico de possível doença he-
pática aguda pelo médico veterinário.
Na tabela 1, verifica-se que a remoção da
lipemia, através da centrifugação a 14.000
DISCUSSÃO (RPM) e através do pré-tratamento com o re-
agente desenvolvido, apresentou resultados
Através dos seus compostos iônicos, o re- de AST muito próximos, atendendo aos re-
agente desenvolvido promoveu a agregação quisitos estabelecidos por Harr et al. (2013)
das lipoproteínas presentes no soro lipêmi- com bias inferior a 5,91%.
co, visualizado após centrifugação, como Por outro lado, o pré-tratamento das
um sobrenadante sólido e de cor clara, como amostras influenciou negativamente nos
demonstrado na figura 1. resultados de Creatinina e da enzima Gama
O soro se tornou límpido e facilmente Glutamiltransferase (GGT), provavelmente
pipetado para utilização nos exames bioquí- pela interação iônica entre os componentes
micos. A tabela 2 demonstra a redução dos do reagente e os analitos em questão.
lipídeos do soro pré-tratado com o reagente O método de centrifugação a 14.000 RPM
desenvolvido, mensurada pela redução da não é aplicável a todos laboratórios de pa-
concentração de triglicérides na amostra, tologia clínica veterinária, pois necessita de
principal lipídeo encontrado em soros lipê- centrífugas específicas, capazes de realizar
micos (XENOULIS; STEINER, 2015). a centrifugação em tal velocidade. Por outro
A lipemia impacta na absorção da luz pela lado, a centrifugação empregada, utilizando
amostra, interferindo nos resultados bioquí- o reagente proposto (3.500 RPM), é similar
micos, como exemplificado na tabela 1. à utilizada rotineiramente nos laboratórios
A enzima AST (Aspartato aminotransfe- veterinários para obtenção do soro a partir
rase), também chamada de TGO (Transami- do sangue, não sendo necessária, portanto,
nase glutâmico-oxalacética) está presente a aquisição de equipamento adicional.
nas células do fígado - cães saudáveis apre- O reagente desenvolvido recebeu o nome
sentam atividade de AST de até 52 U/L - e de DelipVET e futuramente estará disponível

PROGRAMA RHAE TRAINEE CNPq – IEL 53


para comercialização pela Labtest Diagnósti-
ca (Figura 3). CONSIDERAÇÕES FINAIS
O DelipVET evita a necessidade de reco-
leta das amostras lipêmicas, garante resulta- O DelipVET é eficiente em remover a lipemia
dos bioquímicos confiáveis e apresenta custo de soros caninos e felinos, garante resulta-
acessível por amostra pré-tratada. Além dis- dos bioquímicos confiáveis, com aplicação
so, possui protocolo de utilização simples e fácil e é de baixo custo. Por se tratar de produ-
não necessita de equipamentos adicionais, to inédito, novos estudos devem ser realiza-
pois a centrifugação pode ser realizada em dos, com o objetivo de ampliar sua utilização
centrífugas normalmente presentes no labo- em todos os reagentes da linha veterinária da
ratório veterinário. Labtest Diagnóstica S.A.

FIGURA 3 - Apresentação comercial do produto desenvolvido DelipVET (Ref. 1020)

54 INOVA TALENTOS
02

REFERÊNCIAS
BIBLIOGRÁFICAS

ANDERSON, G.; SCOTT, M. Determination of Pro-


duct Shelf Life and Activation Energy for five drugs
of abuse. Clinical Chemistry, Baltimore, v. 37, n.3, p.
398-402, 1991.

BRAUN, J.P.; BOUNGÈS-ABELLA, N.; GEFFRÉ, A.


et al. The preanalytic phase in veterinary clinical
pathology. Veterinary Clinical Pathology, Columbia,
v.44, n.1, p.8- 25, 2015.

HARR, K. E.; FLATLAND, B.; NABITY, M. et al. AS-


VCP guidelines: allowable total error guidelines for
biochemistry. Veterinary Clinical Pathology, Colum-
bia, v.42, n.4, p. 424-436, 2013.

KANEKO, J. J.; HARVEY, J. W.; BRUSS, M. Clinical


Biochemistry of Domestic Animals. 6 ed. Londres:
Elsevier, 2008.

MORI, N., LEE, P., MURANAKA, S. et. al. Predis-


position for primary hyperlipidemia in Miniature
Shnauzers and Shetland Sheepdogs as compared to
other canine breeds. Research in Veterinary Science,
Londres, v. 88, p. 394 – 399, 2010.

STOCKHAM, S. L.; SCOTT, M. A. Fundamentals of


Veterinary Clinical Pathology. 2 ed. Ames: Wiley-
-Blackwell, 2008.

XENOULIS, P.G.; STEINER, J. M. Lipid metabolism


and hyperlipidemia in dogs.Veterinary Journal, Lon-
dres, v.183, n.1, p. 12-21, 2010.

XENOULIS, P.G.; STEINER, J. M. Canine hyperlipi-


daemia. Journal of Small Animal Practice, Londres,
p.595-605, out. 2015.

PROGRAMA RHAE TRAINEE CNPq – IEL 55


03
DESIGN DE ESTRUTURAS
HÁPTICAS PARA PLATAFORMAS
DE LENTES INTRAOCULARES
MULTIFOCAIS TÓRICAS
LU CA S CA M POS S ILVA
_
Bacharel em Engenharia Mecânica
Universidade Federal de São João Del Rey
_
Pesquisador Júnior
Mediphacos Indústrias Médicas SA

OTÁVIO GOMES DE OLIVEIRA


LUIZ MELK DE CARVALHO
JULIE H. S. M. BARON
RODOLFO FELIPE DE OLIVEIRA COSTA
_
Mediphacos Indústrias Médicas SA
Belo Horizonte/MG, Brasil

Lucas Campos Silva: Bacharel em Engenharia Mecânica pela


Universidade Federal de São João Del Rey. Pesquisador Júnior
na Mediphacos Indústrias Médicas SA. Atuou com bolsista de
Iniciação Científica pela UFSJ (2011) e como bolsista do CPNQ,
no Programa RHAE TRAINEE Inova Talentos (2015-2016).

lucas.campos@mediphacos.com

Rua Itamar Teixeira, 77/203-BL5,


Betânia, Belo Horizonte/MG, Brasil,
CEP: 30.590-145

(31) 3889-3653

57
R E SU M O

PALAVRAS CHAVE design de lentes intraoculares; ISO11979-3; modelo pós-Cirúrgico

Este trabalho descreve o desenvolvimento de estruturas hápticas para plataformas de len-

tes intraoculares, destinadas a abrigar lentes hidrofílicas multifocais e tóricas, capazes

de fornecer estabilidade rotacional e alinhamento no eixo óptico. O desenvolvimento in-

cluiu análise estrutural mecânica, desenvolvida por meio de um modelo computacional

do ensaio mecânico – previsto pela norma ISO 11979-3 – e de um modelo computacional

biomecânico da lente no saco capsular, no instante pós-cirúrgico. Softwares de elementos

finitos foram utilizados nesta análise, para verificar os pontos de concentração de tensão

e o estado de deformação final das variações propostas. Quatro variações de plataformas

foram propostas, analisadas, fabricadas e apresentadas como opção, para abrigar os no-

vos modelos de lentes premium da empresa.

58 INOVA TALENTOS
03

A BSTR ACT

KEYWORDS intraocular lens designs; ISO 11979-3; post-surgical model

This paper describes the design phase of haptic structures for intraocular lens platforms,

intended to be used in multifocal, toric, hydrophilic lenses, providing rotational stability

and precise alignment to the optical axis. A computational model of the mechanical

test predicted in ISO 11979-3 and a computational biomechanical model of the lens in

the capsular bag at the post-surgical time were developed to conduct the analysis of the

mechanical behavior of the proposed platforms. Finite element software was used in this

analysis to verify the stress concentration points and the final deformation state of each

proposed design model. Four variations of platforms were proposed and analyzed through

the proposed methodology, manufactured and presented as option to be used with the

company’s new family of premium intraocular lenses.

PROGRAMA RHAE TRAINEE CNPq – IEL 59


matismo pode ser tratado cirurgicamente,
INTRODUÇÃO por meio do implante das LIOs tóricas. A
combinação desses dois tipos de lentes, para

A
cirurgia de catarata é o procedimen- formar as LIOs multifocais tóricas, garante ao
to mais realizado em muitos países paciente a possibilidade de correção do astig-
desenvolvidos, proporcionando me- matismo, ao mesmo tempo em que permite a
lhorias significativas, econômicas e de lon- focalização em duas ou mais distâncias.
go prazo para pacientes de todas as idades. Ao mesmo tempo em que LIOs multifo-
(BUSBEE, B. G., 2002; LUNDSTROM M, cais tóricas possuem recursos ópticos para
2005) Avanços nas técnicas e tecnologias propiciar melhor qualidade de visão para os
empregadas na cirurgia de catarata, nas úl- pacientes, elas demandam maior nível de
timas décadas, levaram a um aumento na precisão e previsibilidade no comportamen-
satisfação do paciente e melhor resultado no to mecânico.
pós-cirúrgico, resultando em mudanças sig- De um lado, para tratar o astigmatismo,
nificativas na frequência com que essas cirur- é necessário garantir um alinhamento preci-
gias são realizadas. (ERIE, J. C., 2014) so entre os eixos de maior e menor curvatura
As lentes intraoculares (LIOs) são utiliza- da lente com aqueles associados à córnea do
das na cirurgia de catarata, em substituição paciente. Para cada procedimento cirúrgi-
ao cristalino opacificado. Além de fisicamente co, esse alinhamento precisa ser calculado
substituírem a lente natural do olho, as LIOs durante a fase de planejamento da cirurgia,
permitem a correção cirúrgica de erros refra- conforme exemplificado na figura 1.
tivos, o que aumenta ainda mais a expectati-
va do paciente em relação aos resultados e,
consequentemente, a demanda pela qualida-
de das lentes. Um dos erros refrativos mais
comuns é a presbiopia, que consiste na perda
da capacidade de acomodação do cristalino,
com consequente dificuldade de visão próxi-
ma. A presbiopia pode ser tratada por meio de
LIOs multifocais, que permitem ao indivíduo
focalizar em duas ou mais distâncias com ni-
tidez. (THOMAS K.; KOCK, D. D. 2005)
Outro erro refrativo bastante comum é o
astigmatismo, com prevalência de 33% na
população com 20 anos ou mais nos EUA FIGURA 1 - Resultado do calculo de
posicionamento de uma lente intraocular tórica
1999-2004 (VITALE, S. et al., 2008).O astig- Fonte: http://miniflextoriccalculator.com Acesso em:10/06/2017

60 INOVA TALENTOS
03

Para garantir o melhor resultado refrativo,


o eixo de orientação da lente deve se manter
alinhado ao eixo do astigmatismo do pacien-
te, sob pena de perda de correção de aproxi-
madamente 3,3% para cada grau de alteração
na orientação da lente. (TYSON II, 2013)
Por outro lado, a superfície da maioria das
LIOs multifocais é caracterizada por anéis
concêntricos, sejam eles degraus de efeito FIGURA 2 - Lente intraocular multifocal pós-cirúrgico.
Fonte: http://www.epirusvisioncenter.gr Acesso em 10/07/2017
difrativo, sejam zonas de curvatura diferen-
ciada com efeito refrativo (ver figura 2). Pela
natureza do fenômeno de geração de multi-
focalidade, esse tipo de lente exige então um
alinhamento perfeito da lente no eixo óptico,
sendo esse um importante fator de acuidade
visual pós-cirúrgica, com consequente influ-
ência sobre a satisfação do paciente.
Assim, a fim de garantir performance
óptica, é essencial que as LIOs multifocais
tóricas sejam construídas sobre plataformas
que promovam estabilidade rotacional, ali-
nhamento ao eixo óptico e comportamento
mecânico previsível e validado.
As primeiras LIOs de câmara posterior,
chamadas lentes de Ridley, eram mais pa-
recidas com o cristalino. Essas lentes, feitas FIGURA 3 - Visão em peça anatômica
de olho com a lente de Ridley implantada.
de material rígido, não possuíam estruturas Fonte: http://www.sdoftalmologia.com.br/ Acesso em: 8/04/2017

aprimoradas para a fixação no saco capsu-


lar (membrana elástica de espessura ínfima,
que envolve o cristalino e é mantida após a
extração da catarata).
Com isso, esse tipo de lente era instável
no olho. Em 1953, Strampelli propôs uma
modificação no design, adicionando alças
rígidas e reduzindo a parte óptica. (MAR-
FIGURA 4 - Lente de Strampelli
QUES, F. F., 2007) Fonte: Duane’s Clinical Ophtalmology

PROGRAMA RHAE TRAINEE CNPq – IEL 61


Desde então, as estruturas hápticas vêm Após o trabalho de engenharia no processo
sendo aperfeiçoadas para garantir a estabili- de fabricação, a lente é fabricada e só en-
dade necessária no olho do paciente e adapta- tão avaliada em atendimento à norma. Esse
ção aos novos materiais utilizados nas lentes. processo resulta em diversas iterações entre
A evolução das lentes intraoculares trouxe a projeto, fabricação e até mesmo testes clíni-
possibilidade do implante em incisões cada cos, para que a plataforma seja aperfeiçoada,
vez menores. Utilizando materiais dobráveis, tornando o processo caro e moroso, ainda
lentes em peça única e um sistema de injeção, que com resultados seguros para o paciente.
é possível hoje implantar uma lente em inci- A recente evolução da ciência da resis-
sões menores do que 2 mm, o que minimiza tência dos materiais – através do advento
a complexidade do procedimento, os erros de de ferramentas computacionais, baseadas
refração residual e o tempo de recuperação. no método de elementos finitos – fez com
Portanto, a preocupação com a injetabilidade que se propagasse a utilização desse méto-
e o tamanho das lentes teve de ser tratada do para prever performance biomecânica de
como pré-requisito de design. LIOs devem vários tipos de implantes, mais usualmente
cumprir requisitos de validação previstos em nas áreas ortopédica, ortodôntica e cardíaca,
normas técnicas. Usualmente, é utilizada como meio para avaliação do efeito de fato-
pelos fabricantes a norma ISO11979-3, que res clínicos sobre o sucesso na execução de
prevê metodologias e parâmetros para ava- implantes. (GENG, T. L., 2001)
liação de comportamento mecânico, visando Face ao exposto, justifica-se, portanto, a
fornecer requisitos e critérios mínimos para proposta de se construírem modelos com-
avaliação de plataformas de LIOs. putacionais capazes de auxiliar o projetista,
A norma contempla ensaios mecânicos, mediante a simulação dos ensaios previstos
que possibilitam medir principalmente a for- na norma regulatória e na fase pós-cirúrgica.
ça de reação da plataforma à compressão, o Assim, produzem-se ferramentas para
deslocamento angular da óptica, o optic tilt, identificação de falhas, promoção de aper-
que basicamente mede a inclinação da óti- feiçoamentos e visualização dos resultados
ca em relação ao eixo óptico simulado no do projeto, antes mesmo da fabricação do
ensaio, a descentração óptica e o ângulo de dispositivo. Com isso, tais modelos permi-
contato da alça com o suporte previsto no tem o desenvolvimento de plataformas mais
ensaio. Tais normas não contemplam a re- robustas e com comportamento previsível,
presentação do contexto pós-cirúrgico, com gerando melhores resultados de estabilidade
a lente acomodada no saco capsular. rotacional e alinhamento ao eixo óptico, aten-
Tradicionalmente, o projeto de estruturas dendo então à demanda de qualidade reque-
mecânicas para LIOs é feito de maneira em- rida pelas LIOs multifocais tóricas.
pírica, com base na experiência do projetista. Cabe ressaltar que, além do contexto pós-

62 INOVA TALENTOS
03

-cirúrgico, devem ainda ser observados fato-


res como o próprio método de fabricação e a MÉTODO
manipulação médica da plataforma durante
a injeção e a cirurgia, visando promover a LEVANTAMENTO DOS
usabilidade do produto. Tais fatores extrapo- PRÉ-REQUISITOS DE PROJETOS
lam, em certa medida, as simulações compu- O primeiro passo do projeto foi o levanta-
tacionais previstas e podem gerar desdobra- mento dos pré-requisitos das plataformas,
mentos de pré- requisitos do design. envolvendo aspectos regulatórios, comer-
Assim, este trabalho pretende apresentar ciais e de usabilidade. Inicialmente, foi rea-
o desenvolvimento de uma solução para o lizada uma pesquisa de mercado para levan-
design de plataformas de LIOs, valendo-se de tar os mais diversos tipos de plataformas
uma metodologia própria, que possa resultar existentes, além dos designs mais utilizados
em um produto com maior estabilidade e se- em lentes multifocais e tendências. Foram
gurança e com menor esforço iterativo. encontrados mais de 75 diferentes tipos de
design para lentes intraoculares.
Notou-se que, embora o design mais co-
mum seja o de alça C-Loop, existe uma ten-
OBJETIVO dência de novos designs, principalmente nas
lentes multifocais, com o uso de plataformas
O presente projeto tem por objetivo prin- rotacionalmente simétricas, com desenho si-
cipal desenvolver propostas de plataforma milar ao estilo Plate. Devido a esse indicativo
mecânica para LIOs, visando atender a re- e objetivando a equalização na distribuição
quisitos de estabilidade de LIOs multifocais no diagrama de forças e o aumento da pre-
tóricas, mediante o uso de análises de ele- visibilidade do comportamento mecânico,
mentos finitos em modelos computacionais diante da compressão da cápsula no pós-ci-
mecânicos e biomecânicos. Para tanto, de- rúrgico, decidiu-se então por adotar como ca-
vem ser elaborados modelo computacional, racterística base a simetria rotacional.
que simule as condições e procedimentos Do ponto de vista técnico e regulatório,
previstos pela norma regulatória, e modelo espera-se de uma LIO que seja estável e não
biomecânico simples, que simule a intera- apresente desalinhamentos no eixo óptico.
ção da lente com o saco capsular no olho do Esses requisitos são amplamente aborda-
paciente. O referido desenvolvimento ainda dos pela norma regulatória ISO11979-3, que
integra a fabricação e a realização de ensaios dispõe sobre a medição de parâmetros de
para validação das plataformas. desalinhamento e tilt sobre um ensaio de
compressão da lente a 10 mm. Uma simula-
ção em modelo computacional, utilizando o

PROGRAMA RHAE TRAINEE CNPq – IEL 63


método de elementos finitos, foi construída tos de partida para os parâmetros construti-
para avaliar estes parâmetros, posteriormen- vos a serem adotados.
te comparados com o modelo físico de en- As principais considerações obtidas fo-
saio previsto na norma ISO 11979-3:2012(E) ram em relação ao carregamento do injetor,
Considerando a usabilidade, o aspecto que estabelece requisitos dimensionais. O
central é a manipulação da plataforma du- injetor escolhido para abrigar o novo design,
rante a cirurgia, que compreende desde o disponível comercialmente, está ilustrado na
carregamento da lente no injetor, até a inje- figura 5. O cartucho utilizado foi de 1.8 mm,
ção da lente e a manipulação da LIO no olho disposto na figura 6. Tanto o injetor quanto o
do paciente. Nessa etapa, foram colhidas cartucho foram reproduzidos computacional-
opiniões de oftalmologistas, fabricantes dos mente para validar o carregamento, conforme
injetores e também de outros projetistas de exemplificado nas figuras, com a plataforma
plataformas, como forma de estipular pon- MF-R2 já produzida pela empresa.

FIGURA 5 FIGURA 6
Detalhe injetor com lente MF-R2 carregada. Cartucho injetor 1.8mm, detalhe para o
Fonte: Os autores círculo da área de carregamento.
Fonte: Os autores

O perímetro do círculo da área de carregamento foi então tomado como dimensão máxima
para largura de uma plataforma, como exemplificado na figura 7.

FIGURA 7
Plataforma MF-R2, relação da largura da
plataforma com a dimensão do injetor.
Fonte: Os autores

64 INOVA TALENTOS
03

Outra fonte de pré-requisitos é o proces-


so de fabricação, que consiste basicamente
em três operações de usinagem, sendo duas
operações de torneamento – uma do primei-
ro lado e outra do segundo lado, que confe-
rem o perfil anterior e posterior da lente – e
uma terceira operação de fresamento, que
confere a geometria de topo, caracterizadora
das estruturas hápticas.
O que restringe a plataforma na fabri-
cação é essencialmente o ferramental, que,
devido ao raio de ponta da ferramenta no
torneamento e também ao diâmetro da fre-
sa no fresamento, não permite detalhes em
raio inferior ao das ferramentas utilizadas
nas plataformas. Essa análise, inclusive,
FIGURA 8
deve levar ainda em conta o fato de que a Esquema do ensaio mecânico da norma.
Fonte: ISO 11979-3:2012(E)
fabricação é realizada com a matéria-prima
desidratada, o que faz com que a lente passe O modelo foi então construído em CAD
por mudanças dimensionais, ao ser hidrata- 3D para ser utilizado em cada lente propos-
da para embalagem. ta,(ver figura 9), aplicado a uma ferramenta
Por fim, o material da lente pré-determi- que permite a análise pelo método de elemen-
nado no projeto óptico foi o acrílico hidrofíli- tos finitos das tensões e deformações da len-
co, apresentado em pastilhas de dimensões te submetida ao ensaio, de modo a alcançar
16 mm de diâmetro por 2,5 mm de altura, o os mesmos critérios estabelecidos na norma.
que também limita as opções de projeto.

ELABORAÇÃO DO MODELO COMPUTACIONAL


MECÂNICO DO ENSAIO NA NORMA ISO11979-3
O modelo computacional mecânico, descri-
to na norma ISO11979-3, consiste em um
ensaio de compressão que leva a plataforma
a um diâmetro de 10 mm. Nele, prevê-se a
construção de duas estruturas denominadas
FIGURA 9
Anvil, que devem ser dispostas conforme Esquema do ensaio mecânico
da norma em CAD 3D.
ilustra a figura 8 a seguir: Fonte: Os autores

PROGRAMA RHAE TRAINEE CNPq – IEL 65


Lentes com o comportamento conhecido ELABORAÇÃO DO MODELO
foram utilizadas para a validação do modelo COMPUTACIONAL DO MOMENTO
e para a visualização de possíveis melhorias, PÓS-CIRÚRGICO
que pudessem ser agregadas à proposição
das novas plataformas. Durante uma cirurgia refrativa para o im-
Além do posicionamento da lente, as plante de uma LIO de câmara posterior por
condições de contorno aplicadas incluíram meio da córnea, é feita uma secção circular
o deslocamento prescrito até a compressão na membrana que envolve o cristalino, por
da lente a 10 mm, a configuração do contato onde ele é aspirado. Desse procedimento
das paredes do Anvil com as alças da lente, resta apenas o saco capsular, seccionado em
definidas como sem penetração, e o mate- sua face anterior e preso pelas fibras zonu-
rial, onde foram usados o módulo de elastici- lares que, junto aos músculos ciliares, é res-
dade, o limite de escoamento e o coeficiente ponsável pelo movimento de acomodação do
de Poisson, sugeridos pelo fabricante. cristalino. (KOHNEN, T., 2005) Essa configu-
ração irá abrigar a lente intraocular, apoiando
as hápticas no equador capsular, que, por sua
vez, empurram a ótica da lente em direção à
face posterior do saco, conforme exemplifica-
do na figura 11.

FIGURA 10
Simulação da Plataforma MF-5Y, já disponível comercial-
mente, sendo submetida a um ensaio de compressão.
Fonte: Os autores

Na simulação do pós-processamento é
possível encontrar, através da seleção de
pontos na malha, valores pontuais de deslo-
camento, o que permitiu a seleção dos mes-
mos pontos de medição estabelecido na nor- FIGURA 11
Facoemulsificação
ma e a obtenção dos valores de inclinação (em cima),
(tilt), deslocamento axial, além da obtenção, Lente intraocular
implantada
através de outros recursos do software, dos (esquerda).
Fonte: http://www.cataratacu-
valores de força de reação na compressão, ritiba.com.br/lente-intraoc-
ular-cirurgia-de-catarata/
exatamente como prevê a norma. Acesso em:10/07/2017

66 INOVA TALENTOS
03

Embora não tenham sido encontradas das zônulas. O modelo da acomodação do


referências a nenhum tipo de experimenta- cristalino proposto por Burd (BURD, 2001)
ção biomecânica que simulasse tal condi- descreve uma representação bidimensio-
ção, um modelo computacional biomecâ- nal que, neste trabalho, foi replicada
nico do cristalino foi encontrado e serviu tridimensionalmente, formando todo o en-
como bibliografia base para a construção do volto capsular necessário para a simulação
modelo do saco capsular e das estruturas da lente na cápsula.

FIGURA 12
Esquema de construção
do modelo da cápsula.
Fonte: (BURD, 2001)

O parâmetro geométrico em relação ao râmetros construtivos, baseados em dados


formato relaxado da estrutura capsular e os estatísticos que permitem constituir um mo-
pontos de fixação às zônulas, sugeridos no delo padrão, embasado nas dimensões esta-
modelo de Burd (2001), são os principais belecidas na figura 12. É importante salientar
elementos da construção do modelo tridi- que o modelo a seguir é uma adaptação do
mensional como ferramenta de análise do modelo de Burd, no qual somente as dimen-
pós-cirúrgico. Nele, o autor reúne de diversas sões referentes à construção do modelo do
fontes (listadas na tabela 1 e na tabela 5), pa- saco capsular foram listadas.

PROGRAMA RHAE TRAINEE CNPq – IEL 67


DADOS GEOMÉTRICOS DE CONSTRUÇÃO DO MODELO

DIMENSÃO 11 ANOS 29 ANOS 45 ANOS FONTE

Raio do cristalino RL Valores da Eq. 1 Strenk et al. (1999)

Raio do corpo Ciliar Rcb Valores da Eq. 2 Strenk et al. (1999)

Espessura anterior do cristalino, Ta(mm) 2.18 2.04 2.42 Brown (1973)

Espessura posterior do cristalino, Tp(mm) 2.13 2.09 2.42 Brown (1973)

Raio de curvatura do polo anterior Rap(mm) 6.8 6.5 7.6 Brown (1973)

Raio de curvatura do polo posterior Rpp(mm) 8.1 12.2 8.0 Brown (1973)

Ângulo da curva equatorial anterior θa(°) 63 63 63 Retirado da Fig.2 Fincham (1937)

Ângulo da curva equatorial posterior θp(°) 37 37 37 Retirado da Fig.2 Fincham (1937)

Variação da espessura da Cápsula Polinômio de quinta ordem descrito na Tabela 4 Fisher e Petted (1972), Fig.2 e tabela 3

Posição de disposição das zônulasxz (mm) Valores da Eq. 3 Strenk et al. (1999)

Offset do Equador em relação ao núcleo Δ (mm) 0.5853 0.5119 0.6292 Fincham (1937) e Brown (1973)

TABELA 1 - Dados geométricos de construção do modelo.


Fonte: (BURD, 2001)

𝐸𝑐 é o Módulo de Young em Nmm-2,


Onde A é a idade em anos

𝑎 = 0,03 𝑁 𝑚𝑚

𝑎 = 0 para 𝐴 ≥ 35 𝑎𝑛𝑜𝑠
para A< 35 anos e

68 INOVA TALENTOS
03

O modelo utilizado fornece os demais dados apenas para idades específicas de 11, 29 e45
anos. Dessa maneira, os valores calculados para cada idade fornecida são apresentados na
tabela 2:

VALORES DE PARÂMETROS PARA CADA IDADE DE REFERÊNCIA

IDADE 11 ANOS 29 ANOS 45 ANOS

Raio do Cristalino 4,1624 4,3136 4,448

Raio do Corpo Ciliar 6,636 6,474 6,33

Xz 0,1675 0,3907 0,5891

Ec 0,73 1,27 1,45

TABELA 2 - Valores de parâmetros para cada idade de referência.


Fonte: (BURD, 2001)

O polinômio que descreve a curva exterior do cristalino foi definido como referência para
a curva interior da cápsula, assumindo que existe contato em toda a extensão das duas geo-
metrias. A curva é descrita por um polinômio de 5º grau, cuja formulação e coeficientes são
descritos na tabela 3.

POLINÔMIO QUE DESCREVE A LINHA EXTERIOR DO CRISTALINO

COEFICIENTES DO POLINÔMIO QUE DEFINE A LINHA EXTERIOR 𝑦 = 𝑎𝑅5 + 𝑏𝑅4 + 𝑐𝑅3 + 𝑑𝑅2 + 𝑓

a b c d f

Anterior (11 anos) -0.00048433393427 0.00528772036011 -0.01383693844808 -0.07352941176471 2.18

Posterior (11 anos) 0.00300182571400 -0.02576464843559 0.06916082660799 0.08928571428571 -2.13

Anterior (29 anos) -0.00153004454939 0.01191111565048 -0.02032562095557 -0.07692307692308 2.04

Posterior (29 anos) 0.00375558685672 -0.03036516318799 0.06955483582257 0.09433962264151 -2.09


TABELA 3
Polinômio que Anterior (45 anos) -0.00026524088453 0.00449862869630 -0.01657250977510 -0.06578947368421 2.42
descreve a linha
exterior do cristalino. Posterior (45 anos) 0.00266482873720 -0.02666997217562 0.08467905191557 0.06172839506173 -2.42
Fonte: (BURD, 2001)

Os símbolos y e R são definidos na Figura 13 . Todas as dimensões estão em milímetros. O grande número
de casas decimais foi utilizado de a à d para minimizar o efeito de erros de arredondamento na definição
da geometria.

PROGRAMA RHAE TRAINEE CNPq – IEL 69


REPRESENTAÇÃO DA ESPESSURA CAPSULAR

Polo Polo
anterior Equador posterior
25
47 anos

20 29 anos
ESPESSURA DA CÁPSULA (μm)

22 anos
15

10

5 FIGURA 13
Representação
da espessura capsular.
0 Fonte: (BURD, 2001)

-1.0 -0.5 0.0 0.5 1.0


η

No trabalho de Burd (2001), a espessura do cristalino é descrita também por um polinômio


de 5º Grau, utilizado para traçar a curva externa das faces anterior e posterior do cristalino, to-
mando como base a curva interna, somada à espessura calculada pelo polinômio.

VARIAÇÕES DA ESPESSURA DA CÁPSULA ASSUMIDAS NO MODELO

IDADE ac bc cc dc ec fc

22 ANOS (usado no modelo de 11 anos) 0.8352 16.0266 2.9249 -29.7854 -5.8871 18.4139

29 ANOS (obtido pela interpolação de Fisher & Pettet,


4.7464 16.8928 -2.7198 -31.6306 -5.4702 21.0881
1972 dados de cristalinos de 22 e 37 anos)

47 ANOS (utilizado no modelo de 45 anos) -16.2276 7.6695 31.7967 -20.0132 -21.3694 20.8891

TABELA 4 - Variações da espessura da cápsula assumidas no modelo.


Fonte: (BURD, 2001)

70 INOVA TALENTOS
03

Sendo a espessura capsular (µm) = acη5 + bcη4 + ccη3 + dcη2 + ecη + fc.
Para superfície anterior 𝜂 = −𝑠/𝑠𝑎,

e 𝑠𝑎 é o valor de 𝑠 no polo anterior.


onde s é a distância medida ao longo da linha exterior do cristalino

Para a superfície posterior 𝜂 = 𝑠/𝑠𝑝,


onde 𝑠𝑝, é a distância medida ao longo da linha exterior
e sp é o valor de s no polo posterior.

Além da determinação da geometria, a determinação correta dos parâmetros de material do


modelo é de fundamental importância para a análise. Tais parâmetros são descritos na tabela 5

DADOS DO MATERIAL DO CRISTALINO

IDADE 11 ANOS 29 ANOS 45 ANOS

Módulo de Young da Cápsula (N mm-2) Valores da Eq. (4)

Rigidez da zônula anterior (N mm-1) 66 x 10-3 66 x 10-3 66 x 10-3

Rigidez da zônula posterior (N mm-1) 11 x 10-3 11 x 10-3 11 x 10-3

Rigidez da zônula central (N mm-1) 33 x 10-3 33 x 10-3 33 x 10-3

Coeficiente de Poisson da cápsula 0.47 0.47 0.47

TABELA 5 - Dados do material do cristalino.


Fonte: (BURD, 2001)

O modelo de cápsula foi então construído em software CAD, que permite desenhos tri-
dimensionais e simulações CAE. Primeiramente, foi constituído um esboço, com base nas
curvas anterior e posterior descritas pelo diagrama da figura 12 e pelos dados e equações su-
pracitadas. Em seguida, o esboço foi revolucionado em torno do eixo central da figura, gerando
a geometria tridimensional, que pode ser vista na figura 14.

FIGURA 13
Construção do
modelo da cápsula.
Fonte: Os autores

PROGRAMA RHAE TRAINEE CNPq – IEL 71


A espessura mostrou-se relativamente cápsula e um ponto específico (ver figura
muito pequena em relação à área total da pa- 12), são definidas por um material isotrópico
rede do modelo. Dessa maneira, a constru- elástico e linear.
ção de uma malha tridimensional para este A referência contida na bibliografia não
tipo de superfície torna-se muito complexa, descreve a representação espacial completa
devido ao nível de refinamento exigido para do modelo. Para melhor representação no
que a malha seja formada. âmbito tridimensional, entende-se o modelo
Basicamente, o tamanho máximo do ele- de Burd (2001) como uma seção do modelo
mento não poderia ultrapassar a espessura tridimensional, reproduzido a partir da revo-
mínima do modelo, o que impõe dimensões lução da estrutura no eixo óptico da figura,
menores que 15 micrometros, para o melhor representado como o eixo y, na figura 12. A
dos casos. A construção da malha, contudo, representação zonular tridimensional pode
não seria o problema propriamente dito, mas ser vista na figura 15.
sim o custo computacional agregado a um No modelo do pós-cirúrgico, a lente se
refinamento desse nível, o que inviabilizaria a encontra já deformada pela restrição geomé-
simulação com os recursos computacionais trica que a estrutura capsular impõe. Assim,
disponíveis. a estratégia adotada foi a de analisar a pla-
A membrana capsular foi então simpli- taforma por simetria cíclica, em um modelo
ficada, mediante a substituição da forma onde lente e cápsula estariam seccionadas
sólida, de espessura variável, por uma su- em planos paralelos ao plano de simetria.
perfície média relativa às superfícies interna A lente é restrita no deslocamento axial no
e externa da estrutura. plano da simetria e sobre o modelo da cáp-
Com isso, o software CAE permite tratar a sula, onde é imposta uma condição de con-
geometria de forma simplificada, com o em- torno de deslocamento prescrito, até que o
prego de elementos de casca, que permitem plano de seção da cápsula encontre o plano
traçar parâmetros de espessura em relação à de seção da lente.
superfície dada.
Nesse caso, devido a restrições do sof-
tware utilizado nas simulações, assumiu-se
espessura constante com base no maior
valor da espessura do modelo de espessura
variável, que varia conforme a idade, como
mostrado na figura 13.
As zônulas, representadas no modelo
bidimensional descrito na bibliografia base FIGURA 15 -
Representação das zônulas no modelo tridimensional.
como linhas de conexão simétricas entre a Fonte: Os autores

72 INOVA TALENTOS
03

Dessa maneira, o estado final deformado


do modelo representa a lente acomodada na
cápsula, assemelhando-se à situação real da
lente estabilizada no pós-operatório. A estra-
tégia proposta para o modelo pode ser ob-
servada na figura 16.
FIGURA 16 -
Dinâmica de simu- No modelo CAE, o recurso da simetria é
lação do modelo.
Fonte: Os autores
interpretado como uma condição de contor-
no, na qual se entende que a força gerada é
simétrica em relação a algum ponto do mo-
delo. Ou seja, na simetria simples, no plano
de simetria, a força de reação de cada nó é
calculada e uma força de mesmo módulo em
direção oposta é aplicada ao mesmo nó. No
caso da simetria cíclica, considera-se que o
nó, que gera força de reação em um determi-
FIGURA 17 - nado ponto das faces, transmite essa força
Faces onde se
aplica simetria em mesmo módulo e sentido, radialmente
cíclica no modelo.
Fonte: Os autores simétrica aos nós da outra face de simetria,
respeitando o eixo imposto a essa relação.
No caso do modelo do pós-cirúrgico, foi
realizada uma seção para aplicação de si-
metria cíclica a partir do eixo longitudinal da
parte óptica, como indicado na figura 17. A
FIGURA 18 - projeção do recurso de simetria do modelo
Projeção da
pode ser vista na figura 18.
simetria do modelo.
Fonte: Os autores A geometria formada pelas superfícies
onde o recurso de casca foi aplicado pode
ser vista na figura 19. Posteriormente, essa
geometria, mais especificamente em sua
porção anterior, foi alvo da remoção de uma
FIGURA 19 -
Geometria formada
seção circular de 6 mm, centrada no eixo
pelas superfícies onde de revolução do desenho, representando a
o recurso de casca
foi aplicado. capsulorhexis. As condições de contorno uti-
Fonte: Os autores
lizadas no modelo podem ser divididas em
duas vertentes: as aplicadas sobre cápsula e

PROGRAMA RHAE TRAINEE CNPq – IEL 73


zônulas e as aplicadas sobre a lente. Enquan- já com a malha refinada pode ser identificado
to as condições de contorno da cápsula são na figura 20, onde, na imagem de cima, obser-
invariantes quanto ao modelo de lente a ser va-se uma malha grosseira, gerada automati-
simulado, as condições de contorno para a camente e, na imagem de baixo, observa-se
lente estão relacionadas ao modelo da plata- a malha refinada. Os resultados de saída da
forma. simulação são os dados numéricos e gráfi-
As relações de contato definem ainda cos para tensão, deslocamento, deformação
condições de contorno adicionais ao mode- e pressão de contato, que auxiliam tanto na
lo, permitindo que as geometrias interajam análise visual do efeito da compressão sobre
durante a simulação, de modo a evitar a so- a plataforma, como no dimensionamento de
breposição dos corpos. parâmetros construtivos e entendimento de
Apesar de as faces de aplicação do con- fatores clínicos atrelados ao design.
tato serem específicas para cada modelo de
lente, existe uma lógica comum para sua
definição. Na capsula e zônulas, o contato
é definido como Unido e Sem Penetração, o
que, em sua essência, define continuidade
entre dois corpos. Já o contato entre a parte
óptica e a háptica, é definido apenas como
Sem Penetração, sugerindo que os corpos, na
condição inicial, não estão em contato e na
condição de equilíbrio estão em contato, em-
bora ainda assim sejam considerados como
corpos distintos.
Em relação à malha, os tipos de elemento
utilizados foram sempre o elemento trian-
gular de casca, para os corpos relativos às
zônulas e cápsula, e o elemento tetraédrico,
para a lente. Esses elementos são ideais para
o trabalho com geometrias mais complexas.
O refinamento da malha foi estrategi-
camente realizado em faces de contato en-
tre componentes e em regiões de transição
abrupta de espessura. Cada modelo e confi-
guração de plataforma exigiu um refinamen- FIGURA 20 - Modelo com malha grosseira acima
e modelo com malha refinada embaixo
to distinto. Um exemplo de um dos modelos Fonte: Os autores

74 INOVA TALENTOS
03

PROPOSIÇÃO DE
DESIGNS OTIMIZÁVEIS
Foram propostas quatro opções de design
otimizáveis, em dimensões compatíveis
com o estabelecido no levantamento dos
pré-requisitos. Os formatos de hápticas
possuem características mecânicas que
propiciam a maior variação possível em seu
dimensionamento, mantendo a melhor dis-
tribuição de força no contato com o fornix
equatorial capsular.
FIGURA 21 - Plataforma MF-5Y, disponível comercialmente, Além disso, foi desenhada uma angu-
submetida ao modelo de pós-cirúrgico.
Fonte: Os autores lação háptica mais agressiva, que gerasse
maior interação entre a parede capsular pos-
terior e a óptica da lente. Os modelos deve-
Nesse modelo, é possível visualizar não riam abrigar ainda uma óptica de no mínimo
só uma projeção da lente deformada na cáp- 6 mm, levando em consideração a introdu-
sula, mas também a cápsula, deformada em ção de uma borda quadrada. As hápticas
torno da lente. Essa última permite identificar foram projetadas para transmitir o mínimo
se a lente, por exemplo, consegue tocar a par- de deformação possível sobre a lente e pro-
te óptica na cápsula de maneira adequada, de piciar a melhor estabilidade possível à pla-
modo a prevenir a formação de PCO (Opaci- taforma. As propostas ainda se apresentam
ficação posterior de cápsula). em dimensões otimizáveis, via software,
A análise da distribuição da pressão de sendo os formatos mostrados na figura 22.
contato permite conhecer como é a interação
da háptica junto à cápsula e, principalmente,
se a relação estabelecida é simétrica, o que
neutralizaria qualquer tendência ao giro. O
ângulo de contato, por sua vez, pode também
ser avaliado mais fidedignamente do que no
modelo da norma, visto que é levada em con-
ta também a deformação da cápsula.
Da mesma maneira que o modelo anterior,
plataformas conhecidas (ver figura 21) foram
simuladas para verificar seu comportamento
FIGURA 22 - Plataformas sugeridas em dimensões otimizáveis
no modelo, como parâmetro de validação. Fonte: Os autores

PROGRAMA RHAE TRAINEE CNPq – IEL 75


torneamento e fresamento das plataformas.
Os arquivos relativos ao design fabricado
são basicamente dois: o primeiro contendo o
perfil da lente – tanto a face anterior quanto
a posterior – e o segundo apresentando um
desenho do topo da lente, caracterizado pelo
formato predominante das hápticas.
Um arquivo principal de comando. con-
tendo todas as informações de velocidade de
corte, profundidade de corte e avanço entre
as informações sobre a óptica da lente, tam-
bém é gerado.
FIGURA 23 - O software do torno, no qual as platafor-
Visualização pré-fabricação modelo 1 no software do torno.
Fonte: Os autores
mas são introduzidas, permite a visualização
do design antes do corte, conforme ilustra a
figura 23. Isto permite que a plataforma seja
analisada anteriormente à fabricação, identi-
OTIMIZAÇÃO DOS MODELOS ficando-se anomalias ou erros de design.
As plataformas propostas foram então ana-
lisadas nos modelos computacionais cons-
truídos, verificando-se o desempenho de
cada estrutura. Iterativamente, as platafor- RESULTADOS
mas foram analisadas a cada modificação
em suas dimensões. O processo iterativo Foram idealizados, simulados nos dois mo-
era interrompido, à medida que a plataforma delos propostos, aperfeiçoados, fabricados
atingisse os critérios da norma na simulação e normativamente testados quatro modelos
do ensaio e distribuísse a pressão de contato de plataformas de LIOs, capazes de abrigar
uniformemente sobre a háptica, pressionan- uma óptica multifocal tórica, propiciando
do também a zona óptica sobre a face poste- estabilidade mecânica e previsibilidade de
rior capsular. comportamento.
Os designs são apresentados nesta seção,
GERAÇÃO DO ARQUIVO do modelo 1 ao 4 e nas figuras organizadas
DE MÁQUINA, SIMULAÇÃO na Tabela 6. Serão mostradas as principais
DA USINAGEM E FABRICAÇÃO características de cada proposta, uma ima-
Após estabelecer a geometria final de cada gem da plataforma fabricada e os resultados
modelo, é necessário gerar os arquivos para o da ultima simulação em cada modelo CAE.

76 INOVA TALENTOS
03

TABELA 6 - Comparativo de resultados obtidos para os quatro modelos propostos.

MODELO 1

Estruturas
antirrotacionais
PRINCIPAIS RECURSOS
AR-System

_
Foto do modelo fabricado

Marcações de
fácil visualização

Concentrador
de tensão
Borda
quadrada
em 360°

_
Projeção de perfil do modelo fabricado

_
Resultados de simulações de tensões e deformações no modelo pós- cirúrgico
_
Resultados de simulações
de tensões e deformação
no modelo da norma

_
Resultados de simulações
_ de pressão de contato no
Resultados de simulações de distribuições de tensões e ângulo de contato no modelo pós-cirúrgico modelo da norma

PROGRAMA RHAE TRAINEE CNPq – IEL 77


MODELO 2

Estruturas
antirrotacionais
PRINCIPAIS RECURSOS
AR-System

_
Foto do modelo fabricado

Marcações de
fácil visualização

Con-
centrador
de tensão Borda
quadrada
em 360°

_
Projeção de perfil do modelo fabricado

_
Resultados de simulaçõesde tensões e deformações no modelo pós- cirúrgico
_
Resultados de simulações
de tensões e deformação
no modelo da norma

_
Resultados de simulações
_ de pressão de contato no
Resultados de simulações de distribuições de tensões e ângulo de contato no modelo pós-cirúrgico modelo da norma

78 INOVA TALENTOS
03

MODELO 3

Estruturas
antirrotacionais
PRINCIPAIS RECURSOS
AR-System

_
Foto do modelo fabricado

Marcações de
fácil visualização

Concentrador
de tensão Borda
quadrada
em 360°

_
Projeção de perfil do modelo fabricado

_
Resultados de simulações de tensões e deformações no modelo pós- cirúrgico
_
Resultados de simulações
de tensões e deformação
no modelo da norma

_
Resultados de simulações
_ de pressão de contato no
Resultados de simulações de distribuições de tensões e ângulo de contato no modelo pós-cirúrgico modelo da norma

PROGRAMA RHAE TRAINEE CNPq – IEL 79


MODELO 4

Estruturas
antirrotacionais
PRINCIPAIS RECURSOS
AR-System

_
Marcações de Foto do modelo fabricado
fácil visualização

Concentrador
de tensão
Cavidade de
amortecimento

_
Projeção de perfil do modelo fabricado

_
Resultados de simulações de tensões e deformações no modelo pós- cirúrgico
_
Resultados de simulações
de tensões e deformação
no modelo da norma

_
Resultados de simulações
_ de pressão de contato no
Resultados de simulações de distribuições de tensões e ângulo de contato no modelo pós-cirúrgico modelo da norma

80 INOVA TALENTOS
03

ENSAIO FÍSICO DE COMPRESSÃO


As plataformas foram também fisicamente testadas, segundo os procedimentos previstos na
norma, sendo comprimidas a um diâmetro de 10 mm e levadas a um projetor de perfil, para
que pudessem ser colhidos os dados necessários ao ensaio, conforme mostram as imagens
da tabela 7.

VISTA DE TOPO VISTA DO PERFIL

MODELO 1

MODELO 2

MODELO 3

MODELO 4

TABELA 7 - Comparativo de imagens geradas no projetor de perfil.

PROGRAMA RHAE TRAINEE CNPq – IEL 81


RESULTADOS NUMÉRICOS DO ENSAIO DE COMPRESSÃO
A partir dos ensaios de compressão, foram coletadas as medidas para deslocamento axial, des-
centração total, força de compressão, tilt total e rotação interna. Os resultados médios obtidos
a partir das medidas de cinco unidades de cada modelo são mostrados nos gráficos das figura
28, a seguir.

MODELO 4 MODELO 4

MODELO 3 MODELO 3

MODELO 2 MODELO 2

MODELO 1 MODELO 1
0 0,2 0,4 0,6 0,8 0 0,02 0,04 0,06
Deslocamento axial [mm] Descentração [mm]

FIGURA 24 - Medida de deslocamento FIGURA 25 - Medida de descentração total


axial obtida por meio do ensaio mecânico. obtida por meio do ensaio mecânico.
Fonte: Autores. Fonte: Autores.

MODELO 4 MODELO 4

MODELO 3 MODELO 3

MODELO 2 MODELO 2

MODELO 1 MODELO 1
0 0,2 0,4 0,6 0,8 0 0,2 0,4 0,6
Força de compressão [mN] Tilt total [o]

FIGURA 26 - Medida de força de com- FIGURA 27 - Medida de rotação interna


pressão obtida por meio do ensaio mecânico. obtida por meio do ensaio mecânico.
Fonte: Autores. Fonte: Autores.

MODELO 4

MODELO 3

MODELO 2

MODELO 1
0 0,02 0,04 0,06 0,08
Rotação interna [0]

FIGURA 28 - Medida de rotação interna


obtida por meio do ensaio mecânico.
Fonte: Autores.

82 INOVA TALENTOS
03

TESTE DE INJEÇÃO
Os testes de injeção foram executados para verificação da injetabilidade e do comportamento
da plataforma no injetor. As lentes utilizadas no teste foram fabricadas em dioptria média
(22D) sendo verificado se pelo menos uma amostra de cada modelo pôde ser injetada no
injetor especificado (cartucho1.8 mm).
Todos os modelos puderam ser injetados com sucesso, sem quaisquer danos à lente ou
dificuldade no processo de injeção. A sequência do teste de injeção pode ser vista na tabela
8. Um exemplo do procedimento do teste de injeção pode ser visto na figura 29, com o mo-
delo 1 disposto no cartucho do injetor, e na figura 30, com a lente sendo injetada.

FIGURA 29 - Disposição do Modelo 1 no cartucho do injetor. FIGURA 30 - Modelo 1 no processo de Injeção no teste de Injeção.
Fonte: O autor Fonte: O autor

SEQUÊNCIA DO TESTE INJEÇÃO

MODELO ESFORÇO ESTADO FINAL ESTADO FINAL MEMÓRIA INJETOR


DE INJEÇÃO DO CARTUCHO DA PLATAFORMA ELÁSTICA[S] [mm]

MODELO 1 Baixo OK OK 2 1.8

MODELO 2 Baixo OK OK 3 1.8

MODELO 3 Baixo OK OK 2 1.8

MODELO 4 Médio OK OK 2 1.8

TABELA 8 - Sequência do teste injeção

PROGRAMA RHAE TRAINEE CNPq – IEL 83


das plataformas finais diferem do inicialmente
DISCUSSÃO proposto. Diversas iterações foram feitas nas
dimensões em aberto, até que se chegasse ao
A metodologia apresentada contempla ferra- modelo final de cada design.
mentas e procedimentos sofisticados do pon- Cada design foi aperfeiçoado em sua con-
to de vista técnico, mas que oferecem a possi- cepção, sendo os objetivos de alinhamento do
bilidade de se obterem ganhos em velocidade eixo óptico e estabilidade rotacional atendidos
em relação ao desenvolvimento, haja vista ser normativamente. A distribuição da pressão de
menor o número necessário de iterações en- contato ao centro da háptica, ocasionando a
volvendo fabricação e medições, para se che- deformação elíptica do saco capsular, como
gar a modelos que atendam aos requisitos im- ocorre nos modelos 1 e 3, pode ser vantajosa
postos. No presente trabalho, conseguiu-se, para evitar a rotação da plataforma, ainda que
em apenas um ano, conduzir a pesquisa base, não agregue ao objetivo de centralização no
desenvolver os modelos computacionais, con- eixo óptico.
ceber, aperfeiçoar, simular, fabricar e caracteri- O inverso acontece para os modelos 2 e 4.
zar todos os designs apresentados neste tra- Contudo, os valores obtidos no ensaio e simu-
balho. Portanto, a metodologia desenvolvida lação são tão pequenos, que muito dificilmen-
representa, por si só, um resultado intangível te o médico disporia de recursos para posicio-
expressivo. nar a lente de maneira tão precisa no olho do
Em relação aos modelos computacionais paciente. Por isso, avaliam-se como favoráveis
desenvolvidos, pode-se considerar que a re- os resultados de estabilidade obtidos.
produtibilidade alcançada, em relação ao mo- Na avaliação das lentes fabricadas, foi
delo físico normatizado, pôde ser verificada. possível observar, em todas as plataformas, a
Acredita-se que modelos computacionais des- flexão nos pontos concentradores de tensão,
sa natureza possam inclusive vir a compor fu- conforme o planejado. Isso fez com que as
turamente as normas regulatórias, principal- lentes localizassem a deformação em pontos
mente quando a interface mecânica interferir estratégicos, o que é essencial para conferir à
ativamente nos efeitos ópticos da lente, como lente a capacidade de melhor se adaptar a di-
já é o caso de LIOs acomodativas. ferentes diâmetros de cápsula ou ainda supor-
O modelo computacional biomecânico tar melhor uma eventual contração capsular,
traz uma abordagem muito mais abrangen- além de, ao mesmo tempo, preservar a zona
te; o saco capsular que se deforma em torno óptica das citadas deformações.
da lente, mostra efeitos que não se poderiam Por meio da análise da distribuição da
notar nos ensaios regulatórios com suportes pressão de contato no modelo pós-cirúrgico, a
rígidos. No que diz respeito aos modelos pro- plataforma do modelo 1, devido à deformação
postos em dimensões otimizáveis, os designs elíptica do saco capsular, ofereceria grandes

84 INOVA TALENTOS
03

vantagens no emprego com uma lente tórica.


Por outro lado, a plataforma do modelo 4 se CONSIDERAÇÕES FINAIS
destacaria nos critérios de estabilidade reque-
ridos para lentes multifocais. Já o modelo 3 A avaliação nos critérios da norma regulatória
distribui igualitariamente a pressão em toda a mostrou-se favorável, uma vez que os parâ-
háptica, o que é favorável para utilização com metros de qualidade exigidos foram atingi-
uma lente multifocal. Seu formato de háptica, dos. Ao todo, quatro opções de design foram
inscrita em um arco com raio menor do que apresentadas, sendo todas factíveis para uti-
o de compressão, ainda confere ao saco cap- lização no posterior teste clínico. A validação
sular o formato levemente elíptico, também do modelo biomecânico deve ser alcançada
favorecendo a utilização com a lente tórica. na fase pré-clinica, com o implante e a ava-
Uma análise como essa só é possível de- liação em olhos de animais e ex-vivo e, em
vido à simulação no modelo pós-cirúrgico, sequência, na fase clínica, com o estágio de-
que propicia a visualização da deformação nominado try-out, sendo a lente avaliada em
da cápsula em torno da lente e a avaliação da implantes realizados em alguns pacientes.
distribuição de pressão na háptica. Como o Essas validações são as principais indicações
suporte no ensaio da norma é rígido, a maior de trabalhos futuros. Já a validação dos resul-
pressão de contato localiza-se no centro da tados ensaiados pôde ser verificada por meio
háptica, onde a plataforma possui a maior da correspondência entre os valores simula-
dimensão, fato que ressalta a importância de dos e os valores obtidos no ensaio físico.
um modelo de análise que leve em considera- O objetivo deste trabalho foi alcançado,
ção a elasticidade do saco capsular, como o ao apresentar uma metodologia de desenvol-
desenvolvido neste trabalho. vimento e projeto de plataformas para lentes
Devido a fatores mais complexos não intraoculares, capaz de oferecer maior segu-
contemplados no modelo, como, por exem- rança quanto à aplicação em lentes intraocu-
plo, variações na pressão intraocular, pos- lares multifocais tóricas.
síveis anomalias na estrutura das zônulas Tal metodologia faz uso de um processo
ou mesmo no saco capsular, entre outros estruturado de forma científica, com ganhos
fatores clínicos, faz-se necessária uma ava- na performance e redução no tempo de de-
liação clínica das diferentes propostas, para senvolvimento. Essas ferramentas poten-
que seja possível ranquear ou mesmo emitir cializam o trabalho de desenvolvimento, ga-
avaliações comparativas definitivas sobre a rantindo mais opções de designs factíveis
performance in vivo dos diferentes modelos. e válidos, que podem ser encaminhados
Tal avaliação, não incluída no escopo deste seguramente para os testes clínicos, para
projeto, será deixada como indicação para posterior definição sobre sua integração ao
trabalhos futuros. portfólio de produtos da empresa.

PROGRAMA RHAE TRAINEE CNPq – IEL 85


KOHNEN, T. Multifocal IOL technology: a successful
REFERÊNCIAS step on the journey toward presbyopia treatment.
Journal of Catarct & Refractive Surgery, v. 34, n. 12,
BIBLIOGRÁFICAS
p. 2005, dez. 2008. Disponível em: <http://www.
jcrsjournal.org/article/S0886-3350(08)00991-7/
BOWLING, B. et al. Kanski oftalmologia clínica. 8 abstract>. Acesso em: 20 de junho de 2017.
ed. Rio de Janeiro: Elsevier, 2016. 928 p. BURD, H. J.;
JUDGE, S.; CROSS, J. Numerical modelling of the ac- LANCHARES, E.; NAVARRO, R.; CALVO, B. Hypere-
commodating lens. Vis Res, v. 42, p. 2235-2251, 2002. lastic modelling of the crystalline lens: Accommoda-
tion. Journal of Optometry, v. 5, n. 3, p. 110-120, jul.
BURD, H. J. et al. Incremental cost-effectiveness of 2012. Disponível em:<https://www.ncbi.nlm.nih.
initial cataract surgery. Ophthalmology, p. 109-606, gov/pmc/articles/PMC3861002/>. Acesso em: 02
2002. de julho de 2017.

BUSBEE B. G. et. al. Incremental cost-effectiveness of LOTTENBERG, C. O que é retina. Disponível em:
initial cataract surgery. Ophthalmology, v. 109, n. 3, <Lotten Eyes: http://www.lotteneyes.com.br/glos-
p. 606-612, mar. 2002. sario-retina/.>. Acesso em: 20 de janeiro de 2016.

CHANG, D. F. Managing residual refractive errors. LUNDSTROM, M. WENDEL, E. Duration of self


EyeWorld, p. 12-13. mai. 2013. Disponível em: <http:// assessment benefit of cataract extraction: a long

bit.ly/2xiXgav>. Acesso em: 03 de julho de 2017. term study. Br J Ophthalmol, v. 89, n. 8, p. 1017-
1020. Disponível em: <http://bjo.bmj.com/con-
DANTAS, A. M. O cristalino. São Paulo: Cultura tent/89/8/1017.full>. Acesso em: 02 de julho de
Médica, 2012. 536 p. 2017.

ERIE, J. C. Rising cataract surgery rates: demand MARQUES, F. F. Análise das indicações das técnicas
and supply. American Academy of Ophthalmology, v. e das complicações de troca de lente intra-oculares
121, n. 1, p. 2-4, 2014. Disponível em: <http://bit. em pacientes submetidos a cirurgia de catarata.

ly/2fNSxlQw>. Acesso em: 02 de julho de 2017. 2007. Universidade Federal de São Paulo - Escola
Paulista de Medicina, São Paulo. 2007. Disponível
FRIEDMAN, N.; KAISER, P. K.; TRATTLER, W. em: < http://livros01.livrosgratis.com.br/cp057573.
Review of Ophthalmology: expert consult. 2 ed. Lon- pdf>. Acesso em: 02 de maio de 2017.
dres: Elsevier Saunders, 2004. 400 p.
MASSA, E. B. Anatomia e fisiologia do olho. Veja
GENG, J. P.; TAN, K. B., LIU, G. R. Application of Bem Oftalmo. Disponível em: <http://drerickabra-
finite element analysis in implant dentistry: A review silmassa.site.med.br/index.asp?PageName=anato-

of the literature. The Journal of Prosthetic Dentistry, mia-e-fisiologia-do- olho>. Acesso em: 10 de julho
de 2016.
v. 85, n. 6, p. 585- 598, jun. 2001.

PEREIRA, F. A. et al. Miyake-apple posterior


GULTEKIN, B.; GUTEKIN, P.; YASCIN, S. Applica-
video analysis/photographic technique Journal of
tion of finite element analysis in implant dentistry.
Cataract & Refractive Surgery. v. 35, n. 3, p. 577-587,
The Journal of Prosthetic Dentistry, v. 85, n. 6, p. 585-
2009.
598, 2012. Disponível em: <http://bit.ly/2hPBaWg>.
Acesso em: 03 de julho de 2017.

86 INOVA TALENTOS
03

SOUZA, R. M. O método dos elementos finitos


aplicado ao problema de condução decalor. Belém,
Notas de aula, Universidade Federal do Pará, Nú-
cleo de instrumentação e computação aplicacada à
engenharia (NICAE), 2003.

THOMAS, K.; KOCH, D. D. Cataract and refractive


surgery. Berlin: Springer Verlag, 2005. 324 p. Dispo-
nível em: <https://link.springer.com/content/pdf/
bfm%3A978-3-540-26678- 5%2F1.pdf> . Acesso em:
02 de julho de 2017.

TYSON II, F. C. Two keys for maximizing outcomes


with toric IOLs. EyeWorld, v. 18, p. 5, mai. 2013.
Disponível em: <http://digital.eyeworld.org/i/
129516-may-2013/75>. Acesso em: 03 de julho de
2017.

VITALE, S. et al. Prevalence of refractive error. Arch


Ophthalmol, v. 126, n. 8, p. 1111-1119, 2008. Dis-
ponível em: <https://www.ncbi.nlm.nih.gov/pub-
med/18695106>. Acesso em: 03 de julho de 2017.

PROGRAMA RHAE TRAINEE CNPq – IEL 87


04
DESENVOLVIMENTO DE
PROCESSO INDUSTRIAL PARA
RECUPERAÇÃO DE OURO
PRESENTE NO DESCARTE DAS
PLACAS DE CIRCUITO IMPRESSO
FR A NC IE LLY A PA R E C IDA
FE R R E IR A DA S ILVA
_
Engenharia Química
Universidade Federal do Paraná - UFPR - Curitiba, PR, Brasil 2015

KÁTHIA IZUMI IRYODA PERES (Coautora)

Em 2014, iniciou atividades de pesquisa, desenvolvimento


e inovação na área de produção de placas de circuitos
impressos, adquirindo conhecimentos sobre o processo
produtivo e também atuando na área ambiental, em especial
no que tange ao gerenciamento de resíduos sólidos.

francielly01@yahoo.com.br

Rua Fausto Pereira, 246


CEP: 81170-130
Curitiba, Paraná

(41) 9982-25152

89
R E SU M O

processo de recuperação de ouro, descarte


PALAVRAS CHAVE de placas de circuito impresso, lixiviação ácida.

Como a recuperação de ouro das placas de circuito impresso é realizada atualmente ape-

nas em países como Bélgica, Holanda e Alemanha, entre outros, todo o resíduo gerado no

Brasil é exportado e recuperado no exterior. Este projeto busca desenvolver um processo

para recuperação de ouro presente na forma metálica das placas de circuito impresso

(PCI’s) que possuem ouro em seu acabamento e são descartadas por falhas no processo

produtivo. A recuperação do ouro foi realizada a partir de um processo de lixiviação áci-

da, técnica menos agressiva ao meio ambiente e ao ser humano, se comparada às que

utilizam produtos tóxicos, como o cianeto – ou mesmo por pirólise, onde o consumo de

energia é muito alto. Foram realizados testes com o objetivo de se chegar à condição óti-

ma de consumo de produtos químicos, recuperação e pureza do metal, obtendo-se ouro

com pureza de 22k. Após a determinação das condições ideais, foi realizado o projeto de

construção de um equipamento, capaz de fazer essa recuperação em maior escala. Trata-

-se de uma proposta inovadora que, no contexto atual do Brasil, é sinônimo de redução de

custos e de benefícios ambientais, provocando ainda o aquecimento do mercado interno

nesse ramo.

90 INOVA TALENTOS
04

A BSTR ACT

KEYWORDS gold recovery process, printed circuit board disposal, acid leaching.

Currently gold recovery from printed circuit boards is only carried out in countries such as

Belgium, the Netherlands, Germany, among others, and all the waste generated in Brazil

is exported and recovered abroad. This project seeks to develop a process for recovering

gold in the metallic form of printed circuit boards (PCI’s) that have gold in their finish and

are discarded by failures in the production process. The recovery of the gold was made

from an acid leaching process, a technique less aggressive to the environment and the

human being when compared to those that use toxic products such as cyanide or even

pyrolysis where the energy consumption is very high. Tests were carried out in order to

reach the optimum condition of chemical consumption, recovery and purity of the metal,

obtaining gold with a purity of 22k. After the determination of the ideal conditions, the

design of an equipment capable of making this recovery on a larger scale was carried out.

It is an innovative proposal and in the current context of Brazil, a regenerative equipment

is synonymous with reducing costs and environmental benefits, as well as heating the

domestic market in this area.

PROGRAMA RHAE TRAINEE CNPq – IEL 91


processo que, além de baixíssimo rendimen-
INTRODUÇÃO to, implica alto consumo de energia, além de
não permitir a obtenção de metal puro (VEIT,

O
ritmo de crescimento da fabricação 2005). Os processos eletrometalúrgicos ne-
e consumo de equipamentos eletrô- cessitam de uma etapa anterior – a da hidro-
nicos, combinado à redução da vida metalurgia – pois os metais precisam já estar
útil desses equipamentos, traz a necessida- em solução, na forma metálica e impura. Nes-
de do desenvolvimento de novas técnicas se caso, a eletrometalurgia (eletrorecuperação
para a recuperação do lixo. Atualmente no ou eletrorefino) purificará o metal. A vantagem
Brasil são gerados cerca de 3 ton./mês de é que esse processo possui poucas etapas, e
resíduo, oriundo de placas de circuito im- os metais obtidos contêm elevado teor de pu-
presso (PCI’s) com acabamento em ouro, ex- reza. Além disso, o tempo de vida do eletrólito
portadas, em sua totalidade, para a remoção é longo, evitando muitas regenerações.
dos metais preciosos. Por outro lado, a hidrometalurgia conso-
Embora existam muitas técnicas para a me grande quantidade de energia, sendo ne-
recuperação de ouro, tais como o processa- cessário um pré-tratamento de remoção de
mento mecânico, eletrometalurgia, hidrome- metais da placa para a solução, para só então
talurgia, processos em altas temperaturas ocorrer a eletrólise (MENETTI et al., 1995).
e biológicos (SANT’ANNA, 2011) normal- Por sua vez, a pirometalurgia ocorre em
mente são empregadas técnicas em série altas temperaturas e consiste na incinera-
para uma recuperação mais eficiente, que se ção, fundição em forno arco de plasma ou
complementam umas às outras. (MENETTI alto-forno, pirólise, drossagem, sinterização,
E TENÓRIO, 1995). fusão e reações com fases gasosas em altas
O processamento mecânico, normal- temperaturas (CUI, et al., 2008). Esse é um
mente utilizado como pré-tratamento, tem dos processos mais tradicionais, utilizado
como função reduzir o volume e aumentar pela Umicore como método para recuperar
a superfície de contato, contemplando as metais – em especial metais preciosos (HA-
seguintes etapas: cominuição, classificação GELUKEN, 2008).
e separação. É um processo totalmente fí- A recuperação de metais mediante a uti-
sico, para o qual são necessários processos lização de altas temperaturas possui várias
subsequentes para a recuperação dos metais etapas, e os metais preciosos recuperados
(SANT’ANNA, 2011). possuem alto valor de pureza. Entretanto, o
Ainda que possua a vantagem de possibi- método apresenta muitas limitações, entre
litar a reciclagem de qualquer tipo de resíduo as quais a necessidade de combinação com
eletrônico e metais, não se pode dispensar a outros processos – para impedir adversida-
moagem, utilizada na etapa da cominuição, des que interfiram na pureza final – além da

92 INOVA TALENTOS
04

presença de halogenados na composição clorídrico, juntamente com o nítrico (água


da PCI que, combinados à alta temperatura, régia), são muito utilizados para a recupe-
causam a geração de dioxinas, que são po- ração de ouro. Porém, ao se utilizarem es-
luentes tóxicos e persistentes. ses ácidos, é necessária uma etapa seguinte
Além disso, componentes vítreos e cerâ- para a precipitação de ouro ou outro metal
micos podem causar o aumento na produ- desejado (SHENG,2007).
ção de escória no alto-forno, o que promove Mesmo que a hidrometalurgia tenha
a perda de metais em geral, inclusive os pre- como desvantagem o efeito limitado da rea-
ciosos. Para se obter um metal precioso de ção química – dependendo da superfície de
alta pureza, faz-se necessário realizar o re- contato e da utilização de produtos quími-
fino à parte, com a contribuição de técnicas cos corrosivos – optou-se neste projeto pela
eletroquímicas (CUI, et al., 2008) utilização do ácido nítrico diluído, para a so-
A biometalurgia é o método mais re- lubilização de níquel e cobre e recuperação
cente – sua utilização vem crescendo – que de ouro puro,
ainda vem sendo estudado. O processo se Esse é um método preciso, facilmente
divide entre biolixiviação e biossorção. Mui- controlável e que gera menor impacto am-
tos microrganismos, entre eles algas, bacté- biental, além de fácil separação de metais e
rias, leveduras e fungos, têm a propriedade custo mais baixo. Apesar de a reciclagem de
de acumular metais, sejam eles pesados ou PCI’s não ser um processo simples, em vir-
preciosos. Como vantagens, destacam-se o tude de sua estrutura interna, torna-se atrati-
baixo custo para operar, baixa utilização de vo pela quantidade de metais preciosos que
produtos químicos e eficiência (CUI, et al., possui (VEIT, 2005)
2008). Porém, ainda é um processo que ne-
cessita superar alguns desafios para a utiliza-
ção em escala industrial (SANT’ANNA, 2011).
O processo de recuperação de ouro pro- OBJETIVOS
posto nesse projeto utiliza a hidrometalur-
gia, baseada na lixiviação, que nada mais é Pretende-se desenvolver um processo para
do que a extração de metais utilizando sol- recuperação de ouro, na forma metálica das
ventes. Atualmente, os principais lixiviantes placas de circuito impresso (PCI’s) / bordas
utilizados para recuperar metais preciosos de PCI’s, rejeitadas por falhas no processo
são o cianeto (muito tóxico) ácidos de hale- produtivo ou recebidas por meio de logística
tos, tioureia e tiossulfato (CUI et al., 2008), reversa. O interesse para recuperação des-
sendo que o solvente a ser utilizado deve ser se ouro vem do alto valor agregado a esse
direcionado ao metal que se deseja recuperar. metal e também da percepção de que uma
Atualmente o ácido sulfúrico e o ácido grande quantidade é perdida no processo

PROGRAMA RHAE TRAINEE CNPq – IEL 93


produtivo das placas, seja por falhas no pro- zando o ácido nítrico PA, por meio de uma
cesso, seja porque, durante a produção, as reação enérgica, o ouro pôde ser removido
bordas do painel, que possuem ouro deposi- facilmente. Esse primeiro teste foi qualitati-
tado, são descartadas. Essa sucata eletrônica vo, apenas para determinar qual dos ácidos
atualmente é enviada a empresas que pagam agiria, visualmente, de maneira mais efetiva.
muito pouco pelo resíduo, enviado para o ex- Determinado o ácido a ser utilizado, fo-
terior para reciclagem, pois no Brasil ainda ram realizados vários testes, variando a por-
não existe tecnologia semelhante. centagem de ácido nítrico e água, tempera-
tura e tempo de reação para a obtenção da
melhor condição e maior eficiência.
Além disso, reduziu-se a utilização de
MÉTODO ácido para menor impacto ambiental, pois,
quanto maior a concentração de ácido utili-
Para recuperar o ouro presente nas placas de zada, maior é também a geração de fumaça
circuito impresso, optou-se pelo método da tóxica. Após a determinação das melhores
hidrometalurgia. Porém, como uma das des- condições, 40 experimentos foram realiza-
vantagens do método é a utilização de áci- dos para recuperar uma quantidade de ouro
dos fortes e muito corrosivos, foi realizado suficiente para o teste de pureza.
um estudo para verificar a possibilidade da O ácido nítrico reage e dissolve todos os
diluição, tornando esses ácidos mais fracos metais da tabela periódica, exceto ouro e pla-
e menos agressivos ao meio ambiente, além tina. Portanto, em reação com a superfície da
de permitir a otimização da quantidade de placa consegue retirar o ouro, níquel e cobre.
produto químico consumida. Esses dois últimos ficam abaixo do acaba-
Foram realizados testes com ácido sulfúri- mento em ouro, dissolvidos na solução áci-
co e nítrico, a fim de verificar se as duas subs- da, o que permite que o ouro seja retirado na
tâncias eram capazes de lixiviar o ouro. Utili- forma sólida, de acordo com a reação abaixo:

94 INOVA TALENTOS
04

Para a realização de cada teste, 600 g de


placas de circuito impresso com acabamen-
to em ouro foram cortadas em pequenos
pedaços e inseridas em um béquer. Inicial-
mente, para verificar a temperatura ideal
para a reação, inseriu-se o ácido nítrico co-
mercialmente vendido (em concentração de
53%) no béquer, de forma que encobrisse as
placas, após aquecido. Nesse teste, realiza-
do em duas temperaturas diferentes, verifi-
cou-se , em temperatura acima do ambiente,
a formação de um sólido branco, que impos-
sibilitava a remoção do ouro. FIGURA 1 - Lixiviação ácida
Fonte: Elaborada pelo autor
Em seguida, os testes prosseguiram, va-
riando-se o tempo de reação e a porcenta-
gem de ácido nítrico 65% e água. O níquel
e o cobre ficam dissolvidos na solução de
ácido nítrico, sendo que o ouro apenas foi
desprendido da placa, sob a forma de peque-
nas cascas.
A reação começa a ocorrer após alguns
minutos e é rápida. No momento da reação,
desprende-se do béquer um vapor tóxico de
coloração avermelhada, o que fez com que
todos os testes fossem realizados dentro da
capela. Após a separação do ouro, a solução é
filtrada e o ouro metálico fica retido no filtro.
A realização de todos os testes foi um FIGURA 2 - Filtração do ouro metálico
Fonte: Elaborada pelo autor
processo que demandou muito tempo, em
virtude do lento processo de filtragem e lava-
gem. Se o ouro recuperado não for bem lava-
do, haverá uma baixa significativa na pureza,
após fundição. As figuras 1, 2 3 e 4 ilustram
as etapas descritas:

PROGRAMA RHAE TRAINEE CNPq – IEL 95


Para a determinação da pureza do ouro
recuperado ao final dos 40 testes, juntou- se
uma quantidade de 9,211 g do metal, que foi le-
vado a um joalheiro para verificação da pureza.
No processo de verificação, a amostra foi
pesada e queimada em alta temperatura, me-
diante a utilização do gás oxigênio e de um
maçarico. Na queima, ocorre a separação das
impurezas do ouro, o que resultou na obten-
ção de uma peça pequena do metal. A peça
foi testada pelo joalheiro e verificou-se que o
grau de pureza obtido foi de 22k (quilates).
FIGURA 3 - Placas que sofreram o processo de lixiviação ácida Após a determinação das condições de
Fonte: Elaborada pelo autor
reação e obtida a recuperação de ouro, foi re-
alizado o projeto de um equipamento capaz
de realizar a recuperação sugerida em maior
escala. Vale ressaltar que os testes foram rea-
lizados em um béquer, portanto em pequena
quantidade. O projeto foi baseado em equi-
pamentos já existentes para a produção de
placas de circuito impresso, principalmente
com relação ao meio de transporte de placas.
Foram verificadas também medidas de con-
trole para a geração de vapor e saídas para o
devido descarte do efluente ácido, gerado no
processo de lixiviação ácida.

FIGURA 4 - Ouro metálico recuperado.


Fonte: Elaborada pelo autor

96 INOVA TALENTOS
04

RESULTADOS

TESTES PARA DETERMINAÇÃO DA MELHOR CONDIÇÃO PARA A REAÇÃO


Os resultados dos testes para a verificação das condições ideais constam da tabela 1, a seguir

DADOS EXPERIMENTAIS

TESTE PESO DAS VOLUME DA % TEMPERATURA TEMPO QUANTIDADE RECUPERAÇÃO OURO


PLACAS SOLUÇÃO Ácido nítrico (°C) DE REAÇÃO DE GASES DE OURO FICOU
(g) (ácido nítrico 53% (min) GERADO (g) RETIDO NAS
+ água) PLACAS?
(ml)
1** 600 500 80 80 30 ALTA - -

2** 600 800 80 45 30 ALTA - -

3 600 500 80 25 60 ALTA 0,107 SIM

4 600 600 80 25 60 ALTA 0,123 SIM

5 600 700 80 25 60 ALTA 0,189 SIM

6 600 800 80 25 60 ALTA 0,202 POUCO

7 600 850 80 25 60 ALTA 0,225 NÃO

8 600 850 75 25 60 ALTA 0,220 NÃO

9 600 850 66 25 60 MÉDIA 0,224 NÃO

10 600 850 50 25 60 MÉDIA 0,224 NÃO

11 600 850 50 25 30 MÉDIA 0,223 NÃO

12 600 850 40 25 30 BAIXA 0,172 SIM

13** 600 850 40 50 30 BAIXA - -

NOTAS:
Não foi possível pesar o ouro recuperado.

TABELA 1 - Dados experimentais

PROGRAMA RHAE TRAINEE CNPq – IEL 97


TESTES PARA DETERMINAÇÃO DA PUREZA DO OURO RECUPERADO
Após a determinação das melhores condições para a reação de retirada do ouro das placas de
circuito impresso, foram realizadas mais 40 lixiviações, utilizando a condição ideal definida, a
fim de se obter uma quantidade significativa de ouro para a verificação da pureza. Na tabela 2,
são descritos os dados obtidos para cada experimento.

DADOS EXPERIMENTAIS

ITEM PESO DE OURO ITEM PESO DE OURO ITEM PESO DE OURO


(g) (g) (g)

1 0,213 14 0,256 27 0,231

2 0,225 15 0,23 28 0,22

3 0,235 16 0,210 29 0,214

4 0,263 17 0,226 30 0,235

5 0,231 18 0,215 31 0,23

6 0,245 19 0,24 32 0,236

7 0,212 20 0,225 33 0,215

8 0,285 21 0,223 34 0,235

9 0,246 22 0,221 35 0,22

10 0,235 23 0,234 36 0,24

11 0,215 24 0,231 37 0,210

12 0,23 25 0,233 38 0,226

13 0,256 26 0,24 39 0,214

40 0,237

TABELA 2 - Dados experimentais

98 INOVA TALENTOS
04

PROJETO DE EQUIPAMENTO DE RECUPERAÇÃO


DE OURO DE PLACAS DE CIRCUITO IMPRESSO DESCARTADAS
O equipamento de recuperação deverá ser fabricado inteiramente em plástico polipropileno,
devido à acidez dos produtos envolvidos no processo. Foi projetado com base em equipamen-
tos que produzem placas de circuito impresso e possui capacidade para recuperar ouro de 20
kg de painéis/dia. O projeto pode ser observado nas figuras 5 e 6 abaixo:

1Entrada de placas de circuito impresso / bordas de placas / painéis


2Saída das placas sem ouro
3Módulo 1 de recuperação de ouro
4Módulo 2 lavagem das placas/painéis/bordas FIGURA 5
Projeto do equipamento
5Exaustão para sucção de dióxido de nitrogênio para recuperação de ouro
– Vista frontal
6Exaustão do módulo 2
Fonte: Elaborada pelo autor
7Filtro para retenção de ouro do Módulo 1
8Filtro para retenção de ouro do Módulo 2
9Saída de solução saturada para a ETE
!0Saída de água para o Tanque de armazenamento de água
!1Entrada de água de lavagem
!2Tanque de armazenamento de água
!3Bomba para sucção de água de lavagem
!4Válvula de retenção do Módulo 1
!5Válvula de retenção do Módulo 2
!6 Bicos de lavagem do Módulo 1

PROGRAMA RHAE TRAINEE CNPq – IEL 99


FIGURA 6
Projeto do equipamento
para a recuperação de
ouro – Vista em 3D.

Fonte: Elaborada pelo autor

O processo se inicia com uma esteira, que succionada pela exaustão do módulo 1.
leva as placas para dentro do equipamento. Ao Após o término da reação, a esteira trans-
entrarem no módulo 1, haverá uma bandeja, portadora voltará à posição inicial, restando
avolumada com a solução de 50% de ácido ní- na bandeja a solução de ácido nítrico, que,
trico (53%) e 50% de água. A esteira transpor- nesse momento, irá conter também cobre e
tadora descerá até que as placas entrem em níquel dissolvidos, além de pequenas pelícu-
contato com a solução, iniciando-se a reação. las de ouro.
Os painéis/bordas de painéis ficarão para- Assim que houver a saturação da solução
dos dentro do módulo 1 por aproximadamen- da bandeja, deverá ser aberta a válvula de sa-
te 30min sendo que, no momento da reação, ída do Módulo 1, fazendo com que o líquido
irá formar-se uma fumaça vermelha, que será contendo ouro desça então pela tubulação,

100 INOVA TALENTOS


04

que possui um filtro na parte interior, capaz


de reter as películas de ouro. .
DISCUSSÃO
Em seguida, será feita a lavagem do Mó-
dulo por jatos de água em alta pressão, im- Como pôde ser observado na tabela 1, os tes-
pedindo que partículas de ouro dentro da tes realizados na temperatura acima de 25°C
máquina. A solução descartada seguirá para não puderam ser finalizados, pois, ao esquen-
a estação de tratamento de efluentes, onde tar o ácido nítrico 53% diluído, formou-se um
será diluída e neutralizada. A remoção de sólido branco no fundo, que aderiu ao ouro
metais será feita, e o lodo gerado será co- purificado e não pôde ser desprendido com
processado. a lavagem.
Os painéis seguirão para o Módulo 2 pela Como todas as amostras testadas com
mesma esteira transportadora. No módulo aquecimento tiveram que ser descartadas, os
2, haverá a lavagem de alta pressão com testes seguintes foram realizados na tempe-
água, para retirar as pequenas películas de ratura ambiente – fator importante, conside-
ouro presas nos painéis. A água utilizada rando que não haverá consumo de energia
para a lavagem das placas será reutilizada e nesse processo.
armazenada no tanque de armazenamento. Determinada a temperatura, a análise
Na saída do módulo 2, também há um filtro passou a ser feita pela quantidade de solução
preso à tubulação para reter o restante do necessária para lixiviar 600g de placas con-
ouro. Os filtros deverão ser removidos ma- tendo ouro. Nos testes onde há a descrição
nualmente e lavados, secos e enviados a um de “POUCO”, uma parte pequena de cobre,
local especializado para a fusão do ouro. Os níquel e ouro ficou retida em algumas partes
painéis sem metais, que sairão do Módulo da placa. Onde há a descrição de “SIM”, gran-
2, serão enviados para empresas especiali- de quantidade de metais ficou ainda na placa.
zadas em coprocessamento. Com base na quantidade de ouro recu-
O equipamento possui 1 m de altura e perada, foi determinada a quantidade de
profundidade e 2 m de comprimento, com solução por grama de placa, que chegou ao
capacidade de recuperar 20 kg de placas/ valor de 1,41 ml de solução/g de placa de
painéis/bordas com ouro por dia, e 440 kg circuito impresso. Após a determinação da
de placas por mês. O tanque de armazena- quantidade de solução, foi analisada qual
mento de água tem a capacidade máxima de porcentagem de ácido nítrico conseguiria
armazenar 200 L de água. A bandeja possui retirar a totalidade de metais da placa e ge-
capacidade de 150 L de ácido nítrico, que rar a menor quantidade de gases possível.
chega à saturação após a passagem de 211 Portanto, observando a Tabela 1, o teste 11
kg de placas. Portanto, será descartado a apresentou os melhores resultados, forman-
cada 14 dias. do menor quantidade de óxido nitroso para

PROGRAMA RHAE TRAINEE CNPq – IEL 101


aproximadamente a mesma quantidade de e do efluente que irá para a estação de trata-
ouro recuperada. mento. Para o coprocessamento de 300 kg de
Quanto maior a concentração de ácido ní- placas serão despendidos R$105,00, além das
trico na solução, maior a geração de gases de despesas com um colaborador para operar a
óxido nitroso. Com relação ao tempo, a rea- máquina. O custo do equipamento ficará em
ção inicia-se após aproximadamente 3min, e a torno de R$135.000,00 (Fabobombas e equi-
maior parte dos metais sai nos 30min seguin- pamentos Ltda), valor que poderá ser pago
tes . Após esse período, a solução já fica na em aproximadamente 1 ano.
coloração esverdeada, devido à alta concentra- Levando em conta apenas 300 kg de pla-
ção de cobre e níquel dissolvidos. cas de circuito impresso, equivalente ao re-
Após o processo de lixiviação do ouro, síduo de uma empresa, o projeto pode não
filtração e lavagem, a amostra foi enviada ao parecer muito atrativo, porém pensando em
joalheiro, que conseguiu uma recuperação de buscar outras fontes de geração de PCI’s essa
84%, pureza de um ouro de 22k. De acordo quantidade pode ser muito maior, necessitan-
com os procedimentos experimentais e os do de um projeto mais abrangente , capaz de
resultados obtidos, pode-se verificar que a aumentar o lucro da planta.
condição ótima para a lixiviação é que ocorra
a 25°C, por 30min, com concentração de ácido
nítrico 53% de 50% e a proporção de 1,41 ml CONSIDERAÇÕES FINAIS
de solução (ácido nítrico 53% + água) / g de
placa de circuito impresso. Analisando os experimentos e os resultados
O projeto de equipamento desenvolvido obtidos, pode-se verificar que o método pro-
mostra-se eficaz pela simplicidade e pela faci- posto para a recuperação de ouro das placas
lidade de recuperar ouro. Quanto aos lucros, de circuito impressos é satisfatório, recupe-
considerando que são geradas aproximada- rando o ouro com altíssima pureza e em ele-
mente 300 kg de rejeitos de placas de circuito vado percentual, em relação à quantidade to-
impresso por mês, a cada 600 g de placa são tal de ouro de cada placa. Portanto, o método
extraídos 0,2 g de ouro puro. Portanto, seria pode ser utilizado na recuperação de ouro. O
possível recuperar 100 g de ouro por mês, no processo desenvolvido é de construção bas-
valor de aproximadamente R$17.000,00. tante simples e poderá gerar lucros para a
Quanto às despesas, para a recuperação empresa, pois o ouro recuperado atualmente
de 300 kg de placas, utilizaríamos aproxima- é vendido por um preço muito baixo. Além
damente 420 kg de ácido nítrico 53%, gerando das questões financeiras, o projeto reduz os
uma despesa de R$1.008,00. As outras des- impactos ambientais, impedindo a geração de
pesas seriam provenientes da soda cáustica passivo ambiental e garantindo a correta des-
50% para a neutralização do lavador de gases tinação de resíduos.

102 INOVA TALENTOS


04

SHENG, P. P. e ETSELL, T.H. Recovery of gold from


REFERÊNCIAS comuter circuit board scrap using aqua regia. Waste
BIBLIOGRÁFICAS Management & Research, 2007, Vol.25 p. 380-383.

VEIT, H.M. Reciclagem de cobre de sucatas de pla-


COOMBS, C.F.J Printed Circuit Handbook. 5th.ed cas de circuito impresso.. Escola de engenharia. Pro-
New York: Mc Graw-Hill,1996 grama de pós graduação em emgenharia Minas,
Metalurgica e de Materiais. UFRS. Porto Alegre,
COSTA, M.A.F; COSTA, M.F.B. Projeto de pesquisa 2005. Tese de doutorado em Engenharia.
– Entenda e faça. 6a ed Petrópolis, RJ: Vozes, 2015
WEISZ, J. Projetos de inovação tecnológica: Planeja-
CUI, J. , ZHANG,L. Metallurgical recovery of metals mento, formulação, avaliação, tomada de decisões.
from eletronic wast: A Review. Journal of Hazar- IEL Brasília, 2009
dous Materials, 2008, Vol 158.

FABOBOMBAS. Fabobombas e equipamentos


LTDA. Consulta em 28/07/2016.

FARAMAZI, M. A . et al. Metal solubilization from


metal containing solid materials by cyanogenic
Chromobacterium violaceum. Jornal of Biotechno-
logy, 2004, Vol. 113.

HAGELUKEN, C. Opportunities & challenges to


recover scarce and valuable metals from eletronic
devices. OECD-UNEP Conference on Resource
Efficiency. Paris, 2008, Vol. April 24.

MENETTI, R.P. , TENÓRIO, J.A.S. Reciclagem de


metais preciosos a partir de sucata eletrônica. 50°
Congresso Anual da ABM, 1995.

MORIN, D., et al. BioMinE – Integrated project for


the development of biotechnology for metal-bea-
ring material in Europe. Hydrometallurgy, 2006,
Vol.83,1-4.

SANT ‘ANA, H.B.S. Caracterização de placas de


circuito impresso de aparelhos de telefone celular
visando recuperação de metais valiosos. Progra-
ma de pós graduação em ciência dos materiais e
metalurgia. PUC-Rio, Rio de Janeiro, 2011.Tese de
mestrado.

PROGRAMA RHAE TRAINEE CNPq – IEL 103


05
SISTEMA DE
COMPRESSÃO VARIÁVEL
OTIMIZANDO MOTORES
PARA O USO DE ETANOL
GU S TAVO S A NTOS LOPE S
_
Mestre em Engenharia Mecânica
Robert Bosch
GS/ENS-LA | Engenharia de Sistemas
Engenheiro de Desenvolvimento de Produtos

Agradeço a colaboração, o suporte e a motivação


dos coautores Erwin Karl Franieck, Paulo César
de Ferreira Gomes e Carlos Fernando Mendes.

Agradeço à Robert Bosch Ltda, pela oportunidade


de desenvolver este projeto em um ambiente
inspirador e inovador. Agradecemos o
financiamento e a subvenção da FINEP para a
realização deste projeto.

gustavo.lopes@br.bosch.com
gustavosl.mec@gmail.com

Robert Bosch Ltda


Via Anhanguera, Km 98
Bairro Boa Vista - Campinas - SP
CEP: 13.065-900

(19) 9 96524366

105
R E SU M O

Motor a combustão interna; razão volumétrica de compressão;


PALAVRAS CHAVE eficiência de conversão de combustível; etanol.

O Brasil se destaca por ser um país majoritariamente composto por veículos bicombus-

tíveis,, com motores adaptados ao uso de gasolina, que trazem efeitos colaterais que vão

muito aquém das possibilidades propiciadas pelo uso do etanol. Este trabalho objetiva

desenvolver uma nova solução, que permita a otimização dos motores a combustão para

o uso de etanol, sem prejudicar seu desempenho original com gasolina. Testes em motor

monocilindro de pesquisa foram realizados, para identificar as melhores razões volumétri-

cas de compressão, mostrando os ganhos de eficiência propiciados pela associação com

outras tecnologias. Os resultados mostraram ganhos de eficiência promissores, solidifi-

cando o desenvolvimento de uma tecnologia para a ampliação do uso de etanol e redução

das emissões dos gases de efeito estufa.

106 INOVA TALENTOS


05

A BSTR ACT

KEYWORDS Internal combustion engine; volumetric compression ratio;


fuel conversion efficiency; ethanol.

Brazil stands out as a country with a fleet composed mostly by Flex-Fuel vehicles. The

side effects present in these vehicles are notorious, with engines adapted to the use of

gasoline, but much less than the possibilities afforded by the use of ethanol. This work

aims to develop a new solution that allows combustion engines to be optimized for the use

of ethanol without damaging their original performance with gasoline. Tests in a single

cylinder research engine were conducted to identify the best volumetric compression ratios,

showing the efficiency gains provided by the association with other technologies. The

results showed promising efficiency gains, solidifying the development of the technology to

increase the use of ethanol and reduce emissions of greenhouse gases.

PROGRAMA RHAE TRAINEE CNPq – IEL 107


dos combustíveis fósseis e abrindo caminho
INTRODUÇÃO para uma maior disseminação do uso de eta-
nol em nossos veículos.
Entretanto, considerar a emissão de gases

N
o passado, aquecimento global, ga- originada apenas nos motores de combus-
ses de efeito estufa, eficiência ener- tão não é suficiente, haja vista ser essencial
gética e problemas ambientais eram incluir também a contribuição de emissão
temas discutidos pontualmente por pessoas durante a produção e o transporte de com-
e instituições ligadas ao clima. Entretanto, a bustível, do poço à roda (Well-to-Wheel). Ao
cada dia que passa a preocupação mundial fazê-lo, é possível demonstrar que os moto-
se eleva, à medida que nos conscientizamos res movidos a etanol serão uma alternativa
dos efeitos colaterais que podemos sofrer importante para alcançar os alvos de emis-
no futuro, se não começarmos a agir para são de CO2 em 2030, quando comparados
reduzir os impactos da existência huma- com outras tecnologias do grupo motopro-
na em nosso ecossistema. Nesse contexto pulsor, do ponto de vista econômico [1].
mundial, é de conhecimento de todos que o Quando falamos do uso de etanol e de ve-
uso de combustíveis fósseis é um dos princi- ículos bicombustíveis, o Brasil toma a frente
pais fatores que contribuem para a emissão no cenário mundial desde 2003, com o lan-
de CO2 na atmosfera e que a redução do uso çamento da tecnologia Flex-Fuel [2]. Assim
desses combustíveis é uma das principais como o Brasil, mais de 60 países já tornaram
rotas para amenizar os efeitos nas mudan- obrigatória a adição de biocombustíveis aos
ças climáticas. combustíveis fósseis, melhorando a eficiên-
Em 2015, a 21ª Conferência das Nações cia energética de seus veículos e contribuin-
Unidas sobre Mudança Climática em Paris, do com os anseios ecológicos por menos po-
COP21, aprovou acordo entre 195 países, de- luição atmosférica [3].
finindo estratégias para amenizar os efeitos Nessa busca crescente por melhor eficiên-
das mudanças climáticas, de modo a manter cia energética, o Brasil, em 2012, introduziu
o aquecimento global abaixo dos 2°C. O Bra- um novo regime automotivo, denominado
sil foi um dos países que, em 2016, assumiu INOVAR Auto, que almejava, além de maio-
o compromisso voluntário de reduzir suas res investimentos em pesquisa e desenvol-
emissões de gases de efeito estufa em 43%, vimento, segurança e uma maior produção
até 2030. nacional de componentes, veículos com me-
Para cumprir com esse compromisso, nor consumo de combustível e, consequen-
definiu-se como meta investir no aumento temente, melhor aproveitamento energético.
do consumo de energias renováveis, tornan- Seguindo esta linha, para entregar os
do sua matriz energética menos dependente compromissos assumidos com a COP21 e

108 INOVA TALENTOS


05

desenvolver um programa nacional de “Efi- quisas e tempo, tornando o resultado um


ciência Energética Sustentável”, o programa enorme desafio para a engenharia automoti-
RenovaBio foi lançado em 2016, para con- va nacional. Mas não basta investir em ape-
solidar e garantir a expansão da produção e nas uma direção. É preciso estudar a cadeia
do uso de biocombustíveis, tendo o etanol como um todo, desenvolvendo novos proje-
como carro-chefe [4]. tos de motores [5,6,7], novos combustíveis
Importante salientar que, quando fala- [8] e até mesmo novas fontes alternativas de
mos de eficiência energética em automóveis, energia [9], como o etanol de milho, batata
não basta apenas investir em novas políticas ou beterraba, recuperação da energia des-
energéticas. Existem diversos fatores agre- perdiçada pelo automóvel, entre outros.
gados, tais como o projeto de suspensão Historicamente, a otimização da taxa de
e pneus, peso e aerodinâmica do veículo, compressão conforme o combustível utiliza-
além do aproveitamento eficiente dos moto- do é uma das rotas mais eficientes para o
res usados, que contribuem para o melhor aumento da eficiência de conversão do com-
ou o pior aproveitamento da energia forne- bustível e consequente aumento da eficiên-
cida pelo combustível. Sendo assim, faz se cia energética [10,11]. Infelizmente, essa rota
necessário o investimento em tecnologias, jamais foi aplicada para a otimização do uso
que propiciem um melhor e maior uso dos de etanol em veículos Flex-Fuel, inutilizando
biocombustíveis, ou seja, devemos produzir as propriedades antidetonantes desse com-
motores Flex-Fuel otimizados, para o uso de bustível e a possibilidade de se reduzirem
etanol de forma mais eficiente. ainda mais as emissões de gases de efeito
Atualmente, o que encontramos no Brasil estufa na atmosfera.
são veículos Flex-Fuel otimizados para o uso Tentando reverter os caminhos adotados
da gasolina, com taxas de compressão limi- até o momento no mercado brasileiro, este
tadas pela ocorrência de fenômenos de deto- trabalho visou estudar a fundo a influência
nação, desconsiderando os possíveis ganhos da razão volumétrica de compressão na efi-
de eficiência de conversão de combustível ciência de conversão de combustível e quais
propiciados pelas propriedades antidetonan- os ganhos advindos da associação com ou-
tes do etanol, superiores às da gasolina. Che- tras tecnologias, como a recirculação interna
gamos então à conclusão quanto à necessi- dos gases de exaustão (iEGR) e a otimização
dade de tecnologias, capazes de aproveitar da estrutura de fluxo (Tumble e Swirl), em
de maneira mais eficiente as propriedades um motor monocilindro de pesquisa com
do etanol, ajustando a taxa de compressão sistemas de injeção direta (DI) e indireta
conforme o combustível utilizado. (PFI), quando abastecido com os combus-
Desenvolver esse tipo de tecnologia de- tíveis brasileiros (gasolina - E22 e etanol hi-
manda grandes investimentos, muitas pes- dratado - E100).

PROGRAMA RHAE TRAINEE CNPq – IEL 109


Ao final dos estudos, foi possível auferir nol, capazes de suportar taxas de compres-
ganhos significativos de eficiência resultantes são maiores.
da conversão do combustível, advindos da oti- Este projeto, portanto, realizou um es-
mização da razão volumétrica de compressão tudo numérico e experimental de possíveis
para ambos os combustíveis – principalmente rotas tecnológicas, visando desenvolver uma
para o etanol – assim como ganhos adicionais nova tecnologia, viável econômica e tecnica-
pela associação de outras tecnologias. mente, que possibilite otimizar a compres-
Também ficou comprovado o real poten- são/enchimento do motor, de acordo com o
cial que as propriedades antidetonantes do combustível utilizado no momento.
etanol possuem para estimular o desenvol- O sistema a ser desenvolvido é denomi-
vimento de tecnologias focadas em extrair nado Sistema de Compressão Variável (SCV),
mais eficiência dos motores otimizados para com o qual se espera melhorar a eficiência
o uso do biocombustível. Consequentemen- energética do motor, quando se utiliza o etanol.
te, abre-se um caminho para o Brasil adentrar Para alcançar esse objetivo, a presente
o mercado internacional de forma competiti- proposta envolve testes experimentais e si-
va, reduzindo a dependência dos combustí- mulações numéricas, em motor mono cilin-
veis fósseis e das variações comerciais do pe- dro de pesquisa (SCRE), com sistemas de
tróleo e aumentando a contribuição do nosso injeção direta (DI) e indireta (PFI), utilizando
país para a redução das emissões dos gases gasolina e etanol em diferentes condições e
de efeito estufa. taxas de compressão, que levem ao desenvol-
vimento do sistema de compressão variável.

OBJETIVOS
MÉTODO EXPERIMENTAL
Os motores com tecnologia Flex Fuel pos-
suem, desde o seu lançamento em 2003, MOTOR MONOCILINDRO
uma taxa de compressão fixa, usualmente DE PESQUISA (SCRE)
determinada pela gasolina ou, às vezes, por Devido à necessidade de estudo dos fenô-
uma taxa intermediária, mais próxima da ide- menos presentes na combustão de forma
al para a gasolina. avançada e com diversas configurações de
Em qualquer um dos casos, a eficiência sistema de injeção e taxas de compressão,
energética do motor é prejudicada, princi- foi escolhido um motor monocilindro de pes-
palmente quando o combustível utilizado é quisa, que permite estabelecer inúmeras con-
o etanol, uma vez que a taxa de compressão figurações, de forma prática e rápida.
mais baixa para a gasolina impede a utiliza- Esse motor também pode ser montado
ção das propriedades antidetonantes do eta- com sua versão para estudos óticos, por meio

110 INOVA TALENTOS


05

da qual um cilindro de quartzo transparente de chama e exaustão dos gases. As princi-


permite a visualização do spray, acionamen- pais características desse motor podem ser
to da vela de ignição, propagação da frente visualizadas na tabela 1 [12].

CARACTERÍSTICAS FÍSICAS E OPERACIONAIS DO MOTOR MONOCILINDRO DE PESQUISA

Número de cilindros 1
Diâmetro do cilindro 82 mm
Curso 86 mm
Volume deslocado 450 cm3
Sistema de injeção de combustível Injeção direta montada lateralmente
Injeção indireta no pórtico de admissão
Sistema de gerenciamento AVL Engine Timing Unit 427
Rotação de marcha lenta 800 rpm
Rotação nominal 6000 rpm
Rotação máxima, instantânea 6400 rpm
Máxima pressão no cilindro 100 bar (Naturalmente aspirado ou superalimentado)
Máxima pressão de admissão 2,0 bar (3,0 bar pressão absoluta)
Válvulas por cilindro 4 (2 admissão, 2 exaustão)
Limite de pressão da bomba de combustível 200 bar

TABELA 1 - Características físicas e operacionais do motor monocilindro de pesquisa.

Inicialmente, um estudo de mercado


para os próximos cinco anos foi realizado,
permitindo identificar a matriz de motores
que permearão o mercado nacional e de-
finir as premissas desta pesquisa. Conse-
quentemente, o foco dos estudos se deu
em motores naturalmente aspirados, com
cilindrada inferior a 1,5 litros e sistema de
injeção indireta nos pórticos de admissão
(PFI). O motor monocilindro de pesquisa
encontra se instalado no dinamômetro de
motores do Centro de Tecnologia da Mobili- FIGURA 1 - SCRE (Single Cylinder Research Engine) –
dade da UFMG, universidade parceira deste Motor monocilindro de pesquisa montado no dinamômetro
de motores do Centro de Tecnologia da Mobilidade
projeto (ver figura 1). na Universidade Federal de Minas Gerais, Brasil.

PROGRAMA RHAE TRAINEE CNPq – IEL 111


DESCRIÇÃO DO EXPERIMENTO Esse método foi adotado devido à impos-
sibilidade de se testarem todos os pontos de
Para aferição de consumo e homologação operação do motor e por assegurar a relevân-
dos veículos pelo Inmetro, o ciclo urbano cia dos resultados. Adicionalmente aos nove
de emissões FTP75 é utilizado (ver figura 2). pontos escolhidos, foram ensaiados mais
Após análise de vários veículos ensaiados dois pontos em plena carga, representando
neste ciclo, com características semelhantes as condições de torque e potência máximos
às adotadas nesta pesquisa, foram escolhidas do motor mono cilindro de pesquisa. A ta-
nove condições operacionais que ocorrem bela 2 ilustra a frequência de ocorrência dos
com maior frequência e que juntas represen- pontos escolhidos, representadas pelo peso
tam 63% do tempo de execução do ciclo. percentual de cada ponto.

FATORES DE PONDERAÇÃO NO CICLO FTP75%

BMEP RPM
[bar] 500 1000 1500 2000 2500 3000 3500 500 4000 4500 5000

2 20,300 2,900

3 19,300 5,081 6,200

4 5,000

5 3,600

8 0,100 0,100

WOT 0,400 0,003

63%

TABELA 2 - Fatores de ponderação por condição de operação no ciclo FTP75.

112 INOVA TALENTOS


05

CICLO DE EMISSÕES URBANO FTP75

60

50
Vehicle speed (mph)

40

30

20

10

0
0 200 400 600 800 1000 1200 1400 1600 1800 2000
Time (s)

FIGURA 2 - Ciclo de emissões urbano FTP75.

A figura 3 ilustra os traços de variação de carga, em função da rotação do motor durante a


execução do ciclo FTP75 em um veículo, assim como os 11 pontos escolhidos para as medições
utilizando o SCRE. Todos os pontos ensaiados foram calibrados com mistura estequiométrica
(Lambda igual a 1) e covariância dos ciclos de combustão inferior a 3%.

VARIAÇÃO DE CARGA E ROTAÇÃO DO MOTOR

12

11
10

9
8
7
BMEP [bar]

6
5
4

3
2

1
0
0 500 1000 1500 2000 2500 3000 3500 4000 4500 5000 5500 6000 6500 7000
nmot_w [RPM]

FIGURA 3 . Variação de carga e rotação do motor durante teste em veículo do ciclo FTP75 e os pontos escolhidos para os experimentos no SCRE.

PROGRAMA RHAE TRAINEE CNPq – IEL 113


sistemas de injeção: injeção direta (DI), com
montagem lateral e pressão máxima de inje-
ção de 80 bar, e injeção indireta (PFI), com
pressão de 3,5 bar.
Também foi investigada a influência da re-
circulação interna dos gases de escapamento
(iEGR), obtida através de variações no tempo
de abertura das válvulas de admissão e do
tempo de fechamento das válvulas de esca-
pamento, na ocorrência de detonação, prin-
cipalmente quando utilizada a gasolina em
FIGURA 4 altas taxas de compressão.
Espaçadores usados para alterar a taxa de compressão no SCRE. Apesar de eficiente na redução da tempe-
ratura na câmara de combustão – e conse-
Foram utilizados três valores distintos de quente mitigação da ocorrência de detonação
taxa de compressão geométrica, alterados – essa estratégia tem como efeito colateral a
facilmente através de calços espaçadores, desaceleração da combustão e prejuízos para
montados no bloco do motor SCRE, confor- a eficiência de conversão de combustível.
me mostrado na figura 4. Foi então necessário otimizar a estrutura
A taxa de 11,5:1 foi adotada como refe- de fluxo para retomar os índices de turbulên-
rência ou baseline, por ser a média das taxas cia existentes na câmara antes do emprego
de compressão utilizadas nos veículos Flex- de iEGR e assim maximizar os ganhos de efi-
-Fuel, vendidos atualmente no Brasil. A taxa ciência propiciados pelo iEGR.
máxima utilizada nos ensaios experimentais
foi de 15:1, para se evitar o toque do pistão
com as válvulas e cabeçote. RESULTADOS E DISCUSSÕES
Devido às limitações físicas e à impossibi-
lidade de se aumentar a razão volumétrica de INFLUÊNCIA DA TAXA DE
compressão acima de 15:1, foram realizadas COMPRESSÃO EM MOTOR COM
simulações numéricas com razão volumé- SISTEMA DE INJEÇÃO PFI SEM IEGR
trica de compressão de 16:1, o que permitiu Os resultados mostrados na figura 5, obti-
constatar ganhos de eficiência de conversão dos na versão do motor equipada com um
de combustível utilizando etanol. sistema de injeção PFI, sem recirculação de
Para cada taxa de compressão, o motor gases de escapamento, indicam a influência
foi ensaiado com gasolina padrão emissões da taxa de compressão sobre a eficiência de
(E22) e com etanol (E100) utilizando dois conversão de combustível, quando o motor

114 INOVA TALENTOS


05

INFLUÊNCIA DA TAXA DE COMPRESSÃO (CR) E DO COMBUSTÍVEL


NA EFICIÊNCIA DE CONVERSÃO DE COMBUSTÍVEL DO SCRE

iPCE PFI - Valores médios


ponderados no FTP75 (63%)
Knocking

11,34%
31,53%
28,31%
15,0:1
TAXA DE COMPRESSÃO [-]

-0,50% 10,26%

13,0:1 28,59% 3,37%


10,76%
0,48%

FIGURA 5 - Influência da taxa de


11,5:1
7,18% compressão (CR) e do combustível na
Eficiência de Conversão de Combustível
28,46% 30,50% do SCRE equipado com sistema de
injeção PFI e ausência de iEGR.
E 22 E 100
QUANTIDADE DE ETANOL [%]

foi testado com gasolina E22 e etanol hidra- Onde,


tado E100. Potind, potência indicada [kW];
Os valores apresentados nas figuras 5 e PCI, poder calorífico inferior do combustível
6 são as médias ponderadas de todos os 11
𝑚̇fuel, vazão mássica de combustível [kg/h].
[MJ/kg];
pontos do plano cotado, calculados conside-
rando as frequências de ocorrência de cada
ponto no ciclo FTP75 (listadas na tabela 2). Pode-se observar, na figura 5, que o au-
A eficiência de conversão do combus- mento de CR de 11,5 para 13:1 resultou num
tível representa quanto da energia contida ganho pouco expressivo da eficiência de con-
no combustível é transformada em trabalho versão da gasolina (0,48%), pois, em alguns
útil e pode ser calculada através da equação pontos – já com taxa de 13:1 – ocorreu a ne-
abaixo: cessidade de atrasar o ponto de ignição para
mitigar os efeitos danosos da detonação.
Utilizando gasolina com taxa de com-
pressão de 15:1, observou-se detonação forte
em quase todos os pontos ensaiados, o que
eliminou a possibilidade de um ganho mé-
dio de eficiência, resultando, na verdade, em
perda de eficiência (-0,50%).

PROGRAMA RHAE TRAINEE CNPq – IEL 115


No caso do etanol, por se tratar de um conclui-se que a taxa de compressão dos mo-
combustível de alta octanagem, o aumento de tores Flex-Fuel atualmente comercializados no
CR para 15:1 resulta num aumento médio da Brasil pode ser otimizada para o uso do etanol.
eficiência de aproximadamente 3,4%. Esses A figura 6 mostra o consumo específico
ganhos, propiciados pelo aumento da taxa de ponderado em função da CR e do combustível
compressão volumétrica, foram maiores para utilizado. Também foi indicada na figura a re-
o etanol do que para a gasolina, na média do lação de consumo entre a gasolina e o etanol.
plano cotado, e podem traduzir-se em redução Com a mesma taxa de 11,5:1, a relação de con-
de consumo no veículo. Em outras palavras, sumo média para o motor foi de 73,68%.

INFLUÊNCIA DA CR E DO COMBUSTÍVEL NO CONSUMO


ESPECÍFICO INDICADO DE COMBUSTÍVEL [l/kWh] DO SCRE

iPCE PFI - Valores médios


ponderados no FTP75 (63%)
Knocking

76,70% 0,591 l/kwh


0,453 l/kwh
15,0:1
TAXA DE COMPRESSÃO [-]

0,03% 75,77%

0,448 l/kwh -3,34%


13,0:1
76,22%
-0,01%
Figura 6 - Influência da CR
11,5:1 e do combustível no Consumo
73,68% Específico Indicado de
0,451 l/kwh
0,611 l/kwh Combustível [l/kWh] do SCRE
equipado com sistema de
injeção PFI e ausência de iEGR.
E 22 E 100
QUANTIDADE DE ETANOL [%]

Apesar de utilizada como critério de es- Fuel nacionais podem ser ainda mais otimi-
colha do combustível durante o abasteci- zados para o uso de etanol. A razão entre os
mento – e de ser amplamente divulgada no conteúdos energéticos de cada litro de eta-
mercado brasileiro como de 70% – a rela- nol e gasolina é de 69.3%, aproximadamente
ção de consumo entre os dois combustíveis 70% por conveniência, conforme ilustrado
pode assumir valores favoráveis ao etanol na equação 2 e na tabela 3. Essa relação deu
superiores a 75%, após a otimização das ta- origem ao paradigma dos 70%, regra prática
xas de compressão para cada combustível, que utiliza a paridade de preços para auxiliar
resultado que mostra que os motores Flex- o usuário na escolha do tipo de combustível,

116 INOVA TALENTOS


05

PODER CALORÍFICO INFERIOR OFICIAL DOS COMBUSTÍVEIS BRASILEIROS

DENSITY LHV
LHV
FUEL
kg/l MJ/kg MJ/L RATIO

E22 0,745 38,92 29,00 TABELA 3 - Poder Cal-


0,693 orífico Inferior oficial
dos combustíveis
E100 0,810 24,80 20,09 brasileiros [13].

durante o abastecimento. Apesar de ser am- INFLUÊNCIA DA TAXA


plamente difundida no país, essa regra não DE COMPRESSÃO EM MOTOR COM
se aplica corre­tamente ao motor de com- SISTEMA DE INJEÇÃO DI SEM IEGR
bustão interna, pois pressupõe que o motor A influência da razão volumétrica de compres-
está otimizado e possui a mesma eficiência são na eficiência de conversão de combustí-
de conversão para ambos os combustíveis. vel e no consumo específico do motor SCRE,
Na figura, é possível observar que o au- equipado com o sistema de injeção direta com
mento da taxa de compressão para 15:1 pro- câmara limpa (sem iEGR), foi avaliada com
piciou uma redução do consumo de etanol gasolina (E22) e etanol (E100).
de aproximadamente 3,3% e que a relação As medições de consumo específico de
entre o consumo médio de gasolina na taxa E22 são apresentadas na figura 7. Observa-se
de referência (11,5:1) e o de etanol, com taxa uma tendência nítida de redução de consumo
otimizada em 15:1, é de 76,2 %. Nessa con- específico de combustível, com o aumento de
dição, seria vantajoso, do ponto de vista eco- carga e a elevação da taxa de compressão de
nômico, abastecer com etanol, mesmo que 11,5:1 para 15:1. Constatou-se que parte dos ga-
a paridade de preços fosse superior a 70% e nhos relativos ao aumento de carga se deve à
inferior a 76%. redução das perdas de bombeamento.

PROGRAMA RHAE TRAINEE CNPq – IEL 117


ISFC [g/kWh] COM E22

420
400
380
360
ISFC [ g/kWh ]

340 Taxa de
320 Compressão
300
11,5
280
260 11
240 15
220
1000 1500 1000 2000 2500 2000 2500 2000 2500 3000 4500 Rotação [RPM]
2 3 4 5 8 WOT Carga do motor [bar]
DI Sistema de Injeção
E22 Combustível

Figura 7 - ISFC [ g/kWh ] com E22 para os 11 pontos e 3 razões volumétricas de compressão.

A figura 8 apresenta o consumo específico de combustível para E100. Nota-se comporta-


mento semelhante ao observado com E22, ou seja, o aumento da carga, regime de rotação e
razão volumétrica de compressão implicam maior eficiência de conversão de combustível e,
portanto, menor consumo específico de combustível.

ISFC [g/kWh] COM E100

600

550
ISFC [ g/kWh ]

500 Taxa de
450 Compressão

400 11,5
13
350 15
300
1000 1500 1000 2000 2500 2000 2500 2000 2500 3000 4500 Rotação [RPM]
2 3 4 5 8 WOT Carga do motor [bar]
DI Sistema de Injeção
E100 Combustível

Figura 8 - ISFC [ g/kWh ] com E100 para os 11 pontos e 3 razões volumétricas de compressão.

118 INOVA TALENTOS


05

Também foi observado que, em função INFLUÊNCIA DA


das maiores pressões e temperaturas dentro RECIRCULAÇÃO
da câmara de combustão, as emissões de INTERNA DOS GASES DE
NOx foram, em média, maiores, quando se ESCAPAMENTO (IEGR)
utilizaram altas razões volumétricas de com- EM MOTOR PFI
pressão. É oportuno mencionar que, com o Para avaliar os efeitos do iEGR sobre a efi-
aumento de CR, a utilização de E22 foi pre- ciência de conversão e o consumo especí-
judicada em altas cargas, em virtude do apa- fico de combustível, o motor monocilindro
recimento de detonação, conforme reportado de pesquisa (SCRE), equipado com sistema
anteriormente por Gomes et al. [14]. de injeção PFI, foi ensaiado @2500 rpm em
Nessas condições de operação do motor, duas condições de carga, 3 e 5 bar iMEP,
é mais adequado o uso de etanol, em virtu- com diversas taxas de compressão volumé-
de de suas características físico-químicas, trica, abastecido com gasolina e etanol.
que elevam seu poder antidetonante, quan- Uma comparação entre o funcionamen-
do comparado à gasolina E22. É importante to do motor com câmara limpa (sem iEGR)
também mencionar que a injeção direta de e com câmara suja (com iEGR) possibilitou
combustível na câmara de combustão tem uma melhor compreensão da influência de
a característica de promover o efeito de res- diversos parâmetros de desempenho do
friamento da câmara, o que justifica a menor motor sobre as variações de eficiência ener-
tendência à detonação dos motores DI, em gética, além de sua interação com as emis-
comparação aos motores PFI. sões de poluentes.

COMPARAÇÃO DAS PERDAS POR BOMBEAMENTO


ENTRE CÂMARA LIMPA (CLEAN) E SUJA (IEGR).

-0,7
-0,6
-0,5 Recirculação
dos gases
PMEP [bar]

-0,4 de exaustão
-0,3
Clean
-0,2
IEGR
-0,1
0
11,5 13 15 11,5 13 15 11,5 13 15 11,5 13 15 Taxa de Compressão
3 5 3 5 Carga do motor [bar]
E100 E22 Combustível

Figura 9 - Comparação das perdas por bombeamento entre câmara limpa (clean) e suja (iEGR).

PROGRAMA RHAE TRAINEE CNPq – IEL 119


Uma das vantagens de se utilizar iEGR baixa, já que, nessas condições, a contribui-
é a redução das perdas por bombeamento. ção relativa das perdas de bombeamento é
A estratégia mais efetiva para se verificar a mais significativa.
influência do iEGR sobre a redução das per- Outro benefício advindo do emprego de
das foi a antecipação da abertura das válvu- iEGR foi a redução das emissões de NOx,
las de admissão. em virtude da homogeneização e redução
Na figura 9, pode-se observar que, com o da temperatura média da frente de chama.
diagrama de admissão adiantado, houve uma Essa redução de temperatura contribuiu, de
redução de PMEP, indicando menores perdas forma eficaz, para a mitigação da detonação,
por bombeamento, como consequência de quando o motor utilizou gasolina e taxas de
maior abertura da borboleta, em virtude do compressão elevadas. Ainda no que se refere
excesso de mistura queimada residual possi- à emissão de poluentes, observou-se redu-
bilitada pela estratégia de iEGR. ção significativa da emissão volumétrica de
Também foi possível observar que a re- CO, o que indica um processo de combustão
dução de consumo resultante da utilização mais eficiente, quando se trabalha com iEGR
de iEGR foi mais expressiva na carga mais em relação à câmara limpa.

COMPARAÇÃO DA DURAÇÃO DA COMBUSTÃO


ENTRE CÂMARA LIMPA (CLEAN) E SUJA (IEGR).

40

35
MBF 10-90 [ºCA]

Recirculação
30 dos gases
de exaustão
25 Clean

20 IEGR

15
11,5 13 15 11,5 13 15 11,5 13 15 11,5 13 15 Taxa de Compressão

3 5 3 5 Carga do motor [bar]

E100 E22 Combustível

FIGURA 10 - Comparação da duração da combustão entre câmara limpa (clean) e suja (iEGR).

120 INOVA TALENTOS


05

Apesar dos diversos benefícios alcança- ção da velocidade de formação do kernel.


dos com a introdução da recirculação inter- Os resultados mostrados na figura 10 cor-
na dos gases de escapamento, a tecnologia roboram a afirmação, uma vez que indicam
promove, como efeitos colaterais, a desace- o aumento de cerca de 5° na duração da
leração do processo da combustão e a redu- porção rápida da combustão (MBF10-90).

COMPARAÇÃO DO AVANÇO DE IGNIÇÃO ENTRE


CÂMARA LIMPA (CLEAN) E SUJA (IEGR).

-45
-40
Avanço de Ignição [0ca APMS]

-35
Recirculação
-30 dos gases
-25 de exaustão
-20
Clean
-15
-10 IEGR
-5
0
11,5 13 15 11,5 13 15 11,5 13 15 11,5 13 15 Taxa de Compressão

3 5 3 5 Carga do motor [bar]

E100 E22 Combustível

FIGURA 11 - Comparação do avanço de ignição entre câmara limpa (clean) e suja (iEGR).

Já na figura 11 pode-se observar a necessi- sua estabilidade, para assegurar os benefícios


dade de maior avanço de ignição quando se associados à recirculação dos gases de esca-
opera com câmara suja, indicando uma pro- pamento e atingir ganhos ainda maiores em
pagação mais lenta da combustão para man- eficiência de conversão de combustível (iF-
ter o MBF50 em 8° (setup de calibração). Ficou CE).A figura 12 mostra que, para a condição
então evidenciada a necessidade de otimiza- de 3 bar de iMEP a 2500 rpm com gasolina, a
ção da estrutura de fluxo, visando à recupera- iEGR possibilitou o ganho de 3,65% na efici-
ção da velocidade de propagação da chama e ência de conversão de combustível.

PROGRAMA RHAE TRAINEE CNPq – IEL 121


INFLUÊNCIA DA CR E DO COMBUSTÍVEL NA EFICIÊNCIA DE
CONVERSÃO DE COMBUSTÍVEL INDICADA [%] DO SCRE EQUIPADO
COM SISTEMA DE INJEÇÃO PFI, IEGR A 2500 RPM E 3 BAR IMEP.

iPCE - PFI @ 2500 rpm - 3 bar iMEP

34,5%
31,7% 8,61%
15,0:1
TAXA DE COMPRESSÃO [-]

13,0:1 3,65% 4,97%


12,57% FIGURA 12 - Influência
da CR e do combustível na
Eficiência de Conversão de
Combustível Indicada [%] do
11,5:1
7,24% SCRE equipado com sistema
de injeção PFI, iEGR a 2500
28,46% 32,8% rpm e 3 bar iMEP.

E 22 E 100
QUANTIDADE DE ETANOL [%]

INFLUÊNCIA DA CR E DO COMBUSTÍVEL NA EFICIÊNCIA DE


CONVERSÃO DE COMBUSTÍVEL INDICADA [%] DO SCRE EQUIPADO
COM SISTEMA DE INJEÇÃO PFI, IEGR A 2500 RPM E 5 BAR IMEP.

iPCE - PFI @ 2500 rpm - 5 bar iMEP

37,9%
34,0% 11,51%
15,0:1
TAXA DE COMPRESSÃO [-]

13,0:1 0,32% 4,14%


11,87%
FIGURA 13 - Influência
da CR e do combustível na
11,5:1 Eficiência de Conversão de
7,42%
Combustível Indicada [%] do
33,9% 36,4% SCRE equipado com sistema
de injeção PFI, iEGR a 2500
rpm e 5 bar iMEP.
E 22 E 100
QUANTIDADE DE ETANOL [%]

122 INOVA TALENTOS


05

A figura 13 mostra que a introdução da a eficiência de combustão pode ser calcula-


recirculação interna dos gases de escape da pela variação de entalpia entre os reagen-
beneficiou o sistema, com a atenuação dos tes e produtos da combustão, dividida pela
fenômenos de detonação quando se usa a vazão mássica de combustível, multiplicada
gasolina, mas como efeito colateral desace- pelo poder calorífico inferior do combustível.
lerou a combustão, resultando em um ga-
nho desprezível de eficiência (0,32%).
(3)

INFLUÊNCIA DA OTIMIZAÇÃO
DA ESTRUTURA DE FLUXO
(SWIRL E TUMBLE) EM MOTOR DI Onde,
Nesta etapa, é analisada a influência da al- HR, entalpia dos reagentes;
teração da estrutura de fluxo, em conjunto
𝑚̇ , vazão mássica de combustível [kg/h].
HP, entalpia dos produtos;
com a recirculação dos gases de escapa-
mento sobre a eficiência de conversão e LHVfuel, poder calorífico inferior
consumo de combustível, bem como sobre do combustível [MJ/kg];
o desempenho da combustão, quando se
usa o etanol. A eficiência térmica é calculada pela razão
De forma a compreender os ganhos de entre o trabalho gerado pelo motor, dividida
eficiência de conversão de combustível, pro- pela energia gerada pela queima do combus-
porcionados pela adição de novas tecnolo- tível, conforme mostrado na equação (4).
gias, é importante analisar a influência des-
sas tecnologias sobre a eficiência térmica e a
eficiência de combustão.
(4)
Como indicado na equação (1), a eficiên-
cia de conversão de combustível expressa a
razão entre o trabalho gerado pelo motor e
a energia presente no combustível injetado. Onde,
Em outras palavras, é a potência indicada, Potind, potência indicada;
dividida pela vazão mássica de combustível, HR, entalpia dos reagentes;
multiplicada pelo poder calorífico inferior do HP, entalpia dos produtos.
combustível.
A eficiência de combustão representa a Combinando-se as equações (3) e (4) é
razão entre a energia gerada pela queima do possível expressar a eficiência de conversão
combustível e a energia presente no com- de combustível, em função das eficiências
bustível injetado. A equação (3) mostra que térmica e de combustão.

PROGRAMA RHAE TRAINEE CNPq – IEL 123


na eficiência de combustão com câmara lim-
(5)
pa (sem iEGR). Entretanto, a adição de iEGR
A figura 14.a mostra que a variação da e a posterior otimização da estrutura de fluxo
taxa de compressão geométrica tem gran- possibilitaram a recuperação da eficiência de
de influência na eficiência térmica do ciclo combustão. A figura 14.c mostra que somente
termodinâmico. Entende-se que um melhor com a variação da taxa de compressão geo-
aproveitamento da energia térmica foi obtido, métrica não foi possível obter ganhos de efici-
à medida que a razão volumétrica de com- ência de conversão de combustível da mesma
pressão foi aumentada. Pode-se observar, na ordem dos ganhos em eficiência térmica, fato
figura 14.b, que a elevação da taxa de com- que se justifica pela queda da eficiência de
pressão volumétrica resultou em uma queda combustão, como mostrado anteriormente.

EFICIÊNCIA TÉRMICA

46
44
Eficiência Térmica [%]

42 Recirculação
dos gases
40
de exaustão
38 Clean
IEGR
36
34
NORMAL NORMAL NORMAL TUMBLE Estrutura de fluxo
11,5 13 15 Taxa de Compressão
DI Sistema de injeção

FIGURA 14 A
Eficiência Térmica.

EFICIÊNCIA DE COMBUSTÃO

86
Eficiência de Combustão [%]

84
82
80 Recirculação
78 dos gases
76 de exaustão
74 Clean
72 IEGR
70
68
NORMAL NORMAL NORMAL TUMBLE Estrutura de fluxo
11,5 13 15 Taxa de Compressão
DI Sistema de injeção

FIGURA 14 B
Eficiência de Combustão.

124 INOVA TALENTOS


05

EFICIÊNCIA DE CONVERSÃO DE COMBUSTÍVEL

37
Eficiência de Conversão Combustível [%]

36
35 Recirculação
34 dos gases
de exaustão
33
32 Clean
31 IEGR
30
NORMAL NORMAL NORMAL TUMBLE Estrutura de fluxo
11,5 13 15 Taxa de Compressão
DI Sistema de injeção
FIGURA 14 C
Eficiência de
Conversão de
Combustível.

GANHOS DE EFICIÊNCIA DE CONVERSÃO DE COMBUSTÍVEL POR TECNOLOGIA

iPCE DI com E100 @ 2500 rpm - 3 bar iMEP

9,15%

34,5% 36,3%
33,2% 3,72% 5,23%
15,0:1
TAXA DE COMPRESSÃO [-]

13,0:1 2,43% 11,80%

11,5:1 FIGURA 14D


Ganhos de Eficiência
32,5% de Conversão de
Combustível por tecnologia.

DI DI + iEGR DI + iEGR + TUMBLE

TECNOLOGIAS INSERIDAS

FIGURA 14 - Análise de eficiência para sistema DI operando com E100 para diferentes CR. Configuração com câmara limpa
(clean) e câmara suja (iEGR), com estrutura de fluxo normal e otimizada para geração de tumble – 3bar@2500rpm.

PROGRAMA RHAE TRAINEE CNPq – IEL 125


DIAGRAMA P x V

34
32 CR11.5:1
30 CR13.0:1
28 CR15.0:1
26 CR15.0:1 I-EGR
24 CR15.0:1 I-EGR TUMBLE
Pressão no Cilindro [bar]

22
20
18
16
14
12
10
8
6
4
2
0
0 50 100 150 200 250 300 350 400 450
Volume [cm3]

CR11.5:1
100
CR13.0:1
50 CR15.0:1
CR15.0:1 I-EGR

20 CR15.0:1 I-EGR TUMBLE

10
Pressão no Cilindro [bar]

0,5

0,2 FIGURA 15 - Diagrama P x V


mostrando a influência da combinação
0,1 de diferentes tecnologias.
40 50 60 80 100 200 300 400
Volume [cm3]

126 INOVA TALENTOS


05

Na figura 14.d podemos avaliar o ganho ção da estrutura de fluxo resulta em um au-
individual proporcionado por cada pacote de mento do pico de pressão e da eficiência de
tecnologias, inserido ao SCRE. Com o pacote combustão, que se traduz em um aumento
completo, no qual uma taxa de compressão da eficiência de conversão de combustível.
otimizada para o etanol é associada à recircu-
lação interna dos gases de exaustão e a uma
melhor estrutura de fluxo, os ganhos de efici-
ência de conversão de combustível chegaram CONCLUSÕES
a 11,8%, para a condição de 3 bar de iMEP e
2500 RPM.Portanto, graças à associação de Ensaios em um motor monocilindro de pes-
novas tecnologias, foi possível melhorar a efi- quisa permitiram o estudo da influência de
ciência térmica do motor com a elevação da várias tecnologias, tais como a taxa de com-
razão volumétrica de compressão, além de au- pressão, sistemas de injeção de combustível
mentar a eficiência de combustão, mediante PFI e DI, recirculação interna de gases resi-
a utilização de estratégias de retenção de gás duais da combustão e otimização da estru-
residual e posterior alteração da estrutura do tura de fluxo sobre a eficiência de conversão
fluxo [15]. e o consumo específico de combustível do
Na figura 15, são apresentadas curvas no motor, utilizando gasolina ou etanol.
diagrama P x V, correspondentes às diferen- Os ensaios com sistema PFI sem iEGR
tes condições de ensaio. Adicionalmente, revelaram que os ganhos em eficiência de
é possível verificar as mesmas condições – conversão de combustível são maiores para
mostradas na forma log-log, para melhor o etanol do que para a gasolina. Isso se deve
detalhamento das regiões de admissão e às propriedades antidetonantes do biocom-
escapamento. bustível e revela que os veículos Flex-Fuel
Podem-se observar as principais pecu- em uso no Brasil utilizam uma CR otimizada
liaridades referentes à operação com dife- para a gasolina e que isso é um compromis-
rentes razões volumétricas de compressão, so limitado, pela ocorrência de detonação,
como o aumento dos picos de pressão, de- quando se utiliza o combustível fóssil.
correntes de CRs mais elevados. Também é O aumento da taxa de compressão de
possível observar o aumento da pressão na 11.5 para 15:1, utilizando E100, resultou em
admissão, quando utilizado o iEGR. ganhos médios de eficiência da ordem de
Esse aumento na pressão de admissão 3,4%, o que indica a possibilidade de ganhos
e ligeira redução da pressão de escapamen- adicionais de eficiência, através da otimiza-
to, ao final do processo de exaustão, fazem ção da CR para cada combustível. Simula-
com que as perdas por bombeamento sejam ções numéricas utilizando taxas de 16:1 com
menores, quando se utiliza iEGR. A otimiza- etanol revelaram ganhos adicionais de efici-

PROGRAMA RHAE TRAINEE CNPq – IEL 127


ência e serão reportadas posteriormente. zação de iEGR.
Por sua vez, a injeção direta de combustí- No entanto, o iEGR promoveu, como efei-
vel na câmara de combustão promove o efei- tos colaterais, a desaceleração do processo
to de resfriamento da câmara de combustão, da combustão, indicado por um aumento
justificando a menor tendência à detonação médio de 5 graus na porção rápida da com-
dos motores DI, em comparação com os bustão, registrada através do parâmetro MBF
motores PFI. Foram observados ganhos re- 10-90. Outra indicação da desaceleração da
sultantes do aumento da CR, mesmo quan- combustão foi a necessidade de maior avan-
do utilizando E22. No entanto, é importante ço de ignição, quando se opera com câmara
mencionar que, devido ao aumento da CR, suja para manter o MBF50 em 8° APMS.
a utilização de E22 foi prejudicada em altas Também foi observado que a associação da
cargas, em virtude do surgimento de deto- alteração da estrutura primária de fluxo com o
nação. Vale mencionar que as ocorrências de iEGR auxiliou na recuperação da eficiência de
detonação foram menos severas do que as combustão e na maximização dos ganhos de
observadas com o motor PFI. eficiência de conversão de combustível.
A estratégia de recirculação de gases re- A associação dessas tecnologias em um
siduais foi investigada no motor PFI, através motor DI com E100 permitiu a redução de
da antecipação da abertura das válvulas de até 10% no consumo específico de combus-
admissão. O uso de iEGR não só atingiu o tível para a condição analisada de 3 bar IMEP
objetivo principal de mitigação da detonação a 2500 rpm. É importante observar que o
com E22 e taxas elevadas, mas também trou- ponto de operação escolhido para a análise
xe benefícios de redução de perdas por bom- se refere a uma condição operacional favorá-
beamento e de emissões de NOx e CO. vel para a aplicação dessas tecnologias. Po-
A redução de consumo, resultante da in- rém, um estudo mais amplo, incluindo novas
trodução de iEGR, foi mais expressiva em condições operacionais, deverá ser realizado
baixas cargas, já que, nessas condições, a para compreender toda a potencialidade da
contribuição relativa das perdas por bom- combinação de tecnologias.
beamento é mais significativa. A redução da A análise da influência da combinação de
temperatura média da frente de chama con- diversas tecnologias considerou como a efici-
tribuiu para a mitigação da detonação, quan- ência térmica, de combustão e de conversão
do o motor utilizou taxas de compressão ele- de combustível foram afetadas. A eficiência de
vadas e gasolina. Uma redução significativa combustão apresentou uma queda de até 9%,
das emissões de CO denota um processo de com o aumento da taxa de compressão de 11.5
combustão mais eficiente, resultante da utili- para 15:1 com câmara limpa. A eficiência tér-

128 INOVA TALENTOS


05

-publicas?p_auth=S9oRfP0R&p_p_id=consulta
mica, por sua vez, sofreu maior influência da publicaexterna_WAR_consultapublicaportle-

taxa de compressão do que a introdução das t&p_p_lifecycle=1&p_p_state=normal&p_p_mo


de=view&p_p_col_id=column-1&p_p_col_cou-
outras tecnologias. A associação da alteração
nt=1&_consultapublicaexterna_WAR_ consulta-
da estrutura primária de fluxo com iEGR auxi-
publicaportlet_objId=277&_consultapublicaexter-
liou na recuperação da eficiência de combus- na_WAR_consultapublicaportlet_ja vax.portlet.
tão e, portanto, na maximização dos ganhos action=downloadParticipacao, acessado em Abril
de eficiência de conversão de combustível. de 2017.

A possibilidade de projetar motores com


[5] ENGINE TECHNOLOGY INTERNATIONAL,
alta razão geométrica de compressão oti- “Engines on Test: MG SGE-LFV GDI 1.5 liter”,
mizada para o uso de etanol, sem compro- http://www.enginetechnologyinternational.com/
meter a vida útil e o desempenho do motor, exclusive_articles.php?ArticleID=2078, acessado

quando abastecido com gasolina, represen- em Abril de 2017.

ta um desafio tecnológico a ser vencido, na [6] RODRIGUEZ, Henrique; Revista Quatro Rodas,
busca de benefícios para a sociedade e para “Por que a Volkswagen vai trocar o motor 1.4 TSI
o meio ambiente. Esses desafios estimulam pelo 1.5 TSI?”, http://www.quatrorodas.abril.com.
a continuidade das pesquisas e o desenvol- br/noticias/por-que-a-volkswagen- vai-trocar-o-mo-
tor-1-4-tsi-pelo-1-5-tsi/, acessado em Abril de 2017.
vimento de uma tecnologia inovadora.
REFERÊNCIAS [7] Revista Carros, “Novo motor 1.5 TSI EVO chega
BIBLIOGRÁFICAS ao Volkswagen Golf”, http://revistacarros.sapo.pt/
novo-motor-1-5-tsi-evo-chega-ao-volkswagen-golf/,
[1] NOVA CANA, “RenovaBio – Diretrizes Estratégi- acessado em Abril de 2017.
cas – Proposta Submetida à Consulta Pública”, ht-
[8] Engine Technology International, “Fleet
tps://www.novacana.com/pdf/22032017150320_14_
trialling sustainable ethanol fuel”, http://www.engi-
Deloitte.pdf, acessado em Abril de 2017.
netechnologyinternational.com/exclusive_articles.
[2] CASEIRO, C., “Production and Consumption of php?ArticleID=2076, acessado em Abril de 2017.
Biofuels in the World Today: Key Issues to Analyze
[9] Automotive Business, “Nissan conclui ciclo de
its sustainability”, Revista de Geografia Agrária, v.
6, n. 12, p. 6-31, Agosto 2011. teste de carro a célula de combustível com etanol”,
http://www.automotivebusiness.com.br/noti-
[3] UNIÃO DA INDÚSTRIA DE CANA DE AÇÚCAR, cia/25775/nissan-conclui-ciclo-de-teste- de-carro-
“Etanol - 60 países já adotam mistura obrigatória -a-celula-de-combustivel-com-etanol, acessado em
de biocombustíveis aos combustíveis fósseis”, http:// Abril de 2017.
bit.ly/2wkyK49/, acessado em Abril de 2017.
[10] Engine Technology International, “Exclusive
[4] ASSOCIAÇÃO BRASILEIRA DE ENGENHARIA Interview: Alain Raposo”, http://www.enginete-
AUTOMOTIVA, “Eficiência Energética Sustentável”, chnologyinternational.com/exclusive_articles.
http://www.mme.gov.br/web/guest/consultas- php?ArticleID=1990, acessado em Abril de 2017.

PROGRAMA RHAE TRAINEE CNPq – IEL 129


[11] Engine Technology International, “Toyota an- [20] NIGRO, F.E.B., “Eficiência de Veículos com
nounces all-new 1.5 liter Petrol engine”, http://www. Etanol”, AEA – Simpósio de Eficiência Energética:
enginetechnologyinternational.com/news.php?New- Emissões e Combustíveis, Brasil, São Paulo, Maio
sID=83601, acessado em Abril de 2017. de 2015.

[12] AVL LIST GMBH, “Single Cylinder Research [21] HOLLANDA, J. B. de, “Paridade 70: falso concei-
Engine 5405.95 Manual”. Áustria, 2014. to a ser desconstruído”, III Seminário Internacional
sobre Uso Eficiente do Etanol, Brasil, Campinas,
[13] Ministério do Desenvolvimento, Indústria e Setembro de 2016.
Comércio Exterior; Instituto Nacional de Metrologia,
Qualidade e Tecnologia, “Aperfeiçoamento dos Re- [22] MARTINS, M.E.S., LANZANOVA, T.D.M., “Full-
quisitos de Avaliação da Conformidade para Veículos -load Miller cycle with ethanol and EGR: Potential
Leves de Passageiros e Comerciais Leves”, Portaria benefits and challenges”, Applied Thermal Engine-
n.º 285, de 19 de junho de 2015, http://www.inme- ering, ScienceDirect, Federal University of Santa
tro.gov.br/legislacao/rtac/pdf/ RTAC002264.pdf, Maria, Santa Maria, Brazil, 2015.
acessado em Junho de 2017.
[23] LI, T., ZHENG, B., YIN, T., “Fuel conversion
[14] GOMES, P., ET AL., “Study on Boosted Direct efficiency improvements in a highly boosted Spark-
Injection SI Combustion with Ethanol Blends and -ignition engine with ultra-expansion cycle”, Energy
the Influence on the Ignition System”, SAE Technical Conversion and Management, ScienceDirect, State
Paper 2011-36-0196, 2011, doi: 10.4271/2011-36- Key Laboratory of Ocean Engineering, Shanghai Jiao
0196.
Tong University, China, 2015.

[15] Financiadora de Estudos e Projetos, “Rela-


[24] Smith, P., Heywood, J., and Cheng, W., “Effects
tório de Acompanhamento Técnico de Projetos”,
of Compression Ratio on Spark-Ignited Engine
Ref. FINEP 0391/14, pag. 4, número de contrato:
Efficiency,” SAE Technical Paper 2014-01-2599, 2014,
03.15.0036.00, Dezembro de 2016.
doi: 10.4271/2014-01-2599.

[16] Financiadora de Estudos e Projetos, “INOVA


[25] WHEELER, J., et. al., “Increasing EGR Tolerance
ENERGIA”, http://bit.ly/2wkrxBd, acessado em Abril
using High Tumble in a Modern GTDI Engine for
de 2017.
Improved Low-Speed Performance”, SAE Technical

[17] Ministério da Indústria, Comércio Exterior e Paper 2013-01-1123, doi: 10.4271/2013-01-1123.

Serviços, “Inovar Auto”, http://inovarauto.mdic.gov.


[26] SU,J., XU, M., et. al., “Combined effects of
br/InovarAuto/public/login.jspx?_adf.ctrl-state=-
cooled EGR and a higher geometric compression
1amwcaa8en_19, acessado em Abril de 2017.
ratio on thermal efficiency improvement of a downsi-
[18] Portal Brasil, “RenovaBio vai expandir produção zed boosted spark-ignition direct-injection engine”,
de biocombustível no País”, http://www.brasil.gov. Energy Conversion and Management, ScienceDirect,
br/infraestrutura/2017/02/renovabio-vai-expandir- National Engineering Laboratory for Automotive
-producao-de- biocombustivel-no-pais, acessado em Electronic Control Technology, Shanghai Jiao Tong
Abril de 2017. University, China, 2014.

[19]. BCSD, “Biocombustíveis”, BCSD Portugal, p. 6, [27] JUNG, H., SHELBY, M., NEWMAN, C. AND
Lisboa, 2008. STEIN, R., “Effect of Ethanol on Part Load Thermal

130 INOVA TALENTOS


Efficiency and CO2 Emissions of SI Engines,” SAE [29] Trevas, I.C., “Análise de Desempenho em um
International Journal Engines, 2013-01- 1634, doi: Motor Flex Operando em Ciclo Atkinson- Miller a
10.4271/2013-01-1634. partir da Variação da Posição Angular do Coman-
do de Válvulas de Aspiração e do seu Curso de
[28] Silva, T.R.V., “Estudo de Estratégias de Controle Abertura”, Dissertação de Mestrado, Universidade
dos Processos Internos de um Motor de Combustão Federal de Minas Gerais, Belo Horizonte, 2017.
Interna de Injeção Direta de Etanol Turbo-
-alimentado para Maximização da Eficiência [30] Gomes, P., Lopes, G., et al. “High efficiency
Global”, Dissertação de Mestrado, Universidade Flex-Fuel engines and the end of the 70% para-
Federal de Minas Gerais, Belo Horizonte, 2017. digm”, Congresso SAE Brasil 2017, 2017-36-0162,
Novembro 2017, em submissão.

[31] RADICCHI, F., LOPES, G., et al., “Study of the


effects of flow box utilization on charge motion

ABREVIAÇÕES E DEFINIÇÕES

APMS Antes do Ponto Morto Superior

BMEP Pressão Média Efetiva de Eixo

CNPq Conselho Nacional de Desenvolvimento Científico e Tecnológico

COP21 Conferência da ONU para mudanças climáticas de 30/11 a 11/12/2015 em Paris

CR Taxa de Compressão Geométrica

CTM Centro de Tecnologia da Mobilidade

DI Injeção Direta de Combustível

DPMS Depois do Ponto Morto Superior

E22 Gasolina usada em testes de homologação

EVC Fechamento da válvula de exaustão

FINEP Financiadora de Estudos e Projetos

Flex-Fuel Veículos que rodam com gasolina E22, etanol E100 ou qualquer mistura de E22 e E100

FTP75 Teste de Emissões para homologação (Federal Test Procedure 75)

GHG Gases de Efeito Estufa

iEGR Recirculação Interna dos Gases de Exaustã

PROGRAMA RHAE TRAINEE CNPq – IEL 131


LHV Poder Calorífico Inferior[MJ/kg]

iMEP Pressão Média Efetiva Indicada Líquida (720º virabrequim)

MBF10-90 Fração de Massa Queimada de 10% a 90%

MBF50 50% de Fração de Massa Queimada

𝒎̇ 𝒇𝒖𝒆𝒍 Fluxo de massa decombustível [kg/h]

PFI Injeção de combustível nos pórticos

PMEP Pressão Média Efetiva de Bombeamento

iFCE Eficiência de Conversão de Combustível Indicada

Potind Potência Indicada [kW]

RenovaBio Iniciativa do Ministério de Minas e Energia que busca promover o uso de biocombustíveis

RPM Rotações por Minuto

SCRE Motor monocilindro de pesquisa

SI Ignição por centelha

UFMG Universidade Federal de Minas Gerais

WOT Wide Open Throttle/Borboleta totalmente aberta

132 INOVA TALENTOS


and mixture formation in an internal combustion
engine”, Congresso SAE Brasil 2017, 2017- 36-0335,
Novembro 2017, em submissão.

[32] GOMES, P., LOPES, G., et al., “Ethanol to


improve the fuel conversion efficiency of S.I. engines
in the Brazilian market”, XXV Simpósio Internacio-
nal de Engenharia Automotiva, Setembro 2017, em
submissão.

[33] RADICCHI, F., LOPES, G., et al., “In-cylinder


gas exchange control process for maximizing fuel
conversion efficiency”, XXV Simpósio Internacional
de Engenharia Automotiva, Setembro 2017, em
submissão.

AGRADECIMENTOS
Agradecimentos especiais para a FINEP e Ro-
bert Bosch GmbH por financiar este projeto.

PROGRAMA RHAE TRAINEE CNPq – IEL 133


06
DETECÇÃO DE SALMONELLA
POR AMPLIFICAÇÃO ISOTÉRMICA DE DNA
A LE S S A ND R O WITC Z A K
_
Bacharel em Biomedicina,
Mestrado em Ciências Biológicas: Neurociências
Universidade Federal do Rio Grande do Sul

ÁLVARO JOSÉ CELMER


ANDRÉ S. K. FONSECA
NILO IKUTA
VAGNER RICARDO LUNGE
_
Simbios Biotecnologia, Brasil

aleswit@gmail.com ,
simbios@simbios.com.br

Simbios Biotecnologia
Rua Caí, 541, Vila Princesa Izabel,
Cachoeirinha - RS
CEP 94940-030

(51) 3074-7400

135
R E SU M O

PALAVRAS CHAVE diagnóstico; Salmonella; Enteritidis; LAMP; PCR.

Salmonella é uma bactéria patogênica, normalmente transmitida pelo consumo de ali-

mentos contaminados. Métodos laboratoriais para detecção desse patógeno são nor-

malmente demorados, pois requerem cultura bacteriológica, caracterização bioquímica

e identificação de cada sorotipo (com uso de diversos antissoros). Métodos de detecção

de DNA (como PCR) permitem a identificação rápida de Salmonella e dos sorotipos, mas

necessitam de equipamentos de alto custo e de difícil operação. O presente trabalho de-

senvolveu método isotérmico de detecção de DNA (LAMP) específico de Salmonella e de

dois sorotipos epidemiologicamente importantes (Enteritidis, Heidelberg). Os resultados

demonstraram excelente performance analítica, mediante simples avaliação colorimétrica

em tubos de ensaio. A Simbios Biotecnologia está validando esse método, visando à pro-

dução de kits de diagnóstico de salmonelas.

136 INOVA TALENTOS


02

A BSTR ACT

KEYWORDS diagnostic; Salmonella; Enteritidis; LAMP; PCR.

Salmonella is a bacterial pathogen classified into several serotypes that cause human

diseases normally transmitted by the consumption of contaminated food. Laboratory

methods to detect these pathogens are usually time consuming, since they require

bacteriological culture, biochemical characterization and identification of each serotype

(with the use of several antisera). DNA detection methods (such as PCR) allow rapid

identification of Salmonella and serotypes, but they require sophisticated equipments

(thermocyclers). The present work developed an isothermal DNA detection method

(LAMP) specific to Salmonella and two epidemiologically important serotypes (Enteritidis,

Heidelberg). The results demonstrated excellent analytical performance with simple

colorimetric evaluation in test tubes. These methods are being validated for the production

of salmonella diagnostic kits by Simbios Biotecnologia.

PROGRAMA RHAE TRAINEE CNPq – IEL 137


Aproximadamente 200 desses sorotipos
INTRODUÇÃO já foram demonstrados como possíveis cau-
sadores de intoxicação alimentar e infecção

A
s bactérias do gênero Salmonella são sistêmica humana. Entre esses, os sorotipos
importantes agentes de infecções tíficos (Typhi e Paratyphi A) são exclusivos
humanas. Estima-se a ocorrência de do homem, enquanto os sorotipos paratíficos
dezenas de milhões de casos de salmonelose ocorrem também em animais. A patogenicida-
em todo mundo anualmente (WHO, 2013). de das salmonelas paratíficas está diretamen-
Além de estarem presentes no homem, essas te relacionada à capacidade de cada bactéria
bactérias ocorrem em uma grande diversida- colonizar a mucosa do trato intestinal, invadir
de de animais e no ambiente. células hospedeiras, replicar-se no interior
A salmonelose humana é normalmente dessas células e sobreviver à destruição por
transmitida pela alimentação e caracteriza-se componentes fagocitários (Suez et al., 2013).
por diarreia e gastroenterite, sendo que infec- Enfim, apenas um número limitado de so-
ções sistêmicas podem resultar em endocar- rotipos (entre os quais Enteritidis, Heidelberg
dite, artrite, osteomielite, septicemia e óbito e Typhimurium) apresenta essas característi-
(Vidal et al., 2003). Os quadros clínicos mais cas e tem sido isolado nos casos de salmone-
graves acontecem principalmente em crian- lose humana.
ças, idosos e indivíduos com imunodeficiên- Esses sorotipos apresentam uma vasta
cia (CDC, 2014). gama de hospedeiros, incluindo diversos ani-
A Salmonella pertence à família Entero- mais utilizados na produção de alimentos
bacteriaceae e morfologicamente é um bacilo (El-Shawrkway et al., 2017). Portanto, podem
gram negativo, não produtor de esporos. O contaminar alimentos de origem animal (car-
gênero é classificado nas espécies S. enterica nes, ovos, leite, queijos, etc), apresentando
e S. bongori, sendo que a primeira é a principal risco elevado de transmissão pelo consumo,
causadora de infecções humanas (Ferreira & sendo alvos de controle constante em toda ca-
Campos, 2008). deia alimentar (Loureiro et al., 2010).
As cepas da bactéria também são classifi- A determinação da presença de Salmo-
cadas em sorotipos, conforme a composição nella em uma amostra (humana, alimentar ou
de antígenos da superfície do bacilo. Três di- ambiental) é normalmente realizada por mé-
ferentes antígenos (somáticos O, flagelares H todos de crescimento em meios de cultivo e
e capsulares de virulência Vi) são analisados, caracterização do metabolismo bacteriano por
e as diferentes combinações encontradas, até testes bioquímicos.
o momento, demonstraram a existência de O resultado “positivo” para a ocorrência de
mais de 2.600 sorotipos (Issenhuth-Jeanjean Salmonella somente é definido após a obten-
et al., 2014). ção de culturas isoladas (com o uso de meios

138 INOVA TALENTOS


06

de cultura gerais e de seletividade diferencia- Devido à demora e à alta complexidade do


da) a partir das amostras biológicas, confor- processo tradicional de detecção de Salmo-
me procedimento estabelecido por órgãos nella, muitos estudos têm focado no desen-
governamentais (Ministério da Saúde, 2011). volvimento de testes mais rápidos e práticos.
As colônias com morfologia típica de Métodos de biologia molecular são boas al-
Salmonella são adicionalmente submetidas ternativas para a detecção específica de Sal-
para caracterização sorológica (Trabulsi e Al- monella e dos principais sorotipos.
terhum, 2004). A determinação do sorotipo A maioria desses métodos é baseada na
ocorre por um esquema denominado Kau- reação em cadeia da polimerase (PCR, Poly-
ffmann-White-LeMinor (KWL), que avalia a merase Chain Reaction) ou variações dessa
ocorrência de antígenos específicos por soro- técnica. Em geral, os procedimentos apre-
aglutinação. sentam excelente performance analítica e são
A caracterização sorológica completa en- mais rápidos do que a forma tradicional de
volve a análise de mais de 150 antígenos O e análise. No entanto, apresentam a limitação
H, com o uso de aproximadamente 250 an- de necessitar do uso de equipamentos mais
tissoros. Assim, todo esse processo se torna sofisticados e caros. A modalidade de “PCR
trabalhoso, na medida em que envolve uma em tempo real”, que tem sido a mais utilizada
grande quantidade de reagentes, mão de recentemente, necessita de um equipamento
obra e, consequentemente, tempo (Menezes misto (termociclador mais fluorímetro), pois
et al., 2010). A figura 1 apresenta um fluxogra- a avaliação dos resultados é realizada durante
ma tradicional, com as etapas de isolamento o processo de amplificação de DNA (Malorny
e caracterização de Salmonella. et al., 2004).

Amostra biológica
Semeadura direta Enriquecimento

Geral:
Ágar EMB Água Peptonada
Ágar MacConkey
Seletivo:
Selenito Cistina
Tetrationato
Rappaport Vassiliadis

Isolamento 5 a 10 colônias
em meios de triagem

Caracterização bioquímica

Caracterização sorológica

FIGURA 1 – Processo de isolamento e caracterização de Salmonella no diagnóstico laboratorial tradicional.

PROGRAMA RHAE TRAINEE CNPq – IEL 139


Novas técnicas para a amplificação de internos ou da região do loop. Os trabalhos
ácidos nucleicos, baseadas em reações iso- iniciais abreviaram os iniciadores externos
térmicas, foram desenvolvidas e têm sido como F3 e B3, os internos, como FIP (forward
utilizadas nas mais diversas finalidades de inner primer) e BIP (backward inner primer) e
análise. Os métodos desenvolvidos apresen- os das regiões dos loops, como LF e LB. Esse
tam diferenças em termos de complexidade conjunto de iniciadores e a enzima Bst DNA
(várias enzimas e/ou iniciadores de oligonu- polimerase (que não possui atividade exonu-
cleotídeos), sensibilidade, especificidade e cleásica 5´- 3´, e sim atividade de deslocamen-
performances analíticas. to de fita - strand displacement activity) permi-
As principais técnicas atualmente utiliza- tem que a amplificação da região de DNA alvo
das são conhecidas pelas siglas NASBA,NE- ocorra em duas etapas: não cíclica e cíclica.
AR, SDA, HDA e LAMP, normalmente deriva- O processo se inicia na fase não cíclica,
das do nome com os princípios das técnicas. mediante um iniciador interno (FIP ou BIP)
Entre estes, LAMP é um método isotérmico utilizado pela enzima, com o consequente
que apresenta características de desempe- deslocamento da fita complementar sinteti-
nho parecidas com a PCR, incluindo a mul- zada. Com a abertura da fita de DNA sem a
tiplicação exponencial das fitas de DNA. Os necessidade de temperatura para desnatura-
procedimentos baseados em LAMP têm de- ção, mais iniciadores podem se ligar nas fitas
monstrado elevada especificidade analítica simples de DNA.
(capacidade de detectar um alvo específico A cadeia deslocada forma então um loop
pré-determinado) devido ao uso de conjuntos no extremo 5’, que serve como local de hibri-
de iniciadores abrangendo seis ou oito regiões dização de outro iniciador. A síntese de DNA
distintas de uma determinada sequência-alvo leva à formação de uma cadeia complementar
(Yan et al, 2014). e à abertura do loop na extremidade 5 ‘.
Com relação aos aspectos técnicos, a am- Após nova etapa de síntese, o DNA em for-
plificação por LAMP ocorre devido a um pro- ma de alça é convertido em uma nova estrutu-
cesso semelhante ao do PCR. A síntese das ra de loop, que serve para iniciar a etapa cíclica
novas fitas de DNA ocorre a partir de uma de LAMP, permitindo a amplificação.
pequena região de fita dupla, devido à hibri- Os iniciadores externos atuam apenas na
dização dos fragmentos iniciadores (primers). etapa não cíclica, amplificando mais sequ-
Como são usados vários iniciadores (de ências-alvo, auxiliando na abertura das fitas
seis a oito), a síntese de DNA é realizada em duplas de DNA e deslocando as estruturas
ambos os sentidos (senso e antissenso) ao em forma de halter, que participarão da eta-
longo da região-alvo. Os iniciadores são nor- pa cíclica. Estima-se que uma sequência alvo
malmente identificados pela localização nesta LAMP seja ampliada 13 vezes a cada meio ci-
região, sendo denominados como externos, clo (Parida et al., 2008). A amplificação é ace-

140 INOVA TALENTOS


06

lerada ainda mais com a adição de primers nas regiões dos dois loops (LF e LB) e com a produção
de um número ainda maior de cópias de DNA em determinado período de tempo (Tomita et al.,
2008). A figura 2 apresenta um esquema de amplificação por LAMP na região-alvo.

ETAPAS DE FUNCIONAMENTO DA TÉCNICA LAMP

FIGURA 2 – Esquema representando as etapas de funcionamento da técnica LAMP, com a identificação das regiões onde os iniciadores devem hibridizar.

PROGRAMA RHAE TRAINEE CNPq – IEL 141


O presente trabalho teve como objetivo DEFINIÇÃO DAS
desenvolver testes de LAMP para detecção REGIÕES-ALVO E DESENHO
genérica de Salmonella e de dois sorotipos DE INICIADORES
específicos (Enteritidis e Heidelberg) que são
epidemiologicamente importantes e ocorrem As regiões genéticas alvo dos testes foram
com frequência na produção de produtos de escolhidas a partir de revisão da literatura
origem animal, principalmente de aves (fran- científica, tendo como foco principal artigos
gos e ovos). Além do estabelecimento do publicados sobre métodos de detecção de
procedimento de amplificação isotérmica, Salmonella e dos sorotipos Enteritidis e Hei-
objetivou-se também desenvolver uma for- delberg por PCR e LAMP. Adicionalmente, as
ma de avaliação colorimétrica, diretamente regiões-alvo foram avaliadas quanto à especi-
em tubos de ensaio. ficidade, mediante a utilização da ferramen-
ta BLAST (Basic Local Alignment Search Tool
- https://blast.ncbi.nlm.nih.gov/Blast.cgi) de
pesquisa de sequencias de DNA no banco de
dados GenBank.
MATERIAL E MÉTODOS Posteriormente, foram definidos os oli-
gonucleotídeos iniciadores para detecção
AMOSTRAS
de Salmonella e dos sorotipos Enteritidis e
Foram obtidos isolados de Salmonella de co-
Heidelberg pelo programa Primer Explorer
leções de culturas de laboratórios públicos
V5 (http://Primerexplorer.jp). Foram escolhi-
e privados de análises clínicas (humanas e
dos conjuntos de seis oligonucleotídeos para
animais) e de alimentos do Estado do Rio
cada alvo, contendo iniciadores externo sen-
Grande do Sul.
so (F3), externo antissenso (B3), interno sen-
Os isolados foram analisados sorologica-
so (FIP), interno antissenso (BIP), loop senso
mente, sendo identificados os sorotipos Ago-
(LF) e loop antissenso (LB).
na (n=1), Albany (n=1), Braenderup (n=1),
A tabela 1 apresenta os conjuntos selecio-
Enteritidis (n=10), Gafsa (n=1), Gallinarum
nados, explicitando as regiões (genes) alvo
(n=3), Give (n=2), Hadar (n=1), Heidelberg
e os estudos que definiram os respectivos
(n=2), Infantis (n=3), Johannesburg (n=1),
iniciadores. Os iniciadores foram adquiridos
Livingstone (n=1), Mbandaka (n=1), Ohio
de empresa especializada (IDT, Coralville, IA,
(n=1), Oranienburg (n=1), Panama (n=3),
USA).
Rissen (n=1), Saintpaul (n=1) e Typhimurium
(n=4). Também foram obtidas 33 amostras
de bactérias, após crescimento em caldo de
meio de cultivo de água peptonada.

142 INOVA TALENTOS


06

INICIADORES UTILIZADOS NAS REAÇÕES DE LAMP

ALVO PRIMERS

Salmonella F3 USDA 5’ – CGGCCCGATTTTCTCTGG – 3’


(invA) B3 USDA 5’ – CGGCAATAGCGTCACCTT – 3’
Cheng et al,
2011 FIP USDA 5’ – GCGCGGCATCCGCATCAATA–TGCCCGGTAAACAGATGAGT – 3’
BIP USDA 5’ – GCGAACGGCGAAGCGTACTG–TCGCACCGTCAAAGGAAC – 3’
LF USDA 5’ – GGCCTTCAAATCGGCATCAAT – 3’
LB USDA 5’ – GAAAGGGAAAGCCAGCTTTACG – 3’

Enteritidis F3 safA 5’ – TGCTGGTAGTGCATGGAA – 3’


(safA) B3 safA 5’ – AGTTATTGGGTACGTATCAGG – 3’
Este estudo FIP safA 5’ – GCCATGACCTCTGCTCATATTATTA–TGGTAAAAATAGTGGCACGAT – 3’
BIP safA 5’ – GGAGCTGGTTCACCTTTGATAC–GGGATATTCTGAGCCCCTAT – 3’
LF safA 5’ – TTTGAGAAGCCCACAGTGAGT – 3’
LB safA 5’ – CAATGCCCCACTTGATATTGTTACA – 3’

Heidelberg F3 SH 5’ – TCTAGCATAGTTCCAAAGCA – 3’
(enzima de B3 SH 5’ – GACCAGCATAATCTTTCGTT – 3’
Restrição
hipotética) FIP SH 5’ – CAGCCACTATTGAATGACAAAATGC–CACCCTGTACTCTCAACGA – 3’
Este estudo BIP SH 5’ – GGCGGGCGGATGTTTATGAA–CTAATGCTCTTGAGTTTGCA – 3’
LF SH 5’ – AGCTTAGCAGGCTTTTTGGC – 3

TABELA 1 – Iniciadores utilizados nas reações de LAMP.

ANÁLISE DE SALMONELLA E de 15s, a 95°C e 60 segundos, a 60°C) no


DOS SOROTIPOS ENTERITIDIS E equipamento Step One Plus (Applied Biosy
HEIDELBERG POR PCR EM TEMPO REAL stems, Foster City, CA, USA).
Por sua vez, a análise de casos positi-
O DNA de cada isolado foi extraído pelos vos e negativos foi realizada diretamente
kits NewGene Prep e PreAmp e submetido no equipamento pela presença de curvas
para detecção genérica de Salmonella, usan- de amplificação e determinação dos valores
do o conjunto de reagentes para PCR em de ciclo-limite de leitura (Ct, cycle treshold).
tempo real NewGene SALAmp (Simbios Amostras positivas demonstravam curvas
Biotecnologia, Cachoeirinha, RS, Brasil). de amplificação com CTs entre 10 e 35, en-
Os ensaios de PCR foram realizados quanto amostras negativas não apresenta-
com as condições recomendadas de am- vam curvas de amplificação.
plificação (um ciclo de desnaturação inicial O DNA de todos os isolados foi também
de 3 minutos a 95°C, seguido de 40 ciclos submetido para detecções especificas de

PROGRAMA RHAE TRAINEE CNPq – IEL 143


Salmonella Enteritidis e Heidelberg, usando observar a alteração da coloração, e poste-
conjuntos de reagentes para PCR em tempo riormente por eletroforese em gel de polia-
real NewGene SEAmp e SHAmp (Simbios crilamida 10%, corado com nitrato de prata.
Biotecnologia, Cachoeirinha, RS, Brasil). Os Os resultados foram documentados por foto
ensaios de PCR foram realizados com as e digitalização da imagem dos géis. Todas as
condições recomendadas de amplificação análises foram realizadas com o uso de con-
no equipamento Step One Plus (Applied trole positivos e negativos.
Biosystems, Foster City, CA, USA). A análise
de casos positivos e negativos foi realizada
da mesma maneira descrita no item anterior.
RESULTADOS
REAÇÕES DE LAMP
DETECÇÃO DE SALMONELLA
As reações foram realizadas em sistemas de E DOS SOROTIPOS ENTERITIDIS
25µl, com concentrações variáveis de inicia- E HEIDELBERG
dores (0,1 a 0,2µM de F3 e B3, 1,6 a 1,8µM de
FIP e BIP e 0,8 a 1 µM de LF e LB) e entre 2 e Inicialmente, foram realizados testes de de-
8U da enzima Bst DNA polimerase 2.0 (New tecção de Salmonella nos DNAs extraídos
England Biolabs, Beverly, MA, USA). Os de- a partir dos 39 isolados. Os resultados de-
mais reagentes apresentaram concentra- monstraram a obtenção de curvas de ampli-
ções fixas: dNTPs (1,2 mM), KCl (50mM), ficação com CTs entre 17 e 20 (ou seja, resul-
(NH4)2SO4 (10mM), MgSO4 (8mM), tri- tado positivo) em todas as amostras com o
ton X-100 (0,1%). uso do sistema de reação SALAmp.
Também foi adicionado um composto Também foram realizados os testes de
químico que muda de coloração conforme o detecção de Enteritidis e Heidelberg utilizan-
pH (alterado conforme a ocorrência da am- do os sistemas de reação de amplificação
plificação pela liberação de pirofosfato e íons por PCR em tempo real sorotipo específicos
H+, acidificando o meio). SEAmp e SHAmp. Com o uso do sistema de
Esse mix de reação foi acrescido de 2µl da reação SEAmp, os 10 isolados do sorotipo
amostra de DNA extraído e os tubos foram Enteritidis apresentaram curvas de amplifica-
incubados de 30 a 60 minutos em termoblo- ção (resultado positivo), enquanto os demais
co, a uma temperatura de 65°C, seguido por isolados apresentaram resultado negativo.
5 minutos em 80ºC para desnaturação da Bst Já na análise com o sistema SHAmp, ape-
DNA polimerase. nas as duas amostras do sorotipo Heidelberg
Após a amplificação, o material foi ava- apresentaram resultado positivo, enquanto
liado primeiramente de forma visual, para as demais foram negativas (tabela 2).

144 INOVA TALENTOS


06

RESULTADOS DAS ANÁLISES COM OS SISTEMAS DE PCR EM TEMPO REAL E LAMP

PCR EM TEMPO REAL LAMP

Sorotipo Isolado Salmonella Heidelberg Enteritidis Salmonella Heidelberg Enteritidis


Agona 159 + - - + - -
Albany 207b/12 + - - + - -
Braenderup 166/12 + - - + - -
Enteritidis 161/10 + - + + - +
Enteritidis 129/11 + - + + - +
Enteritidis 50/12 + - + + - +
Enteritidis 73/12 + - + + - +
Enteritidis 67/13 + - + + - +
Enteritidis 148/13 + - + + - +
Enteritidis 28/14 + - + + - +
Enteritidis 7/15 + - + + - +
Enteritidis 10794/13 + - + + - +
Enteritidis 1623/15 + - + + - +
Gafsa 15939/13 + - - + - -
Gallinarum 11 + - - + - -
Gallinarum 77 + - - + - -
Gallinarum 146 + - - + - -
Give 172/10 + - - + - -
Give 204/11 + - - + - -
Hadar 19/12 + - - + - -
Heidelberg 170 + + - + + -
Heidelberg 180 + + - + + -
Infantis 171/12 + - - + - -
Infantis 50/13 + - - + - -
Infantis 73/13 + - - + - -
Johannesburg 321/11 + - - + - -
Livingstone 165 + - - + - -
Mbandaka 167/11 + - - + - -
Ohio 153/12 + - - + - -
Oranienburg 210/12 + - - + - -
Panama 162/10 + - - + - -
Panama 103/12 + - - + - -
Panama 86/13 + - - + - -
Rissen 163 + - - + - -
Saintpaul 80/13 + - - + - -
Typhimurium 5/12 + - - + - -
Typhimurium 109/13 + - - + - -
Typhimurium 104/14 + - - + - -
Typhimurium 5/15 + - - + - -

TABELA 2 - Resultados das análises com os sistemas de PCR em tempo real e LAMP.
PROGRAMA RHAE TRAINEE CNPq – IEL 145
IMPLEMENTAÇÃO DO PROCEDIMENTO DE DETECÇÃO DE SALMONELLA POR LAMP
Inicialmente, foi implementado o procedimento de detecção genérica de Salmonella por LAMP,
com o uso de amostra do sorotipo Typhimurium (5/12).
Foram realizadas amplificações utilizando a amostra concentrada e três diluições decimais,
obtidas a partir dessa amostra. Antes da incubação em banho isotérmico, observou-se uma co-
loração alaranjada em todas as amostras dos tubos (figura 3A). Após o tempo de reação, houve
mudança de coloração apenas nos casos positivos (figura 3B).
Todas as amostras foram adicionalmente analisadas por eletroforese em gel de poliacrilami-
da, onde foram observadas bandas de DNA nas amostras positivas, enquanto não houve am-
plificação nos controles negativos (figura 3C). Esses resultados demonstram amplificação em
todos os pontos com amostras de DNA do isolado 5/12 do sorotipo Typhimurium e ausência de
amplificação nos controles negativos.

[A] [C]
M 1 2 3 4 5 6 7 8 M

[B]

FIGURA 3 - Fotografia dos tubos com sistema de reação antes (A) e depois (B) da amplificação por LAMP (P=Positivo; N=Negativo).
Visualização dos produtos de amplificação em gel de poliacrilamida corado com nitrato de prata (C). A ordem dos tubos é a mesma do gel: 1)
Typhimurium 5/12; 2) Typhimurium 5/12 (1/10); 3) Typhimurium 5/12 (1/100); 4) Typhimurium 5/12 (1/1000); 5 a 8) Controles negativos. Nas duas
extremidades do gel, foi utilizado peso molecular (M), como referência da altura das bandas.

146 INOVA TALENTOS


06

Após esse processo, foi realizado experimento com os demais 38 isolados dos 19 diferentes
sorotipos. Novamente observou-se resultado positivo, com mudança de coloração e ocorrên-
cia de bandas no gel, em todos os tubos com presença de amostras de Salmonella (figura 4 e
tabela 2).

[A] [B]

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 M

FIGURA 4 - Fotografia dos tubos com sistema de reação antes (A) e depois (B) da amplificação por LAMP (P=Positivo; N=Negativo). Visual-
ização dos produtos de amplificação em gel de poliacrilamida corado com nitrato de prata (C). A ordem dos tubos é a mesma do gel com um iso-
lado de cada sorotipo: 1) Agona; 2) Albany; 3) Braenderup; 4) Enteritidis; 5) Gafsa; 6) Gallinarum; 7)Give; 8) Hadar; 9) Heidelberg; 10) Infantis;
11) Controle negativo; 12) Johannesburg; 13) Livingstone; 14) Mbandaka; 15) Ohio; 16) Oranienburg; 17)Panama; 18)Rissen; 19) Saintpaul; 20)
Typhimurium; 21) Controle negativo. Nas duas extremidades, foi utilizado peso molecular (M), como referência da altura das bandas.

PROGRAMA RHAE TRAINEE CNPq – IEL 147


DESENVOLVIMENTO DO PROCEDIMENTO
DE DETECÇÃO DE ENTERITIDIS E HEIDELBERG POR LAMP

Paralelamente, foram estabelecidos procedimentos de detecção dos sorotipos Enteritidis e Hei-


delberg por LAMP com o uso dos isolados 161/10 e 170, respectivamente. Os testes iniciais
foram realizados de forma semelhante ao anterior, ou seja, com a realização de amplificações
com as amostras concentradas e três diluições decimais. Os resultados demonstraram am-
plificação em todos os pontos com amostras de DNA dos respectivos isolados e ausência de
amplificação nos controles negativos (figura 5).

[A] [B]

[C] [D]

M 1 2 3 4 5 6 7 8 M M 1 2 3 4 5 6 7 8 M

FIGURA 5 - . Fotografia dos tubos com sistema de reação depois da amplificação por LAMP de Enteritidis (A) e Heidelberg (B). Visualização dos
produtos de amplificação em gel de poliacrilamida corado com nitrato de prata para o LAMP de Enteritidis (C) e Heidelberg (D). A ordem do gel é
a mesma dos tubos: 1) Amostra concentrada; 2) Diluição 1/10; 3) Diluição 1/100; 4) Diluição 1/1000; 5 a 8) Controles negativos. M=marcador de
peso molecular.

148 INOVA TALENTOS


06

Em seguida, foi realizado experimento com os demais 38 isolados dos 19 diferentes soroti-
pos. Obteve-se resultado positivo, com mudança de coloração e ocorrência de bandas no gel,
apenas nas amostras de DNA de isolados dos sorotipos Enteritidis e Heidelberg nos procedi-
mentos de LAMP para Enteritidis e Heidelberg, respectivamente. Nas demais amostras, não
houve mudança na coloração nos tubos e não foram observadas bandas no gel (tabela 2).

ANÁLISE DE AMOSTRAS DE CALDO DE ENRIQUECIMENTO POR LAMP

As 33 amostras de caldos incubadas na temperatura de 37°C por 24 h em água peptonada (meio


de cultura de enriquecimento) foram submetidas à extração de DNA com os kits NewGene
Prep e PreAmp, após analisadas por PCR em tempo real (com o kit SALAmp) e pelo método de
LAMP para detecção do gênero Salmonella.
Os resultados demonstraram a detecção de Salmonella pelo PCR em tempo real e LAMP
exatamente nas mesmas amostras. A tabela 3 apresenta a análise comparativa, demonstrando
a total conformidade de resultados e a excelente performance analítica do procedimento de
LAMP (sensibilidade, especificidade e acurácia 100% e kappa 1,0).

QPCR (+) QPCR(-) TOTAL


TABELA 3 - Resultados compara-
tivos obtidos pela amplificação
LAMP (+) 23 0 23 isotérmica LAMP e a PCR em
tempo real (qPCR).
LAMP (-) 0 10 10

TOTAL 23 10 33

O motivo principal é que os procedimentos


DISCUSSÃO padrões de detecção de Salmonella (bacte-
O controle da contaminação por Salmonella riológicos, bioquímicos e sorológicos) são
em alimentos e no homem é fundamental excessivamente laboriosos e demorados,
para a saúde pública. Métodos rápidos e sen- além de só poderem ser realizados por téc-
síveis são necessários para a detecção desse nicos altamente especializados.
patógeno no ambiente, em alimentos e em A necessidade de diferentes etapas (pré-
amostras clínicas humanas. No entanto, ain- -enriquecimento, enriquecimento seletivo,
da não existem métodos práticos que possi- identificação bioquímica e sorológica) tor-
bilitem rápida detecção em locais com pouca na o procedimento completo extremamen-
infraestrutura laboratorial (Yang et al., 2010). te complexo. Em geral, são necessários em

PROGRAMA RHAE TRAINEE CNPq – IEL 149


média cinco dias para uma análise completa, caldos de enriquecimento, obtido 6 a 12 ho-
período relativamente longo, se considerar- ras após a coleta da amostra, de maneira que
mos as medidas necessárias para tratamento os resultados finais possam ser disponibili-
no ambiente, retirada de alimentos contami- zados em menos de 24 horas (em compara-
nados do mercado e adoção de medidas pro- ção aos cinco dias, normalmente necessários
filáticas em pessoas contaminadas. pelo procedimento tradicional).
O desenvolvimento de métodos molecu- Além disso, a adição de composto químico
lares baseados em ácidos nucleicos (princi- que muda de coloração com a ocorrência de
palmente PCR) permitiu acelerar a detecção amplificação permitiu uma análise visual dire-
de Salmonella em amostras clínicas e alimen- ta nos tubos de ensaio. O processo completo
tos desde os anos 1990 (Gadó et al., 2000; pode ser realizado em laboratórios com infra-
Feder et al., 2001). estruturas muito mais simples e que possuam
Técnicas de PCR têm sido utilizadas cres- apenas banhos termostáticos, sem a necessi-
centemente para detecção de Salmonella e dade de equipamentos e insumos para a reali-
identificação de sorotipos. A PCR tem inclu- zação de procedimentos bacteriológicos com-
sive apresentado melhores resultados do que plexos (estufas, incubadoras) e/ou técnicas de
os métodos clássicos, pois possibilita índices biologia molecular, que precisem de variações
mais elevados de positividade em amostras de temperaturas (como PCR).
de caldo de enriquecimento, com a detecção Esse procedimento certamente pode ser
de bactérias que não crescem nos meios de uma alternativa de detecção molecular de
cultura seletivos (Dickel et al., 2004). Salmonella extremamente importante em
No entanto, a técnica de PCR ainda é usu- locais e regiões com menores recursos, con-
almente considerada mais dispendiosa do forme preconizado anteriormente (Mori et al,
que o método bacteriológico (devido ao custo 2009; Boehme et al., 2007).
dos insumos importados), necessita de pes- Adicionalmente, foram desenvolvidos
soal técnico qualificado e principalmente equi- dois testes de LAMP para detecção específica
pamentos sofisticados (Kokkinos et al., 2014). dos sorotipos Enteritidis e Heidelberg, proce-
O presente estudo realizou a implemen- dimentos que também apresentaram elevada
tação e a validação de técnica de detecção especificidade.
de Salmonella por LAMP (amplificação iso- Embora não tenham sido realizados tes-
térmica). Os resultados demonstraram uma tes a partir de um grande número de amos-
performance analítica excelente, comparável tras de caldos de pré-enriquecimento – como
a outros trabalhos que avaliaram este procedi- na implementação do teste para o gênero
mento (Hara-Kudo et al., 205; Chen et al., 2011). Salmonella – experimentos preliminares de-
Também foi demonstrada a viabilidade de monstraram resultados semelhantes.
realizar a detecção tanto de isolados como de Ao longo da pesquisa bibliográfica, cons-

150 INOVA TALENTOS


06

tatou-se a existência de outro estudo, realiza-


do com o sorotipo Enteritidis (mas com ou-
CONSIDERAÇÕES FINAIS
tro alvo – sdfI) que demonstrou performance Nas últimas décadas, a evolução dos mtodos
analítica semelhante – inclusive testando a para análise microbiológica tem sido bastante
performance em condições de campo (Yang significativa; já que métodos convencionais,
et al., 2010). baseados em cultivos de microrganismos,
Já o procedimento de análise de Hei- começaram a não atender mais às necessi-
delberg foi totalmente original, pois não dades da indústria. O desenvolvimento de
encontramos artigos ou patentes que esta- novas ferramentas – mais rápidas, sensíveis,
beleceram LAMP para detecção do sorotipo reprodutíveis, de fácil execução e custo mais
Heidelberg. Novos estudos estão sendo re- acessível – se tornou imprescindível.
alizados para validar esses testes e também Nos anos 1980, a PCR foi descrita e re-
implementar procedimentos específico para volucionou o diagnóstico de patógenos e
detecção de outros sorotipos de Salmonella demais microorganismos, tendo como prin-
epidemiologicamente importantes (como cipal vantagem a de permitir a obtenção in
Typhimurium, Gallinarum, Minessotta e vitro de bilhões de cópias de um segmento
Cholerasuis). Por oferecer a possibilidade de de DNA de qualquer natureza, em um pe-
resultados rápidos e qualitativos, a técnica queno tempo. No entanto, uma das desvan-
de LAMP pode ser utilizada para análise de tagens do método é o uso de equipamentos
amostras de campo, provenientes de gran- caros (termociclador), que requererem mui-
jas, frigoríficos, entre outros. A perspectiva é tos cuidados na execução das análises.
a implementação e comercialização de uma A técnica LAMP foi avaliada e testada
linha de testes rápidos para detecção de Sal- como uma nova ferramenta para diagnós-
monella e principais sorotipos com o uso tico do gênero Salmonella e dos sorotipos
deste método (figura 6). Enteritidis e Heidelberg. Os resultados de-
monstraram que os testes são rápidos e
práticos e podem ser produzidos na forma
FIGURA 6. Imagem de protótipo de kit de kits de diagnóstico. O protocolo LAMP
de amplificação LAMP para detecção de
Salmonella (contém todos os reagentes) representa um novo paradigma em diag-
e os materiais mínimos necessários para
nóstico molecular, dispensando estrutura
realização da técnica (banho-maria e
micropipetas, considerando detecção pelo laboratorial complexa, por sua simplicidade
método visual).
e robustez, além de oferecer sensibilidade e
acurácia analítica, com ótima agilidade.

PROGRAMA RHAE TRAINEE CNPq – IEL 151


and PCR-hybridization for detection of Salmonella
REFERÊNCIAS in porcine fecal and water samples. Journal Clinical
Microbiology, v.39, p. 2477-2484, 2001.
BIBLIOGRÁFICAS
FERREIRA. E.O, CAMPOS, L.C., SALMONELLA,
BOEHME, C.C., NABETA, P., HENOSTROZA, G., IN: TRABULSI, LR.,ALTERTHUM, F. Microbiologia.
RAQIB R., RAHIM, Z., GERHARDT, M.E S.,HOELS- São Paulo, p. 329-338, 2008.
CHER, M., NOTOMI, T., TETSU, T., PERKINS,
M.D. Operational Feasibility of using loop-mediated FIERER, J., GUINEY, D.G. Diverse virulence traits
isothermal amplification for diagnosis of pulmonary underlying different clinical outcomes of Salmonella
tuberculosis in microscopy centers of developing infection. The Journal of Clinical Investigation, v.10,
countries. Journal of Clinical Microbiology, v. 45, p. p. 7775 -7780, 2001.
1936–1940, 2007.
GADO, I., MAJOR, P., KIRALY, M., PLAVECZKY, M.G.
BRASIL. Manual técnico de diagnóstico Laborato- Rapid combined assay for Salmonella detection in
rial da Salmonella ssp. Série A. Normas e Manuais food samples. Acta Microbiology Immunology, v.47,
Técnicos. Ministério da Saúde/Departamento de p.445-456, 2000.
Apoio a Gestão de Vigilância em Saúde/Secretária
de Vigilância em Saúde/Departamento de Apoio à GANDRA, E.A, GANDRA, T.K.V, MELLO, W.S.,
Gestão de Vigilância em Saúde. Brasília - DF, 2011. GODOI, H.S. Técnicas moleculares aplicadas à mi-
crobiologia de alimentos. Acta Science Technology, v.
CDC, CENTER FOR DISEASES CONTROL. In-
30, p. 109-118, 2008.
cidence and Trends of Infection with Pathogens
Transmitted Commonly Through Food — Foodborne HARA-KUDO Y, YOSHINO M, KOJIMA T, IKEDO
Diseases Active Surveillance Network, 10 U.S. Sites, M. Loop-mediated isothermal amplification for the
2006–2013. Morbidity and Morbidity Weekly Report, rapid detection of Salmonella. FEMS Microbiol Lett.,
v. 63, p.328-332, 2014.
v. 253, p.155-161, 2005.

CHEN S, WANG F, BEAULIEU JC, STEIN RE, GE B.


ISSENHUTH- JEANJEAN, S., ROGGENTIN, P.,
Rapid detection of viable salmonellae in produce by
MIKOLEIT, M. MGUIBOURDENCHE, M., PINNA,
coupling propidium monoazide with loop-mediated
E., NAIR, S., FIELDS, I.P., WEILL, X.F. Supplement
isothermal amplification. Appl Environ Microbiol. V.
2008–2010 (no. 48) to the White–Kauffmann–Le
77(12), p.4008-4016, 2011.
Minor scheme. Research in Microbiology, v. 165, n. 7,
EL-SHARKAWY H., TAHOUN A., EL-GOHARY A. p. 526-530, 2014.
E.G.A., EL-ABASY M., EL- KHAYAT F., GILLESPIE
T., KITADE Y., HAFEZ H.M., NEUBAUER H., EL- KOKKINOS, P.A., ZIROS, P.G., BELLOU, M, VANTA-
ADAWY H. Epidemiological, molecular characteriza- RAKIS, A. Loop-Mediated Isothermal Amplification
tion and antibiotic resistance of Salmonella enterica (LAMP) for the Detection of Salmonella in Food.
serovars isolated from chicken farms in Egypt. Gut Food Analytical Methods, v.7, p.512-526, 2014.
Pathogens, v. 9:8, 2017.
LOUREIRO, E.C.B., MARQUES, N.D.B., RAMOS,
FEDER, I., NIETFELD, J.C., GALLAND, J., YE- F.L.P. Salmonella serovars of human origin identi-
ARY, T., SARGEANT, J.M., OBERST, R., TAMPLIN, fied in Pará State, Brazil from 1991 to 2008. Revista
M.LLUCHANSKY, J.B. Comparison of cultivation Pan- Amazônica de Saúde, v. 1, p. 93-100, 2010.

152 INOVA TALENTOS


06

MALORNY, B., PACCASSONI, E., FACH, P., WHO Salmonella (non-typhoidal). Disponível em:
BUNGE, C., MARTIN, A.,HELMUTH, R. Diagnostic http://www.who.int/mediacentre/factsheets/fs139/
Real-time PCR for detection of Salmonella in food. en/. Acesso em: 01/06/2016
Applied and Environmental Microbiology, v. 70, p.
7046-7052, 2004. YAN, L., ZHOU, J., ZHENG, Y., GAMSON, A.S.,
ROEMBKE, B.T., NAKAYAMA, S., SINTIM, H.O.
MENEZES, Y.E. Identification and Characterization Isothermal amplified detection of DNA and RNA.
of Salmonella serotypes isolated from pork and Molecular Biosystems, v. 10, p. 970-1003, 2014.
poltry from commercial sources. Lincoln, Nebraska,
2010. Thesis (Master of Science) - University of YANG, J.L,, MA, G.P,, YANG, R., YANG, S.Q., FU,
Nebraska. L.Z., CHENG, A.C., WANG, M.S., ZHANG, S.H.,
SHEN, K.F., JIA, R.Y., DENG, S.X., XU, Z.Y. Simple
MORI, Y., NOTOMI, T. Loop-mediated isothermal
and rapid detection of Salmonella serovar Enteriti-
amplification (LAMP): a repid, accurate, and cost-
dis under field conditions by loop- mediated isother-
-effective diagnostic method for infectious diseases,
mal amplification. Journal of Applied Microbiology,
Journal of Infection and Chemotherapy, v.15, p,
v. 109, p. 1715-23, 2010.
62–69, 2009.

PARIDA, M., SANNARANGAIAH, S., DASH, P.K.,


RAO, P., MORITA, K. “Loop mediated isothermal
amplification (LAMP): a new generation of innova-
tive gene amplification technique; perspectives in
clinical. Diagnosis of Infectious Diseases, v.18, p.
407-42, 2008.

SUEZ J, PORWOLLIK S, DAGAN A, MARZEL


A, SCHORR YI, DESAI PT, et al. Virulence Gene
Profiling and Pathogenicity Characterization of
Non- Typhoidal Salmonella Accounted for Invasive
Disease in Humans. PLoS ONE 8(3). 2013.

TOMITA, N., MORI, Y., KANDA, H., NOTOMI, T.


Loop-mediated isothermal amplification (LAMP)
of gene sequences and simple visual detection of
products. Nature Protocols, v. 3, p. 877-882, 2008.

TRABULSI, L.R., ALTERTHUM, F. Microbiologia.


Ed. Atheneu, São Paulo, 2004.

VIDAL, J.E, SILVA, P.R., SCHIAVON, N.R., BONAS-


SER, F.F., HERNANDEZ, A.V. Liver abscess due to
Salmonella Enteritidis in a returned traveler with
HIV infection: case report and review of the literatu-
re. Revista do Instituto de Medicina Tropical de São
Paulo, v.45, p.115-117, 2003.

PROGRAMA RHAE TRAINEE CNPq – IEL 153


07
MODELAMENTO
MATEMÁTICO E CRIAÇÃO DE
SIMULADOR COMPUTACIONAL
PARA O SISTEMA PNEUMÁTICO
DE ÔNIBUS URBANOS E RODOVIÁRIOS.
JA IR O V INÍC IU S LAVA R DA
_
Engenheiro mecânico
UNIOESTE, 2012
_
Mestre em Engenharia Mecânica
UTFPR, 2015

jairolavarda@gmail.com

Rua Sylvio Zeny, 106, ap. 52,


Curitiba – PR.
CEP: 80320-190

(41) 99772-9752

155
R E SU M O

PALAVRAS CHAVE simulador computacional, ônibus, análise de dados, programação.

Sabe-se que os veículos pesados possuem um sistema pneumático para realizar as fun-

ções básicas. Esse sistema é composto basicamente pelo compressor (que produz o ar),

pelas tubulações e os tanques (que armazenam o ar) e pelos subsistemas que o conso-

mem (freio de serviço e estacionamento, portas, rampas, suspensão e sistemas de pós-

-tratamento dos gases de escapamento). Assim, o bom funcionamento do compressor

garante que o sistema sempre tenha ar disponível. Para isso, o tempo de funcionamento

máximo dos compressores não pode exceder um limite, determinado pelos fabricantes.

Levando em consideração tais fatores, o objetivo deste trabalho é modelar matematica-

mente e implementar um simulador, para que seja estimado o tempo de funcionamento

dos compressores, além de apresentar as limitações e incertezas associadas tanto às me-

dições reais utilizadas, como às limitações do código, tempo e modelos.

Também serão apresentados em detalhe todas as suposições e conceitos usados para mo-

delar o sistema completo de ar de ônibus. Ao final, serão apresentados alguns trechos do

código e alguns estudos preliminares, bem como discriminados os resultados extraídos

do simulador.

156 INOVA TALENTOS


07

A BSTR ACT

KEYWORDS computational simulator, buses, data analysis, code programming

The heavy duty vehicles have a pneumatic system to roll the basic functions. This

system is composed basically by one compressor, pipes and tanks (air storage) and the

consumers, likely service and parking brakes, doors, ramps, suspension and exhausted

gas posttreatment system. Thus, the good working of the compressor is fundamental for

the whole pneumatic system. Thereunto, the maximum working time of the compressor

(set by fabricators) do not be exceed. With this in mind, the aim of this study is to model

mathematically and programming a code of one simulator to predict the duty cycle of

compressors. In the present study are the explanations of the ACDC simulator creation

(Air consumption and Duty Cycle simulator), further to show limitations and associated

uncertainties. All the hypothesis, conception and models of the system are also shown. In

last part of the study are presented some simulator code parts, preliminary studies and the

results obtained from simulator.

PROGRAMA RHAE TRAINEE CNPq – IEL 157


INTRODUÇÃO OBJETIVOS
Realizar o modelamento matemático do cir-

N
os últimos anos, as megacidades cuito pneumático de ônibus urbanos e rodo-
buscam soluções de mobilidade ur- viários e implementar um código computa-
bana para se tornarem mais eficien- cional para a simulação.
tes, com melhor gasto energético e com redu-
ção de emissões de gases nocivos.
Para isso, muitas montadoras estão inves- MÉTODOS
tindo em veículos híbridos, com propulsão
O simulador computacional foi baseado na
mista (motor à combustão, juntamente com
análise dos dados coletados em rotas reais
motores elétricos) [1]. Essa tendência também
utilizadas por ônibus da Volvo (por exemplo,
ocorre para veículos pesados [2], uma vez que
rotas de Curitiba, Bogotá, etc.). Esses dados
as normas de redução de poluentes também
contêm informações sobre as pressões nos
são aplicadas a eles. Com a mudança dos sis-
tanques de ar principais e secundários dos
temas de propulsão nos ônibus, também é
ônibus, a velocidade do veículo e a rotação
necessário adequar os sistemas acoplados ao
do motor.
motor, como, por exemplo, o compressor.
Todas essas informações, adquiridas nos
A utilização de compressores nos veícu-
testes, foram utilizadas para a compreensão
los pesados faz-se necessária para fornecer ar
do funcionamento do sistema e para a cria-
comprimido para o circuito pneumático, uma
ção do simulador no MATLAB, utilizando ba-
vez que a abertura das portas, a frenagem e
ses matemáticas de engenharia e de progra-
a suspensão funcionam com ar. Contudo, o
mação para a obtenção do simulador.
parâmetro crucial para os compressores é o
A seguir, serão apresentadas as hipóteses
tempo de engajamento (do inglês, duty cycle),
assumidas, os modelos matemáticos e os
o qual não pode nem ser nem muito baixo
parâmetros, utilizados no desenvolvimento
(para mantê-lo quente, visando ao bom fun-
do simulador.
cionamento) nem muito elevado (para dar
tempo de esfriá-lo e de realizar a limpeza do
sistema de secagem do ar) [3]. Dessa forma, HIPÓTESES ASSUMIDAS
saber a carga de ar necessária nos ônibus – e, Algumas hipóteses se fazem necessárias
consequentemente, o tempo de engajamento para o modelamento matemático do siste-
necessário dos compressores, é vital para o ma, uma vez que muitas variáveis não po-
correto funcionamento do sistema, o que ge- dem ser corretamente medidas ou previstas.
rou a demanda pela criação de um simulador, Assim, são adotadas as hipóteses relaciona-
capaz de estimar esse tempo. das a seguir:

158 INOVA TALENTOS


07

Todos os tanques estão totalmente preenchidos de ar no início da simulação;


1. O sistema é considerado em regime transiente;

2. As trocas térmicas são desprezíveis (já está na temperatura de trabalho);

3. As temperaturas e pressões de entrada do ar no compressor são constantes


ao longo da simulação, independentemente da mudança de altitude na rota;

4. Todos os subsistemas são tratados como novos, ou seja, não são levados em
consideração desgastes e avarias que ocorrem durante a vida útil
desses equipamentos;

5. A eficiência de cada componente só é considerada quando os dados relativos aos


compressores estiverem disponíveis;

6. As perdas de carga e por atrito são desprezíveis, uma vez que as tubulações são curtas, e
a diferença de pressão entre os tanques é pequena.

MODELAMENTO MATEMÁTICO
O desenvolvimento do simulador baseia-se no modelo de gás ideal, apresentado na equação
1.1, que relaciona diretamente a massa, a pressão e o volume dentro de qualquer tanque ou
câmara da seguinte forma [4]:

(1.1)

sendo P a pressão [kPa],


V o volume [m3],
m a massa [kg],
R = 0,287 kJ/kg.
K a constante dos gases para o ar e
T a temperatura [K].

Para garantir que os parâmetros obtidos pela equação 1.1 sejam válidos, as variáveis precisam
respeitar as seguintes condições [4]:

PROGRAMA RHAE TRAINEE CNPq – IEL 159


𝑃 ≪ , para qualquer temperatura
𝑇 > 2𝑇𝑐 para 𝑃 ≤ 5𝑃𝑐

Onde 𝑃𝑐 e 𝑇𝑐 são pressão e temperatura críticas, respectivamente.

Para o ar, esses valores são 𝑃𝑐 = 3,37 Mpa e 𝑇𝑐 = −140°𝐶 [4]. Assim, substituindo os valores do
ar na relação acima, obtêm-se os parâmetros limitantes para a utilização do modelo:

𝑃 ≤ 15,08 𝑀𝑃𝑎 𝑒 𝑇 > −70°𝐶

Portanto, o sistema de ar dos ônibus pode ser descrito mediante a utilização do modelo de
gás ideal, uma vez que a pressão e a temperatura encontradas nesta aplicação são suficiente-
mente distantes dos fatores limitantes.

FLUXO MÁSSICO, EM VEZ DE FLUXO VOLUMÉTRICO


A base de operação de qualquer tipo de compressor é o aumento da pressão do gás confinado
em sua câmara pela diminuição do volume, o que também aumenta a temperatura do ar.
Logo, se considerado o fluxo volumétrico que circula pelo sistema, não será considerado o
quanto de energia disponível está contida realmente no ar (por exemplo, 1L de ar a 1 bar tem
menos energia disponível para trabalho do que 1L de ar a 12 bar). Assim, para a análise levar
em consideração as variações de pressão e temperatura, deve-se observar o ponto de vista do
fluxo mássico.

pela câmara do compressor com 𝑉𝑎𝑡𝑚, podemos observar, na equação 1.2, que, conforme o volu-
Partindo da equação. 1.1, reorganizando para massa e considerando o volume de ar admitido

me de ar que sai, 𝑉𝑠𝑦𝑠 será menor, devido à variação da pressão, embora a massa permaneça
a mesma [5].

(1.2)

Essa mesma observação pode ser feita utilizando a lei da conservação da massa, que diz que
a variação da massa em um volume de controle fixo é igual à massa restante, dentro do volume
de controle. De forma matemática [5]:

(1.3)

160 INOVA TALENTOS


07

Nota-se, então, que todas as considerações no sistema devem ser feitas com base na massa
de ar existente no interior dos tanques, câmaras ou cilindros utilizados.

FLUXO MÁSSICO NAS TUBULAÇÕES


Outro ponto que deve ser analisado é a transferência de massa entre dois recipientes que con-
têm ar (tanques, câmaras ou cilindros) pelos mesmos motivos descritos na seção anterior. Se
considerarmos a transferência de massa entre dois volumes do sistema por uma tubulação de
seção transversal A, a taxa de variação de massa, dentro de um dos volumes, será [5]:

(1.4)

ρ a densidade [kg/m3],
sendo dm/dt o fluxo de massa [kg/s],

v a velocidade [m/s] e
A a área da seção transversal do tubo [m2].

Agora, se utilizarmos a equação de Bernoulli entre dois pontos conhecidos, desconside-


rando as perdas de carga na linha, podemos obter uma relação para a velocidade [5]:

(1.5)

substituindo a equação 1.5 na equação 1.4, obtém-se:

(1.6)

Voltando à lei do gás ideal, mas rearranjando para a densidade,

(1.7)

e substituindo a equação. 1.7, obtém-se na equação 1.6:

(1.8)

PROGRAMA RHAE TRAINEE CNPq – IEL 161


A equação 1.8 mostra que o fluxo mássico, diretamente proporcional à área da seção trans-
versal da tubulação, é resultante da diferença de pressão existente entre os pontos considerados
(os mesmos assumidos na equação 1.5). Separando as variáveis para realizar a integração na

ção para dois passos de tempo ti até ti+1 (sendo ∆𝑡 = 𝑡𝑖+1 − 𝑡𝑖), finalmente obtemos:
equação 1.8 – para que seja implementada no simulador – e substituindo os limites de integra-

(1.9)

sendo Pi a pressão do recipiente transmissor de massa e

além da variação de tempo Δt [s].


Pf a pressão do recipiente receptor de massa [kPa],

Todos os cálculos da transferência de massa entre os tanques e os componentes do sistema


de ar serão feitos pela equação 1.9, considerando os pontos iniciais e finais relevantes à trans-
ferência considerada.

MASSA ADMITIDA PELO COMPRESSOR


Como discutido anteriormente, todo o design do sistema é baseado no fluxo mássico do ar. A
partir da lei do gás ideal (equação 1.1), com pressão e temperatura ambientes, podemos ver que
mudanças nesses parâmetros (mantendo os outros constantes), alteram a quantidade total de
massa admitida pelo compressor. Ou seja:

(1.10)

Isso ocorre porque o volume da câmara do compressor é fixo, considerando seu ponto morto
inferior. Em outras palavras, se a pressão ambiente aumentar, a massa aumentará, enquanto, se
a temperatura aumentar, a massa diminuirá.
Nota-se, também, que a equação 1.10 só leva em consideração a admissão de massa para 1
ciclo. Contudo, o compressor realiza vários ciclos de admissão por segundo, haja vista que está

pressor (RPScomp) para obter a massa de ar gerada por segundo (𝑚̇) [kg/s], modifica-se a
diretamente acoplado ao motor do ônibus. Assim, utilizando a rotação por segundo do com-

equação 1.10 e obtém-se:

162 INOVA TALENTOS


07

(1.11)

A equação 1.11 é utilizada no código do simulador para estimar a massa de ar admitida pelo
compressor, independentemente do tipo do compressor e do volume da câmara, alterados
quando o compressor é selecionado no simulador.

EFICIÊNCIA VOLUMÉTRICA DO COMPRESSOR


Como todos os sistemas mecânicos, os compressores também têm os seguintes parâmetros de
eficiência: adiabática, mecânica e volumétrica. Neste estudo, apenas é necessário considerar a
eficiência volumétrica, pois o estudo se concentra na massa produzida pelo compressor.
A eficiência volumétrica de um compressor é o volume total de ar entregue ao sistema, divi-
dido pelo volume total admitido em temperatura ambiente, ou seja [6]:

(1.12)

sendo o 𝑉𝑢 volume útil [m3],


𝑉𝑐𝑜𝑚𝑝 o volume total [m3] e
ηv a eficiência volumétrica.

Quanto maior o ηv, mais ar é entregue ao sistema para o mesmo volume admitido. Para os
compressores utilizados neste estudo, as eficiências volumétricas foram calculadas com base
nas curvas de eficiência, dependentes da rotação do compressor.

CÁLCULO DA PRESSÃO DOS FREIOS DE SERVIÇO


Existem dois tipos de freio nos ônibus: os auxiliares (freio motor e retardador hidráulico/pneu-
mático/magnético) e os freios a ar (de serviço e de estacionamento).
O primeiro tipo de freio é usado para minimizar o ar consumido pelo freio de serviço, impedindo
que o ônibus fique sem ar e assegurando a baixa temperatura nas pastilhas de freio para momentos
em que são realmente necessárias (a eficiência do freio diminui com o aumento da temperatura).
Entretanto, os freios auxiliares por si sós não possuem potência suficiente para parar o ôni-
bus completamente, além de a eficiência de frenagem diminuir com a velocidade.

PROGRAMA RHAE TRAINEE CNPq – IEL 163


Assim, para serem modelados os dois tipos de freios em conjunto e ativando primeiro os
freios auxiliares e depois os freios de serviço (abordagem utilizada nos ônibus reais), a seguinte
ideia foi utilizada para a implementação do sistema de freio no simulador:
ԎԎ calcular a variação de energia total do ônibus
a cada passo de tempo, quando em desaceleração;

ԎԎ calcular quanta energia cinética pode ser removida pelos freios auxiliares;

ԎԎ utilizar a potência restante para calcular a quantidade


de ar necessária nas câmaras de freio de serviço.

Para esse cálculo, precisamos considerar primeiro a energia cinética de um veículo em mo-
vimento, dada pela equação [7]:

(1.13)

Onde mB é massa do veículo


e v é a sua velocidade.

O sistema de freio tem que reduzir a energia cinética do veículo, convertendo sua velocidade
em energia térmica (aquecendo os discos ou tambores e as pastilhas). Essa variação na ener-
gia cinética é calculada pela variação da velocidade do veículo entre dois instantes de tempo
conhecidos:

(1.13-2)

Assim, a potência de frenagem pode ser calculada com base nessa variação de energia em um
único passo de tempo (∆𝑡):

(1.13)

sendo 𝑃𝑤𝑠𝑏𝑐 a potência dissipada pelo freio de serviço,


𝑃𝑤𝑒𝑛𝑔 a potência dissipada pelo freio do motor e
𝑃𝑤𝑟𝑒𝑡 a potência dissipada pelo retardador hidráulico.

Dessa forma, primeiro se calcula a potência dos freios auxiliares (𝑃𝑤𝑒𝑛𝑔 e 𝑃𝑤𝑟𝑒𝑡), consideran-
do todas as engrenagens e acoplamento entre eles e as rodas. Para calcular a potência de freio
do motor, tem-se:

164 INOVA TALENTOS


07

(1.14)

𝜔𝑐 é a velocidade angular do cardan


onde Gr é a relação de transmissão real (com base na caixa de velocidades),

𝑇𝑒𝑛𝑔 é o torque de frenagem do motor [Nm].


(isto é, a velocidade angular da roda multiplicada pela redução do cubo da roda) e

Para a frenagem do retardador hidráulico, temos dois conjuntos possíveis: o retardador mon-
tado antes da caixa de velocidades (configuração do ZF) ou o retardador montado após a caixa
de velocidades (configuração de Voith). A equação para a montagem do retardador antes da
caixa de velocidades é apresentada a seguir.

(1.15)

sendo 𝑎𝑐𝑡𝑟𝑒𝑡 a ativação do retardador hidráulico e


𝑇𝑟𝑒𝑡 o torque do retardador hidráulico.

Para o caso do retardador montado posteriormente à caixa de velocidade, é necessário des-


considerar o torque produzido pela caixa. Assim, quando uma frenagem é realizada, calcula-se
a potência dissipada por cada um dos freios auxiliares e, se mais energia for dissipada, ela é
atribuída inteiramente ao sistema de freio de serviço, como comentando anteriormente.
Para se saber qual a pressão de ar aplicada nas câmaras do freio de serviço, utilizam-se os
valores de torque produzidos por kPa em cada um dos eixos do ônibus, segundo parâmetros
fornecidos pelos fabricantes. Os valores encontrados nos ônibus, utilizados no desenvolvimento
do simulador, são:

(1.16)

onde 𝑇𝑏𝑘 corresponde aos freios a disco e


𝑇𝑏𝑟 corresponde aos freios a tambor.

Finalmente, para estimar a quantidade de pressão de ar necessária para frear o ônibus, divi-
dimos a potência total do freio de serviço pelos seguintes parâmetros:
ԎԎ número de eixos (𝑁𝐴);

ԎԎ Torque de frenagem no eixo (𝑇𝑏)

ԎԎ Velocidade angular da roda (𝜔𝑤)

PROGRAMA RHAE TRAINEE CNPq – IEL 165


(1.17)

A resposta obtida é dada em kPa. A potência dissipada pelos freios deve, necessariamente,
“zerar a variação da energia cinética”, ou seja, a equação 1.13 deve ser igual a zero.

SISTEMAS EURO DE EMISSÕES


Outra característica apresentada pelos ônibus atuais são os sistemas de controle de emissões.
O Brasil se baseia na norma europeia [8], conhecida mais amplamente pelos nomes de EURO 3,
EURO 5 e EURO 6 (esta última ainda em implantação).
Essas normas limitam a quantidade de poluentes que os veículos a diesel podem emitir em
gramas/km rodado.
O sistema EURO6 utiliza ar do circuito pneumático dos veículos pesados para injetar uma

escapamento saem para o ambiente), a fim de reduzir as emissões de 𝑁𝑂𝑥.


solução aquosa de ureia diretamente no último volume do escapamento (do qual os gases de

Assim, se esse sistema existe no ônibus que está sendo simulado, é necessário contabilizar
o gasto de ar com o EURO6, para que o simulador seja o mais próximo possível do real.

166 INOVA TALENTOS


07

FLUXOGRAMA DO SIMULADOR
A seguir é apresentado um fluxograma do simulador para ilustrar a ideia de funcionamento.
Cada ação ocorre em um passo de tempo da simulação.

SÃO FEITAS AS PERGUNTAS PARA TODOS OS PARÂMETROS


INÍCIO CONFIGURAR O ÔNIBUS SÃO CONFIGURADOS

+Δt

TODOS OS TANQUES
VERIFICA A ACELERAÇÃO
COMEÇAM CHEIOS

SIM
PARADO? SIM
CONSOME
ABRIU AR DO TANQUE DE
PORTAS? PORTAS/SUSPENSÃO
NÃO
NÃO
NÃO
<0?

+Δt
SIM
AUMENTOU CORRIGE
SIM CARGA? SUSPENSÃO

NÃO
CALCULA
POTÊNCIA FREIO CONSOME
AUXILIAR AR DO
SIM
TANQUE
FREIO DE DE FREIO
ESTACIONAMENTO? ESTACIONA-
MENTO
SIM

POTÊNCIA NÃO
SUFICIENTE?

PRESSÃO NO
<CUT IN? TANQUE
NÃO
PRINCIPAL
NÃO
CALCULA POTÊNCIA SIM
FREIO SERVIÇO
LIGA
COMPRESSOR

CONSUMO DE AR DO
TANQUE FREIO SERVIÇO
TRANSFERE AR

FIM DE 1 CICLO

PROGRAMA RHAE TRAINEE CNPq – IEL 167


RESULTADOS

LÓGICA DO SIMULADOR
Nesta seção, é apresentada a lógica utilizada em todo o simulador programado em MATLAB,
com as entradas necessárias, nas quais são feitas perguntas ao usuário para configurar todas
as seções apresentadas no código. A base do simulador é a pressão de ar no tanque primário,
pois todos os outros tanques estão conectados a ele, e o compressor produz ou para de pro-
duzir ar, baseado na sua pressão.

ENTRADAS DO SIMULADOR
Em primeiro lugar, os dados dos testes de RPM do motor e velocidade precisam ser inseridos
num modelo do Excel, para que o simulador consiga realizar os cálculos com aceleração e des-
locamento do ônibus. Esses dados devem ser de um teste já feito na rota que será simulada.
Depois, o simulador é executado e algumas perguntas são feitas para selecionar a configuração
correta do ônibus.

PERGUNTAS DO SIMULADOR:
Todas as perguntas feitas no início da simulação para configurar os parâmetros do ônibus,
rotas e condições ambientes são apresentadas abaixo.

ԎԎ Local da aplicação: necessário para mostrar opções extras, consideradas obrigatórias nos
testes de balanço de ar, como abrir ou não as portas e / ou aplicar mais de uma vez o
freio de estacionamento.

ԎԎ Temperatura ambiente: necessária para corrigir e avaliar a massa que entra na câmara do
compressor. A pressão ambiente também é necessária, mas é definida automaticamente
com base no local da rota.

ԎԎ Carga de ônibus: para verificar se foi selecionada qualquer rota diferente do balanço de ar
(primeira pergunta). Essa pergunta aparece para configurar a carga do ônibus (peso total
de pessoas): alta, média-alta, média, média-baixa, baixa e vazio.

ԎԎ Motor do ônibus: necessário para selecionar a relação de rotação correta entre motor e
compressor.

168 INOVA TALENTOS


07

ԎԎ Caixa de transmissão: necessária para calcular a potência do freio motor e do retardador


hidráulico.

ԎԎ Número de eixos: autoexplicável

ԎԎ Número de articulações: só aparece quando o número de eixos é maior ou igual a três.

ԎԎ Encarroçador: necessário para definir os diâmetros e os deslocamentos dos cilindros de


ar das portas e das rampas.

ԎԎ Tipo de freio: freio a disco ou tambor.

ԎԎ Número de aplicações de freio de estacionamento: perguntado apenas se o tipo de teste


for balanço de ar.

ԎԎ Retardador hidráulico ativado: somente se for um teste de balanço de ar, pois o padrão é
sempre ativado.

ԎԎ Sistema de combustão EURO6: se o motor for EURO 6, é utilizado ar do sistema


pneumático para neutralizar as emissões, sendo contabilizado pelo simulador.

ԎԎ Pressões de acoplamento e desacoplamento do compressor: questão vital para uma boa


previsão do valor do ciclo de trabalho do compressor, pois a simulação inteira é muito
sensível a mudanças nesse valor.

ԎԎ Compressor: uma lista aparece com os compressores utilizados, como Voith, Wabco e
Knorr (incluindo os movidos a motor elétrico).

Depois de responder a estas perguntas, o simulador define as configurações do ônibus. En-


tão, é executada a simulação, sendo apresentados os resultados e os gráficos, com as pressões
dos tanques de ar configurados.

PROGRAMA RHAE TRAINEE CNPq – IEL 169


O SIMULADOR
Nas figuras a seguir, são apresentadas algumas linhas do simulador implementado no MATLAB.

FIGURA 1 - Algumas linhas do simulador.

170 INOVA TALENTOS


07

RESULTADOS DO SIMULADOR
Quando a simulação é finalizada no console do MATLAB são apresentadas as informações
resultantes da simulação (Figura 2 - Resultado da simulação no console.), com todos os dados
configurados, o tempo de funcionamento do compressor, os valores de massa de ar consu-
mido por cada subsistema e as regenerações feitas (quando o compressor para e acontece a
limpeza do sistema de secagem de ar).

FIGURA 2 - Resultado da simulação no console.

PROGRAMA RHAE TRAINEE CNPq – IEL 171


Na Figura 3, é apresentado o consumo de massa de ar por cada subsistema do ônibus de
forma gráfica.

Doors
Parking brake
9% Service brake
Suspension
Leakage
8% Before air dryer
Regenaration

39% 7%

14%

FIGURA 3 -
Resultado gráfico
4% do simulador para
19% o consumo de ar.

As simulações realizadas sempre apresentaram os resultados das figuras 2 e 3, para facilitar


o controle do que foi inserido e a análise dos resultados obtidos.

DISCUSSÃO
Depois de realizar algumas simulações preliminares, foram observadas variações significativas
na estimativa do ciclo de trabalho dos compressores, quando feitas algumas alterações nas
variáveis de entrada. Assim, torna-se necessário uma análise da influência dos parâmetros que
alteram o ciclo de trabalho dos compressores, além do quanto eles o alteram.

PRESSÃO PARA ACIONAR E DESLIGAR O COMPRESSOR


Para entender melhor como o ciclo de trabalho muda com valores de pressão, algumas simula-
ções foram realizadas com os dados do balanço de ar de um ônibus articulado B12M, Euro 5, de
Curitiba. A tabela 1 - Condições de simulação para as pressões de acionamento e desligamento
do compressor mostra a configuração utilizada no teste e nas simulações.

172 INOVA TALENTOS


07

Os resultados são mostrados na Figura 4 (sem valores, por questões de segredo industrial),
em função da diferença entre acoplar e desacoplar o compressor. Tanto os valores limites de
pressão (eixo y) quanto a diferença entre as pressões (eixo x) foram baseadas nos valores reais
vistos nos testes, sendo extrapolado a diferença das pressões para notar a tendência. As pres-
sões de desacoplamento do compressor são mostrados na legenda.

CONDIÇÕES DE SIMULAÇÃO PARA AS PRESSÕES


DE ACIONAMENTO E DESLIGAMENTO DO COMPRESSOR

AMB. TEMP. AMB. PRES. BUS DOORS BRAKE RETARDER COMP.

18ºC 101.3 kPa B12M artic closed drum not use Wabco 636

TABELA 1 - Condições de simulação para as pressões de acionamento e desligamento do compressor

INFLUÊNCIA DA PRESSÃO DE ACIONAMENTO DE


DESLIGAMENTO DO COMPRESSOR NO CICLO DE TRABALHO.
DUTY CYCLE [%]

CUT IN/CUT OUT DIFFERENCE [BAR]

FIGURA 4 - Influência da pressão de acionamento de desligamento do compressor no ciclo de trabalho.

PROGRAMA RHAE TRAINEE CNPq – IEL 173


Os resultados mostram diminuição no tempo do ciclo de trabalho, à medida que aumenta
a diferença entre o acoplar e o desacoplar do compressor.. Outro ponto observado é a redução
do tempo do ciclo, quando a diferença se aproxima do ponto X, em ambos os casos. Após essa
diferença (1,1 bar), o ciclo de trabalho aumenta ligeiramente com o aumento da diferença.
Pode-se ver, também, que, utilizando a pressão de acoplamento mais alta marcas verme-
lhas, os resultados do tempo de ciclo de trabalho também são mais elevados, indicando que o
ciclo de trabalho aumenta com o aumento da pressão de acoplamento.
Calculando-se a diferença relativa o ponto X e o primeiro ponto na curva vermelha, obtém-
-se a variação relativa de 42%, ou seja, o aumento na diferença entre as pressões de acopla-
mento e desacoplamento do compressor faz com que ele trabalhe 42% menos tempo, pois
o compressor trabalha em um tempo mais longo a cada vez que é acionado e realiza menos
ciclos de limpeza do secador de ar, “desperdiçando” menos ar.
Assim, o tempo em que o compressor está acoplado e os efeitos que isso pode causar (por
exemplo, aumento de temperatura, diminuição da qualidade do ar, etc.) se tornam fatores
críticos para selecionar a melhor pressão de acoplamento e desacoplamento do compressor.

VARIAÇÃO DA ELEVAÇÃO DO AMBIENTE


Outro parâmetro de influência no ciclo de trabalho é a pressão ambiente. Sua influência pode
ser observada analisando a compressão em termos de massa. Como o volume da câmara do
compressor não muda (no ponto morto inferior), se a pressão ambiente for maior, mais massa
de ar entra, para a mesma temperatura. Como a pressão do sistema depende da massa de ar
que está nele, menos tempo será consumido para encher os tanques e, consequentemente,
menor será o ciclo de trabalho. A tabela 2 mostra as condições de simulação utilizadas para
verificar a variação do ciclo de trabalho com a pressão ambiente.

CONDIÇÕES DE SIMULAÇÃO PARA


A INFLUÊNCIA DA PRESSÃO AMBIENTE

BUS TYPE DOORS BRAKE RET. CUT OUT CUT IN COMP.

B12M artic closed drum not use 11.7 bar 10.5 bar Wabco 636

TABELA 2 - Condições de simulação para a influência da pressão ambiente

174 INOVA TALENTOS


07

Os resultados do ciclo de trabalho foram removidos por questões de segredo industrial.

INFLUÊNCIA DA PRESSÃO AMBIENTE NO CICLO DE TRABALHO


DUTY CYCLE [%]

AMBIENT PRESSURE [KPA]

FIGURA 5 - Influência da pressão ambiente no ciclo de trabalho.

É possível notar que o ciclo de trabalho sofre forte influência da pressão ambiente, como
esperado, passando de 40% (com 70 kPa) para 30% (com 100 kPa). Na tabela 3, é mostrada
a pressão atmosférica em função da elevação. Para comparação, alguns dos locais utilizados
pelos ônibus da Volvo: Curitiba (900 m), Bogotá (2600 m) e La Paz (3600 m).

RESULTADOS COMPILADOS DOS TESTES NO LABORATÓRIO VALIDA.

ELEVATION [m] 0 500 700 1500 2000 2500 3000 3500 4000
ATM. PRES. kPa 101.3 95.42 89.73 86.28 79.43 76.38 70.12 66.48 61.68

TABELA 3 - Pressão atmosférica em função da elevação

Assim, as estimativas do ciclo de trabalho ao nível do mar (como os testes de balanço de ar)
resultaram em valores menores do que em cidades com qualquer elevação.

PROGRAMA RHAE TRAINEE CNPq – IEL 175


INFLUÊNCIA DA TEMPERATURA AMBIENTE
Uma variação na temperatura ambiente também pode influenciar os valores do ciclo de traba-
lho. Isso pode ser visto como variação da estação ou entre dois locais com a mesma altitude.
Assim, algumas simulações foram conduzidas variando a temperatura ambiente de -10°C a
50°C e usando no simulador os dados apresentados na tabela 4. Essa variação de condições
de temperatura resume todas as condições dos locais de utilização dos ônibus da Volvo, o que
permite obter uma visão geral de sua influência.

CONDIÇÕES DE SIMULAÇÃO PARA INFLUÊNCIA DE TEMPERATURA

AMB. PRES. BUS TYPE DOORS BRAKE RET. CUT OUT CUT IN COMP.

101.3 kPa B12M artic closed drum not use 11.7 bar 10.5 bar Wabco 636

TABELA 4 - Condições de simulação para influência de temperatura

Na figura 6, observa-se a variação do ciclo de trabalho com a temperatura. Conforme esperado,


os valores do ciclo de trabalho mudam linearmente com o aumento de temperatura, mas sua
influência é bastante leve (por exemplo, um aumento relativo de 13% no ciclo de trabalho com
60°C de variação).

INFLUÊNCIA DA TEMPERATURA SOBRE O CICLO DE TRABALHO DO COMPRESSOR

31,5
31
30,5
30
DUTY CYCLE [%]

29,5
29
28,5
28
27,5
27
-10 0 10 20 30 40 50 60

AMBIENT PRESSURE [KPA]

FIGURA 6 - Influência da temperatura sobre o ciclo de trabalho do compressor

176 INOVA TALENTOS


07

LIMITAÇÕES, INCERTEZAS E SUGESTÕES


Após os resultados apresentados, algumas limitações e incertezas sobre o simulador são apre-
sentadas.

ԎԎ RUÍDO NOS DADOS DE TESTE:


Sabe-se que, em qualquer medição feita em aplicações reais, é praticamente impossível
obter os sinais de forma completamente limpa. Muitos problemas ocorrem durante o
teste e podem passar despercebidos, gerando problemas na fase de processamento.
Para minimizar esses problemas, podem-se utilizar alguns filtros (como mover média),
além de tentar estimar os valores reais mascarados.

ԎԎ UTILIZAÇÃO DE RPM DO MOTOR E VELOCIDADE DO ÔNIBUS:


Os valores utilizados nas simulações sempre são baseados em testes realizados
previamente na rota que será simulada. Ou seja, se nenhum teste prévio for feito para
a rota que se quer simular, não será possível simulá-la, uma vez que não há nenhum
dado de RPM e velocidade do veículo, representativos para aquela condição. Pensou-
se em implementar uma estimativa para o RPM e a velocidade do ônibus, baseada na
topografia do local do teste, Contudo, notou-se que é praticamente impossível obter
valores representativos para as condições. Assim, sempre é necessário observar os
dados de testes anteriores.

ԎԎ PRESSÕES FORA DO PADRÃO:


Outro problema encontrado nos dados são as pressões de acoplamento e
desacoplamento do compressor. Quase todas as medidas indicaram que esses
parâmetros estavam fora do valor definido pela Volvo, o que causa uma enorme variação
no ciclo de trabalho estimado pelo simulador, conforme visto nas seções anteriores.

ԎԎ MEDIÇÃO DA DISTÂNCIA DAS PARADAS DOS ÔNIBUS:


As distâncias onde o ônibus para são difíceis de serem obtidas a partir dos dados
de teste, a fim de distinguir uma parada de ônibus de um semáforo ou uma parada
inesperada. Muito tempo foi gasto para criar um padrão para cada rota, sendo que não
há informações sobre a maioria delas, o que não resulta em padrão representativo. Por
isso, foi proposta para novos testes urbanos a aquisição dos sinais das portas (quando
eles abrem), para remover esse problema em simulações futuras.

ԎԎ PROBLEMAS DE ENCARROÇADORES:
O diâmetro e os deslocamentos de portas e cilindros de rampas são o principal
problema, pois cada encarroçador utiliza as medidas que acha conveniente, muitas

PROGRAMA RHAE TRAINEE CNPq – IEL 177


vezes aparecendo variações entre os veículos de um mesmo encarroçador . O ponto
crítico é que esse subsistema é um dos principais consumidores de ar, ou seja, causa
variações na estimativa do ciclo de serviço, pois depende das diferenças entre os
parâmetros configurados e os equipamentos reais. Assim, foi proposta a medição dos
cilindros de cada ônibus que será simulado, a ser adicionada ao código, para aumentar a
confiabilidade do simulador.

ԎԎ VÁLVULAS:
Os problemas aqui começam com o princípio de trabalho das válvulas - molas. Esse tipo
de componente mecânico apresenta variações inerentes a seus parâmetros, causando
mudanças nas pressões de abertura e fechamento, além da existência da histerese das
válvulas. Outro ponto crítico é o envelhecimento da válvula, alterando seus parâmetros
de funcionamento (devido à temperatura de trabalho, água e óleo no ar que passam
por elas, além do desgaste natural do material), o que torna impossível sua inserção no
simulador, sendo uma das causas de problemas inerentes ao sistema do ônibus.

ԎԎ SUSPENSÃO:
Embora a variação da altura da suspensão (quando as pessoas entram e saem do ônibus)
tenha sido implementada, o principal problema são as condições da estrada, causadores
de grandes variações na altura da suspensão, fazendo-a consumir ou não ar. O problema
nesse sistema é justamente prever quantas pessoas entram ou saem do ônibus em cada
ponto de parada, para minimizar as variáveis envolvidas nos processos.

ԎԎ TEMPERATURA:
Com base em alguns dados de teste, foi estimada a temperatura do sistema como uma
porcentagem acima da temperatura ambiente. Esse mesmo método foi usado para
estimar a temperatura do ar que sai do compressor, embora seja mais difícil prever essa
temperatura com boa precisão, pois a distância entre o motor e a tubulação de entrada
de ar do compressor altera essa temperatura.

ԎԎ EFICIÊNCIA VOLUMÉTRICA DO COMPRESSOR:


Essas informações foram obtidas com os fornecedores dos compressores. Descobriu-se,
depois de um tempo, que os valores apresentados nos diagramas fornecidos são o pior
caso que pode ser utilizado, tornando nossas previsões válidas somente para esses casos
também. Em outras palavras: o ciclo de trabalho calculado no simulador dará valores
mais altos (ou iguais, em alguns casos) do que testes reais, sendo um erro intrínseco aos
dados fornecidos.

178 INOVA TALENTOS


07

CONSIDERAÇÕES FINAIS
Ao longo do presente trabalho, foi possível mostrar as hipóteses assumidas, o embasamento
matemático utilizado e alguns trechos do código do simulador computacional implementado
em MATLAB, para estimar o tempo de funcionamento do compressor e as massas de ar con-
sumidas e produzidas.
Assim como apresentado, o simulador precisa de alguns dados de entrada para realizar a
simulação (como PRM, velocidade dos ônibus e condições ambientes), para que o resultado seja
representativo. Mesmo assim, o simulador consegue representar, de forma robusta, as aplica-
ções reais, quando todos os dados são configurados de forma correta, apresentando pequenas
diferenças em relação aos dados reais (não apresentados por questões de sigilo industrial).
Outras questões em que não há controle são as variações intrínsecas à utilização do sis-
tema, como as formas de condução do motorista, a quantidade de pessoas que entram no
ônibus durante a rota (variando a carga de forma não prevista) e as condições ambientes
fora do esperado (dias mais quentes ou mais frios do que os configurados). Ou seja, muitas
incertezas associadas ao simulador estão diretamente ligadas às incertezas de utilização, pois
- como visto - a simulação é bastante sensível aos parâmetros de entrada, os quais, se não
tomados de forma confiável, não passarão a mesma confiabilidade para o simulador e, conse-
quentemente, para os resultados obtidos.
Mesmo assim, o simulador consegue entregar a ordem de grandeza que será encontrada
nas aplicações reais, tornando mais rápida a resposta para uma possível substituição de mar-
ca de compressor ou de um ônibus como um todo. Dessa forma, essa ferramenta é extrema-
mente poderosa, quando utilizada de forma correta.

TRABALHOS FUTUROS
Em futuros trabalhos, o simulador poderia ser implementado em ambientes mais amigáveis
ao usuário (uma vez que foi feito em MATLAB, usando linguagem de programação sequencial,
sem apresentar interface gráfica do tipo “clique e selecione”) a fim de tornar mais fáceis e
compreensíveis os dados de entrada para a simulação.
Como comentado no trabalho, adquirir os sinais das portas/rampas para saber quando o
ônibus parou em ponto facilitaria amplamente a “inclusão de rotas“, pois o simulador está
preparado para esses dados – e não seria necessário alterá-lo.

PROGRAMA RHAE TRAINEE CNPq – IEL 179


REFERÊNCIAS
BIBLIOGRÁFICAS

1.UOL. Híbrido é opção realista ao futuro 100%


elétrico discutido na Europa. [S.l.]. 2016. https://
carros.uol.com.br/colunas/alta-roda/2016/10/26/
hibrido-e-opcao- realista-ao-futuro-100-eletrico-dis-
cutido-na-europa.htm. Acesso em 25 de mai. de
2017.

2. VOLVO. Ônibus Híbrido: Tecnologia, Economia


e Respeito Ao Meio Ambiente. Curitiba. http://
www.volvobuses.com/SiteCollectionDocuments/
VBC/Brasil%20-%20ILF/Downloads/Brochura%20
%C3%94nibus%20H%C3%ADbrido.pdf. Acesso
em 25 de mai. de 2017.

3. VIAIR. Compressors duty cycle. Edelman. http://


www.viaircorp.com/tech/. Acesso em 25 de mai. de
2017.

4. BORGNAKKE, C.; SONNTAG, R. E.; WYLEN,


G. J. V. Fundamentals of Thermodynamics. NY:
John Wiley & Sons Ltd, 2008.

5. BIRD, R. B.; STEWART, W. E.; LIGHTFOOT, E. N.


Transport Phenomena. 2. ed. NY: John Wiley and
Sons Ltd, 2006.

6. HANLON, P. Compressor Handbook. NY: MC-


GRAW HILL BOOK CO, 2001.

7. HALLIDAY, D. Fundamentos de Fisica: Mecânica.


NY: LTC, v. 1, 2016.

8. IVECO. Emissões de veículos a Diesel: Evolução


da tecnologia veicular. [S.l.]. 2009. http://www.
anfavea.com.br/documentos/SeminarioItem6.pdf.
Acesso em 25 de mai. de 2017.

180 INOVA TALENTOS


07

PROGRAMA RHAE TRAINEE CNPq – IEL 181


DESENVOLVIMENTO
08
DE PLATAFORMAS DE
GESTÃO DE IDEIAS
E SEU IMPACTO NA SISTEMATIZAÇÃO DA INOVAÇÃO
T ITO FR A NC IS C O IA NDA
_
Mestre em Administração,
área de inovação,Tecnologia e Sustentabilidade
Universidade Federal do Rio Grande do Sul (UFRGS)
_
Doutorando em Administração,
área de inovação,Tecnologia e Sustentabilidade
Universidade Federal do Rio Grande do Sul (UFRGS)

titoianda@yahoo.com.br

Porto Alegre, RS

+55 51 98204-5163.

183
R E SU M O

PALAVRAS CHAVE inovação, plataformas de suporte, sistematização da inovação, gestão de ideias

Este artigo apresenta as plataformas de Gestão de Ideias – ferramentas desenvolvidas no

Sistema FIERGS para apoiar a indústria do Estado do Rio Grande do Sul na Sistematiza-

ção da Inovação. A iniciativa partiu da necessidade percebida, nas empresas atendidas

pela FIERGS, de uma ferramenta de apoio à geração de ideias e processos estruturados

para coleta, análise e transformação de ideias em projetos de inovação. Além disso, devi-

do aos recursos disponibilizados para registro de ideias nas empresas, essa atividade apa-

rece fortemente atrelada à alta administração, sem contar a falta de uma visão integrada

de projetos de inovação em andamento.

A metodologia utilizada para o desenvolvimento das ferramentas foi a Arquitetura de

Inovação. Os resultados permitiram estruturar as plataformas de suporte no Excel com

indicadores e métricas, para gerenciar o fluxo de processos de gestão de ideias e etapas

de evolução de projetos de inovação, aproveitando o conhecimento do bolsista em Excel

avançado, no que tange aos conceitos da arquitetura de inovação, o que permitiu o acesso

de todos os funcionários às plataformas de geração de ideias, em consonância com a

orientação estratégica das empresas.

O desenvolvimento das plataformas é uma inovação, na medida em que permite auto-

matizar o processo e e reduzir o risco de investimento, além de potencializar o gerencia-

mento de projetos de inovação nas empresas atendidas pela FIERGS.

Em 2016, as plataformas foram aplicadas em vários workshops de inovação, capacitan-

do mais de 80 profissionais em Porto Alegre e no interior do Rio Grande do Sul. O artigo

apresenta três cases. O programa Inova Talentos foi crucial nesse processo, permitindo ao

bolsista atuar na facilitação do processo de gestão de ideias e contribuir para a sistemati-

zação da inovação na indústria gaúcha.

184 INOVA TALENTOS


08

A BSTR ACT

KEYWORDS innovation, support platforms, systematization of innovation, idea management

This article presents Idea Management platforms – a tool developed at Sistema FIERGS

to support the industry of the State of Rio Grande do Sul in the Systematization of

Innovation. An initiative based on the need to obtain business tool, to support the

generation of ideas and structured processes for collect, analyzing and transforming

ideas into innovation projects. In addition, It provide the resources to register ideas in

companies. This activity appears strongly tied to top management, not to mention a

lack of an integrated vision of innovation projects in progress. The methodology used for

the development of the tools is the Architecture of Innovation. The results allowed us to

structure support platforms in Excel with indicators and metrics to manage the flow of

ideas management processes and stages of evolution of innovation projects, joining of

the knowledge of the advanced Excel and the concepts of innovation architecture, giving

access to all the employees to the platforms of idea generation according to strategic

of the company. The development of the platforms is an innovation, since it allows the

process of innovation, reducing the risk of investment, and potentiates the management

of innovation projects in the companies served by FIERGS. In 2016, platforms were applied

in several innovation workshops, training more than 80 professionals in Porto Alegre

and in the interior of Rio Grande do Sul. The article presents 3 cases. The Inova Talentos

program was crucial to the idea management process, supporting the systematization of

innovation in the gaucho industry.

PROGRAMA RHAE TRAINEE CNPq – IEL 185


Desde 2013, a Mobilização Empresarial
INTRODUÇÃO pela Inovação (MEI) vem sendo impulsiona-
da pela contribuição da Confederação Nacio-

E
ste artigo apresenta as plataformas de nal da Indústria (CNI), consubstanciada na
gestão de ideias e seus impactos na criação de Núcleos Estaduais de Inovação –,
sistematização da inovação nas em- bem como pela atuação do Ministério de Ci-
presas atendidas pela Federação das Indús- ência, Tecnologia e Inovação (MCTI) e pela
trias no Estado do Rio Grande do Sul (Siste- Financiadora de Estudos e Pesquisa (Finep)
ma FIERGS em 2016. O Sistema FIERGS é para fomentar a inovação.
uma entidade sem fins lucrativos, que atua no Entretanto, apesar desse relevante supor-
desenvolvimento empresarial do Rio Grande te, várias organizações ainda apresentam
do Sul, mediante a prestação de serviços de enormes dificuldades em estruturar o pro-
aprendizagem da indústria e saúde no traba- cesso de inovação internamente, configurada
lho. As plataformas foram desenvolvidas no intuitivamente apenas por algumas pessoas
âmbito do projeto Cultura de Inovação no dentro das organizações, especialmente na
Sistema FIERGS, cujo objetivo consiste em alta administração.
envolver todos os funcionários do Sistema Os esforços empresariais para inovar são
no compromisso com a inovação. mensurados por diversos indicadores e métri-
A inovação pode ser definida como resul- cas constantes do Manual de Oslo e Manual
tado de atividades empresariais na criação de Frascatti (OCDE, 1997; 2013), assim como
de novos produtos, processos ou serviços indicadores nacionais de países. No Brasil, os
e sua importância é reconhecida como um indicadores nacionais de inovação são defi-
meio para o desenvolvimento e o progresso nidos pelo MCTI e Finep. Estes indicadores.
tecnológico, não somente empresarial, mas além de essenciais para as empresas alcança-
também para o crescimento econômico e rem financiamentos para inovação, reduzem
competitividade de uma nação (SABINO e os riscos de inovar, uma vez que oferecem
MONTANUCCI, 2013). No entanto, nos últi- maior controle sobre o processo.
mos anos, o Brasil tem apresentado uma pro- As técnicas e processos de inovação são
funda deficiência em termos de inovação. Em dinâmicos e evoluem numa velocidade expo-
2016, o país ocupava o 69º lugar no ranking nencial. Nessa perspectiva, várias metodo-
mundial de inovação, a mesma posição que logias são aplicadas para facilitar o proces-
ocupa atualmente (CNI, 2017). Entre as eco- so de inovação nas empresas, tais como
nomias da América Latina e Caribe, o Brasil brainstorming (ARIVANANTHAN, 2015), de-
aparece em sétimo lugar, atrás do Chile (46º), sign thinking (VIANNA et. al. 2012) e golden
Costa Rica (53º), México (58º), Panamá (63º), circle (SINEK, 2012), entre outras.
Colômbia (65º) e Uruguai (67º) (CNI, 2017). As consultorias empresariais e facilitado-

186 INOVA TALENTOS


08

res especializados desempenham um papel partilhar ideias orientadas ao desafio estra-


crucial nessa atividade, utilizando diferentes tégico das empresas, exercer maior controle
ferramentas e técnicas na implantação do sobre indicadores e métricas de inovação –
processo nas empresas. Porém, as técnicas minimizando, consequentemente, o risco de
utilizadas são muito atreladas a conceitos, o inovar – bem como apoiar as empresas na
que faz com que as organizações enfrentem Sistematização da Inovação.
enormes dificuldades em pôr em prática es-
ses processos, o que limita a capacidade de
sistematizar a inovação. MÉTODO
Nesse sentido, este artigo se propõe a
responder às seguintes indagações: Para desenvolver as Plataformas de Gestão
de Ideias, foi utilizada a metodologia de “Ar-
ԎԎ Quais os impactos das plataformas de
quitetura de Inovação”, que nada mais é do
gestão de ideias na sistematização da
que uma representação gráfica dos elemen-
inovação para as empresas atendidas
tos necessários para implantação de um Sis-
pela FIERGS?
tema de Gestão da Inovação. A arquitetura
ԎԎ Quais os ganhos resultantes de conta com três práticas de inovação – Explo-
mensurar e monitorar indicadores de ratória, Radical e Incremental – orientadas à
inovação dentro de uma organização? geração de diferentes resultados, que aten-
dam a diferentes necessidades do negócio.
Os resultados deste projeto buscam res-
As três práticas de inovação apresentam o
ponder a tais perguntas, enaltecendo a im-
apoio dos chamados “blocos de suporte”,
portância de monitoramento de indicadores,
que permitem o funcionamento das práticas
visão integrada de projetos de inovação e
de uma forma integrada e articulada em to-
custos de projetos, a partir de plataformas
das as áreas da empresa (figura 1).
de gestão de ideias. O artigo está estrutura-
do nos seguintes tópicos: objetivos, méto-
dos, resultados, discussão, desafios, apren-
dizados e considerações finais.

OBJETIVOS

Desenvolver Plataformas de Gestão de Ideias


e de Processos, com base na Metodologia
“Arquitetura de Inovação”, permitindo com-

PROGRAMA RHAE TRAINEE CNPq – IEL 187


PRÁTICAS DE INOVAÇÃO
PRODUÇÃO

Inovação Exploratória Inovação Radical Inovação Incremental

BLOCOS DE SUPORTE

Estruturas Organizacionais Treinamento Imagem e Comunicacão Rede de Inovação


SUPORTE

Estratégias e Objetivos Processos e Metodologias Plataformas de Suporte Métricas e Avaliação

FIGURA 1 - Arquitetura de Inovação.


Fonte: adaptado a partir do Sistema FIERGS, 2013.

As necessidades expressas pelas áreas de As Plataformas de Suporte são ferramen-


negócio através do diagnóstico e as expecta- tas capazes de amparar o sistema de gestão
tivas de resultados dessas áreas serão os ele- da inovação nas empresas (SISTEMA FIER-
mentos que levarão a decidir sobre qual a me- GS, 2013). Alguns pontos a considerar na
lhor prática a ser aplicada para cada desafio. construção dessas plataformas são:

188 INOVA TALENTOS


08

a. GESTÃO INTEGRADA turmas abertas. Após a definição das ativi-


DO SISTEMA DE INOVAÇÃO dades, o processo é detalhado em Platafor-
Deve-se garantir o bom planejamento, mas Integradas, com uso de Excel avançado
desenvolvimento, execução e e Dashboard para facilitar o monitoramento
acompanhamento de todas as práticas de ideias e projetos de inovação internamen-
de inovação previstas no processo. te, permitindo sistematizar a inovação nas
A gestão de alguns blocos de suporte empresas atendidas. Os resultados serão
é também relevante e pode ser apresentados na próxima seção.
garantida tanto pela plataforma:
Treinamento, Métricas, como pelas
estruturas organizacionais que fazem RESULTADOS
o Sistema funcionar.
O desenvolvimento de Plataformas de Ges-
b. GESTÃO DO CONHECIMENTO
tão de Ideias é fundamental para sistemati-
GERADO NESSE SISTEMA
zar a inovação dentro de uma organização,
Deve-se garantir que todo o
permitindo a geração de ideias de modo
conhecimento e informação gerada
contínuo, orientadas aos desafios estraté-
no processo de inovação tenha a
gicos da empresa, não apenas oriundos da
utilização mais correta e com maior
alta administração ou de um pequeno grupo
impacto para a empresa.
de pessoas, mas também da administração
intermediária e operacional, envolvendo to-
c. FACILITAÇÃO DA
das as áreas da organização.
INTERAÇÃO ENTRE O SISTEMA
O processo possibilita a criação de es-
E O RESTO DA ORGANIZAÇÃO
paço para registro (incubação) de ideias e
Deve-se permitir que toda a
compartilhamento de conhecimentos, for-
organização se conecte às atividades
mando um ambiente de conexão e melhoria
de inovação e ao desenvolvimento
de ideias, a partir de diferentes perfis e ex-
de projetos de inovação.
periências dos colaboradores para o desen-
A coleta de dados para identificação das volvimento de soluções inovadoras para o
necessidades de ferramentas de gestão de crescimento e competitividade empresarial.
ideias é realizada a partir do diagnóstico A incubação de ideias é uma atividade de
on-line e entrevistas presenciais nas empre- Gestão de Ideias. Como as ideias revolucio-
sas, enquanto o desenvolvimento e a im- nárias não surgem de modo completo, são
plantação das plataformas são realizados necessárias várias conexões para transfor-
in company com os grupos de inovação das má-las numa inovação.
empresas e nos cursos de capacitação em Segundo Johnson (2014) “não existe mo-

PROGRAMA RHAE TRAINEE CNPq – IEL 189


mento eureca” para surgimento de ideias Nesse contexto, foram criadas ferramen-
com potencial de mudar o mundo. Para o tas de Gestão de Ideias para facilitar o flu-
autor, as melhores ideias começam com pal- xo do processo de geração, coleta, avaliação
pites vagos e demoram anos para serem de- e implementação de ideias. As ferramentas
senvolvidas – o que o autor denomina como de gestão começaram a ser aplicadas nos
“palpite lento”. workshops de inovação, realizados pelo Sis-
O impulso a este processo é o estímulo às tema FIERGS nas empresas atendidas no
diversas interações e conexões entre pessoas estado do Rio Grande do Sul, em 2016 (SIS-
com conhecimentos e perfis diferentes, in- TEMA FIERGS IEL, 2016). Foram capacitados
centivando a criatividade e a inovação (ASH- mais de 80 profissionais, incluindo ativida-
TON, 2016). Para Johnson (2012), as ideias des in company e turmas abertas (SISTEMA
muitas vezes precisam de um tempo de incu- FIERGS IEL, 2016).
bação e maturidade, para serem desenvolvi- O recurso utilizado para desenvolver so-
das posteriormente em todo o seu potencial. luções de gestão de ideais e de projetos de
Isto remonta à história da internet e das inovação nas empresas é o Excel. Isso só foi
grandes inovações que ocorreram nos últi- possível pela combinação do conhecimento
mos anos. Para o Johnson (2014), não existe avançado deste recurso e o conhecimento da
gênio solitário. Ashton (2016) também defen- metodologia da arquitetura de inovação, o
de a mesma tese. Johnson acrescenta ainda que permitiu criar plataformas de fácil acesso
que o sucesso de Elon Musk, com os veículos e uso para as empresas.
elétricos Tesla, aconteceu porque ele tem três Essas soluções incluem criação de plani-
empresas, todas sob intensa interação: uma lhas inteligentes e automatizadas, com pai-
de energia solar, outra de tecnologia espacial néis de controle no Menu Inicial e hiperlinks,
e outra ainda de automóveis. com acesso às planilhas secundárias. Os re-
Para melhorar o intercâmbio de ideias sultados podem ser visualizados nos cases a
com outras pessoas, Steven recomenda que seguir.
“é preciso manter contato com pessoas de
perfis variados. As mídias sociais podem aju-
dar nisso”.
“Eu sigo uma mescla de pessoas interessantes
no Twitter – escritores, políticos, arquitetos,
gente de tecnologia... Sigo pessoas que são
diferentes de mim. De modo geral, a melhor
parte não é o que eles escrevem, mas os links
que publicam.” (Johnson, 2014).

190 INOVA TALENTOS


08

CASE 1

A figura 2 apresenta o painel inicial da plataforma desenvolvida para uma empresa que tinha
a necessidade de implementar plano de ação de inovação até 2019. A partir de análise da ne-
cessidade e processos internos da empresa, foi desenvolvida uma plataforma, que, além de
facilitar a visualização de ações, permitiu identificar responsáveis, equipe participante, custo
da ação e cronograma de aplicação. O Excel foi utilizado por ser uma ferramenta de fácil acesso
para a empresa, além de não exigir custos de treinamento para uso.

Cronograma 2017
Cronograma 2018
EMPRESA Cronograma 2019
Consolidado

FIGURA 2 - Cronograma de atividades de gestão da inovação


Fonte: o autor

Esta página inicial possui hiperlinks que direcionam para as planilhas secundárias, local de
detalhamento das atividades (figura 3).

ANO ATIVIDADE COMO RESPONSÁVEL QUEM CUSTO JAN


PARTICIPA

2017 Ampliar a política de COACHING IEL GRUPO


treinamento e capac- + INOVAÇÂO
itação para assuntos, 1) Workshop Liderança GRUPO
metodologias e para Inovação INOVAÇÂO
comportamento para
inovação 2) Coaching - 7 a 10
sessões individuais
- coaching
3) Workshop de Inte-
gração

FIGURA 3 - Planilha de atividades e cronograma de realização


Fonte: o autor

Na mesma planilha da atividade, aparece logo abaixo tabela, com identificação de cada ati-
vidade e os respectivos campos para acompanhamento e observações (figura 4).

PROGRAMA RHAE TRAINEE CNPq – IEL 191


CONTROLE DE ATIVIDADES REALIZADO OBSERVAÇÕES

ATIVIDADE 1

ATIVIDADE 2

ATIVIDADE 3

FIGURA 4 - Tabela de descrição de atividade e observações


Fonte: o autor

Vale ressaltar que essas planilhas possuem preenchimento automático em vários campos,
principalmente na aba consolidada. Os campos de preenchimento automático são bloqueados,
impedindo erros de digitação e perda de informações. O case 2 apresenta mais um resultado
de solução desenvolvida para gestão do projeto de inovação.

CASE 2
O painel a seguir foi desenvolvido para uma empresa de engenharia mecânica. A empresa tinha
a necessidade de implementar o projeto de inovação internamente e, para tanto, criou um gru-
po de inovação com profissionais de perfis, conhecimentos e áreas diferentes: P&D, marketing,
arquitetos, gestores de projetos e desenvolvedores de produto.
A maior dificuldade era o desenvolvimento de processo de gestão de ideias e de projetos de
inovação. Nesse sentido, foi criada uma plataforma de suporte, com fluxograma de processo
e indicadores básicos, para facilitar a visualização integrada de todos os projetos de inovação
em andamento. A plataforma contém ainda definição de processos, banco de ideias e fichas de
avaliação de projeto (figura 5).

FIGURA 5 -
Plataforma
de suporte
na gestão
de projetos
de inovação
Fonte: o autor

192 INOVA TALENTOS


08

As fichas de avaliação possuem hiperlinks disponíveis no painel inicial na parte su-


perior, à direita da plataforma. São 50 fichas, cujo número poderá ser aumentado, sem-
pre que necessário. A ficha de avaliação pode ser visualizada na figura 6, a seguir

AVALIAÇÃO DE IDEIA

Identificação
Ficha Nº 28
Título
Responsável Área
Data da avaliação Grau Tipo
Status da avaliação da ideia Etapa Avaliação Final

Descrição da necessidade / problema / oportunidade





Descrição da ideia




Critérios de Avaliação

Obrigatórios
1 Alinhamento estratégico 2 Viabilidade técnica
Nota Sim Nota Sim
3 Atende às politicas de Saúde, Segurança e Meio Ambiente 4 Vabilidade econômica
Nota Sim Nota Sim

Avaliação Sim Considerações




Desejáveis
5 Estratégia
Grau de alinhamento da ideia à estratégia da unidade de negócio
Baixo Médio Alto Nota
0 1 2 3 4 5 6 7 8 9 10
Importância Estratégica
Baixo Médio Alto Nota
0 1 2 3 4 5 6 7 8 9 10

Avaliação Considerações


6 Vantagem do produto
Benefícios únicos
Baixo Médio Alto Nota
0 1 2 3 4 5 6 7 8 9 10
Atende as necessidades do cliente melhor do que produtos competidores ou existentes
Baixo Médio Alto Nota
0 1 2 3 4 5 6 7 8 9 10
Custo benefício
Baixo Médio Alto Nota
0 1 2 3 4 5 6 7 8 9 10

Avaliação Considerações

PROGRAMA RHAE TRAINEE CNPq – IEL 193


7 Atratividade de mercado
Tamanho do mercado
Baixo Médio Alto Nota
0 1 2 3 4 5 6 7 8 9 10
Crescimento do mercado
Baixo Médio Alto Nota
0 1 2 3 4 5 6 7 8 9 10
Situação competitiva
Baixo Médio Alto Nota
0 1 2 3 4 5 6 7 8 9 10

Avaliação Considerações


8 Sinergias (aumentam competências chave)
Sinergias mercadológicas
Baixo Médio Alto Nota
0 1 2 3 4 5 6 7 8 9 10
Sinergias tecnológicas
Baixo Médio Alto Nota
0 1 2 3 4 5 6 7 8 9 10
Sinergias de processos / manufatura
Baixo Médio Alto Nota
0 1 2 3 4 5 6 7 8 9 10

Avaliação Considerações

9 Viabilidade técnica
Gap técnico
Baixo Médio Alto Nota
0 1 2 3 4 5 6 7 8 9 10
Complexidade
Baixo Médio Alto Nota
0 1 2 3 4 5 6 7 8 9 10
Incerteza técnica
Baixo Médio Alto Nota
0 1 2 3 4 5 6 7 8 9 10

Avaliação Considerações


10 Risco sobre o retorno
Lucratividade esperada
Baixo Médio Alto Nota
0 1 2 3 4 5 6 7 8 9 10
Taxa de retorno sobre o investimento
Baixo Médio Alto Nota
0 1 2 3 4 5 6 7 8 9 10
Tempo de payback
Baixo Médio Alto Nota
0 1 2 3 4 5 6 7 8 9 10
Certeza de retorno
Baixo Médio Alto Nota
0 1 2 3 4 5 6 7 8 9 10

Avaliação Considerações

FIGURA 6 - Fica de avaliação de ideias de inovação


Fonte: o autor
Figura 6. Fica de avaliação de ideias de inovação
Fonte: o autor

194 INOVA TALENTOS


16
08

A ficha de detalhamento permite descrever a ideia de projeto de inovação e a avaliação de


todos os aspectos da ideia, antes de ser incluída na lista de projeto.
Cada aspecto de avaliação possui uma pontuação e espaço para considerações. A avaliação,
nesse caso, é realizada por um analista de projeto e aprovada pela equipe, antes de ser apre-
sentada pela alta administração, impulsionando maior comprometimento dos funcionários
com o processo de inovação. A seguir, é apresentado o case de uma plataforma de suporte na
prática de inovação incremental.

CASE 3

Esta plataforma foi criada para ser aplicada em uma capacitação de inovação incremental. A
metodologia de inovação incremental possui quatro fases de desenvolvimento, e a plataforma
foi criada com o intuito de apoiar a metodologia em todas as fases. Possui um espaço para des-
crição do desafio estratégico, coleta e avaliação de ideias, plano de ação e cronograma de de-
senvolvimento de projeto ou aplicação da ideia em melhoria de produtos ou serviços (figura 7).

Definição de Plano de ação/


Desafio plataforma prototipagem
Avaliação
de inovação
das ideias
incremental
Coletar ideias Implementação

Geração
Feedback
de ideias Avaliação de
Registrar ideias
resultados

FIGURA 7. Metodologia de inovação incremental


Fonte: autoria própria.

A plataforma de suporte pode ser visualizada na figura 8.

PROGRAMA RHAE TRAINEE CNPq – IEL 195


PLATAFORMA DE GESTÃO DE IDEIAS DE INOVAÇÃO INCREMENTAL

Critério
DESAFIO Seleção
PRODUTO

Critério Critério
LISTA DE
Seleção Seleção
ORGANIZACIONAL IDEIAS PROCESSO

PRIORIZAÇÃO
AÇÃO 1: Projeto de Inovação Incremental 1

Critério AÇÃO 2: Projeto de Inovação Incremental 2


Seleção AÇÃO 3: Projeto de Inovação Incremental 3
MARKETING
AÇÃO 4: Projeto de Inovação Incremental 4
AÇÃO 5: Projeto de Inovação Incremental 5
AÇÃO 6: Projeto de Inovação Incremental 6

FIGURA 8 - Plataforma de gestão


de ideias de inovação incremental
Fonte: o autor

A fase inicial do processo começa com um desafio estratégico (figura 9), que parte de um
problema identificado pela empresa, a partir do qual é gerada uma lista de ideias para criar a
solução.
Além disso, orienta os colaboradores na geração de ideias de acordo com a estratégia de
inovação da empresa. As ideias aprovadas passam por uma seleção e classificação por tipo
de inovação – de produto, processo, organizacional ou de marketing – permitindo visualizar a
atratividade da ideia e priorização, conforme a necessidade da organização.

196 INOVA TALENTOS


08

COMO DEFINIR O DESAFIO EM UMA FRASE?

1. Inicie o desafio estratégico com um verbo como “Aprimorar”, “Desenvolver”, “Definir”,


“Implementar”, “Otimizar”, “Criar”, “Adaptar”,etc. Ou expresse o desafio em formato de
pergunta, começando com “Como poderíamos...?”

DESAFIO:

FIGURA 9 - Planilha de descrição do desafio estratégico


Fonte: o autor

Após a definição do desafio estratégico, as ideias são coletadas e descritas numa lista de
ideias (figura 10).

FIGURA 10 - Planilha de lista de ideias


Fonte: o autor

Os critérios de seleção e priorização de ideias compõem a terceira etapa de gestão da ino-


vação incremental. Para cada tipo de inovação, é definido um critério de seleção, com base em
requisitos predefinidos e sua respectiva pontuação (figura 11 e figura 12).

PROGRAMA RHAE TRAINEE CNPq – IEL 197


CRITÉRIOS DE AVALIAÇÃO DE IDEIA DE INOVAÇÃO DO MARKETING E ORGANIZACIONAL.

CRITÉRIO DE AVALIAÇÃO NOTAS

0 1 3 5

ALINHAMENTO 1. Contribuição para metas de NULA BAIXA MÉDIA ALTA


ESTRATÉGICO resultados (Tangíveis - Faturamento)

2. Contribuição para imagem/marca NULA BAIXA MÉDIA ALTA


da empresa (intangível)

NECESSIDADE DO 3. Probabilidade de NULA BAIXA MÉDIA ALTA


CONSUMIDOR
aceitação do consumidor

4. Benefícios únicos para o NULA PEQUENA MÉDIO GRANDE


consumidor (diferencial/exclusividade)

VIABILIDADE 5. Participação no Mercado NULA PEQUENA MÉDIA ALTA


COMERCIAL
(fatia de mercado estimada)

6. Probabilidade de NULA PEQUENA MÉDIA ALTA


crescimento do mercado
VIABILIDADE
ECONÔMICA 7. Investimento total (P&D, MUITO ALTO ALTO MÉDIO BAIXO
Marketing, Produção, etc.)

8. Retorno sobre o investimento NULA BAIXA MÉDIO ALTO

VIABILIDADE 9. Potencial técnico para NULA BAIXA MÉDIO ALTO


TÉCNICA o novo desenvolvimento

10. Aproveitamento das NULA BAIXA MÉDIO ALTO


competências atuais/pretendidas

11. Tempos de desenvolvimento e MUITO GRANDE GRANDE MÉDIO PEQUENO


introdução do produto no mercado

FIGURA 11 - Critérios de avaliação de ideia de inovação do marketing e organizacional.


Fonte: o autor

198 INOVA TALENTOS


08

Os critérios de avaliação de ideias de inovação incremental de produto e processo são apre-


sentados abaixo (figura 12).

CRITÉRIO DE AVALIAÇÃO DE IDEIA DE INOVAÇÃO DO PRODUTO E PROCESSO

CRITÉRIO DE AVALIAÇÃO NOTAS

0 1 3 5
1.
REDUÇÃO NULA BAIXA MÉDIA ALTA
DE CUSTO

2. MELHORIA
DA QUALIDADE NULA BAIXA MÉDIA ALTA
DO PRODUTO

3. COMPLEXIDADE
DE IMPLEMENTAÇÃO MUITO ALTA ALTA MÉDIA BAIXA

4. AUMENTO DE
PRODUTIVIDADE NULA PEQUENA MÉDIO ALTA

5. CUSTO DE P&D
PARA REALIZAÇÃO MUITO ALTO ALTO MÉDIO BAIXO

6. TEMPO PARA
REALIZAÇÃO MUITO GRANDE GRANDE MÉDIO BAIXO

7. INVESTIMENTO
DE CAPITAL MUITO GRANDE ALTO MÉDIO BAIXO

SOMA

FIGURA 12 - Critério de avaliação de ideia de inovação do produto e processo


Fonte: o autor

A última fase do projeto consiste na priorização e implementação da ideia, etapa realizada


na planilha do plano de ação (figura 13). Nessa fase, também é definido um cronograma de
aplicação.

PROGRAMA RHAE TRAINEE CNPq – IEL 199


Figura 13. Planilha de descrição do projeto de inovação incremental.

Previsão Previsão
Cód. da ideia Descrição do Projeto de Inovação Incremental Responsável Recurso estimado ($)
Início Término

Cód. da ideia 0 0 R$ -

Descrição
detalhada

Atividades Metas Indicadores Custos

Etapas de execução
Mês 1 Mês 2 Mês 3 Mês 4 Mês 5 Mês 6 Mês 7 Mês 8 Mês 9 Mês 10 Mês 11 Mês 12
do projeto
0
0
0
0
0
0
0
0
0
0

FIGURA 13 - Planilha de descrição do projeto de inovação incremental


Fonte: o autor

Todas as plataformas já foram aplicadas na capacitação de profissionais como suporte à Sis-


tematização da Inovação nas empresas atendidas, sendo extremamente aceitas pelas empresas
clientes.
Uma vez implantadas, as plataformas exercem a função de facilitar a circulação de ideias
dentro das organizações, além de permitir a visualização dos custos de projetos em andamento
e as fases do desenvolvimento (projetos iniciados, em fase de prototipagem, teste, validação,
conclusão e lançamento). Também permite visualizar indicadores como tempo de desenvolvi-
mento, número de desafios estratégicos, número de ideias geradas, rejeitadas e ideias transfor-
madas em projetos de inovação, entre outros.

200 INOVA TALENTOS


08

– que permitem realizar gestão de projetos


DISCUSSÃO e desenho de processos, como o Bizagi Mo-
deler, MS Project, entre outras metodologias
No desenvolvimento das plataformas de muito eficientes na gestão de projetos e pro-
gestão de ideias, uma das questões levadas cessos como o BPM.
em consideração é a capacidade de simpli- Esses programas muitas vezes exigem
ficação do processo de inovação, a partir de um considerável investimento financeiro da
uma ferramenta de apoio acessível a todos empresa em capacitação e treinamento dos
os colaboradores em uma organização. funcionários, além do gasto com a própria
Com o avanço tecnológico e o intenso aquisição do programa.
movimento migratório rumo à digitaliza- Ainda que essas soluções apresentem
ção, os profissionais de TI têm direcionado vantagens quanto à eficiência de gestão de
seus esforços no desenvolvimento de gran- projetos, as desvantagens são o tempo de
de número de softwares de gestão de proje- desenvolvimento e o custo das soluções.
tos, bem como aplicativos mobile, para fa- Além disso, exigem manutenção e customi-
cilitar o armazenamento e a disponibilidade zação do sistema, de acordo com a estrutura
de grande volume de dados, envolvendo e a cultura organizacional da empresa, trei-
desde informações básicas de agendas pes- namento dos funcionários para uso do siste-
soais até informações especializadas, como ma, etc. Nesse contexto, o desenvolvimento
de projetos comerciais das empresas. de uma solução simplificada, de fácil acesso
Basta verificar que várias empresas já e uso, desempenha papel crucial no compro-
disponibilizam dispositivos móveis para metimento de colaboradores com a gestão
seus colaboradores, visando facilitar a co- de projetos de inovação.
municação e acesso a informações em qual- A ideia de criar plataformas de suporte,
quer lugar, sempre que precisarem. como solução em gestão de ideias e de pro-
Em termos de serviços empresariais, jetos de inovação, uniu o conhecimento do
também existem empresas que desenvol- bolsista em Excel avançado e metodologia de
vem softwares para atender a necessidades inovação. As planilhas são complementares
específicas das empresas – inclusive inte- e respondem à necessidade de suporte para
gração de um software com Sistemas de encaminhamento de processos de inovação.
Gestão Empresarial (ERP), por exemplo, ou Ainda que não seja uma solução completa,
desenvolvimento de um dispositivo total- constitui-se em uma solução barata, que dá
mente novo, para atender a uma demanda subsídio para avanço e implantação da ino-
específica. vação na prática.
Para gestão de projeto, existem vários Nas capacitações realizadas em todas as
softwares – inclusive programas gratuitos empresas atendidas e em turmas abertas, as

PROGRAMA RHAE TRAINEE CNPq – IEL 201


plataformas são adaptadas e fazem parte da inicial da capacitação. O Excel foi adotado
entrega final, junto com o relatório de capa- como ferramenta de suporte, porque é um
citação em inovação incremental, processos recurso de fácil aplicação, que, além de não
e metodologias de inovação. Esse trabalho requerer muito conhecimento de tecnologia
gerou muitos desafios e aprendizados, a se- para aplicação, também não compete com
rem apresentados no próximo tópico. outros sistemas de gestão de projetos ou
de processos. Os aprendizados decorrentes
dessas atividades aparecem descritos na se-
DESAFIOS ção a seguir.

O desenvolvimento das plataformas foi rea-


lizado durante o atendimento às empresas, APRENDIZADOS
com o objetivo de auxiliar na sistematização
da inovação. A necessidade de uma platafor- Em todas as fases do desenvolvimento dos
ma para gestão de ideias, de processos e de processos de gestão do projeto, foram ne-
projetos de inovação foi percebida a partir cessários testes, análise e validação. Os
de análise de diagnósticos e demandas das testes contaram com alguns critérios como
empresas. As plataformas precisavam ser simplicidade, experiência do usuário e es-
simples e fáceis de usar, permitindo ainda trutura amigável. Com isso, as plataformas
o envolvimento do maior número de parti- ficaram mais rápidas para se uso e armaze-
cipantes possível, compreendendo todas as namento informações.
áreas da empresa. As funções do Excel inicialmente utiliza-
Além disso, cada empresa possui sua es- das eram ineficientes, gerando bloqueios,
trutura de gestão e uma cultura específica. muitas vezes enquanto as plataformas esta-
Sendo assim, uma plataforma criada para vam em uso. Nesse contexto, foi necessário
determinada empresa precisava ser custo- pesquisar e experimentar funções mais efi-
mizada para atender às necessidades e se cientes em termos de utilização das platafor-
adaptar à realidade de outra empresa. Nesse mas. Também foi possível agregar os concei-
sentido, é criada uma versão inicial apresen- tos de inovação e metodologia de inovação
tada para a empresa, cuja customização será às plataformas, oferecendo uma visão mais
efetivada após análise em conjunto com os ampla das práticas de inovação.
membros da empresa atendida. Toda a equipe de inovação aprendeu um
O prazo para o desenvolvimento e a en- pouco mais sobre aplicação de planilhas in-
trega final das plataformas gira em torno de teligentes em gestão da inovação, que pas-
uma semana. Todas as plataformas refle- saram a ser utilizadas em todos os proces-
tem a parte conceitual, apresentada na fase sos de gestão de projeto de inovação.

202 INOVA TALENTOS


08

Os processos e fluxos desenvolvidos nas de produtos e processos de produção, em


plataformas não são substitutos do software sua maioria, oriundos da alta administra-
de gestão de projetos, tampouco concorren- ção, o que restringe a participação ativa dos
tes diretos de algum sistema específico de colaboradores de níveis mais operacionais.
gestão da inovação, mas são ferramentas ro- Sendo assim, a ferramenta propicia uma
bustas e eficientes, a partir das quais podem quebra de paradigma, impulsionando uma
ser desenvolvidos sistemas programáveis de cultura de inovação, em que é estimulada a
gestão de ideias e de projetos de inovação. participação e comprometimento de toda a
Aprendemos também que um recurso organização.
simples pode ter várias utilidades, desde Em vez de criar um sistema complexo
que canalizadas com base numa metodolo- para gestão de ideias e de projetos de ino-
gia, fato percebido somente após a identifi- vação, as plataformas desenvolvidas são de
cação das necessidades de uma ferramenta grande utilidade para apoiar essa atividade.
de gestão de projetos de inovação nas em- As plataformas são eficientes para uso
presas atendidas. Nesse sentido, a sistema- tanto em pequenas, como em médias e gran-
tização da inovação torna-se mais concreta, des empresas. Importante ressaltar que a não
criando espaço para o envolvimento de to- limitação do número de usuários facilita a
dos os usuários com a inovação dentro de manutenção e o controle de informações so-
uma organização. bre os projetos de inovação, de modo geral.
As fichas de avaliação de ideias permi-
tem descartar ou incubar ideias com menor
CONSIDERAÇÕES FINAIS pontuação ou baixa prioridade, permitindo
assim que a empresa direcione seus recursos
A Sistematização da Inovação não é um pro- a ideias e projetos com maior potencial de re-
cesso que acontece de forma solitária, mas torno de investimento.
resulta do envolvimento de todos os cola- Finalmente, cabe salientar que o objetivo
boradores, criando uma cultura de inovação deste artigo foi o de mostrar o impacto do
em torno da empresa. Para tornar esta práti- projeto cultura de inovação na sistematiza-
ca uma realidade, é necessária, entre outras ção da inovação. Os resultados permitiram
atividades, uma plataforma de suporte para verificar que o processo de inovação pode ser
apoiar os processos de inovação de forma sistematizado com a aplicação de uma ferra-
geral e a gestão de projetos de inovação. menta simples de gestão de ideias e de pro-
Entre as empresas atendidas no progra- jetos. Essa ferramenta pode ser desde pla-
ma de competências para inovação pela taformas em Excel a um software de gestão
FERGS, foram percebidas várias iniciativas de projetos. No entanto, neste artigo foram
em termos de estimular ideias de melhoria apresentados apenas os cases com a utiliza-

PROGRAMA RHAE TRAINEE CNPq – IEL 203


ção do Excel para desenvolver as plataformas ―. De onde vêm as boas ideias. 2012. Disponível
para sistematização da inovação. Não sendo em: <https://www.youtube.com/watch?v=-6Oypv_
substituto de outros programas de gestão Z0_s>. Acesso em: 28 jul. 2017.
de projetos de inovação, pode ser utilizado
OCDE. Manual de Oslo. Diretrizes para coleta e in-
como base para o desenvolvimento de sof-
terpretação de dados sobre Inovação. 1997. Terceira
twares mais eficientes de gestão da inovação.
edição. Disponível em:<http://bit.ly/2hMMT88>.
Como bolsista no Programa Inova Talen-
Acesso em: 16 ago. 2017.
tos, o fato de ter passado por treinamentos

―. Manual de Frascati 2002: Medição de ativi-


e cursos de extensão em Liderança, Criativi-
dade e Inovação da Harvard Business Review dades científicas e tecnológicas Tipo de metodologia
permitiu utilizar os conceitos aprendidos em proposta para levantamentos sobre pesquisa e de-
todas as atividades desenvolvidas no projeto senvolvimento experimental. 2013. F-INICIATIVAS
cultura de inovação para melhorar a eficiên- P+D+I para a edição em Português do Brasil.
cia dos serviços realizados internamente e Disponível em http://bit.ly/2kjgJlb > Acesso em: 16
promover a inovação na indústria gaúcha. ago. 2017.

SINEK, Simon. The Golden Circle. ELF. 2012. Dispo-


nível em: <http://bit.ly/2fNVVAQ>. Acesso em: 16
ago. 2017.
REFERÊNCIAS
BIBLIOGRÁFICAS SABINO, R. Maria; MONTANUCCI, G. R., Jonatas.
Inovação Sistêmica. Casos de Empreendedorismo
ARIVANANTHAN, Meena. Brainstorming. Free- e Inovações Sustentáveis. 2013. Disponível em:
-flowing creativity for problem-olving. 2015. Know- <http://www.isaebrasil.com.br/download/Livro_
ledge Exchange. UNICEF. Disponível em: < http:// Inovacao_Sistemica.pdf>. Acesso em: 31 jul. 2017.
uni.cf/2fIBH83>. Acesso em: 16 ago. 2017.
SISTEMA FIERGS. Manual de Gestão da Inovação.
ASHTON, Kevin. A História Secreta da Criativida-
Strategos Consulting. 2013.
de: Descubra como nascem as ideias que podem

―. IEL. Relatório Técnico. Núcleos de Inovação


mudar o mundo. 2016. Editora Sextante. 1ª ed.

CNI. Confederação Nacional da Indústria. Brasil de Apoio à Gestão da Inovação, NAGI/RS. 2016.
fica estagnado no Índice Global de Inovação. 2017. Porto Alegre, RS.
Disponível em: <http://bit.ly/2xdeSVo>. Acesso
em: 31 jul. 2017. VIANNA, Maurício; VIANNA, Ysmar; ADLER, Isabel
K.; LUCENA, Brenda; BEATRIZ, Russo. Design
JOHNSON, Steven. O guru Steven Johnson conta
Thinking: Inovação em Negócios. – Rio de Janeiro:
de onde vem a inovação. 2014. Revista Exame.
Disponível em: <http://abr.ai/2hKmx6H>. Acesso MJV Press, 2012. 162p.: il.; 24 cm. Disponível em:
em: 28 jul. 2017. <http://bit.ly/2fJiT8T>. Acesso em: 13 jul. 2017.

204 INOVA TALENTOS


08

PROGRAMA RHAE TRAINEE CNPq – IEL 205


09
DESENVOLVIMENTO DE
METODOLOGIAS PARA
AVALIAÇÃO SENSORIAL
APLICADA A PRODUTOS CAPILARES
AN A PAUL A PE RE S DO N ASC IMEN TO
_
Processos Químicos
Instituto Federal do Rio de Janeiro - RJ,

LUIZA PINHEIRO CARVALHO

_JULIANA BATTOCHIO FARIAS


L’Oréal Research and Innovation, Rio de Janeiro, Brazil

A autora principal é graduanda em Processos Químicos pelo


Instituto Federal do Rio de Janeiro - RJ, ex-bolsista do projeto
Inova Talentos, Fulbright Alumni, Assistente de Avaliação
Sensorial na empresa L’Oréal Pesquisa e Inovação.

Anascimento@rd.loreal.com
lucarvalho@rd.loreal.com
jfarias@rd.loreal.com

Ilha do Fundão 00
Via Projetada 1 do PAL 48212, n° 2100
Ilha do Bom Jesus – Cidade Universitária
Rio de Janeiro

(21)9802 74523

207
R E SU M O

PALAVRAS CHAVE análise sensorial; cosméticos; cabelos; painel sensorial.

Métodos sensoriais descritivos são fundamentais para determinar performance e auxi-

liar no desenvolvimento de produtos cosméticos mais assertivos para o mercado. Nesse

sentido, é indiscutível a importância da utilização da análise sensorial como instrumento

válido no processo de inovação e pesquisa. Este estudo tem como objetivo apresentar os

desafios para a formação de um painel sensorial capilar, utilizando a metodologia de aná-

lise descritiva quantitativa (ADQ) como ferramenta para obtenção e análise de dados ob-

jetivos e estratégicos sobre as características dos cosméticos em processo de otimização.

Devido ao desenvolvimento e a validação de um painel treinado, conseguiu-se direcionar

a equipe de desenvolvimento na seleção de fórmulas vencedoras, contribuindo para uma

avaliação mais preditiva quanto à aceitação dos produtos pelos consumidores.

208 INOVA TALENTOS


09

A BSTR ACT

KEYWORDS sensory analysis; cosmetics; hair; sensory pane

Descriptive sensory methods are essential to determine performance and support in the

development of assertive cosmetic products to the market share, as using sensory analysis

as a valid instrument in the process of innovation and research. This study aims to present

the challenges of the formation of a capillary sensory panel using the Quantitative Descrip-

tive Analysis (QDA) as a tool for obtaining and analyzing objective and strategic data that

can describe characteristics and lead in the optimization process of evaluation of hair care

cosmetic products. With the development and validation of a trained panel, we managed to

support the development team in the selection of winning formulas contributing to a more

predictive evaluation regarding the acceptance of the products by consumers.

PROGRAMA RHAE TRAINEE CNPq – IEL 209


de higiene pessoal e cosméticos, devido ao
INTRODUÇÃO aumento de renda, contribuiu para a alavan-
cagem do segmento. Além disso, os novos
integrantes da classe C passaram a consumir

E
m 2016, o Brasil foi considerado pela produtos com maior valor agregado, aliado à
revista Exame como o terceiro maior participação crescente da mulher brasileira
mercado do mundo para produtos de no mercado de trabalho. Os lançamentos
beleza, além de apresentar uma grande di- constantes de produtos, capazes de atender,
versidade na população em tipos de cabelos, cada vez mais, às necessidades do mercado,
o que torna nosso país uma grande fonte de contribuíram para o crescimento nos últimos
inovações em potencial para o mundo no anos. (ABIHPEC, 2016).
segmento. Faz-se necessário, dessa forma, o desen-
A categoria de higiene e cuidado capilar volvimento do estudo relativos a diferentes
é o foco principal dos fabricantes de cos- metodologias sensoriais para produtos capi-
méticos, por ser um segmento de grande lares, a fim de se encontrarem opções mais
valor econômico. Nos últimos anos, o aces- eficientes para as categorias de produtos tra-
so das classes D e E aos produtos do setor balhadas pela empresa L’Oréal Brasil.

CRESCIMENTO DO SETOR DE COSMÉTICOS

R$ Bilhões 43,2 42,6


US$ Bilhões
38,2
34,6
29,9
27,3
24,4
21,3
19,6
17,5 17,9 17,6 17,6 18,4
15,4 15,5
12,6 13
10,1 11,7
8,1
6,4

2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015

GRÁFICO 1 - Crescimento do Setor de cosméticos


Fonte: ABIHPEC (2016)

210 INOVA TALENTOS


09

A Ciência Sensorial tem papel funda- de sua aplicação para produtos capilares é
mental na pesquisa e desenvolvimento de muito maior, devido, principalmente, à am-
produtos, integrando estatística, anatomia, pla variedade dos tipos de cabelos, especial-
química, psicologia e outras tecnologias para mente no Brasil.
avaliar e analisar, através de métodos quali- Para posicionamento de fórmulas em ni-
tativos, quantitativos e afetivos, produtos de chos do mercado, testes rápidos e assertivos
forma mais assertiva para o mercado. Se- e metodologias quantitativas são os proces-
gundo Stone e Sidel, essa ciência é descrita sos mais indicados. “O método da Análise
como “uma disciplina científica, usada para Descritiva Quantitativa (ADQ) é a técnica de
evocar, medir, analisar e interpretar reações descrição sensorial mais utilizada na área
para produtos percebidos pela visão, ol- de alimentos, pois permite o levantamento,
fato, tato, paladar e audição.” (STONE; SI- a descrição e a quantificação dos atributos
DEL,1993) sensoriais detectáveis no produto, utilizan-
“Testes sensoriais têm sido conduzidos do julgadores com alto grau de treinamento
em seres humanos, para avaliar característi- e análise estatística dos dados.” (STONE e
cas positivas e negativas de alimentos, água, SIDEL, 2004)
armas, abrigos e tudo que pode ser usado De acordo com Meilgaard et al. (1991),
ou consumido.” “(...) construtores de painéis para análises
Recentemente, pesquisadores têm de- descritivas devem ter habilidade para per-
senvolvido métodos de avaliação sensorial ceber as diferentes características senso-
formalizadas e estruturadas, buscando refi- riais de produtos, sendo também capazes
nar técnicas sensoriais atualmente empre- de sentir a intensidade dessas diferenças.”
gadas no mercado. Esses métodos têm sido Para Bitnes et al. (2007), “também devem
desenvolvidos principalmente por interes- apresentar habilidade de descrever essas
ses econômicos, que estabelecem o valor e características e aplicar conceitos abstratos,
a aceitação de um determinado produto no quando uma característica/atributo precisa
mercado. “O principal uso das técnicas sen- ser dimensionado(a).”
soriais visa ao controle de qualidade, desen- Uma vez que não foram encontrados na,
volvimento e pesquisa de novos produtos.” bibliografia brasileira, protocolos para uso
(MEILGAARD; CIVILLE; CARR, 1991). da análise sensorial aplicada a cosméticos
“A análise sensorial foi inicialmente utili- capilares, este estudo sobre o desenvolvi-
zada na indústria de alimentos, sendo adap- mento e a formação de painel sensorial es-
tada para outros segmentos. Na indústria pecífico para produtos do segmento de hair
cosmética, a análise sensorial foi primor- care propicia um conhecimento mais abran-
dialmente adaptada em produtos para a pele gente sobre a análise sensorial, que tende a
(...)” (ISAAC, 2013). Porém, a complexidade ser útil como material de consulta a estudan-

PROGRAMA RHAE TRAINEE CNPq – IEL 211


tes e pesquisadores da área, que buscam in- tudo se baseou em quatro etapas, sendo a
formações sobre metodologias de avaliação primeira, a seleção das candidatas, iniciada
quantitativa para cosméticos, podendo ainda através de testes em que foram utilizadas to-
ser utilizado na cadeia de inovação e desen- das as categorias de produtos para cuidados
volvimento de novos produtos da categoria. com os cabelos, elaborados para que se jul-
gasse a atenção, o foco, bem como sua acui-
dade sensorial, capaz de torná-las aptas ou
OBJETIVO não a integrar um painel sensorial.

Este trabalho tem como objetivo principal o


TESTE DE ORDENAÇÃO DE IMAGENS
desenvolvimento de metodologias para ava-
Sete mechas foram preparadas e fotografadas
liação sensorial de produtos cosméticos que
para avaliação de determinadas característi-
caracterizem sensorialmente todas as cate-
cas. O aspecto a ser avaliado (ver figura 1) foi
gorias de produtos para cuidados capilares
o alisamento (cabelos sem/com falta de cur-
(Shampoo, Condicionador, Creme para Pen-
vatura). As imagens foram apresentadas de
tear, Sérum, Máscaras, etc.) através da for-
forma randomizada em cada umas das ca-
mação de um painel sensorial de avaliação
bines, para que fossem ordenadas de forma
capilar, de forma quantitativa, que melhor
crescente (menor grau de alisamento para
discrimine os produtos avaliados e direcione
maior grau de alisamento).
a equipe de desenvolvimento para seleção e
Além do teste de ordenação de imagens
aperfeiçoamento das melhores fórmulas.
de alisamento, elaborou-se um segundo tes-
te, no qual se avaliou o aspecto de frizz (cabe-
los não alinhados) sendo também utilizada a
METODOLOGIA
ordenação visual em ordem crescente (me-
PRÉ-SELEÇÃO nor intensidade de frizz para maior intensi-
Participaram do estudo 123 candidatas, com dade de frizz), como critério do exame.
perfil capilar previamente determinado. O es-

FIGURA 1 - Mechas com diferentes graus de alisamento


Fonte: Atlas Margalith

212 INOVA TALENTOS


09

TESTE DE ESCALA DE PROPORÇÃO TESTES TRIANGULARES


(Retirado da ASTM- E 2082 – 00) DE MECHAS (in vitro)
Usado como teste de raciocínio e habilidade Utilizaram-se mechas de cabelos naturais
de proporção de escala. Nele, solicitou-se para compor quatro testes triangulares para
que os candidatos avaliados marcassem na seleção do painel sensorial. Segundo a ABNT
escala a proporção do sombreado em cada (Teste triangular em análise sensorial de ali-
desenho. Foram considerados 10 desenhos. mentos e bebidas,1994) os testes triangula-
res são utilizados para determinar diferenças
sensoriais entre dois tratamentos ou produ-
TESTE DE ESCALA
tos. Às candidatas foram apresentadas três
Instruções: Observe a figura da esquerda e determine a quantidade
amostras codificadas, sendo-lhes indicado
que está pintada e marque na escala a porção da área da figura
que uma delas seria diferente das outras duas.
pintada, conforme o exemplo a seguir:
Os produtos usados no teste foram di-
versos. Focou-se na textura de cada produto
na superfície da amostra capilar para a ela-
boração do teste. As mechas foram prepara-
das de forma padronizada para minimizar a
variabilidade. O fator visual não foi determi-
nante na avaliação, sendo o tato o principal
sentido a ser utilizado para a identificação.

TESTE DE TRIANGULAR DE TEXTURA


Também se acrescentou aos testes de sele-
ção de painel um teste triangular de textura.
Três amostras foram dispostas para as candi-
datas, de forma randomizada, entre as quais
deveria ser identificada a amostra diferente.

TESTE DA DIFERENÇA DO CONTROLE


A metodologia da diferença do controle é
utilizada quando o objetivo do estudo é (1)
determinar onde existe a diferença entre
uma ou mais amostras e a amostra controle;
e (2) estimar a magnitude dessa diferença.
Geralmente, uma amostra é definida como
FIGURA 2 - Teste de Escala.
Fonte: ASTM- E 2082 -00 controle ou referência e todas as outras

PROGRAMA RHAE TRAINEE CNPq – IEL 213


amostras são comparadas a esta. Apresen- TESTE DE ORDENAÇÃO
tou-se às candidatas uma amostra referência DE PRODUTOS
e mais outras três amostras. Solicitou- se às Disponibilizaram-se quatro produtos dife-
candidatas que avaliassem a magnitude en- rentes, para que fossem ordenados a partir
tre a amostra referência e as amostras a tes- da sua viscosidade, após o contato com a
tar, em uma escala pré-determinada. pele. As amostras foram constituídas de
produtos que, apesar de apresentarem a
mesma cor, tinham viscosidades diferen-
tes, previamente avaliadas. Solicitou-se que
as candidatas ordenassem, de forma cres-
cente, o fator de deslize do produto após o
toque com os dedos (do menos deslizante
para o mais deslizante).
Para auxiliar a avaliação das mechas, de-
senhou-se um suporte com características
inovadoras, projetado e desenvolvido es-
pecificamente para este projeto. O suporte
de mechas possui uma base de metal com
altura ajustável e uma parte de acrílico com
mobilidade circular separada por divisórias,
que permite a avaliação monádica e sequen-
cial,conforme baseado na metodologia ADQ,
das amostras capilares (mechas –in vitro).
No momento de triagem dos candida-
tos, uma equipe especializada em classi-
FIGURA 3 ficação de tipos capilares com suporte da
Suporte para metodologia de curvatura desenvolvida por
Avaliação de Mechas
Fonte: Elaboração própria LOUSSOUARN et al utilizou o questionário
abaixo, para selecionar perfis previamente
determinados dos cabelos das futuras pai-
nelistas. O questionário considerou não só
o perfil capilar da candidata, como também
seu histórico de danos (processos de colo-
ração e química em geral).
Para evitar a fadiga sensorial, os testes fo-
ram divididos em dois dias na semana, com
cinco testes em cada dia.

214 INOVA TALENTOS


09

FIGURA 4 - Questionário de avaliação capilar.


Fonte: Elaboração própria

PROGRAMA RHAE TRAINEE CNPq – IEL 215


LEVANTAMENTO DE ATRIBUTOS tas posicionavam os produtos em uma es-
Foram inicialmente aprovadas 40 candida- cala e identificavam as âncoras e referências
tas, que seguiram para a segunda etapa do para cada atributo. Após uma bateria de trei-
projeto: o desenvolvimento da terminolo- namentos, foram realizadas sessões de vali-
gia descritiva. Utilizou-se o método de rede dação, nas quais as candidatas avaliaram 4
(Grid), descrito em MOSKOWITZ, no qual amostras em 2 replicatas sobre 17 atributos
as amostras foram apresentadas em pares (definidos na etapa anterior). As painelistas
às candidatas. Mediante a utilização de uma foram avaliadas a partir de parâmetros de
ficha, foi solicitada a avaliação das amostras, discriminabilidade, homogeneidade e repeti-
descrevendo-se similaridades e diferenças bilidade.
entre elas com relação à aparência e à textura O software FIZZ Acquisition 2.50 ©, para
produzida na superfície da amostra capilar. a formatação dos testes de seleção e valida-
ção, foi utilizado para análises sensoriais ro-
DEFINIÇÕES, GESTUAIS E bustas de avaliação sensorial nas indústrias.
REFERÊNCIAS DOS ATRIBUTOS A partir dos dados coletados, foi realizada
SELECIONADOS análise de variância (ANOVA) de dois fatores
Baseado nesses registros, definiu-se uma lis- fixos (produto, julgador e sessão), com inte-
ta convergente de termos citados com maior ração para cada atributo.
frequência e termos importantes para descre- Dois aspectos de performance necessita-
ver o resultado da avaliação. A partir desse ram ser monitorados: a acuracidade e a pre-
levantamento, elaborou-se uma lista de de- cisão do painel.
finições de cada termo descritivo desenvol-
vido, gestuais e referenciais para a avaliação
dessas características (glossário). RESULTADOS E DISCUSSSÕES
Durante a primeira etapa, foram aprovadas
TREINAMENTO, SELEÇÃO 40 futuras painelistas, com a nota de corte
FINAL E VALIDAÇÃO definida pela equipe de sensorial de 8 pontos
Na última etapa, foram realizados os proces- em 9 testes contabilizados, sendo o teste de
sos de treinamento, seleção final e validação escala com apresentação de pontuação vari-
das candidatas. O treinamento consistiu na ável para cada figura.
realização de testes com referências e com Na terceira semana do processo seletivo,
outras amostras diferentes entre si. Fez-se foram analisados os índices de aprovação em
ainda um levantamento de produtos que cada teste. Notou-se que, em um dos testes,
apresentavam resultados extremos com foco houve alta taxa de reprovabilidade. Sendo
em resultado final, ou seja, na mecha já seca. assim, decidiu-se por reduzir a nota de corte
A partir desse levantamento, as painelis- em um ponto, a fim de não comprometer a

216 INOVA TALENTOS


09

formação do painel. Percebeu-se, com isso, que os testes que possuíam o tato como sentido
principal, por ser um sentido com um conceito mais abstrato, foram aqueles com maior taxa
de reprovabilidade.

INDÍCE DE APROVAÇÃO DOS TESTES REALIZADOS

TESTE 2 3 4 5 6 7 8 9 10

APROVAÇÃO 66.9 56.2 44.6 92.6 74.2 80.8 55.8 16.7 65.8

TABELA 1 - Indíce de aprovação dos testes realizados.


*Os testes possuem o mesmo nome por serem do mesmo tipo. Porém, foram utilizados produtos diferentes para cada teste.

TESTES PARA A SELEÇÃO

NÚMERO TESTE SENTIDO CATEGORIA

1 Teste de Verificação de Escala - -

2 Teste de Ordenação Para Avaliar Alisamento Visão -

3 *Teste Triangular de Toque com Mechas Tato Care

4 *Teste Triangular de Toque com Mechas Tato Care

5 Teste Triangular de Toque Tato Styling

6 Teste de Ordenação Para Avaliar Frizz Visão -

7 Teste Triangular com Produtos Visão Care

8 *Teste Triangular de Toque com Mechas Tato Styling

9 Teste de Textura Tato -

10 Teste de Diferença do Controle Tato -

TABELA 2 - Cronograma de testes


*Os testes possuem o mesmo nome por serem do mesmo tipo. Porém, foram utilizados produtos diferentes para cada teste.

A partir dos resultados, obteve-se uma margem de aproximadamente 30% de aprovação, sendo que apenas
uma parcela das candidatas que obtiveram nota 7 foi classificada, devido à mudança na nota de corte, conforme
exemplificado no gráfico 2.

PROGRAMA RHAE TRAINEE CNPq – IEL 217


SELEÇÃO DE PAINEL SENSORIAL - 2016

23,8%

19,7%
18,9%

14,8%
12,3%

4,9%
3,3%
0,8% 0,0% 0,8% 0,8%

0 1 2 3 4 5 6 7 8 9 10
NOTAS
GRÁFICO 2 - Resultado Final da Pré-Seleção de Painel Sensorial
Fonte: Elaboração própria

O segundo desafio foi encontrar candidatas com o perfil capilar previamente determinado
(Perfil capilar: TIPO I e II – lisos e quimicamente tratados; TIPO III e IV ondulados e cache-
ados) para a formação do painel de autoavaliação, etapa futura após validação do painel de
mechas. Dentro do perfil capilar previamente determinado, observou-se uma grande variedade
de espessura, volume e sensibilização, o que ampliará o alcance das informações sobre a per-
formance dos produtos a serem testados.

TIPO I e II

TIPO III e IV

FIGURA 5 - Tipagem capilar das aprovadas em seleção

218 INOVA TALENTOS


09

Durante a terceira etapa, reduziu-se o ԎԎ interação produto/painelista:


quadro para 24 painelistas, motivado pelo Uma interação produto/painelista
não enquadramento das demais candidatas significativa é positiva, pois significa
no perfil comportamental desejado. A partir que, para o atributo avaliado, a
da lista obtida através do método de rede, painelista conseguiu ver diferença.
obteve-se um glossário integrando 17 atribu-
ԎԎ interação produto/replicata:
tos, com suas respectivas definições, gestu-
Uma interação produto/painelista
ais e referências.
significativa é negativa, pois significa
Para a etapa de validação das candidatas,
que, para o atributo avaliado, o
foi realizada a análise de variância (ANOVA)
produto foi avaliado de maneira
para cada atributo, objetivando verificar a
diferente em cada repetição.
existência de diferenças significativas entre
ԎԎ interação painelista/repetição:
as médias e se os fatores (produto/paine-
Uma interação produto/painelista
lista/sessão) exercem influência em alguma
significativa é negativa, pois significa
variável dependente, checando-se o efeito
que, para o atributo avaliado, a
do produto, o desempenho da painelista,
painelista não repetiu a avaliação.
além das repetições das interações e das
interações de produto/painelista, produto/ Na última etapa, obteve-se a validação
sessão, e painelista/sessão. de 16 painelistas, a partir de um padrão de-
ԎԎ efeito produto: Uma avaliação terminado de 70% nos parâmetros dispos-
de produto significativa é positiva, tos a seguir:
pois significa que as painelistas
conseguiram discriminar os produtos.
(P ≥ 0,05 95% de confiança).
RESULTADOS DA VALIDAÇÃO
ԎԎ efeito painelista: Uma avaliação de
PADRÃO
RESULTADOS
painelista significativa é negativa, pois SATISFATÓRIO
significa que as painelistas avaliaram PARÂMETROS DE
92% ≥ 70%
DISCRIMINABILIDADE
o atributo de maneira diferente. (P ≥
0,05 95% de confiança). PARÂMETROS DE
75% ≥ 70%
HOMOGENEIDADE
ԎԎ efeito repetição: Uma avaliação de
repetição significativa é negativa, pois PARÂMETROS DE
92% ≥ 70%
REPETIBILIDADE
significa que o atributo foi avaliado de
maneira diferente entre as repetições. DISCRIMINABILIDADE
75% ≥ 70%
(P ≥ 0,05 95% de confiança). DAS PAIENLISTAS

TABELA 3 - Resultados da Validação

PROGRAMA RHAE TRAINEE CNPq – IEL 219


Foram validados 11 dentre os 17 atributos treinados, separados em três momentos diferen-
tes, conforme a tabela 4:

ATRIBUTOS VALIDADOS

APARÊNCIA TOQUE APARÊNCIA APÓS O TOQUE

4 atributos validados 5 tributos validados 1 atributo validado


TABELA 4 - Resultados da Validação

A partir da metodologia empregada, foi sensorial treinado, essa foi considerada uma
possível notar a necessidade de aperfeiçoa- das metodologias mais assertivas para inte-
mento, com o desenvolvimento dos testes grar e sustentar dossiês de projetos e para o
para a formação de um painel sensorial, as- mapeamento mais estratégico dos produtos
segurando que estejam dentro do limite de internos e do mercado.
detecção sensorial dos seres humanos, pois,
como foi constatado, alguns testes podem
apresentar baixa distinção sensível.
CONSIDERAÇÕES FINAIS
O maior desafio para o desenvolvimento
A cada ano, milhares de fórmulas são de-
dessa metodologia se deu a partir da adapta-
senvolvidas pelas equipes de pesquisa da
ção de testes de seleção e treinamento, em
L’Oréal. A geração de equipamentos, testes
que as referências enfatizam fortemente o
e protocolos de procedimentos analíticos
mercado de alimentos.
para preparação dos testes tem alavancado
Ainda que, nos centros de pesquisa da
aprimoramentos na categoria de técnicas de
L’Oréal espalhados pelo mundo, existam pai-
avaliação sensorial desse segmento.
néis treinados para diversas categorias, esse é
Essas novas metodogias são indispensá-
o primeiro painel que tem como foco a avalia-
veis para trazer novos produtos ao mercado,
ção de resultado final, além de ser o primeiro
demonstrando cientificamente sua seguran-
painel de mechas de cabelo, metodologia es-
ça e rigorosa eficácia, o que faz com que a
tudada em recente estudo interno de correla-
formação de um painel sensorial capilar seja
ção de atributos cabeça versus mechas.
considerada uma ferramenta de extrema im-
Perceberam-se vantagens e desvantagens
portância para o monitoramento estratégico
no uso de mechas para avaliação, porém,
de mercado, auxiliando tanto no desenvol-
diante da robustez dos dados de um painel

220 INOVA TALENTOS


09

vimento de produtos mais assertivos, como Inova Talentos, em conjunto com a L’Oréal
no controle de qualidade das fórmulas, em – Pesquisa e Inovação, tendo o CNPQ como
projetos de redução de custo com paridade agência de fomento e o IEL como parceiro,
de performance e mapeamento sensorial de inserindo jovens profissionais capacitados
diferentes nichos. diferentes nichos.Este es- a contribuir, com seu conhecimento, para
tudo foi desenvolvido a partir do Programa empresas de pesquisa e desenvolvimento.

REFERÊNCIAS MEILGAARD M, CIVILLE GV, CARR BT. Consu-


BIBLIOGRÁFICAS mer test and inhouse panel acceptance tests. In:
Meilgaard M, Civille GV, Carr BT, editors. Sensory
STONE HS, SIDEL JL. Sensory evaluation practices. evaluation techniques. Florida: CRC Press; 1991. p.
San Diego, CA: Academic Press; 1992.City, Califor- 142-47.
nia, 1993.
Indústria de Cosméticos dribla crise e projeta
MOSKOWITZ, H.R. Product testing and sensory crescimento, 2016, Revista EXAME. Disponível em :
evaluation of foods: marketing and R & D approa- <http://exame.abril.com.br/negocios/dino/indus-
ches. Westport, Food & Nutrition Press, 1983. 605 p. tria-de-cosmeticos-dribla-crise-e-projeta- cresci-
mento-dino890103433131/>
AMERICAN SOCIETY FOR TESTING AND MA-
TERIALS - ASTM. Standard Guide for Descriptive MOSKOWITZ, H.R. Product testing and sensory
Analysis of Shampoo Performance1, ASTM, E 2082
evaluation of foods: marketing and R & D approa-
– 00
ches. Westport, Food & Nutrition Press, 1983. 605 p.

AMERICAN SOCIETY FOR TESTING AND MA-


ISAAC, VERA LUCIA BORGES.,et al. Análise
TERIALS - ASTM Guidelines for the Selection and
sensorial como ferramenta útil no desenvolvimento
Training of Sensory Panel Materials, ASTM STP 758,
de cosméticos. Revista de Ciências Farmacêuticas
ASTM.
Básica e Aplicada, v. 33, n. 4, p. 479-488, 2013.
BITNES J, RODBOTTEN M, LEA P, UELAND O,
MARTENS M. Effect of product knowledge on PANORAMA DO SETOR DE HPPC, 2016, Asso-
profiling performance comparing various sensory ciação Brasileira da Indústria de Higiene Pessoal
laboratories. J Sens Stud. 2007;22(1):66-80. Perfumaria e Cosméticos. Disponível em: http://
bit.ly/2xjSNDI
ASSOCIAÇÃO BRASILEIRA DE NORMAS TÉCNI-
CAS - ABNT. Teste triangular em análise sensorial LOUSSOUARN,G., GARCEL,A.,LOZANO,I.,et al.
de alimentos e bebidas. –NBR 12995. Rio de Janei- « Worldwide diversity of hair curliness, a new
ro: ABNT; 1994a. method of assessment », International Journal of
Dermatology, v.46, pp.2-6, 2007.

PROGRAMA RHAE TRAINEE CNPq – IEL 221


10
β-GALACTOSIDASE
PRODUÇÃO DA ENZIMA

RECOMBINANTE E IMOBILIZADA,
VISANDO À APLICAÇÃO INDUSTRIAL
JU LE A NE LU NA R D I
_
Quatro G Pesquisa & Desenvolvimento Ltda.
Porto Alegre – RS, Brasil.
_
Graduação em Biomedicina
UFCSPA
_
Doutorado em Biologia Celular e Molecular
PUC - RS

BRUNA COELHO DE ANDRADE


VICTÓRIA FURTADO MIGLIAVACCA
JOCELEI MARIA CHIES
GABY RENARD
_
Quatro G Pesquisa & Desenvolvimento Ltda.
Porto Alegre – RS, Brasil.

GIANDRA VOLPATO
_
Instituto Federal de Educação, Ciência e Tecnologia
do Rio Grande do Sul (IFRS). Porto Alegre – RS, Brasil.

A autora possui graduação em Biomedicina pela UFCSPA e


mestrado e doutorado em Biologia Celular e Molecular pela
PUC - RS. Foi bolsista no programa Inova Talentos na empresa
Quatro G pesquisa & Desenvolvimento Ltda., na qual atuou
na aplicação de técnicas inovadoras da biotecnologia moderna
para o desenvolvimento da produção nacional de uma lactase
geneticamente modificada.

jlunardi@gmail.com

(51) 996724057

223
R E SU M O

Inovação, lactase, enzima geneticamente modificada,


PALAVRAS CHAVE intolerância a lactose, produção nacional.

A β-galactosidase, ou lactase, é uma enzima aplicada no tratamento do leite, com o intui-

to de obter derivados e suplementos alimentares com baixo teor de lactose, utilizados por

indivíduos intolerantes a essa substância. Atualmente, o Brasil é dependente da impor-

tação da lactase para a produção desses produtos. O objetivo deste trabalho foi estudar

estratégias para possibilitar a produção nacional da enzima lactase geneticamente modifi-

cada, de modo a introduzir um produto inovador no mercado brasileiro.

224 INOVA TALENTOS


10

A BSTR ACT

KEYWORDS Innovation, lactase, genetically modified enzyme,


lactose intolerance, national production.

The β-galactosidase, or lactase, is an enzyme applied in milk treatment in order to

obtain its low lactose derivatives and food supplements, used by individuals intolerant

to lactose. Currently, Brazil is dependent on the import of lactase for the production of

these products. The objective of this work was to study strategies to enable the national

production of the genetically modified lactase and to introduce an innovative product in

the Brazilian market.

PROGRAMA RHAE TRAINEE CNPq – IEL 225


gado na fabricação de doces e iogurtes, por
INTRODUÇÃO exemplo. Essa aplicação leva à melhora das

enzima β-galactosidase, ou lactase,


propriedades sensoriais do produto final,

A
devido às características tecnológicas mais
tem especial importância para a in- interessantes dos monossacarídeos resul-
dústria de alimentos e farmacêutica, tantes, glicose e galactose, tais como au-
por hidrolisar a lactose (açúcar presente no mento do gosto doce, maior solubilidade e
leite) em glicose e galactose, seus monossa- menor poder de cristalização (4, 5). No Bra-
carídeos constituintes. A enzima é utilizada sil, o setor de leite e derivados tem produção
na preparação de leite e derivados lácteos expressiva, especialmente no Rio Grande do
com baixo teor de lactose e em suplementos Sul, contribuindo para a expansão e diversi-
alimentares, produtos utilizados por indiví- ficação econômica. O estado representa o
duos intolerantes à lactose (1). segundo maior produtor do país, perdendo
Esta enzima está presente nos mamífe- apenas para Minas Gerais (6).
ros durante o período de amamentação. Na Atualmente, a lactase vem ganhando
maioria destes, a atividade da lactase dimi- destaque neste mercado, principalmente no
nui no intestino após este período, podendo desenvolvimento de produtos alimentícios
provocar sintomas de intolerância à lactose com baixo teor de lactose, que tem crescido
(2), como desconforto abdominal. A inten- significativamente em função do aumento
sidade dos sintomas varia, dependendo da de indivíduos que apresentam sintomas a
quantidade de lactose ingerida, aumentan- intolerância à lactose.
do com o passar da idade (3). O uso industrial de enzimas ainda repre-
Mattar e Mazo (2) realizaram um resu- senta um aumento de custo bastante signi-
mo de dados epidemiológicos, relacionando ficativo no processo, que se reflete no valor
a ocorrência dessa enfermidade em adultos, do produto final. Algumas alternativas para
em diferentes regiões. O estudo demonstra diminuir o custo da aplicação industrial de
grande variação da intolerância à lactose enzimas envolvem o aumento da atividade
pelo mundo, podendo variar entre poucos enzimática, que pode ser obtido através da
indivíduos afetados na Suécia (1% a 7%) produção da enzima modificada genetica-
até a grande maioria da população na Ásia – mente (7). As técnicas de engenharia gené-
pode chegar a 100% de indivíduos afetados. tica representam um avanço nas possibilida-
No Brasil, a intolerância varia de 57%, em des de se obter maior quantidade de lactase,
brancos e mulatos, até 100%, em japoneses. com menor custo de produção.
O interesse em utilizar a lactase na in- As bactérias Escherichia coli (E. coli), mo-
dústria de laticínios surgiu inicialmente para dificadas geneticamente, são capazes de
realizar o tratamento prévio do leite empre- produzir a lactase. O crescimento dessas

226 INOVA TALENTOS


10

bactérias pode ser realizado em equipa- Obtêm-se, assim, relações empíricas entre
mentos conhecidos como biorreatores, nos uma ou mais respostas de interesse. Dessa
quais é possível controlar as condições de forma, este estudo permite que se verifique,
processo, de modo a obter quantidades quantifique e otimize a influência das variá-
apreciáveis da enzima. veis estudadas, sendo possível a obtenção
Técnicas para cultivo de E. coli a altas das melhores condições para realização de
densidades celulares têm sido desenvol- determinado processo e/ou para a obtenção
vidas para aumentar a produtividade (8). de um produto com as características dese-
Para tal, os processos são conduzidos fre- jadas (10, 11). Com os resultados obtidos no
quentemente com uma adição controlada planejamento, é possível calcular os efeitos
de nutrientes (batelada-alimentada). Essas principais e de interação das variáveis sobre
técnicas podem diminuir consideravelmen- as respostas.
te o custo da produção dessas proteínas de No Brasil, o número crescente de pesso-
interesse industrial, como a lactase. as diagnosticadas com intolerância à lacto-
Para que as bactérias produzam a enzi- se vem aumentando o consumo de produ-
ma de interesse, é necessária a indução da tos lácteos com baixos teores da substância,

agente químico indutor, o isopropil β-D-


sua produção por meio da adição de um fato que ampliou a demanda do uso da enzi-
ma pela indústria nacional de laticínios.
1- tiogalactopiranosídeo (IPTG). Porém, o Atualmente, há uma dependência da
momento da indução e as concentrações importação da lactase por esta indústria,
do indutor utilizadas podem influenciar na indicando um novo nicho de mercado, no
produtividade final da enzima (9). qual tecnologias inovadoras podem ser em-
O planejamento experimental é um dos pregadas para obtenção de um produto na-
métodos que pode ser utilizado para estudar cional.
a influência desses parâmetros no cresci-
mento bacteriano. Graças ao planejamento
experimental, a análise de um determinado OBJETIVOS
processo é realizada mediante a utilização
de um número menor de experimentos, O objetivo deste trabalho é aplicação de téc-
quando comparado às metodologias con- nicas inovadoras da biotecnologia moderna
vencionais, o que permite a investigação do para a produção nacional da lactase, por
processo em uma faixa ampla de variação, meio de estudos das variações nas estraté-
com redução de tempo e de custos (10). gias de crescimento dos cultivos de Escheri-
Um dos métodos de avaliação do pla- chia coli.
nejamento experimental é a análise e oti-
mização através de superfícies de resposta.

PROGRAMA RHAE TRAINEE CNPq – IEL 227


utilizados no biorreator foram os mesmos já
METODOLOGIA determinados pelos cultivos em shaker.

Os experimentos foram desenvolvidos na


CULTIVOS DESCONTÍNUOS
empresa Quatro G Pesquisa & Desenvolvi-

Nos experimentos de batelada, foram realizados


(EM BATELADA)
mento Ltda (Quatro G). Neles, foram reali-

cultivos sem a utilização de alimentação ou


zados cultivos, com o objetivo de estudar a

qualquer tipo de indução. Foram mantidos


influência de algumas variáveis importantes
nas relações entre produtividade de biomas-
apenas os parâmetros básicos: taxa de OD
sa celular e produtividade da enzima, em di-
de 30%, mantida pela variação da agitação
ferentes momentos do cultivo.
(400-1000), e taxa de fluxo de ar constante
de 1 vvm. Todos os ensaios tiveram duração
de 7 horas cada.
CULTIVO EM BIORREATOR As condições de crescimento utilizadas
As condições de cultivo básicas foram de- foram as já estabelecidas nos cultivos em
terminadas em agitador orbital de bancada agitador orbital de bancada, sendo que os

expressão da β-galactosidase de Kluyveromy-


(shaker), sendo obtida a melhor condição de dados resultantes dos experimentos foram
utilizados para a determinação da curva de
ces sp. em cepas de E. coli BL21(DE3), tempe- crescimento bacteriana, o que tornou pos-
ratura de cultivo de 30ºC e meio de cultivo sível verificar o momento em que o cultivo
LB (Lysogeny Broth), condições que serão entra em fase estacionária de crescimento.
mantidas nos cultivos em biorreator. Quando realizados os cultivos em batelada
Todos os cultivos foram desenvolvidos alimentada, esse momento foi utilizado para
em biorreator de bancada com duas dornas o início da fase de alimentação.
de 2 L cada (BIOSTAT® B Plus, Sartorius
Stedim Biotech, Alemanha). O biorreator, CULTIVOS EM
com controle automático de temperatura, BATELADA ALIMENTADA
agitação, aeração e pH, mede diretamente Nas culturas com batelada alimentada, sele-
o oxigênio dissolvido, mediante um eletrodo cionamos uma estratégia com feedba­ck, a do
polarográfico. stat, e uma sem feedback, a linear ascenden-
O acompanhamento do cultivo foi reali- te (calculada e programada no próprio bior-
zado pela monitoração de uma série de pa- reator pela equação (1).
râmetros como oxigênio dissolvido (OD), Os testes de estratégias de alimentação
consumo de glicose, pH, temperatura, agita- foram realizados com a indução da cultura,
ção, densidade óptica a 600 nm (DO600nm). adicionando 1 mM de IPTG, após 12 h do iní-
O meio de cultura e a temperatura a serem cio do processo. A agitação do meio de cul-

228 INOVA TALENTOS


10

tivo é mantida em cascata com a taxa de OD CONVERSÃO DE DO600NM


até o início da alimentação (para DO-STAT) ou PARA BIOMASSA (X).
até o final do cultivo (para linear ascendente). O crescimento celular foi monitorado por
Foram testados os diferentes horários medida de DO600 nm com espectrofotôme-
e concentrações para a indução do cultivo tro Amersham Biosciences modelo Ultros-
com IPTG. Todas essas condições foram pec 3100 pro e foi relacionado com a bio-
analisadas, visando ao aumento de produ- massa por medida de peso-seco.
tividade de biomassa e de produtividade Para a medida de peso-seco, três alíquo-
da proteína de interesse, para que, ao final tas de 10 mL foram coletadas do biorreator
dos experimentos, pudéssemos determinar, em tubos de 15 mL, previamente pesados
através de planejamento estratégico experi- em balança analítica e centrifugadas por 10
mental, qual a condição ideal de cultivo a ser minutos, a uma velocidade de 6.000 rpm.
empregada para a produção da lactase. O sobrenadante foi desprezado e o pellet

(1)
formado foi lavado com 10 mL de tampão
F = at + b 50 mM Tris-HCl pH 8,0. Novamente, as alí-
quotas foram centrifugadas e o sobrenadan-
onde, F é a taxa de alimentação (mL/min), te, descartado. O pellet formado foi levado à
X é a biomassa, t é o tempo de cultivo após estufa a 90ºC, onde permaneceu até atingir
um peso constante. A diferença encontrada
tantes. C é uma constante da equação, SF
o início da alimentação e a e b são cons-
foi relacionada à medida de densidade ópti-
ca, mediante uma reta de correlação, o que
alimentação, µset é a velocidade específica
é a concentração do substrato no meio de
permitiu determinar a biomassa em gramas
de crescimento desejada, ta é o tempo de de célula por litro.
alimentação, V é o volume do biorreator e
YX/S é a conversão de substrato em células. ANÁLISE DA EXPRESSÃO DA LACTASE
A expressão da enzima foi analisada utili-
zando eletroforese em géis de poliacrilamida
MÉTODOS 12%. Para tal, os centrifugados das amostras
ANALÍTICOS nos cultivos em biorreator foram ressuspen-
Para a análise dos dados obtidos nos dife- sos em 1 mL de tampão 50 mM Tris-HCl pH
rentes experimentos, foram utilizados os 8,0. As amostras foram rompidas por ultras-
métodos analíticos descritos a seguir. Todas som e centrifugadas, e as frações solúveis
essas análises foram realizadas com a uti- foram separadas e congeladas a -20 ºC até
lização do software Statistica 7.0 (Statsoft, o momento das análises. O padrão de peso
Tulsa, UK, USA). molecular Page Ruler (Thermo Scientific) foi
utilizado como marcador nos géis.

PROGRAMA RHAE TRAINEE CNPq – IEL 229


QUANTIFICAÇÃO

(3)
DE PROTEÍNAS TOTAIS
Para a quantificação do total de proteína ex-
pressa pelo micro-organismo, foi empregada

(4)
a técnica de Bradford (12).

DETERMINAÇÃO DA
ATIVIDADE ENZIMÁTICA

(5)
A atividade da enzima lactase foi determi-
nada segundo a metodologia proposta por
Rech (13), com modificações, utilizando
ONPG (o-nitrofenol-β-D-galactopiranoside)
como substrato. Uma unidade de atividade

(6)
enzima requerida para liberar 1 μmol de ONP
enzimática é definida como a quantidade de

(o-nitrofenol) por minuto, nas condições da


análise.

(7)
ANÁLISES DE PRODUTIVIDADE
DE BIOMASSA E DE PROTEÍNA
Os cálculos de conversão (rendimento) de
substrato em biomassa, produto em biomas-
sa e substrato em produto foram realizados
utilizando as equações (3-5), respectivamen- onde, YX/S é a conversão de substrato em
te. Para os cálculos relacionados à produtivi- biomassa, YX/P é a conversão de biomassa em
dade de produto realizados neste trabalho, foi produto, YP/S é a conversão de substrato em
proposta uma modificação na equação (6). produto, X é a biomassa, P é o produto e S é
Considerou-se um Tempo morto (tm) o substrato (ex. glicose), sendo X0, S0 e P0 os
de 8 horas, equivalente ao período de lava- valores iniciais para cada uma das variáveis
gem, calibração, esterilização e montagem e Xm e Pm os valores máximos ou finais para
dos biorreatores, conforme representado cada uma das variáveis. PP é a produtividade
na equação (7). O tempo morto foi utiliza- do produto, t é o tempo final do cultivo, tm
do como tentativa de englobar um processo é o tempo morto e tp é o tempo de produção
fermentativo rotineiro no laboratório da em- do produto durante o cultivo (ex. expressão da
presa Quatro G. enzima, após a indução com IPTG).

230 INOVA TALENTOS


10

PLANEJAMENTO perimento, foi desenhada a curva de cresci-


EXPERIMENTAL mento bacteriano (figura 1). Com essa curva,
As variáveis a serem consideradas foram foi possível observar o horário de inicio da
tempo de indução e concentração do agente fase estacionária de crescimento, que se deu
indutor IPTG, utilizando um Delineamento com 5 horas, momento considerado ideal
Composto Central Rotacional (DCCR). Como para a introdução da alimentação no cultivo.
mencionado, esses dois parâmetros podem Com o objetivo de otimizar o cultivo da
influenciar diretamente na resposta estuda- lactase, iniciamos os testes em batelada ali-
da (produtividade de célula e de proteína). mentada. A alimentação foi iniciada 5 h após
o início do cultivo (conforme os dados ob-
tidos nos cultivos descontínuos (figura 1)).
RESULTADOS A vazão de ar é mantida a 1 vvm e o pO2 a
A fim de determinar o melhor momento 30%. Para essa etapa, utilizamos um meio
para iniciar a alimentação do cultivo, foram de alimentação mais rico em nutrientes (Gli-
realizados os ensaios de batelada (descontí- cose + LB 2x + MgSO4).
nuos), sem alimentação e sem indução do Os valores de DO obtidos nesses ensaios
cultivo. A partir dos dados obtidos neste ex- estão na tabela 1.

CURVA DE CRESCIMENTO BACTERIANO

Cultivo 1
10
* Cultivo 2

1
OD (600 nm)

FIGURA 1 - Curva de crescimento


bacteriano. Relaciona a densidade
0,1 ótica (OD), referente ao cultivo
descontínuo realizado em duplicata
(Cultivo 1 e Cultivo 2), com o tempo
de cultivo em horas. É possível
observar o início da fase estacionária
0,01 de crescimento após 5h de cultivo (*).
0 1 2 3 4 5 6 7 8 9

PROGRAMA RHAE TRAINEE CNPq – IEL 231


VALORES DE OD PARA OS CULTIVOS DE DETERMINAÇÃO DA MELHOR ESTRATÉGIA
DE ALIMENTAÇÃO PARA PRODUÇÃO DA LACTASE EM BIORREATOR.

FERMENTAÇÃO ESTRATÉGIA DE OD
ALIMENTAÇÃO

1 DO-STAT 41,5

2 DO-STAT 48

3 DO-STAT 39,95

4 DO-STAT 35,35

5 Linear ascendente (1-5%) 41,75

6 Linear ascendente (1-3%) 53,25

TABELA 1 - Valores de OD para os cultivos de determinação da melhor


estratégia de alimentação para produção da lactase em biorreator.

Analisando esses resultados, conjunta- da melhor estratégia de alimentação.A me-


mente com o resultado obtido por eletrofore- lhor atividade específica da enzima lactase
se em gel de poliacrilamida, foi possível ob- foi obtida no Cultivo 1 (15,09 U/mg), realiza-
servar que, independentemente da estratégia do com estratégia de alimentação DO-STAT
de alimentação empregada, o nível de expres- nas seguintes condições: meio de cultivo LB,
são foi muito semelhante para, praticamen- temperatura de 30º C, pH 7,0, indução com 1
te, todos os cultivos. Quando analisados os mM de IPTG após 12 horas do inicio do culti-
dados de densidade ótica (OD600 nm) (TA- vo, meio de alimentação Glicose + MgSO4 +
BELA 1), observamos que a média também LB (2x) e estratégia de alimentação DO-STAT.
ficou muito próxima entre os cultivos. Assim, Na etapa seguinte, foram realizados cul-
os resultados da atividade específica (tabela tivos com diferentes meios de alimentação,
2) são preponderantes para a determinação conforme tabela 3.

232 INOVA TALENTOS


10

RESULTADOS DE ATIVIDADE DA LACTASE OBTIDOS NOS CULTIVOS


PARA ANÁLISE DE ESTRATÉGIA DE ALIMENTAÇÃO 1 – 6.

CULTIVO TEMPO INDUÇÃO OD ATIVIDADE PROTEÍNA ATIVIDADE


(h) 600 nm VOLUMÉTRICA (mg/mL) ESPECÍFICA
(U/mL) (U/mg)

1 12 NI 0,374 1,5708 0,721 2,179

1 16 1 mM 0,178 3,738 0,536 6,974

1 20 1 mM 0,316 6,636 0,6 11,060

1 24 1 mM 0,2995 6,2895 0,599 10,500

1 28 1 mM 0,342 7,182 0,476 15,088

1 30 1 mM 0,3015 6,3315 0,461 13,734

2 12 NI 0,0065 0,0273 0,603 0,045

2 16 1 mM 0,7295 3,0639 0,693 4,421

2 20 1 mM 0,174 3,654 0,467 7,824

2 24 1 mM 0,2345 4,9245 0,532 9,256

2 28 1 mM 0,2885 6,0585 0,586 10,339

2 30 1 mM 0,2745 5,7645 0,515 11,193

3 12 NI 0,0085 0,0357 0,77 0,046

3 16 1 mM 0,421 1,7682 0,589 3,002

3 20 1 mM 0,374 3,1416 0,584 5,379

3 24 1 mM 0,479 4,0236 0,482 8,348

3 28 1 mM 0,4495 3,7758 0,479 7,883

4 12 NI 0,0095 0,0399 0,62 0,064

4 16 1 mM 0,4595 1,9299 0,561 3,440

4 20 1 mM 0,408 3,4272 0,563 6,087

PROGRAMA RHAE TRAINEE CNPq – IEL 233


CULTIVO TEMPO INDUÇÃO OD ATIVIDADE PROTEÍNA ATIVIDADE
(h) 600 nm VOLUMÉTRICA (mg/mL) ESPECÍFICA
(U/mL) (U/mg)

4 24 1 mM 0,6725 5,649 0,679 8,319

4 28 1 mM 0,258 5,418 0,561 9,658

5 12 NI 0,0075 0,0315 0,899 0,035

5 16 1 mM 0,1285 2,6985 0,502 5,375

5 20 1 mM 0,1675 3,5175 0,614 5,729

5 24 1 mM 0,0975 2,0475 0,429 4,773

5 28 1 mM 0,0885 1,8585 0,519 3,581

5 30 1 mM 0,5255 2,2071 0,35 6,306

6 12 NI 0,0105 0,0441 0,42 0,105

6 16 1 mM 0,4825 2,0265 0,493 4,110

6 20 1 mM 0,136 2,856 0,454 6,290

6 23 1 mM 0,097 2,037 0,586 3,476

6 27 1 mM 0,1245 2,6145 0,552 4,736

6 30 1 mM 0,1175 2,4675 0,521 4,736

TABELA 2 - Resultados de atividade da lactase obtidos nos cultivos para análise de estratégia de alimentação 1 – 6.

MEIOS DE ALIMENTAÇÃO TESTADOS NOS CULTIVO DA LACTASE

CULTIVO MEIOS DE
ALIMENTAÇÃO

7 Glicose + MgSO4 + LB (1x)

8 Glicose + MgSO4 + LB (1x)

9 Glicose + MgSO4

10 Glicose + MgSO4

TABELA 3 - Meios de alimentação testados nos cultivo da lactase.

234 INOVA TALENTOS


10

É importante lembrar que, nos cultivos foram muito semelhantes, a atividade bio-
anteriores, foi utilizado o meio de alimen- lógica da lactase foi bem mais elevada no
tação mais rico em nutrientes (Glicose + Cultivo 1 (meio de alimentação mais rico
MgSO4 + LB 2x), razão pela qual (ver tabela em nutrientes), como pode ser observado
4) foram incluídos os resultados de ativida- na tabela 4. Apesar da maior riqueza de nu-
de e OD do Cultivo 1, com a finalidade de trientes deste meio (Glicose + MgSO4 + LB
comparar os resultados obtidos com os três 2x) não foi observado acúmulo de glicose
diferentes meios de alimentação utilizados. durante a cultura, o que poderia elevar os
Enquanto os resultados de expressão níveis de acetato (tóxico para o cultivo).

RESULTADOS DE ATIVIDADE DA LACTASE OBTIDOS NOS


CULTIVOS PARA ANÁLISE DE MEIO DE ALIMENTAÇÃO 1, 7 – 10.

CULTIVO TEMPO INDUÇÃO OD ATIVIDADE PROTEÍNA ATIVIDADE


(h) 600 nm VOLUMÉTRICA (mg/mL) ESPECÍFICA
(U/mL) (U/mg)

1 12 NI 19,12 1,5708 0,721 2,179

1 16 1 mM 24,65 3,738 0,536 6,974

1 20 1 mM 26,75 6,636 0,6 11,060

1 24 1 mM 32,6 6,2895 0,599 10,500

1 28 1 mM 33,85 7,182 0,476 15,088

1 30 1 mM 41,5 6,3315 0,461 13,734

7 12 NI 12,42 0,0483 1,729 0,028

7 16 1 mM 17,1 6,6675 1,625 4,103

7 21 1 mM 20,15 6,867 1,5 4,578

7 23 1 mM 20,5 8,043 1,596 5,039

7 25 1 mM 19,4 11,6025 2,157 5,379

7 27 1 mM 21,45 6,468 0,807 8,015

7 30 1 mM 21 6,9615 1,759 3,958

TABELA 4 - Resultados de atividade da lactase obtidos nos cultivos para análise de meio de alimentação 1, 7 – 10.

PROGRAMA RHAE TRAINEE CNPq – IEL 235


CULTIVO TEMPO INDUÇÃO OD VOLUMÉTRICA PROTEÍNA ATIVIDADE
(h) 600 nm (U/mL) (mg/mL) ESPECÍFICA
(U/mg)

8 12 NI 16,6 0,8841 1,736 0,509

8 16 1 mM 27,5 5,712 1,534 3,724

8 20 1 mM 30,4 11,235 1,655 6,789

8 22 1 mM 34,3 10,689 1,299 8,229

8 24 1 mM 37,5 10,5735 1,155 9,155

8 26 1 mM 36,05 12,621 1,37 9,212

8 28 1 mM 32,55 6,93 1,534 4,518

8 30 1 mM 30,55 7,9485 1,606 4,949

9 12 NI 22,87 0,1197 1,868 0,064

9 16 1 mM 29,45 5,4705 1,625 3,366

9 21 1 mM 35,3 8,3475 1,253 6,662

9 23 1 mM 31,6 9,7755 1,386 7,053

9 25 1 mM 35,95 4,2105 0,981 4,292

9 27 1 mM 37,6 10,206 1,761 5,796

9 29 1 mM 32 10,2585 1,497 6,853

10 12 NI 21,32 0,063 2,162 0,029

10 16 1 mM 29,85 3,4356 1,589 2,162

10 20 1 mM 31,75 5,481 1,31 4,184

10 22 1 mM 35,45 6,3 1,252 5,032

10 24 1 mM 36,9 6,3735 1,52 4,193

10 26 1 mM 38,9 6,174 1,218 5,069

10 28 1 mM 37,7 5,9745 1,616 3,697

10 30 1 mM 42 5,5965 1,208 4,633

TABELA 4 - Resultados de atividade da lactase obtidos nos cultivos para análise de meio de alimentação 1, 7 – 10. (continuação)

236 INOVA TALENTOS


10

Apesar de utilizarem o meio mais pobre mentação mais adequado para o cultivo da
em nutrientes (Glicose + MgSO4), os Cultivos enzima é a combinação de Glicose + MgSO4
9 e 10, obtiveram valores de OD600 nm altos + LB (2x).
(tabela 4), mas apresentaram um acúmulo de Iniciamos, então, o planejamento experi-
glicose durante o cultivo, além de valores de mental do projeto, que compreende a etapa
atividade específica muito baixos, em compa- de testes com diferentes tempos de indução
ração com os outros cultivos. e concentrações de IPTG. Os experimentos
Assim, determinamos que o meio de ali- foram realizados conforme a tabela 5.

DELINEAMENTO COMPOSTO CENTRAL ROTACIONAL PARA AS VARIÁVEIS


TEMPO DE INDUÇÃO E CONCENTRAÇÃO DO AGENTE INDUTOR (IPTG).

CULTIVO CONCENTRAÇÃO TEMPO DE X1 X2


DE IPTG (mM) INDUÇÃO (h)

11 0,19 10 -1 -1

12 0,86 10 1 -1

13 0,19 22 -1 1

14 0,86 22 1 1

15 0,52 16 0 0

16 0,52 16 0 0

17 0,52 16 0 0

18 0,05 16 -1,41 0

19 0,52 24 0 1,41

20 1 16 1,41 0

21 0,52 8 0 -1,41

TABELA 5 - Delineamento composto central rotacional para as variáveis tempo de indução e concentração do agente indutor (IPTG).

PROGRAMA RHAE TRAINEE CNPq – IEL 237


Os valores de OD obtidos em todos os cultivos para a análise dos dados coletados e encerrar
(11 ao 21) estão na tabela 6. Depois de todos os estudos, determinando a melhor condição
os cultivos previstos no planejamento estraté- de cultivo em biorreator para a produção da
gico terem sido realizados, pudemos avançar enzima lactase, modificada geneticamente.

VALORES DE OD DOS CULTIVOS 11 AO 21

CULTIVO OD 600 nm

11 36,05

12 36,50

13 42,10

14 53,80

15 42,05

16 47,10

17 41,30

18 41,80

19 45,95

20 45,70

21 34,15

TABELA 6 - Valores de OD dos cultivos 11 ao 21.

238 INOVA TALENTOS


10

Na tabela 7, constam os valores da atividade específica e os valores de produtividade do


produto (Pp) em todos os cultivos realizados.

RESULTADOS DE ATIVIDADE DA LACTASE OBTIDOS


NOS CULTIVOS DO PLANEJAMENTO EXPERIMENTAL 11 – 21

CULTIVO TEMPO DE OD 600 nm ATIVIDADE PROTEÍNA ATIVIDADE PRODUTIVIDADE


CULTIVO (média) VOLUMÉTRICA (mg/mL) ESPECÍFICA DE PRODUTO
(h) (U/mL) (U/mg) (Pp)a

11 10 17,05 0,0798 0,701 0,114 0,0044

11 14 25,15 8,4945 0,421 20,177 3,8611

11 18 29,15 30,009 0,454 66,099 1,1542

11 20 31,30 14,532 0,788 18,442 0,5190

11 22 31,65 13,818 0,522 26,471 0,4606

11 24 35,90 14,238 0,741 19,214 0,4449

11 26 34,10 17,724 0,673 26,336 0,5213

11 28 35,25 29,988 1,288 23,283 0,8330

11 30 36,05 14,49 0,459 31,569 0,3813

12 10 15,175 2,5137 0,873 2,879 1,3965

12 14 21,75 6,531 0,797 8,194 0,2969

12 18 26,35 13,965 0,831 16,805 0,5371

12 20 27,30 16,905 0,591 28,604 0,6038

12 22 30,04 17,22 0,76 22,658 0,5740

12 24 26,10 24,339 1,247 19,518 0,7606

12 26 27,15 24,738 1,101 22,469 0,7276

12 28 31,85 16,989 1,13 15,034 0,4719

12 30 36,50 14,511 0,621 23,367 0,3819

TABELA 7 - Resultados de atividade da lactase obtidos nos cultivos do planejamento experimental 11 – 21.

PROGRAMA RHAE TRAINEE CNPq – IEL 239


CULTIVO TEMPO DE OD 600 nm ATIVIDADE PROTEÍNA ATIVIDADE PRODUTIVIDADE
CULTIVO (média) VOLUMÉTRICA (mg/mL) ESPECÍFICA DE PRODUTO
(h) (U/mL) (U/mg) (Pp)a

13 22 37,45 0,0672 0,843 0,080 0,0022

13 24 39,50 1,4301 0,938 1,525 0,4469

13 26 40,55 2,9085 1,036 2,807 0,8554

13 28 40,60 4,9665 0,864 5,748 1,3796

13 30 42,10 2,457 1,129 2,176 0,0647

14 22 34,85 5,4285 1,094 4,962 1,8095

14 24 37,85 5,691 1,398 4,070 0,1778

14 26 39,40 13,8705 1,237 11,213 4,0796

14 28 38 9,5235 1,329 7,166 2,6454

14 30 53,80 7,3815 0,896 8,238 1,9425

15 14 28,35 0.0021 1,1 0,002 0,0001

15 16 26,35 0,5964 1,18 0,505 0,0249

15 18 32,25 2,2281 1,025 2,174 0,8570

15 20 33,75 4,6116 1,67 2,761 1,6470

15 22 30,90 6,93 1,31 5,290 0,2310

15 24 37,45 8,2425 1,472 5,599 2,5758

15 26 36,90 9,009 1,167 7,720 0,2650

15 28 40,30 9,3135 1,319 7,061 2,5871

15 30 42,05 9,7335 1,501 6,485 2,5614

16 14 25,20 0,0042 1,51 0,003 0,0002

16 16 26,90 0 1,55 0 0

16 18 31,40 2,2764 1,774 1,283 0,8755

16 20 35 4,4226 1,83 2,417 1,5795

16 22 29,75 6,741 2,261 2,981 0,2247


TABELA 7 - Continuação

240 INOVA TALENTOS


10

CULTIVO TEMPO DE OD 600 nm ATIVIDADE PROTEÍNA ATIVIDADE PRODUTIVIDADE


CULTIVO (média) VOLUMÉTRICA (mg/mL) ESPECÍFICA DE PRODUTO
(h) (U/mL) (U/mg) (Pp)a

16 24 38 8,127 2,035 3,994 0,2540

16 26 40,90 8,7465 1,533 5,705 2,5725

16 28 44,20 9,1455 2,252 4,061 2,5404

16 30 47,10 10,4895 2,217 4,731 2,7604

17 16 26,60 4,2504 1,388 3,062 1,7710

17 18 29,45 5,838 1,241 4,704 0,2245

17 20 32,95 7,5915 1,172 6,477 2,7113

17 22 33,95 10,2165 1,869 5,466 3,4055

17 24 35,45 11,5395 1,34 8,611 3,6061

17 26 38,35 10,248 1,567 6,540 0,3014

17 28 39,65 10,374 1,075 9,650 0,2882

17 30 41,30 9,177 1,439 6,377 0,2415

18 16 26,90 0 0,95 0 0

18 18 28,50 1,8795 0,854 2,201 0,7229

18 20 34,50 4,431 0,733 6,045 0,1583

18 22 35 5,754 0,847 6,793 0,1918

18 24 36,80 8,3685 0,635 13,179 2,6152

18 26 38,85 9,9015 0,735 13,471 2,9122

18 28 39,30 10,3215 0,735 14,043 2,8671

18 30 41,80 10,983 0,776 14,153 0,2890

19 24 40,30 0,1386 1,909 0,073 0,0043

19 26 41,55 1,4028 1,909 0,763 0,4126

19 28 43,45 2,7426 1,676 1,636 0,7618

19 30 45,95 4,2294 1,377 3,071 1,1130


TABELA 7 - Continuação

PROGRAMA RHAE TRAINEE CNPq – IEL 241


CULTIVO TEMPO OD 600 nm ATIVIDADE PROTEÍNA ATIVIDADE PRODUTIVIDADE
DE CULTIVO (média) VOLUMÉTRICA (mg/mL) ESPECÍFICA DE PRODUTO
(h) (U/mL) (U/mg) (Pp)a

20 16 26,30 0,0714 1,534 0,046 0,0030

20 18 30,65 2,5851 1,527 1,693 0,9943

20 20 37 5,2332 1,268 4,127 1,8690

20 22 36,15 7,203 1,484 4,854 0,2401

20 24 38,85 8,526 1,409 6,051 0,2664

20 26 40,85 9,366 1,402 6,680 0,2755

20 28 43,75 9,954 1,584 6,284 0,2765

20 30 45,70 11,214 1,316 8,521 0,2951

21 8 11,48 0,3192 1,565 0,204 0,0200

21 10 15,47 6,216 1,565 3,972 0,3453

21 12 16,32 12,852 1,715 7,494 0,6426

21 14 15,32 14,133 1,555 9,089 0,6424

21 16 19,17 10,7457 1,527 7,037 4,4774

21 18 21,20 12,642 1,301 9,717 0,4862

21 20 23,97 12,579 1,238 10,161 0,4493

21 22 24,72 12,453 1,498 8,313 0,4154

21 24 26,40 10,458 1,309 7,989 0,3268

21 26 29,97 12,243 1,187 10,314 0,3601

21 28 34,15 10,311 1,195 8,628 0,2864

21 30 33,95 12,159 1,425 8,533 0,3200

TABELA 7 - Continuação

a
Para o cálculo da Pp considerou-se um ―tempo morto‖ (tm) de 8 horas, equivalente ao
período de lavagem, calibração, esterilização e montagem dos biorreatores.

242 INOVA TALENTOS


10

A análise estatística (Desirability‖) dos ção nos quais a produtividade de produto


dados obtidos para o parâmetro de pro- foi mais elevada. Os valores resultantes fo-
dutividade da enzima-alvo (produto) nos ram de 0,1 mM para concentração de IPTG
mostrou um valor ótimo aproximado de e de 12h de cultivo para o tempo de indução
concentração de IPTG e um tempo de indu- (figuras 2 e 3).

RESULTADOS DAS ATIVIDADES DA LACTASE OBTIDOS NOS DOIS CULTIVOS (22 E 23)
REALIZADOS COM CONCENTRAÇÃO DE IPTG DE 0,1 mM E TEMPO DE INDUÇÃO
DE 12H APÓS O INÍCIO DO CULTIVO.

CULTIVO TEMPOTEMPO DE OD 600 nm ATIVIDADE ATIVIDADE


CULTIVO (média) VOLUMÉTRICA ESPECÍFICA
(h) (U/mL) (U/mg)

22 30 44,90 10,33 10,64

23 30 48,40 7,41 9,38

TABELA 8 - Resultados das atividades da lactase obtidos nos dois cultivos (22 e 23)
realizados com concentração de IPTG de 0,1 mM e tempo de indução de 12h após o início do cultivo.

Foram realizados mais dois cultivos para de ruminante doméstico, parte importante
confirmação dos parâmetros adotados para da nutrição humana, contém 5% de lactose
produção da lactase, o que pode ser observa- (14). A lactose é a fonte de energia mais im-
do na tabela 8, que apresenta os elevados va- portante durante o primeiro ano de vida hu-
lores de atividades para a duplicata realizada, mana, fornecendo quase metade da energia
confirmando nossos resultados . total requerida pelos lactentes (15).
A deficiência de lactase representa a
principal causa de má absorção de lactose.
DISCUSSÃO Concentrações elevadas de lactase estão
normalmente presentes em recém-nasci-
A lactose é o principal carboidrato do leite dos, mas, após o desmame, sua atividade
de mamíferos, incluindo animais criados em diminui na maioria das pessoas de forma
fazendas que produzem leite. Enquanto o genética, conduzindo para a chamada má
leite humano contém 7% de lactose, o leite absorção primária da lactose.

PROGRAMA RHAE TRAINEE CNPq – IEL 243


A hipolactasia secundária, por sua vez, alguma patente relacionada ao tema deste pro-
pode ser resultante de qualquer dano à borda jeto. Para tanto, foi consultado o Escritório de
da escova da mucosa do intestino delgado Transferência de Tecnologia (ETT), da pró-rei-
(a lactase é produzida por vilosidades in- toria de Pesquisa, Inovação e Desenvolvimen-
testinais) ou aumento do tempo de trânsito to, da PUC-RS. Não foram encontradas paten-
gastrointestinal (16). A intolerância à lactose tes com o mesmo propósito deste projeto.
é definida quando a má absorção de lactose Considerando que a empresa Quatro G,
provoca sintomas gastrointestinais (17). até recentemente, estava voltada para o de-
Com o aumento dos casos de indivíduos senvolvimento de insumos para laboratórios
intolerantes, a demanda por leite e seus deri- da área de biotecnologia e para linhas de
vados sem lactose tem crescido. O consumo pesquisa envolvendo biofármacos, este pro-
de leite sem lactose cresceu 47% em 2016, jeto é considerado inovador para a empresa,
segundo dados do Sindicato da Indústria de pois marca o início de uma nova frente de
Laticínios do Rio Grande do Sul (Sindilat-RS). pesquisa na área de insumos para a indústria
Como o leite é uma fonte primária de cál- alimentícia – neste caso, a lactase genetica-
cio e vitamina D, os indivíduos intolerantes à mente modificada.
lactose geralmente obtêm quantidades insu- Para a produção da enzima nacional,
ficientes desses nutrientes, o que pode levar combinamos métodos como o cultivo de
a resultados adversos para a saúde. A produ- bactérias em alta densidade e técnicas de
ção de leite sem lactose pode fornecer uma planejamento experimental e assim conse-
solução para esse problema (18). guimos chegar à melhor condição para ob-
No Brasil, grande parte das enzimas uti- termos alta produtividade da enzima, com o
lizadas na indústria de alimentos é importa- menor número de experimentos necessários.
da – inclusive a lactase. A produção nacional Para tanto, levamos em consideração
de enzimas com alto grau de eficiência leva à dois parâmetros altamente influenciáveis no
maior competitividade do mercado e menor resultado final na produção das enzimas de
dependência de importação. O amplo conhe- interesse utilizando bactérias: o momento de
cimento e competência dos pesquisadores e induzir sua produção pela bactéria e a con-
das instituições de ensino, assim como das centração do agente indutor.
indústrias biotecnológicas, levam ao estabe- Com isso, obtivemos as condições ótimas
lecimento de parcerias de sucesso, gerando de cultivo para produção da lactase em bior-
inovação e produção de diversos bioprodu- reator, que foram: cepa de E. coli BL21(DE3),
tos economicamente viáveis e com qualidade meio de cultivo LB, temperatura de 30º C, pH
competitiva com os produtos importados. 7,0, meio de alimentação Glicose + MgSO4 +
Para reforçar o potencial inovador desta LB (2x), estratégia de alimentação DO-STAT,
pesquisa, procurou-se verificar a existência de indução com 0,1 mM IPTG após 12h de culti-

244 INOVA TALENTOS


10

vo. O projeto, cuja etapa de modelagem em setor de transferência de tecnologia.


biorreator foi contemplada neste estudo, con- É imprescindível destacar a importância
tinua em andamento na empresa Quatro G da combinação entre o conhecimento técni-
e ainda prevê as etapas de purificação e imo- co do bolsista e da equipe da empresa Qua-
bilização. Essa última irá possibilitar a reutili- tro G, somada à a experiência em inovação
zação, diminuindo custos e facilitando a pos- e gestão de projetos do Instituto Euvaldo
terior separação entre a enzima do produto. Lodi, o que só foi possível por meio do Pro-
grama Inova Talentos.
O programa foi capaz de selecionar um
CONSIDERAÇÕES FINAIS bolsista para desenvolver suas competên-
cias e habilidades, a fim de resolver o desafio
O propósito deste estudo foi melhorar as proposto pela empresa e assim suprir uma
condições de produção da lactase, utilizan- necessidade importante para o aperfeiçoa-
do tecnologias inovadoras que auxiliem no mento do processo de produção da enzima
desenvolvimento de processos que permi- em questão.
tam a obtenção de um produto nacional. Fo- Além disso, o programa também fomen-
ram estudadas algumas variáveis do proces- tou o desenvolvimento pessoal e profissio-
so, utilizando o planejamento experimental nal do bolsista nas áreas de competência
como ferramenta. emocional, liderança, gestão de carreira,
Com esses estudos, conseguimos dimi- empreendedorismo, criatividade e inovação,
nuir 10 vezes a quantidade do agente indutor gestão financeira, negociação e gestão de
utilizado e determinar o momento adequado projetos e seu tutor em criatividade e ino-
para indução da expressão da lactase, obten- vação e coaching, além de estimular o pen-
do assim um aumento na atividade biológica samento inovador do profissional e, conse-
e na produtividade da enzima, produzida por quentemente, da empresa.
um organismo geneticamente modificado. Por tudo aqui exposto, torna-se evidente
As técnicas desenvolvidas e aprofunda- que o sucesso deste estudo está diretamen-
das neste projeto servirão de base para a pro- te relacionado à parceria proporcionada
dução de outras proteínas de interesse para pelo Inova Talentos.
a indústria nacional. Com a abertura dessa O estudo aqui apresentado complemen-
nova linha de pesquisa e desenvolvimento, ta a etapa de modelagem em biorreator

”Produção da enzima β-galactosidase


a empresa Quatro G atinge uma meta já es- de um projeto maior de pesquisa, intitula-
tabelecida em seu planejamento estratégico, do
que diz respeito à ampliação de mercado e recombinante na forma livre e imobilizada,
ao aumento do seu portfólio de produtos, visando sua aplicação industrial”.
além de fortalecer ainda mais sua marca no O projeto financiado pelo CNPq (Cha-

PROGRAMA RHAE TRAINEE CNPq – IEL 245


mada 94/2013 MEC/SETEC/CNPq - Apoio a Instituto Federal de Educação do Rio Grande
Projetos Cooperativos de Pesquisa Aplicada do Sul (IFRS), a empresa Quadro G Pesquisa

da β-galactosidase recombinante e imobiliza-


e de Extensão Tecnológica), visa à produção & Desenvolvimento Ltda (Quatro G), o Cen-
tro Universitário Univates e o Centro de Pes-
da, sob a coordenação da prof. Dra. Giandra quisa em Biologia Molecular e Funcional da
Volpato, tem como instituições envolvidas o PUCRS (CPBMF).

ANSARI, S. A.; SATAR, R. Recombinant β-galacto-

REFERÊNCIAS sidases – Past, present and future: A mini review. J.


Mol. Cat. B: Enzymatic. v. 81: 1-6 (2012).
BIBLIOGRÁFICAS
LEE, SY. High cell-density culture of Escherichia coli.
Trends in Biotechnology. 3, 98-105 (1996).
BELEM, MAF; LEE, BH. Production of bioingredients
from Kluyveromyces marxianus grown on whey: an HARCUM, SW; BENTLEY, WE. Response dynamics
alternative. Crit. Rev. Food Sci. Nutr. v. 38: 598–656 of 26-, 34-, 39-, 54-, and 80- kDA proteases in induced
(1998). cultures of recombinant Escherichia coli. Biotechnolo-
gy and Bioengineering. 42, 675-685 (1993).
MATTAR, R; MAZO, DFC. Intolerância à lactose: mu-
dança de paradigmas com a biologia molecular. Rev. NETO, BB; SCARMINIO, IS; BRUNS, RE. Planeja-
mento e Otimização de Experimentos. Campinas:
Assoc. Med. Bras. v. 56(2): 230-6 (2010).
Editora da Unicamp, 1996.
HUSAIN, Q. Beta galactosidases and their potential
RODRIGUES, MI; IEMMA, AF. Planejamento de
applications: a review. Crit. Rev. Biotechnol. v. 30:
Experimentos e Otimização de Processos: Uma
41–62 (2010).
Estratégia Seqüencial de Planejamentos. Campinas:
Casa do Pão Editora, 2005.

da β-galactosidase para prevenção da cristalização


KLEIN, MP; JONG, EV; RÉVILLION, JPP. Utilização

BRADFORD MM. A rapid and sensitive method for


em doce de leite. Ciênc. Agrotec. v. 34 (6): 1530- 1535 the quantitation of microgram quantities of protein
(2010). utilizing the principle of protein-dye binding. Analyti-

VASILEVVA et al. Immobilization of β-galactosidase


cal Biochemistry 7: 248-254 (1976).

on modified polypropilene membranes. Int. J. Biol. RECH, R, CASSINI, CF, SECCHI, A, AYUB, MAZ,

production of β-galactosidase by Kluyveromyces


Mac. v. 51: 710-719 (2012). Utilization of protein hydrolyzed cheese-whey for

Companhia Nacional de Abastecimento (CONAB). marxianus. J. Ind. Microbiol. and Biotech. 23, 91-96.
Conjuntura Mensal Leite e Derivados. Abril 2016. (1999).

246 INOVA TALENTOS


10

A Comparison of Various Milks; La Cité du Lait—


Lactopôle. Available online: http://www.lactopole.
com/museum/milk/ (acessado em 24 julho 2017).

VESA, T.H, MARTEAU, P, KORPELA, R. Lac-


tose intolerance. J. Am. Coll. Nutr. 19: (Suppl.
2),165S–175S. (2000).

IANIRO, G, PECERE, S, GIORGIO, V, GASBARRINI,


A, CAMARROTA, G. Digestive Enzyme Supplemen-
tation in Gastrointestinal Diseases. Current Drug
Metabolism, 17: 187-193. (2016).

MONTALTO et al. Effect of exogenous B-galacto-


sidase in patients with lactose malabsorption and
intolerance: a crossover double-blind placebocontrol-
ledstudy. Eur. J. Clin. Nutr. 59: 489-493. (2005).

with a recombinant thermostable β-glucosidase


LI et al. Preparation of lactose-free pasteurized milk

from Pyrococcus furiosus. BMC Biotechnology. 13:73.


(2013).

PROGRAMA RHAE TRAINEE CNPq – IEL 247


11
DESENVOLVIMENTO DE UMA
CULTURA DE INOVAÇÃO
NO SISTEMA FIERGS
DA NIE L CA NE LLO PIR E S
_
Graduação Tecnológica em Gestão Ambiental
(UNISINOS, 2009)
_
Mestrado em Engenharia Civil
(UNISINOS, 2011)

Possui Graduação Tecnológica em Gestão Ambiental


(UNISINOS, 2009), Mestrado em Engenharia Civil, com
foco em Gerenciamento de Resíduos (UNISINOS, 2011)
e capacitação nas Metodologias Arquitetura de Inovação
(IEL/RS, 2014) e FORTH (IEL/RS, 2015). Participou de
projetos de iniciação científica em programas de ideias
e inovação incremental em empresas e atua há 4 anos no
desenvolvimento e aplicação de metodologias de inovação
e criatividade em cursos, palestras, workshops e consultorias
em empresas do Rio Grande do Sul pelo IEL/RS.

249
R E SU M O

cultura de inovação; diagnóstico; ferramentas de inovação;


PALAVRAS CHAVE colaboração, comunicação; disseminação.

A inovação pode definida como o resultado de atividades empresariais voltadas para o

desenvolvimento de novos produtos, processos ou serviços, conceito que há muito se

tornou um mainstream na teoria econômica e nos estudos organizacionais. A importância

da inovação é reconhecida mundialmente não só como um meio para o desenvolvimento

e o progresso tecnológico – não somente empresarial – mas também como vetor indis-

pensável para o crescimento econômico e competitividade de uma nação. Nesse sentido,

o Projeto Cultura de Inovação buscou um modelo ideal aplicado à realidade do Sistema

FIERGS, que permitisse intervenções nos hábitos dos colaboradores através de mudança

de hábitos, quebra de paradigmas, experimentação de processos de inovação e capaci-

tação de pessoas que compõem a instituição. Um diagnóstico foi realizado e permitiu

emergir um modelo adequado à realidade da instituição, apontando objetivos, estratégias

e tecnologias de comunicação para cada público envolvido, promovendo capacitações

direcionadas à disseminação de novos rituais, símbolos e mitos, que por vezes impediam

um melhor desenvolvimento para o mercado a que a organização atende.

250 INOVA TALENTOS


11

A BSTR ACT

KEYWORDS innovation culture; diagnosis; innovation tools;


collaboration, communication; dissemination.

Innovation can be defined as a result of business activities in the development of new

products, processes or services, a concept that has become a mainstream in economic

theory and organizational studies. The importance of innovation is recognized worldwide

as a device for the development and technological progress, not only business but also the

economic growth and competitiveness of a nation. In this sense, the Culture of Innovation

Project sought an ideal model applied to the reality of the FIERGS System, which

allowed interventions in the habits of the employees through change of habits, paradigm

breaks, experimentation of innovation processes and training of people that compose the

institution. A diagnosis was made and allowed to emerge a model adapted to the reality

of the institution, pointing out communication objectives, strategies and technologies for

each public involved, promoting trainings directed to the dissemination of new rituals,

symbols and myths that sometimes prevented a better development for the market that

the organization meets.

PROGRAMA RHAE TRAINEE CNPq – IEL 251


para fora, através de capacitação, experimen-
INTRODUÇÃO tação e comunicação.
A inovação pode ser definida como o re-
Com 115 sindicatos filiados, congregando 47 sultado de atividades empresariais no desen-
mil fábricas responsáveis pela geração de volvimento de novos produtos, processos ou
mais de 680 mil empregos diretos, a FIERGS serviços, conceito que há muito se tornou
e o CIERGS atuam buscando um ambiente um mainstream na teoria econômica e nos
favorável ao desenvolvimento da indústria. estudos organizacionais. A importância da
Em 2007, foi criado o Conselho de Inovação inovação é reconhecida mundialmente não
e Tecnologia (CITEC), que atua na promoção só como um meio para o desenvolvimento e
da competitividade da indústria através da progresso tecnológico – não somente empre-
inovação, estimulando a cooperação univer- sarial – mas também como um instrumento
sidade/empresa/poder público para se obte- necessário para promover o crescimento eco-
rem avanços nesse sentido. nômico e a competitividade de uma nação.
Em 2008, a CNI lança o programa Mo- Partindo desse pressuposto, percebe-
bilização Empresarial pela Inovação (MEI), -se uma profunda deficiência nacional em
que, através do CIERGS, SESI, SENAI e IEL, termos de inovação no Brasil nos últimos
consolidou o Núcleo de Inovação RS para anos. Em 2016, o Brasil ocupava o 69º lugar
atuar, entre outros objetivos, em um projeto no ranking mundial de inovação, a mesma
de Cultura de Inovação no Sistema FIERGS. posição ocupada no ranking de 2017. Entre
O presente artigo descreve os resultados as economias da América Latina e Caribe, o
parciais da implementação desse projeto, ao Brasil aparece em sétimo lugar, atrás de Chile
longo de 2015 e 2016. (46º), Costa Rica (53º), México (58º), Panamá
O Sistema FIERGS é composto por qua- (63º), Colômbia (65º) e Uruguai (67º) (CNI,
tro entidades: CIERGS, SESI, SENAI e IEL. A 2017). (CNI, 2017).
Federação é uma entidade sem fins lucrati- Ainda que diversas iniciativas venham
vos, que atua no desenvolvimento empresa- tentando fazer com que o mercado volte suas
rial no estado do Rio Grande do Sul, além de atenções para o assunto, várias organizações
prestar serviços vinculados à aprendizagem ainda apresentam enormes dificuldades em
da indústria e à saúde do trabalhador. estabelecer uma cultura de inovação, o que
O projeto Cultura de Inovação foi desen- reflete diretamente nos hábitos, costumes e
volvido com o propósito de promover um formas de se trabalhar e resolver desafios.
movimento de transformação: de uma Fede- Nesse contexto, o projeto Cultura de Ino-
ração reativa às demandas da indústria para vação foi desenvolvido justamente para traba-
uma Federação proponente à indústria, por lhar os rituais, símbolos e mitos do Sistema
meio de uma mudança cultural de dentro FIERGS, para que fosse possível promover

252 INOVA TALENTOS


11

uma mudança nos padrões de comporta- cas maduras de inovação internas, gerando
mentos internos e assim, consequentemen- um paradoxo de coerência da proposta de
te, melhorar os serviços prestados para a valor do próprio Sistema Indústria.
indústria do estado do Rio Grande do Sul.
Foram considerados alguns valores que
emergiram dessa experiência e que serão OBJETIVOS
trabalhados ao longo da continuidade do
programa, como responsabilidade e autono- Este artigo objetiva descrever a experiência
mia, compromisso com resultado, humani- do Sistema FIERGS na implementação de
zação das relações, integração das “casas” um projeto de Cultura de Inovação. O pro-
(entidades), qualidade de vida no trabalho e jeto buscou promover um movimento de
alinhamento de propósitos. transformação de uma organização reativa
Nesse sentido, o Instituto Euvaldo Lodi às demandas da indústria para uma Fede-
do Rio Grande do Sul – IEL/RS – estruturou ração proponente à indústria, por meio de
e coordenou a aplicação de uma metodolo- uma mudança cultural de dentro para fora.
gia para a disseminação da Cultura de Ino- Compreende-se que a forma de pensar e
vação no Sistema FIERGS, com o apoio da agir dos colaboradores pode ser transforma-
consultoria Symnetics. da através da inserção inicial de novos há-
Um dos princípios de inovação trabalha- bitos e ferramentas, que apoiem a estrutu-
do pelo IEL/RS consiste em enraizar uma ração de processos de inovação, até chegar
cultura de inovação dentro de uma organi- a perspectivas sobre o próprio significado e
zação envolvendo todos os colaboradores, propósito do trabalho de cada um na cons-
estimulados a pensar em inovação em todas trução de uma organização que traga maior
as fases de desenvolvimento de produtos e impacto na mudança de modelo mental da
serviços realizados – o que vem a ser o mote indústria, que passará por grandes mudan-
deste projeto. ças nos próximos anos.
Dessa forma, buscar formas efetivas de
disseminação de novos hábitos e práticas
se torna fundamental para redirecionar uma MÉTODO
cultura para a inovação, compreendendo as
características específicas, que poderão ser A cultura organizacional é composta por
trabalhadas com o intuito de atingir este ob- práticas – que chamamos de rituais – que in-
jetivo. Faz parte da problemática o fato de se cluem os processos organizacionais, os pro-
oferecerem internamente serviços de gestão cedimentos e as políticas internas e externas.
da inovação e desenvolvimento tecnológico, Também é composta por símbolos – como a
sem a contrapartida da existência de práti- arquitetura e a ambiência da organização – e

PROGRAMA RHAE TRAINEE CNPq – IEL 253


por mitos, que traduzem o modo de pensar Projeto, visando preparar os dirigentes para
e agir da organização, influenciando todos os exercer um papel de liderança no movimento
indivíduos que se relacionam direta ou indi- cultural focado em inovação.
retamente com a organização. Uma cultura
também pode ser explicada quando observa-
DIAGNÓSTICO
mos o indivíduo. Ele é influenciado e influen-
Um diagnóstico da cultura atual da organi-
cia através de seus relacionamentos, a partir
zação foi realizado, com o objetivo de avaliar
de seus próprios mitos, rituais e símbolos
qualitativamente a alta liderança e quantitati-
(SYMNETICS, 2015).
vamente os funcionários do Sistema FIERGS.
A Cultura Atual do Sistema FIERGS per-
A metodologia utilizada foi a de entrevistas
passa os indivíduos e sua equipe de traba-
dirigidas à alta liderança e um survey quanti-
lho, as equipes de outros setores, o Sistema
tativo, enviado para todos os colaboradores
“S” em si, que contém essa cultura, e por fim
do Sistema FIERGS (844 respondentes).
também reflete e influencia a indústria do Rio
Grande do Sul. Levando em conta os mitos,
rituais e símbolos da atual cultura do Siste-
MODELO DE DESENVOLVIMENTO
ma FIERGS, o Projeto Cultura de Inovação,
Com base nas conclusões do diagnóstico, foi
através de encontros de capacitação e co-
desenvolvido um modelo cultural para im-
municação, promoveu intervenções na atual
plantação no Sistema FIERGS.
cultura para reforçar aspectos da inovação
como criatividade, flexibilidade, interdisci-
plinaridade e experimentação, influenciando CERTIFICAÇÃO
assim uma cultura emergente. Capacitação, reconhecimento e certificação
Para a avaliação do ambiente então pre- dos colaboradores participantes em novas
dominante e a proposição de soluções, o formas de pensar e agir.
Projeto se baseou em quatro pilares princi-
pais: modo de pensar e agir para inovação,
DIFUSÃO DA CULTURA NA INDÚSTRIA
processos e atores, ambiência e resultados.
Transmissão de uma cultura reforçada por
Dessa forma, o Projeto foi dividido em
conceitos de inovação para a indústria, bus-
cinco fases:
cando resultados a partir de uma nova forma
de pensar e agir.
SENSIBILIZAÇÃO Definido o sequenciamento, optou-se
Momento em que ocorreram encontros com pela utilização do método POST (LI; BERNO-
a Alta Liderança do Sistema, com pautas es- FF, 2011) para avaliação da forma de abor-
tratégicas relacionadas aos quatro pilares do dagem mais adequada para cada público,

254 INOVA TALENTOS


11

considerando o uso adequado das mídias integrante do Sistema FIERGS.


sociais disponíveis para o engajamento e Por sua vez, a pesquisa quantitativa com
disseminação de uma cultura de inovação todos os colaboradores foi aplicada através
entre os colaboradores do Sistema FIERGS. de um questionário de autopreenchimento
De forma mais objetiva, o presente ar- on-line, sendo respondida por 844 pessoas
tigo busca relatar as atividades realizadas (25% dos colaboradores). A pesquisa consi-
neste projeto sistêmico até agosto de 2016 derou questões relativas ao modo de pensar
(aplicação do Modelo de Desenvolvimento) e agir para a inovação, processos e atores,
e os resultados parciais atingidos, além de ambiência e resultados.
avaliar o potencial de continuidade de resul- Dos respondentes, aproximadamente 75%
tados já alcançados pelo Projeto Cultura de foram representantes do SESI e SENAI, e a
Inovação. amostra permitiu avaliar que 50% dos colabo-
A aplicação da metodologia de trabalho radores do Sistema FIERGS possuem menos
foi apoiada pela consultoria Symnetics, que de quatro anos de “casa”. O público é predo-
orientou estratégica e metodologicamente minantemente feminino (58%) e demonstra a
as atividades desempenhadas ao longo da convivência das gerações “X”, “Y” e “Z”, sen-
execução do projeto. do a geração X a mais representativa.
O nível de escolaridade se mostrou bas-
tante alto, com aproximadamente 75% dos
colaboradores com minimamente um curso
RESULTADOS superior completo, somando pós-graduados
(31%), mestres e doutores (3%).
A busca dos resultados de um projeto sistê- Há uma grande variedade em temas de
mico de cultura de inovação em um ambiente interesse, com destaque para Educação,
tradicional da indústria iniciou-se através de Atualidades, Indústria e Tecnologia, haven-
um entendimento sobre a situação presente do troca de informações intensa entre os
naquele momento, mediante um diagnóstico pares. O valor “Tradição” foi o mais citado
diagnóstico, capaz de permitir a construção pelos respondentes.
de um Modelo de Cultura de Inovação mais Em relação à percepção do significado de
adequado à realidade da organização. inovação, a amostra pode ser representada
A pesquisa qualitativa com a alta lideran- por três perfis dominantes, sendo: um con-
ça foi aplicada pela equipe da consultoria, junto de achados de diversas fontes, traduzi-
buscando orientar estrategicamente o dire- dos nas necessidades da organização; uma
cionamento do trabalho, bem como colher forma de experimentação através da prototi-
percepções do propósito de cada entidade pação; uma solução a necessidades latentes,

PROGRAMA RHAE TRAINEE CNPq – IEL 255


gerada através de um líder, que cria as condi- nado de informações. Das principais fontes
ções necessárias para que a inovação parta de informação, destacam-se a comunica-
da organização. ção entre os próprios colegas e o envio de
Já a visão de mundo dos colaboradores e-mails, sendo pouco citada a fonte “Meu
foi expressa, em sua maioria, por um mode- chefe”, apesar de mais de 70% dos colabo-
lo complexo, no qual se lida com incertezas, radores se considerarem bem informados
contradições e emergências. sobre as atividades que ocorrem na entidade.
Os respondentes mostraram formas de A comunicação informal, embora seja vista
agir diferentes, dependendo de cada contex- em grande parte como “boato”– alguns con-
to sugerido. Em uma situação relativamente siderados verdadeiros; outros considerados
simples, busca-se atender a expectativas; em falsos – ainda é uma das maiores fontes de
uma situação complicada, busca-se contatar informação, apesar de nem sempre possuir
especialistas; em um ambiente complexo, credibilidade. Mais de 70% consideram a co-
busca-se conceber uma solução; e, em um municação nas equipes como boa ou ótima.
ambiente caótico, busca-se agir. Observou-se que mais de 40% relatam
Em relação ao desempenho em processos não haver uma periodicidade definida para a
de aprendizagem, houve destaque para ca- comunicação de projetos ou temas estratégi-
pacidades como Entender, Avaliar, Sintetizar, cos, afora o fato de mais da metade das co-
Aplicar, Analisar e Lembrar, sendo a capacida- municações envolver apenas colegas ou su-
de de sintetização extremamente importante perior do setor ou entidade na resolução de
para a inovação, pois permite que se construa problemas, com destaque para 1% na coope-
uma nova estrutura de solução com elemen- ração entre as entidades do Sistema FIERGS.
tos diversos, utilizando conceitos básicos Em relação ao estímulo à inovação, a
para encontrar novas teorias ou padrões. amostra apresentou mais de 60% dos res-
Percebeu-se que a grande maioria orgulha- pondentes se considerando muito estimula-
-se de trabalhar no Sistema FIERGS e mais da dos ou estimulados para o assunto e mais de
metade entende que o ambiente é propício à 90% demonstrando muito ou algum interes-
colaboração, participação, criatividade, inova- se em inovação.
ção, tentativa e erro, embora ainda se perceba No que se refere às ferramentas para
bastante resistência em relação ao aproveita- apoiar a inovação, observaram-se altos índi-
mento total do potencial intelectual. ces de desconhecimento de ferramentas e mé-
Enquanto mais da metade entende que a todos como Lean, Canvas, Cocriação, Cenários,
comunicação formal é boa, aproximadamen- Triz, Stage Gate e Métodos de design. Ainda que
te 20% a entendem como ruim ou péssima, se tenha grande interesse pelo tema Inovação,
associada à falta de transparência e clareza, há pouco conhecimento metodológico.
precariedade nos processos e fluxo desorde- Com os resultados apresentados, com-

256 INOVA TALENTOS


11

preendeu-se que o Sistema FIERGS possui mitos e o estímulo à comunicação em múl-


uma população com alto nível de escolarida- tiplas vias.
de e um perfil para lidar com contextos com- Para isso, torna-se necessária uma ativa-
plexos e sistêmicos, com resultados mar- ção das redes formais e informais de comu-
cantes em aprendizagens e troca de saberes nicação e relacionamento, acesso aos méto-
em torno dos temas do cotidiano. dos e princípios de inovação.
Ainda que o perfil para lidar com contex- O método POST foi utilizado como guia
tos complexos e sistêmicos privilegie a aná- para ajudar a determinar a estratégia correta
lise e o planejamento, relata-se a dificulda- para o público certo em uma mudança social.
de em partir para a ação, restringindo-se ao Á partir do método POST, definiu-se o
momento de reflexão. Isso cria um ambiente desenho da estratégia de disseminação de
de alto nível de análise e baixo nível de ação, conteúdo para os colaboradores (Público),
que deve ser aprimorado para atuar em pro- representada pela curva de engajamento so-
cessos de inovação. cial (hype cycle).
Os colaboradores sentem que todo o seu
potencial não está sendo explorado, além de
entenderem possuir pouco espaço para a ex- MÉTODO POST
perimentação de novas soluções. Possuem
Quais públicos estamos acionando
um alto interesse no assunto inovação, mas P através do Projeto e qual será a dinâmica
de envolvimento desses públicos?
um baixo conhecimento sobre métodos, fer-
ramentas e até mesmo no que tange a proje- Quais os objetivos de
O
envolvimento com cada público?
tos inovadores que ocorrem no Sistema.
Qual o conteúdo estratégico a ser
A tradição é a característica mais percebida S
desenvolvido com cada público?
e o orgulho pela organização é extremamen-
Quais tecnologias de
T
te relevante, além de a comunicação informal envolvimento serão utilizadas? PERDAS POR CONDUÇÃO (P.U.)

ser mais presente e possuir maior relevância


TABELA 1 - Método POST.
prática do que a comunicação formal.
Nesse sentido, um Modelo de Desen- Estudos indicam (FENN; RASKINO,
volvimento foi formulado para disseminar 2008) e (BURTON; WALKER, 2015) que, ao
a Cultura de Inovação, considerando fatores se iniciar uma mudança social, é necessário
importantes como o descondicionamento atingir um percentual de sua população, pre-
do olhar sobre os problemas e desafios, o parando-a para dar início ao processo de mu-
que leva a buscar as mesmas fórmulas de dança. De todos os funcionários do Sistema
solução, a cognição e o estímulo à troca de FIERGS, 5% foram preparados para serem
saberes e paixões entre os colaboradores, agentes de mudança (multiplicadores) e ear-
uma ressignificação de símbolos, rituais e ly adopters (colaboradores), totalizando apro-

PROGRAMA RHAE TRAINEE CNPq – IEL 257


ximadamente 254 pessoas. Esses 5% foram veis pela replicação do método para os de-
desafiados a engajar os outros 95% da po- mais 228 early adopters (colaboradores).
pulação, introduzindo aspectos de inovação Os agentes de mudança e os early adopters,
na cultura do Sistema FIERGS. A consultoria através da inspiração motivação, suporte e
apoiou-se na capacitação de 26 agentes de engajamento, foram desafiados a envolver a
mudança (multiplicadores) – representando população do Sistema FIERGS (engajamento
todas as entidades do Sistema – responsá- e mudança) para a inovação.

CICLO DE ENGAJAMENTO

EARLY
ADOPTERS

HYPE SOCIAL
CYCLE ENGAGEMENT

16%
FIGURA 1 - Relação de entre perdas e área ocupada na PCB.
Fonte: Symnetics, 2015.

O Objetivo principal foi a experimen- CAPACITAR


tação e vivência do Processo de Inovação Ocorreu a capacitação com early adopters,
(Explorar, Conceber e Experimentar) por to- agentes de mudança e alta direção do Siste-
dos os públicos envolvidos (Alta Liderança, ma FIERGS, com o objetivo de sensibilizar e
Agentes de mudança, Early adopters, Enga- formar para a Inovação, dividindo ferramen-
jamento e mudança). Para cada um desses tas, métodos e informações sobre tendências
públicos, houve diferentes objetivos: e inovação.

258 INOVA TALENTOS


11

INTERVIR
COMUNICAR
Através da intervenção, com ações posi-
Todos os públicos foram envolvidos neste ob-
tivas de alto impacto na cultura do Sis-
jetivo, mas com diferentes ênfases. Para a po-
tema, foi possível “aprender fazendo” e
pulação do Sistema, foi importante informar e
vivenciar a prática de ferramentas e méto-
reconhecer ações de impacto positivo do Pro-
dos de inovação.
jeto. Com os early adopters, foi trabalhado o
No que diz respeito à estratégia (Stra-
engajamento através da comunicação, levan-
tegy), houve diferentes conteúdos e estí-
do informações que embasavam a mudança.
mulos trabalhados com cada público, as-
Com os agentes de mudança, foi utilizada a
pectos que incentivaram e promoveram a
comunicação direcionada à celebração, enfa-
inovação, de maneira geral.
tizando os benefícios imediatos do Projeto.

CONTEÚDOS E ESTÍMULOS POR GRUPO TRABALHADO

ԎԎ Descondicionamento do olhar
ALTA LIDERANÇA ԎԎ Estímulo à comunicação de múltiplas vias
ԎԎ Cognição
ԎԎ Tendências
ԎԎ Estímulo à troca de saberes e paixões ԎԎ Construção da Visão de Futuro
ԎԎ Acesso a princípios de inovação

ԎԎ Descondicionamento do olhar
AGENTES DE MUDANÇA ԎԎ Estímulo à comunicação de múltiplas vias
GESTORES E MULTIPLICADORES ԎԎ Cognição
ԎԎ Ressignificação de símbolos, rituais e mitos
ԎԎ Estímulo à troca de saberes e paixões ԎԎ Ativação da rede (formal e informal)
ԎԎ Acesso a princípios de inovação

EARLY ADOPTERS ԎԎ Descondicionamento do olhar ԎԎ Acesso a princípios de inovação


COLABORADORES CAPACITADOS
ԎԎ Cognição
ԎԎ Estímulo à comunicação de múltiplas vias
ԎԎ Estímulo à troca de saberes e paixões

ENGAJAMENTO E MUDANÇA ԎԎ Estímulo à troca de saberes e paixões


POPULAÇÃO DO SISTEMA

TABELA 2 - Conteúdos e estímulos por grupo trabalhado

Também foram apresentados exemplos sendo traduzidas à realidade do Sistema FIER-


de ideias e conceitos de Tecnologias de re- GS, com foco na ferramenta interna de comu-
lacionamento para engajar as pessoas. Al- nicação IBM Conecta, principal ferramenta
gumas dessas tecnologias foram utilizadas, on-line para engajamento na organização.

PROGRAMA RHAE TRAINEE CNPq – IEL 259


CONCEITOS DE TECNOLOGIAS DE RELACIONAMENTO PARA ENGAJAR O PÚBLICO.

CAFÉ COM O PRESIDENTE Encontro presencial com a liderança do Sistema FIERGS para trocar ideias sobre inovação

INSTAGRAM Desafiaros públicos capacitados a dividir suas descobertas


e aprendizados, com fotos na plataforma Conecta

IGNITE Desafiar os participantes a gravar vídeos sobre seus hobbies e o que eles
têm a ensinar para dividir com os colegas na plataforma Conecta

MEETUP Criar, na plataforma Conecta, comunidades de assuntos


diversos ligados a interesses comuns

DO IT YOURSELF Desafiar os integrantes das capacitações a adotar o espírito do DIY, buscando aplicar
aos exercícios propostos o conceito de fazer tudo você mesmo. Registros na plataforma
Conecta

INNOVATION CHALENGE Desafio de inovação para engajar candidatos para as capacitações

TOOLKIT DE INOVAÇÃO Kit de ferramentas de inovação para apoiar os multiplicadores e colaboradores


FIERGS do Sistema FIERGS na resolução de desafios através da inovação

DICAS DE INOVAÇÃO Dicas com boas práticas e exemplos de inovação dentro de


ambientes como o Sistema FIERGS

TABELA 3 - Conceitos de tecnologias de relacionamento para engajar o público.

A aplicação do método POST permitiu direcionar as melhores formas e canais de comuni-


cação com cada público capacitado de forma específica e objetiva para o atingimento dos re-
sultados do Projeto, estabelecendo um Modelo de Desenvolvimento adequado para a situação.

DISCUSSÃO
Após a definição do Modelo de Desenvolvimento a ser aplicado no Projeto Cultura de Inova-
ção no Sistema FIERGS, iniciaram-se as capacitações das equipes de multiplicadores e cola-
boradores capacitados. As capacitações foram definidas conforme a tabela 4.

260 INOVA TALENTOS


11

CAPACITAÇÕES REALIZADAS

PÚBLICO (TURMA) REALIZAÇÃO CARGA HORÁRIA OBJETIVO PARTICIPAÇÃO

30 Gestores Março/2016 40h Experenciar ferramentas e Por indicação


e Multiplicadores métodos de inovação e estar
(agentes de mudança) apto para replicar o modelo
de treinamento

60 Colaboradores Agosto/2016 24h Experenciar ferramentas Por adesão a desafio


capacitados (early adopters) e métodos de inovação

80 Colaboradores Agosto/2016 8h Experenciar ferramentas e Por adesão a desafio


capacitados (early adopters) métodos de inovação

TABELA 4 - Capacitações realizadas

A turma de agentes de mudança foi sele- vação de forma prática e com desafios reais.
cionada por indicação, ao passo que os early Os participantes foram constantemente
adopters tiveram que responder a um desafio, estimulados a multiplicar forma de pensar e
aberto a todo o Sistema FIERGS de modo a agir em sua área/unidade, formas de saírem
garantir a participação na capacitação. com duas atividades práticas para a conti-
O desafio consistiu em apresentar o Proje- nuidade do trabalho: responder a um novo
to para outro colaborador e filmar essa ação, desafio para garantir sua participação do 4º
para, em seguida, enviar aos organizadores Fórum de Inovação IEL (evento de inovação
o vídeo para aprovação, além de responder do Instituto Euvaldo Lodi) e realizar um igni-
a um questionário com o objetivo de nivela- te (método de apresentação criativa e rápida
mento e alocação de perfis em cada turma. em apenas 5 minutos) relatando algum as-
No total, mais de 170 colaboradores fo- sunto de seu conhecimento, que permitisse
ram capacitados, assumindo a referência a possibilidade de compartilhar com os de-
de multiplicadores de inovação no Sistema mais.
FIERGS. Com a capacitação dos grupos, ocorreu o
As turmas utilizaram um Toolkit de fer- surgimento de quatro projetos, que abarca-
ramentas de inovação do Sistema FIERGS, vam pontos estratégicos da sistematização
apresentado durante as capacitações para de uma cultura de inovação no Sistema, con-
apoiar a experimentação do processo de ino- forme a seguir discriminado:

PROGRAMA RHAE TRAINEE CNPq – IEL 261


MOVIMENTO MAKER
objetivo: o Movimento Maker FIERGS busca oferecer um ambiente colaborativo para inovação
aberta, estimulando experiências, articulação, integração, conexão de pessoas e propósitos.

MEDIA LAB
objetivo: empoderar pessoas para realizar trocas de conhecimento, colocando em prática
ações, projetos e materiais que facilitem a comunicação e o dia a dia do Sistema FIERGS, de
forma simples, criativa e a baixo custo.

PONTES PARA INTEGRAÇÃO


objetivo: o projeto Pontes para Integração busca a estruturação de um processo para o desen-
volvimento integrado de produtos e modelos de negócios no Sistema FIERGS.

BANCO DE IDEIAS
objetivo: estruturar um banco de ideias para o Sistema FIERGS, através do qual os colabora-
dores possam contribuir com novos desafios a serem solucionados, ideias para desafios pro-
postos e ideias livres.

PROJETOS ESTRATÉGICOS PROVENIENTES DAS CAPACITAÇÕES

PROJETO PALAVRAS CHAVE DESCRIÇÃO

MAKER Conexão Plataforma de conexão entre os diferentes


atores do ecossistema de inovação do RS.

PONTES Stagegates Processo estruturado para desenvolvimento de novas soluções (produtos,


(Processo) serviços ou processos) envolvendo duas ou mais casas da FIERGS. Formado por
estágios (Stages) separados por pontos de avaliação e decisão (Gates) com o
objetivo de apoiar a tomada de decisão relacionada à alocação de recursos.

IDEIAS Ideação Banco de ideias do Sistema FIERGS onde colaboradores podem contribuir com
desafios a serem solucionados, ideias para desafios propostos ou ideias livres.

MEDIA LEAB Comunicação Sistema de empoderamento de colaboradores para facilitar a comunicação diária
e troca significativa de conhecimento de forma simples, criativa e de baixo custo.

FIGURA 2 - Projetos estratégicos provenientes das capacitações.

262 INOVA TALENTOS


11

Cada projeto contou com um grupo vo- ao mesmo tempo, pontos que devem ser
luntário e multidisciplinar de colaboradores, melhorados e oportunidades de intervenção.
que ficou responsável por conduzir o assun- Da mesma forma com as capacitações, fun-
to e estruturar os próximos passos desses damentais para se criar um ambiente direcio-
subprojetos estratégicos. As etapas de Cer- nado à experimentação e ao desafio do óbvio.
tificação (reconhecimento e certificação dos A assertividade da comunicação se deu
colaboradores participantes) e Difusão da através de um planejamento bem estrutura-
Cultura na Indústria (transmissão de uma do, oriundo de uma metodologia de direcio-
cultura reforçada por conceitos de inovação namento de objetivos, estratégia e tecnolo-
para à indústria) estão previstas como próxi- gias para diferentes públicos. Uma percepção
mos passos do Projeto. que emergiu dessa aplicação foi a de que não
há resposta pronta para o desenvolvimento
de uma cultura de inovação, que, obviamen-
CONSIDERAÇÕES FINAIS te, pressupõe participação de pessoas.
O Projeto Cultura de Inovação possui a
De forma geral, a cultura de inovação em continuidade associada ao sucesso das pró-
organizações se baseia no comportamen- ximas etapas, quando os grupos deverão
to das pessoas, expresso através de rituais, organizar ações estruturadas para cada pro-
símbolos e mitos que existem no ambiente e jeto estratégico, resultante das capacitações.
estão muitas vezes inconscientemente asso- As atividades relatadas neste artigo com-
ciados às práticas de trabalho diárias. preenderam a primeira campanha do proje-
Pensar, reavaliar sobre novas perspec- to, que também prevê o desenvolvimento de
tivas, contemplar o problema com um viés uma segunda campanha, cujo objetivo prin-
propositivo de resolução e não de proble- cipal será a difusão dos conceitos e a ambi-
matização pode ser uma forma de encarar ência para a inovação.
desafios sob o aspecto da inovação. Nesse segundo momento, será abordada
Porém, a prática deste processo deve ser a abertura ao diálogo, com o objetivo de oxi-
mais bem estruturada, através do forneci- genar os temas abordados nas capacitações,
mento de mecanismos de fácil utilização, trazendo assuntos atuais relacionados à for-
que apoiem um novo olhar sobre proble- ma de pensar e agir.
mas, geralmente associados a ferramentas Também está prevista uma construção
de inovação e formas distintas de comunica- coletiva de conhecimento, através de condi-
ção com cada público atingido. ções para promover a integração dos cola-
O trabalho mostrou a importância de um boradores das entidades, além de um desen-
bom diagnóstico da realidade da empresa, volvimento maior para a liderança, buscando
expondo fragilidades e vícios e mostrando, a formação de “líderes do futuro”.

PROGRAMA RHAE TRAINEE CNPq – IEL 263


Somente a vivência e a experimentação de
novas práticas e habilidades, abertura à ten-
tativa e erro e comprometimento da alta di-
reção e de todos os colaboradores envolvidos
poderá fazer emergir um modelo ideal para
cada organização, respeitando características
e pressupostos básicos e envolvendo as pes-
soas no processo de construção de um am-
biente favorável à inovação, que possa então
servir de exemplo para as demais empresas.

REFERÊNCIAS
BIBLIOGRÁFICAS

LI, Charlene; BERNOFF, Josh, 2011. Groundswell -


Expanded and Revised Edition: Winning in a World
Transformed by Social Technologies. Paperback –
May 24, 2011.

CNI, 2017. Brasil fica estagnado no Índice Glo-


bal de Inovação. Notícia. Disponível em: http://
www.portaldaindustria.com.br/agenciacni/noti-
cias/2017/06/brasil-fica-estagnado-no- indice-glo-
bal-de-inovacao/

FENN, Jackie; RASKINO, Mark, 2008. Mastering the


hype cycle: how to choose the right innovation at the
right time. Disponível em: http:/bit.ly/2wfRkdP

BURTON, Betsy; WALKER, Mike - GARTNER, 2015.


Hype Cycle for Emerging Technologies. Disponível
em: https://www.gartner.com/doc/3100227

SYMNETICS, 2015. Relatórios técnicos do Projeto


Cultura de Inovação no Sistema FIERGS.
Documentos internos.

264 INOVA TALENTOS


11

PROGRAMA RHAE TRAINEE CNPq – IEL 265


12
RESULTADOS DA IMPLEMENTAÇÃO
DA GESTÃO DE INOVAÇÃO EM UMA
EMPRESA DE TECNOLOGIA:
ESTUDO DE CASO.
Á B IA S D E OLIV E IR A C OS TA
_
Administração
UNIPLAN - Centro Universitário do Planalto
do Distrito Federal - Brasília – DF.

ROSANI MOREIRA FERNANDES DE AQUINO

MÁRCIO REZENDE DA SILVA

A autora principal é administradora, nascida em


Niquelândia - GO, formada pela UNIPLAN (Centro
Universitário do Planalto do Distrito Federal) Brasília –
DF. Atua na área administrativo-financeira e inovação.

abias_costaoliveira@yahoo.com.br

Águas Claras. Brasília – DF

(61) 99662-7454,

267
R E SU M O

tecnologia; gestão da inovação; processos;


PALAVRAS CHAVE
aprendizagem e tecnológica; capacidade tecnológica.

Este artigo tem como finalidade apresentar os resultados da gestão da inovação numa

empresa de tecnologia da área de telecomunicações. A principal intenção é descrever o

processo de implementação, enumerando suas etapas, imputs, transformações, parti-

cipantes e, por fim, avaliar a natureza dos resultados apresentados, decorrentes desse

processo. Além disso, a descrição do processo desenhado para a empresa em estudo é

uma proposta para empresas semelhantes ou de outra natureza, uma vez que pode ha-

ver ganho na cultura organizacional, além do ganho tecnológico stricto sensu, pois houve

aprendizagem e capacitação tecnológica.

268 INOVA TALENTOS


12

A BSTR ACT

KEYWORDS technology; innovation management; processes;


learning and technology; technological capacity.

This article aimed to present the results of the implementation of innovation management

in a technology company, is in the area of telecommunication. The main intention is to

describe the implementation process, describing its stages, imputs, transformations, par-

ticipants and, finally, evaluating the nature of these results presented in this process. In

addition, the description of the process designed for the company under study is a proposal

for similar companies, or even for companies of another nature, since it may have gained

in the organizational culture, in addition to the technological gain stricto sensu, since there

was learning and capacity technological.

PROGRAMA RHAE TRAINEE CNPq – IEL 269


conjunto ou estoque de recursos decorrentes
INTRODUÇÃO de conhecimento tecnológico, contribuindo

O
para que as empresas realizem sua produção,
termo inovação pode ser compre-
seja de bens ou serviços, seja de inovação.
endido de várias formas, dependen-
A Organização Internacional para a Padro-
do da perspectiva adotada. A maior
nização – ISO – na NBR ISO 9001/2015, defi-
parte dessas definições apresenta uma visão
ne processo como o “conjunto de atividades
restrita e próxima do entendimento de tec-
inter-relacionadas ou interativas, que trans-
nologia de P&D, assim como no que diz res-
formam entradas em saídas”. Ou ainda, para
peito ao desenvolvimento de um novo pro-
Valle (2012, p. 9), pode-se entender como
duto ou à dicotomia de produtos/processos.
“um conjunto de atividades estruturadas e
Para Figueiredo (2012) inovação é mais que
medidas, destinadas a resultar num produto
criatividade, “é a implementação de novos
especifico para determinado cliente ou mer-
produtos, serviços, processos ou arranjos de
cado (...)”.
organização”.
Gerir a inovação é basicamente conce-
Conforme Bessant e Tidd (2009), a teoria
ber, melhorar, reconhecer e compreender as
sobre o processo de inovação foi construí-
rotinas efetivas para geração de inovações,
da, essencialmente, com base em inovações
bem como facilitar seu surgimento dentro da
de cunho tecnológico, particularmente rela-
organização. O O’connor (apud Silva, 2012)
cionadas ao setor industrial. Deve-se então
orienta que a gestão da inovação deve primar
entender a inovação como resultado de um
por um sistema gerencial, que possibilite à
processo, segundo Baregheh, Rowley e Sam-
empresa inovar de forma sistemática, objeti-
brook (2009, apud Silva, 2014), capaz de re-
vando a sobrevivência e o aumento da com-
alizar e transformar ideias em bens, serviços
petitividade. Assim, compreender o processo
ou novos processos, trazendo à organização
de inovação é fundamental para entender fa-
melhorias, capazes de impactar no seu su-
tores que podem facilitar ou inibir o desenvol-
cesso no mercado.
vimento de inovações nas organizações.
Além disso, para Figueiredo (2012), há
O foco do presente estudo está neste pro-
dois conceitos vinculados à tecnologia: a
cesso de inovação: a descrição da implemen-
aprendizagem tecnológica e a capacidade
tação do processo em um caso concreto e,
tecnológica, sendo o primeiro entendido
em decorrência disso, a análise e levantamen-
como “insumo para a construção e acumu-
to dos resultados advindos dessa prática, de
lação de capacidade tecnológica e realização
modo que, ao final, seja possível avaliar se a
de atividades tecnologicamente inovadoras
implementação da gestão da inovação realiza
em nível de empresas.” Quanto à capacida-
de fato resultados significativos a uma em-
de tecnológica, o autor define como sendo o
presa de tecnologia de telecomunicação.

270 INOVA TALENTOS


12

em qualquer pesquisa de natureza históri-


OBJETIVOS ca”. Gil complementa (2002, p.44)
O objetivo deste artigo é demonstrar quais
Uma pesquisa bibliográfica é desenvolvida
os resultados da implementação da Gestão
com base em material já elaborado, constitu-
da Inovação em uma empresa de tecnologia,
ído principalmente de livros e artigos científi-
inserida do ramo de telecomunicações.
cos. Embora em quase todos os estudos seja
Para tanto, faz-se necessário analisar e
exigido algum tipo de trabalho dessa nature-
descrever o processo de Gestão, para, em
za, há pesquisas desenvolvidas exclusivamen-
seguida, analisar o desenvolvimento empre-
te a partir de fontes bibliográficas[...]
sarial e ponderar se a gestão da inovação
trouxe, de fato, novas receitas, bem como
Além da pesquisa documental, por ser
novos produtos para o portfólio empresarial,
indispensável a todo trabalho acadêmico e
advindas desse processo.
profissional, a pesquisa bibliográfica consti-
Por fim, analisar o impacto desse pro-
tui instrumento largamente utilizado. Esse
cesso na força de trabalho – englobando,
tipo de pesquisa se realiza, segundo Severi-
aqueles que participam ou não da Gestão de
no (2007, p. 122), a partir do:
Inovação –, tendo em vista que nem todos
[...]registro disponível, decorrente de pesquisas
são participantes do processo tecnológico,
anteriores, em documentos impressos, como
mas podem colaborar para a aprendizagem
livros, artigos, teses, etc. Utilizam-se dados de
ou capacidade tecnológica.
categorias teóricas já trabalhadas por outros
pesquisadores e devidamente registrados. Os
textos tornam-se fontes dos temas a serem
MÉTODO pesquisados. O pesquisador trabalha a partir
A pesquisa documental se mostra funda- de contribuições dos autores dos estudos ana-
mental para o desenvolvimento deste traba- líticos constantes dos textos. (SEVERINO,
lho, pois a maior parte das fontes utilizada é 2007, p.122).
composta por materiais impressos, que ser-
vem quase sempre de base para o trabalho O estudo de caso pode ser entendido
de investigação, realizada em documentos, como a análise de fatores, capazes de pro-
contemporâneos ou retrospectivos, consi- porcionar e permitir um amplo e detalhado
derados cientificamente autênticos. Para Gil conhecimento dos resultados apresentados
(2002 p.46), esse tipo de pesquisa apresen- na condição de hipóteses e não de conclu-
ta vantagens, pois os documentos possuem sões, “proporcionando uma visão global do
uma “fonte rica e estável de dados”. Uma problema ou a identificação de possíveis fato-
vez que subsistem ao longo do tempo, “tor- res que o influenciam ou são por ele influen-
nam-se a mais importante fonte de dados ciados” (Thiollent, 1985, p.14, apud Gil, 2002).

PROGRAMA RHAE TRAINEE CNPq – IEL 271


Assim, utilizando essas ferramentas de tuito de gerar ideias e projetos de sucesso,
pesquisa podem-se analisar, com fundamen- sistematizando o processo de inovação. Para
to nos conceitos de tecnologia, capacidade a WISE, a inovação é um pilar do planeja-
tecnológica e gestão da inovação, os proces- mento estratégico. A partir dessa estratégia,
sos de inovação de uma empresa de tecnolo- espera-se a criação de novos modelos de ne-
gia e levantar os resultados obtidos. gócios, novas formas de atender às necessi-
dades do cliente, além da implementação de
novos processos organizacionais e a introdu-
RESULTADOS ção de novos meios de competir e cooperar
no ambiente empresarial.
A EMPRESA DE TECNOLOGIA
A Wise é uma indústria sediada em Brasília,
que atua no setor de tecnologia da informa- O PROGRAMA INOVAWISE
ção. Desde 1988, a empresa desenvolve e A ideia de sistematizar os processos de ino-
fabrica equipamentos para testes, medições, vação partiu da sócia Suely, enquanto atuava
análise de comunicação, instalações e manu- como diretora de Assuntos de Desenvolvi-
tenções de linhas de comunicação de dados mento Tecnológico da Federação de Indús-
de alta tecnologia para empresas de teleco- trias do Distrito Federal (Fibra).
municações, sendo a única fabricante latino- Nesse período, a diretora teve o primeiro
-americana dessa linha de produtos. contato com metodologias de gestão da ino-
Com capital 100% nacional, a Wise forne- vação, por meio de um treinamento ofereci-
ce hoje equipamentos para praticamente to- do pela Confederação Nacional da Indústria
das as concessionárias de telefonia do país, (CNI) como parte do Núcleo de Inovação
sem concorrentes nacionais. No mercado de programa MEI – Movimento Empresarial
TIC (tecnologia da informação e comunica- pela Inovação. Ao identificar que o mesmo
ção) está inserida em toda a cadeia de pro- processo se adequava ao planejamento es-
dução de telecomunicações, desde as ope- tratégico da Wise, decidiu implementá-lo1.
radoras até as prestadoras de serviços. Esse Conforme publicação dos resultados (ci-
mercado tem passado por grande ampliação, clo 2013/2014, do Prêmio Nacional de Inova-
a partir do lançamento de novas tecnologias. ção pela CNI32, em 2012) a Wise deu início à
Seu alvo é atender com prontidão às neces- sistematização do programa, a partir de uma
sidades do mercado de telecomunicações,
com soluções eficientes. 1 (relato contido em: Confederação Nacional da Indústria.
Para conquistar mais clientes e tornar a Inovar é fazer: 22 casos empresariais de inovação. Brasília,
2015, p. 317.)
empresa mais competitiva, a Wise imple-
2  Prêmio Nacional de Inovação pela CNI (Confederação
mentou o Programa INOVAWISE, com o in- Nacional da Indústria) (2014, p. 18)

272 INOVA TALENTOS


12

sensibilização, capacitação, participações em Inovação, Funding para Inovação e Relaciona-


congressos e ações de fomento internas, foca- mentos para Inovação.
das nos colaboradores sobre o tema inovação. Para cada uma das oito dimensões são
Como metodologia, foi adotado o octógo- apresentadas práticas e políticas a serem im-
no da Inovação, ressaltando as oito dimen- plementadas – ou mesmo já existentes, que,
sões necessárias para a Gestão da Inovação: quando realizadas, criam um ambiente favo-
Estratégia de Inovação, Processo de Inovação, rável para que a WISE possa ser mais inova-
Liderança para Inovação, Pessoas para Ino- dora e, sobretudo, seja capaz de gerenciar a
vação, Cultura de Inovação, Estrutura para atividade de inovação na Empresa.

QUESTÕES ABORDADAS PELA FERRAMENTA:

ESTRATÉGIA: Como a empresa articula o direcionamento das iniciativas de inovação?

RELACIONAMENTO: De que forma a organização utiliza parceiros, clientes e concorrentes na geração e


refinamento de ideias?

CULTURA: O que a alta gestão diz e faz para criar um ambiente que estimule a inovação?

PESSOAS: Como é o apoio à inovação, seus incentivos e reconhecimentos?

ESTRUTURA: Onde está localizada a atividade de inovação e como ela é organizada?

PROCESSO: Como as oportunidades de inovação são geradas, desenvolvidas e avaliadas?

FUNDING: Como as iniciativas de inovação são financiadas?

LIDERANÇA: O quão claro é o entendimento das lideranças quanto à necessidade e relevância


da inovação? De que forma as lideranças apoiam o ambiente de inovação?

QUADRO 1 – Principais pontos abordados dentro de cada uma das oito dimensões.
Fonte: Inovar é fazer, 22 casos empresariais de inovação de pequenas, médias e grandes empresas (pag321) 2015 CNI

PROGRAMA RHAE TRAINEE CNPq – IEL 273


Além disso, foi construído um Manual de Inovação, parte relevante da política de inovação,
bem como desenvolvida uma logomarca para o programa, seguida do estabelecimento de
horizontes e temáticas para a inovação, além da discriminação das ações a serem realizadas
para disseminar a cultura entre colaboradores, fornecedores, clientes e parceiros.

Fonte: Manual InovaWise

Como política, definiu-se que inovar é co- xiliar na alocação de recursos para inovação.
locar em prática uma nova ideia, um novo Servirão ainda para comunicar e auxiliar
plano, um novo método para melhorar a per- na tomada de decisão quanto à alocação de
formance de algo que já existe ou possibilite a recursos para projetos de inovação. O perfil
criação de algo novo. de inovação da Wise aborda cinco temáti-
O objetivo é priorizar a criação de novos cas, três das quais três referentes a proces-
produtos, o desenvolvimento de novos ne- so, uma referente a oferta e uma referente a
gócios e a implementação de mudanças im- cliente ou relacionamento.
portantes nas especificações técnicas, com- Para desenvolver as ideias, a empresa
ponentes, materiais, software, nas relações optou pelo funil da inovação, ferramenta uti-
internas e externas da organização, ampliando lizada na gestão do processo inovativo, que
a participação do produto e serviço no merca- parte do princípio de que, a partir da geração,
do nacional e internacional de TI e fazendo da desenvolvimento, teste e experimentações
Wise um lugar estimulador e inovador. de um amplo conjunto de ideias, é possível
Definida a estratégia, estabeleceram-se as encontrar propostas com maior potencial de
várias temáticas a serem abordadas, entendi- se tornarem soluções inovadoras.
das como os direcionamentos principais da O Funil ilustra essa relação. Parte-se de
empresa para geração de ideias. Essas temá- um grande número de ideias, que demandam
ticas servem como indutor e filtro inicial das poucos recursos, e segue-se com a redução
ideias e estão ligadas aos horizontes defini- de projetos ao longo do ciclo e o progressi-
dos na estratégia; dizem respeito a quais as- vo aumento dos recursos aplicados aos que
suntos precisam de ideias, de maneira a au- transpassaram as várias fases do funil.

274 INOVA TALENTOS


12

Ideia Ideia Ideia Ideia Ideia Ideia Ideia

Ideia Ideia Ideia Ideia Ideia Ideia Ideia Ideia Ideia

FASE 1 (7)
Proposição das ideias

GATE 1 (0)
Classificação das ideias

FASE 2 (7)
Elaboração da viabilidade

GATE 2 (0)
Analise da viabilidade

GATE 3 (0)
Aprovação da direção

FASE 3 (5)
Elaboração do plano de Projeto

FASE 4 (2)
Desenvolvimento do piloto

GATE 4 (0)
Aprovação do piloto

FASE 5 (0)
Implementação

GATE 5 (1)
Avaliação da
implementação

Fonte: Manual de inovação InovaWise

PROGRAMA RHAE TRAINEE CNPq – IEL 275


O PROCESSO DE INOVAÇÃO Como ferramenta de acompanhamento e
As ideias selecionadas passam então pelas medição, utilizam o Innovation Scorecard.
seguintes fases: fluxo de cadastramento no O portal InovaWise é uma ferramenta
Portal de Inovação, classificação, encami- eficaz de comunicação, construída para am-
nhamento pós-classificadas, elaboração da pliar a capacidade profissional dos colabo-
viabilidade, avaliação da viabilidade, aprova- radores, como gerador constante de novos
ção da direção, elaboração do Plano de Pro- conceitos. A partir de agora, uma Comissão
jeto, desenvolvimento do piloto, aprovação rotativa, formada por funcionários, será
do piloto, implementação e avaliação da im- responsável por fazer o diagnóstico, filtrar
plementação. e identificar as ideias viáveis de aplicação,
Nessa última fase, a equipe gestora será premiando seus autores.
responsável por levantar os resultados positi- Em publicação no portal inova indústria
vos e negativos resultantes da implementação a diretora da Wise, Suely Silva explica que
do projeto, que servirá como case para os pro- portal Inova Wise é o espaço em que os fun-
cessos de capacitação em inovação na WISE. cionários podem postar suas ideias sobre
A estrutura é acompanhada via portal de ino- inovação que, se absorvidas pela empresa,
vação, onde estão alocados banco de ideias, permitirão ao autor participação nos lucros.
Funil da Inovação e projetos em andamento. A empresa também criou um grupo

FLUXO DO PROCESSO DE AVALIAÇÃO E VIABILIDADE

FASE 1 FASE 2 FASE 3 FASE 4 FASE 5


Proposição Elaboração da Elaboração Desenvolvimento Implementação
das Ideias Viabilidade do plano de do piloto
projeto

GATE 1 GATE 2 GATE 3 GATE 4 GATE 5


Classificação Análise da Aprovação Aprovação Avaliação da
das Ideias Viabilidade da Direção do Piloto Implementação

Fonte: Manual de inovação InovaWise

276 INOVA TALENTOS


12

gestor de inovação, que reúne e estuda a de que ela foi implementada, conseguimos
viabilidade de cada ideia proposta. “Apesar observar ganhos na empresa, inclusive mol-
da queda da indústria, diante do cenário de dando os bolsistas ao perfil de que precisá-
recessão da economia, com os novos pro- vamos. O convívio com outros empresários
dutos propostos pelos nossos funcionários, e o apoio do Sistema também facilitaram
aumentamos 14% nas vendas. Portanto, a o processo de aprendizagem e desenvolvi-
inovação é vital para empresa. Se não inovar, mento, tanto na troca de informações e solu-
você morre”, completou. 3
ções, como no acesso a editais de fomento.
A recompensa e o reconhecimento se
dão a partir de um programa de premiação,
DISCUSSÃO
que estimula a criação de ideias e a alimen-
Dentre as análises realizadas sobre os pro-
tação do programa.
cessos da Gestão da Inovação, desenhados
Os resultados, observados nos indica-
e implementados pela WISE, foi possível ob-
dores de inovação, podem ser: ampliação
servar como o tema inovação foi incutido na
do portfólio de produtos; aumento da par-
cultura da empresa, provocando uma mu-
ticipação desses novos produtos no fatu-
dança comportamental positiva dos colabo-
ramento da empresa; quantidade maior de
radores. Como demonstram os indicadores
novas ideias; recursos oriundos de projeto
(contexto, processo, temática, resultado e
de fomento, participação da empresa em
conceito), houve o aumento de proposição
premiações; elevação na capacitação.
de ideias, envolvimento dos colaborados
Em setembro de 2013, o programa foi ofi-
ao negócio da empresa, além de adoção de
cialmente lançado e já em 2014 a empresa
parcerias importantes para o desempenho
foi vencedora do Prêmio Nacional de Ino-
da Wise, em especial no que concerne ao
vação da CNI na categoria gestão de inova-
desenvolvimento de soluções oferecidas a
ção, que reconhece empresas brasileiras que
seus clientes.
contribuíram para o aumento da competiti-
Graças a essas colaborações, foi possível
vidade do País, por meio da implementação
desenvolver projetos, agregando conheci-
de projetos inovadores.
mento, recurso dos parceiros e fortalecimen-
to da marca, entre outros. Outra relevância da
PARCERIAS inovação foi estimular o desenvolvimento de
A parceria com o IEL-DF foi essencial para pessoas a partir da inovação, o que fez com
a criação da nossa área de inovação., Des- que a WISE aumentasse a capacitação dos
colaboradores, e, consequentemente, o nível
3  Acessado em 09/07/2017, às 18:56, < https://www.
sistemafibra.org.br/fibra/sala-de-imprensa/noticias/884- intelectual do capital humano da empresa.
industria-do-df-participa-do-6-congresso-brasileiro-de-i-
novacao.html>.
Como empresa participante do programa

PROGRAMA RHAE TRAINEE CNPq – IEL 277


Inova Talentos4, a Wise obteve aproveitamento de 100% em relação aos bolsistas que passa-
ram pelo programa, considerando que os três bolsistas foram efetivados pela instituição. Esse
resultado só foi possível pela aplicação concreta dos bolsistas nos processos de Gestão da
Inovação executados na empresa, o que possibilitou também uma aprendizagem tecnológica.5
Com a recente recessão brasileira, a maior parte das indústrias apresentou quedas em seu
faturamento. No entanto, em decorrência dos processos de inovação, novos produtos propos-
tos pelos funcionários, através do processo InovaWise, proporcionaram o aumento de 14% nas
vendas em 20146.

CONSIDERAÇÕES FINAIS
Diante das descrições e dados apresentados, fica evidenciada a existência de resultados posi-
tivos, que vão ao encontro das propostas teóricas da Gestão da Inovação, cuja implementação
traz como resultados a mudança cultural, contribuições ou novos produtos que integram o
portfólio da empresa, crescimento da participação de novos produtos no faturamento total,
captação de recursos junto às principais agências de fomento e realização da aprendizagem
tecnológica, por meio da capacitação de seus empregados7.
Assim, realizar uma gestão de inovação bem desenhada e bem aplicada, seguindo os parâ-
metros teóricos, pode proporcionar uma mudança profunda para as empresas de tecnologia,
Essas mudanças, não se limitam à parte tecnológica stricto sensu , mas também dizem respeito
à percepção de mudança, necessária a qualquer empresa dos dias atuais, seja ela de tecnologia
ou não.

4  Programa pertencente ao Instituto Euvaldo Lodi (IEL), que tem como objetivo ampliar o número de profissionais qualifica-
dos em atividade de inovação no setor empresarial brasileiro. < http://www.portaldaindustria.com.br/inovatalentos/conheca-
-o-inova/> acessado em 11/07/2017, às 11:33.

5  Conceito adotado por Paulo Figueiredo em: FIGUEIREDO, Paulo N. Gestão da Inovação: conceitos, métricas e experiências
de empresas no Brasil. Rio de Janeiro: LTC, 2012. p. 14.

6  Acessado em 09/07/2017, às 18:56, < https://www.sistemafibra.org.br/fibra/sala-de-imprensa/noticias/884- industria-do-


-df-participa-do-6-congresso-brasileiro-de-inovacao.html>.

7  Disponível em: < http://arquivos.portaldaindustria.com.br/app/conteudo_24/2015/06/11/540/CNI_PT_web.pdf> acessa-


do em 11/07/2017, às 13:37.

278 INOVA TALENTOS


12

GIBSON, Rowan, Inovação: prioridade nº 1: o cami-


REFERÊNCIAS BIBLIOGRÁFICAS nho para transformação nas organizações. Rio de
Janeiro: Editora Elsevier: 2008.
Associação Brasileira de Normas Técnicas. NBR ISO
9001/2015: Sistemas de Gestão da Qualidade. Rio de SEVERINO, Antonio Joaquim. Metodologia do Tra-
Janeiro, 2015. balho Científico. São Paulo: Cortez, 2007.

BAREGHEH, A.; ROWLEY, J.; SAMBROOK, S. SILVA, Débora Oliveira. Modelos para a gestão da
Towards a multidisciplinary definition of inno- inovação: revisão e análise da literatura. Production,
vation. Management Decision, v. 47, n. 8, p. v. 24, n. 2, p. 477-490, Apr./June 2014. Disponí-
1323-1339, 2009. Disponível em <http://dx.doi. vel em <http://www.scielo.br/pdf/prod/v24n2/
org/10.1108/00251740910984578>, acessado em aop_0750-12.pdf>. Acessado em 18/07/2017, às
18/07/2017, às 13:42. BESSANT, J. e TIDD, J. Inova- 13:53.
ção e empreendedorismo. Porto Alegre: Bookman,
2009. SOUZA NETO, Jóse Adeodato de; BAIARDI, Amilcar
& Cavalcanti de Alburquerque, Lyanaldo. Gestão da
CONFEDERAÇÃO NACIONAL DA INDÚSTRIA: inovação tecnológica. Brasília: Editora Paralelo 15,
Inovar é fazer: 22 casos empresariais de inovação de 2006.
miro, pequenas, médias e grandes empresas. Brasília:
CNI: SEBRAE, 2015. VALLE, Rogerio & OLIVEIRA, Saulo Barbará de (co-
ordenadores). Análise e modelagem de processos de
CONFEDERAÇÃO NACIONAL DA INDÚSTRIA: negócios: foco na notação BPMN. São Paulo: Atlas,
Prêmio nacional da inovação: publicação de resulta- 2012.
dos ciclo 2013/2014. Brasília: CNI: SEBRAE, 2014.

GIL, Atonio Carlos. Como elaborar projetos de


pesquisa. São Paulo: Atlas, 2002. FIGUEIREDO,
Paulo N. Gestão da Inovação: conceitos, métricas e
experiências de empresas no Brasil. Rio de Janeiro:
LTC, 2012.

PROGRAMA RHAE TRAINEE CNPq – IEL 279


13
O DESIGNER DE
PRODUTO INSERIDO NA
PRODUÇÃO INDUSTRIAL
UM RELATO DE PESQUISA
M ILE NA A LV E S
_
Formada em Desenho Industrial
Universidade Federal do Maranhão
_
Especialista em Gerenciamento Estratégico de Projetos
Universidade FUMEC
_
Mestranda em Design de Sistema de Produção e Utilização
Universidade Federal do Paraná (UFPR)

Mestranda em Design de Sistema de Produção e Utilização na


Universidade Federal do Paraná (UFPR), Formada em Desenho
Industrial pela Universidade Federal do Maranhão, Especialista
em Gerenciamento Estratégico de Projetos pela Universidade
FUMEC, ex- Bolsista de Fixação de Recursos Humanos do
CNPq - Nível G em parceria com o IEL-MA e SENAI MA, na
área de Design Estratégico. Ex-bolsista pelo CNPq do Projeto
Identidade é valor: iconografias do artesanato da Ilha do
Maranhão e Alcântara, ex-voluntária do projeto iconografias
do Maranhão: Embarcações e Manguezais. Ex- bolsista pelo
Ciências sem fronteiras da Kwantlen Polytechnic University -
Vancouver - Canadá.

mcarneiroalves@gmail.com

Presidente Carlos Cavalcanti, 400,


Apartamento 51, Centro,
Curitiba, Paraná, CEP:80020280

281
R E SU M O

PALAVRAS CHAVE Designer; Inovação; Sustentabilidade; Construção Civil; IEL; SENAI.

Este artigo é um relato de pesquisa promovida pelo Instituto Euvaldo Lodi (IEL) e CNPQ,

por meio do Inova Talentos e do SENAI - MA, empresa parceira. A bolsista foi contratada

para auxiliar no design e na produção, em escala industrial, da Ecoplaca, visando à dimi-

nuição dos impactos ambientais causados pela matéria-prima utilizada na fabricação de

copos plásticos e sacos de cimento, o que reflete a preocupação com o planejamento da

cadeia produtiva, de modo a promover o desenvolvimento de produtos de forma cons-

ciente, aumentar a competitividade entre as empresas de forma sustentável e desenvolver

um mercado voltado à produção de produtos que atendam a todos os stakeholders. Como

resultados, a Ecoplaca conseguiu acompanhar um processo de desenvolvimento mais

industrial, abandonando o modo artesanal como estava sendo produzida.

282 INOVA TALENTOS


13

A BSTR ACT

KEYWORDS Design; Innovation; Sustainability; Construction; IEL; SENAI.

This paper is a report about a research promoted by Instituto Euvaldo Lodi (IEL) and

CNPQ, through Inova Talentos program and SENAI MARANHÃO, which was the

partner company; The Designer was hired to assist the production and design of Ecoplaca,

always aiming at reducing the environmental impacts caused by the raw material of the

Ecoplaca, as a concern of the production chain, planning and developing products in a

conscious way, increasing competitiveness among companies in a sustainable way and

developing a market focused on producing products that meet all stakeholders desires.

As a result, an Ecoplaca has been able to follow a more industrial development process,

leaving the craft mode it was being produced.

PROGRAMA RHAE TRAINEE CNPq – IEL 283


cimento misturados a polímeros (copos des-
INTRODUÇÃO cartáveis), em um processo que envolve eta-
pas de desagregação, mistura e moldagem.

A
construção civil, em toda a sua ca- A adição do polímero veio para agregar valor
deia produtiva, produz impactos estético ao produto – semelhante à pedra de
negativos no meio ambiente, sendo mármore – e que pode atender às tendências
a indústria de Resíduos de Construção e De- do mercado moveleiro.
molição (RCD), um dos maiores poluidores A bolsista Inova Talentos foi contratada
da sociedade (DOS SANTOS, PINTO & CA- para auxiliar no design e na produção da placa
TUNDA, 2015). Apesar dos problemas cau- ecológica, que necessitava ser sustentável, ter
sados, a construção civil atua na dinâmica qualidade e possuir preços competitivos com
econômica de qualquer país, por meio da ge- os concorrentes do mercado moveleiro e de
ração de emprego e renda, proporcionando, construção civil.
assim, melhor qualidade de vida a uma boa O plano de trabalho contemplou as se-
parcela de cidadãos brasileiros. guintes atividades: levantamento dos con-
No Brasil, a RCD busca auxílio dos concei- correntes potenciais e suas estratégias para
tos sustentáveis para promover uma constru- divulgação dos seus produtos no mercado; le-
ção mais limpa e sistemática, que visa aca- vantamento dos perfis dos clientes potenciais
bar com os impactos ambientais e sanitários que utilizarão o produto Ecoplaca; realização
relacionados ao processo. Cabe ressaltar de estudos para identificação dos canais que
que a indústria de Resíduos de Construção deverão ser utilizados para comunicar ao
e Demolição, por envolver elevado número cliente a inovação e o valor agregado ao pro-
de processos e produtos, representa um dos duto; e auxílio na produção do design do pro-
setores econômicos mais significativos do duto Ecoplaca.
país, (responsável por 4% do PIB, em 2009) Como resultados, a Ecoplaca conseguiu
e que vem acumulando sucessivas taxas de acompanhar um processo de Desenvolvimen-
crescimento de 1995 até 2008, com taxa de to mais industrial, ao deixar de lado o modo
crescimento média em torno de 9,7% ao ano artesanal como estava sendo produzida.
(MONTEIRO FILHA, 2010).
Um exemplo de resíduos é o saco de ci-
mento, que possui alta resistência e durabili-
dade e que, se não for descartado de manei- OBJETIVO
ra correta, causa contaminação e poluição.
Assim, para tentar minimizar o problema, O objetivo do projeto era propor a produção
foi pensada a produção de placas ecológicas de placas ecológicas (denominadas Ecopla-
que possuem como elementos-base sacos de cas), por meio da desagregação, fusão e mis-

284 INOVA TALENTOS


13

tura de sacos de cimento com um polímero Em linha com essa postura, a Gestão do
(copos descartáveis), para a criação de divi- Design ajuda nas tomadas de decisões das
sórias, compensados, pisos, paredes, forros, atividades inerentes ao projeto, tanto para
além da produção de tampos, bancadas de produtos e serviços, como para processos,
cozinhas, revestimento de banheiros com ao diagnosticar e propor inserções estratégi-
características estéticas semelhantes a pe- cas do design em todas as áreas, atividades,
dras nobres, como mármore e ao granito. conceitos, cultura, e meio ambiente, entre
A proposta contemplou auxiliar no de- outros aspectos.
sign e na produção, em escala industrial, da O Guia PMBOK - Guide to Project Ma-
Ecoplaca, sempre visando à diminuição dos nagement Body of Knowledge, desenvolvido
impactos ambientais causados pela matéria- pelo Instituto de Gerenciamento de Proje-
-prima da placa ecológica. tos – PMI, em 2013, consolida as boas prá-
ticas na área de Gerenciamento de Projetos,
abordando conhecimentos das etapas de
MÉTODO um gerenciamento de projeto e descreven-
do normas, processos e práticas aplicáveis,
A literatura registra a existência de metodo- na busca de melhorias mediante o uso de
logias, desenvolvidas para que o designer habilidades, ferramentas e técnicas. O Guia,
sistematize o processo de criação e constru- reconhecido globalmente, é considerado um
ção de produtos e serviços. Contudo, as eta- paradigma para o gerenciamento estratégi-
pas propostas por tais métodos são comu- co, podendo ser aplicado para diferentes ti-
mente negligenciadas ou desconsideradas, pos de produção.
ocasionando desvios de objetivos, aumento Este artigo relata a pesquisa promovido
de erros de execução e elevação de riscos pelo Instituto Euvaldo Lodi (IEL) e CNPQ,
econômicos. por meio do Inova Talentos e pelo SENAI-
Kerzner (1994) assinala que, na fase de -MA (empresa parceira), com o objetivo de
projeto, a atenção deve ser dirigida à ocor- fazer: a) levantamento dos concorrentes po-
rência de eventos futuros, cujo exato resul- tenciais e de suas estratégias para divulga-
tado é desconhecido, ressaltando a necessi- ção de seus produtos no mercado; b) levan-
dade de criação de formas para lidar com tamento dos perfis dos clientes potenciais
essa incerteza. Assim, surgem os guias e que utilizarão o produto Ecoplaca; c) realiza-
programas de controle para gestão de pro- ção de estudos para identificação dos canais
jetos, gerando empresas que possuem um que deverão ser utilizados para comunicar
sucesso significativamente alto, sendo 15% ao cliente a inovação e o valor agregado ao
mais bem sucedidas com seus novos produ- produto; e d) auxilio na produção do design
tos (BERGER, 2013). do produto Ecoplaca.

PROGRAMA RHAE TRAINEE CNPq – IEL 285


(Empresa parceira do projeto). Nesse segun-
RESULTADOS do momento, entrevistaram-se os vendedo-
res locais de pedras ornamentais, a fim de
A pesquisadora bolsista do Inova Talentos já saber mais sobre preços, formatos, tempo de
havia sido produzido o primeiro protótipo da entrega e preferências em geral dos clientes,
placa ecológica de forma artesanal, a partir tais como cor, textura e espessura. O encon-
da fragmentação e desagregação de sacos de tro com a equipe de Açailândia permitiu uma
cimento e do derretimento dos copos des- maior integração e troca de conhecimentos,
cartáveis, mistura colocada para secar, até que resultou em soluções viáveis para as re-
se formar a placa. Vale ressaltar que a equipe soluções de alguns problemas projetuais e
do projeto testava outros materiais, como sa- de produção.
colas plásticas, entulhos, aglutinantes e pig- Em novembro de 2015, foi feita outra via-
mentos. As características desejáveis da Eco- gem à unidade SENAI de Açailândia para
placa com a utilização desses componentes acompanhar as atividades, oferecer opini-
seriam: alta resistência à tração, ao rasgo, ao ões a respeito da indústria, pesquisar sobre
estouro; alto poder de aglutinação; alto grau o mercado local e documentar problemas e
de impermeabilização; alto brilho; e dureza. dificuldades encontradas.
A primeira etapa do cronograma – de se- Foram quatro dias de intenso trabalho,
tembro a outubro de 2015 – compreendeu o quando a pesquisadora pôde acompanhar a
levantamento de concorrentes em potencial produção das Ecoplaca. Houve várias reuni-
e suas estratégias para a divulgação de seus ões, em que foram apontadas as dificuldades
produtos no mercado. A segunda etapa – de relacionadas a problemas básicos de mate-
outubro a dezembro de 2015 – contemplou, riais (especificações, formatos e quantida-
por sua vez, o levantamento dos perfis dos de). Deifiniram-se ainda novos métodos que
clientes potenciais que iriam utilizar o produ- melhor se encaixassem nos padrões para es-
to Ecoplaca. cala industrial.
Primeiramente, foi feito, via internet, um Alguns corpos de prova foram então en-
levantamento dos produtos concorrentes, caminhados à unidade SENAI para os testes
buscando medidas específicas, pesquisas de físicos e mecânicos. Houve a visita à empresa
mercado, público-alvo, principais empresas, parceira (Marmogran) para uma conversa so-
média de preços e táticas usadas para o au- bre as características que eles almejavam da
mento de receita. Houve também uma pes- Ecoplaca. Assim, criaram-se novos requisitos
quisa de concorrentes e do público-alvo na para a produção do corpo de prova, antes de
cidade de Açailândia, cidade onde o projeto serem destinados aos ensaios físicos e mecâ-
estava sendo desenvolvido, juntamente com nicos. Também foi definido o público em po-
o Senai - MA, Senai Açailândia e Marmogran tencial e suas características de compra.

286 INOVA TALENTOS


13

Outra atividade que começou a ser re- do SENAI- Açailândia, que se mostrava um
alizada nesse período foi a pesquisa sobre pouco relutante em atender ao método in-
fornecedores e parceiros em potencial. Fo- dustrial proposto nas reuniões anteriores.
ram encontrados aparistas e recicladores de Em março e abril, houve a continuidade
plásticos nas cidades de São Luís- MA, Açai- no planejamento do processo de produção,
lândia- MA, Imperatriz- MA e Teresina- PI. para que o design do produto e sua identida-
Duas empresas atenderam aos requisitos do de visual atendessem aos requisitos e objeti-
projeto, sendo que uma delas disponibilizou vos do projeto. Houve uma melhor comuni-
25 kg de amostras de PP (Polipropileno) e cação entre a equipe do projeto e a empresa
PS (poliestireno), reciclados e fragmentados participante, proporcionando uma troca de
para testes. ideias mais especializada.
Em dezembro de 2015, foi finalizada a Algumas reuniões semanais sobre o pro-
pesquisa sobre público-alvo, fornecedores e cesso de fabricação resultaram na produção
parceiros em potencial e análise da concor- de mais quatro Ecoplacas, produzidas em
rência. Os testes começaram a ser feitos de moldes de alumínio mais altos e com os
modo mais sistemático, utilizando uma ta- materiais mais fragmentados, diminuindo
bela de referência para documentar as quan- assim, o tempo de produção.
tidades de materiais utilizados, assim como A empresa parceira, Marmogram, parti-
suas características, quando finalizados. cipou ativamente nesses meses, fornecendo
Essa etapa de testes foi importante, pois ideias e ajudando na confecção de um mol-
ajudou a entender as características do ma- de de alumínio fundido, com um sistema
terial quando fossem realizados os testes “macho-fêmea”, para concluir alguns experi-
mecânicos e físico-químicos, pois toda a mentos. Foram produzidas duas Ecoplacas,
produção do corpo de prova deveria respei- ainda com alguns problemas de homogenei-
tar os requisitos do projeto e a identidade dade de material. Também foi produzido um
visual que produto final precisava ter. triturador de copos e papel para auxiliar no
Em janeiro e fevereiro de 2016, as Ecopla- corte dos materiais, pois, na primeira reu-
cas continuaram sendo produzidas de acor- nião com a designer bolsista, fora definida
do com os requisitos, visando atender às a necessidade de que as amostras a serem
necessidades da indústria. Assim, foram en- colhidas deveriam ser apresentadas sob for-
viados mais três corpos de prova para testes ma reduzida.
na unidade SENAI DI-MA. Houve algumas Nos últimos meses, (agosto e setembro
reuniões sobre os métodos de produção, de- de 2016) , além de a placa ser produzida no
finição da identidade visual e especificação Senai Açailândia-MA (Base da equipe do pro-
das atividades que precisariam ser desen- jeto), foi produzida também na unidade Senai
volvidas, com maior urgência pela equipe Distrito Industrial-MA (mas sem lograr êxito).

PROGRAMA RHAE TRAINEE CNPq – IEL 287


Na Unidade SENAI Açailândia-MA, foi de comunicação efetiva na hora de produzir
concluída a construção de um novo tritura- as peças.
dor e uma prensa de proporção de 80x60cm Nos primeiros meses, foram apontados
(solicitada pela empresa parceira). Desse falhas e defeitos no modo de produção, além
modo, foi feito um teste com esses novos da utilização de materiais não previstos no
materiais. O resultado final foi positivo, pois escopo do projeto. Mesmo na fase final de fa-
a Ecoplaca se adequou aos requisitos de au- bricação do produto, os químicos ainda assim
sência de porosidade e superfície lisa. Em testavam novos materiais, o que não agregava
paralelo, houve a finalização e encerramento valor e atrasava ainda mais o projeto.
das atividades do projeto proposto no Plano Como exemplo do problema, no primeiro
de Trabalho. mês foi desenvolvida uma tabela de requisi-
tos, contendo uma lista a ser preenchida com
a proporção das substâncias usadas e infor-
DISCUSSÃO mações relativas ao tratamento e tamanho
dos materiais, a serem dispostos sobre o
A maior dificuldade encontrada em um ano molde, que seria de alumínio. Esses requisi-
de projeto foi a comunicação com a equipe tos foram realizados apenas seis meses após
de químicos responsáveis pela produção a entrega.
da placa. Vale ressaltar que a pesquisadora Em março de 2016, começou a haver uma
bolsista e seu tutor trabalhavam de forma re- comunicação mais efetiva entre as equipes
mota na coordenadoria SENAI MARANHÃO excluir e a empresa parceira, permitindo
(São Luís), enquanto o restante da equipe do uma troca maior de conhecimentos capaz de
projeto se localizava no Senai de Açailândia, agregar valor ao projeto.
cidade situada no interior do estado. Para
minimizar o problema, houve contato diário
por Skype/Hangout/telefone, reuniões se- CONSIDERAÇÕES FINAIS
manais por Skype e visitas de campo a cada
dois meses. A orientação do tutor Francisco Gaspar, da
Apesar de a equipe localizada em São coordenadora do Senai-MA Scheherazade
Luís sempre se mostrar disposta a auxiliar Bastos, bem como dos demais colegas da
no projeto e a desenvolver métodos efica- COTEI e COEPT, auxiliaram sobremaneira na
zes para a produção na escala industrial, os troca de informações e conhecimentos entre
químicos ainda se mostravam relutantes em as equipes do projeto e a empresa participan-
abandonar suas técnicas de produção artesa- te, proporcionando uma comunicação mais
nal. Quando a bolsista ingressou no projeto, eficiente entre as partes.
esse já estava atrasado, devido a essa falta Além de ter aprendido mais sobre coope-

288 INOVA TALENTOS


13

ração, comunicação e bons relacionamentos


no trabalho, a bolsista pôde vivenciar a pro-
REFERÊNCIAS
dução de novos produtos e lidar com pro-
BIBLIOGRÁFICAS
blemas que aparecem no desenvolvimento
DOS SANTOS, A.L; PINTO, C.H.C; CATUNDA,
de projetos.
A.C.M.M. Percepcão da legislação ambiental,
As capacitações com foco no desenvol- gestão e destinação final dos RCD- Resíduos da
vimento de competências, oferecidas pelo construção e Demolição: um estudo de caso em Par-
programa Inova Talentos, permitiram uma namirin/RN/Brasil. HOLOS. ANO3.VOL 2.2015.

compreensão mais ampla do meio coorpo-


KERZNER, H. Project Management: A Systems
rativo e suas atividades burocráticas, além Approach to Planning, Scheduling and Controlling,
além do melhor desenvolvimento da inteli- VNR, Cincinnati – USA, 1994.
gência emocional para lidar com desafios,
MONTEIRO FILHA, Dulce Corrêa. COSTA, Ana
que passaram a ser resolvidos de forma
Cristina Rodrigues. FALEIROS, João Paulo Martin.
mais clara e multidisciplinar. NUNES, Bernardo Furtado. Construção Civil no
Participar do Inova Talentos, em conjun- Brasil: investimentos e desafios. In: Perspectivas do
to com o SENAI-MA mostrou a importân- Investimento 2010-2013. Brasilia: BNDS, 2010.

cia da inovação, bom como a necessidade


PROJECT MANAGEMENT INSTITUTE. Um Guia
de se preocupar com a cadeia produtiva do do Conhecimento em Gerenciamento de Projetos. 5
projeto do início ao fim, agregando valor em ª Edição Traduzida. Pensilvânia. 2013.
todo ciclo de vida do produto, planejando o
projeto de forma consciente, desenvolven-
do produtos ou serviços voltados às reais
necessidades do usuário, aumentando a
competitividade entre as empresas de forma
mais sustentável e desenvolvendo um mer-
cado voltado à produção de produtos ou ser-
viços que atendam a todos os stakeholders.