Journal of Agricultural Science; Vol. 5, No.

7; 2013
ISSN 1916-9752 E-ISSN 1916-9760
Published by Canadian Center of Science and Education

Genetic Diversity Analysis of Some Barley Genotypes for Salt

Tolerance Using SSR Markers
Samah A. Mariey1, Maher Noaman Mohamed1, Ismail A. Khatab2, Antar N. El-Banna2,
Amro Farouk Abdel Khalek3 & Medhat Eraqy Al-Dinary4
1
Barley Res. Dep., Field Crops Res. Institute, Agricultural Res. Center, Egypt
2
Dep. of Genetics, Faculty of Agriculture, Kafrelsheikh University, Egypt
3
Rice Res. Dep., Field Crops Res. Institute, Agricultural Res. Center, Sakha Expt. Res. Station., Egypt
4
Genetics Dep., Faculty of Agriculture, Tanta University, Egypt
Correspondence: Maher Noaman Mohamed, Barley Res. Dep., Field Crops Res. Institute, Agricultural Res. Center,
Egypt. E-mail: mahernoaman@yahoo.com

Received: March 19, 2013 Accepted: April 22, 2013 Online Published: June 15, 2013
doi:10.5539/jas.v5n7p12 URL: http://dx.doi.org/10.5539/jas.v5n7p12

Abstract
The aim of the present work was to evaluate the performance of 20 barley genotypes and find out the genetic
diversity of these genotypes for salt tolerance using simple sequence repeats during two consecutive seasons;
2009/2010 and 2010/2011. Twenty barley genotypes differed in their tolerance potentiality against salinity were
planted in two screening field experiments at two locations; Sakha, North Egypt (as a control) and El-Serw (as
saline site) to detect their tolerance to salt stress. They were planted in a randomized complete block design with
three replicates. Results revealed that the Egyptian barley cultivars Giza 123, California Mariout and genotype
no.12 (line 12 from Cyprus) were salt tolerant besides genotype no.9 (Saiko) giving a moderate salt tolerance
response and they all exhibited the highest mean values for some traits such as heading date and plant height under
saline condition. Out of ten primers used, only six primers (Bmac0209, Bmac0316, Scssr03907, Bmag770,
HVM67 and HVHOTRI) generated clear patterns with high polymorphism. This six discriminatory primer pairs
were used to evaluate the genetic diversity of salt tolerance in the 20 barley genotypes. Based on phylogenic trees
the data from the dendrogram constructed with SSR markers showed four clusters. All the salt tolerant genotypes
and some moderately salt tolerant genotypes were found in two closely related clusters, while all the sensitive
genotypes and moderate ones were closely related in the other two clusters. It was concluded that those barley
genotypes which showed salt tolerance could serve as potentially novel germplasm that could be exploited for the
development of new breeding lines with high level of salinity tolerance and to accelerate genetic advancement in
barley and better cost efficient compared to conventional and tedious screening procedures under saline field
conditions.
Keywords: Simple Sequence Repeats, agronomic characteristics, Hordeum vulgare
1. Introduction
Salinity is a major abiotic stress affecting crops in Egypt and many other countries worldwide. More than 800
million hectares of land are globally salt affected, accounting for more than 6% of the total land area (Munns &
Tester, 2008). Egypt is one of the countries that suffer severe salinity problems in some areas of the country. For
example, 33% of the cultivated land (Ghassemi et al., 1995), which comprises about 3% of total land area in Egypt,
is already salinized. The reduction in production of soils affected by salinity is about 30% (El-Lakany et al., 1986).
Barley (Hordeum vulgare L.) 2n=2x=14 is a crop with a great adaptation potential in many regions of the world.
Growers can obtain a harvest in areas with low precipitations, mainly because this crop has advantages in aspects
such as salt, drought, frost tolerance and the early period of development (Bennett & Smith, 1976). It is an
important crop, ranking the fourth crop in terms of production after wheat, rice and maize (Bengtsson, 1992). In
terms of importance, barley is used mainly for animal feed, brewing malts and for human consumption in some
countries. It is one of the most economic and important cereals grown under saline or partially reclaimed alkaline
soils.

12
www.ccsenet.org/jas Journal of Agricultural Science Vol. 5, No. 7; 2013

Ahmed et al. (2001) found that barley genotypes significantly differed in plant height, biological yield and grain
yield. They added that it was possible to identify some barley genotypes that could survive salt stress conditions.
Taghipour and Salehi (2008) studying salt tolerance of Iranian barley (Hordeum vulgare L.) genotypes in seedling
growth stages found significant differences among the genotype × stress interaction for all characteristics studied.
Their results showed that seedling growth stages were decreased in all 12 barley varieties they have studied with
increasing salinity level. Barley is also considered a model species for cereals due to its widely available genetic
information (Hayes et al., 2002). The improvement of abiotic stress tolerance in barley depends largely on
exploiting the available genetic variation in cultivated (Hordeum vulgare subsp. vulgare L.) and wild barley (H.
vulgare subsp. spontaneum C. Koch.) (Robinson et al., 2000).
Microsatellite or simple sequence repeat (SSR) markers are very useful for plant breeding and genetic diversity
studies for several reasons. SSR markers combine a number of advantages for practical applications, as they are
co-dominant and multi-allelic, stably inherited, amenable to automation and high-throughput analysis, highly
variable, and detect the highest level of polymorphism per locus (Röder et al., 2004).
They require only small amounts of sample DNA, are easy to amplify by polymerase chain reaction (PCR), are
amenable to high-throughput analysis, and are largely co-dominantly inherited, multi-allelic, highly informative,
and abundant in plant genomes (Powell et al., 1996). In barley, more than 775 microsatellites have been published
(Varshney et al., 2007), and genetic maps based on microsatellites for all seven barley chromosomes are publicly
available (Saghai-Maroof et al., 1994; Becker & Heun, 1995; Liu et al., 1996; Struss & Plieske, 1998; Ramsay et
al., 2000; Varshney et al., 2007). Numerous studies on the analysis of genetic diversity in wild and cultivated
barley have been conducted using SSRs makers (Saghai-Maroof et al., 1994; Russell et al., 1997, 2000; Struss and
Plieske, 1998; Pillen et al., 2000; Macaulay et al., 2001; Ivandic et al., 2002; Hamza et al., 2004). Marker-assisted
selection (MAS) is very efficient in backcross-assisted incorporation of single recessive resistance genes (Ordon et
al., 2004) as well as in pyramiding non-linked resistance genes (Werner et al., 2005).
Few studies (Saker, 2005) have analyzed the pattern of genetic diversity by SSR markers within Egyptian barley.
In the present research we used the SSR markers to investigate the genetic diversity among 20 Egyptian barley
genotypes for salt tolerance.
2. Materials and Methods
The present field investigation was carried out at Sakha Research Farm (North of Egypt), Barley Research
Department, Field Crops Research Institute; Agricultural Research Center during two growing seasons; 2009/2010
and 2010/2011. Laboratory work was carried out at the Central Laboratory for Environmental Studies, Kafr
El-Sheikh University, Egypt. Two field experiments were carried out in this study; the first experiment was carried
out during 2009/2010 season at two locations; El-Serw (as a saline soil) and Sakha (as a control non-saline soil)
using 20 genotypes varied in their tolerance/sensitivity to salinity stress and were sown in a small scale as
individual plants. The second experiment was carried out during 2010/2011 season at the same two locations;
El-Serw and Sakha using the same twenty genotypes but sown in a larger scale in bigger plots (1.6 m2).
The selection criteria of these genotypes were based on pedigrees, origin of each genotype and the genotype
performance, yield and its components, heading date and plant height (Eleuch et al., 2008), based on normal
distribution curve. The present investigation also intended to study molecular markers associated with salt
tolerance to be useful in barley future breeding programs. Moreover, to study the genetics of yield and yield
components in the studied barley genotypes in order to detect the best genotypes, which are expected to be salt
tolerant and to understand the genetic basis of key agronomic traits for the development of molecular markers.
2.1 Barley Genotypes
Twenty genotypes of barley (Hordeum vulgare L.) were selected from 48 genotypes based on their
tolerance/sensitivity to salinity stress (Table 1). Barley genotypes were kindly provided by Sakha Barley Research
Department, Field Crops Research Institute, Agricultural Research Center, Giza, Egypt.

13
www.ccsenet.org/jas Journal of Agricultural Science Vol. 5, No. 7; 2013

Table 1. Name, pedigree and origin of 20 barley cultivars and lines included in the second and third field
experiments
No Genotype Origin Pedigree
1 Giza 121 Egypt Baladi16/Gem.
2 Giza 123 Egypt Giza 117/FAO 86
3 Giza 124 Egypt Giza 117/Bahteem 52// Giza 118/FAO 86
Giza117/Bahteem52// Giza118/ FAO86 / 3/
4 Giza 2000 Egypt
Baladi16/ Gem.
5 Giza 132 Egypt Rihane-05//AS 46/Aths*2Athe/ Lignee 686
6 CC89 Egypt Selected from composite crosses
7 Rihane3 (R3 ICARDA As 46//Avt/Aths
8 California Mariout (CM) Egypt Selected landrace
9 Saiko FRANCE
10 Beecher USA Introduced to Egypt and named Giza 118
11 Dier Alla Jordan
12 Mr 25-84/Att/3/Mari/Aths//Bc Line1 Cyprus CYB-5235-0AP
13 Alanda//Lignee527/Arar Line2 ICARDA ICB89-0829-2LAP-3AP-0TR-3AP-0AP
Aths/Lignee686/5/Apm/RL/4/API/EB48
14 9-8-2-15-4//POR/U.SASK1766/3/ Line3 ACSAD ACS-B-10328-5IZ-3IZ-IIZ-0IZ
CEL/CL
15 CM67/4/Hma-02//11012-2/cm67/3/Arar Line4 ICARDA ICB98-0238-0AP-7AP-0AP
Alanda01/5/c101021/4/CM67/ ICB890775-7AP-0AP-0AP-10AP-0AP-1A
16 Line5 ICARDA
U.Sask.1800//pro/CM67/3/dl70 P-0AP

Panniy/Salmas/5/Baca"s"/3/AC253// ACS-B-10824-10IZ-3IZ-1IZ-0IZ
17 Line6 ACSAD
C108887/C105761/4/JLB70-01

Lignee527//NK1272/3/Nacha2// ICB95-0281-0AP-6AP-0AP-7TR-1TR-0A
18 Line7 ICARDA
Lignee640/Hma-01 P
M6476/Bon//JO/York/3/M5/Galt//As46/
19 Line8 ICARDA ICB84-0156-0AP
4/Hj34-80/Astrix/5/Nk1272
20 ACSAD618//Aths/Lignee686 Line9 ACSAD ACS-B-9988-42IZ-1IZ-1IZ-0IZ

2.2 Field Experiments

Those twenty barley genotypes were grown in the field at two locations (Sakha non-saline and El-Serw saline soil)
in two cropping seasons; 2009/2010 and 2010/2011 after taking soil samples from the experimental site at El-Serw
to measure salinity level (EC). The twenty genotypes were planted in a randomized complete block design (RCBD)
with three replicates each plot consisted of a genotype, which was planted in one row 2.5-m long and 30-cm apart
in 2009/10 season and in plots of four rows 2.0-m long and 20-cm apart (plot area=1.6 m2) with three replications
in the 2010/11 growing season.
2.3 Soil Samples
Soil samples were taken before land preparation in two depths from the soil surface; i.e. 0-15 cm and 15-30 cm.
Chemical properties of the soil at El-Serw and Sakha locations for the two seasons; 2009/2010 and 2010/2011 are
presented in Table 2. Field experimental samples were analyzed according to Piper (1950) and Black et al. (1965).

14
www.ccsenet.org/jas Journal of Agricultural Science Vol. 5, No. 7; 2013

Table 2. Chemical properties of soil samples from the field experiments site at El-Serw and Sakha locations
during the two consecutive seasons, 2009/10 and 2010/11
2009/10 2010/11
Chemical properties El-Serw Sakha El-Serw Sakha
pH 8.3 7.2 8.6 7.9
-1
ECe (dsm ) 11.6 2.1 12.8 3.7
CaCO3 % 0.73 0 0.88 0
SP † 100 7.6 100 7.8
SAR ‡ 11.70 - 12.77 -
-1
Soluble cations meq100 g soil
Ca++ 7.8 4.6 10.7 4.7
++
Mg 12.5 2.5 14.7 5.7
++
Na 95 14.4 45.6 14.8
+
K 0.75 0.2 0.6 0.3
-1
Soluble anions meq100 g soil
SO4 18 6.2 36.3 7.1
-
Cl 88 10.1 21.9 10.3
HCO3 11 5.5 5.3 4.1
CO3 - - - -
† SP : Soil Paste, ‡ SAR: Sodium Absorpation Ratio.

2.4 Studied Characteristics

Five growth traits for the twenty barley genotypes were taken on ten individual plants that have been randomly
taken from the central rows of each plot including seedling growth rate (%), days to 50% heading, plant height
(cm), number of tillers m-2 and grain yield (kg m-2)
2.5 Statistical Analysis
Data collected from the two seasons were statistically analyzed as a randomized complete block design (RCBD)
using analysis of variance (ANOVA) for each season and over all the two locations in the two seasons 2009/10 and
2010/11 as a combined analysis. The mean values of genotypes and cultivars included in this trial were compared
using Duncan’s New Multiple Range Test (Duncan, 1955) (L.S.D.) at 0.05 level of probability. All statistical
analyses were performed using the computer software MSTAT-C Computer Program according to (Snedecor &
Cochran, 1969).
2.6 Microsatellite Markers, DNA Extraction and PCR Amplification
Ten microsatellite primers from the published sequences of (Saghai-Maroof et al., 1994; Pillen et al., 2000;
Ramsay et al., 2000; Karakousis, 2002) have been used for this study. They were on the average 18-24 bp in length.
Primers’ sequences, chromosomal location, size range, marker type and the reference are listed in Table 3.
Genotyped markers were assigned using the Grain Genes data base
(http://grain.jouy.inra.fr/cgibin/graingenes/browse.cgi) (Kleinhofs & Graner, 2001).

15
www.ccsenet.org/jas Journal of Agricultural Science Vol. 5, No. 7; 2013

Table 3. Barley SSRs primers, their sequences, the chromosomal location (Von Korff et al., 2004) of derived loci,
size range, marker type, motif and the reference
No Marker PCR primers Chromosome Size Type Reference
F:ATGAGCAGTCTTGTCTTAACC Hayden et.
1 HVHOTR1 2H 165 SSR
R:AGTTGGTCGCTAGATCTTATG al. (2006)
F:GTCGGGCTCCATTGCTCT Sato K et al.
2 HVM67 4H 116 SSR
R:CCGGTACCCAGTGACGAC (2009)
F:CTGTAAGTGAGACAATCGACA Ramsy et al.
3 HVAMY2 7H 134 SSR
R:CAGTTGAACCCCTGAAAG (2000)
F:CATGGGAGGGGACAACAC Ramsy et al.
4 HVHVA1 1H 136 SSR
R:CGACCAAACACGACTAAAGGA (2000)
F: GGTAAGGAGTGGGTCTCAGG SSR, Hearnden et
5 scssr0013 6H 168
R:CAAGCAGATGCAACTACACC SNP al. (2007)
F: CTCCCATCACACCATCTGTC SSR, Hearnden et
6 scssr0397 5H Unknown
R: GACATGGTTCCCTTCTTCTTC SNP al. (2007)
F': ATGGTAGAGGTCCCAACTG Ramsy et al.
7 Bmac0316 6H 135 SSR
R :ATCACTGCTGTGCCTAGC (2000)
F: CTAGCAACTTCCCAACCGAC Varshney et
8 Bmac0209 3H 176 SSR
R:ATGCCTGTGTGTGGACCAT al. (2007)
F: AAGCTCTTTCTTGTATTCGTG Ramsy et al.
9 Bmag770 1H 158 SSR
R: GTCCATACTCTTTAACATCCG (2000)
F:CGATGACCATTGTATTGAAG Varshney et
10 Bmag0387 5H 123 SSR
R: CTCATGTTGATGTGTGGTTAG al. (2007)
F=Forward, R=Reverse.

Genomic DNA of the 20 barley genotypes was extracted from leaves isolated using CTAB method adapted by
(Doyle & Doyle, 1990). The quantification of DNA was confirmed by agarose gel electrophoresis (2%) in 1 x TBE
buffer against 100 bp DNA Ladder as a size marker. Polymerase chain reaction (PCR) amplification was prepared
in volume of 25 µl using 40 ng genomic DNA, 2 µmol dNTP, 25 mM MgCl2, 10 pmol of each primer (forward and
reverse), 5U Taq polymerase.). PCR cycling was carried out as the following program; one cycle at 95°C for 5
min., then 35 cycles were performed as follows: 1min. at 95°C for denaturation, 45 sec. at (based on primer almost
54~56°C) for annealing and 30 sec. at 72°C for extension. Reaction was incubated at 72°C for 7 min then at 4°C
for keeping.

2.7 Statistical Analysis and Data Scoring

The amplified bands from SSR were scored under the heading of total scorable fragments. Amplification profiles
of the 20 barley genotypes were compared with each other and bands of DNA fragments were scored as a binary
data where presence (1) or absences (0), for all accessions and then converted to a genetic similarity (GS) matrix.
The data were used to estimate genetic similarity (GS) on the basis of the number of shared amplification products
(Nei & Li, 1979). The coefficients were calculated by the following statistical equation:
F=2Nxy/(Nx + Ny)
Where, F is the similarity coefficient in which Nx and Ny are the number of fragments in genotypes x and y,
respectively, where Nxy is the number of fragments shared by the two genotypes (Lynch, 1990).
Phylogenetic trees were constructed based on similarity matrix obtained with neighbor joining (NJ) method using
Jaccard formula djk=M/(M+N). The relationships among genotypes were displayed as dendrogram using the
NTSYSpc 2.01 software package (Rohlf, 1998). Finally, percent polymorphism was calculated using the formula,
Total number of polymorphic bands
Percent polymorphism X 100
Total number of bands

16
www.ccsenet.org/jas Journal of Agricultural Science Vol. 5, No. 7; 2013

3. Results and Discussion

Data were classified into two major topics; field screening and molecular analysis:
3.1 Field Screening
Generally, field screening for salinity tolerance remains the main tool, despite its limitation of time required and
environmental dependency. However, many potential criteria or traits have been proposed for field screening.
The significance and the mean performance of the 20 barley genotypes were calculated for the five studied
characteristics for the twenty genotypes which were selected from 48 genotypes and were grown in the field at two
locations (Sakha non-saline and El-Serw saline soil) in two cropping season 2009/2010 and 2010/2011.
3.1.1 Seedling Rate (SR)
Seedling rate of each genotype was estimated and data were analyzed and tabulated in Table 4. The data showed
high significant differences among all 20 genotypes at seedling stage at both locations and their combined during
the 2009/10 season. Data in Table 5 indicate that the mean values of the highest germination of seedling stage were
obtained from barley cultivar no.2 (Giza 123) and barley cultivar no. 8 (California Mariout) which gave 100%
germination at both locations and in their combined, whereas under Sakha conditions, about seven barley
genotypes gave 100% germination. On the other hand, barley genotype no.18 gave the lowest mean value of the
germination under El-Serw (26.7%), (66.7%) under Sakha and about (46.7%) in the combined between the two
locations followed by barley cultivar no.5 (Giza 132) giving (26.7%) under El-Serw conditions, (73.3%) under
Sakha and (50.0%) in their combined. Moreover, in 2010/11 growing season, the data in Table 8 show high
significant differences among all 20 genotypes at both locations; and their combined analysis. Data in Table 9
indicate that the mean values of the highest germination of seedling stage were obtained from barley cultivar no.2
(Giza 123) and no.8 (California Mariout), whereas barely genotype no.12 gave the same rate of germination at
both locations (El-Serw and Sakha) and in their combined recording 78.3, 100 and 89.2% germination,
respectively. At Sakha, about eight barley genotypes gave 100% germination. On the other hand, barley genotype
no.17 gave the lowest mean value of the germination at El-Serw (8.3%), and about (47.5%) in the combined
between the two locations, while barley genotype no.5 (Giza 132) and barley genotype no.11 (Dier Alla) both
gave the same value (80.0%) at Sakha. Those results were similar to the findings of (Naseer et al., 2001; Taghipour
& Salehi, 2008). High significant interaction (GxL) between the two locations (L) and genotypes (G) for seedling
rate was detected (Table 9). Those results were similar to the findings reported by (Naseer et al., 2001; Taghipour
& Salehi, 2008) who reported that salt tolerance at the seedling stage is important because the initial plant stand
affects the final production in growth stages. High significant interaction (GxL) between the two locations (L) and
Genotypes (G) for seedling rate was detected (Table 5). Those results were similar to those obtained by (Taghipour
& Salehi, 2008) who found that there were significant differences among the genotype × stress interaction for
seedling growth.
3.1.2 Days to Heading (DH)
Concerning days to heading (DH), data presented in Table 4 show high significant differences for this
characteristic among barley genotypes and between the two locations and their combined during the 2009/2010
growing season. Results in Table 5 show the means for DH of the 20 barley genotypes under study at the two
locations. The results showed that genotype no. 12 was the earliest at the two locations; El-Serw and Sakha (79.3
and 89.3 days), respectively. In addition, this genotype was the earliest across the two locations having an
average of 84.3 days. On the other hand, the latest barley cultivar was no.11. (Dier Alla) with average values of
(89.3 days) at El-Serw, while under Sakha barley cultivar no.5 (Giza 132) was the latest (96.0 days) followed by
barley cultivar no.11 (Dier Alla), which recorded (94.0 days). In addition, the same barley cultivar genotype no. 11
(Dier Alla) headed later over the two locations (91.7 days) as well as in the second season, 2010/11. Data of the
appearance of 50% of spikes from the sheath (known as days to heading) are presented in Table 8 showing high
significant differences for this characteristic among the 20 barley genotypes at both locations; saline (El-Serw) and
non-saline (Sakha) and their combined during the 2010/11 growing season. Results in Table 9 show the means of
DH of the 20 barley genotypes under study for the two locations and their combined. Results show that barley
cultivar no.9 (Saiko) was the earliest at the two locations; El-Serw and Sakha (87.7 and 96.3 days), respectively. In
addition, this genotype was the earliest across the two locations having an average of 92.0 days. On the other hand,
the latest barley genotype was no.17 with average of 101.7 days at El-Serw, while at Sakha barley genotype no.10
(Beecher) and no.11 (Dier Alla) were both the latest genotypes and had the same value recording (105.7 days). In
addition, the same two barley cultivars no.10 (Beecher) and no. 11 (Dier Alla) headed later over the two locations
with mean values of (102.2 and 102.3 days), respectively. These results are in agreement with those reported by

17
www.ccsenet.org/jas Journal of Agricultural Science Vol. 5, No. 7; 2013

(Ellis et al., 2000; Mariey, 2004; Oraby et al., 2005; Eleuch et al., 2008). Data in Table 9 show significant
interaction (LxG) between the two locations (L) and genotypes (G) for heading date.

Table 4. Mean squares of seedling rate, days to heading, and plant height for 20 barley genotypes under El-Serw,
Sakha conditions and their combined in the first experiment during 2009/2010 growing season
Seedling rate Days to heading Plant height

(days) (days) (cm)

DF
S.O.V. Location Location Location

Combined

Combined

Combined
El-Serw Sakha El-Serw Sakha El-Serw Sakha

Rep. 2 206.6 46.66 210 125 6.87*** 3.56* 75.25 4.74 29.72

Genotype 19 1730.17*** 394.39*** 1749.29*** 22.203*** 48.76*** 22.885*** 66.107** 365.828*** 330.81***

Location 1 16803.3*** 2585.40*** 19364.6***

Gen x Loc. 19 375.26*** 11.075*** 101.119***

Error 78 76.666 0.9002 16.121

*, ** and *** indicate significance at P ≤ 0.05, 0.01, and 0.001.

Table 5. Mean performance of seedling rate, days to heading, and plant height as affected by 20 barley genotypes
under El-Serw and Sakha conditions and their combined in the first experiment during 2009/10 growing season
Seedling rate (%) Days to heading (days) Plant height (cm)
Genotype
El-Serw Sakha Combined El-Serw Sakha Combined El-Serw Sakha Combined
1 86.7 100.0 93.3 81.0 91.3 86.2 58.2 96.7 77.4
2 100.0 100.0 100.0 79.7 89.3 84.5 61.3 100.5 80.9
3 60.0 86.7 73.3 80.0 90.7 85.3 59.4 86.2 72.8
4 86.7 100.0 93.3 81.3 93.0 87.2 60.4 77.3 68.8
5 26.7 73.3 50.0 80.3 96.0 88.2 46.5 58.9 52.7
6 73.3 86.7 80.0 80.7 90.7 85.7 49.7 75.3 62.5
7 86.7 100.0 93.3 81.7 92.0 86.8 57.2 79.0 68.1
8 100.0 100.0 100.0 80.0 90.0 85.0 58.7 88.3 73.5
9 93.3 100.0 96.7 82.3 93.7 88.0 55.8 90.7 73.2
10 40.0 86.7 63.3 88.0 93.7 90.8 49.5 74.1 61.8
11 46.7 73.3 60.0 89.3 94.0 91.7 54.5 82.0 68.2
12 93.3 100.0 96.7 79.3 89.3 84.3 62.2 86.9 74.5
13 73.3 100.0 86.7 83.3 91.0 87.2 56.4 82.1 69.2
14 66.7 93.3 80.0 81.0 90.0 85.5 59.3 79.0 69.2
15 53.3 100.0 76.7 81.0 91.0 86.0 53.7 68.6 61.1
16 46.7 73.3 60.0 87.7 90.7 89.2 52.0 69.7 60.8
17 40.0 86.7 63.3 82.0 91.7 86.8 51.3 73.1 62.2
18 26.7 66.7 46.7 84.0 92.3 88.2 47.3 66.7 57.0
19 86.7 100.0 93.3 84.7 92.0 88.3 56.8 99.4 78.1
20 66.7 100.0 83.3 81.7 92.3 87.0 58.7 82.6 70.7
Average 67.7 91.3 79.5 82.5 91.7 87.1 55.4 80.9 68.1
L.S.D. 0.05 16.06 12.87 10.06 1.59 1.37 1.09 7.71 5.12 4.62
C.V.% 14.36 8.53 11.01 1.17 0.89 1.08 8.41 3.84 5.89

18
www.ccsenet.org/jas Journal of Agricultural Science Vol. 5, No. 7; 2013

3.1.3 Plant Height

In 2009/10 growing season, plant height of the 20 barley genotypes showed significant differences among the
genotypes under study. Data in Table 4 show high significant differences at the two locations and their combined
analysis. The mean performances of the 20 barley genotypes for plant height are shown in Table 5. Results indicate
that barley genotype no. 12 was ranked first for plant height (62.2 cm) under El-Serw conditions, and means of this
trait clearly indicated that the Egyptian barley cultivar genotype, Giza 123 was the tallest at each individual
locations and their combined recording 61.3, 100.5 and 80.9 cm, respectively. On the other hand, the shortest
genotype was recorded by genotype no.5 at each individual location and their combined recording 46.5, 58.9 and
52.7 cm, respectively, followed by genotype no.18 at each individual location and their combined recording 47.3,
66.7 and 57.6 cm, respectively. While in season 2010/11, plant height of the 20 barley genotypes showed
significant differences among all genotypes under study. Data in Table 8 show high significant differences at the
two locations and their combined. The mean performances of the 20 barley genotypes for plant height under the
study are shown in Table 9. Results indicate that barley genotype no. 19 was ranked first for plant height (89.3 and
105.8 cm), at El-Serw location and the combined, respectively. Mean values of this trait clearly indicate that the
Egyptian barley cultivar no.2 (Giza 123) was the tallest at Sakha location recording 124.3 cm. On the other hand,
the shortest genotype was recorded by barley cultivar no.6 (CC 89) at El-Serw location (67.3 cm), while barley
genotype no.17 was the shortest at each of Sakha location and in the combined recording 100.7 and 87.6 cm,
respectively. These results are in agreement with those recorded by (Ahmed et al., 2001; Mariey, 2004). High
Significant interaction (GxL) between the two locations (L) and genotypes (g) for plant height was detected (Table
9).
3.1.4 Number of Tillers Plant-1
Concerning number of tillers plant-1, data in Table 6 show high significant differences among the 20 barley
genotypes at the two locations; El-Serw and Sakha and their combined during 2009/10 growing season. The
results of mean performance as shown in Table 7, revealed that at El-Serw location and in the combined
analysis, barley cultivar no. 6 (CC89) had the lowest value for number of tillers plant-1 (6.4 and 8.1 tillers
plant-1), respectively, whereas at Sakha location barely genotype no.17 was recorded as the lowest genotype
for number of tillers plant-1 (8.2 tillers plant-1). The same genotype gave the lowest number at the combined
analysis between the two locations (8.1 tillers plant-1). On the other hand, barley cultivar no.1 (Giza 121)
ranked first for number of tillers plant-1 at both locations and in their combined, while barley genotype no. 12
gave the highest value for number of tillers plant-1 at Sakha location (18.8 tillers plant-1). The differences
among genotypes' ability to produce suitable number of tillers or tillers containing spikes might be attributed
to its genetically constitutions. Regarding number of tillers m-2 in the 2010/11 growing, data in Table 10 show
high significant differences among the 20 barley genotypes at the two locations; El-Serw and Sakha and their
combined. Data of the mean performance as shown in Table 11, reveal that at El-Serw location and in their
combined, barley genotype no. 5 (Giza 132) had the lowest value for number of tillers m-2 (243.0 and 313.5
tillers m-2), respectively, whereas at Sakha location, barely genotype no. 18 recorded the lowest value of
number of tillers m-2 (353.0 tillers m-2). On the other hand, barley genotype no.1 (Giza 121) gave the highest
value for number of tillers m-2 at Sakha and in their combined (597.0 and 517.0 tillers m-2), while barley
cultivar no. 2 (Giza 123) gave the highest value for number of tillers m-2 at El-Serw location (467.0 tillers m-2).
These results were supported by the results reported by (Ahmed et al., 2003; Mariey, 2004). The combined
analysis (Table 11) showed high significant effect of the interaction between locations (L) and genotypes
(GxL) for the number of tillers m-2.

19
www.ccsenet.org/jas Journal of Agricultural Science Vol. 5, No. 7; 2013

Table 6. Mean squares of No. tillers and grain yield as affected by 20 barley genotypes under El-Serw, Sakha and
their combined first experiment during 2009/10 growing season
No. Tillers plant-1 Grain yield
Location Location

Combined

Combined
S.O.V. DF
El-Serw Sakha El-Serw Sakha

Rep. 2 2.53 0.68 0.38 0.81 4.014 1.17

Genotype 19 14.832*** 25.49*** 33.5405*** 45.5913*** 134.37*** 141.45***
Location 1 259.89*** 894.34***
Gen x Loc. 19 6.7889*** 38.51***
Error 78 1.2349 2.4580
*** indicate significance at P ≤ 0.001.

Table 7. Mean of No. tillers and grain yield as affected by 20 barley genotypes under El-Serw, Sakha and their
combined in the first experiment during 2009/10 growing season
No. Tillers plant-1 Grain yield (g plant-1)
Genotype
El-Serw Sakha Combined El-Serw Sakha Combined
1 16.3 16.4 16.3 14.4 36.1 25.3
2 13.1 17.4 15.3 18.7 32.3 25.5
3 7.9 9.6 8.7 12.6 15.8 14.2
4 8.3 10.6 9.4 13.8 14.5 14.1
5 9.1 9.6 9.4 13.0 13.6 13.3
6 6.4 9.7 8.1 7.2 12.2 9.7
7 9.7 14.9 12.3 11.6 17.0 14.3
8 10.5 13.7 12.1 13.6 15.0 14.3
9 11.1 11.3 11.2 10.6 12.1 11.4
10 10.2 11.0 10.6 5.8 12.1 9.0
11 9.3 10.5 9.9 6.8 12.3 9.5
12 12.2 18.8 15.5 15.3 18.8 17.1
13 10.0 14.6 12.3 12.9 13.1 13.0
14 10.6 15.7 13.1 7.2 10.7 8.9
15 9.9 14.1 12.0 6.0 15.4 10.7
16 9.9 13.0 11.5 6.4 13.3 9.8
17 8.1 8.2 8.1 6.9 12.1 9.5
18 6.9 14.0 10.5 6.4 11.5 9.0
19 8.2 10.7 9.4 6.0 14.3 10.1
20 9.8 12.6 11.2 9.3 11.3 10.3
Average 9.9 12.8 11.3 10.2 15.7 12.9
L.S.D. 0.05 9.9 1.72 1.27 1.71 3.21 1.80
C.V.% 11.56 8.13 9.79 10.14 12.41 12.11

20
www.ccsenet.org/jas Journal of Agricultural Science Vol. 5, No. 7; 2013

Table 8. Mean squares of seedling rate, days to heading, and plant height as affected by 20 barley genotypes under
El-Serw, Sakha and their combined in the second experiment during 2010/11 growing season
Seedling rate Days to heading Plant height

(days) (days) (cm)

S.O.V. DF
Location Location Location

Combined

Combined

Combined
El-Serw Sakha El-Serw Sakha El-Serw Sakha

Rep. 2 386.25** 21.666 NS 193.95* 59.8166** 33.616*** 91.525*** 43.1166NS 177.45* 192.508**

Genotype 19 738.135*** 171.491*** 588.804*** 27.5956*** 17.389*** 32.0328*** 96.8026*** 134.34*** 134.408***

Location 1 22550.2*** 837.408*** 1159.40***

Gen x Loc. 19 320.822*** 12.952** 96.741***

Error 78 51.6506 5.6019 34.722

*, ** and *** indicate significance at P ≤ 0.05, 0.01, and 0.001.

NS Not significant at P ≤ 0.05.

Table 9. Mean of seedling rate, days to heading, and plant height as affected by 20 barley genotypes under El-Serw,
Sakha and their combined in the third experiment during 2010/11 growing season
Seedling rate (%) Days to heading (days) Plant height (cm)
Genotype
El-Serw Sakha Combined El-Serw Sakha Combined El-Serw Sakha Combined
1 76.7 100.0 88.3 93.0 101.7 97.3 78.0 116.0 97.0
2 78.3 100.0 89.2 91.3 101.3 96.3 81.0 124.3 102.5
3 75.0 93.3 84.2 98.0 104.3 101.2 71.3 123.0 97.2
4 66.7 100.0 83.3 95.3 101.0 98.2 85.3 118.7 102.0
5 50.0 80.0 65.0 97.0 102.3 99.7 86.0 115.7 92.2
6 71.7 90.0 80.8 97.7 102.7 100.2 67.3 110.7 89.0
7 73.3 100.0 86.7 97.3 99.0 98.2 79.7 112.0 95.8
8 78.3 100.0 89.2 97.3 100.0 98.7 80.7 120.7 100.7
9 65.0 100.0 82.5 87.7 96.3 92.0 82.3 116.7 99.5
10 73.3 86.7 80.0 98.7 105.7 102.2 81.7 103.0 92.3
11 75.0 80.0 77.5 99.0 105.7 102.3 83.7 113.3 98.5
12 78.3 100.0 89.2 97.0 99.0 98.0 68.7 113.7 99.8
13 70.0 100.0 85.0 93.3 99.3 96.3 75.3 121.7 98.5
14 63.3 96.7 80.0 94.3 100.3 97.3 77.3 104.0 90.7
15 68.3 100.0 84.2 96.0 103.0 99.5 86.0 114.0 95.5
16 70.0 83.3 76.7 95.3 103.7 99.5 81.3 107.7 94.5
17 8.3 86.7 47.5 101.7 99.3 100.5 73.3 100.7 87.0
18 56.7 86.7 71.7 97.3 101.3 99.3 76.3 113.0 94.7
19 61.7 100.0 80.8 95.3 100.0 97.7 89.3 122.3 105.8
20 75.0 100.0 87.5 97.0 99.3 98.2 76.3 115.0 95.7
Average 66.75 94.17 80.47 95.98 101.26 98.63 79.04 114.4 96.45
L.S.D. 0.05 13.25 9.12 8.26 4.69 3.03 2.72 6.52 12.18 6.77
C.V.% 12.02 5.86 8..93 2.95 1.81 2.30 5.01 6.44 6.12

21
www.ccsenet.org/jas Journal of Agricultural Science Vol. 5, No. 7; 2013

Table 10. Mean squares of No. Tillers and grain yield as affected by 20 barley genotypes under El-Serw, Sakha
and their combined in the second experiment during 2010/11 growing season
No. Tillers m-2 Grain yield (kg m-2)
Location Location
S.O.V.

Combined

Combined
DF
El-Serw Sakha El-Serw Sakha

Rep. 2 12196.867** 894.066 NS 3259.9NS 0.0125NS 0.04829* 0.05352**

Genotype
19 10266.119*** 9537.90*** 16137.04*** 0.12658*** 0.10128*** 0.12446***

Location 1 124163.3*** 13.0020***

Gen x Loc. 19 3666.982*** 0.10339***
Error 78 1461.609 0.00905
*, ** and *** indicate significance at P ≤ 0.05, 0.01, and 0.001.
NS Not significant at P ≤ 0.05.

3.1.5 Grain Yield

Regarding grain yield and its response to salinity stress, in the 2009/10 growing season, high significant
differences for grain yield among all 20 barley genotypes was detected as shown in Table 6. Mean values of grain
yield per plant under study are found in Table 7. The maximum grain yield per plant (36.1 g) was obtained by
barley cultivar no.1 (Giza 121) at Sakha followed by barley cultivar no.2 (Giza 123) at El-Serw and the combined
(18.7 and 25.5 g), respectively, whereas the minimum value (5.8 g) was obtained by genotype no.10 at El-Serw
location, whereas barley genotype no. 14 gave the lowest value at Sakha and the combined recording 10.7 and 8.9
g, respectively. Moreover, high significant differences for grain yield among all 20 barley genotypes were detected
(Table 10), in the 2010/11 growing season and the mean values of grain yield are presented in Table 11. The
maximum grain yield was obtained by barley cultivar no.2 (Giza 123) at El-Serw and combined (0.98 and 1.11 Kg
m-1), while genotype no.20 gave the maximum grain yield (1.60 Kg m-2) at Sakha. On the other hand, the minimum
value (0.17 Kg m-2) was obtained by genotype no.17 at El-Serw location, while barley genotype no.5 (Giza 132)
gave the lowest value at Sakha and combined recording (0.97 and 0.66 Kg m-2), respectively. These results are in
agreement with those reported by (Ahmed et al., 2001; Ahmed et al., 2003; Mariey, 2004; Oraby et al., 2005). The
combined analysis (Table 11) showed high significant effect of the interaction between locations (L) and
genotypes (GxL). It was also concluded from this investigation that there was an interaction between genotypes
and environment, and there were two barley genotypes including genotypes no. 9 (Saiko) from (France) and barley
genotype no.12 (line from Cyprus), out yielded the check cultivars (Giza 123 and Giza 124) in grain yield,
significantly. They also have some other advantages such as earliness, plant height, and number of tillers m-2.
Therefore, it is suggested that these two genotypes need more genetic stability studies to be grown in such saline
soils and could be used as new tolerant genotypes for the saline breeding programs. We also consider barley
genotype no.17 (from ACSAD) as sensitive for salinity stress and can be used in barley breeding program and
molecular studies as well.

22
www.ccsenet.org/jas Journal of Agricultural Science Vol. 5, No. 7; 2013

Table 11. Mean of No. tillers and grain yield for 20 barley genotypes under El-Serw, Sakha and their combined in
the second experiment during 2010/11 growing season
No. Tillers m-2 Grain yield (kg m-2)
Genotype
El-Serw Sakha Combined El-Serw Sakha Combined
1 437.0 597.0 517.0 0.55 1.53 1.04
2 467.0 479.0 473.0 0.98 1.23 1.11
3 370.0 461.0 415.5 0.62 1.27 0.94
4 297.0 400.0 348.5 0.58 1.33 0.96
5 243.0 384.0 313.5 0.35 0.97 0.66
6 379.0 379.0 379.0 0.63 1.23 0.93
7 367.0 423.0 395.0 0.98 1.17 1.08
8 430.0 453.0 441.5 0.42 1.10 0.76
9 297.0 451.0 374.0 0.35 1.10 0.73
10 317.0 376.0 346.5 0.43 1.00 0.72
11 333.0 373.0 353.0 0.58 1.15 0.87
12 453.0 456.0 454.5 0.63 1.57 1.10
13 390.0 395.0 392.5 0.68 1.00 0.84
14 380.0 419.0 399.5 0.57 1.10 0.83
15 395.0 477.0 436.0 0.73 1.10 0.92
16 343.0 401.0 372.0 0.58 1.07 0.83
17 327.0 367.0 347.0 0.17 1.23 0.70
18 299.0 353.0 326.0 0.33 1.18 0.76
19 343.0 451.0 397.0 0.33 1.33 0.83
20 397.0 463.0 430.0 0.58 1.60 1.09
Average 363.2 427.9 395.6 0.55 1.21 0.89
L.S.D. 0.05 63.3 52.7 43.9 0.115 0.191 0.109
C.V.% 10.53 7.45 9.66 12.5 9.53 10.76

3.2 Molecular Analysis

Out of the 10 used SSR primer pairs, only six primers (Bmac0209, Bmac 0316, Scssr 03907, Bmag770, HVM67
and HVHOTRI) generated clear patterns with high polymorphism. Three primers showed monomorphic band
profiles (Scssr 0013, Bmag 0387 and HVHVA1), and one primer (HVAMY2) did not show any amplification even
when repeated twice and did not generate any bands, therefore it was discarded (Table 12).

Table 12. Barley SSR primers, their amplified fragments, polymorphic and the polymorphism parentage
Amplified fragments
Primer Polymorphism %
Total (T) Polymorphic
HVHOTR1 2 1 50
HVM67 3 2 66
HVHVA1 1 0 0
Scssr0013 1 0 0
Scssr03907 3 3 100
Bmac0316 5 4 80
Bmac0209 3 3 100
Bmag770 4 4 100
Bmag0387 1 0 0
HVAMY2 0 0 0

23
www.ccsenet.org/jas Journal of Agricultural Science Vol. 5, No. 7; 2013

3.2.1 Diversity Analysis

The six discriminatory primer pairs were used to evaluate the genetic diversity and association of salt tolerance in
20 barley genotypes. These primer pairs revealed a total of 23 alleles ranging from two to five alleles per locus
(Table 12). For all tested genotypes, the highest number of bands was developed by the primer Bmac0316 (five
bands), followed by Bmag770 (four bands). Moreover, the primer Bmac0209 showed unambiguous scorable
bands with the 20 barley genotypes with varying responses to salinity stress, it showed three bands with 100%
polymorphism. Also, the primer Scssr03907 gave fewer bands number but have high polymorphic percentage; it
showed three bands, with 100% polymorphism, while the marker HVM67 produced three bands with 66%
polymorphism. However the lowest number of bands was found by the primer HVHOTRI which gave two bands
with 50% polymorphism.
3.2.2 Cluster Analysis
Based on phylogenic trees using rooted neighbor joining (NJ) the dendrogram (Figure 1) constructed with SSR
markers data showed four clusters. All the tolerant genotypes and some moderately tolerant ones were found in
closely related three clusters, which consisted of the tolerant genotypes. The first cluster included (California
Mariout, G. 123, Line 8, Line 9, Saiko and Giza 2000), while the other two clusters included the moderate tolerant
genotypes in two clusters; the first cluster included Rihane-03 and Line 1 and second cluster included two
genotypes (line 2 and line 4). On the other hand, the most closely related two clusters consisted of Giza 124 only
and the other cluster consisted of all the sensitive and moderate sensitive genotypes together. The second cluster
divided into two subgroups. The first subgroup consisted of Giza 121 only and the second subgroup consisted of
sensitive and moderate genotypes. This cluster could be divided into two subgroups; the first subgroup consisted of
sensitive genotypes as Line 5, Giza 132, CC89, Dier Alla, Beecher and Line 6, while the second subgroup included
two genotypes (Line 3 and Line 7) as moderate sensitive genotypes. Considering the alleles produced with respect
to California Mariout and G. 123, all primer alleles were linked to genotypes that were tolerant or moderately
tolerant to salt stress.

24
www.ccsennet.org/jas Journal of A
Agricultural Sciience Vol. 5, No. 7; 2013

Figuure 1. Rooted neighbor

n joininng (NJ) phyloggenetic tree forr 20 barley gennotypes based oon SSR make

3.2.3 Geneetic Similarity

The genetiic similarity matrix
m was estaablished by sim
mple matchingg coefficient ussing the data ggenerated by th he six
expressingg primers. Thesse primers enaabled us to disccriminate all thhe genotypes annd to study thee genetic variab
bility
for salt tollerance among the improved varieties and llines. The sim milarity index shhowed more reelation and clo ose in
most tolerrant genotypess and they aree more divergged than other sensitive geenotypes. Regaarding the tolerant
genotypes they were classified into ttwo clusters, tthe first clusteer included thhe tolerant gennotypes (Califfornia
Mariout, G G. 123, Line 8, Line 9, Saiko and Giza 20000) which weree similar to eacch other and theeir GS ranged from
0.53 to 0.886%. Howeverr, the second clluster includedd Rihane-03 annd Line1, thesee two genotypes were genetiically
very similar to each othher (GS=0.86% %), also the twwo genotypes S Saiko and Gizaa 2000 were vvery similar to each
other (GS=0.86%). On the other hannd, the subgrooup clusters inncluded the seensitive and m moderate genottypes
including two subgroupp clusters. In tthe second suubgroup clusterr the two gennotypes (line 3 and line 7) were
geneticallyy very similar to each otherr (GS=0.92%)), and Giza 1221 was similarr to the sensitiive group with h GS
ranging from 0.47% bettween Giza 1221 and line 6 to 0.82% betw ween Giza 1211 and Line7. A Also Giza 124 4 was
similar to the sensitive genotype line 6 with (GS=339%). Regardiing the relativveness betweenn the most tolerant
genotype C California Maariout and the most two sennsitive genotyppes, line 6 with GS=0.35% and Beecher with
GS=0.31% %. We could coonclude that thhere was swervved between toolerant group aand sensitive group.

25
www.ccsenet.org/jas Journal of Agricultural Science Vol. 5, No. 7; 2013

Markers validation in independent genotypes of different genetic background is essential in determining the
effectiveness and reliability of the markers to predict phenotypic (Lin et al., 1998; Koyama et al., 2001; Collins et
al., 2003; Cakir et al., 2003), which indicates that SSR marker, could be used in routine screening for
marker-assisted selection (MAS). Markers should also be validated by testing for the presence of the markers on a
range of cultivars and other important genotypes. Therefore, marker-assisted selection for salinity tolerance could
be genotype resistance specific. Interestingly enough, our findings indicated that the potential efficacy of highly
informative SSR markers were efficient screening for brewing genotypes in barley. Genetic relationships among
barley varieties revealed by genetic similarity at SSR levels were in agreement with their roles in agricultural
production and breeding (Qian et al., 2011). As a good confirmation, Karakousis et al. (2003) argued the
usefulness of polymorphic SSR markers for the discrimination of breeding material in Australian barley. In barley,
important traits such as salt tolerance are controlled by polygenes with additive and dominant effects that are
described by quantitative trait loci (QTLs) (Eilles et al., 2000) as salt tolerance is controlled by a variety of
mechanisms.
The presence of moderately tolerant to highly sensitive genotypes in the same cluster group confirms the presence
of polygene controlling salt tolerance. Also cluster of all salt tolerant diverse genotypes at seedling stage with
varying marker response to cluster groups indicates that some markers are more suitable for use in marker-assisted
breeding than the other and that HVHOTRI was best in marker-assisted selection followed by Bmac0316, HVM67
and Bmac 0209. These results are in a good harmony with those reported by (Eleuch et al., 2008; Chaabane et al.,
2009; Aliyu et al., 2011). For the present study we can consider that these genotypes which showed salt tolerance
could serve as potentially novel germplasm that could be exploited for the development of new breeding lines with
high level of salinity tolerance and to accelerate genetic advancement in barley and cost-efficient than
conventional screening under saline field conditions. The productivity of SSR markers may be due to the
possibility of amplification of the different size fragments from different regions of the genome or may be
dependent on the genotypes; it clearly indicated that there were correlations among the salt tolerant genotypes.
References
Ahmad, A. N., Intshar, U. H. J., Shamshad, A., & Muhammad, A. (2003). Effects of Na, SO2 and NaCl salinity
levels on different yield parameters of barley genotypes. Intl. J. Agric. Biol., 5(2), 157-159.
Ahmed, I. A., El-Hag, A. A., Amer, K. A., El-Moselhy, M. A., & Said, M. A. (2001). Evaluation of some barley
genotypes for salt tolerance. National Coordination Meeting, Egypt, ARC, Cairo, Sept., 2-4.
Aliyu, R., Adamu, A. K., Muazu, S., Alonge, S. O., & Gregorio, G. B. (2011). Tagging and validation of SSR
markers to salinity tolerance QTLs in Rice (Oryza spp.). International Conference on Biology, Environment
and Chemistry (IPCBEE vol.1).
Becker, J., & Heun, M. (1995). Barley microsatellites: allele variation and mapping. Plant Mol Biol., 27, 835-845.
http://dx.doi.org/10.1007/BF00020238
Bengtsson, B. O. (1992). Barley Genetics. Trends in Genetics, 8, 3-5.
http://dx.doi.org/10.1016/0168-9525(92)90003-M
Bennett, M. D., & Smith, J. B. (1976). Nuclear DNA amounts in angiosperms. Philos. Trans. R. Soc. Lond. Ser.,
274, 227-274. http://dx.doi.org/10.1098/rstb.1976.0044
Black, C. A., Evans, D. D., White, J. L., Ensminger, L. E., & Clark, F. E. (1965). Methods of Soil Analysis. Part 2.
Agron. Monogr. 9. Wisconsin, USA: American Society of Agronomy, Madison.
Cakir, M., Gupta, S., Platz, G. J., Ablett, G. A., Loughman, R., Emebiri, L. C., … Appels, R. (2003). Mapping and
validation of the genes for resistance to Pyrenophora teres f. teres in Barley (Hordeum vulgareL.). Aust J
Agric Res., 54, 1369-1377. http://dx.doi.org/10.1071/AR02229
Chaabane, R., El Felah, M., Ben Salah, H., Ben Naceur, M., Abdelly, C., Dalila, R., … Saker, M. (2009).
Molecular Characterization of Tunisian barley (Hordeum vulgare L.) genotypes using microsatellites (SSRs)
markers. European Journal of Scientific Research, 36(1), 6-15
Collins, H. M., Panozzo, F., Logue, S. J., Jefferies, S. P., & Barr, A. R. (2003). Mapping and validation of
chromosome regions associated with high malt extract in barley (Hordeum vulgare L.). Aust. J. Agric. Res.,
54, 1223-1240. http://dx.doi.org/10.1071/AR02201
Doyle, J. J., & Doyle, J. L. (1990). Isolation of plant DNA from fresh tissue. Focus, 12, 13-15.
Duncan. (1955). Multiple range and multiple F-test. Biometrics, 11, 1-42.

26
www.ccsenet.org/jas Journal of Agricultural Science Vol. 5, No. 7; 2013

EI-Lakany, M. H., Hassan, M. N., Ahmed, A. M., & Mounir, M. (1986). Salt affected soils and marshes in Egypt;
their possible use for forages and fuel production. Reclamation and Revegetation Research, 5, 49-58.
Eleuch, L., Jilal, A., Grando, S., Ceccarelli, S., Schmising, M. K., Tsujimoto, H., … Baum, M. (2008). Genetic
diversity and association analysis for salinity tolerance, heading date and plant height of barley germplasm
using simple sequence repeat markers. J. Integr. Plant Biol., 50, 1004-1014.
http://dx.doi.org/10.1111/j.1744-7909.2008.00670.x
Ellis, R. P., Forster, B. P., Robinson, D., Handley, L. L., Gordon, D. C., Russell, J. R. … Powell, W. (2000). Wild
barley: a source of genes for crop improvement in the 21st century? J. Exp. Bot., 51, 9-17.
http://dx.doi.org/10.1093/jexbot/51.342.9
Ghassemi, F., Jakeman, A. J., & Nix, H. A. (1995). Salinisation of land and water resources: Human causes,
extent, management and case studies. Sydney, Australia: UNSW Press, and CAB International, Wallingford,
UKAgr. Expt.
Hamza, S., Hamida, W. B., Rebai, A., & Harrabi, M. (2004). SSR-based genetic diversity assessment among
Tunisian winter barley and relationship with morphological traits. Euphytica, 135, 107-118.
http://dx.doi.org/10.1023/B:EUPH.0000009547.65808.bf
Hayden, M. J., Stephenson, P., Logojan, A. M., Khatkar, D., Rogers, C., Elsden, J., … Sharp, P. J. (2006).
Development and genetic mapping of sequence-tagged microsatellites (STMs) in bread wheat (Triticum
aestivum L.). Theor. Appl. Genet., 113, 1271-1281. http://dx.doi.org/10.1007/s00122-006-0381-4
Hayes, R. B., Zhang, L., Yin, S., Swenberg, J. A., Xi, L., Wiencke, J., … Smith, M. T. (2000). Genotoxic markers
among butadiene polymer workers in China. Carcinogenesis, 21(1), 55-62.
http://dx.doi.org/10.1093/carcin/21.1.55
Hearnden, P. R., Eckermann, P. J., McMichael, G. L., Hayden, M. J., Eglinton, J. K., Chalmers, K. J. (2007). A
genetic map of 1000 SSR and DArT loci in a wide barley cross. Theor. Appl. Genet., 115(3), 383-391.
http://dx.doi.org/10.1007/s00122-007-0572-7
Ivandic, V., Hackett, C. A., Nevo, E., Keith, R., Thomas, W. T., & Forster, B. P. (2002). Analysis of simple
sequence repeats (SSRs) in wild barley from the Fertile Crescent: associations with ecology, geography and
flowering time. Plant Mol Biol., 48, 511-27. http://dx.doi.org/10.1023/A:1014875800036
Karakousis, A. (2002). The development, identification and application of SSR markers for use in Australian
barley (Hordeum vulgare L.) breeding programs. PhD thesis, Department of Plant Science, University of
Adelaide, Australia.
Karakousis, A., Gustafson. J. P., Chalmers. K. J., Barr. A. R., & Langridge, P. (2003). A consensus map of barley
integrating SSR, RFLP, and AFLP markers. Aus. J. Agr. Res., 54, 1173-1185.
http://dx.doi.org/10.1071/AR02177
Kleinhofs, A., & Graner, A. (2001). An integrated map of the barley genome. In R. L. Phillips, & I. K. Vasil (Eds.),
DNA-based Markers in Plants (2nd ed., pp. 187-200). Dordrecht: Kluwer Academic Publishers.
http://dx.doi.org/10.1007/978-94-015-9815-6_12
Koyama, M. L., Aurora, L., Robert, M. D. K., Timothy, J. F., & Anthony, R. Y. (2001). Quantitative trait loci for
component physiological traits determining salt tolerance in rice. Plant Physiol., 125, 406-422.
http://dx.doi.org/10.1104/pp.125.1.406
Lin, H., Yanagihara. S., & Zhuang, J. (1998). Identification of QTL for salt tolerance in rice via molecular markers.
Chinese Journal of Rice Science, 12(2), 72-78.
Liu, Z. W., Biyashev, R. M., & Maroof, M. A. S. (1996). Development of simple sequence repeat markers and
their integration into a barley linkage map. Theor. Appl. Genet., 93, 869-876.
http://dx.doi.org/10.1007/BF00224088
Lynch, M. (1990). The similarity index and DNA fingerprinting. Molecular Biology and Evolution, 7, 478-484.
Macaulay, M., Ramsay, L., Powell, W., & Waugh, R. (2001). A representative, highly informative ‘genotyping
set’ of barley SSRs. Theor. Appl. Genet., 102, 801-809. http://dx.doi.org/10.1007/s001220000487
Mariey, A. S. (2004). Genetical and molecular studies on barley salt tolerance. M.Sc. Thesis, Tanta Univ., Egypt.
Munns, R., & Tester, M. (2008). Mechanisms of salinity tolerance. Annu. Rev. Plant Biol., 59, 651-681.
http://dx.doi.org/10.1146/annurev.arplant.59.032607.092911

27
www.ccsenet.org/jas Journal of Agricultural Science Vol. 5, No. 7; 2013

Naseer, S. H., Nisar, A., & Ashraf, M. (2001). Effect of salt stress on germination and seedling growth of salt stress
in the selection of salt tolerance hybrids in barley (Hordeum vulgare L. ). Pak. J. Biol. Sci., 4(3), 359-360.
http://dx.doi.org/10.3923/pjbs.2001.359.360
Nei, M., & Li, W. H. (1979). Mathematical models for studying genetic variation in terms of restriction
endonucleases. Proc Natl. Acad. Sci., 76, 5269-5273. http://dx.doi.org/10.1073/pnas.76.10.5269
Oraby, H. F., Ransom, C. B., Kravchenko, A. N., & Sticklen, M. B. (2005). Barley HVA1 Gene Confers Salt
Tolerance in R3 Transgenic Oat 2005. Crop Sci., 45, 2218-2227. http://dx.doi.org/10.2135/cropsci2004-0605
Ordon, F., Friedt, W., Scheurer, K., Pellio, B., Werner, K., Neuhaus, G., … Graner, A. (2004). Molecular markers
in breeding for virus resistance in barley. J. Appl. Genet., 45(2), 145-159.
Pillen, K., Binder, A., Kreuzkam, B., Ramsay, L., Waugh, R., Forster, J., ... Leon, J. (2000). Mapping new
EMBL-derived barley microsatellites and their use in differentiating German barley cultivars. Theor. Appl.
Genetics, 101, 652-660. http://dx.doi.org/10.1007/s001220051527
Piper, C. S. (1950). Soil and Plant Analysis. Australia: Adelaide University Hassel Press.
Powell, W. (1996). Molecular biology. In S. W. H. Macfarlane, & T. D. Heilbron (Eds.), Scottish Crop Research
Institute Annual Report 1996/97 (pp. 79-82). Dundee: Burns and Harris.
Qian, G., Ping, J., Wang, D., Zhang, Z., & Luo, S. (2011). Malt genotypic screening of polymorphism information
content (PIC) of PCR-based marker in barley, based on physiological traits. Molecular Biology, 1, 101-106.
Ramsay, L., Macaulay, M., Ivanissevich, S. D., MacLean, K., Cardle, L., Fuller, J., … Waugh, R. (2000). A simple
sequence repeat-based linkage map of barley. Genetics, 156, 1997-2005.
Röder, M. S., Huang, X. Q., & Ganal, M. W. (2004). Wheat microsatellites: potential and implications. In H. Lörz,
& G. Wenzel (Eds.), Biotechnology in agriculture and forestry: molecular marker systems (pp. 255-266).
Springer Verlag.
Rohlf, F. J. (1998). NTSYS-pc version 2.02j. Numerical taxonomy and multivariate analysis system. Exeter
software, Setauket: New York.
Russell, J. R., Ellis, R. P., Thomas, W. B., Waugh, R., Provan, J., Booth, A., … Powell, W. (2000). A retrospective
analysis of spring barley germplasm development from ‘foundation genotypes’ to currently successful
cultivars. Mol. Breed., 6, 553-568. http://dx.doi.org/10.1023/A:1011372312962
Saghai, M. A., Biyashev, R. M., Yang, G. P., Zhang, Q., & Allard, R. W. (1994). Extraordinarily polymorphic
microsatellite DNA in barley: species diversity, chromosomal locations, and population dynamics. Proc. Natl.
Acad. Sci., 91, 5466-5470. http://dx.doi.org/10.1073/pnas.91.12.5466
Saker, M. M. (2005). Mapping RAPD and SSR markers linked to net blotch resistance gene in barley. Arab J.
Biotechnology, 8, 369-378.
Snedecor, C. W., & Cochran, W. G. (1969). Statistical Methods (6th ed.). Iowa State Univ. Press, Ames, Iowa,
USA.
Struss, D. (1998). The use of microsatellite markers for detection of genetic diversity in barley populations.
Theor. Appl. Genet., 97, 308-315. http://dx.doi.org/10.1007/s001220050900
Taghipour, F., & Salehi, M. (2008). The study of salt tolerance in Iranian barley (Hordeum vulgare L.) genotypes
in seedling growth stage. Am Eu J. Agric. Environ. Sci., 4, 525-529.
Varshney, R. K., Marcel, T. C., Ramsay, L., Russell, J., Röder, M. S., Stein, N., … Graner, A. (2007). A high
density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics, 114(6),
1091-1103. http://dx.doi.org/10.1007/s00122-007-0503-7
Werner, K., Friedt, W., & Ordon, F. (2007). Localisation and combination of resistance genes against soil-borne
viruses of barley (BaMMV, BaYMV) using doubled haploids and molecular markers. Euphytica, 158(3),
323-329. http://dx.doi.org/10.1007/s10681-006-9206-4

Copyrights
Copyright for this article is retained by the author(s), with first publication rights granted to the journal.
This is an open-access article distributed under the terms and conditions of the Creative Commons Attribution
license (http://creativecommons.org/licenses/by/3.0/).

28