Bio D 1 12 PDF

Principles of Genetics
Merlyn S. Mendioro
Adelina A. Barrion
Rita P. Laude
Ma. Genaleen Q. Diaz
University of the Philippines

OPEN UNIVERSITY
Principles of Genetics
Merlyn S. Mendioro, Adelina A. Barrion, Rita P. Laude and
Ma. Genaleen Q. Diaz
Copyright © 1998 by Merlyn S. Mendioro, Adelina A. Barrion, Rita P. Laude,

Ma. Genaleen Q. Diaz and the UP Open University
Apart from any fair use for the purpose of research or private study,
criticism or review, this publication may be reproduced, stored
or transmitted, in any form or by any means
ONLY WITH THE WRITTEN PERMISSION
of the author and the UP Open University.
Published in the Philippines by the UP Open University

Office of Academic Support and Instructional Services
2/F, National Computer Center Building
CP Garcia Avenue, Diliman, Quezon City 1101
Tel/Fax (632) 426-1515
Email oasis@upou.edu.ph
First Published 1998

Reprinted 2006
Layout by Helen M. Creer
Printed in the Philippines

Preface
After a decade, here comes the first revision of BIO D (Principles of Genetics)
teaching -learning materials consisting of 24 modules intended to accompany a
one-semester course. This set of modules is the concerted team efforts of the
faculties-in-charge, tutors and other staff of the Genetics and Molecular Biology
Division of the Institute of Biological Sciences.
It was in 1988 when the first set of modules in BIO D was used by the pioneering
batch of intermediate and high school science teachers of the post-baccalaureate
degree program, the Diploma in Science Teaching (DST) major in Biology. These
modules were continuously used by DST-BIO students for eight years till 1995
when the UP Board of Regents approved the establishment of the UP Open
University (UPOU) as the 5th autonomous member of the UP System.
UPOU through the leadership of Chancellor Ma. Cristina D. Padolina stressed

that to deliver quality distance education, it must be able to provide quality
instructional materials, thus the revision of BIO D modules. The revision of the
teaching-learning materials in Genetics was taken-cared of by the course team
called quality circle composed of:
• Writers/Authors : Dr. Rita P. Laude

Dr. Adelina A. Barrion
Dr. Merlyn S. Mendioro
Prof. Ma. Genaleen Q. Diaz
• Instructional Designer : Dr. Felix Librero
• Readers : Writers exchange modules and serve as readers
• Language Editor : Dr. Teresa Velasco
• Media Specialist :
• Encoder : Ms. Elizabeth A. Melgar
• Illustrator : Mr. Victor Jun M. Ulat
The authors of the modules are greatly indebted to all the members of the quality
circle who generously gave of their special time for the revision.
In this new edition of BIO D modules, the writers present to the readers the
revised text covering both basic and applied points of view, many of which were
rewritten, new findings were incorporated, discussions were made simple,
illustrations and diagrams were artistically but scientifically presented. Genetic
concepts are easier to comprehend and learned, familiar situations are cited as
examples, and, therefore, as a whole, the revised BIO D instructional modules
are reader-friendly avoiding the telescopic “dictionary style” of textbook writing.
Also, the topics are now arranged in sequence most appropriate for dealing with
various diverse areas of Genetics. The organization of modules conveys that
Genetics is a way of thinking as well as collection of important facts.
The newly revised BIO D modules were pretested to DST-BIO students for two
consecutive semesters, SY 1998-1999. The comments and suggestions of the
student evaluators for further improvements of the modules were seriously
considered by the authors. To these student evaluators, the authors are greatly
indebted.
The authors of the modules are actually so pleased to have the opportunity to
share the up-to-date and integrated genetic knowledge to the high school science
teachers. They look forward for its multiplier effect - - teacher’s turn to extend
the learned genetic knowledge to their high school students in Biology.
Dr. Rita P. Laude

Dr. Adelina A. Barrion
Dr. Merlyn S. Mendioro
Prof. Ma. Genaleen Q. Diaz
Table of Contents
Module 1 The Beginnings and Scope of Genetics, 1
Objectives, 1
Introduction, 1
Review of Prerequisites, 2
Definition of Terms, 2
The Beginnings of Genetics, 4
Do you know who Gregor Mendel is?, 7
Specifically, what were Mendel’s contributions to the science of Genetics?, 7
Scope of Genetics, 9
Applications of Genetics, 10
Summary, 13
Answers to Review of Prerequisites , 13
Answers to Self-Assessment Questions, 14
Module 2 Cell Cycle, 17

Objectives, 17
Introduction, 17
Concept Map, 18
Summary, 23
Answer to Self-Assessment Question, 23
Module 3 Cell Division Phase: Mitosis, 25

Objectives, 25
Introduction, 25
Concept Map, 26
Summary, 33
Module 4 Cell Division Phase: Meiosis, 35

Introduction, 35
Concept Map, 36
Summary, 47
Module 5 Mendelian Principles of Heredity, 51

Objectives, 51
Introduction, 51
Concept Map, 52
Mendel’s Monohybrid Inheritance, 53
Mendel’s Dihybrid Inheritance, 57
Chromosome Theory of Inheritance, 62
Summary, 64
Module 6 Allelic and Non-Allelic Interactions, 67

Objectives, 67
Introduction, 67
Concept Map, 68
Allelic Interactions, 70
Multiple alleles, 72
Lethal genes, 74
Non-Allelic interaction, 75
Environmental Influence on Gene Expression, 81
Summary, 84
Module 7 Definition and Types of Linkage, 87

Objectives, 87
Introduction, 87
Concept Map, 89
The Discovery and Definition of Linkage, 89
Arrangement of Linked Genes, 92
Definition of Recombination, 93
Types of Linkage, 95
Summary, 100
Module 8 Linkage and Recombination: Sex Linkage, 103

Objectives, 103
Introduction, 103
Definition of Sex Linkage, 104
Types of Sex Linkage, 106
X-linked dominant, 106
X-linked recessive, 107
Y-linked traits, 110
Summary, 110
Module 9 Chromosome Mapping in Eukaryotes, 113

Objectives, 113
Introduction, 113
Steps in Constructing the Linkage Map, 115
Determination of the Strength of Linkage, 116
Summary, 119
Module 10 The Structure and Properties of the Genetic Material, 121

Objectives, 121
Introduction, 121
The Chemical Components, 123
The Structure of DNA , 124
The Three-Dimensional Structure of the DNA , 126
The Structure of RNA, 126
Properties of the Genetic Material, 127
Summary, 131
Module 11 An Overview of the Central Dogma of Molecular Biology, 135

Objectives, 135
Introduction, 135
The One “Gene - One Enzyme” and
“One Gene - One Polypeptide” Hypotheses, 138
The Central Dogma of Molecular Biology, 140
Summary, 142
Module 12 DNA Replication, 143

Objectives, 143
The Y-Fork Model of Prokaryotic DNA Replication, 144
Eukaryotic DNA Replication, 148
Accuracy of DNA Replication, 148
Summary, 151
Module 13 Transcription, 153

Introduction, 153
Steps of Prokaryotic Transcription, 153
Transcription Products and the Genetic Code, 156
Summary, 160
Module 14 Translation, 161

Objectives, 161
Introduction, 161
Steps of Prokaryotic Translation, 161
Eukaryotic Transcription and Translation, 165
RNA Processing, 166
Capping, 166
Poly A Tailing, 167
Splicing, 167
Summary, 169
Module 15 Gene Regulation and Genetic Control of Development, 173

Objectives, 173
Introduction, 173
Concept Map, 175
Differential Gene Action, 176
Gene Regulation, 177
Operons in Prokaryote, 179
How is the Operon Controlled?, 180
Nucleocytoplasmic Interactions, 184
Genetic Control of Development, 185
Summary, 189
Module 16 Mutations, 191

Objectives, 191
Introduction, 191
What is mutation?, 191
Concept Map, 192
Kinds of Mutation, 194
Variations in Genome Structure, 196
Why are monoploids sterile?, 203
How do polyploids arise?, 197
Aneuploidy, 201
Structural Changes in Chromosomes, 202
What are the Possible Genetic Effects of Deletion or Deficiency?, 204
Gene or Point Mutations, 208
Mutagenic Agents, 210
Evolutionary Significance of Mutations, 212
Summary, 213
Module 17 Delayed Chromosomal and Extrachromosomal Inheritance, 217

Objectives, 217
Introduction, 217
Concept Map, 218
Delayed Chromosomal Inheritance, 220
Extrachromosomal Inheritance, 222
Summary, 228
Answers to Questions in Review of Prerequisites, 229
Answers to Self-Assessment Questions,230
Module 18 Population Genetics: Genetic Equilibrium, 233

Objectives, 233
Introduction, 233
Concept Map, 234
The Hardy-Weinberg Principle, 235
Gene and Genotype Frequencies under H-W Equilibrium, 238
Module 19 Population Genetics: Changes in Gene Frequency, 247

Objectives, 247
Introduction, 247
Concept Map, 248
Factors that Cause Changes in Gene Frequency, 248
Summary, 261
Module 20 Inheritance of Quantitative Traits, 265

Introduction, 265
Objectives, 266
Concept Map, 256
Inheritance of Quantitative Traits, 267
Multiple genes/Polygenes, 267
Number of genes in a polygene system, 273
Summary, 275
Module 21 Analysis of Quantitative Characters, 279

Objectives, 279
Introduction, 279
Concept Map, 280
Components of Phenotype Variance, 283
Heritability, 287
Summary, 292
Module 22 Evolutionary Genetics, 287

Introduction, 287
Objectives, 288
Do you know what organic evolution is?, 288
Genetic Equilibrium = Hardy Weinberg Law, 290
Evolutionary Genetic Mechanisms, 292
Random Changes in Gene Frequency, 293
Genetic drift, 293
Mutations, 294
Recombinations, 297
Migration, 298
Directed Changes in Gene Frequency, 298
Selection, 298
Molecular Evolution, 300
Gene products, 300
Genes, 303
Evolution of Genetic Systems, 303
Summary, 306
Module 23 Human Genetics, 311

Objectives, 311
Introduction, 311
Concept Map, 312
Heritable Traits in Man, 312
The Pedigree Chart, 317
Pedigree Analysis, 318
Applications of Pedigree Analysis, 323
Summary, 324
Module 24 Recombinant DNA Technology, 329

Introduction, 329
Objectives, 330
Concept Map, 331
The General Procedure in the Genetic Engineering or Recombinant DNA Tech-
nology, 331
Applications of Recombinant DNA Technology, 337
Transgenic Plants for Insect Pest Resistance, 338
Transgenic Plants for Disease Resistance, 339
Transgenic Plants for Herbicide Resistance, 339
Transgenic Plants with Improved Qualities, 340
Applications of Recombinant DNA in Animals, 340
Summary, 342
Module 1
The Beginnings and Scope of
Genetics
Introduction
Objectives
T he production of offspring in each gene- After studying this module,

ration that are exactly, or very much, like you should be able to:
the parent or parents is called genetic
continuity or heredity. Human babies are 1. Define genetics;
always cast in the human mold and they 2. Discuss the beginnings of
usually resemble in particular ways their genetics; and
parents and siblings. Puppies always grow 3. Explain the scope of
to be dogs and usually have the body, shape, genetics.
size, color, and other characteristics of their
breed. Thus, the old proverb “ like begets like.”
The field of biological science dealing with the mechanisms of heredity,

by which traits or characteristics are passed from generation to generation,
is Genetics. Genetics also deals with variation and related biological
processes, such as reproduction, development, and evolution in all forms
of life. It seeks to understand the molecular and physical bases of
biodiversity. The scientists who study how offspring inherit characteristics
from a parent are geneticists.
2 Biology D: Principles of Genetics
SAQ 1-1
Define Genetics.
Review of Prerequisites
Your basic understanding of the processes of reproduction in diverse
organisms is needed for you to understand the subject matter fully. Please
answer the following review questions:
1. What is the relationship between reproduction and heredity?
2. Correlate Genetics with Biology.
Did you get the answers? If you do not know the answers to the above
questions, the general textbooks in biology will help you.
Definition of Terms
Abiogenesis - spontaneous generation - origin of life from non-living
things
Biodiversity - varying living forms in the biosphere
Biogenesis - origin of living organisms from other living organisms
Chromosome - threadlike structure found in the nucleus of the cell; carrier

of genes
Cytogenetics - a branch of biology that deals with the study of heredity

and variation by method of both cytology and genetics
Cytology - branch of biology that deals with the structure, function,

multiplication, pathology, and life history of cells
Cytoplasm - the protoplasm of a cell external to the nuclear membrane
UP Open University
Module 1 3
DNA - Deoxyribonucleic acid, the primary genetic material of all cells
Epigenesis - development of new characters in an initially undifferentiated

entity (as a fertilized egg or spore)
Gamete - a mature reproductive cell capable of fusing with a similar cell

of the opposite sex to form a zygote; also called sex cell
Gemmule - hypothetical particle of heredity postulated in the theory of

pangenesis
Gene - nucleotide sequence coding for a polypeptide which may be an

enzyme or part of an enzyme, which in turn is responsible for a
certain phenotype
Genetic engineering - manipulation of genes to provide variations
Genetics - the branch of biology that deals with the principles of heredity
and variation
Germplasm - germ cells collectively or sex cells
Heredity - genetic transmission of characteristics from parents to offspring
Nucleoplasm - the protoplasm of a nucleus
Pangenesis - hypothesis that every somatic cell generates self-

representative hereditary materials that enter the blood stream and
eventually coalesce in reproductive cells, making possible the
inheritance of acquired characteristics
Preformation - biological theory that all parts of future organisms exist

completely formed in the germ cell and develop only by increasing
in size
Sex chromosome - chromosome responsible for the determination of the

sex of an organism
Somatoplasm - cells of all other parts of the body produced by the

germplasm as a means to protect and reproduce itself
Variation - marked differences or deviations from characteristics, form,

function, and structure
UP Open University
The Beginnings of Genetics

For a long time, it was common to think that biological materials did not
necessarily have to be transmitted between generations. At least, until the
middle of the 18th century, practically all biologists believed that many
organisms could arise spontaneously from various combinations of
decaying matter (abiogenesis or spontaneous generation).
In the 19th century, the idea of sponstaneous generation was put to rest
by Louis Pasteur (1822-1895) and John Tyndall (1820-1893) who showed
that the birth of new organisms arose only through the continuity of life
(biogenesis).
Interest in questions about heredity is evident in the writings of Plato and

Aristotle, in the Old Testament, and in other ancient texts. In these, as in
the myths and legends of many people, the resemblances among animals
were noted as being due to common heredity. Departures from resemblances
among relatives in physical features, behavior, or in the ways in which
individuals reacted to the same environment were noted as due to variation.
SAQ 1-2
Differentiate biogenesis and abiogenesis.
Define: a. Variation
b. Heredity
Aristotle (384-322 B.C.) presented the Theory of Pangenesis which proposed

that the semen was formed everywhere in man’s body and such semen
reflected the characteristics of the body part from where it was formed.
That semen traveled through the blood vessels into the male reproductive
organs. Aristotle proposed that an organism formed through sexual
reproduction received the“substance”of the female egg and a contribution
of “form” by the male seminal fluid. The combined effect produced by
these two factors in creating a new organism did not necessarily involve
any material transfer between them but was assumed through a mystical
influence of the male semen, which Harvey (1578-1657) called aura
seminalis.
UP Open University
Module 1 5
Charles Darwin (1809-1914) believed that gemmules or very small, exact

but visible copies of each body organ and component were transported
by the blood stream to the sex organs and there they assembled into
gametes. Upon fertilization, gemmules of the opposite sex were added
and all these miniature elements then separated out to different parts of
the body during development to constitute a mixture of paternal organs
and tissues.
After the discovery of eggs and sperms, of pollen and ova, many biologists
indicated that one of the sex cells, or gametes, either sperm or egg, contained
within it the entire organism in perfect miniature form. The miniature
form will be properly nourished to unfold its preform adult proportions
(preformationalism).
Wolff (1738-1794) showed that different adult structures of both plants

and animals developed from uniform embryonic tissues. Many new factors,
such as tissues and organs, arose completely de novo through mysterious
vital forces. Von Baer (1792-1876) proposed that they arose through a
gradual transformation of increasingly specialized tissues (epigenesis).
Heredity was thought to be a “blending” process that offspring were

essential mixtures of different parental characteristics. This helped explain
the intermediate nature of the children to both parents. However, there
were cases when children resembled either one parent; these led to several
hypotheses ranging from differential quantitative contributions by each
parent to differences in wild direction during fertilization.
Jean Baptiste de Lamarck (1744-1829) proposed the Theory of

Inheritance of Acquired Characteristics based on the pangenesis theory.
Inheritance of acquired characteristics was in turn proposed to be the
fundamental mechanism of evolutionary change. For example, body
modifications acquired by use or disuse could be transmitted to the progeny
because the semen formed reflected such modifications.
SAQ 1-3
Explain in just one sentence each of the following:
a. Aristotle’s Theory of Pangenesis

b. Harvey’s aura seminalis
c. Darwin’s gemmules
d. Wolff’s epigenesis
e. Lamarck’s Theory of Inheritance of Acquired Characteristics
UP Open University
August Weismann (1834-1914) challenged the theory of pangenesis by

conducting experiments on inheritance of mice tail. He showed that cutting
off tails of mice generation after generation produced progenies with
normal tail length. He concluded that inheritance of tail length did not
depend on particles produced in the tail of parent mice but on the
germplasm cells which were not affected when tails were cut. Weismann’s
Germplasm Theory proposed that germplasm or sex cells perpetuated
themselves in reproduction generation after generation. On the other hand,
somatoplasm or cells of all other parts of the body were produced by the
germplasm only as a means to protect and reproduce itself.
By the end of the 19th century, a number of important discoveries had

been made regarding the source of heredity. Researches in cell structures
and cell divisions were made by notable biologists such as Schleiden (1804-
1881) and Schwann (1810-1882), Nageli (1817-1891), Virchow (1821-
1902), Fleming (1843-1915), and Butachi (1848-1920). The cell nucleus
named and described by Robert Brown (1773-1858) in 1833 was shown
by O. Hertwig (1849-1922) to be directly involved in sea urchin fertilization
through the union of the sperm and egg nuclei. In plants, Strasburger
(1844-1912) showed the occurrence of such union and introduced the
terms nucleoplasm and cytoplasm.
The inheritance of biological characteristics was studied by other early

scientists like Koelreuter (1733-1806) who observed that although hybrids
between species might have shown a uniform appearance, their fertile
offspring would usually produce considerable diversity. Similar
observations were reported by botanists like Gartner (1772) and Naaudin
(1815-1899). Exept for Dzierson, a bee-hybridizer, none of them took the
numerical ratios into account.
SAQ 1-4
Explain Weismann’s Germplasm Theory.
What is the source of heredity?
“The whole subject of inheritance is wonderful,” wrote Charles Darwin

in 1868. With his usual candor and honesty, Darwin admitted, however,
that the biology of his day provided no solution for what continued for
many years to be called the “riddle of heredity.” Yet at the same time
Darwin made his remark, the essential steps that led to the solution of the
riddle had already been taken by another great biologist, Gregor Johann
Mendel (1822-1884).
UP Open University
Module 1 7
Genetics is a 20th century science. It began to assume a distinctive form in

1900 when the first simple laws of biological inheritance were widely
recognized. These rules had first been formulated and proved to operate
in certain plants in the mid-19th century, in 1865, by the Austrian monk
botanist Gregor Mendel.
Do you know who Gregor Mendel is?

The modern story of genetics began with Mendel who discovered the first
principles of genetics. He was the first to pose the questions concerning
the mechanisms of hereditary transmission in terms that could be answered
by experiments designed for the purpose. These experiments on pea plants
were carried out in the garden of the Augustinian Monastery of St. Thomas
in Brunn, Austria (now Brno, Czechoslovakia) where Mendel lived and
worked. In addition to his religious duties as a member of the Augustinian
order, Mendel was also a teacher of science in the local high school. Mendel
described his experiment, which he began in 1856 and continued until
1863, in a paper entitled “Experiments in Plant Hybridization”, presented
in 1865 before the Brunn Society of Natural History and published in
1866 in a provincial scientific journal.
Specifically, what were Mendel’s contributions to

the science of Genetics?
Mendel discovered that hereditary characteristics were determined by
elementary units transmitted between generations in uniform predictable
fashion. He demonstrated that the appearance of the different characters
in heredity followed specific laws that could be determined by counting
the diverse kinds of offspring produced from any particular set of crosses.
Mendel showed that the hybrid between two parental types of garden
peas differing in a single characteristic would produce two types of gametes
in equal numbers. Each gamete was an unchanged descendant of one of
the original parental gametes. This showed that there was no blending or
dilution of inheritance, and inherited characteristics were determined by
discrete units which remained unchanged in the presence of other units
in the hybrids. He showed convincingly that simple algebra could describe
the tendency of offspring to resemble their parents.
Due to Mendel’s insights and methodologies, he was named the Father of

Genetics.
UP Open University
SAQ 1-5
Why is Genetics considered a 20th century science?
Mendel’s discovery remained unknown to most biologists and had no

influence in the progress of science until his laws were rediscovered,
confirmed, and extended in 1900, 16 years after his death, by three
scientists — Hugo de Vries of Amsterdam, Holland, Carl Correns of
Tubingen, Germany, and Erich Tschermak von Seysenegg of Vienna,
Austria. They duplicated Mendel’s experiments on garden peas, maize,
primrose, poppies, and many other flowering plants. Each of them obtained
similar ratios as those of Mendel.
In 1902, Bateson, Sanders, and Cuenot provided the information

indicating that Mendel’s principles were also applicable to animals.
In 1906, the English naturalist William Bateson first applied the name
“genetics” to the study of heredity and variation and to what he called
the physiology of descent. Genetics was derived from the Greek word
gen, meaning to become or to grow into something.
Following are other significant contributions to the science of Genetics.
1903 Walter S. Sutton of the United States of America and Theodore

Boveri of Germany indicated the association of the Mendelian
factors with the chromosomes by pointing to the resemblances in
the behavior between the two. The segregation of paired factors
that Mendel postulated during gamete formation is paralleled by
the separation of homologous chromosomes during meiosis. Such
foundation knowledge gave birth to Cytogenetics.
1908 G.H. Hardy, a British mathematician, and the German physician

W. Weinberg independently developed a relatively simple
mathematical concept, now referrred to as Hardy-Weinberg
theorem, to describe the genetic equilibrium. Such knowledge is
fundamental to Population Genetics.
1910 Thomas Hunt Morgan confirmed the chromosome theory of

inheritance through the discovery of the sex chromosomes.
UP Open University
Module 1 9
1911 Johannsen introduced the term gene and genotype as sum total of
heredity, the genetic constitution that an organism receives from
its parents. Such is the fundamental knowledge of Qualitative
Genetics.
1916 Calvin B. Bridges demonstrated that each chromosome contained

not one but many genes.
1944 O.T. Avery, C.M. MacLeod, and McCarty identified the nucleic
acids as the hereditary material.
1945 Beadle and Tatum invented a simple and ingenious method for
detecting mutations. These findings laid down the foundation of
Biochemical Genetics.
1953 J.D.Watson and F.H. Crick discovered the molecular structure

and chemical properties of DNA which resulted in better
understanding of how the genes or DNA molecules were
transmitted from generation to generation and how the genes were
expressed in individuals or populations. The chemical and
molecular processes involved in gene action and interaction, as
well as in regulation of gene action, have been firmly established,
thus giving birth to Molecular Genetics.
SAQ 1-6
How will you describe the post-Mendelian Genetics?
Scope of Genetics
Years of investigation revealed that the physical basis of heredity and
variation is the same in all forms of life — from viruses to microorganisms,
to plants, to animals, and to man. This proof of the oneness of life has
brought about a new unification of the biological sciences within which
genetics now occupies a focal position.
Genetics deals with the fundamental properties and problems of life and
living, thus impinging on all aspects of biology — biochemistry, physiology,
development, morphology, anatomy, ecology, and evolution. It also
impinges on other natural or behavioral sciences, such as chemistry,
mathematics, statistics, psychology, and sociology. All these disciplines
UP Open University
are vital to the search for the understanding of the mechanisms of

inheritance. The differences in the rates of advances in these supporting
disciplines resulted in the growth of Genetics in irregular fashion.
Genetics is important to the study of the:
1. origin of life on earth;

2. differentiation of the forms of life through factors producing changes
in the composition of populations;
3. related questions about evolution and the future prospects for life on
earth;
4. medicine and public health;
5. agriculture through plant and animal improvements, specifically
through breeding and genetic engineering; and
6. sciences of anthropology and sociology.
SAQ 1-7
Correlate genetics with basic and applied sciences.
Applications of Genetics
Do you know that Genetics has many practical applications? Following
are examples of these applications.
1. Plant and Animal Improvement. The history of improvement of food

crops and domestic animals by selective breeding is too well known.
High yielding and pest-resistant varieties of rice, corn, sorghum, and
wheat have been the most important factors in the successes of the
Green Revolution movement in many countries. The advances in meat
production of cattle, swine, and poultry through breeding have
supplied the protein needs of the ever growing population.
2. Medicine. Applications of Genetics in the medical field are numerous

and growing. The diseases and abnormalities that have genetic bases
are now known and appropriate preventive measures are prescribed.
For example, diabetes, hemophilia, anemia, known as hemolytic
icterus, hemoglobin abnormalities, and some forms of blindness and
deafness are heritable. Recognition of their inherited nature is important
in anticipating their possible occurrence in a given family, so that
appropriate preventive steps may be taken.
UP Open University
Module 1 11
3. Genetic Counselling. Geneticists can provide some estimate of the

likelihood of a particular desirable or undesirable trait appearing in
the children of a given couple. Information regarding the ancestors of
prospective couples is utilized in genetic counselling.
4. Legal Applications. Genetics has its legal applications. It helps solve

problems of disputed parentage. Analysis of the blood type, a genetically
determined character, establishes parentage of children and it can
answer questions regarding illegitimate children, estate claims, and
even baby mix-ups in hospitals.
5. Genetic Engineering. Genetic engineering, which may be a

controversial application of genetics, has equal potentials for good or
evil. Production of organisms that may eventually find use in food
production, medicine, and energy production would be as possible as
the production of organisms that would be destructive to almost all
living organisms.
SAQ 1-8
Prove that genetics can be considered as both basic and applied
sciences.
The science of genetics progressed rapidly through several stages of

development. Geneticists began to turn from concern with descriptive
genetics as patterns of traits to the problem of how the observabe trait is
produced. Parallelisms between inheritance patterns and the structure of
behavior of cells were observed. Cytology rapidly became an adjunct to
genetics. The study of cellular structures and mechanisms associated with
genetics resulted in Cytogenetics. The door was thereby opened to an
objective examination of the physical mechanisms of the genetic processes.
Concern with the results of experimental breeding programs in which
genotypic and phenotypic patterns emerged gave birth to Population and
Quantitative Genetics. Then search for answers proceeded more deeply
in Molecular levels. The contributions of various sciences enabled
geneticists to gain a clear concept of the molecular nature of the gene and
its operation. All these genetic knowledge are now being utilized in the
ultimate understanding of the evolution of the various species of organisms.
UP Open University
Summary
Genetics is a field of biological science which deals with the mechanisms
of heredity, variation, and related biological processes, such as
reproduction, development, and evolution in all forms of life.
Some of the pre-Mendelian ideas are:
1. Abiogenesis or Spontaneous Generation;

2. Biogenesis;
3. Pangenesis;
4. Preformation;
5. Epigenesis;
6. Inheritance of Acquired Characteristics; and
7. Germplasm Theory.
Gregor Johann Mendel discovered the first principles of Genetics. He

discovered that hereditary characteristics were determined by elementary
units transmitted between generations in uniform predictable fashion.
Mendelian laws were rediscovered in 1900 by Hugo de Vries, Carl Correns,

and Erich Tschermak von Seysenegg.
Post- Mendelian genetics deals with the fundmental properties and

problems of life thus impinging on all aspects of biology.
Genetics is important in several studies, like the origin of life on earth. For
human advantages, Genetics has many practical applications, namely:
plant and animal improvement; medicine; genetic counselling; legal
applications; and genetic engineering.
Different areas of genetics include descriptive or qualitative genetics,

cytology, cytogenetics, population and quantitative genetics, biochemical
and molecular genetics, and evolutionary genetics.
UP Open University
Module 1 13
References
Burns, G.W. (1983). The science of genetics. N.Y.: MacMillan Publ. Co., Inc.
p. 470.
Dunn, L.C. (1990). A short history of genetics. Encyclopedia Americana. p.
397.
Gardner, E.J. and D.P. Snustad. (1984). Principles of genetics. N.Y.: John
Wiley and Sons. p. 415.
Ramirez, D.A. (1991). Genetics. 7th ed. U.P. Los Baños, Laguna: SEAMEO-
SEARCA. p. 217.
Sinnott, E.W., L.C. Dunn, and T. Dobzhansky. (1981). Principles of genetics.
McGraw Hill Book Co., Inc. p. 459.
Strickberger, M.W. (1985). Genetics. N.Y.: MacMillan Publ. Co. p. 868.
Answers to Review of Prerequisites

1. Reproduction is a process by which a species gives rise to offspring or
new individuals of the same kind. Its universal features include
cellularity, biogenesis, development, and heredity. Heredity means
“like begets like.” The field of science which deals with the study of
heredity and variation is genetics. Reproduction, therefore, is better
explained and understood through genetics.
2. Genetics is an area or field of biology which deals with heredity and

variation, as well as related biological processes, such as reproduction,
development, and evolution.
UP Open University
Answers to Self-Assessment Questions
ASAQ 1-1
Genetics is the field of biological science which deals with the mechanisms
of heredity, variation, and related biological processes, such as
reproduction, development, and evolution in all forms of life.
ASAQ 1-2
Biogenesis states that life begets life whereas abiogenesis states that non-
life begets life.
Variation means marked differences or deviations from characteristics,

form, function, and structure.
Heredity means genetic transmission of characteristics from parents to

offspring.
ASAQ 1-3
a. Aristotle’s Theory of Pangenesis proposed that the semen, which was

formed everywhere in a man’s body and which reflected the
characteristics of the body part where it was formed, traveled through
the blood vessels into the male reproductive organs.
b. Harvey’s aura seminalis refers to the mystical influence of the male

sperm in creating new organism.
c. Darwin’s gemmules refer to very small, exact but invisible copies of

each body organ and component transported by the blood stream to
the sex organs and there assembled into gametes.
d. Wolff’s epigenesis explains that the different structures of organisms

develop from uniform embryonic tissues which arise completely de
novo through mysterious vital forces.
e. Lamarck’s Theory of Acquired Characteristics states that the body

modifications acquired by use and disuse can be transmitted to the
progeny via pangenesis because the semen formed reflects such
modification.
UP Open University
Module 1 15
ASAQ 1-4
The Germplasm Theory proposed that germplasm were sex cells which
perpetuated themselves in reproduction generation to generation.
The source of heredity is the sex cells or gametes which undergo

fertilization.
ASAQ 1-5
Genetics is a 20th century science because it began to assume a distinctive

form in 1900 when the first simple laws of biological inheritance were
widely recognized.
ASAQ 1-6
Post-Mendelian Genetics is an elaboration of the basic Mendelian laws; it

associated Mendelian factors with chromosomes, molecular and chemical
characterization of the genetic material, and utilization of the basic
knowledge of genetics for various applied aspects. The different areas of
Genetics were born.
ASAQ 1-7
When Genetics deals with fundamental properties and problems of life

and living things, it impinges on all basic and applied aspects of biology
— biochemistry, physiology, development, morphology, anatomy,
evolution, and ecology, as well as other natural and behavioral sciences,
such as chemistry, mathematics, physics, statistics, psychology, and
sociology.
ASAQ 1-8
Genetics is a basic science when its fundamental principles are being relied
upon. When it is considered in practical applications, then it is an applied
science.
UP Open University
Assignment
1. Gregor Johann Mendel was not the pioneer in the study of the
inheritance of characters. However, he is now considered the
Father of Genetics. Why? (5pts.)
2. Compare and contrast the pre- and post-Mendelian genetics.

(10 pts.)
3. Discuss two (2) instances which will show the basic and applied
aspects of Genetics. (10 pts.)
4. The science of genetics is progressing so fast. Why? (5 pts.)
5. Prove the following: (10 pts.)
a. Genetics is the core science of Biology.

b. Genetics is a diverse area.
Note: Your answers to each of the assignment questions should be

just one paragraph with not more than five sentences.
UP Open University
Module 2
Cell Cycle
Introduction
Objectives
C hristmas is a big event for most Filipinos.
What do you do to prepare for Christmas?
Do you decorate your house? Do you send
After studying this module,
you should be able to:
cards to your friends? Do you do it as early as
November? Do you buy gifts for your loved 1. Describe the different
ones? stages of interphase; and
2. Explain the significance of
If you prepare for a big event, the cells in all interphase.
living organisms do prepare too. One big event
is the cell cycle, when the cell doubles its content
to produce daughter cells.
The cell cycle is composed of interphase and M or division phase (Figure

2-1). Interphase is further subdivided into Gap1 , S phase, and Gap2. M
phase could be mitosis or meiosis.
Module 2 19
Definition of Terms
Cell cycle - event where the cell doubles its content to produce daughter
cells; It is divided into interphase (Gap1 , S and Gap2) and cell
division or M phase (mitosis and meiosis)
Cell division - formation of daughter cells from a single mother cell; two
genetically identical daughter cells with diploid chromosome
number if mitosis; four genetically different daughter cells with
reduced chromosome number if meiosis
Chromatin fiber - the material of chromosomes composed of nucleosomes

(histone or nucleosome core and DNA) joined together resembling
beads on a string
Nucleosome core -core composed of histones, 2 each of H2A , H2B , H3

and H4 where the DNA is wound around
Nucleus - the control center of the cell that contains the DNA, the carrier
of genetic information
Imagine a plate of spaghetti. Can you divide the noodles equally into two
plates ? Are you thinking of weighing it? No! I won’t allow you to do so.
Can you think of another method? Well, it is rather difficult.
In the nucleus (the control center of the cell ) are long tiny threads called
DNA (Deoxyribonucleic Acid), the carriers of genetic information or
hereditary materials. The DNA is associated with a nucleosome core. The
core resembles a ball and wound around it is the DNA. Can you imagine
what I am saying? Now take a look at Figure 2-2. This is a diagram showing
the nucleosome of a chromatin fiber.
Figure 2-2. Beads on a string appearance of chromatin fiber
UP Open University
If one nucleosome is linked to another nucleosome and so on, they resemble

beads on a string. This is called chromatin fiber. If you consider the size of
the nucleus, these fibers are long just like spaghetti noodles. These are the
fibers that must be distributed equally during cell division. The cell has its
own mechanism to divide chromatin fibers equally. This happens during
the cell cycle (composed of interphase and M phase). For this lesson we
will consider the three subdivisions of interphase — the Gap1 , S phase,
and Gap2 phase.
The three stages of interphase are different biochemically but they are not
distinguishable morphologically. The nucleus of an interphase cell under
the microscope could appear as darkly staining body (Figure 2-3). The
nucleus may look inactive but it is actually very busy preparing for a big
event.
Figure 2-3.
Interphase cell of onion
(Allium cepa)
Let us characterize each stage of the cell cycle.
1. Gap1 (G1) -The cell increases its size by taking in water and nutrients
and building new protoplasm. Cytoplasmic organelles like endoplasmic
reticulum, Golgi apparatus, mitochondria, chloroplast, and many
others are made.
2. S-phase - Both DNA and the components of the nucleosome core

called histones are synthesized. The nucleosome core is composed of
two of each H2A, H2B, H3, and H4. The DNA content represented as
2C becomes 4C after S phase.
3. Gap2 (G2 ) - RNA and proteins necessary for chromatin condensation

are formed.
You may pause for a while. Try to recall the different phases of interphase.
Can you differentiate one stage from the other? If you can, marvelous!
You may read the lesson again if you miss to differentiate one phase from
another.
Let us try a simple exercise. Consider SAQ 2-1.
UP Open University
Module 2 21
SAQ 2-1
The amount of DNA in a particular species is 12 C. Give the DNA
content of a cell at:
a. G 2
b. S
c. G 1
The amount of time spent in each phase of the cell cycle is a characteristic
of a particular cell. Differences in cell cycle times are due mainly to
variations in the length of G1. Cells that divide rapidly spend little time at
G1, while those that divide slowly spend days or years on the said stage.
Embryonic cells spend little time at G1 but brain cells which do not divide
remain at G1 or G0 (resting stage) forever.
What is the behavior of chromatin fiber in each of the three stages of

interphase?
At G1, the chain of nucleosome (the beads on a string) makes a long

chromatin fiber. After S, with DNA and histones for the core already
synthesized, the chromatin fiber is doubled. At G 2, the nucleosome
undergoes nucleosome packing. This is made possible by histone called
H1 (Figure 2-4).
Figure 2-4. H1 attachment on nucleosome
UP Open University
Module 2 23
What happens at interphase is one big event during the cell cycle. Each
step from G1, S to G2 is executed properly so that the linear DNA can be
properly packed or folded to form the chromosome. Packing the chromatin
would make distribution of the DNA easy and orderly during cell division.
Summary
Cell cycle is the event where the cell doubles its content to produce daughter
cells. It is divided into interphase and cell division or M phase. Gap 1, S,
and Gap 2 comprise the interphase. The chromatin fiber in these different
stages of interphase is doubled through replication and properly folded at
G 2.
Answer to Self-Assessment Question
ASAQ 2-1
In a particular species where the amount of DNA is 12 C, the amount of

DNA in the given stages will be as follows:
G2 - 24 C
S - 24 C
G1 - 12 C
Were you able to get it right? Excellent! If you miss a point, remember that
DNA synthesis happens at S phase; since G1 happens before S then it
remains to be 12 C; but after S, and at G2, the amount of DNA becomes 24
C.
UP Open University
Module 3
Cell Division Phase: Mitosis
Introduction
Objectives
H ave you seen a bamboo plant? Bamboos
grow nearly a meter (39.4 in) tall in one
day. This is about the same height you will
reach at the age of 10. How does this happen?
In a bamboo plant, the tip is actively growing 1. Describe the different
and dividing. This is the meristematic region stages of mitosis ;
the region of active cell division. 2. Identify the stages of
mitosis using photomicro-
You already know from your previous lesson graphs; and
that living organisms are composed of cells. 3. State the significant
Mitosis is the kind of cell division actively consequences of mitosis.
going on in meristematic regions. This is the
type of cell division that makes a bamboo
plant grow faster.
In this lesson, you will know that mitosis is composed of different stages
and each of the stages is different from one another.
In studying this lesson, you will be guided by this concept map.
Concept Map
Mitosis
(cell division in all body and sex cells)
Sub-stages
Prophase Metaphase Anaphase Telophase
For a deeper understanding and appreciation of this module go over again

this new set of definition.
Definition of Terms
Acrocentric chromosome - chromosome where the location of centromere

is subterminal
Centromere - region of chromosomes that contains the kinetochore, the

site of attachment of spindle microtubule
Chromatids - longitudinal subunits of a chromosome
Chromosomes - thread-like structures found in the nucleus of the cell

formed through higher order of folding of chromatin fiber
Genome - complete set of chromosomes
Meristematic region - region of active cell division
Metacentric chromosome - chromosome where the location of centromere

is median
UP Open University
Module 3 27
Mitosis - a type of cell division by which the genetic and chromosome

composition of a cell is faithfully reproduced in each of the daughter
cells
Nucleolus organizer region - a region of the chromosome associated with

the nucleolus; contains gene for rDNA
Submetacentric chromosome - chromosome where the location of

centromere is submedian
Telocentric chromosome - chromosome where the location of centromere

is terminal
The higher order of folding of chromatin fibers results in the formation of

chromosomes, the physical carriers of the inherited factors or genes. The
formation of chromosomes facilitates distribution of genetic materials when
cells undergo the two types of cell division, mitosis and meiosis. Figure 3-1
is a diagrammatic representation of a chromosome.
sister chromatid
chromosome arms
centromere
Figure 3-1. Diagrammatic
representation of a chromosome
telomeres
The chromosome is composed of chromosome arms and the centromere or

primary constriction. Each of the chromosomes is composed of two duplicate
halves called sister chromatids. These are formed at S phase when DNA
and histones are replicated. Each of the chromatids is composed of a single,
long, linear DNA molecule. At a specific point along the chromosome is a
waistline (centromere), the region that contains the kinetochore, the site of
attachment for the spindle microtubule. The tips of a chromosome are
called telomeres. Removal of the telomeres makes a chromosome unstable.
UP Open University
Chromosomes may be classified into four types based on the position of

the centromere:
a. metacentric - the centromere is median;
b. submetacentric - the centromere is submedian;
c. acrocentric - the centromere is subterminal; and
d. telocentric - the centromere is terminal.
Some chromosomes possess a secondary constriction, which is also called

nucleolus organizer region. This contains the gene for rDNA that is
transcribed into rRNA which in turn conjugates with proteins to form the
ribosome, the site of protein synthesis.
Mitosis happens in somatic cells (body cells) as well as in sex cells. The
chromosomes in somatic cells are derived from the fusion of haploid
chromosomes (n) from maternal and paternal parents. The haploid
chromosome or the complete set of chromosomes coming from either
parent of a diploid individual is called the genome (X). After fertilization,
the diploid number or somatic number (2n) is formed.
Mitosis is divided into four stages, namely, prophase, metaphase,

anaphase, and telophase. Let us consider each stage one by one.
Prophase. This is the stage where the chromosomes begin to shorten and
thicken (Figure 3-2). By late prophase, each chromosome appears double.
The two halves are called chromatids.
UP Open University
Module 3 31
Telophase is the last stage of mitosis. This is marked by the arrival of the
chromosomes at the poles. The chromosomes lengthen and nuclear division
is over.
Figure 3-6.
Illustration of
telophase
At the end of mitosis, two cells are formed. In terms of genetic content,
the two cells are identical. Cytokinesis happens. This involves separation
of cytoplasmic contents into two cells. The chromosomes are distributed
equally to the daughter cells, making mitosis an equational division. The
genetic content in the parental cell is faithfully passed on to the daughter
cells. The chromosome number remains constant through successive cell
division.
Can you recall the event that makes this possible? Remember that before
mitosis, the cell passed S phase. A chromatin fiber is doubled at the end of
S phase. The doubled chromatin fibers when folded form the sister
chromatids. At anaphase, the sister chromatids (now called chromosomes)
move to the opposite poles.
Now, try SAQ 3-2.
UP Open University
SAQ 3-2
Which of the photomicrographs shows anaphase?
Figure 3-7. Photomicrographs of mitosis in onion (A. cepa)
Were you able to get the answer for SAQ 3-2? I hope so!
Now try SAQ 3-3. This will test if you can follow the number of chromatids,
chromosomes, and centromeres during mitosis.
SAQ 3-3
Rice (Oryza sativa) is a diploid and has a chromosome number of
24. How many of each are present in the different stages of mitosis?
a. Number of chromatids at metaphase per cell

b. Number of chromosomes per cell at telophase (after cytokinesis)
c. Number of centromeres per cell at prophase
d. Number of chromosomes per cell at anaphase
Did you get a perfect score? If yes, you’re great!
UP Open University
Module 3 33
If you miss one or two points, you may read again your lesson. Remember,
you must keep on trying.
Have you ever wondered why mitosis occurs in living organisms? Why
do leaves grow in size? Why do wounds heal? In multicellular organisms,
mitosis is a means of increasing the number of cells and replacing worn
out tissues. If you accidentally cut your fingers, mitosis is actively occurring
under the scab until the wound is completely healed. For unicellular
organisms, mitosis is a means of reproduction.
Summary
Mitosis happens in meristematic cells in plants. It is divided into four stages,
namely, prophase, metaphase, anaphase, and telophase. The chromosomes
that thicken and contract at prophase align themselves at the equatorial
plate during metaphase. The chromosomes at anaphase start to move to
the opposite poles and finally regroup in the poles at telophase. The
daughter cells have the same chromosome number and genetic content as
the parental cell; this makes mitosis an equational division.

ASAQ 3-1
Photograph a is prophase while b is metaphase. Chromosomes in a are

becoming visible which means chromosomes contract and thicken — a
description of prophase cell. The chromosomes in b align themselves at
the equatorial plate. This follows the description of metaphase.
If you missed the right answers, don’t worry because most people find
this hard at first. Prophase and metaphase are often interchanged.
ASAQ 3-2
Photograph c shows anaphase. Did you get it right? Great! The

chromosomes are moving to the opposite poles. You may have mistaken
this for telophase. But since the chromosomes have not reached the poles,
this is still anaphase.
UP Open University
ASAQ 3-3
The given chromosome number of rice is 2n = 24.
a. The number of chromatids at metaphase per cell is 48. This is because

each of the chromosomes is composed of sister chromatids. If there
are 24 chromosomes, therefore there must be 48 chromatids.
b. The number of chromosomes per cell at telophase (after cytokinesis) is

24. Mitosis is an equational division, hence if a cell has a starting
chromosomes of 24, it will form two cells with 2n = 24.
c. The number of centromeres per cell at prophase is 24. Since there are
24 chromosomes and each chromosome has a centromere, 24
chromosomes have 24 centromeres.
d. The number of chromosomes per cell at anaphase is 48. Take note that
at anaphase the sister chromatids separate. These chromatids when
separated are called chromosomes. If there are 24 chromosomes, each
pole will have 24 chromosomes when they separate and move to the
opposite poles. The total number of chromosomes per pole is 48.
UP Open University
Module 4
Cell Division Phase: Meiosis
Introduction
Objectives
D o you know that half of your chromo-
somes are from your father and the
other half are from your mother? This is
because the reproductive cells have to
undergo cell division before they fuse during 1. Enumerate the stages of
fertilization as gametes (sperm and egg). This meiosis ;
is called meiosis. The cells formed at the end 2. Differentiate meiosis I
of meiosis must contain only half of the from meiosis II ;
chromosomes of a diploid organism so that 3. Identify the different
when gametes combine to form the zygote stages of meiosis I and II
the original number of chromosomes is using photomicrographs;
restored, not doubled. The complete set of and
chromosomes coming from either parent is 4. Enumerate the significant
called the genome (X). In a true diploid (2n), consequences of meiosis.
the genome (X) is equal to the haploid number
of chromosomes.
Let us consider an example. Corn is diploid and has a chromosome number

of 2n = 20. The male and female gametes must contain only 10
chromosomes. The reduction in chromosome number is due to meiosis.
The chromosome number must be reduced so that when gametes combine
during fertilization the diploid number of 2n = 20 is restored.
We will discuss the different stages of meiosis in this lesson.

Concept Map
Meiosis
(cell division in sex cells)
Meiosis I Meiosis II
(Reduction Division) (Equational Division)
Prophase I Metaphase I Anaphase I Telophase I Prophase II Metaphase II Anaphase II Telophase II
Leptotene
Zygotene
Pachytene
Diplotene
Diakinesis
Go over these new set of definition of terms before you start reading this
module.
UP Open University
Module 4 37
Definition of Terms
Gamete - also called sex cell; a mature reproductive cell capable of fusing
with a similar cell of the opposite sex to form a zygote
Genome - a complete set of chromosomes
Homologous chromosomes - chromosomes that are identical in size, shape,

and genetic composition (except for allelic differences)
Megasporogenesis - formation of haploid (n) megaspores from diploid

(2n) megasporocytes
Meiosis - a type of cell division exhibited by the reproductive cell whereby

the chromosome number of the four daughter cells is reduced to
half (n) the somatic number (2n)
Microsporogenesis - formation of haploid (n) microspores from diploid

(2n) microsporocytes
Spermatogenesis - formation of mature sperm from a diploid reproductive

cell (spermatogonium)
Zygote - the diploid cell formed by the union of the gametes; the egg and
the sperm cells
Meiosis occurs only in certain kinds of cells. In animals, it takes place in

the gonads, in the primary and secondary gametocytes; in higher plants,
the process takes place in the stamens and pistils of plants. Meiosis occurs
during gamete formation. It is called spermatogenesis or sperm formation
in male animals while in females it is called oogenesis or egg formation. In
higher plants spore formation, which occurs in male floral parts, is called
microsporogenesis while megasporogenesis occurs in female floral parts.
Meiosis is also preceeded by G1, S, and G2 phases. Meiosis is divided into

meiosis I and meiosis II; meiosis I is reductional division while meiosis II is
equational division. Do you have any idea why meiosis I is called
reductional division? What do you think is reduced during the first
division?
Let us now consider the stages of meiosis I.
Prophase I has five recognizable stages: leptonema; zygonema;

pachynema; diplonema; and diakinesis.
UP Open University
Module 4 39
Pachynema. This is the stage where the chromosomes appear as thick

threads. The bivalents thicken due to coiling and chromatid breaks occur.
Repairing of breaks could result in crossing-over between homologues
and the consequent formation of chiasmata at the point of exchange. This
is a cytological evidence that crossing-over happens. Genetic variability in
gametes is the primary result of crossing-over.
Figure 4-3.
Pachynema
Diplonema. This is the stage where there is longitudinal separation of

bivalents. Homologues separate starting from the centromere. There is
separation of strands because the synaptonemal complex is no longer
functional.
Figure 4-4.
Diplonema
UP Open University
Diakinesis. There is maximal contraction of bivalents showing a unique

configuration due to repulsion of bivalents. This is the stage where bivalents
are distributed throughout the nucleus. By counting the number of
bivalents, one can easily establish the species’ chromosome number.
Figure 4-5.
Diakinesis
Can you remember the stages of prophase I? Let us have a simple SAQ.
SAQ 4-1
What specific stage of prophase I would fit the following
description:
a. pairing of homologous chromosomes

b. separation of bivalents starting from the centromere
c. long thin threads of chromosomes
d. exchange of chromosome segments
e. bivalents are distributed
Did you get a perfect 5? If you did, very good. If you missed a number,
read again the description of each stage.
UP Open University
Module 4
Figure 4-6. Different stages of prophase I in teosinte (Zea mays mexicana)

41
UP Open University
Consider the photomicrographs in Figure 4-6. Can you identify the stages
of prophase I? Letter a is leptotene, b is zygotene, c is pachynema, d is
diplotene, and e is diakinesis.
Let us now consider the next stages.
Metaphase I. Bivalents move to the equatorial plate or metaphase plate.

Can you differentiate metaphase from metaphase I? Recall mitotic
metaphase so you will know the difference.
Figure 4-7.
Metaphase I
Anaphase I. The univalents in each bivalent separate and move to the

opposite poles. How does this stage differ from anaphase? Centromeres
at mitotic anaphase become functionally doubled. The sister chromatids
separate and move to the opposite poles. If there are four chromosomes at
the equatorial plate during metaphase, after the separation of the sister
chromatids, each pole will have four chromosomes. At anaphase I , when
bivalents separate, each pole will contain only two chromosomes. This
accounts for reductional phases of meiosis I.
Figure 4-8.
Anaphase I
UP Open University
Module 4 43
Telophase I. The chromosomes regroup and their coiled structures begin

to relax. Two haploid nuclei are formed.
Figure 4-9.
Telophase I
Can you now answer why meiosis I is called reductional division? Take
note that at leptotene, Figure 4-1 shows four long chromosomes. The
homologous chromosomes pair with each other to form bivalents; the
chromosomes contract and later there is separation of bivalents into
univalents. Each of the univalents moves to the opposite poles. This happens
at anaphase I. Each of the poles will have two chromosomes, reducing
the initial chromosome number of 2n = 4 to n = 2.
Let me check if you can identify metaphase I, anaphase I, and telophase I

using the following photomicrographs.
The first picture on your left is metaphase I, when all the chromosomes
are at the equatorial plate. The middle picture shows anaphase I. After
separation of bivalents into univalents, the groups of chromosomes start
to move to the opposite poles. The third picture shows telophase I, when
the chromosomes start to regroup on the opposite poles.
UP Open University
Did you get a perfect score? If yes, splendid! Read again the description of
these three stages if you failed to identify them all. Drawings or illustrations
are totally different from actual photographs. Just keep trying!
Now let us have a simple exercise; consider SAQ 4-2.
SAQ 4-2
In corn (Zea mays) the somatic cells have 2n = 20 chromosomes.
How many of each of the following are present in each cell at the
stage of meiosis indicated?
a. centromeres at anaphase I
b. bivalents at metaphase I
c. chromosomes at telophase I
d. chromatids at anaphase I
e. chromosomes at anaphase I
Did you get a perfect score? If you did, good! If you missed a number or
two, read your lesson again.
Let us now consider the next stage, meiosis II. This is referred to as equational
division. What comes to your mind when you read equational? Are you
thinking about mitosis? Exactly! You are right! Meiosis II is similar to
mitosis. Let us consider each stage one by one. Please take note that the
following stages would occur in the two cells formed after telophase I.
Prophase II. Except for having half the chromosome number, this stage is
similar to mitotic prophase. The chromosomes appear as double structures.
Figure 4-10.
Prophase II
UP Open University
Module 4 47
Let me check if you can follow the number of chromosomes, chromatids,

and centromeres. Try SAQ 4-3.
SAQ 4-3
Using the same specimen corn with 2n = 20, how many of each of
the following are present in each cell at the stages of meiosis II
indicated?
a. Number of chromatids at metaphase II

b. Number of chromosomes at anaphase II
c. Number of chromosomes in each cell after cytokinesis
Summary
Meiosis happens in gametic cells. It is divided into meiosis I, a reductional
division and meiosis II, an equational division. Meiosis I is further
subdivided into prophase I, metaphase I, anaphase I, and telophase I.
There are five subdivisions of prophase I, namely, leptonema, zygonema,
pachynema, diplonema, and diakinesis. The substages of prophase I start
with long and thin chromosomes at leptonema then pairing, crossing-
over, and contraction of chromosomes happen. The paired chromosomes
(II) align at metaphase I and separate at anaphase I, the stage where
there is reduction in chromosome number. Two cells are formed at the
end of telophase I which proceed to meiosis II, an equational division
similar to mitosis.
Meiosis is responsible for maintaining the chromosome number of species

and generating genetic variation.
UP Open University
References
Gardner, E.J., M.J. Simmons, and D.P. Snustad. (1991). Principles of genetics.
8th ed. New York: John Wiley & Sons. Inc. pp. 52-68.
Laude, R.P., A.A. Barrion, G.P. Balaccua, M.S. Mendioro, and D.A.
Ramirez. (1992). U.P. Los Baños and TLRC. Laboratory guide in genetics.
pp. 1-14.
Ramirez, D.A. (1991). Genetics. 7th ed. U.P. Los Baños, Laguna . SEAMEO-
SEARCA. pp. 7-22.
Suzuki, D. T., A. J. F. Griffiths, J. H. Miller, and R .L. Lewontin. (1986).
An introduction to genetic analysis. 3rd ed. New York. W.H. Freeman &
Co. pp. 34-40.
ASAQ 4-1
1. The following descriptions fit the specific stages of prophase I.
a. Zygonema is the stage where there is pairing of homologous

chromosomes.
b. Diplonema is the stage where there is separation of the bivalents

starting from the centromere.
c. Leptonema is the stage where the chromosomes appear as long,

thin threads.
d. Pachynema is the stage where there is an exchange of chromosome

segments.
Did you get a perfect score? Excellent! It is easy to recall these stages if you
remember their outstanding features.
ASAQ 4-2
If corn has a chromosome number of 2n=20, then the following are present
in the different stages of meiosis I.
a. Each chromosome has a centromere, so if there are 20 chromosomes,

then there must be 20 centromeres.
UP Open University
Module 4 49
b. At metaphase I, paired chromosomes align at the equatorial plate. If

the 20 chromosomes pair, they form 10 bivalents.
c. Cells at telophase I have a reduced chromosome number; in each cell

there must be 10 chromosomes (after cytokinesis).
d. At anaphase I, there are 20 chromosomes, since a chromosome has

two chromatids, the number of chromatids is 40.
e. At anaphase I, bivalents separate into univalents and move to the

poles. If there are 10 bivalents, the number of chromosomes is 20, 10
univalent in each pole.
Another perfect 5? Hurray! You really understood the lesson! If you missed
a number read the lesson again. Some students find this confusing at first.
Don’t give up!
ASAQ 4-3
Considering again the same chromosome number 2n=20, the following

are present at different stages of meiosis II:
a. At metaphase II, 10 chromosomes align at the equatorial plate. Since

there are two chromatids in each chromosome, then there are 20
chromatids.
b. Anaphase II is characterized by the separation of sister chromatids.

The 10 chromosomes per cell when they separate will have 10
chromosomes in each pole. Remember that when chromatids separate,
they are considered chromosomes.
c. The number of chromosomes per cell after cytokinesis is 10. Recall

that during meiosis I there is reduction in chromosome number and in
meiosis II there is equational division, 2n = 20 is reduced to n = 10.
UP Open University
Module 5
Mendelian Principles of
Heredity
Introduction
Objectives
L ook at the things in your surroundings!
Every plant shows a definite pattern
of growth, a specific leaf shape, flower
color, and other distinct morphological
characteristics. Animals likewise would 1. Explain Mendel’s
show their own unique morphological principles of heredity; and
characteristics. Different dogs show 2. Apply Mendel’s principles
different coat colors. This is also true for of heredity in predicting
cats. Some would be brown, others white, possible outcomes of
black , or even calico. You are different from mono and dihybrid
your brothers and sisters. Although you crosses.
have traits that are similar, you have a trait
that is unique in you. Do you know the
reason why? This is the essence of studying genetics. For this unit we will
try to study the principles of heredity.
Concept Map
Mendelian Genetics
Principle of Independent Segregation Principle of Independent Assortment

(Monohybrid Cross) (Dihybrid Cross)
Read this new set of definition of terms before reading Module 5.
Definition of Terms
Allele - one of two or more alternative forms of a gene which are usually
recognizable by phenotypes
Chromosome Theory of Inheritance - theory that chromosomes are the

physical carriers of the gene
Dominance - condition when one allele marks the expression of the other
allele
Genes - inherited factors that determine particular characteristics of an

individual
Heterozygous - a cell or organism having different alleles at a given locus

on homologous chromosomes
Homozygous - a cell or organism having identical alleles at a given locus

on homologous chromosomes
Hybrid - an offspring of a cross between two genetically unlike individuals
Hybridization - crossing of individuals with two contrasting traits
Monohybrid - a cross between individuals that have different alleles at

one gene locus
Principle of Independent Assortment - principle which states that alleles

of the different gene pairs separate cleanly from each other and
randomly combine during meiosis
UP Open University
Module 5 53
Principle of Independent Segregation - principle which states that alleles

in a gene pair separate cleanly from each other during meiosis
Recessive - allele that does not function when two different alleles are
present in the cells of an organism
Mendel’s Monohybrid Inheritance

The concept of the gene was first set forth by an Augustinian monk in
Brunn, Austria by the name of Gregor Mendel, the Father of Genetics. He
realized that similarities and differences could be explained by the presence
of discrete hereditary units. A genetic determinant of a specific character
is passed from one generation to the next without blending with the other
units. In his experiment, Mendel used garden pea (Pisum sativum). Garden
peas can self pollinate because the male and female parts of the flower are
enclosed in a petal box. To cross pollinate, anthers from one plant are
clipped off to prevent selfing (Figure 5-1). Pollen of another plant is brushed
on the stigma (female part) of the emasculated flower. Mendel used traits
with clear cut differences such as yellow or green colored pods, purple or
white flower color, or tall and dwarf plants. Crossing plants with two
contrasting traits is called hybridization. When only one trait is considered
in the hybridization, a monohybrid is formed. Mendel crossed plants that
were pureline, a population that breeds true for a particular character
being studied. Offspring of a pureline produced by either selfing or crossing
within the population will always show the same form for their character.
Transfer
of
pollen
with
brush
Parents (P) Removal

of anthers
Purple
White Purple White
F1 All purple
F1 All purple
Figure 5-1. Cross pollination in pea plants
UP Open University
Next, the offspring were crossed with one another. The seeds produced
from this cross were collected and grown. When these plants flowered,
three-fourths produced purple flowers and one-fourth produced white
flowers. Mendel inferred that the F1 plants received from their parents the
ability to produce both purple and white flowers. Mendel invented the
term dominant and recessive to describe the phenomenon without
explaining the mechanism. Purple is dominant while white is recessive.
In the F1, purple masked white thus showing dominance while white is
masked hence showing recessive condition. This is an example of complete
dominance.
From the results of the experiment, Mendel deduced the following

explanations:
1. Color of the flower is controlled by a factor that is transmitted from

parents to offspring. The factor is now called genes.
2. A gene has two alternative forms called alleles; for flower color, the
alleles are purple and white.
3. Flower color is controlled by a gene pair. Capital letter represents

dominant while small letter represents recessive. The purebreeding
plants with purple flowers have two dominant alleles (PP) hence called
homozygous dominant. The purebreeding plants with white flowers
have two recessive alleles (pp) hence called homozygous recessive. A
combination of a dominant allele (P) and a recessive allele (p) is called
heterozygous (Pp). PP, Pp, and pp represent the genotype for flower
color. The gene or genetic content coding for a trait is the genotype.
4. The members of each gene pair separate during gamete formation. In

sexually reproducing organisms which produce gametes (egg and
sperm), each gamete carries only one member of each gene pair.
5. The union of gametes to form the first cell (zygote) is random and it
occurs irrespective of which member of a gene is carried.
UP Open University
Module 5 57
SAQ 5-1
Find the genotype(s) of the F1 in the following crosses. Assume
that tall (T-) is dominant to dwarf (tt).
a. TT x TT
b. TT x Tt
c. TT x tt
d. Tt x Tt
e. Tt x tt
f. tt x tt
Mendel in his experiment considered traits like flower color (purple and
white), color of the cotyledon (yellow or green), and traits like tall and
dwarf. These are examples of phenotype. The distinctive traits possessed
by an organism are collectively known as phenotype. The trait may be
visible to the eyes or may require a special test for identification. The
phenotype is the result of gene product brought to expression in a given
environment.
In SAQ 5-1, the phenotypes are tall and dwarf. Can you give the
phenotypes of the F1? You may assume that whenever allele T is present
(whether single copy or double) it will show tall characterisitics. If the
genotype is homozygous recessive (tt), it will always show the dwarf
condition.
Mendel’s Dihybrid Inheritance

What happens when two gene pairs affecting two different characters
are considered in a cross? Mendel also crossed plants that differed in two
contrasting traits or two pairs of different alleles. This is called a dihybrid
cross. The cross can be illustrated diagrammatically.
Let us consider two characteristics of seeds: smooth vs. wrinkled and yellow
vs. green.
UP Open University
Parental 1 Parental 2
Genotypes: SSYY ssyy
Phenotypes: smooth, yellow wrinkled, green
Gametes SY sy
F1 SsYy
smooth, yellow
Take note that although there are two gene pairs in each of the parentals,
the two alleles in each gene pair would separate independently of each
other; from the parental with genotype SSYY, one type of gamete(s) can
be obtained from SS and only one type (Y) from YY, hence the gamete
would be SY. The same happens with the other parental ssyy. The gamete
will be sy.
The F1 were intercrossed or self - fertilized.
Parental 1 Parental 2
SsYy x SsYy
smooth, yellow smooth, yellow
To derive the gametes from SsYy, again the alleles in each gene pair will
separate; from Ss, two types can be obtained (S and s) and two from Yy
(Y and y). By combining the different alleles from the two gene pairs, the
following gametes can be obtained.
UP Open University
Genotypic Ratio Phenotypes Phenotypic Ratio
1 SSYY 1 round, yellow

2 SSYy 2 round, yellow 9/16 round, yellow
1 SSyy 1 round, green
2 SsYY 4 round, yellow

4 SsYy 2 round, green 3/16 round, green
2 Ssyy 2 round, yellow
1 ssYY 1 wrinkled, yellow

2 ssYy 2 wrinkled, yellow 3/16 wrinkled, yellow
1 ssyy 1 wrinkled, green 1/16 wrinkled, green
16 Total
With the results of dihybrid cross, Mendel was able to propose the second
principle called Principle of Independent Assortment. It states that the
alleles of the different gene pairs separate cleanly from each other
and randomly combine during meiosis. The phenotypic ratio in the F2
can also be obtained by using dichotomous branching method. This is the
other method of getting genotypes in a given cross. Let us again consider
the given cross.
SsYy x SsYy
smooth, yellow smooth, yellow
If you take each gene pair independently, then this is simply saying that
you cross:
Ss x Ss → 1 SS : 2 Ss : 1 ss
Yy x Yy → 1 YY : 2 Yy : 1 yy
If you combine the genotypes of the two gene pairs through branching
method, then you can obtain the different genotypes.
UP Open University
Module 5 61
Genotypes Phenotypes Pheneotypic Ratio
1 YY - 1 SSYY 1 round, yellow 9 round, yellow

1 SS 2 Yy - 2 SSYy 2 round, yellow 16
1 yy - 1 SSyy 1 round, green 3 round, green
16
1 YY - 2 SsYY 2 round, yellow 3 wrinkled, yellow

2 SS 2 Yy - 4 SsYy 4 round, yellow 16
1 yy - 2 Ssyy 2 round, green
1 YY - 1 ssYY 1 wrinkled, yellow 1 wrinkled, green

1 ss 2 Yy - 2 ssYy 2 wrinkled, yellow 16
1 yy - 1 ssyy 1 wrinkled, green
Take note that you obtained the same genotypic and phenotypic ratios.
Can you see the advantage of using dichotomous branching?
You need not summarize the genotypes, unlike in Punnett square where
you must examine the genotypes in the box one by one to be able to get
the genotypic ratio.
Using the dichotomous branching method, you can compute for

phenotypic ratio easily without deriving first the genotypic ratio.
Let us consider again the given cross.
SsYy x SsYy
Taking each gene pair independently:

Phenotypic ratio
Ss x Ss → 1 SS : 2 Ss : 1 ss
1 round : 2 round : 1 wrinkled 3 round : 1 wrinkled
Yy x Yy → 1 YY : 2 Yy : 1 yy
1 yellow : 2 yellow : 1 green 3 yellow : 1 green
UP Open University
Summary
The two principles of heredity, namely, the Principle of Independent
Segregation and the Principle of Independent Assortment were discovered
by Gregor Mendel, the Father of Genetics. The Principle of Independent
Segregation states that the alleles in a gene pair separate clearly from
each other during gamete formation. The Principle of Independent
Assortment, on the other hand, states that the different gene pairs are
distributed independently of each other during gamete formation.
A correlation between Mendelian factors (genes) and the chromosome

during meiosis was noted by Walter Sutton and Theodore Boveri. This is
called the Chromosome Theory of Inheritance. Chromosomes are the
physical carriers of Mendelian factors and the behavior of the chromosome
during meiosis can explain Mendelian principles.
ASAQ 5-1
a. TT x TT
(tall) (tall)
gametes T T
F1 genotype TT
(tall)
b. TT x Tt
(tall) (tall)
gametes T T t
F1 genotypes TT Tt
(tall) (tall)
UP Open University
Module 5 65
c. TT x tt
(tall) (dwarf)
gametes T t
F1 genotypes Tt
(tall)
d. Tt x Tt
(tall) (tall)
gametes T t T t
F1 genotypes TT Tt TT tt
(tall) (tall) (tall) (dwarf)
e. Tt x tt
(tall) (dwarf)
gametes T t t
F1 genotypes Tt tt
(tall) (dwarf)
f. tt x tt
(dwarf) (dwarf)
gametes t t
F1 genotypes tt
(dwarf)
Were you able to get the genotypes of F1? If your score is 6, you’re incredible!
If you got 5, you’re very good! If you got 4, well, you’re good! You may
read again if you got 3 correct answers.
Were you able to identify the proper phenotypes of the F1? You are doing
great!
UP Open University
ASAQ 5-2
In answering this problem, you must consider each gene pair

independently. If the alleles in a gene pair would separate you must note
how many kinds of alleles can be obtained. Then combine the different
alleles from the different gene pairs.
a. TtAA For genotype Tt you will get two alleles T

and t, while from AA, you will get only A.
T — A→ TA
t — A→ tA
b. BBccDD
B — c — D→ BcD
c. DdEEAaCC
A—C → DEAC
D—E
a—C → DEaC
A—C→ dEAC
d—E
a—C→ dEaC
Were you able to get the right answers? Try to remember, you must always
consider each gene pair independently.
UP Open University
Module 6
Allelic and Non-Allelic
Interactions
Introduction
Objectives
H ave you seen a four o’clock plant
(Mirabilis jalapa)? If you cross plants
bearing red flowers with plants bearing white
flowers, the F1 flowers are not red but pink.
This is different from the cross between 1. Differentiate the types of
purple and white where the F1 showed purple dominance relationships;
flowers; this is an example of complete 2. Explain the different types
dominance. In the F 1 , the dominant of non-allelic interactions;
phenotype is expressed as long as the and
dominant allele is present. The inheritance of 3. Predict phenotypes of
flower color in M. jalapa can no longer be given genotypes or vice-
explained on the basis of complete dominance. versa.
This is one exception noted but it did not in
any way disprove Mendel’s principles. For
this unit we will try to consider these exceptions.
68
Concept Map
Mendelian Genetics
UP Open University
Two Alleles Multiple Alleles
ABO Blood Groups
Law of Independent Segregation Law of Independent Assortment

(Monohybrid) (Dihybrid)
Biology D: Principles of Genetics
3:1 Modified Ratios 9: 3: 3: 1 Modified Ratios

Complete dominance
Non-Allelic Interactions
Lethal Genes Pseudoalleles Allelic Interaction
Novel Epistasis Complementary Duplicate

Phenotype Gene Action Gene
Incomplete Over-dominance Co-dominance

Dominance
(No Dominance) Dominant Recessive
Module 6 69
Read these new sets of definition before reading Module 6.
Definition of Terms
Codominance - the relationship of alleles such that the phenotype of the
heterozygote shows the individual expression of each allele
Complete dominance - a condition where the phenotype of the

homozygous dominant and heterozygotes are the same. (This is
due to the presence of a dominant allele, eg., AA and Aa.)
Dominant lethals - genes whose lethal effects occur in heterozygous

condition
Expressivity - the degree to which a particular genotype is expressed in

the phenotype
Incomplete dominance - a condition where the phenotypes of the

heterozygote are intermediate of phenotypes of the homozygotes
Multiple alleles - a condition whereby a gene or locus has more than

two alleles
Non-allelic interaction - condition where an allele of a gene could interact

with or alter the expression of the allele of another gene
Over dominance - a condition where the heterozygote exhibits a more

extreme manifestation of the trait than either homozygote does
Penetrance - the proportion of the genotypes that shows an expected

phenotype
Pleiotropy - a phenomenon whereby a single mutation has effects on

several different characters
Recessive lethals - genes that cause death when homozygous recessive
UP Open University
Allelic Interactions
1. Incomplete dominance or No dominance
Dominance is absent and the progeny does not resemble any of its
parents. The F1s are intermediate between the two parents. This fits
the inheritance of flower color in M. jalapa.
Parentals: red x white

RR rr
Gametes: R r
F1: Rr
pink
Selfing the F1 plants:
Parentals: Rr x Rr
(pink) (pink)
Gametes: R r R r
UP Open University
Module 6 71
Punnett Square : R r
R RR Rr
r Rr rr
Genotypic Ratio : 1 RR : 2 Rr : 1 rr
Phenotypic Ratio: 1 red 2 pink 1 white
2. Overdominance
This is the condition where the heterozygote exceeds the phenotypic

measurements of the homozygous parents. In Drosophila, the
heterozygote (w+/w) has a higher amount of fluorescent pigments
(sapiapteridine and himmelblaus) than that of white (w/w) and wild
type (w+/w+) homozygotes.
3. Co-dominance
When each allele of a gene is associated with specific substance, co-

dominance is present if both substances appear together in the
heterozygote.
Landsteiner and Levine (1900) were able to classify people into three
general types (M, N, and MN) based on the agglutination
characteristics of the red blood cells. The M types could elicit antibodies
(anti-M serum) specific for M which could not agglutinate N, while
the N red blood cells could cause the production of antibodies specific
for N (anti-N serum). Both types of antibodies, however, could
agglutinate the MN red blood cells.
Can you differentiate complete dominance from the three dominance

relationships? Try this simple SAQ 6-1.
UP Open University
SAQ 6-1
Considering the position of the homozygous dominant and
recessive parents in the figure below, indicate the location of the
heterozygote if the following dominance relationships are observed.
AA aa
_______________________________________
a. co-dominance
b. complete dominance
c. over dominance
d. incomplete dominance
Multiple alleles
Do you still recall the Principle of Independent Segregation? We assume
that a gene pair is composed of two alleles. Each allele is present in the
homologous chromosomes. There are many cases where more than two
alleles exist in a gene; this is called multiple allele system. If the alleles act
within the same phenotypic range of each other, it is called isoalleles.
An example of a multiple allele system is the ABO blood groups in man.

Based on the antibodies (agglutins) present in the serum and the antigens
(agglutinogens) present in the red blood cells, Landsteiner (1900) classified
people into four groups (Table 1).
Table 1. ABO blood groupings in man based on the presence of agglutinins

and agglutinogens.
Blood Contains Reaction of red

Blood Type Genotype Cellular Serum blood cells with
agglutinogen agglutinin Anti A Anti B
A AA, AO A Anti B + -
B BB, BO B Anti A - +
AB AB A, B None + +
O OO None Anti A and - -
Anti B
Do you know the blood type of your mother? Your father? How about
your blood type?
UP Open University
Mother Father
Genotypes : AO x BO
Gametes : A O B O
F1 Genotype : AB BO AO OO
F1 Phenotypes : Type AB Type A Type B Type O
Do you know the blood types of your brothers and sisters? Try to predict
the genotypes of your parents.
If you are married and planning to have children, try to determine their
possible blood types. Can you do it?
The ABO blood groups show both codominance and complete dominance.
For genotypes BO and AO, both A and B are completely dominant to O,
hence the blood types are Type B and Type A, respectively. Type AB is an
example of codominance. The products of both A and B are present in
individuals with Type AB blood.
Lethal genes
Have you heard of genes that can cause death? These are called lethal
genes. They may exert an effect during embryo formation or at later stages
of embryonic development. There are genes that are lethal when in
homozygous recessive condition. These are called recessive lethals. They
may have dominant or recessive phenotypic effect. Xeroderma pigmentosum,
which causes heavy freckling in humans, shows a dominant phenotypic
effect. This becomes lethal when the gene is homozygous recessive.
Genes whose lethal effects occur in the heterozygous are called dominant
lethals. An example is epiloia. An affected individual has abnormal skin
growth, severe mental defects, and multiple tumors, which may lead to
early death.
The environment may influence expression of lethal genes. Under

permissive conditions, an organism may survive but it may die under
restrictive conditions. This is called conditional lethal.
UP Open University
Crossing the F1 , to get the F2
RrPp x RrPp
(walnut) (walnut)
Taking each gene pair independently:
Rr x Rr → 1 RR : 2 Rr : 1 rr
Pp x Pp → 1 PP : 2 Pp : 1 pp
Genotypic Phenotypes Phenotypic

Ratio Ratio
1 PP → 1 RRPP 1 walnut
1 RR 2 Pp → 1 RRPp 2 walnut 9/16 walnut
1 pp → 1 Rrpp 1 rose 3/16 rose
1 PP → 2 RrPP 2 walnut 3/16 pea
2 Rr 2 Pp → 4 RrPp 4 walnut
1 pp → 2 Rrpp 2 rose 1/16 single
1 PP → 1 rrPP 1 pea
1 rr 2 Pp → 2 rrPp 2 pea
1 pp → 1 rrpp 1 single
Total 16
Summarized F2 results:
9 R-P- walnut
3 R - pp rose
3 rr P- pea
1 rr pp single
Phenotypic ratio : 9 : 3 : 3 : 1
UP Open University
Module 6 77
Walnut is formed from the interaction of the dominant alleles while single
is formed from the interaction of the recessive alleles. The phenotypic ratio
is 9:3:3:1. How different is this ratio from our previous example on
independent assortment? The two gene pairs are responsible for only one
trait, the comb type in poultry.
Dominant Epistasis
There is complete dominance in both gene pairs but one gene when
dominant masks the effect of the other gene.
Example: fruit color in summer squash
Gene pairs involved: W - White is dominant to color (ww).

Y - Yellow is dominant to green (yy).
Interaction: Dominant gene W hides the effect of yellow and green.
Parentals: WWyy x wwYY

(white) (yellow)
Gametes : Wy wY
F1 : Ww Yy
WWYy
(white)
To get the F2 generation:
WwYy x WwYy
Summarized F2
results: 9W-Y- white
3 W - yy white
3 wwY - yellow
1 ww yy green
Phenotypic Ratio : 12 : 3 : 1
UP Open University
Dominant Epistasis
dominant is epistatic to the second and the second gene when homozygous
recessive is epistatic to the first.
Example : Feather color in fowl
Gene pairs involved : I - Color inhibition is dominant to color expression

(ii).
C - Color is dominant over non color or white (cc).
Interaction: Dominant gene for color inhibition prevents color

expression even when the gene for color is present.
Parentals: IICC x iicc

(white leghorn) (white wyandottes)
Gametes: IC ic
F1: IiCc
(white)
Summarized F2
results: 9I-C- white
3 I - cc white
3 ii C - colored
1 ii cc - white
Phenotypic Ratio: 13 : 3
Recessive Epistasis
homozygous recessive is epistatic to the other gene.
Example: coat color in mouse
Gene pairs involved: C - Color is dominant to albino (cc).

A - Agouti is dominant to black (aa).
Agouti has black hair with yellow stripes.
Interaction: Homozygous albino is epistatic to agouti and black.
UP Open University
Module 6 79
Parentals: CCaa x ccAA

(black) (albino)
Gametes Ca cA
F1 :
Cc Aa
agouti
Summarized F2
ratio: 9 C-A- agouti
3 C - aa black
3 cc A - albino
1 cc aa albino
Phenotypic ratio : 9 : 3 : 4
Complementary Gene
There is complete dominance in both gene pairs but either gene when
homozygous recessive is epistatic to the other gene.
Example: Pea flower color
Gene pairs involved: P - Purple is dominant to white.

C - Color is dominant to non-color.
Interaction: Homozygous recessive in either P or C produces colorless

flowers.
UP Open University
Module 6 81
Can you identify the different types of non-allelic interaction? The

phenotypic ratio is your best guide in recalling the different types of gene
interaction. Please consider SAQ 6-2.
SAQ 6-2
Identify the type of non-allelic interaction exhibited by the
following phenotypic ratios:
a. 9 : 3 : 4 d. 13 : 3
b. 9 : 7 e. 12 : 3 : 1
c. 15 : 1
Let us try to solve a problem related to non-allelic interaction. Consider

SAQ 6-3.
SAQ 6-3
White fruit color in summer squash is dependent on a dominant
gene (W) and colored fruit on the recessive gene (w). In the presence
of ww, a dominant gene D produces yellow color, but when D is
not present, the color is green. Give the F 2 phenotypes and
proportions expected from crossing a white-fruited (WWDD) with
a green fruited (wwdd) plant.
Submit your answer to your tutor during your study session. Write
your answer in a yellow paper. In answering this problem, start
by identifying the given. Always remember the assignments of the
gene for you to get the correct phenotypic ratio. Derive the F2
phenotypic ratio using dichotomous branching method. Provide
the phenotypes of all the genotypes.
Environmental Influence on Gene Expression

Phenotype is the product of the interaction of genes and their environment.
A given genotype if placed in a different environment will give rise to a
different phenotype. You may think of a rice variety that grows well in
Central Luzon but not in Mindoro. An adapted genotype in one
environment may not survive in another environment. A genotype may
show a range of reactions depending on its environment.
UP Open University
Let us consider some terms to understand fully the genotype -environment

interactions.
Penetrance
An individual with a given genotype may or may not show the expected
phenotype. If we consider the proportion of genotypes that show the
expected phenotypes, then this is penetrance. Let me give you an example
to make this point clear. Consider monozygotic twins with identical
genotypes. Let us say they have the genes for harelip. If both expressed
the trait, then they show complete penetrance; if only one of the twins
expressed the trait, then he/she shows incomplete penetrance.
Expressivity
This is the degree by which an individual expresses a particular phenotypic

effect. If individuals with a particular gene show identical phenotypes
then the gene shows constant expressivity; if the phenotypes expressed in
individuals are not identical then the gene shows variable expressivity.
Let us consider an example. Have you seen individuals with extra digits
in their hands or extra toes? These individuals have genes for polydactyly,
which is controlled by a dominant gene. Homozygous dominant or
heterozygous individuals show polydactyly. This gene shows variable
expressivity. Two individuals with the said gene could show variable
numbers of digits — one individual could have two, others could have
one or three.
Pleiotropy
This is a condition in which a gene has multiple phenotypic effects.
Have you seen a red blood cell (RBC) in a photograph? Its shape is spherical
and it is concave. Do you know of other shapes? Have you heard of sickle
cell anemia? Can you guess the shape of RBC? Yes, indeed! It is like a
sickle. The substitution of valine for glutamic acid at position 6 of the
normal hemoglobin results in abnormal hemoglobin chain. This leads to
sickling RBC.
UP Open University
Module 6 83
Figure 6-2. Normal red blood cells and a sickle red blood cells.
Why is it considered an example of pleiotropy? It is because the sickling of

RBC can lead to the several phenotypic changes. Sickle cells can result in
clumping, and can interfere with blood circulation leading to local failures
in blood supply. This in turn results in damages to the heart, lungs, kidneys,
muscles, joints, and the brain. Collection of sickle cells in the spleen results
in its enlargement and later in fibrosis.
Rapid destruction of sickle cells can lead to anemia which results in:
1. over activity of bone marrow resulting in tower skull;

2. weakness and lassitude;
3. impaired mental function;
4. poor physical development; and
5. dilation of heart which leads to heart failure.
Phenocopy
This is defined as environmental mimic of gene action. Environmental

influence is strong so that the resulting phenotype stimulates the effects of
certain genes.
Can you think of examples? If one goes to a beauty parlor and asks the
hairdresser to curl her hair, is this phenocopy? Gary Valenciano is a known
diabetic. If he takes insulin shots, is he a phenocopy?
These two are examples of phenocopy. Curly hair is due to a dominant

gene. An individual even without the said gene can show curly hair due
to strong environmental influence. All it takes is setting the hair in curling
solution.
Gary Valenciano is a phenocopy of a normal individual. Insulin prevents

the expression of genes for diabetes.
UP Open University
Summary
There are five types of allelic interactions, namely:
a. Incomplete dominance - F1 is intermediate or does not resemble any of

its parents;
b. Over dominance - Heterozygotes exceed the phenotypic measurements

of the homozygous parents;
c. Co-dominance - both substances secreted by the dominant and

recessive alleles are secreted in the heterozygote; and
d. Complete dominance - Dominant allele is masking the expression of

the recessive allele.
Alleles from other genes can mask the expression of the alleles of the other
genes. This is called epistasis or non-allelic interaction. The five different
types of gene interaction and their corresponding F2 phenotypic ratios are
as follows :
a. novel phenotypes - 9 : 3: 3: 1
b. dominant epistasis - 12: 3: 1 ; 13 : 3
c. recessive epistasis - 9:3:4
d. complementary gene action - 9:7
e. duplicate gene action - 15 : 7
The environment can influence gene expression. A given genotype if placed

in a different environment can give rise to a different phenotype. Following
are the terms to consider to be able to understand genotype- environmental
interactions:
1. penetrance - the proportion of genotypes that show the expected

phenotypes;
2. expressivity - the degree by which a particular phenotypic effect is

expressed by an individual;
3. pleiotropy - a condition in which a gene has multiple phenotypic effects;

and
4. phenocopy - environmental mimic of gene action.
UP Open University
Module 6 85
References
Ramirez. (1992). Laboratory guide in genetics. U. P. Los Baños and
Technology and Livelihood Resource Center. pp. 30-32.
Ramirez, D.A. (1991). Genetics. 7th ed. U.P. Los Baños, Laguna: SEAMEO-
SEARCA. pp. 27-36.
Suzuki, D.T., A.J.F. Griffiths, J.H. Miller, R.C. Lewwontin. (1986). An
introduction to genetic analysis. 3rd ed. pp. 60-72.
Weaver, R.F. and P.W. Hedrick. (1992). Genetics. Wm.c. Brown. Pub. 2nd
ed. pp. 42-58.

ASAQ 6-1
AA aa
Aa Aa Co-dominance Aa
(Over dominance) (Complete Incomplete dominance (Over dominance)
dominance) (Aa)
a. Co-dominance - The product of both alleles (A and a) are expressed

hence it is in between the AA and aa.
b. Complete dominance - The presence of a dominant allele in the Aa
would mean expressing the dominant trait.
c. Over dominance - The Aa could exceed either AA or aa.
d. Incomplete dominance - The Aa is intermediate.
Did you get a perfect score of 5? Excellent! Read again if your answer is
below 3.
ASAQ 6-2
a. recessive epistasis
b. complementary gene action
c. duplicate gene action
d. dominant epistasis
e. dominant epistasis
It is easy to recall the different types of non-allelic interaction considering

the phenotypic ratio. But you must be able to differentiate one from the
other.
UP Open University
ASAQ 6-3
If you are answering a problem, start by indentifying the given:

W_ - white
ww - colored
wwD_ - yellow
wwdd - green
P1 P2
WWDD x wwdd
(white) (green)
F1 WwDd (white)
To get the F2; identify the genotypic ratio for each gene pair.
Ww x Ww → 1 WW : 2 Ww : 1 ww
Dd x Dd → 1 DD : 2 Dd : 1 dd
Combine genotypic ratio through dichotomous branching.
Genotypic Ratio Phenotypic Ratio
1 DD - 1 WWDD 1 white
1 WW 2 Dd - 2 WWDd 2 white
1 dd - 1 WWdd 1 white
1 DD - 2 WwDD 2 white
2 Ww 2 Dd - 4 WwDd 4 white
1 dd - 2 Wwdd 2 white
1 DD - 1 wwDD 1 yellow
1 ww 2 Dd - 2 wwDd 2 yellow
1 dd - 1 wwdd 1 green
Phenotypic ratio: 12 white: 3 yellow: 1 green
Were you able to get the right answer? If yes, very good! if you missed out
in deriving the proper phenotypic ratio, probably you were confused in
recalling the gene assignments.
UP Open University
Module 7
Definition and Types of
Linkage
Introduction
Objectives
I n the previous modules, you learned that
independently assorting genes reside in
different chromosomes. If there are four pairs
of chromosomes in the common fruitfly
Drosophila melanogaster, does it mean that the 1. Define linkage and
fly has only four genes? Definitely not! Think recombination;
about the many traits or phenotypes 2. Identify the meiotic
expressed by Drosophila. These traits are products of crossing over
controlled by many genes. between homologous
chromosomes; and
Indeed! There are more genes than 3. Differentiate independent
chromosomes. In Drosophila, around 10,000 segregation, complete and
genes are present yet it has only four pairs of incomplete linkage.
chromosome. This only means that each
chromosome bears many genes. The general situation in which genes are
residing on the same chromosome and therefore expected to be inherited
as a group rather than individually is termed linkage.
Before we go to the lesson proper, I think it would be to your advantage if

you know the meanings of some important words used in the discussion.
Definition of Terms
Coefficient of Coincidence - a measure of the strength of interference in
linkage
Complete Linkage - when genes are closely associated that they are always
transmitted together
Incomplete Linkage- when crossing over between linked genes is possible

and recombinant types are recovered
Interference -the measure of the degree to which one cross-over affects

the occurrence of another cross-over in an adjacent region of the
same chromatid
Linkage - linear arrangement of non-allelic genes on the same

chromosome, thus, they have the tendency to be transmitted
together. Linked genes do not assort independently but can be
separated by crossing over
Linkage Groups - a group of genes that have their loci on the same
chromosome
Linkage Map - a chromosome map showing the linear order of the genes
located on the chromosome
Recombination - the process that leads to the formation of new gene

combinations on chromosomes
Sex Linkage - the pattern of inheritance resulting from genes located in

the sex chromosome specifically the X chromosome
UP Open University
Module 7 89
Concept Map
LINKAGE
Types
special type
Complete Linkage Incomplete Linkage
All parental types;
Sex Linkage No recombinants
Results in
X linked Y linked
X linked dominant RECOMBINATION

X linked recessive
recombination
frequency used for
Chromosome mapping
Three point testcross
The Discovery and Definition of Linkage

William Bateson and R.C. Punnett, while working on sweet pea, were
among the early geneticists to report exception to the Mendelian Law of
Independent Assortment in plants and animals. They examined the
simultaneous inheritance of: flower color, dominant purple (P) versus
recessive red (p); and pollen shape, dominant long (L) versus recessive
round (l). In the dihybrid cross, instead of getting the expected F2 ratio of
9:3:3:1, the two geneticists obtained the following results:
UP Open University
PPLL x ppll
Parents: purple, long red, round
F1: PpLl
purple, long
F2:
Progeny Phenotypes Observed Expected
class (9:3:3:1 ratio)
parental purple, long 296 240 (9/16 x 427)

recombinant purple, round 19 80 (3/16 x 427)
recombinant red, long 27 80 (3/16 x 427)
parental red, round 85 27 (1/16 x 427)
427
A substantial deviation from the expected 9:3:3:1 F2 ratio can be noted.

There is an excess of both parental phenotypes and a deficiency of
recombinant phenotypic classes.
The genes have not changed neither has the number of each pair of alleles.
The dominance-recessive relationship between members of the two pairs
of alleles has not changed either. The results show that alleles tend to stay
together in parental combinations and do not assort independently.
Linkage is therefore defined as the tendency for any two or more genes to
be inherited together. This phenomenon suggests that two or more genes
reside in the same chromosome. Linked genes do not assort independently,
but tend to stay together in the same combinations as they were in the
parents. Genes may be linked together on one of the autosomes or
connected together on the sex chromosomes. The number of linkage groups
of any organism is equal to its haploid chromosome number. Hence, for
the common fruitfly, there are four linkage groups.
UP Open University
Module 7 91
SAQ 7-1
Given the following illustration:
Multiple choice:
The following genes are linked except:

a. A and B d. J and K
b. F and G e. H and I
c. D and E f. L and M
The following genes are independently segregating except:

a. A and J d. H and L
b. B and I e. G and M
c. I and M f. D and K
SAQ 7-2
The following species have the following diploid chromosome
numbers:
Corn, Zea mays 2n = 20

Rice, Oryza sativa 2n = 24
Dog, Canis familiaris 2n = 78
Mouse, Mus musculus 2n = 40
Man, Homo sapiens 2n = 46
What would be the corresponding linkage groups of each?
UP Open University
Arrangement of Linked Genes

Given a double heterozygote, AaBb, and assuming A and B are linked,
how are these two genes arranged in the chromosome? Linked loci may
appear in either of two positions relative to one another. It is in a coupling
phase or cis form if the dominant alleles are on one chromosome and the
two recessives on the other chromosome. When the dominant allele of
one locus and the recessive allele of the other occupy the same chromosome,
it is in a repulsion phase or trans form.
Before we illustrate the difference between the cis and the trans forms, it
is important for you to note that as a convention, the genotypes of linked
genes are denoted differently. They are usually written with single or
double bars just like the way fractions are written. For example, instead
of writing AaBb, it is denoted as AB or AB
ab ab
Here now, is the diagram to differentiate the cis and trans forms:
A B
============= cis form or coupling phase
a b
A b
============= trans form or repulsion phase
a B
Different parental and recombinant gametes will be obtained depending

upon how genes are linked in the parent.
Coupling Parent: AB
ab
Gametes:
Parentals or AB ab
Non-cross overs
Recombinant or Ab aB
Cross overs
UP Open University
Module 7 93
Repulsion Parent : Ab
aB
Gametes :
Parental or Ab aB
Non-cross overs
Recombinant or AB ab
Cross overs
Definition of Recombination
Earlier, you have encountered the term recombination. This term is widely
used in Genetics and at this point let me explain what recombination is in
relation to meiosis and linkage of genes.
Recall that during meiosis, specifically at pachytene, there is complete

pairing of homologous chromosomes. Also during this stage, crossing over
between non-sister chromatids occurs. Crossing over, a process by which
parts of homologous chromosomes are interchanged, leads to new
combinations or recombination of linked genes. Due to crossing over, the
genotype of the meiotic products could be different from the original. It is
also mainly through crossing over where linkage of genes can be broken.
In eukaryotes, recombination between two genes could take several forms.

It could be a two-strand single cross over, two strand double cross over,
three-strand cross over or four-strand cross over.
To illustrate, let’s consider a triple heterozygote, ABC. Let us also assume

abc
that these genes are located in an acrocentric chromosome and that the
genes reside at the long arm of this specific chromosome. Further, assume
that there is crossing over between non sister chromatids of the
chromosome pair. What would then be the genotypes of the meiotic
products ?
If there is a single strand cross over between genes A and B of chromatids

2 and 3:
Cross over Meiotic products
genes A B C
1 A B C
2 A b c
3 a B C
4 a b c
a b c
UP Open University
Were you be able to deduce how we obtained the meiotic products ?

Starting from the centromere, just follow the line. If there is a cross-over
you then have to go up or down. As you trace the line you can identify
which genes would be dragged along if the centromeres move towards
the poles during anaphase I.
SAQ 7-3
What would be the meiotic products of a single cross over between
genes B and C involving chromatids 2 and 4? Illustrate your answer.
If there is a double cross over between genes A, B, and C of chromatids 2

and 3:
A B C
1 A B C
2 A b C
3 a B c
4 a b c
a b c
Can you follow? Okay, let’s go on. What if, there is a three-strand double
cross over involving chromatids 1 and 3; 2 and 3:
A B C
1 A b C
2 A B c
3 a B C
4 a b c
a b c
UP Open University
Module 7 95
SAQ 7-4
What would be the meiotic products of a three-strand double cross
over between genes A and B of chromatids 2 and 3 and genes B
and C of chromatids 2 and 4? Illustrate your answer.
How about a four-strand cross over between genes A and B of chromatids

1 and 3 and between genes B and C of chromatids 2 and 4?
A B C
1 A b c
2 A B c
3 a B C
4 a b C
a b c
Types of Linkage
Linkage could be complete or incomplete. But before we describe and
differentiate the two, let us review the premises of independently assorting
genes.
When two different genes are lo-

cated in two different homologous
chromosomes, they are said to be
independently segregating. For ex-
ample, genes Aa and Bb are located
on two different homologous chro-
mosomes, hence, independently
segregating. There would be four types of gamete produced: AB; Ab; aB;
ab. If these gametes are fertilized by gamete ab, the testcross progeny
consists of four genotypes in equal number (genotype and phenotype ra-
tios - 1:1:1:1) (Figure 7-1). Two classes of progeny exhibit the same asso-
ciation of alleles as observed in the parents (parental types) and the other
two classes of progeny exhibit new or recombinant association of alleles
(recombinant types). Thus, the parental types are equal in number with
the recombinant types. Independent assortment is characterized by a re-
combination frequency, calculated as the summed frequency of recombi-
nant phenotypes among the total progeny, of 50 per cent.
UP Open University
In the case of complete linkage, two or more non-allelic genes are closely
located in linear order on the same chromosome and they do not usually
assort independently of each other. The complete association of the alleles
of two genes leads to the expectation of only two genotypes among the
progeny of a testcross. These genotypes exhibit the association of alleles
observed in the parents (parental types). There are no recombinants
produced. How did this happen? Consider the following:
Genes A and B or a and b are

very closely located on the
same chromosome, hence,
they are completely linked.
Because of the closeness of
these two genes, it is very un-
likely that crossing over will
occur between them. Thus, at
anaphase I, upon the separa-
tion of the homologous chro-
mosome, A and B or a and b
will always be transmitted to-
Anaphase I
gether.
There would be two types of gamete only: AB and ab. In a testcross,

when these two types of gamete are fertilized by the ab gamete, all the
progenies are of the parental types (Figure 7-1).
When two or more non-allelic genes located on the same chromosome are
positioned far apart from each other, these genes are said to be incompletely
linked. Although four progeny genotypes are observed, distinct
preponderance of parental types resulted from the testcross (Figure 7-1).
For instance, the testcross progeny may exhibit a recombination frequency
of 20 per cent When a recombination frequency of significantly less than
50 per cent is observed between alleles of two genes, these genes are said
to be incompletely linked. To illustrate:
UP Open University
Module 7 97
Genes A and B or a and

b are positioned far apart
on the same chromo-
some. Because of the dis-
tance between these
genes crossing over
could take place be-
tween them. Conse-
quently there would be a
new combination of
linked genes. The ga-
Anaphase I metes produced would
be: AB; Ab; aB; ab. If
these gametes are fertilized by gamete ab, the resulting progenies are of
the parental and recombinant types.
Just to give you a concrete example. In Drosophila, purple eye (pr) and
vestigial wing (vg) are completely linked. Given the following cross:
P1 & P2: Pr Vg x pr vg
Pr Vg pr vg
purple eye,
normal vestigial wing
F1: Pr Vg
pr vg normal
Testcross: 1 Pr Vg (normal) : 1 pr vg (purple eye,

pr vg pr vg vestigial wing)
In corn, shrunken (Sh), colored (c), and waxy (wx) endosperm are
incompletely linked. Because of this, different recombinants can be formed
in a testcross. But again, remember that the parental types are the most
frequent.
UP Open University
Given the test cross: C Sh Wx x c sh wx

c sh wx c sh wx
white, shrunken, colored, not shrunken,

non-waxy waxy
The progenies would be:
Parental types: C Sh Wx white, shrunken, non-waxy

(the most frequent) c sh wx
c sh wx colored, not shrunken, waxy

c sh wx
Recombinants: C sh wx white, not shrunken, waxy

c sh wx
c Sh Wx colored, shrunken, non-waxy

c sh wx
C Sh wx white, shrunken, waxy

c sh wx
c sh Wx colored, not shrunken, non-waxy

c sh wx
C sh Wx white, not shrunken, non-waxy

c sh wx
c Sh wx colored, shrunken, waxy

c sh wx
UP Open University
Summary
Linkage is the tendency of two or more genes to be transmitted together.
This phenomenon suggests that two or more genes reside in the same
chromosome. Linked genes are almost always transmitted together, hence
they do not follow the expected ratio for independently assorting genes.
Because of crossing over between homologous chromosomes recombinants
can be produced. Linkage can be complete or incomplete. Completely
linked genes produce parental type progenies only but when recombinants
are formed, the genes are said to be incompletely linked.
ASAQ 7-1
e. Genes H and I are located on two different chromosomes, hence are

not considered linked and are expected to segregate and assort
independently.
c. Genes I and M are linearly located on the same chromosome

(chromosome 2), and are therefore considered to be linked.
Right? If so, the definition of linkage is already clear to you. If not, go back
to the module, read and try to understand its definition again.
ASAQ 7-2
Species No. of linkage groups
Corn, 2n = 20; n = 10 10
Rice, 2n = 24; n = 12 12
Dog, 2n = 78; n = 39 39
Mouse, 2n = 40; n = 20 20
Man, 2n = 46; n = 23 23
Remember that the number of linkage groups is equal to the haploid

number of a species? If you were able to recall this simple fact, then I’m
sure you got a perfect score. If not, you probably forgot all about it. Maybe,
after reading the correct answer to this question, you won’t repeat the
same mistake. Better luck next time!
UP Open University
Module 7 101
ASAQ 7-3
A B C
1 A B C
2 A B c
3 a b c
4 a b C
a b c
ASAQ 7-4
A B C
1 A B C
2 A b C
3 a B c
4 a b c
a b c
Were you able to illustrate the correct answers for SAQ 7-3 and SAQ 7-4?
Simple, isn’t it? I hope you enjoyed drawing the cross overs and predicting
the meiotic products. If you did not get the correct answers, kindly go
back to the module and read again.
UP Open University
Module 8
Linkage and Recombination:
Sex Linkage
Introduction
Objectives
A re you familiar with the tragic story of
the last Russian Czar, Nicholas II, and
his wife Alexandra? If you are, you most likely
know that their only son, Alexis, was afflicted
with the disease called hemophilia. In affected 1. Ddefine sex linkage;
individuals, the blood fails to clot normally 2. Enumerate the types of
because of the absence of the blood clotting sex linkage; and
factor VIII. The gene for this genetic anomaly 3. Predict the progenies of a
resides on the sex chromosome specifically the cross given a sex linked
X chromosome. character.
So, what would happen when a gene

controlling a trait is located on one of the sex chromosomes? Do you think
they would show the same segregation pattern as those linked genes
located on the autosomes? Will there be differences in the expression of
the trait in male and female progenies? You will find the answers to all
these questions in this module.
Definition of Sex Linkage

What we have discussed so far are traits whose genes are located on the
autosomes. But what would happen when a gene controlling a trait is
located on one of the sex chromosomes? Do you think they would show
the same segregation pattern as those linked genes located on the
autosomes? Let’s find the answer.
In mammals and other organisms like Drosophila melanogaster, the sex

determining chromosomes are the X and Y chromosomes. Human males
have 22 pairs of autosomes, an X and a Y chromosome (22IIA + XY), while
females have 22 autosomal pairs and a pair of X chromosomes (22IIA +
XX).
There are cases when a gene which produces a certain phenotypic trait
often unrelated to sex is located on the sex chromosome. This phenomenon,
which is a special type of linkage, is known as sex linkage. Genes located
on the X chromosome are said to be X-linked and they could be X-linked
dominant (if governed by a dominant gene) or X-linked recessive (if
controlled by a recessive gene). On the other hand, genes localized on the
Y chromosome are Y-linked. Table 8-1 presents some of the known sex
linked traits in man.
For you to truly understand sex-linked inheritance, you should always

remember the following:
1. Since a female carries two copies of the X chromosome, she has two
alleles of all X-linked genes. Therefore, she could either be homozygous
or heterozygous for any of the genes.
2. Males have only one copy of the X chromosome and since the Y
chromosome does not carry alleles of X-linked genes, a male cannot be
homozygous or heterozygous for X-linked genes. The males will
therefore express all genes on the X chromosome be they dominant or
recessive.
3. Females randomly pass on one or the other X chromosome to all

daughters and sons.
4. Males pass on their X chromosome to all daughters and their Y

chromosome to all sons.
5. Because of the stated facts in numbers 3 and 4, daughters get their X

chromosomes each from their mother and father, whereas sons inherit
their X chromosome only from their mother and the Y chromosome
solely from their father.
UP Open University
Module 8 105
Table 8-1. Some sex-linked traits in man (Cummings, 1988; Ramirez, 1990)
Traits Phenotype
X-linked dominant
Hypophosphatemia Produces bone disorders such as rickets that cannot
be cured with Vitamin D
Defective teeth enamel Characterized by the browning of teeth
X-linked recessive
Adrenoleukodystrophy Atrophy of adrenal glands, mental deterioration; death
1-5 years after onset
Colorblindness
Deutan Insensitive to green light; 60-75 per cent of color
blindness
Protan Insensitivity to red light; 25-40 per cent of color blindness
Farby’s disease Metabolic disease caused by lack of enzyme

a-galactosidase A; progressive cardiac, renal problems,
early death
Glucose-6-phosphate Benign condition that can produce severe, even fatal

dehydrogenase deficiency anemia in presence of certain foods, drugs
Hemophilia A Inability to form blood clots; caused by lack of

clotting factor VIII
Hemophilia B Christmas disease; clotting defect caused by lack of

factor IX
Icthyosis Skin disorder causing large, dark scales on

extremities, trunk
Lesch-Nyhan syndrome Metabolic defect caused by lack of enzyme

hypoxanthine guanine phosphoribosyl transferase
(HGPRT); causes mental, self-mutilation, early death
Muscular dystrophy Duchenne-type, progressive; fatal condition

accompanied by muscle wasting
Testicular feminization Insensitivity to testosterone in XY individual

resulting in female sexual phenotype
Y-linked traits
Porcupine man Whole body except palms, soles, head, and face is
covered with rough, bristly scales and cylindrical
bristle-like outgrowths nearly an inch long
Webbed toes Characterized by a web-like connection between the

second and third toes
Hypertrichosis of the ears A conspicuous growth of hair on the outer rim of the
ears
UP Open University
Types of Sex Linkage

With the occurrence of sex-linked inheritance just described, let us
demonstrate the different types of sex linkage as they occur in man.
X-linked dominant
Defective teeth enamel is governed by a completely dominant allele which
happened to be located on the X chromosome. Let’s designate D, for
defective teeth enamel and its recessive allele, d, for the normal phenotype.
Males and females are designated as follows (Take note of the notation
for the genotypes: the alleles were written as superscripts of the male and
female X chromosome.):
X DX D female with defective teeth enamel (homozygous for gene D)

X DX d female with defective teeth enamel (heterozygous)
X d X d female with normal teeth
XDY male with defective teeth enamel

X dY male with normal teeth
Now that you know the respective genotypes and their corresponding
phenotypes, let’s look at reciprocal crosses using the trait.
Parental cross:
(P1 & P2) XDXD x X dY
defective teeth normal teeth
Gametes: XD Xd Y
Progenies:
Xd Y
XD XDXd XDY
Genotypic ratio: 1 XD X d
1 XDY
Phenotypic ratio: 1 daughter with defective teeth

1 son with defective teeth
UP Open University
Module 8 107
Parental cross:
(P1 & P2) X dX d x XDY
normal teeth defective teeth
Gametes: Xd XD Y
Progenies:
XD Y
Xd XDXd XdY
Genotypic ratio: 1 XDXd

1 XdY
Phenotypic ratio: 1 daughter with defective teeth

1 son with normal teeth
From the above given reciprocal cross, try to notice that when the father
exhibits the trait for defective teeth enamel, his daughter inherits the trait.
Why? Again, this is because the daughter inherits one of her X
chromosomes from her father and if that X chromosome carries the
dominant allele for defective teeth enamel, she would automatically exhibit
the trait. A father-daughter transmission is a characteristic of X-linked
dominant traits.
X-linked recessive
Look at Figure 8-2. These are photographs of plates commonly used to
test for red-green colorblindness in man. Colorblind persons will not be
able to read or recognize certain figures or numbers “hidden” in each
plate. Colorblindness is due to a recessive allele which we would designate
as c (colorblind) versus the normal phenotype (C). However, the gene for
colorblindness was found to reside in the X chromosome, thus, it is X-
linked. Because of this, males and females differ in the way by which they
would express the trait. The following are the different possible genotypes
and their corresponding phenotypes:
X CX C normal female (She has no gene for colorblindness.)

X CX c normal female (However, she is known as a carrier; the
expression of the recessive allele is being masked.)
UP Open University
X cX c colorblind female
XC Y normal male (He has no gene for colorblindness.)
X cY colorblind male
I’m sure you have noticed that the males need only one dose of the recessive
allele in order to express the trait but the females need the presence of the
two recessive alleles to express colorblindness.
Figure 8-2. Photograph of sample plates used to test red-green colorblindness
UP Open University
Module 8 109
Gametes: XC Xc Y
Progenies:
Xc Y
XC XCXc XC Y
Genotypic ratio: 1 XCXc

1 XCY
Phenotypic ratio: 1 normal female (but carrier)

1 normal male
Parental cross:
(P1 & P2) Xc X c x XC Y
colorblind normal
Gametes: Xc XC Y
Progenies:
XC Y
Xc XCXc X cY
Genotypic ratio: 1 XCXc

1 XcY
Phenotypic ratio: 1 normal female (but carrier)

1 colorblind male
UP Open University
For X-linked recessive traits, as illustrated by the given reciprocal cross,

you might have noticed that a colorblind mother would have sons who
are all colorblind. This is mainly due to the fact that sons inherit their X
chromosome from their mother. If this X chromosome carries a recessive
allele then the son will definitely be colorblind. A mother to son
transmission is an indication of a sex-linked recessive trait.
SAQ 8-1
Let’s try another cross. A carrier female (XCXc) marries a normal
male (XCY). What would be the chance of colorblindness appearing
in their progenies ?
For your practice, try to make other crosses and predict the genotypes
and phenotypes of the progenies and their respective frequencies. (Who
knows! This might be included in the exam.)
Y-linked traits
If there are X-linked traits, there are also Y-linked traits. An example is
hypertrichosis, a trait characterized by the presence of excessive hairs in
the ear rims. Another example is webbed toes. Who do you think will
inherit these traits? Daughters only? Sons only? Or both sons and
daughters?
Y- linked traits like hypertrichosis can only be inherited by the sons, never
by the daughters. Why? Simply because the Y chromosome is transmitted
from the father to the son only and if the gene is located on the Y
chromosome, it follows that only the sons will always inherit that trait.
This father to son transmission of a trait is called holandric transmission.
Summary
Sex linkage is a special type of linkage where genes not related to sexual
characteristics are associated with the sex chromosomes. Sex- linked genes
can be X-linked dominant, X-linked recessive or Y-linked. X-linked
dominant traits exhibit a father to daughter transmission, while, X-linked
recessive traits show a mother to son transmission. But for Y-linked traits,
a definite father to son transmission is followed.
UP Open University
Module 8 111
ASAQ 8-1
From the cross : XCXc x XCY
Gametes: XC Xc XC Y
Progenies:
XC Y
XC XCXC XC Y
Xc XCXc Xc Y
Genotypic ratio: 1 XC X C
1 XCXc
1 XCY
1 XcY
Phenotypic ratio: 2 normal daughters

1 normal son
1 colorblind son
From the results of the cross between a carrier female and a normal male,
you can see that there is a 25-per-cent chance (or ¼) of having a colorblind
progeny.
It’s easy, right? All you have to remember is how the sex chromosomes
are transmitted and you can then deduce how the genes are transmitted.
UP Open University
Module 9
Chromosome Mapping in
Eukaryotes
Introduction
Objectives
W hen you ask a native of Los Baños how
far the town is from Manila, he would
most likely say it is around 63 km. That’s how
we measure distance, right ? How about if I
ask you, how far is gene X from gene Y? What 1. Construct a linkage map
would be our measure of distance ? based on the three-point
testcross; and
In this lesson, we will discuss one classical or 2. Solve problems on linkage.
conventional method of determining the
distance between genes in a chromosome.
Since genes are found in linear order in a chromosome, it is possible to

establish the relative distance between them and map them accordingly.
When we talk of distances between objects, we usually express them in
terms of centimeters, inches, feet, meters, yards, etc., but not when we
refer to distances between genes.
It was T.H. Morgan who first suggested that the amount of crossing over
between two linked genes is proportional to the distance between the
genes on the chromosomes. Less crossing over will occur between genes
that are closer to one another than between those that are at opposite
ends of the chromosome. A.H. Sturtevant, a student of Morgan in 1912,
advanced the idea that this difference in frequency of crossing over could
be used for mapping chromosomes. The percentage of the recombinant
arising from crossing over can be converted into a measurement of distance

between two linked genes. One map unit of distance is equivalent to the
space between genes in which one per cent recombinant arises by crossing
over. Or one map unit is the distance that yields 1 per cent recombination.
A map unit is a relative measurement in arbitrary units and not an absolute
or actual measurement of chromosome length in physical units.
The most classical and useful method of linkage analysis in diploid species
is the three point testcross. In a testcross, each phenotype is a unique
genotype and each phenotypic class will have a unique combination of
the alleles of the two linked genes in all possible pairwise arrangements.
The three point testcross, in which three pairs of alleles are segregating, is
the method usually chosen for mapping linked genes on the chromosome.
Homozygotes are crossed to produce triple heterozygote or trihybrid
(ex . ABC ) and the trihybrids are then testcrossed to triple homozygote
abc
abc
recessive so that the kinds and frequency of the F1 gametes can be
abc
determined directly from the phenotypes of the testcross progeny.
As an example, let us consider the following testcross and the resulting

progenies:
ABC x abc
abc abc
Genotype No. of progenies Genotype No. of progenies
ABC 370 ABc 2

abc abc
abc 385 abC 3

abc abc
Abc 45 AbC 75
abc abc
aBC 50 aBc 70
abc abc
Total no. of progenies: 1000
UP Open University
Module 9 115
Steps in Constructing the Linkage Map

1. Look for the parental phenotypes. The parental phenotypes are the
most frequent.
ABC = 370 and abc = 385

abc abc
2. Look for the double cross over types (DCO). DCO types are the least
frequent.
ABc = 2 and abC = 3

abc abc
3. Compare the arrangements of the three genes in the parental and

DCO types. You will notice that in the parentals, all the dominant
alleles ABC are together while all the recessive alleles abc are in the
other parental type. But if you look at the DCO types, genes A and B
are together while genes a and b are also together. It is the position of
C/c which was interchanged. The allele which changed position or
whose position shifted is designated as the middle gene. In case all the
genes are always together and no gene shifted position, it only means
that the given gene order is already the correct gene order.
4. Establish the proper gene order. Now that you know C/c is the middle
gene, the proper gene order is ACB.
acb
5. Determine the single cross overs (SCO) at the two regions. If you think
about it, there are two regions — the region between genes A and C,
designated as region I; and the region between genes C and B,
designated as region II. With the following illustration, we can easily
identify the single cross overs:
SCOI(A-C)
A C B Acb = 45 &
acb
a c b
aCB = 50
acb
UP Open University
SCOII(C-B)
A C B ACb = 75 &
acb
a c b
acB = 70
acb
6. Compute the % recombination or cross overs in the two regions.
% recombinants = x 100
or cross overs
SCO + DCO
I
% COI = x 100
total testcross progeny
45 + 50 + 2 + 3
% COI(A-C) = x 100 = 10%
1000
SCO + DCO
% COII = II x 100
total testcross progeny
75 + 70 + 2 + 3
% COII(C-B) = x 100 = 15%
1000
(Note: DCOs are added because they undergo crossing overs at regions I
and II.)
6. Draw the linkage map as follows:
A C B
________________________________________
10 map units 15 map units
Determination of the Strength of Linkage

The degree of closeness of a set of genes, hence their ability to be passed
on together to the next generation, can be determined in terms of
interference. Interference is a measure of the degree to which cross over
in one region affects the probability of a second cross over in an adjacent
region. If the genes are close to one another, the occurrence of one cross
over prevents or interferes with another crossing over occurring nearby.
UP Open University
Module 9 117
The degree of interference can be easily measured by the coefficient of

coincidence (cc) which is:
cc = ADCO (actual double cross overs)

EDCO (expected double cross overs)
where ADCO = DCO ; EDCO = COI x COII

N
N = total
Interference is actually equal to 1 - cc. A cc value of 0 (interference is 1)

means that there is complete interference. Crossing over in a region
prevents another crossing over to occur at a region near it. This then
indicates that the genes are very near each other and they are described
to show strong linkage. On the one hand, a cc value near 1 means that
there is no interference. Crossing overs between the genes of different
regions occur frequently and freely; the gene loci are therefore far from
each other and the genes are said to be weakly linked.
SAQ 9-1
Solve and interpret the coefficient of coincidence and interference
in the example given in the section illustrating construction of the
linkage map.
Aside from constructing a linkage map given the frequencies of the testcross
progenies, you will also encounter another type of problem. In this
problem, you will be given the linkage map and asked to determine the
expected frequencies of the testcross progenies.
Let us consider the following example.
Given the following map:
A B C
_____________________________________ and cc = 0.50
5 map units 8 map units
UP Open University
Module 9 119
For SCOII
SCOII = COII x N - DCO
= 0.08 x 4000 - 8
= 312; 156/156
A B C ABc = 156
abC = 156
a b c
The parentals can be computed easily by subtracting all DCOs and SCOs
from the total.
Parentals = 4000 - 8 - 192 - 312

= 3488; 1744/1744
ABC = 1744
abc = 1744
Summary
In eukaryotes, linkage mapping is conventionally done by the analysis of
the frequencies of the different progenies of a three point testcross. The
distance between genes is determined in terms of the frequency of
recombination between them. The degree of closeness of genes can be
measured by interference, which in turn can be determined by computing
the coefficient of coincidence.
References
Cummings, M.R. (1988). Human heredity: Principle and issues. Mn: West
Pub. Co. pp. 89-110.
Gardner, E.J. (1993). Principles of genetics. 6th ed. New York: John Wiley
and Sons.
Laude, R.P., A.A. Barrion, M.S. Mendioro, M.G.Q. Diaz, N.N. Bebing,
and D.A. Ramirez. Genetics laboratory manual. 8th ed. U.P. Los Baños.
pp. 37-48.
Ramirez, D.A. (1990). Genetics. 7th ed. U.P. Los Baños: SEAMEO-SEARCA.
pp. 41-58.
Strickberger, M.W. (1976). Genetics. 2nd ed. New York: Mc Millan Pub. Co.
Inc. pp. 313-434.
UP Open University
Suzuki, D.T., A.J.F. Griffiths, J.H. Miller, R.C. Lewontin. (1986). An

introduction to genetics. 3rd ed. New York: W.H. Freeman and Co.
pp. 79-125.
Weaver, R.F. and P.W. Hedrick. (1995). Basic genetics. 2nd ed. Iowa: Wm.
C. Brown Pub. pp. 106-128.

ASAQ 9-1
Here is the computation for the cc value:
DCO 2+1
cc = =
N 1000
CO I X CO II (0.10) (0.15)
0.005
cc = = 0.33
0.015
interference = 1-cc = 1 - 0.33 = 0.67
The computed value, 0.67, is relatively a high interference value. This

indicates that the genes A,B, and C are quite near each other and they
share a relatively strong linkage.
I do hope you got the correct value and interpretation. It’s just a
straightforward substitution of given values to the formula. If you did
not, maybe you got confused with the use of the formula and in the
interpretation of the resulting interference value. Try again!
UP Open University
Module 10
The Structure and Properties
of the Genetic Material
Introduction
Objectives
H ave you ever wondered why you look
different from your neighbor? Why can you
identify brothers and sisters, or parents and
children, based on their physical appearances?
Why are identical twins almost indistinguishable 1. Identify the chemical compo-
from each other? nents of the genetic mate-
rial;
Doubtless, these distinct differences on one hand 2. Illustrate the planar and
or striking similarities on the other hand are partly three dimensional structures
influenced by the environment in which people of the genetic material;
are raised. However, these can be mainly explained 3. Distinguish the features of
in terms of a chemical basis −− a biomolecule DNA and RNA;
preserved in the cell nucleus, duplicated faithfully, 4. Explain the characteristics of
transmitted from one generation of cells to another, the genetic material; and
able to express a trait, and stores diverse amount 5. Relate the physical structures
of biological information. This is the genetic of the DNA with its proper-
material called deoxyribonucleic acid or DNA. Some ties as the genetic material.
viruses do not have DNA as their genetic material;
instead they have RNA, ribonucleic acid.
Knowing the structure of the genetic material would greatly help you in
understanding the different genetic processes that lead to trait expression. But
before we start with the lesson, read first the following definition of terms.
Definition of Terms
Antiparallel - opposite in polarity or orientation (said of two linear polymers)
Deoxyribonucleic acid or DNA - the genetic material of all cells and many
viruses
Double helix - the three-dimensional structure of the DNA characterized by

the plectonemic coiling of the two strands around each other
Genetic material -the biomolecule, specifically a nucleic acid, containing the

genetic information; physically and chemically stable; able to transfer
the genetic information from generation to generation
Nucleoside - a compound consisting of a purine or pyrimidine base covalently

linked to a pentose
Nucleotide - a nucleoside phosphorylated at one of its pentose hydroxyl groups
Polynucleotide - a covalently linked sequence of nucleotides in which the 3’

position of the pentose of one nucleotide is joined by a phosphodiester
group to the 5’ position of the pentose of the next
Ribonucleic acid or RNA - the genetic material of some viruses
Concept Map
MOLECULAR COMPONENTS
Phosphate
Pentose Sugar
Nitrogen Bases
STRUCTURE
DNA RNA
PROPERTIES
GENETIC MATERIAL GENETIC MATERIAL

of all cells and many viruses
of some viruses
UP Open University
The Three-Dimensional Structure of the DNA

So far, what I have shared with you are the components and the planar structure
of the DNA. In 1953, James Watson and Francis Crick proposed the three
dimensional DNA structure. This model is called the DNA double helix.
Figure 10-3. Double

helical structure of the
DNA
Imagine that you are in an old church. In this church, you will usually find a
spiral staircase. The DNA helix can be likened to this staircase. The two rails
represent the sugar phosphate backbone while the flat, horizontal bars stacked
on top of one another represent nitrogen base pairs. Remember, the two strands
are antiparallel and together form a complete right handed (clockwise) turn
every 34 angstrom (A) units (i.e., 3.4 nm). There are ten base pairs in one
complete turn of 360o. If so, then the base pairs occupy 3.4 A in space. The
diameter of the DNA molecule is 20A. The DNA also has its minor and major
grooves.
The Structure of RNA

Though it is still debatable whether or not to consider viruses as living cells,
these entities are characterized by the presence of the genetic material. Some
carry DNA as their genetic material; many others, like the tomato mosaic virus
and the deadly human immunodeficiency virus (HIV) or the AIDS virus, have
RNA.
UP Open University
Module 10 127
Recall that RNA nucleotides would have

the phosphate, ribose as its sugar
component and G, C, A, and U as its
nitrogen bases. It is a polynucleotide but
unlike DNA, it would not show
antiparallelism and specificity of base
pairing because it is single- stranded.
Figure 10-4 illustrates the planar
Figure 10-4.
structure of RNA.
A simplified
structure of
RNA
SAQ 10-2
Using three criteria, give the differences between DNA and RNA. To
make it easier, you can tabulate your answer.
Properties of the Genetic Material

The DNA is the genetic material of all cells, both prokaryotic and eukaryotic. It
is also the genetic material of many viruses. Have you therefore thought of the
reasons why this nucleic acid and not any of the other biomolecules is
considered as the genetic material?
There are four basic requirements for a biomolecule to qualify as a genetic

material. They are:
a. ability to store large amounts of genetic information;

b. ability to transfer the information to daughter cells;
c. physical and chemical stability; and
d. mutability.
The amount of information stored in the genetic material should account for
virtually all expressible traits - unimaginably large! The DNA could meet this
by an equally unimaginable variation in base sequences. Ultimately, the base
sequences are responsible for “dictating” the amino acid sequences of proteins
which, in turn, directly or indirectly express the organism’s traits.
As would be seen in the next module, every cycle of somatic or body cell division
is preceded by a cycle of faithful DNA replication. Replication is exact because
UP Open University
the two DNA strands are separated to function as templates in the synthesis of
new complementary strands. As such they produce two exact copies of the
original DNA. These two copies are then distributed to daughter cells during
cell division.
SAQ 10-3
Can you guess what feature of the DNA enables it to self replicate?
Explain your answer.
The DNA is a very stable biomolecule mainly due to three factors inherent in
its structure. The sugar-phosphate backbone is extremely stable under all
conditions, say extreme temperatures and pH. In fact, at pH 8 to 9, there is less
than one bond broken per million bonds per month. The base stacking, which
refers to the tendency of the hydrophobic N-bases to pile one on top of the
other, also contributes to stability. Lastly, though H-bonds are weak in
themselves, they can add tremendous stability when found in millions between
base pairs of a whole DNA.
Many textbooks add a fourth requirement for a genetic material, namely, the
ability to change without major loss of parental information or simply,
mutability. DNA mutations are most frequently harmful but in some rare cases
they may be advantageous in helping organisms adapt to the selection pressure
of a changing environment. DNA could mutate this way via two causes —
chemical alteration and replication errors.
RNA is not an ideal genetic material because its structure, though stable, loses
much of the base stacking and almost all of the hydrogen bonding. However,
like the DNA, it can also vary its sequences innumerably and replicate faithfully.
It is mutable. Relatively speaking, only a few known viruses use RNA as their
genetic material among which the AIDS virus is the most popular and probably
the most dangerous.
Activity 10-1
Let’s have an exercise and see if you can illustrate the DNA and RNA
structures using the DNA RNA kit I provided. You will be able to do
this activity during your session with your tutor in your respective study
centers. The result of this activity will be presented during the tutorial
session for discussion.
UP Open University
Activity 10-1 continued
Here are some clues that could lead you toward the correct
identification of the components. Try to follow them.
a. The phosphate group of DNA and RNA are identical. If you

will build a 15 nucleotide long DNA and RNA, then you need
a total of 45 molecules.
b. A 15-nucleotide long double stranded DNA needs 30
deoxyribose molecules.
c. A 15-nucleotide long single stranded RNA needs 15 ribose
molecules.
d. The protruding parts of the white and orange chips complement
the two different shapes found in the red, blue, and green colors.
You can then identify the chips for DNA and the chips for RNA.
At this point, you can segregate the chips for the DNA model
and those for the RNA model. If you can’t, review the chips’
colors and shapes.
e. Let’s continue our designations. When you compare the DNA

chips with the RNA chips, you will notice that yellow is present
only in the RNA group. On the other hand, pink can only be
found in the DNA group. Why is this so?
When you count the chips, you will notice that the number of
pink chips is equal to that of the blue ones ( ). Remember the
specificity of pairing? If you have already identified what pink
is, then you should know what blue is for.
Pyrimidines are single ringed molecules, therefore smaller, while
purines are double ringed, hence larger. The red and pink chips
are smaller than the blue and green ones. You have already
identified the chemical component being represented by pink;
you would definitely know what red is, another pyrimidine.
Follow this kind of reasoning and you will be able also to identity
the green chips.
5. After identifying the chemical component being represented by each

color, you can now try building a 15 nucleotide long DNA.
a. Build nucleoside from all bases and from them make nucleotides.
b. Connect 15 nucleotides and label the 5' and 3' ends.
c. Pair these nucleotides with appopriate nucleotides to construct
a 15 nucleotide long antiparallel strand.
6. Build a 15 nucleotide long RNA following steps 6a and 6b.
UP Open University
Module 10 131
SAQ 10-4
Calculate the actual size in micrometers (mm) of the 15 nucleotide long
planar DNA model that you built.
Note: There are 10 base pairs per 34 Angstrom (Å) and 10,000 Å per
micrometer.
Summary
DNA and RNA are both polynucleotides which could act as genetic materials.
There are three major chemical components: phosphate group; pentose sugar;
and nitrogen base. DNA and RNA have certain structural similarities and
differences.
The accepted three-dimensional DNA structure called the DNA double helix
was proposed by James Watson and Francis Crick.

ASAQ 10-1
Here is the schematic diagram that shows the different chemical components
of DNA and RNA nucleotide.
Nucleotide
Phosphate Nucleoside
Pentose sugar Nitrogen bases
Deoxyribose Ribose Purines Pyrimidines

for DNA for RNA Guanine Cytosine
Adenine Thymine(DNA)
Uracil (RNA)
It’s great if you got this correctly. I believe you will easily understand the next
topic. In case you didn’t get it right, don’t lose hope, just read again.
UP Open University
ASAQ 10-2
Here is the tabulated answer to the question I gave in SAQ 10-2.
Criteria DNA RNA

1. No. of strands double single
2. Sugar component 2 deoxyribose D-ribose
3. Nitrogen bases A,C, G, T A,C,G, U
The above answer is the best answer you can give. If you got all points correctly,
very good! You have already mastered the differences between DNA and RNA
in terms of their structure. If not, then try to read again and be a little more
alert.
ASAQ 10-3
The feature of the DNA that enables this molecule to self replicate is the
specificity of base pairing. Remember that A will always pair with T and C
with G. Thus, if you have the 2 single stranded-templates complemented, the
result will be 2 identical double-stranded DNA copies. Were you able to figure
that out? You’re really good. If not, don’t worry, you will better understand
this when we discuss DNA replication in the next module.
ASAQ 10-4
Here is the solution to the problem I gave in SAQ 10-4.
Every 10 base pairs (bp) measure 34 Å. If you did ratio and proportion, your
answer is 51 Å. Right?
10 bp = 15 bp
34 Å X
X = 51 Å
Getting the correct answer means you’re on the right track.
If you remember that for every micrometer there are 10,000 Å and you computed
for the equivalent value of 51 Å in micrometer, then your answer is definitely
0.0051 mm. This is the final answer.
(51 Å) (10,000 Å/1μm)

= 0.0051 μm
Don’t you think that’s easy? Congratulations on your correct answer! However,
don’t worry if you did not get it, I suggest you review the dimensions of DNA
and the equivalents and conversions of one microscopic unit to another.
UP Open University
Module 11
An Overview of the Central
Dogma of Molecular Biology
Introduction
W e Filipinos are fond of watching

movies or television shows. So, let
us try to visualize the making of a film. The
Objectives
final film is the work of a lot of highly After studying this module,
skilled specialists— the actors and you should be able to:
actresses, scriptwriter, cinematographer,
designer, musical scorer, editor, 1. Explain the “one gene-one
cameramen, and a host of others. However, enzyme” and “one gene-
behind all these workers, there is usually a one polypeptide” hypo-
single man who has envisioned how the theses;
film is to be made, who interprets the script, 2. Illustrate the general plan
who motivates and tell the performers how of the central dogma of
to act and feel, who tells every crew what molecular biology;
to do, and who supervises everything. Yes, 3. Define replication, trans-
I think you guessed it right, this man is cription, and translation;
none other than the director. and
4. Explain how a gene product
Biologically speaking, the DNA is the produces a phenotype.
organism’s director. It contains all the
information necessary in order to build a
whole organism from a single cell. However, as a director, it does not do the
work by itself but employs others, the proteins.
Proteins are biomolecules produced under the direction of the DNA. They are
like the employed specialists, the actual builders of the organism’s body. How
are they produced? That is the concern of this lesson.
What follows is a list of terms with their respective meanings. Knowing the
meaning of the words in the list would surely aid you in understanding the
succeeding lessons.
Definition of Terms
Anticodon - a specific sequence of nucleotides found at one of the arms of the
transfer RNA and is complementary to the codon in a messenger RNA
Codon - a series of three adjacent nucleotides in a nucleic acid that codes for a
specific amino acid
Genetic code - the set of triplet code words in coding for the amino acids of
proteins
Messenger RNA or mRNA - a class of RNA molecules, each of which is

complementary to one strand of the cellular DNA and provides the
template that gives the code for the amino acid sequence of the proteins
Polypeptide - a long chain of amino acids linked by peptide bonds
Replication - synthesis of a daughter duplex DNA molecule identical to the

parental duplex DNA molecule
Ribosomal RNA or rRNA - a class of RNA molecules serving as components

of ribosomes
Ribosomes - a macromolecular assembly of rRNAs and proteins which serve

as the site of protein synthesis
Transcription - the enzymatic process whereby the genetic information

contained in one strand of DNA is used to specify a complementary
sequence of bases in an mRNA chain
Transfer RNA - a class of RNA molecules, each of which covalently combines

with a specific amino acid; brings the amino acid to the site of synthesis
Translation - the process in which the genetic information present in an mRNA

molecule directs the sequence of amino acids during protein synthesis
UP Open University
Module 11 137
Concept Map
REPLICATION
(self-synthesis) DNA
TRANSCRIPTION
RNA
has three types
messenger RNA transfer RNA ribosomal RNA
has codons has anticodons plus ribosomal proteins
GENETIC
CODE
forms ribosomes
codes for sequence brings the coded connects together

brings the coded amino acid coded amino acids
TRANSLATION
PROTEINS
directly or indirectly
PHENOTYPIC EXPRESSION
(appearance)
UP Open University
The “One Gene - One Enzyme” and

“One Gene - One Polypeptide” Hypotheses
The first studies implying that genes made enzymes were those conducted in
the late 1800s on the metabolic pathway of phenylalanine breakdown. Three
diseases called inborn errors of metabolism are associated with this biochemical
pathway, namely: (1) alkaptonuria or the accumulation of a black substance,
alkapton, in the urine; (2) phenylketonuria or the accumulation of phenylalanine
or phenylpyruvic acid (phenylketones) in the urine and in the blood leading to
mental retardation; and (3) albinism or the failure to produce the pigment
melanin (Figure 11-1).
Studies show that all these compounds— phenylalanine, alkapton,

phenylpyruvic acid, and melanin— are interrelated by a metabolic pathway
and each disease could be explained by a metabolic or biochemical block due
to a defective step in the pathway. Apparently, each block is due to a defective
enzyme. Now since inheritance studies reveal that these three metabolic
disorders behave as if under the control of single genes, it appears that normal
individuals use these genes to produce specific enzymes that are defective in
affected individuals. Figure 11-1 illustrates a part of the metabolic pathway of
phenylalanine breakdown and the metabolic disorder associated with it.
It was not until 1941 that two American geneticists, Beadle and Tatum, set out
to investigate more fully this proposition that genes made enzymes. They used
the red colored mold (normally found on bread) Neurospora crassa.
UP Open University
Module 11 139
Protein
Enzymes
Phenylalanine Phenylpyruvic acid

Phenylketonuria
(PKU)
Phenylalanine block diverts to

hydroxylase
Tyrosine Melanin
Transaminase block Albinism
Hydroxyphenylpyruvic
acid
Hydroxyphenylpyruvic
acid oxidase
block Tyrosinosis
Homogentisic acid
Homogentisic
acid oxidase block Alkaptonuria
Maleylacetoacetic acid
CO2 and H2O
Figure 11-1. A part of the metabolic pathway of phenylalanine breakdown

(Lerner and Libby, 1976 as cited in Suzuki et al., 1986)
UP Open University
They irradiated N. crassa spores with X-rays or UV light, both of which could
increase the rate of mutation (genetic defect) in the mold. All the spores grew
on complex medium (i.e., supplemented with all known amino acids, vitamins,
and nitrogen bases). However, when they were transferred to minimal
(unsupplemented) medium, the 299th spore did not grow, indicating the defect
to be only in one metabolic pathway. Further analysis revealed that the defects
could well be in single steps of the pathways, i.e., due to single defective enzyme.
Genetic studies revealed that each defect behaved as if controlled by a single

gene. Hence, putting these findings together, leads to the conclusion that
mutation in a single gene causes a defect in a single enzyme which blocks a
single step of a metabolic pathway. In normal individuals, therefore, a gene
controls the synthesis of an enzyme — this conclusion is often referred to as
the “one gene - one enzyme” hypothesis.
In this era of molecular biology, it has been found that an enzyme could be
composed of several protein subunits, the synthesis of each is controlled by
separate genes. There are also cases when a gene controls the production of a
protein which is not an enzyme (e.g. structural proteins). Hence, Beadle and
Tatum’s conclusion has been improved to state that a gene controls the synthesis
of a polypeptide or a protein, i.e., the “one gene - one polypeptide” hypothesis.
SAQ 11-1
Galactosemics characterized by hyperglycemia are deficient in enzyme
galactose-1-phosphate uridyl transferase. Do you consider this an inborn
error of metabolism? Can you cite other examples of inborn errors of
metabolism?
The Central Dogma of Molecular Biology

As previously stressed, DNA as the genetic material stores all the information
for all the traits of an individual in the nucleotide base sequence. However,
traits are expressed through the action of proteins. But how does DNA control
the synthesis of a protein? The answer to this question lies in the central dogma
of molecular biology which is diagrammed in Figure 11-2.
UP Open University
Module 11 141
Transcription Translation
(RNA synthesis) (Protein synthesis)
DNA Replication
DNA RNA Proteins
Reverse RNA
Transcription Replication
Figure 11-2. The central dogma of molecular biology
In the last two lessons, the structure of the DNA and its replication have been
explained. The DNA transfers its nucleotide sequence to an RNA through the
process of transcription. The biological logic behind this seems to be that the
cell is avoiding an overuse of the DNA so as not to risk unnecessary damage.
In much the way, the director would rather provide photocopies of the script
to the talents and keep the original copy safe. In a sense RNA is a copy of the
DNA base sequence. The nucleotide sequence of the RNA, which is a copy of
the DNA’s, is then interpreted or decoded into an amino acid sequence of a
protein in the process of translation. The protein, then, could express the trait
directly or indirectly.
Proteins affect trait expression either directly, when it is a structural protein, or

indirectly, when it is an enzyme. Let us have specific examples. Keratin, a
structural protein, is the main component of our hairs and nails. How our
hairs and nails appear is dependent on the quality and quantity of this protein.
On the other hand, our coloring is due to the presence and quantity of the
melanin pigment in our skin. And this pigment is produced via a metabolic
pathway that requires several enzymes to catalyze the several steps.
Aside from the three general transfers (replication, transcription, translation),

there are what we call special transfers or extensions of the central dogma.
These include reverse transcription and RNA replication.
Some viruses known as the retroviruses are viruses with RNA as the genetic
material; they contain the unique enzyme reverse transcriptase. This enzyme
can catalyze the enzymatic synthesis of a DNA complementary to the viral
RNA. The dreaded human immunodeficiency virus (HIV) or the AIDS virus is
a retrovirus.
On the other hand, some RNA - containing viruses (f2, MS2, R17, and Qb
phages) when present in their host cell (E. coli), bring about the synthesis of a
set of enzymes, the RNA replicases. Because of the presence of these enzymes,
the duplication of the virus’ RNA is made possible.
UP Open University
Summary
The DNA carries the information necessary for the synthesis of proteins, which
could express traits either directly as structural proteins or indirectly as enzymes.
The transfer of information from DNA to proteins is encapsulated in the central

dogma of molecular biology by which self-replicating DNA can be transcribed
to form RNA which in turn is translated to form a protein. A gene can be
defined as a segment of the DNA that codes for one protein or polypeptide.

ASAQ 11-1
Galactosemia due to the deficiency of the enzyme galactose-1-phosphate uridyl

transferase is an inborn error of metabolism. Homozygous recessive individuals
are unable to metabolize galactose because of the deficiency in the said enzyme.
There would be accumulation of galactose in the blood which leads to the
enlargement of the liver, retarded mental development, and generally slow
growth.
Here are more other examples of inborn errors of metabolism:
Inborn error of Phenotype Enzyme Normal enzyme

metabolism activity
1. Cretinism thyroid malfunction; iodotyrosine catalyzes removal

mental retardation deiodinase of iodine from
iodotyrosine
2. Huntington’s progressive mental glutamic acid catalyzes synthesis

chorea retardation decarboxylase of aminobutyric acid
3. Jaundice presence of bile in glucoronyl catalyzes transfer of

(congenital) various tissues transferase glucoronic acid from
uridine di-PO4 to
bilirubin receptors
4. Lesch-Nyhan mental retardation; hypoxanthine purine metabolism

Syndrome self-mutilation guanine
phosphoribosyl
transferase
5. Tay-Sachs mental and motor ß-D-N-acetyl cleaves the terminal

retardation; death hexoaminidase A residue from
ganglioside
UP Open University
Module 12
DNA Replication
Introduction
Objectives
C an you still remember the “word relay
game” that you used to play when you
were a child? In this game, a group of people
will line up. A sentence will be given by a
leader to the first person in the line then that 1. Enumerate the different
person will whisper it to the next person and steps of replication and the
so on down the line. It is always funny when protein requirements of
the last person recites the sentence because each step;
most of the time the sentence is entirely 2. Describe the function of the
different from the original. different proteins and
enzymes necessary in
The above given example clearly shows the replication; and
inaccurate transmission of information from 3. Explain the significance of
one person to another but living organisms accurate DNA replication.
cannot afford this kind of mistake. All of life
depends on the accurate transmission of
information. Through countless cell divisions, the genetic messages in the DNA
are scrupulously preserved and passed from one generation to another. This is
made possible by DNA replication ⎯ a process which happens at the S
(synthesis) phase of the cell cycle and provides two exact copies of the DNA to
be distributed to daughter cells. This lesson will help you understand this
complex but life-maintaining process.
The Y-Fork Model of Prokaryotic

DNA Replication
The bulk of studies on replication is concentrated on DNA replication in
prokaryotes and viruses because they are much less complex than the eukaryotic
systems. Different models have been proposed for prokaryotic and viral DNA
replication which have essentially the same basic requirements. The Y-fork
model of replication of linear DNA molecules found in certain organisms (e.g.,
E. coli, phage T7) is discussed below.
1. Unwinding of the complementary strands
Starting from a single site, the two strands of the DNA molecule separate
to make single stranded templates ⎯ the leading strand and the lagging
strand. These two strands differ in their orientation: the leading strand has
the 3'-5' while the lagging strand has the 5' - 3' orientation.
The unwinding involves the actions of three types of proteins: a) the DNA
unwinding protein or DNA helicase which uses up ATP to separate the parental
strands; b) the DNA single strand binding proteins (SSBP) or helix destabilizing
proteins (HDP) which bind to single stranded DNA at the separation point
or fork to prevent the reannealing or repairing of the two strands; and c)
DNA gyrase which relaxes the twisting tension created by the unwinding
process. Look at Figure 12-1 and see if it helps you visualize this step. Take
note of the Y configuration (hence, the name Y-fork) clearly evident upon
the separation of the two strands.
Figure 12-1.
Unwinding of
DNA
SAQ 12-1
What do you think would happen if there are no helix unwinding
proteins and helix destabilizing proteins?
UP Open University
At the end of replication there are two DNA molecules which are exact molecular
replicas of the other and of the parental DNA molecule. Each of the two
molecules is composed of one old and one newly synthesized strand. This is
what is known as the semi-conservative nature of DNA replication.
Whew! I know the preceding discussion on the different steps of replication is

quite difficult to follow. If after the first or second reading the process is still
vague to you, try to read again. Some things may still be unclear after the third
reading, but don’t worry, you will be able to understand them better when you
get to use the teaching model on replication.
Eukaryotic DNA Replication

Eukaryotic DNA replication is more complex than the replication process of a
prokaryote. The complexity can be attributed to some of the characteristics of a
eukaryotic genome. Eukaryotes have large genome size; they have much more
chromosomes than prokaryotes have. In addition, the eukaryotic DNA is
associated with histones and non-histone chromosomal proteins. Hence,
eukaryotic DNA is replicated not as bare DNA but as chromatin.
Because of the complexity of eukaryotic DNA replication and the relatively

shorter time it has been effectively studied, this process is much less understood.
However, several lines of organization have already been established. Some of
them are:
1. The basic plan is the same, i.e., unwinding, priming, elongation, replacement
of primers, and sealing of breaks or nicks.
2. Eukaryotic replication has many initiation sites in contrast to prokaryotes
and viruses which only have one. In Drosophila melanogaster, for example,
as many as 5,000 initiation sites are commonly observed at spacings around
30,000 base pairs apart. The obvious biological significance of this is to
shorten the time for full replication of the genome.
3. More protein factors are used in eukaryotic replication presumably for
correction of errors and regulation.
4. There is a step that dissociates histones from the DNA prior to replication
and a step that reassociates it after replication.
5. As to histone synthesis, old octamers seem to be conserved and entirely
new ones are synthesized and added to the replicating leading strand.
Accuracy of DNA Replication

“It has not escaped our notice that the specific base pairing we have postulated
immediately suggests a possible copying mechanism for the genetic material.”
UP Open University
Module 12 149
This statement given by Watson and Crick in 1953 when they published the
now classic paper on the structure of the DNA is said to be one of the great
understatements in scientific literature. The specificity of base pairing does not
only suggest but it is primarily responsible for the accuracy and fidelity of
DNA replication.
Aside from the specificity of base pairing, there are two other factors that ensure
the accurate transmission of trait from one cell to the other. One is the
proofreading ability of DNA polymerase; another is the presence of DNA repair
mechanisms in the cell nucleus.
DNA polymerase inserts an incorrect base for every 104 or 105 but because of
the presence of the separate 3’ to 5’ exonuclease activity of DNA polymerase
(especially DNA polymerase I), the enzyme would excise the wrong base and
replace it with the correct one. This then improves the accuracy of replication
by 100 - 1000 fold. Thus, all in all, DNA polymerase makes an error for every
106 - 108 bases added.
If there are replication errors missed by DNA polymerase, then there are DNA
repair mechanisms that would correct replication errors. One example is the
uracil-DNA glycosidase (N-Glycosidase) system. This system would recognize,
remove, and replace a uracil- bearing nucleotide in a DNA molecule.
Activity 12-1
Now that you have read the discussion on the Y-fork model of DNA
replication, you are ready to recreate the whole process on your own
by using a teaching model. You would be able to do this when you
report to your respective study centers.
The DNA replication kit contains the following:

colored cardboard chips to represent nucleotides;
zippers for fastening the cardboard chips; and
plywood chips to represent protein requirements.
These are now the steps in using the DNA replication kit:
1. Fasten the nucleotides to the zipper to form a double stranded DNA

molecule. Following the color designation we used in the activity of
the previous module, you can have any sequence or order of
arrangement of the nucleotides. But be sure that you follow the
right nucleotide pairing, i.e., A pairs with T (or blue pairs with pink)
and C with G (or red pairs with green). The right pairing is very
critical in the demonstration of the process of replication. Label the
5’ and 3’ ends.
UP Open University
2. Now you are ready to do the first step of replication. Take note that
the HUP was made with a wire hook. You can hook it with the
zipper slider and by dragging it down, you can open up the zipper.
Open the zipper up to the middle of the model only. Put the HDP
chips along the single stranded templates and the DNA gyrase at
the end of the DNA model (Refer to Figure 12-3). Can you now see
the Y configuration ?
Since your DNA model is quite short, you can continue unwinding
until the two strands are totally separated.
3. Notice that one strand starts with 3’ and ends with 5’ (leading strand)
and the other starts with 5’ and ends with 3’ (lagging strand). The
leading strand will therefore be used as a template to synthesize a
new complementary 5’ to 3’ strand. On the other hand, the lagging
strand is the template for the synthesis of a new complementary 3’
to 5’ strand. There is a difference in the priming of these two
templates.
By using RNA polymerase, form RNA primers by adding RNA

nucleotides complementary to the first few bases of the 3’ end of
the leading strand. At this point you should be able to see that there
is a 5’phosphoryl end and an exposed 3’OH at the end of the set of
primers. For the lagging strand you need to form several sets of
primers.
4. Elongate the complementary strands by adding DNA nucleotides

in a 5’ to 3’ direction starting from the 3’OH end of each primer.
Properly position the DNA polymerase III to show its function. You
will definitely observe that in the leading strand there is continuous
elongation from the 3’OH end of the single RNA primer, while, in
the lagging strand, elongation is discontinuous starting from the
exposed 3’OH of each of the several primers.
5. At this point, you will notice something irregular in your model.

That is, the presence of RNA nucleotides which served as primers.
These should be removed. Excise the primers in a 5’ to 3’
direction while filling them up with DNA nucleotides using DNA
polymerase I.
6. For the last step, seal the broken phosphodiester bonds between
nucleotides using DNA ligase.
UP Open University
If elongation takes place in a 5’ to 3’ direction beginning from the 3’OH end of

the primer, then nothing would be synthesized since there’s no nucleotide to
complement.Thus, another primer must be placed such as ..... then another .....
and so on.
RNA primer primer primer

3’ UAC 3’UAA 3’GUA
5’ ATGCAAGACCTTATTTTCGTAGCCTTGCAT ... 3’
So, the lagging strand needs several primers (You can also see this in Figure
12-2) and beginning from the 3’OH of each of the several primers, DNA
elongation will proceed in a 5’ to 3’ direction. Because of this the lagging strand
exhibits discontinuous replication.
I hope this explanation is clear enough. By the way, is your answer correct? If
it is, you’re excellent! But don’t feel so low if you didn’t get it right; maybe, you
need to bone up on following directions.
ASAQ 12-3
If the cell loses its capacity to synthesize DNA polymerase I, then the RNA
primers formed during replication will not be excised and replaced with DNA
nucleotides. What would be produced are DNA molecules with RNA
nucleotides interspersed with it. Hence, exact replicas of the daughter molecules
are not produced. Replication is no longer accurate, thereby adversely affecting
the faithful transmission of the genetic information from generation to
generation.
I do hope you agree with me. If not, try to review the function of DNA
polymerase I and think deeply about how disastrous it would be if the
proofreading ability of this enzyme were impaired or lost.
ASAQ 12-4
If you look closely at the base sequence of the two resulting daughter strands,
then you will definitely see that they are exactly identical to each other and to
the parent molecule. This ensures the accurate and faithful transmission of
genetic information from parent cell to daughter cells, or in a broader
perspective, from one generation to another. As such it assures the preservation
of the characteristics of a species.
UP Open University
Module 13
Transcription
Introduction
Objectives
W hen you buy fruits and vegetables in
the market, you know that the vendor
is not likely to be the producer, i.e., he was
not the one who planted and harvested the
goods. We can therefore say that he is the 1. Enumerate the different
middleman between the producer and the steps of transcription;
consumer. It is the same in the case of the flow 2. Describe the functions of
of biological information. Our ‘middle man’ the different protein and
is the RNA. enzyme requirements of
transcription;
DNA stores the biological information which 3. Differentiate mRNA, tRNA,
is transferred to RNA through the process of and rRNA; and
transcription. 4. Describe the features of the
genetic code chart.
Steps of Prokaryotic
Transcription
Transcription, unlike DNA replication, is not a continuous process. This means
that, not all of the whole DNA strand is transcribed at one time. Only those
nucleotide sequences coding for needed proteins or enzymes are transcribed.
Hence, there is a beginning and an end of transcribable sections.
The synthesis of RNA from a DNA template in the bacterium Escherichia coli
can be divided into three general steps.
1. Initiation of transcription
RNA transcription is controlled by RNA polymerase or RNA transcriptase.

To begin transcription, this enzyme has to bind to a specific site in the
DNA called the initiation site or the promoter. However, RNA polymerase
itself binds randomly along the DNA. RNA polymerase is usually found
associated with an auxiliary protein known as the sigma factor (s) forming
the complete enzyme or holoenzyme. It is this sigma factor that recognizes
and directs the specific binding of RNA polymerase to the promoter (Figure
13-1).
Figure 13-1. Initiation of transcription
SAQ 13-1
Assume that environmental factors cause the loss of the ability of the
cell to produce the protein, sigma factor. Predict the effect of this change
on transcription.
2. Elongation of the RNA strand
Here the RNA polymerase moves along one of the DNA strands called the
antisense or anticoding strand in 5’ to 3’ direction separating the strands as it
goes along and complementing DNA nucleotides with RNA nucleotides
(Note: it complements A with U rather than with T). As soon as a segment
is transcribed the DNA strands reanneal (or rejoin) because DNA-DNA
UP Open University
SAQ 13-2
At the end of transcription, an RNA strand complementary to the DNA
antisense strand is produced. The DNA sense strand, as its name implies,
is the strand that carries the genetic message or code. The antisense
strand is complementary to the sense strand; as such it does not carry
the message. So, try to explain why the antisense strand and not the
sense strand is being complemented during transcription.
Transcription Products and the Genetic Code

The RNA transcripts produced from transcription could give rise to three types
of RNA, namely, messenger RNA, transfer RNA, and ribosomal RNA. Let us take
a look into the structure and function of each of these types of RNA essential in
the process of translation.
1. Messenger RNA (mRNA)
The messenger RNA provides the template that gives the code for the amino
acid sequence of the proteins. Every three nucleotides of RNA codes for
one amino acid. These groups of 3 nucleotides are called codons (Figure
13-4). They code for specific amino acids. The genetic code chart specifies
these coded amino acids.
Figure 13-4. Codons in the messenger RNA
At this point, let us digress for a while and concentrate on the genetic code
just mentioned. Take a close look at the genetic code chart presented in
Figure 13-5. It shows the three bases of each codon and the amino acid that
is coded for. Let’s now try to notice some features of the genetic code.
a) The code is a three-letter code. This conclusion is firmly established.
UP Open University
Module 13 157
b) The code is universal. From viruses and prokaryotes to the most complex
eukaryotes this code is in standard use (some variations have been found
in the mitochondrial genome and in some pleuropneumonia-like
organisms).
c) There is one initiation codon (AUG) which is found at the initiation site
of translation and which codes for methionine (Note: Some bacteria use
GUG as initiation codon and interpret it as methionine but this is very
rare).
d) There are three termination codons, namely: UAA, UAG, and UGA
which do not code for any amino acid.
e) Lastly, the code is degenerate, i.e., there are 43 = 64 codes coding for
any 20 amino acids. Hence there are synonymous codons which usu-
ally differ only in the third base. It seems that the third base is either
not specifically recognized (e.g., val, ala, lys, ser, etc.) or recognized
only as a purine or pyrimidine (e.g., ser and arg, asp and glu, phe and
leu, etc.). This third base degeneracy is explained by Francis Crick in
his “wobble” hypothesis as due to a “shaky” interaction of the third
base of the codon with the third base of the anticodon of the tRNA
leading to the reduced specificity.
Figure 13-5. The genetic code chart
UP Open University
Module 13 159
Activity 13-1
Just like what you did in the last module, you will recreate the processes
of transcription on your own by using a teaching model. This can be
done in your respective study centers. In the gene action kit to be
provided by your tutor, look for the following:
1 pc zipper and button DNA model *

1 pc extra zipper with snaps as mRNA support
3 pcs small plywood chips labeled tr, σ, and ρ
36 pcs small colored buttons for RNA nucleotides *
* Color coding of nucleotides
Blue - Adenine
Pink - Thymine (T)
Green - Guanine (G)
Red - Cytosine (C)
Yellow - Uracil (U)
Here are the steps in demonstrating transcription using the gene action
kit.
1. Lay the DNA model flat on the table. Consider that this DNA is
only one of the many transcribable sections of a DNA molecule and
not the whole molecule. The antisense strand is marked. The end
that would be opened first should be marked as the 3’ end.
2. Locate the initiation point. In your DNA model, the marked 3’ end
is already the initiation point. Initiate transcription by attaching to
it the RNA polymerase with the help of the sigma factor.
3. Move the RNA polymerase along the anticoding strand and open
the zipper as you move it along. Put the extra zipper opposite the
opened part of the antisense strand and complement the DNA
nucleotides with RNA nucleotides by attaching the appropriate small
colored buttons on the snaps of the extra zipper. Remember, A pairs
with U and C with G.
As the RNA polymerase moves along the DNA you should be

getting the 5’ to 3’ elongating RNA. Reanneal the DNA after it has
been transcribed by closing it again with the second zipper runner.
4. Bind the rho factor to the RNA polymerase upon reaching the
termination point (In your DNA model, it would be the end of the
strand) and dissociate the different components. At the end of this
step, you should have a single stranded RNA which would be used
as the mRNA in demonstrating translation. Set it aside for a while.
UP Open University
Summary
Transcription is the process whereby the antisense strand of DNA is
complemented in a 5’ to 3’ direction by RNA polymerase to form different
types of RNAs— messenger, transfer, and ribosomal — which are all essential
to the process of translation.

ASAQ 13-1
If the cell loses its ability to synthesize sigma factor, the RNA polymerase won’t
be able to recognize and bind the promoter site during transcription. Without
this function, transcription of a specific gene would not take place.
Were you able to answer this question? If so, you understood the function of
the sigma factor quite well. If not, try to review its function.
ASAQ 13-2
The antisense or anticoding DNA strand is complemented during transcription

for the very simple reason that the resulting complementary RNA strand is the
same as that of the sense strand (except that Ts are replaced with Us). Therefore,
the message carried by the DNA sense strand is efficiently tranferred to the
RNA molecule. Also, with the antisense strand having the 3’ to 5’ orientation
transcription easily occurs in the 5’ to 3’ direction.
It’s very logical, isn’t it? If you got the answer right, then I guess you have a lot
of common sense. If not, maybe you were trying to think of a very technical
answer to the question.
UP Open University
Module 14
Translation
Introduction
Objectives
A t this point, I am sure you are already
fully aware of the fact that the DNA is
the so called “blueprint” of life and as such it
carries all the biological information that an
individual possesses. But try to recall also 1. Enumerate the different
what was mentioned to you before. That is, steps of translation;
the biomolecule responsible for trait 2. Describe the functions of
expression is the protein. Structural proteins the different protein and
directly affect phenotypic expression while enzyme requirements of
enzymes indirectly affect phenotypic translation; and
expression. 3. Differentiate prokaryotic
and eukaryotic transcrip-
This module deals with the details of the steps tion and translation.
that transfer the information from the RNA
to the eventual production of the polypeptide chain.
Steps of Prokaryotic Translation

Translation can be divided into six significant stages:
1. Activation of amino acids
The amino acids are attached to their respective tRNAs. This requires energy
in the form of ATP and this is mediated by aminoacyl synthetase. A different
aminoacyl synthetase acts for a different tRNA (Figure 14-1).
Figure 14-1.
Activation of
an amino acid
2. Initiation of the polypeptide chain
Here the codon AUG acts as the initiation codon. The 30S subunit, with the
help of two proteins called initiation factors 1 and 3 (IF1 and IF3), attaches
itself to the AUG codon. IF1 is believed to increase the rate of dissociation
of the 70S complexes to 50S and 30S subunits while IF3 stabilizes the 30S
subunit as it will bind to the mRNA. This is followed by the attachment of
the aa-tRNA complex with the anticodon UAC corresponding to AUG.
This complex carries with it the amino acid methionine. Being the first amino
acid in the sequence, this methionine is present as formylated methionine (f-
met). The formyl group attached to the amino end of methionine will ensure
that the elongation of the polypeptide chain will occur at the carboxylic
end of f-met. The fmet-tRNA complex is the only complex that could attach
to the P site where the AUG codon is found. The binding of this complex is
assisted by initiation factor 2 (IF2) which, in addition, brings a GTP bound
to it. After the binding, the 50S subunit of the ribosome attaches to complete
the 70S initiation complex (Figure 14-2) with consequent dephosphorylation
of GTP to GDP and inorganic phosphate. Notice here that the complete
ribosomal P site contains the initiation codon.
Figure 14-2.
Initiation of
polypeptide
chain
UP Open University
Module 14 163
3. Binding of another aa-tRNA complex
Notice the open A site after initiation of the polypeptide chain. This A site
receives a new aa-tRNA complex corresponding to the next codon. GTP is
used in this binding (Figure 14-3).
Figure 14-3. Binding of another aa-tRNA
4. Formation of the peptide bond
The enzyme tRNA deacylase first cuts the bond between the amino acid and
the tRNA in the P site and the enzyme peptidyl transferase of the 50S subunit
forms a peptide bond between the carboxylic end of the first amino acid
and the amino end of the next amino acid (Figure 14-4). GTP is again needed
for this to occur. Thus the first amino acid is detached from its tRNA and
the tRNA is released leaving the first amino acid bound to the second in
the A site. The f-met specific tRNA released could again be used to activate
an f-met amino acid in the cytosol.
Figure 14-4. Formation of a peptide bond
UP Open University
5. Elongation of the polypeptide chain
The ribosome first moves the mRNA to transfer the peptidyl-tRNA complex
from the A site to the P site. This is followed by a repetition of steps 3 and
4 resulting in the addition of one amino acid. The protein that adds new aa-
tRNA complexes to the A site is elongation factor Tu (EF-Tu) and the protein
responsible for translocating the peptidyl tRNA from the A site to the P
site is elongation factor G (EF-G). This movement of the mRNA and the
addition of amino acids corresponding to the codons that enter the A site is
repeated cyclically forming a long polypeptide chain (Figure 14-5).
Figure 14-5. Elongation of the polypeptide chain
SAQ 14-1
The peptidyl binding (P) site of the ribosome is always oriented toward
the 5’ end of the mRNA while the amino-acyl (A) site or acceptor site is
always oriented in the 3’ terminus. Why ? (Hint: Relate it to the function
of the 2 sites and the direction of transcription.)
6. Termination of the polypeptide chain
This occurs when the ribosome encounters any one of the termination
codons — UAA, UAG, or UGA. These codons once in the A site do not
code for any aa-tRNA complex but instead code for release factor 1 (RF1)
which recognizes UAA and UGA or release factor 2 (RF2) which recognizes
UAA and UGA. These release factors bind to the A site and alter the
specificity of the peptidyl transferase for it to cleave the peptidyl tRNA
bond releasing the polypeptide chain. The tRNA, ribosomes, mRNA, and
the release factors are all subsequently released (Figure 14-6). A polypeptide
chain or protein with an amino acid sequence corresponding to the mRNA
codons which in turn, corresponds to the DNA nucleotide sequence, is
thus formed.
UP Open University
1. The basic steps and processes involved in transcription and translation of

both prokaryotes and eukaryotes are the same. There are always initiation,
elongation, and termination.
2. There are differences in the protein factors used in eukaryotic gene

expression.
3. EukaryoticDNA have intervening sequences, popularly known as introns.

These are regions that interrupt the transcribed part of a gene. Introns are
transcribed but removed by splicing during the maturation of the transcript.
Later, we will discuss this in greater detail. Prokaryotic DNA is intronless.
4. Prokaryotic messenger RNA is polycistonic, meaning a single mRNA bears

information for more than one gene. Eukaryotic mRNA is monocistronic - -
an mRNA bearing information for one gene only.
5. In eukaryotes, replication and transcription occur in the nucleus while

translation occurs in the cytoplasm. Prokaryotes, on the other hand, do not
have membrane-bound nuclei, so all these processes occur in the cytoplasm.
Morover, in prokaryotes, translation of a polypeptide chain will begin even
if the rest of the transcript is still being transcibed.
RNA processing
In eukaryotes, the heterogeneous or primary RNA transcript (precursor of the
mRNA) would undergo processing before it is translated. There would be
capping, tailing, and splicing, all of these occurring in the nucleus. After which,
the mature transcript would be transported to the cytosplasm for translation.
Capping
Capping refers to the addition of a methylated guanine nucleotide to the 5’
end of the RNA molecule. Recall that it is this 5’end that is being synthesized
first during transcription. After about 30 RNA nucleotides have been
synthesized, a methyl transferase enzyme adds a 7 methyl-guanosine tri-P to the
5’ end.
What is capping for ? Capping of the RNA transcript is mainly for protection
of the growing RNA transcript from degradation, as well as ribosome
recognition during translation. Don’t we wear caps, too, for protection from
the heat of the sun?
UP Open University
Module 14 167
Poly A tailing
During this step, the enzyme poly A polymerase adds 100-200 residues of adenylic
acid (as poly A) to the 3’ end of the RNA transcript. Tailing is believed to: 1) aid
in the export of mature mRNA from the nucleus; 2) render stability to some
mRNA in the cytoplasm; and 3) serve as a recognition signal for the ribosome.
Splicing
Early studies on mammalian viral DNA transcript showed a lack of
correspondence between the genetic map and the specific mRNA molecule.
Further studies showed that the primary transcript⎯ the faithful copy of the
gene⎯ was shortened by the elimination of internal segments before transport
into the cytoplasm. RNA transcripts that have undergone the “shortening”
process are referred to as the mature RNA, this one directly coding for a
polypeptide chain.
Those internal segments removed from the RNA transcript are called introns
and those segments which remained and hence coded for the different amino
acids in the protein are called exons. The process of cutting introns out of the
immature RNAs and stitching together the exons to form the mature RNA is
known as splicing. The splicing machinery is called the spliceosome. It includes
the mRNA precursor, a set of snRNPs (small nuclear ribonucleoproteins), and
snRNAs (small nuclear RNAs).
Activity 14-1
Again, for the demonstration of the process of translation, you will be
using the gene action kit. This can be done in your respective study
centers. The result of the activity will also be presented as discussion
during your study session. From the gene action kit, get the following:
10 pcs garter with snaps for peptide bonds

8 pcs assorted plywood chips for ribosome and protein equirements
11 pcs big colored buttons for amino acids (with specific designations)
11 pcs tRNA models made of copperwire with buttons
1 pc mRNA model (transcription product)
* Color coding of nucleotides
Blue - Adenine (A)
Pink - Thymine (T)
Green - Guanine (G)
Red - Cytosine (C)
Yellow - Uracil (U)
UP Open University
Here are the steps in demonstrating translation using the gene action
kit.
1. Remember when you demostrated the process of tanscription? At

the end, you have a single stranded RNA which you will use as the
mRNA in demonstrating translation. Set it aside for a while.
5. Get the tRNA wire models. The free end of each tRNA connected
with a snap is the 3’ amino-acyl arm. Activate the amino acids by
fastening them to the tRNA snaps, positioning the aminoacyl
synthetase to show its function. Use the genetic code chart to
determine what amino acid is carried by each tRNA.
Let me give you an example. One of the tRNA models has 1 red and 2
yellow buttons in its anticodon arm. If you hold it and identify the
bases by reading from left to right, the sequence is red - yellow - yellow
which corresponds to cytosine - uracil - uracil. Right?
Always remember that this is the anticodon, and from it you can know
the corresponding codon. In this case, it is guanine - adenine - adenine.
You can then use the genetic code chart which indicates that the codon
GAA is for glutamic acid (Glu). Look for the large colored button with
Glu as label and snap it on the 3’ amino-acyl arm of the tRNA. Did you
follow?
You have to activate the remaining 10 tRNAs by following the example

I have given you.
6. You are now ready to form the initiation complex. With the aid of
IF1 and IF3, attach the 30S subunit at the 5’ end of the mRNA. Then
attach the fmet-tRNA with the help of IF2 followed by the 50S
subunit all at the AUG codon at the 5’ end of the mRNA. Make sure
the AUG codon is at the P site of the ribosome and the A site is
open. You may refer to Figure 14 as your guide.
7. Place the proper aa-tRNA at the A site. This amino acid should
complement the codon in that site.
8. Connect the two amino acids by a peptide bond represented by a

garter with snaps. By the end of this step the first amino acid has
been disconnected from its tRNA and the snap for that bond used
is peptide bonding.
UP Open University
Module 14 169
9. Move the ribosome such that the codon and tRNA complexed with
amino acids in the A site are transferred to the P site. Repeat steps 7
and 8 to add another amino acid. Be sure that the correct aa-tRNA
enters the A site.
Continue elongating your polypeptide chain by repeating the movement

of the ribosome, addition of amino acid in the A site, and peptide
bonding. Record the sequence of codons and amino acid coded for.
10. When the termination codon is in the A site, terminate the process
by binding RF1 to the A site and dissociating the polypeptide chain
from the last tRNA. Then dissociate the whole assembly.
SAQ 14-3
Write the nucleotide sequence of the transcription product. Indicate
also the 5’ and 3’ ends. What is the amino acid sequence coded for by
the mRNA transcript?
Summary
The DNA carries the information necessary for the synthesis of proteins which
could express traits either directly as structural proteins or indirectly as enzymes.
In translation, the code stored in the mRNA is interpreted according to the

universal and degenerate genetic code by the ribosome which, with the help of
many other proteins, sequentially connects amino acids brought in by the tRNA
and corresponding to the mRNA codon sequence.
UP Open University
References
Ayala, F.J. and John A. Keiger Jr. (1980). Modern genetics. California: The
Benjamin/Cummings Pub. Co., Inc. pp. 243-248.
Avers, Charlotte J. (1980). Genetics. New York: D. Van Nostrand and Co.
pp. 209-214.
Burns, George W. (1983). The science of genetics: An introduction to heredity. 5th
ed. New York: MacMillan Pub. Co., Inc. pp. 312-325.
Gardner, E.J. 1993. Principles of genetics. 6th ed. New York: John Wiley and Sons.
Laude, Rita P., A.A. Barrion, G.P. Balaccua, M.S. Mendioro, and D.A. Ramirez.
(1991). Laboratory guide in genetics. 7th ed. U.P. Los Baños: TLRC. pp. 51-74.
Lehninger, A.L. (1982). Principles of biochemistry. New York. Worth Pub., Inc.
pp. 837-900.
Ramirez, D.A. (1990). Genetics. 7th ed. U.P Los Baños: SEAMEO-SEARCA.
pp. 59-98.
Suzuki, D.T., A.J.F. Griffiths, J.H. Miller, R.C. Lewontin. (1986). An introduction
to genetic analysis. 3rd ed. New York: W.H. Freeman and Co. pp. 236-263.
Tamarin, R.H. (1993). Principles of genetics. Iowa: Wm. C. Brown
Communications, Inc. pp. 195-300.
Weaver, R.F. and P.W. Hedrick. (1992). Genetics. 2nd ed. Iowa: Wm. C. Brown
Pub. pp. 215-317.
UP Open University
Module 14 171
ASAQ 14-1
The direction of translation is 5’ to 3’ with respect to the mRNA strand. As

such, AUG, the initiation codon, is at the 5’ terminus and the corresponding f-
met tRNA complex carrying f-met is the only complex that could attach to the
P site which is oriented also at the 5’ end. The result is therefore an open A site
oriented at the 3’ end. Being the acceptor site, it could easily receive incoming
aa-tRNA complex corresponding to the next codon. After peptide bonding,
the aa-tRNA in the A site is translocated at the P site, opening the A site again.
Translation then effectively proceeds in the 5’ to 3’ direction.
Is it clear? I hope your answer is right. If it is, very good! However, if you
answered differently, I guess you got confused with the functions of the P and
A sites and maybe you forgot the direction of translation.
ASAQ 14-2
Here is the corrected diagram:
direction of synthesis →
Corrections:
1. The 5’ and 3’ labels of the mRNA should be interchanged.
2. 40S subunit should be changed to 30S subunit.
3. The second codon CAU codes for histidine (his) not valine (val).
4. P and A sites should be interchanged.
5. Replace the 2 Ts in the mRNA sequence with Us. RNA molecules have no
Ts.
Easy, isn’t it? It’s just like the “find the errors” game in some newspapers and
magazines. I hope you enjoyed answering it.
UP Open University
ASAQ 14-3
The following is the mRNA sequence and the corresponding amino acid
sequence:
mRNA5’AUG,CUU,UAU,UGU,CAU,GAA,GCU,UUU,UGG,AUG,AAU,UAA3’
aa seq. f-met- leu- tyr- cys- his - glu - ala - phe - trp - met - asn
If you have the correct sequence, then that means you have already mastered
the characteristics of DNA and RNA and also how to use the genetic code
chart.
UP Open University
Module 15
Gene Regulation and Genetic
Control of Development
Introduction
Objectives
H ave you seen a sewing thimble? Can you
imagine its size? Would you believe
around two million of us could fit into a
sewing thimble at the same time? Each of us
when we started from a fertilized egg had a 1. Define differential gene
diameter of around 1/200 of an inch. The action;
billions of cells in our body which vary so 2. Identify the mechanisms of
much in appearance, all those cells that make gene regulation in
up the tens of kilograms of mass that you see prokaryotes and
(and admire) in the mirror every morning, eukaryotes; and
came from that single 1/200 of an inch of 3. Explain how genes are
fertilized egg! controlled during
development.
Just how did that happen? Honestly, much
of these secrets of human development
remain secrets. This is also true for plants and other animals. What is sure is
that the genes are responsible for this. Development is the product of gene
expression. But how does gene expression get regulated? This is the question
we would like to answer in this chapter.
Please go over the following definitions before reading this module.

Definition of Terms
Cell determination - a cell becomes committed to a specialized function
Cell differentiation - cell’s expression of predetermined specialized role
Co-repressor - is a small molecule that triggers repression of transcription by

binding to a regulator protein
Development - orderly sequence of change that leads to increase in complexity

during the growth of an organism
Differential gene action - switching on and off of genes at different times
Exon - any segment of an interrupted gene that is represented in the mature

RNA product
Gene amplification - continuous replication of a particular gene
Heterogenous nuclear RNA - transcripts of nuclear genes made by RNA

polymerase
Intron - segment of DNA that is transcribed but removed from within the
transcript by splicing together the exons on either side of it.
Operon - a group of functionally related to structural genes mapping close to

one another in the chromosome which is transcribed into a single mRNA
UP Open University
Module 15 175
Concept Map
GENES
Molecular Cellular
level level
Gene Regulation
prokaryotic eukaryotic
(nucleus)
nucleo cytoplasmic Differential

interaction Gene Action
cytoplasm
cellular differentiation
DEVELOPMENTAL
SYSTEM
unicellular
organisms
in multicellular
organisms
single differentiated cell
Cells of Different Phenotypes
Multicellular organism
UP Open University
Differential Gene Action

How can a single-celled zygote with only one genotype give rise to many cells
with different phenotypes? Can you offer an explanation?
A single cell with one genotype can give rise to cells with different phenotypes
through differential gene action; that is, different genes are turned on and off
at different times. There is different activation of various genes at different
stages of development. What are the evidences to support differential gene
action?
1. Puff formation and regression in polytene chromosomes
Polytene chromosomes are giant chromosomes of the salivary glands of

Drosophila melanogaster and other homopteran species. They are
characterized by the presence of bands and interbands (Figure 15-1).
Band
Puff
Puff
Interband
Figure 15-1. Polytene chromosomes of Drosophila
If the gene is active or on, puffs are formed on the chromosomes. These
puffs are associated with the presence of newly synthesized RNA. At some
point, puffs would regress indicating that the genes are off or inactive.
2. DNA-RNA hybridization reveals that specialized cells (reticulocytes for

hemoglobin, vertebrate oviduct for albumin) producing certain proteins
are accompanied by an increase in the number of mRNA coding for the
said protein. This increase in mRNA is not found in other cells not involved
in the production of said protein.
UP Open University
Module 15 177
3. An increase in the number of RNA Polymerase associated with the gene in

the cell responsible for producing a certain protein indicates active
transcription.
Gene Regulation
How is a gene turned on or off? Studies reveal that there are at least five possible
points of control.
1. Replication
Gall (1968) observed the proliferation of hundreds of copies of DNA

sequences for nucleolus organizer region (NOR) in amphibian oocytes
permitting them to synthesize vast numbers of rRNA in a shorter period of
time. This phenomenon is called gene amplification. A gene is replicated
several times indicating that one gene is more active than the other.
2. Transcription
In clawed foot, Xenopus laevis, alteration on the rate of RNA synthesis was
noted. An increase was noted in immature oocytes which diminished
strikingly when they matured to eggs only to increase again at gastrulation
of the developing embryos. This simply indicates selective transcription of
genes at specific stages of development.
How the primary transcript is spliced and processed is another point of

control during transcription. The transcript in the nucleus is called
heterogeneous nuclear RNA (hnRNA). It leaves the nucleus as mRNA. This
is because hnRNA undergoes modifications:
a. 5’ capping
This involves addition of methylated G almost immediately after about

30 nucleotides of RNA are synthesized. Capping protects the RNA
transcript from degradation. It is also important in the initiation of
transcription.
b. poly A tailing
This involves addition of 100 to 200 residues of adenylic acid or poly A

at the 3’ end by poly A enzyme. This is required in the export of mature
mRNA from the nucleus to the cytoplasm. It also stabilizes the mRNA
by retarding their degradation in the cytoplasm.
UP Open University
c. differential splicing
The primary transcript is the faithful copy of the gene (DNA-RNA). It

contains introns and exons. Introns are intervening sequences about 80
to 10,000 nucleotides while exons are coding sequences. Splicing or
removal of introns and ligation of exons are processing events critical
in the production of mature mRNA. If a given primary transcript
contains several splice sites (Figure 15-2) scattered in both introns and
exons, then differential splicing may yield several mRNA coding for
different proteins.
differential splicing
Figure 15-2. Diagrammatical representation of alternative splicing

of initial RNA transcript (I represents introns; numbers represent exons)
3. Post Transcription
a. Selective hnRNA degradation
This could bring about differences in gene products in various cell issues.
b. Passage of mRNA from the nucleus to the cytoplasm
Ultrastructural studies show that the nuclear pore linking the

nucleoplasm with the cytoplasm is not always open. It is plugged by
proteins most of the time. This indicates that passage of mRNA is
regulated. Only those needed for immediate translation may be released.
4. Translation
Not all mRNA from the nucleus to the cytoplasm are translated at the same
time. In sea urchins, protein synthesis fluctuates during development, close
to zero at (and before) fertilization; it increases several hundredfold three
to four hours after fertilization, declines, and increases again during
gastrulation.
UP Open University
Module 15 179
a. Stability of mRNA
Many mRNAs have short half life but others survive for a long period
of time. The silk fibroin mRNA of Bombyx mori can be used continuoulsy
for several days yielding 105 fibroin molecule.
5. Post Translation
Majority of proteins need to undergo post translational modification in order

to attain their final form and perform their physiologic function. This may
include: a) deletion of a part of a polypeptide chain; b) change in the state
of oxidation or reduction affecting the structure of the enzymes; and c)
attachment of a small molecular moiety to the enzyme.
Do you find this exciting? The cell with its DNA can regulate its expression
so that proper gene product is produced at the proper time and proper cell.
Operons in Prokaryote
In prokaryotes the primary point of regulation happens at the transcription
level. Related genes in prokaryotes are generally in cluster. The gene products
of this cluster belong to the same metabolic pathway. This cluster of functionally
related genes is called an operon.
Transcriptional regulation in prokaryotes is the most studied at the molecular

level. Some enzymes are synthesized constitutively or continuously, indicating
that transcription of mRNA is constantly occurring. Other enzymes are
inducible; the enzyme is normally present in small amount but increases
tremendously in the presence of a substance.
An example of an operon in Eschiricia coli is the lactose operon. There is a

group of genes responsible for the metabolism of lactose from the external
environment of the cells into energy. It consists of the following parts:
1. Promoter gene (p) - the site in the DNA where RNA polymerase binds
together with cyclic adenine monophosphate-receptor protein complex
(cAMP-CRP complex), to start transcription.
2. Operator gene (o) - site in the DNA to which the repressor molecule binds;
When the repressor is bound to the operator, transcription of structural
gene is prevented.
3. Regulatory gene (i) - codes for a protein called repressor; Binding of repressor
to the operator gene stops transcription.
UP Open University
4. Structural gene - carries the message for the amino acid sequence of a specific
protein
a. z - codes for ß-galactosidase which breaks down lactose into glucose

and galactose; It also catalyzes conversion of lactose to allolactose
which acts as an inducer.
b. y - codes for permease which facilitates the entry of lactose into the cell
c. a - codes for acetylase which catalyzes the transfer of acetyl group to -

galactosidase
How is the Operon Controlled?

Let us consider how the system works.
Initially, there is a minimal amount of ß-galactosidase, permease, and acetylase

that is present in the cell. The system is normally off (Figure 15-3). This is when
the repressor protein is bound to the operator. RNA polymerase cannot
transcribe the sructural genes. The system is turned on when lactose is provided
to the E. coli. With the presence of minimal amount of permease, lactose can
enter into the cell. Lactose is converted into an allolactose by ß-galactosidase.
The allolactose which acts as an inducer will bind to the repressor, distorting
the repressor resulting in the release of the repressor from the operon (Figure
15-4). This gives RNA polymerase access to the promoter thereby transcribing
the structural genes. Lactose operon is an inducible system. When lactose is
consumed, the repressor will bind again to the operator and the operon is off.
The system is indeed very efficient! The bacterial cell is so minute, yet it knows
how to conserve its energy. It is only when the product of the gene is needed
that it is transcribed and translated.
UP Open University
Module 15 181
regulator
i p o z y a terminator
CRP protein RNA
polymerase
repressor
repressor
RNA
polymerase
Figure 15-3. Lactose operon is off when repressor is bound to the operator.
UP Open University
repressor
inducer
CRP protein RNA transcription

polymerase
repressor
inducer
CRP protein RNA

transcription
polymerase
by RNA polymerase
mRNA
RNA
translation polymerase
galactosidase permease acetylase
Figure 15-4. Lactose operon is on when repressor dissociates from the operator.
Binding of inducer to the operator releases the repressor
UP Open University
Module 15 183
Another example of operon in E. coli is the tryptophan operon. Unlike lactose

operon which is inducible, trp operon is repressible. This operon codes for
catalysts for the biosynthesis of the amino acid tryptophan. The synthesis of
tryptophan is normally continuous and it stops only when there is over
production.
The following are the parts of the trp operon:
1. promoter gene (p) - the site in the DNA where RNA polymerase binds to
start transcription;
2. regulator gene (r ) - the gene that codes for an incomplete repressor protein
that will not bind to the operator (o) unless the end product tryptophan
binds to it as a co-repressor;
3. operator gene (o) - the site where the activator repressor binds to stop
transcription; and
4. structural gene - codes for the different enzymes involved in the synthesis
of trp (Figure 15-5)
attenuator
trp P structural genes of trp operon
trp
trp R o trp E trp D trp C trp B trp A
Genes
mRNAs
long distance anthranilate P-ribosyl tryptophan tryptophan

in genome synthase transferase synthetase synthetase
B protein A protein
Protein (trp repressor-inactive
without signal molecule) AS-PRT
enzyme complex tryptophan synthetase
leader of
mRNA indole glycerol
phosphate complex
Metabolic reactions
catalyzed by enzymes chrosimate anthranilate phosphoribosyl CDRP indole tryptophan
encoded by trp operon glycerol
phosphase
Figure 15-5. Diagrammatic representation of the trp operon when turned on
UP Open University
Let us consider how the system works.
The binding of RNA polymerase to the operator results in transcription of

structural genes. The mRNA is translated, all enzymes are present, and the
amino acid is continuously formed. When there is over production of
tryptophan, the excess tryptophan binds to the incomplete repressor coded by
the regulator gene. An active or complete repressor is formed it binds to the
operator to stop transcription. The system is very simple, isn’t it? If tryptophan
is needed, then it is synthesized; if not, synthesis stops.
Nucleocytoplasmic Interactions
What triggers the gene to be selectively on or off? The slight differences in the
chemical environment of the different regions of the cytoplasm initially trigger
differential gene action or selective gene expression. Nucleocytoplasmic
interaction is responsible in making the nucleus respond properly to the
cytoplasmic environment. The nuclear response, in turn, alters the cytoplasm.
This leads to a series of reciprocal nucleocytoplasmic interactions that set the
development of the cell to a predetermined direction.
Nuclear transplantation experiments in Amoeba proteus show that

nucleocytoplasmic interactions exist. Radioactively labeled nuclei, when
transplanted to non-labeled Amoeba, showed that radioactively labeled proteins
could move out of the nucleus and back or out of the nucleus and into other
nonradioactive nucleus. These proteins are responsible for conveying
information from the cytoplasm to the nucleus.
The above experiment shows that substance can shuttle between the nucleus
and the cytoplasm. But do cytoplasmic particles affect nuclear function? It is
clear that this is so. Adult brain cells do not undergo DNA replication and cell
division. However, when adult frog brain cell nuclei were transplanted into
oocytes at the time germinal vesicles in the cytoplasm were bursting, DNA
replication was induced. The germinal vesicles release a substance in the
cytoplasm which induces replication. It may be DNA polymerase. Further,
there is also an observed swelling of the nuclei upon transplantation into the
oocytes as a result of nucleocytoplasmic interactions. Lastly, in a different
experiment, it also became clear that RNA synthesis was influenced by the
cytoplasm. When nuclei of cells actively synthesizing RNA were transplanted
to enucleated eggs (non rRNA synthesizing), they stopped rRNA synthesis
according to signals from the egg cytoplasm. rRNA synthesis is resumed when
the “embryo” reaches gastrulation.
UP Open University
Module 15 185
Genetic Control of Development

Development is the orderly sequence of change that leads to increase in
complexity during the growth of an organism. It involves coordinated regulation
of sequential gene expression. It is genetically preprogrammed so that the
appropriate genes are expressed in the appropriate time.
Figure 15-6. Four

winged Drosophila
Look at Figure 15-6. Is there something wrong with the picture? Yes, there is!
The fly has four wings. This happens when the halteres required to maintain
balance are changed into wings.
Have you seen a fly with legs on the position of antennae? You might think
I’m kidding, but this is true! This may happen if the pre-programmed pattern
of gene expression is not strictly followed. Something happens along the way
that a different structure emerges in the wrong position.
A favorite specimen to understand the genetic control of development is

Drosophila melanogaster. So much information is available on Drosophila and it is
a specimen that is easy to manipulate.
The stages in the development of Drosophila are shown in Figure15-7. Embryonic

development of the fertilized egg occurs very rapidly. Within one day after
fertilization, the first larval stage hatches and about five days post fertilization,
pupation occurs. Metamorphosis happens at about nine days after fertilization.
UP Open University
Fertilized egg
Embryo develops
Hatching
Larva
3 larva stages
with intervening molts)
Pupation
Pupa
Metamorphosis
Adult fly
Figure 15-7. Stages of development in Drosophila
UP Open University
Module 15 187
Very early in the development of Drosophila, each embryonic cell achieves a

unique identity that determines its subsequent developmental fate. During
embryogenesis, cells become committed to perform a specialized function. This
is called cell determination. As early as blastoderm stage, a major segmentation
pattern happens (Figure 15-8). Each of the segments corresponds to the body
segments of the larvae. During larval stage, cells set aside at an early stage
grow into a lump of tissues called imaginal discs. These imaginal discs are
committed to give rise to a specific adult structure, an eye disc for an eye, wing
disc for wings, genital disc for genitals, etc. (Figure 15-9). The expression of its
predetermined specialized role is called cell differentiation. It is only when
mutation happens that the state of determination in a specific imaginal disc is
altered, allowing for the transformation of an antenna disc into a leg disc. Legs
replace the antennae on the head (Figure 15-10).
(a) Blastoderm
(b) Larva
Figure 15-8. Segmentation pattern in Drosophila
UP Open University
Eye/Antenna
Leg
Wing
Figure 15-9.
Imaginal discs
of Drosophila Haltere
larva
and the adult Genital
structures that
are derived
from them
Leglike appendage
Eye
Antenna
Mouth
(a) Wild type (b) Antennapedia
Figure 15-10. Diagram illustrating the effects of mutation

antennapedia on the phenotype of Drosophila
a. wild type showing antennae on the head
b. antennapedia mutant; leg structures replace portion of the antennae
UP Open University
Module 15 189
Summary
Although cells contain the complete set of genes to produce various gene
products, not all gene products are present at any given time. Gene expression
is highly regulated. Gene regulation can occur during replication, transcription
and transport of mRNA from the nucleus to the cytoplasm, translation, and
during post translation modification of proteins. In prokaryotic cell, the primary
point of control is transcription. Lactose operon is an example of regulation in
E. coli. Enzymes for lactose utilization are only synthesized if lactose is provided
as a source of energy for the organisms.
Development is the orderly sequence of change that leads to increase in

complexity during the growth of an organism. Gene expression is highly
coordinated and regulated so that the proper adult structure is formed in its
proper position.
References
Darnell, J., H. Lodish and D. Baltimore. (1990). Molecular cell biology. Scientific
American Books. N.Y. : W.H. Freeman Co. pp. 391-448.
Gardner, E.J., M.S. Simmons, and D.P. Snustad. (1991). Principles of genetics. 8th
ed. N.Y. : John Wiley and Sons Inc. pp. 410-447.
Laude, R.P., A.A. Barrion, G.P. Balaccua, M.S. Mendioro and D.A. Ramirez.
(1992). Laboratory guide in genetics. UPLB-TLRC. 8th ed. pp. 81-90.
Ramirez, D. A. (1991). Genetics. 7th ed. U.P. Los Baños, Laguna: SEAMEO-
SEARCA-UPLB. pp. 99-116.
Suzuki, D. T., A. J. F. Griffiths, J.H. Miller, and R. C. Lewontin. (1986). An
introduction to genetic analysis. 3rd ed. N.Y. :W.H. Freeman. pp. 456-503.
UP Open University
Module 16
Mutations
Introduction
Objectives
What is mutation?
Mutation is the change in the genetic material
of an organism that is heritable and essentially
1. Define mutation;
permanent. Mutations may change either the
2. Enumerate and describe the
number or structure of the chromosomes or
different kinds of mutation;
the chemical structure of the DNA
3. Cite specific example for each
(deoxyribonucleic acid) of the genes in the
type of mutation; and
chromosomes. An individual that has
4. Explain the significance of
inherited a genetic change and shows some
mutations.
abnormality as a result, is called a mutant.
In order to cope with the subject matter, you should have some prerequisite
knowledge. Please answer the following review questions:
1. What is a chromosome?
2. What is a gene?
If your knowledge on these concepts is inadequate, be sure to go back to earlier

modules.
Concept Map
192
Mutation
UP Open University
Chromosomal Gene
Structural Changes Numerical Changes Base Pair Substitution Frameshift Mutation

Biology D: Principles of Genetics
Euploidy Aneuploidy
Deletion Duplication Inversion Translocation
Addition of Loss of Chromosome

Chromosome
Trisomic Tetrasomic Monosomic Nullisomic
Monoploid Alloploid Autoploid

Module 16 193
Definition of Terms
Aneuploidy - one or more chromosomes lacking or present in excess
Autosomal mutation - gene mutation in one of the autosomes
Conditional mutation - effects manifested only in some environments but not

in others
Deficiency (deletion) - loss of chromosomal segment
Dominant mutation - single normal copy of the gene not enough for normal
function; abnormality apparent
Duplication (repeat) - portion of chromosome in excess of the normal amount
Euploidy - changes involving the whole genome
Forward mutation - change of the normal form of a gene to a mutant form
Germinal mutation - one that occurs in a germ cell (egg or sperm)
Induced mutation - caused by deliberate application of chemicals or physical

agents
Inversion - reinsertion of a chromosome segment in a different order
Invisible or silent mutation - mutation occurring without noticeable effect
Lethal mutation - mutation resulting in death of the individual
Mutation - change in the genetic material of an organism that is heritable and

essentially permanent
Polyploid - a cell, tissue, or organism having three or more genomes
Recessive mutation - the presence of the mutant gene is undetected because

the single copy of the normal gene is enough for normal function
Reverse or back mutation - second event which restores the original form of
the gene
Sex-linked mutation - gene mutation in one of the sex chromosomes (usually

the x chromosome)
UP Open University
Somatic mutation - mutation which occurs in a body cell
Spontaneous mutation - mutation which arises naturally
Suppressor mutation - second mutation in another gene causing suppression

of the first mutation
Translocation - exchange of chromosome sections after breaks
Transposon - a transposable gene or DNA sequence (carrying one to many

genes) bound at each end with identical insertion sequences; it can move
from one location to another within the genome; also called jumping
gene
Transversion - a base pair substitution mutation resulting in the replacement

of a purine by a pyrimidine and vice versa
Kinds of Mutation
There are several ways by which mutations are described and categorized.
Mutations may be induced by the deliberate application of chemicals or physical

agents or may be spontaneous, arising naturally.
A somatic mutation is one that occurs in a body cell. If the cell continues to
divide and transmits the mutant gene to daughter cells, it may give rise to a
small patch of mutant tissue, whether or not the mutation is passed on to the
offspring. A germinal mutation is one that occurs in a germ cell (egg or sperm).
It does not generally affect the somatic tissues of the individual in which it
occurs, but it may be transmitted to offspring.
Gene mutations that occur in one of the sex chromosomes (usually the X
chromosome) are called sex-linked mutations, and those that occur on one of the
other chromosomes are called autosomal mutations.
UP Open University
Module 16 195
SAQ 16-1
How will you explain the following concepts to your students and
colleagues?
1. induced mutation
2. somatic mutation
3. sex-linked mutation
The change of the normal form of a gene to a mutant form is called a forward
mutation. The original form of the gene may be restored by a second event,
which is called a reverse mutation or back mutation. Sometimes the loss or change
of function that accompanies a forward mutation in one gene can be
compensated for by a second mutation that occurs in another gene. The change
in the second gene is known as a suppressor mutation because it suppresses the
effects of the first mutation.
A mutation is called lethal if it results in the death of the individual; visible if the
individual survives but has some physical, chemical, or behavioral abnormality
that is easily observed; conditional if its effects are manifested in some
environments but not in others; and invisible or silent if it produces no noticeable
effect. Silent mutations are detectable only by indirect genetic methods or by
direct analysis of the gene itself.
Each cell of every individual organism contains two copies of each gene-one
inherited from the mother and the other is mutant. The presence of the mutant
gene may go undetected because the single copy of the normal gene is enough
for normal function. In such cases the mutant gene is considered recessive. On
the other hand, if a single normal copy of a gene is not enough for normal
function, some abnormality will be apparent and the mutant gene is said to be
dominant. Sickle cell anemia, Tay-Sachs disease and phenlyketonuria (PKU)
are caused by recessive genes ⎯ thus only those individuals in which both
copies of the gene are mutant show over symptoms of the disease. The gene
for color blindness, hemophilia, duchenne muscular dystrophy, and retinitis
pigmentosa are on the X-chromosomes, which may carry the mutant gene on
one of the chromosomes and still be normal. A man, having only one X-
chromosome, will necessarily manifest the mutant condition if he carries the
mutant gene.
UP Open University
SAQ 16-2
The normal form of a gene is changed into mutant form through
_______________mutation and restored into its original form through
_______________mutation.
A mutation is ____________ if it results in the death of the individual. It

is _____________ if individual survives but has abnormalities. Mutant
gene is _____________ when single copy of the normal gene is enough
for normal function. It is __________ when normal single copy of a gene
is not enough for normal function.
Mutations occur as chromosomal aberrations such as numerical changes

and structural changes. These may result in alteration in the amount or
positions of genetic material.
Variations in Genome Structure

A. Euploidy refers to the changes involving the whole genome or the entire set
of chromosomes. For instance, in cells with basic chromosome number = 4,
the varying chromosome numbers are:
Type Formula Chromosome Complement

Monoploid n (ABCD)
Diploid 2n (ABCD)(ABCD)
Autotriploid 3n (ABCD)(ABCD)(ABCD)
Autotetraploid 4n (ABCD)ABCD)(ABCD)(ABCD)
Allotetraploid 4n (ABCD)(ABCD)(MNOP)(MNOP)
Monoploids carry one genome (n) as in male honeybee, algae, fungi, and in all
bryophytes (liverworts and mosses). Adult monoploid and vascular plants are
weak, small, and highly sterile. The first case on monoploidy was reported by
Blakeslee and Belling in 1924 to occur in the Jimson weed. They developed
from unfertilized eggs.
UP Open University
Module 16 197
Why are monoploids sterile?

Sterility in monoploids is due to extreme irregularity of meiosis because of
impossibility of chromosome pairing and low probability of their distribution
in complete sets to daughter nuclei.
Polyploids are euploids with the cells containing three or more sets of
chromosomes or genomes. It is rather common in the plant kingdom but rare
among animals. For instance, the rose genus Rosa includes species with somatic
numbers 14, 21 28, 35, 42, and 56. The basic number is 7. It is estimated that at
least two- thirds of all grass species are polyploids.
How do polyploids arise?

Polyploids may be either naturally or artificially induced. In natural population,
this may arise as the result of interference with cytokinesis once chromosome
replication has occurred, and may occur either: (1) in somatic tissue giving
tetraploid branches; or (2) during meiosis, producing unreduced gametes.
Application of alkaloid colchicine induces polyploidy by interfering with normal

spindle formation. Other chemicals, like acenapthene and venatrine, can induce
polyploidy. The exposure to heat and cold can also induce polyploidy. When
polyploidy is due to the multiplication of one basic genome from the same
species, it is called autopolyploidy. Allopolyploids, on the other hand, are those in
which the genomes making up the multiple sets are from hybrids between
different species. Following are examples of basic types of euploids.
1. Autopolyploidy
a. Triploids (3x) - bananas, hyacinths, watermelons, winesap, apples,

European pears
Polyploids with odd numbers of genomes, like triploids, are highly

sterile. Triploid watermelons, for example, are nearly seedless. They
are created by crossing the normal diploid, whose gametes are n, with
a tetraploid gametes of which are 2n.
b. Tetraploids (4x) - alfalfa, coffee, peanut, potato
In general, tetraploids are often harder and more vigorous in growth;

they are able to occupy less favorable habitats; and/or they have larger
flowers and fruits.
UP Open University
2. Allopolyploidy
Example 1: Allotetraploidy in Raphanobrassica produced by Russian

cytologist G.D. Karpechenco in 1928 by hybridizing radish (Raphanus sativus
L.) with cabbage (Brassica oleraceae)
P1 and P2 : Raphanus sativus and Brassica oleraceae

(RR; 2n =18) (BB; 2n = 18)
F1 : 18 I (9 IR + 9 IB ) = Sterile
Chromosome
Doubling of F1 : 18 II (9 IIR + 9 II B) = Fertile
Phenotype: Head of radish and root of cabbage
Example 2: Allotetraploidy in Tobacco, Nicotiana tabacum L. (2n = 48)
P1 and P2 : Nicotiana sylvestris x N. tomentosiformis

(ss; 2n = 24) (tt; 2n = 24)
F1 : 24 I (12 Is + 12 I t) = Sterile
Chromosome
Doubling of F1 : 24 II ( 12 IIs + 12 IIt) = Fertile
= Nicotiana tabacum L. (2n = 48)
Example 3: Allohexaploidy in bread wheat, Triticum aestivum (2n = 42)
P1 and P2 : Triticum monococcum x Aegilops speltoides

(AA; 2n = 14) ( BB; 2n = 14)
F1 : 14 I (7 IA + 7 IB) = Sterile
Chromosome
Doubling of F1 : 14II (7 IIA + 7 IIB) + Fertile
= Triticum dicoccum (2n=28)
T. dicoccum x Aegilops squarrosa

(AABB; 2n = 28) (DD; 2n = 14)
F1 : 21 I (7 IA + 7 IB + 7 ID) = Sterile
Chromosome
Doubling of F1 : 21 II ( 7 IIA + 7 IIB + 7 IID) = Fertile
= Triticum aestivum (2n = 42)
UP Open University
Module 16 199
SAQ 16-3
Differentiate autotetraploid from allotetraploid.
The origins and relationships of the different polyploids are as follows:
Species A Species B Species C

2n = AA 2n = BB 2n = CC
F1
2n = AB
Autotriploid Autotetraploid Triploid
3n = AAA 4n = AAAA 3n = ABB
Autohexaploid Allotetraploid Triploid

6n = AAAAAA 4n = AABB 3n = ABC
Autoallohexaploid
Autopentaploid
6n= AABBBB
5n = AAAAA
Autoallooctoploid
Allohexaploid
8n = AAAABBBB
6n = AABBCC
Polyploidy is a common occurrence in plants — at least 47 per cent of all

angiosperm species are polyploids. Also, about 70 per cent of the grasses are
polyploids.
On the other hand, polyploidy is extremely rare among sexually reproducing

animals. This is probably because the chromosome balance of sex determination
is upset in polyploids. Furthermore, animals are generally cross-fertilized.
Therefore, a newly formed polyploidal animal cannot reproduce by itself. Also,
any change in the cell due to polyploidy will affect the complex development
of animals. Most polyploids that have been established in nature reproduce
parthenogenetically. For example, of the 18 parthenogenetic species in snout
beetles (Curculionidae), only one is a diploid; the others are triploids, tetraploids,
and pentaploids.
UP Open University
In both plants and animals, polyploidy may confer an evolutionary advantage

upon the descendants by giving them the opportunity to evolve a number of
functions for genes that are originally present only once.
What are the Physical Properties of Polyploids?
Autopolyploids are quite distinct from their diploid progenitors. Since their
individual cells increased in size, their growth rate became slower; they mature
late; with thicker leaves; bore fewer flowers but larger fruits; and displayed
reduced fertility. There is also the existence in general of an optimum range of
polyploidy beyond which growth may be depressed with increasing
chromosome number. The decrease in plant height beyond the optimum range
may be due to difficulties of nuclear mechanics, as well as other imbalances
caused by the extreme ploidy. These difficulties effect rather formidable barriers
for the successful establishment of such forms in nature.
SAQ 16-4
In timothy plants, the chromosome number and the corresponding plant
height are as follows:
Chromosome number Plant height (cm)

3n 60
4n 79
5n 105
6n 124
7n 128
8n 135
9n 143
10n 143
11n 117
12n 85
13n 50
a. What is the optimum range of polyploidy?

b. How will you describe the relationship of chromosome number and
plant height?
Allopolyploids, on the other hand, are fertile and they possess many of the
characteristics of the autopolyploids. Allopolyploidy has been responsible for
the formation of new species, for instance, in tobacco, wheat, and
Raphanobrassica.
UP Open University
Module 16 201
Aneuploidy
The nuclei of aneuploids have incomplete genomes or one or more
chromosomes are lacking or present in excess. If we consider an individual
with a diploid chromosome number of 8, the different types of aneuploids, its
chromosome number, complement, and configuration are:
Formula Chromosome Chromosome Chromosome Configuration

Number Complement at Diakinesis
1. Monosomic 2n -1 7 (ABCD) (ABC) 3II + 1 I

2. Nullisomic 2n -2 6 (ABC) (ABC) 3 II
3. Double 2n-1-1 6 (ABCD) (AB) 2 II + 2 I
monosomic
4. Trisomic 2n +1 9 (ABCD) (ABCD) (A) 3 II + 1 III or 4 II + 1 I
5. Tetrasomic 2n + 2 10 (ABCD) (ABCD) 3 II + 1 IV or 5 II
(A) (A)
6. Double 2n +1 + 1 10 (ABCD) (ABCD) 2 II + 2 III or 4 II + 2 I
trisomic
In 1924, Blakeslee and Belling found that each of several specific morphological
variants of the Jimson weed, Datura stramonium, had 25 chromosomes. One of
the 12 kinds of chromosomes was found to be present in triplicate; that is, the
somatic cells were 2n + 1 (trisomy).
Aneuploidy in man can be either sexual or autosomal. Examples of sexual

aneuploidy in man are:
Chromosome Composition Characteristics

and Number
1. Double Y syndrome 22 IIA + XYY Antisocialism;

(2n = 47) aggressiveness;
criminal tendencies;
low IQ
2. Metafemale 22 IIA + XXX Mental retardation;
(2n = 47) premature menopause
3. Klinefelter’s syndrome 22 IIA + XXY Underdevelopment
(2n = 47) in males, sterility;
mental retardation
4. Turner’s syndrome 22 IIA + XO Sexual infantilism;
(2n = 45) mental retardation
UP Open University
Examples of autosomal aneuploidy in man are:
Chromosome Composition Characteristics

and Number
1. Down’s syndrome 22 IIA + I21 Mental retardation;

(Mongolism) + XX or XY oriental eyes; Mongo-
trisomic for chrom 21 (2n = 47) lian eyelid fold;
saddle nose, swollen
tongue, characteristic
abnormalities in palm
print
2. Edward’s syndrome 22 IIA + I18 Malformations in
trisomic for chrom 18 + XX or XY virtually every organ
(2n = 47) system; slow growth;
mental retardation
3. Patau’s syndrome 22 IIA + I13 Malformations, like
trisomic for chrom 13 + XX or XY harelip and cleft
(2n = 47) palate; serious
cerebral, ocular, and
cardiovascular defects
SAQ 16-5
Take note of the examples of aneuploidy in man.
a. What specific types of aneuploidy are exemplified?

b. What characteristic is common in most of the human
aneuploids?
Structural Changes in Chromosomes

There are cases when the chromosome number remains normal but changes
occur in chromosome structure through loss, gain, or rearrangement of
particular sections. The chromosomal breaks may not be followed by a repair
causing structural aberrations. Each break produces two ends, which may follow
three alternative paths:
1. remain ununited leading to eventual loss of the segment which does not
include the centromere;
2. reunite or restitute immediately; and
3. join those produced by different breaks, causing an exchange or a
nonrestitutional union.
UP Open University
Module 16 203
Thus, a wide variety of structural changes is possible depending on the number

of breaks, their locations, and pattern in which broken ends are joined. The
commonly encountered types of structural changes produced by chromosome
breaks are:
Type Description Gene Changes
Normal (A B C D E F G H) None
Deficiency No rejoining, chromosome ABFGH, CDEFGH, etc.
segment lost
Inversion Broken segment re-attached original ABFEDCGH, etc.
chromosome in reverse order
Duplication Broken segment becomes attached ABCDEFGEEFGH
to homologue that has experienced
a break; homologue then bears one
block of genes in duplicate
Translocation Broken segment becomes attached LMNOPQRCDEFGH, etc.
to a non-homologue resulting in a
new linkage relations
A. Deficiency or Deletion represents a loss of chromosomal segment (Figure

16-1).
a.1. Interstitial deficiency
1
1 2 1
1
2 4 3 4
4
3
4
a.2. Interstitial deficiency
1 1 1 1
2 2 2 2
3
4 3 3 3
4 4 4
b. Terminal deficiency
1 1 1 1
2
2
3 2 2 Figure 16-1.
3 4 3 3 Types of chromo-
4 4 some deletion or
deficiencies
UP Open University
Autosomal genotype of flies subjected to X-irradiation may suffer an intercalary

or terminal break or deletion of genes. Intercalary or interstitial deficiency refers
to deletion within the genic sequence while terminal indicates that the deletion
occurred at the end portion of gene sequence. Deletion of genes is usually
detected thru the presence of a deficiency loop at pachytene if deletion is
heterozygous.
What are the Possible Genetic Effects of

Deletion or Deficiency?
The deficiencies for a considerable number of loci result in lethality. Non-lethal
deficiencies may result in psuedo-dominance, complete absence of crossing
over, and they may produce unique phenotypic types.
In man, examples of cases of deficiency are :
a. Cri-du-Chat or Cat Cry syndrome described by le Jerome (1963) -

deletion in the short arm of chromosome 5 causing severe mental
retardation, a round “moon face”, various forms of physical retardation,
and plaintive cat-like-cry during infancy;
b. Philadelphia 22 - deficiency for a large position of the long arm of

chromosomal 22 resulting in occurrence of chronic myeloid leukemia;
c. German (1970) described an infant male having a deletion of the short

arm of a number 4 autosome as being unusually small, with severe
psychomotor retardation, suffering from convulsions, and having a
wide, flat nasal bridge, a prominent forehead, cleft palate, and congenital
heart disease.
B. Duplications or Repeats occur when a portion of the chromosome is

represented more than twice in a normally diploid cell. The repeated section
of chromosomal material may be present in one pair of homologous
chromosomes or may have been transported to a different linkage group
or may even exist independently with its own centromere (Figure 16-2).
UP Open University
Module 16 205
a b c d e f g h i j
fragment duplicated
in sequences below
Types of Duplication
a b c d e d e f g h i j
tandem
a b c d e e d f g h i j
reverse tandem
a d e b c d e f g h i j
displaced (homobrachial,
on the same arm)
a b c d e f g h d e i j
displaced (heterobrachial,
on different arm)
k l m n o p q d e r s t
transposition
(to nonhomologue)
extrachromosome
Figure 16-2. Types of duplication of chromosome segments
The first duplication critically studied by Bridges (1936) is the bar eye variant
in Drosophila. The trait is associated with the duplication of a segment of the X-
chromosome called section 16 A in salivary gland chromosomes.
UP Open University
Module 16 207
The two types of inversion are:
a. Pericentric inversion - the inverted segment includes the centromere; and
b. Paracentric inversion - the centromere is not included in the inverted

segment.
Homologous chromosomes, with identical inversions in each member, pair

and undergo normal distribution in meiosis. On the other hand, should
only one chromosome pair experience a given inversion, synapsis produces
a characteristic inversion loop.
The genetic consequences of inversions are:
1. production of new linkage order by inversion homozygotes;
2. suppression of the crossing over in inversion heterozygote; and
3. having inversion heterozygotes which are partially or completely sterile.
D. Translocation occurs when single breaks in two nonhomologous

chromosomes produce an exchange of chromosome sections between them.
The two principal types of translocation are:
a. Simple, in which, following breaks, a segment of one chromosome is

transferred to another nonhomologous chromosome where it occupies
an intercalary location; and
b. Reciprocal (interchange), in which segments, which need not be of the

same sizes, are exchanged between nonhomologous chromosomes
(Figure 16-4).
Normal Homozygous Heterozygous

translocation translocation
Figure 16-4. Translocation of chromosome segments
UP Open University
There are two genetic consequences of translocation.
1. In homozygotes, there are altered linkage associations for the genes

contained in the exchanged segments.
2. The heterozygotes are frequently sterile and this is due to chromosome

segregation during Anaphase I, whereby gametes with duplication and
deficiencies of some loci are produced. Such gametes may be lethal.
Translocation in man results in numerous phenotypic abnormalities and

spontaneous abortion or death within a few months after birth. Those who live
exhibit mental retardation.
SAQ 16-7
In ___(a)___ of both inversion and translocation, there are altered linkage
associations of genes while their ___(b)___ result in sterility and lethality.
Gene or Point Mutations

Mutation is basically a change within the DNA molecule. Anyone of the four
nitrogen bases of the DNA renders itself to changes that could alter the DNA
molecule. There are several gene mutations which alter the sense of the gene.
A. Tautomerization
The purines and pyrimidines of DNA and RNA may exist in general
alternate forms, or tautomers. Tautomerism occurs through rearrangement
of electrons and protons in the molecule. Uncommon tautomers of adenine,
cytosine, guanine, and thymine differ from the common form in the position
at which one H atom is attached as a result, some single bonds and vice
versa.
B. Microlesions : Base pair substitution
The mutation involves one nucleotide pair. There is only one nucleotide
pair difference between the wild type and the mutant allele.
1. Transition mutation refers to the substitution of a purine with another

purine or a pyrimidine with another pyrimidine, e.g., adenine by
guanine or thymine by cytosine.
UP Open University
Module 16 209
Many spontaneous mutations are transitions. One mechanism that may

cause this is tautomeric shift.
2. Transversion mutation is the substitution of a purine by a pyrimidine or

vice versa, e.g., guanine by cytosine or thymine by adenine.
An example of transversion mutation is the case of the sickle cell gene

where glutamic acid (genetic codes: UGA and GAG) is replaced by valine
(genetic codes: GUA and GUG). The base pair substitution in the DNA
involves the A=T pair.
For both transition and transversion mutations, a base substitution,

which leads to a new nucleotide sequence, is produced. The new
sequence will be perpetuated in the subsequent generations, giving rise
to a new mutant cell linkage.
SAQ 16-8
(1)
Adenine Guanine
| |
(4) | | (2)
Thymine Cytosine
(3)
Transition mutations are represented by numbers ___(a)___ and ___(b)__

while transversion mutations are indicated by numbers ___(c)___ and
___(d)___.
C. Frameshift Mutations
Frameshift mutation occurs upon addition or deletion of a single nucleotide

or a few nucleotides. The “reading” of the genetic message started from a
fixed point. An insertion or deletion of one or two nucleotide pairs would
produce a shift in the “reading frame” and such shift would result in
mutation.
Frameshift mutation occurs most frequently in regions where there is a

monotonous DNA sequence, such as AAAAAA in one strand and TTTT in
the other. Somehow this favors “stuttering” in the process of DNA synthesis
leading to addition or deletion of one or more bases.
UP Open University
D. Mutator Genes
Mutation rate frequencies might be attributed to specific mutator genes

observed in various organisms. These genes believed to be associated with
DNA polymerase or similar enzymes are involved in DNA replication and
repair. For instance, Teffer mutator gene in E. coli is linked closely to the
gene for DNA polymerase II and is known to change the A-T pair to C-G
pair during replication.
The total mutation rate is increased several times.
E. Transposons or Jumping Genes
The movable genetic elements, which can physically shift position within
the same chromosome or between chromosomes, are called transposons or
jumping genes. Transposons in E. coli are capable of moving around the
DNA. This provides another mechanism of seemingly high mutability and
also a basis for genes moving around the genome. Transposons in E. coli
are able to move to a new site while still leaving a copy at the original site.
This allows the number of such elements in a cell to build up.
In 1951, Barbara McClintock discovered the movable genetic elements in

corn referred to as Ac-Ds system.
SAQ 16-9
Enumerate ways by which gene mutation can be produced.
Mutagenic Agents
The factors which bring about mutation include mutagens. Some of the common
mutagenic agents are discussed below.
1. Physical mutagens like ionizing radiation, e.g., X-rays, protons, neutrons

and alpha, beta, and gamma rays from radioactive sources like radium and
cobalt-90.
These ionizing radiations probably break DNA strand. They are particularly
more effective in breaking single-stranded DNA of viruses than double-
stranded DNA. In double-stranded DNA, when one strand is broken, the
other strand acts as a bridge and holds the molecule together until the
break is repaired.
UP Open University
Module 16 211
The ultraviolet light can produce thymine dimers, which are mostly
connected by the excision repair system. Those that are not repaired, or are
misrepaired, become mutations.
2. Exposure to extreme physical conditions, e.g. extremes of temperature or

humidity and centrifugation (Extreme temperature changes result in higher
frequency of polyploid cells in plants like Datura under cold treatments
and corn under 38-45oC at the time of the first division of the zygote.).
Centrifugation induces aneuploidy and structural aberration of

chromosomes.
3. Chemical mutagens, such as acenapthene, alkylating agents (e.g., nitrogen

mustard, ethyl ethanesulfonate, etc.), acridine dyes, base analogoues (e.g.,
bromodeoxyuridine, s-bromouracil, 2-aminopurine), chloral hydrate,
colchicine, and nitrous acid, can cause a variety of changes. For instance,
nitrous acid can change C to U, C-G pair to a T-A pair. The U is quickly
replaced by T. Adenine is changed to hexanthine, which pairs with cytosine,
hence changing the A-T pair to C-G pair.
The base analogues substitute for the bases if the DNA, e.g., bromouracil is
similar to thymine and can substitute for it in DNA synthesis. Since
bromouracil has a much higher tautomerism than thymine and, therefore,
often mispairs with guanine, more transition mutation is produced.
Proflavine and other dyes are flat molecules that slip into the DNA molecule
and produce frameshift mutation.
Colchicine, derived from autumn crocus (Colchicum autumnale) prevent the

formation of spindle fibers during anaphase, so that the doubled
chromosomes in a cell remain in a single restitution nucleus, forming a
polyploid.
4. Cell Regeneration
Removal of young shoots or axillary buds will induce callus formation.

Shoots regenerate, many of which are polyploids, such as in tomato,
Nicotiana species and cabbage.
5. Interspecific or Intergeneric Hybridizations
The naturally occurring and the experimental allopolyploids are products

of interspecific or intergeneric hybridizations.
UP Open University
SAQ 16-10
Name at least one mutagenic agent which can bring about:
a. change in chromosome number;
b. change in chromosome structure; and
c. gene mutation.
Evolutionary Significance of Mutations

What is the evolutionary significance of mutations?
The diversification on which evolution is built, however, requires in every case

alterations in the genetic material itself leading to reproductive incompatibility.
Mutations are the sources of genetic variations, which serve as the raw materials
of evolution. They are related to the evolutionary development of new species.
1. Interspecific hybridization combined with polyploidy offers a mechanism

whereby new species may arise suddenly in natural populations.
2. Trisomy in the Jimson weed leads to morphological differences that are

recognizable and forms a basis for an aneuploid series. In many plant
families and genera, aneuploid genes are associated with interspecific
morphological differences.
3. Allopolyploidy enables cataclysmic or evolution of species
4. Inversions differentiate several species of Drosophila. D. pseudoobscura and

D. persimilis are morphologically very similar; they produce sterile male
but fertile female hybrids and differ in four major inversions.
5. Translocation in the evening primrose, Oenothera, was largely responsible

for the differences in which De Vries based his mutation theory.
6. A series of many reciprocal translocations in isolated populations lead to

complete reproductive incompatibility, as well as definite morphological
differences showing that speciation occurred.
UP Open University
Module 16 213
Summary
Mutation is the change in the genetic material of an organism that is heritable
and essentially permanent. It may change either the number or structure of the
chromosomes or the chemical structure of the DNA of the genes in the
chromosomes. Mutations are of different kinds, namely: induced or
spontaneous; somatic or germinal; sex-linked or autosomal; forward or
backward suppressor; lethal, visible, conditional, invisible or silent, and
recessive or dominant mutations.
Mutations occur as chromosomal aberrations such as numerical and structural

changes. The numerical changes in the genome include euploidy and
aneuploidy. Structural changes in the chromosomes include deletion or
deficiency, duplication or repeat, inversion and translocation.
Gene mutations refer to changes within the DNA. The gene mutational process
includes tautomerization, base-pair substitution, frameshift, mutator genes,
and transposons.
Mutations are brought about by mutagens (which can be physical or chemical)

and other factors.
Mutations are the sources of genetic variations, which serve as raw materials
of evolution.
References
Burns, G.W. (1974). The science of genetics. An introduction to heredity, 2nd ed.
New York: The Macmillan Co. pp. 335-354.
Blakeslee, A.F. and J. Belling. (1924). Chromosomal mutations in the Jimson
weed, Datura stramonium. Jour. Hered. 15, 195-206.
Bridges, C.B. (1936). The bar “Gene”, a duplication. Science. 83: 210-211.
Karpechenko, G.D. (1928). Polyploid hybrids of Raphanus sativa L. x Brassica
olearacea L. Ztshu Ind. Abst. Vererb. 48: 1-83.
Ramirez, D.A. (1991). Genetics. 7th ed. SEARCA-UPLB. p. 217.
UP Open University
ASAQ 16-1
1. Induced mutation - type of mutation which occurs due to deliberate

application of chemicals or physical agents
2. Somatic mutation - mutation that occurs in a body cell
3. Sex-linked mutation - mutation that occurs in one of the sex chromosomes,
usually the X chromosome
ASAQ 16-2
1. forward
2. back or reverse
3. lethal
4. visible
5. recessive
6. dominant
ASAQ 16-3
Autotetraploid is the multiplication of one or similar genome while allotetraploid

consists of different genomes in the multiple sets.
ASAQ 16-4
a. The optimum polyploidy is in the range of 6n to 10n.

b. From 3n to 10n, the plant height increased with increase in chromosome
number. However, starting 11n, the growth was depressed.
ASAQ 16-5
a. monosomic (2n-1) and trisomics (2n + 1)

b. mental retardation
ASAQ 16-6
Duplication or repeat contributes more variations to species than deficiency or

deletion. The viability of mutants resulting from duplication or repeat is higher
than that from deletion.
UP Open University
Module 16 215
ASAQ 16-7
a. homozygous
b. heterozygotes
ASAQ 16-8
a. 1 c. 2
b. 3 d. 4
ASAQ 16-9
Gene mutation can be produced through:

1. microlessions
2. frameshift
3. transposons
ASAQ 16-10
a. chemical mutagens
b. hybridization
c. physical mutagens
UP Open University
Module 17
Delayed Chromosomal and
Extrachromosomal Inheritance
Introduction
Objectives
M ost of the hereditary variabilities that
were analyzed in animals, plants, and
microorganisms have been attributed to self-
replicating genes, known to be elements of
nuclear DNA (RNA, in a few cases). However, 1. Explain delayed chromo-
there are cases of non-Mendelian or non- somal inheritance;
chromosomal type of inheritance that have 2. Discuss the different modes
been known from the very beginning of of extrachromosomal inher-
genetics. There are inheritance patterns which itance; and
result in entirely different segregation ratios; 3. Cite cases of characteristics
maternal transmission patterns have also been determined by extracellular
observed. These hereditary processes are particles.
the delayed chromosomal inheritance and
extrachromosomal inheritance. In other
organisms, some characteristics of inheritance may be attributed to extracellular
particles.
1. What is Mendelian inheritance?
2. Cite an example of chromosomal type of inheritance.
Did you get the right answers? If you do not know the answer to the above
questions, the general textbooks in biology should be useful.
Definition of Terms
Autogamy - self-fertilization
Chromosomal segregation - Mendelian fashion; exhibits standard segregation

ratio
Delayed chromosomal inheritance - non-Mendelian inheritance or inheritance

pattern resulting in entirely different segregation ratio due to maternal
influence
Dextral - right direction coiling of the shell of the snail
Episome - genetic elements or DNA molecules that may exist either as integrated
part of a chromosomal DNA molecule of the host or as cytoplasmically
located genetic determiner
Extracellular particles - non chromosomal factors which are responsible for

certain traits in organisms
Extrachromosomal inheritance - heritable cytoplasmic factors which are capable

of self-perpetuation and independent transmission
Grandchildless gene - product of mutation in Drosophila resulting in fertile

homozygous females but the sex organs of their offspring fail to mature
Kynurenine - diffusible, hormone-like substance which provides pigment

coloration in larval skin and eyes of flour moth
UP Open University
Module 17 219
Plasmid - also known as plasmagenes, plasmons, or cytogen; genetic factors

which are located outside the chromosomes and independently
replicating
Petites - varieties of the baker’s yeast which can be segregational, neutral, and
suppressive
Pro-plastid - origin of mature plastid
Sigma - virus-like particle responsible for CO2 - sensitivity in Drosophila
Sinistral - left direction coiling of the shell of the snail
Concept Map
GENETIC VARIATIONS
(Hereditary variabilities)
Chromosomal Other Inheritance

(nuclear DNA or RNA) Patterns
Inheritance
Delayed Chromosomal Extrachromosomal

Inheritance Inheritance
Examples: Examples:
1. Coloration of Larval Skin 1. Streptomycin

and Eyes Resistance-Sensitivity
2. Direction of Shell Coiling 2. Killer-Sensitive traits
3. Grandchildless 3. Chloroplasts
4. Petite Characteristics
5. Extracellular particles
UP Open University
SAQ 17-1
Aside from the chromosomal type of inheritance, what other processes
are responsible for the observed variabilities in some organisms?
Delayed Chromosomal Inheritance

The delayed chromosomal inheritance of some characters of organisms is due
to maternal inheritance. It is still dependent on the nucleus but the principle of
chromosomal genetics is sidetracked by the ties between the maternal parent
and the offspring. The maternal influence is attributed to two important features
of the egg but not the sperm, namely:
1. orientation of the mitotic spindle axis; and

2. high cytoplasmic continuity between the egg and the oocyte with very little
or no contribution from the sperm.
Some of the examples of delayed chromosomal inheritance (= maternal

influence) are as follows:
A. Coloration of the Larval Skins and Eyes of the Flour Moth (Ephestia
kuhniella) and Water Flea (Gammarus)
In 1948, Caspari found that the colors of the larval skin and eye of the flour
moth and water fleas were controlled by the nuclear genes A (pigmented) and
a (non-pigmented).
Allele A controls the production of kynurenine (a diffusible hormone-like

substance) involved in pigment synthesis while a does not elaborate kynurenine.
The cross Aa x aa produces the progeny which consist of Aa and aa individuals.

The aa individuals cannot elaborate kynurenine since they lack the A allele.
However, these aa larval individuals develop some pigments in their skin and
eyes. Kynurenine diffuses from the Aa mother into all the young enabling
them to manufacture pigment regardless of their genotypes. The pigment fades
as they grow older and the effect disappears in the next generation.
These results are explained by the fact that Aa mother includes in her eggs
some of the A hormones elaborated in her own body. This substance, present
by maternal influence in the a, as well as in the A eggs, enables the aa offspring
to develop some pigment. But the aa individuals, being unable to elaborate a
continuing supply of the hormone for themselves, dilute and use up the supply
UP Open University
Module 17 221
that was transmitted from the mother. The maternal influence diminishes during
the development or its effect is transient.
SAQ 17-2
Where is the “maternal influence” in the inheritance of the coloration of
the larval skin and eye?
B. Direction of Shell Coiling in Snail (Limnaea peregra)
The shells of snails coil either to the right (dextral) or to the left (sinistral). Direction
of coiling is determined by a pair of nuclear genes, dextral being dominant to
sinistral.
Reciprocal crosses of dextral and sinistral lines resulted in the following:
1. F1s showed the same direction of coiling as the maternal parent;

2. F2s produced by selfing the F1s were all dextrally coiled; and
3. F3s segregated 3 dextral : 1 sinistral.
The direction of coiling depends upon the orientation of the spindle in the first
mitosis of the zygote. Spindle orientation, in turn, is controlled by the genotype
of the oocyte from which the egg came. The F1 shells in the reciprocal crosses
are determined by the genotypes of the maternal parents; the F2 shells are all
dextral since their maternal parents are all heterozygous. The F3 progeny reflect
the 3:1 phenotypic segregation of the maternal parent or the F2.
C. Grandchildless in Drosophila
Grandchildless mutation occurred in Drosophila resulting in fertile homozygous

females but the sex organs of their offspring failed to mature. The offsprings
are, therefore, all fully sterile, irrespective of the genotype of the male parent.
The effect of grandchildless gene is transmitted through the egg cytoplasm where
it acts to prevent normal reproductive development. The developmental
consequences of delayed gene action are detrimental to the species.
SAQ 17-3
What is the role of egg cytoplasm in the inheritance of:
a. direction of shell coiling in L. peregra; and
b. grandchildless?
UP Open University
Extrachromosomal Inheritance
The mode of inheritance called extrachromosomal inheritance is attributed to
cytoplasmic factors which are capable of self-perpetuation and independent
transmission in the chromosome. These genetic factors which are located outside
the chromosomes are called plasmagenes, or plasmons, or cytogen, or plasmids.
Extrachromosomal inheritance through plasmids tends to be maternal because

most of the zygote’s cytoplasm is derived from the egg. Like the delayed
chromosomal inheritance, reciprocal crosses give different results. However,
the unusual phenotypic ratios do not disappear after one generation. Plasmid
inheritance implies perpetuation through DNA replication, hence, it is a second
system for the transmission of traits.
SAQ 17-4
Compare and contrast delayed chromosomal inheritance and
extrachromosomal inheritance.
Extrachromosomal inheritance is clearly illustrated in the following examples.
A. Streptomycin Resistance - Sensitivity in Green Alga, (Chlamydomonas)
In 1960, Soger and her co-workers found a number of hereditary variables that
failed to show chromosomal segregation.
For example, when streptomycin resistant (sr) Chlamydomonas was crossed with
sensitive (ss) strain, the offsprings produced were 1/2 sr and 1/2 ss. One
resistant strain, sr-500, acts differently; if sr-500 is plus mating type or mt + (sr
mt+) and ss is mt- (ss mt-), all offsprings are ss. This effect is continuous as
long as the mt+ parent is sr. Even after four generations of backcrossing sr mt+
to ss mt-, no ss offspring appear. Since these results cannot be explained on the
basis of chromosomal segregation, in which a 1 sr: 1 ss ratio is expected, they
are ascribed to an extrachromosomal factor transmitted only through the plus
mating type in the cytoplasm (=cytoplasmic inheritance).
SAQ 17-5
Explain why sr-ss inheritance is considered non - chromosomal
inheritance.
UP Open University
Module 17 223
B. Killer-Sensitive Traits in Paramecium aurelia
Sonneborn in 1943 found that some races (killers) of the common ciliate,
Paramecium aurelia, produce a substance called paramecin which is lethal to
other “sensitive” individuals. It must have the gene K (exhibits
extrachromosomal segregation), and a complement of cytoplasmic particulate
maternal called kappa. Kappa contains DNA and RNA and is mutable. Sensitive
animals are those devoid of kappa. Animals with genotype kk lose their kappa
if they initially had it but they are unable to generate it. If kappa is present in a
cell with either genotype KK or kk, it is continuously produced. However,
once lost from a cell with a K gene, kappa does not reappear unless some
kappa is introduced from another cell.
For example, conjugation of killer (KK) and senstive (kk) strains produces
exconjugants, with very little or no exchange of cytoplasm. Separate killer and
sensitive clones are formed depending on the parent from whom they were
derived. Induced autogamy or self-fertilization of the killer exconjugant will
produce the homozygotes KK and kk, which will give rise to killer and sensitive
clones, respectively. Autogamy of the sensitive exconjugant gives rise to
sensitive clones only, in spite of the segregation of KK:kk.
When conjugation is prolonged, thus allowing massive cytoplasmic exchange,

both exconjugants show the killer trait. Autogamy gives rise to killer and
sensitive clones in accordance with the segregation of KK : kk. The killer trait is
maintaining itself in the KK clones but not in the kk clones.
Killer animals could maintain as many as 1600 kappa particles, each measuring
about 0.2 micron in diameter. Each kappa particle contains DNA, indicating
some hereditary independence. Also, the cytochrome pigments that kappa
utilizes in oxygen respiration are different from those of the host. Therefore,
since Paramecium exists quite well without kappa, its presence seems to be of
an accessory organism or symbiont.
SAQ 17-6
Explain the role of cytoplasmic particle in extrachromosomal inheritance.
UP Open University
C. Chloroplasts of Variegated Four O’Clock (Mirabilis jalapa)
Chloroplasts are the organelles in plant cells responsible for photosynthesis.

They contain DNA so they have their own genetic machinery that lies outside
the chromosome. Plastid differences are not transmitted along the chromosomal
lines. In the cells of the variegated four o’clock, M. jalapa, the progeny of
intercrosses are as follows:
Male Parent Female Parent Progeny

Pale Pale Pale
Green Green
Variegated Pale, Green and Variegated
Green Pale Pale
Green Green
Variegated Pale Pale
Green Green
The results indicate that there are two kinds of plastids transmitted only through
the female. The types of plastid and their distribution are as follows:
Phenotype of Plant Type of Plastid or Pro-plastid
Pale Pale
Green Green
Variegated Pale and Green
Seeds from the pale plant would have only the pale plastid types; those from
green, only green; those from variegated, either pale or green or a mixture of
the two types. Neither the genotype of the male genotype nor the nuclear genetic
constitution of the fertilized egg would be involved in the control of this
variation.
SAQ 17-7
Why is the chloroplast inheritance considered extrachromosomal
inheritance?
UP Open University
Module 17 225
D. Petite Chracteristics of the Baker’s Yeast (Saccharomyces cerevisiae)
In 1951, Ephrussi and his co-workers identified several petite varieties.
a. Segregational (nuclear) petites, when crossed with the wild type, produce
ascospores which segregate in the ratio 1 petite: 1 normal. This petite
characteristic is a chromosomally determined trait.
b. Neutral petites, when marked with normal strains, will produce only normal
or wild type ascospores and colonies. In the succeeding generations, the
petite characteristic never reappears and seems to have been physically
lost. This behavior indicates an extrachromosomal inheritance. A
heterokaryon test further proved this.
c. Suppressive petites suppress normal respiratory behavior in crosses with

the normal strains so most of the diploid cells derived from a zygote are
petites. Most of them, when induced or sporulate in a special environment,
give rise to asci with four petite spores. The suppressive petite factor,
therefore, acts as a dominant trait.
The petite characteristic of yeast has been attributed to deficiencies of

cytochromes b, c, and cytochrome oxidases a, a3 that are nomally found in the
inner membrane of the mitochondria.
The mitochondria also have their own DNA and they have been known to
divide or reproduce by themselves. This continuity of the mitochondria and
the mitochondrial DNA explains the cytoplasmic continuity of the neutral and
suppressive petites.
SAQ 17-8
Why are mitochondria capable of extrachromosomal transmission of
traits?
E. Extracellular Particles
There are certain traits of organisms which may be attributed to extracellular

particles. These are characterized as :
a. not normal or indespensable components of the normal cell;

b. transmissible by cell extracts from infected to uninfected individuals;
c. capable of moving in and out of the chromosomal DNA of the host; and
d. can exist in the nucleus or the cytoplasm of the host.
UP Open University
Following are examples of these traits.
1. Milk Factor in Mice
The femaleness of certain lines of mice are particularly susceptible to

mammary cancer, while other lines are resistant. From the milk of
susceptible females, virus-like particles or milk factors were isolated. These
particles, if present in the appropriate genotype, predispose young females
to mammary cancer when they mature.
2. Sigma Factor in Drosophila melanogaster
A certain strain of D. melanogaster shows a higher degree of sensitivity to

CO2. The sensitivity to CO2 of Drosophila flies is a heritable trait transmitted
through the maternal line. Extracts from sensitive flies become non-sensitive
when heat-treated. The cause of CO2-sensitivity is a virus-like particle called
sigma. Sigma contains DNA and is mutable, but is clearly an infective, foreign
particle in the cytoplasm. The transmission behavior of sigma shows that it
requires a nuclear gene before its life cycle may continue. Also, sigma is
not infective in other insect genera, indicating its dependence on appropriate
genes.
3. Fertility Factor in Escherichia coli
The bacterial fertility factor involves episomes or genetic elements (DNA

molecule) that may exist either as an integrated part of single circular
chromosomal DNA molecule of the host or in the cytoplasm as an
independently replicating DNA molecule (plasmid), free of the host
chromosome. Cells lacking the F-factor (F-) are the receptor (female) cells.
Cells having F in the cytoplasm (F+) are the donor (male) cells. Cells in
which F is a part of the chromosome are the high frequency recombinant
(Hfr) donors or “males”. There are eight salient features of fertility.
a. The F-factor is composed of DNA, about 105 nucleotide pairs, about 1/

45 the size of the chromosome in E. coli. It is replicated
semiconservatively in cell division, autonomously in F+ cells, and along
with chromosome into which it has been integrated in Hfr cells.
b. In the autonomous state, it is curable by mutagenic agents like X-ray

and acridine dye. Different treatments can cause the interconversion of
autonomous to integrated F-factor.
c. F-factor is infectious - F+ x F+ → all F+ cells.
d. It is hereditary trait; fission of F+ cells yields F+ progeny. F- and Hfr cells

also breed true.
UP Open University
Module 17 227
e. The fertility factors can enter the host DNA (Hfr) or be physically
independent of the chromosome (F+) and autonomous. But because the
cells become immune to further F-factors and because replication of F is
controlled, a cell may be F+ or Hfr, but not both simultaneously.
f. A cell containing F changes its behavior by becoming immune to more F

and by growing F-fimbriae. The presence of F-fimbriae makes the cell more
susceptible to some viral infections because these viruses specifically attach
to the fimbriae.
g. When an F-factor leaves the chromosome, it can transfer some bacterial

genes.
h. The F-factor has two kinds of genes — genes for replication and genes for
transfer. In the case of Hfr, these include mobilization of the host’s DNA.
SAQ 17-9
What are the similar characteristics of the virus-like particles causing
mammary cancer in mice and the sigma particles causing CO2-sensitivity
in Drosophila?
4. Resistance Transfer Factor in Shigella
Multiple resistance to several drugs in a number of bacterial genera, like

Shigella (causative agent of bacterial dysentery), appears to depend upon a
resistance transfer factor (RTF) which has many properties of an episome. It
can be transfered intergenerically to the related Salmonella and Escherichia
and can be modified by acridine dyes.
5. Colicin Factor in Escherichia coli
Some strains of E. coli produce highly specific antibiotic substances

consisting of proteins (sometimes along with lipopolysaccharides) that kill
other strains of the species. They have been named “colicins..” An F-col- cell
may become col+ by conjugation; in this case, all of its sexually derived
progeny are also col+. In this and other respects, colicins appear to be due
to autonomous cytoplasmic particles, referred to as col factors.
The character of the organism deviates from chromosomal heredity and

has extrachromosomal inheritance if the following situations are
encountered:
1. Results of the reciprocal crosses are different.
UP Open University
The results of the reciprocal crosses are usually identical when the characters
follow chromosomal heredity, except in cases of sex-linkage.
2. The difference in the results of the reciprocal crosses is due to maternal

inheritance or the progenies show the characteristics of their female parent.
The female gamete ordinarily provides more cytoplasm to the zygote than
the male gamete.
3. The gene controlling the character is non-mappable.
4. The varying characters fail to show segregation under appropriate

circumstances.
5. When segregation occurs but in fashion consistent with chromosome

segregation, non-chromosomal factors might have accounted for the
phenotypic variations.
6. The heritable characteristic persists in the presence of nuclei known to have

been associated with alternative characteristics.
7. The heritable phenotype has infection-like transmission.
Summary
1. The varying patterns of transmission of phenotypes include the
chromosomal type of inheritance and other cases of inheritance patterns.
The total disregard of the principles of segregation and the tendency to
look like the mother are unequivocal illustrations of cytoplasmic genetic
systems, like delayed chromosomal inheritance and extrachromosomal
inheritance.
2. Some of the characters which exhibit delayed chromosomal inheritance are:

the coloration of the larval skin and eye of the flour moth, Ephestia kuniella;
direction of coiling of shell of the snail, Limnea peregra; and granchildless in
Drosophila.
3. Some of the traits which have extrachromosomal inheritance: are

streptomycin resistance and sensitivity in Chlamydomonas; killer and
sensitive traits in Paramecium aurelia; chloroplasts of variegated four o’clock,
Mirabilis jalapa; and petite characteristics of baker’s yeast, Saccharomyces
cerevisiae. Other traits of organisms are attributed to extracellular particles,
such as milk factors in mice, sigma factor in Drosophila, fertility factor in E.
coli, resistance transfer factor in Shigella, and Col factors in E. coli.
UP Open University
Module 17 229
4. The inheritance of characteristics may suggest extrachromosomal

inheritance if there are differences in reciprocal cross, maternal inheritance,
non-mappability of chromosomes, non-segregation of characters, non-
Mendelian segregation, indifference to nuclear substitution, and infection-
like transmission.
References
Bernhard, R. (1967). Chromosomes are not the whole story of heredity. Sci.
Res. 2:51-54.
Bernhard, R. (1969). Mitochondrial “genes”: Some gambles pay off. Sci. Res.
4: 31-34.
Burns, G.W. (1972). The Science of Genetics. An introduction to heredity. New
York: The MacMillan Co. 368-385.
Campbell, A.M. (1962). Episomes. Advances Genet: 11: 101-105.
Campbell, A.M. (1969). Episomes. New York : Harper and Row.
Carnevali, F., G. Morpurgo, and G. Tecce. (1969). Cytoplasmic DNA from petite
colonies of Saccharomyces cereviasiae : A hypothesis of the nature of mutation.
Science 163: 1331-1333.
Suzuki, D. T., A. J. F. Griffiths, J. H. Miller, and R. C. Lewontin. (1986).
An introduction to genetic analysis. 3rd ed. W. H. Freeman & Co. New York.
pp. 433-452.
Weaver, R.F. and P. W. Hedrick. (1997). Genetics. 3rd ed. WC Brown Pub.
Dubuque. pp. 504-517.
Answers to Questions in Review of

Prerequisites
1. Mendelian inheritance is chromosomal type of inheritance; the factors (gene)
which determine the dominant and recessive characters reside on the
chromosomes. The single pair of alleles of a gene segregate during gamete
formation. The genes for different characters are inherited independently
of one another or that the members of one pair of alleles segregate
independently of the other pairs.
2. An example of chromosomal type of inheritance is the inheritance of each

of the seven characters of the sweet pea, Pisum sativum, which Mendel
observed in his hybridization work, namely:
a. purple vs. white flowers;

b. axial vs. terminal flowers;
c. inflated vs. pinched pods;
UP Open University
d. green vs. yellow pods;

e. round vs. wrinkled seeds;
f. yellow vs. green seeds; and
g. tall vs. short seeds.

ASAQ 17-1
Aside from the chromosomal type of inheritance, the other processes responsible
for the observed variabilities in organisms are delayed chromosomal
inheritance, extrachromosomal inheritance, and extracellular particles.
ASAQ 17-2
The heterozygous (Aa) mother moth, E. kuhniella, has eggs with A hormones
elaborated in her body. The substance from the mother is transmitted not only
to A progenies but even to aa offspring resulting in development of pigments
in larval skin and eyes.
ASAQ 17-3
Egg cytoplasm influences transmission of the genes for the direction of coiling
in snail and grandchildless in Drosophila resulting in deviations from usual
chromosomal inheritance.
ASAQ 17-4
In both delayed chromosomal inheritance and extrachromosomal inheritance,

the reciprocal crosses gave different results. In delayed chromosomal
inheritance, the unusual phenotypic ratio disappeared in subsequent
generations while in extrachromosomal inheritance, the ratios did not disappear
after one generation.
ASAQ 17-5
The streptomycin resistance (Sr)- streptomycin sensitive (ss) inheritance is

nonchromosomal but cytoplasmic inheritance. The extrachromosomal factor
is transmitted only through the plus mating type in the cytoplasm.
UP Open University
Module 17 231
ASAQ 17-6
The cytoplasmic particle, like kappa, complements with the gene K in the
expression of the killer trait character of Paramecium aurelia. Its presence seems
to be of an accessory organism or symbiont.
ASAQ 17-7
Plastids contain DNA and therefore have a genetic machinery of their own, a
machinery that lies outside the chromosome.
ASAQ 17-8
Mitochondria have their own DNA capable of cytoplasmic continuity of traits,

like neutral and suppressive petites in S. cereviasiae.
ASAQ 17-9
The similar characteristics of virus-like particles causing mammary cancer in

mice and the sigma particles causing CO2 -sensitivity in Drosophila are :
1. not normal or indispensable components of the normal cell;

2. transmissible by cell extracts from infected to uninfected individuals;
3. capable of moving in and out of the chromosomal DNA of the host;
4. can exist in the nucleus or the cytoplasm of the host.
UP Open University
Module 18
Population Genetics: Genetic
Equilibrium
Introduction
Objectives
T o predict the fate of genes, one must
follow this up in a population. Although
genes are in individuals, the fate of
individuals and consequently the fate of the
genes depend upon the factors concerning the 1. State the Hardy-Weinberg
population as a whole. Population is defined principles; and
as a group of sexually interbreeding 2. Calculate the gene and
individuals sharing a common gene pool. This genotype frequencies in a
gene pool and gene frequencies are attributes population under random
of genes in a population. Gene pool refers to mating.
the sum of all the genes in the reproductive
gametes of a population. The proportion of
the alleles of a particular gene (gene frequency) and of the genotype (genotype
frequencies) at any generation depends upon the frequency of the allele of that
gene in the previous generation.
In a large and random mating population, the gene and genotype frequencies
remain constant from generation to generation as long as there are no outside
forces such as mutation, selection, and migration. This condition is referred to
as genetic equilibrium which is governed by the Hardy-Weinberg Law.
In man, traits that are randomly mated for such as the ABO blood groups have
been noted to be at genetic equilibrium in a Filipino population (Laude, 1991).
This module will primarily focus on the conditions that allow genetic
equilibrium in a population and the manner of predicting the gene and genotype
frequencies at genetic equilibrium under various modes of genes action.
You will be guided by the following concept map.
Concept Map
No Evolution
HW Equilibrium
No change in gene frequency
Environment No migration
Large population No mutation
Random mating
Prerequisite
You should have completed the module on the physical basis of heredity
including sex linkage and quantitative inheritance.
UP Open University
Module 18 235
The Hardy-Weinberg Principle

In 1908, the mathematician G.H. Hardy of Cambridge University, England
and the physician Wilhelm Weinberg of Germany, working independently,
formulated the basic principles of population genetics, the Hardy-Weinberg Law.
It states that as long as there are no alterations in any of the genes nor migration
or immigration of individuals in a large and random mating population, the
gene and genotype frequencies will no longer change in the next or succeeding
generations. This law sets the condition for no evolution. These conditions
include the following:
1. The population must be large enough to allow each individual an equal

chance to mate with any other individual;
2. Mutations must not occur;
3. There must be no individuals moving out of the population (emigration)
or individuals introduced into the population (immigration); and
4. Reproduction must be completely random, i.e., all gametes are equally fertile
and randomly fertilized to contribute to the next generation.
To illustrate the principle, assume a herd of 100 cattle. Consider this herd as
the initial population. Let us follow up the fate of the genes for coat color in
cattle. This is controlled by one gene (monogenic) with 2 alleles of which one
allele for red (R) is co-dominant over the other allele for white (r). Given a
phenotype distribution of 25 RR: 50 Rr: 25 rr, the gene pool of the cattle herd
with respect to coat color shall consist of 100 R and 100 r.
To calculate the gene frequency, merely take the proportion of one allele over
the total number of alleles as follows:
ΣR 2(no. of RR) + no. of Rr

frequency of allele R, f(R) = =
Σ(R  r) 2(Total Population)
2 (25)  50 100
= = = 0.5
2 (100) 200
ΣR 2(no. of rr)  no. of Rr

frequency of allele r, f (r) = =
Σ(R  r) 2(Total Population)
2 (25)  50 100
= = = 0.5
2 (100) 200
UP Open University
Likewise, to calculate the genotype frequency refer back to the given genotype
distribution and take the proportion of each genotype over the total number
of genotypes as follows:
25
frequency of genotype RR, f(RR) = = 0.25
100
50
frequency of genotype Rr, f(Rr) = = 0.5
100
25
frequency of genotype rr, f(rr) = = 0.25
100
What will be the gene and genotype frequencies in the next generation?
Assuming that the parental herd is a totally effective population with 50 bulls
and 50 cows, which are all at reproductive state, well maintained, healthy, and
therefore producing equally fertile gametes, then all the individuals will be
randomly mating.
Under random mating, all individuals have an equal chance to mate with any
other individual. All possible mating systems equally occur. Hence, the
frequency of mating is computed by multiplying the frequency of the respective
genotype. The genotype frequency among the progeny is based on the sum of
the resulting offspring of each mating type following the Mendelian principles
of heredity (Table 18-1).
Table 18-1. The genotype frequencies among the offspring

after one generation of random mating
Offspring (Gen. 1)
Mating system f(mating) RR Rr rr
RR x RR .25 x .25 = 0.0625 0.0625

2RR x Rr 2(.25) x .5) = 0.25 0.1250 0.1250
2RR x rr 2(.25 x .25) = 0.1250 0.1250
Rr x Rr .5 x .5 = 0.25 0.0625 0.1250 0.0625
2 Rr x rr 2(.5 x .25) = 0.25 0.125 0.125
rr x rr .25 x .25 = 0.0625 0.0625
______ ______ ______
0.2500 0.500 0.2500
UP Open University
Module 18 237
As derived from the above table, genotype frequencies after one generation of
random mating are as follows:
f(RR)1 = 0.25
f(Rr)1 = 0.50
f(rr)1 = 0.25
Likewise, the gene frequencies can be calculated from the genotype frequencies
at the first generation as follows:
f(R)1 = f(RR)1 + 1/2 f(Rr)

0.25 = 0.25 + 1/2 (0.5) = 0.5
f(r)1 = f(rr)1 + 1/2 f(Rr)

= 0.25 + 1/2 (0.5) = 0.5
To summarize, the gene and genotype frequencies in the parental (generation

0) and its progeny after one generation of random mating (generation 1) are as
follows.
Frequencies Generation 0 Generation 1

f(R) 0.5 0.5
f(r) 0.5 0.5
f(RR) 0.25 0.25
f(Rr) 0.5 0.5
f(rr) 0.25 0.25
Note that the gene and genotype frequencies did not change or they remained
constant demonstrating therefore genetic equilibrium or what is known as the
Hardy- Weinberg equilibrium.
Under Hardy- Weinberg equilibrium, the following algebraic formula is used:

For the given example above: Let p = f(R)
q = F(r)
The sum of all the gene frequencies relative to one locus is as follows:
p+q=1
To check
f(R) + f(r) = 1
p + 2pq + q = 1
2 2
where: p 2 = f(RR)
2pq = f(Rr)
q2 = f(rr)
UP Open University
To check
f(RR) + f(Rr) + f(rr) = 1
0.25 + 0.5 + 0.25 = 1
SAQ 18-1
A. For the following genotype distribution of different populations,
mark HW all populations in Hardy- Weinberg equilibrium and NG
all populations not in genetic equilibrium:
a) AA 0.30 Aa 0.42 aa 0.28

b) BB 0.09 Bb 0.42 bb 0.49
c) CC 0.9801 Cc 0.0198 cc 0.0001
d) DD 0.9216 Dd 0.0768 dd 0.0016
e) EE 0.0100 Ee 0.2678 ee 0.7222
B. Calculate the expected equilibrium gene and genotypic frequencies

for populations not in HW equilibrium.
Gene and Genotype Frequencies

under H-W Equilibrium
As long as the conditions for genetic equilibrium prevail in a population, the
gene and genotype frequencies in a population can be predicted. The
equilibrium genotype frequency is given by the square of allelic frequencies as
follows:
(p + q)2 = p2 + 2pq + q2
where p = dominant allele
q = recessive allele
The following are model systems for population stability.
1. Co-dominant alleles
To demonstrate how the Hardy-Weinberg principle predicts the gene and

genotype frequencies, we shall consider the M-N blood group in man
controlled by the alleles M and N which are co-dominant; that is, the
phenotype is the same as the genotype.
Given: f(M) = p = 0.6

f(N) = q = 0.4
UP Open University
Module 18 239
The genotype frequencies at equilibrium after generations of random mating

are as follows:
f(MM) = p2 = (0.6)2 = 0.36 or 36%

f(MN) = 2pq = 2(0.6) (.04) = 0.48 or 48%
f(NN) = q2 = (0.4)2 = 0.16 or 16%
If there are 1000 individuals in the population, then the phenotype

distribution is as follows:
MM = 0.36 x 1000 = 360

MN = 0.48 x 1000 = 480
NN = 0.16 x 1000 = 160
Total = 1000
The gene frequencies are
(360 x 2) + 480
M = = 0.6
1000 x 2
(160 x 2) + 480
N = = 0.4
1000 x 2
2. Complete Dominance
When a trait is controlled by completely dominant alleles, the genotype is

not directly observed. A dominant phenotype is either homozygous
dominant or heterozygous. You need to do a test cross to verify this. The
recessive phenotype results from the presence of a double dose of the
recessive alleles. One can therefore calculate the frequency of the recessive
allele q from q2 and p from the equation p + q = 1. Knowing p and q, you
can easily proceed to get frequency of the homozygous p 2 and the
heterozygous 2pq among those with dominant phenotype.
As an example, the gene controlling the ability to roll your tongue or tongue-
rolling is dominant (T) and that for the non-rolling tongue or the inability
to roll is recessive (t). Among 1000 Filipino residents of Los Baños, Laguna,
640 are tongue rollers while 360 have non-rolling tongue. To predict the
gene frequencies, calculate as follows:
UP Open University
f(tt) = q2 = 360/1000 = 0.36

f(t) = q = 0.36
q = 0.6
p+q = 1
f(T) = p = 1–q
p = 1 – 0.6
p = 0.4
The genotypic frequency distributions therefore are as follows:
f(TT) = p 2 = (0.4) = 0.16 x 1000 = 160

f(Tt) = 2pq = 2(0.6) (0.4) = 0.48 x 1000 = 480
f(tt) = q2 = (0.4)2 = 0.16 x 1000 = 160
3. Multiple Alleles
A classic example is the ABO blood group in man. This is controlled by

three alleles. A, B, and O. A and B have complete dominance over O while
A and B codominant to each other. Their gene frequencies are as follows:
f(A) = p
f(B) = q
f(O) = r
p+q+r = 1
Likewise, the genotype frequencies are predicted using the formula:
(p + q + r)2 = 1
p2 + 2pq + 2qr + 2pr + q2 + r2 = 1
where
Phenotype Genotype Genotype Frequency

A AA p2
AO 2pr
B BB q2
BO 2qr
AB AB 2pq
O OO q2
UP Open University
Module 18 241
To demonstrate this, consider the following phenotype distribution of the

ABO blood group among Filipino residents of Los Baños, Laguna.
Blood Type Phenotype Phenotype Genotype

Distribution Frequency Frequency
A 1350 0.45 p2 + 2pr
B 390 0.13 q2 + 2qr
AB 180 0.06 2pq
O 1080 0.36 r2
Total 3000 1.0
In calculating the gene frequencies, start with O as follows:
“O” phenotype = r2 = 0.36

f(O) = r = r2
r = 0.36
r = 0.6
Next, consider p or q. Assuming, p, calculate as follows:
p = 1 – (q + r)
= 1 – ( q + r) 2
= 1– (q 2 + 2qr + r 2
= 1 – 0.13 + 0.36
= 1 – 0.49
= 1 – 0.7
p = 0.3
Proceed in determining q, using the formula:
p+ q + r = 1
q = 1 – (p + r)
= 1 – (0.3 + 0.6)
q = 0.1
UP Open University
Likewise the genotype frequencies are as follows:
f(AA) = p2 = (0.3)2 = 0.09

f(AO) = 2pr = 2(0.3) (0.6) = 0.36
f(BB) = q2 = (0.1)2 = 0.01
f(BO) = 2qr = 2(0.1) (0.6) = 0.12
f(AB) = 2pq = 2(0.3) (0.1) = 0.06
f(OO) = r2 = (0.6)2 = 0.36
1.00
4. Sex-Linked Genes
For traits controlled by sex-linked genes, there are five possible genotypes
with homozygous or heterozygous conditions in females and hemizygous
conditions in males. The following are the genotypes and genotype
frequencies for each phenotype in females and males for H and h alleles for
hemophilia:
Phenotype Genotype Genotype Frequency
Females normal: XHXH = p2

carrier: XHXh = 2pq
hemophiliac: XhXh = q2
Males normal: XHY = p

Hemophiliac: XhY = q
To illustrate the calculation in predicting the gene and genotype frequencies:
Given: f (hemophiliac allele, h) = 0.0001
The gene frequencies are:

f(h) = q = 0.0001
f(H) = p = 0.0000
Consequently, the genotype frequencies are:
For females: f(XHXH) = p2 = (0.9999)2

f(XHXh) = 2pq = 2(0.9999) (0.0001)
f(XhXh) = q2 = (0.0001)2
For males: f(XHY) = p = 0.9999

F(XhY) = q = 0.001
UP Open University
Module 18 243
SAQ 18-2
For the following random-mating populations, calculate the gene and
genotype frequencies:
a) Among 200 persons 128 belong to M blood group.

b) Among 150 students of Biology 30, 74 had adherent earlobes.
c) Among 1000 females, 40 colorblind.
Among Filipinos, 49% have O blood type and 15% have B blood type.

ASAQ 18-1
1A. The correct answers are as follows:

a) NG
b) HW
c) HW
d) HW
e) NG
Note: Populations b, c, and d are at HW equilibrium because the actual is equal

to the expected genotypic frequencies. Otherwise, they are not in HW
equilibrium as in populations a and e.
If you got a score of 5/5, you did great. Keep up the good work. If you scored
3/5 read the lesson again; try the given example by yourself and proceed to
SAQ 18-1 again. I’m sure you will get it this time. Patience and perseverance
are important ingredients of success.
1B. a) q = f(a) = f(aa) + 1/2 f(Aa)

= 0.28 + 1/2 (0.42)
= 0.28 + 0.21
= 0.49
p = f(A) = 1–q
= 1 – 0.49 = 0.51
UP Open University
Genotype frequencies:
p2 = f(AA) = (0.51) 2 = 0.2601

2pq = f(Aa) = 2(0.51) (0.49) = 0.4998
q2 = f(aa) = (0.49) 2 = 0.2401
e) Gene frequencies:
p = f(e) = f(ee) + 1/2 f(Ee)

= 0.7222 + 1/2 (0.2678)
= 0.8561
p = f(E) = 1-q = 1 – 0.8561 = 0.1439

p2 = f(EE) = (0.1439)2 = 0.0207
2pq = f(Ee) = 2(0.1439) (0.8561) = 0.2464
q2 = f(ee) = (0.8561)2 = 0.7329
For each correct genotype frequency in cases a and e, give yourself 1 point. A
perfect score is 6/6. If you got this, marvelous. You have just correctly applied
the procedures for calculating gene and genotype frequencies under H-W
equilibrium. For further exercises under cases controlled by genes with different
types of allelic or gene interaction, proceed to the next lesson on calculation of
gene and genotype frequencies.
ASAQ 18-2
Give yourself one point for every correct answer. Recall that M and N blood
groups are controlled by M and N alleles which are codominant.
Gene Genotype Phenotype

Frequencies Frequencies Frequencies
128
a) f(M) = p = f(MM) = p2 = (0.8)2 M = (0.64) 200 = 128
200
= 0.64 p2 = 0.64
= 0.8
f(N) = q = 1 – p f(MN) = 2pq = 2(0.8) (0.2) MN = (0.32) 200 = 8

q = 1 – 0.8 2pq = 0.32
q = 0.2
f(NN) = q2 = (0.2)2 NN = (0.04) 200 = 8

= q2 = 0.04
UP Open University
Module 18 245
b) Adherent earlobe is the recessive alternative of free-earlobes which is

completely dominant over the recessive allele, a.
Gene Genotype Genotype

f(a) = q = 74/150 f(aa) = q2 = (0.7)2 aa = 0.49 (150 ) ~ 74

q = 0.7 q = 0.49
2
f(A) = p = 1 – q
p = 1 – 0.7 f(Aa) = 2pq = 2(0.7) (.03) Aa = (0.42) 150 = 63
p = 0.3 2pq = 0.42
f(AA) = p 2 = (0.3)2 AA = (0.09) 150 = 13

p 2 = 0.09
c) Red-green colorblindness is due to a sex-linked recessive allele, c.
Gene Genotype Genotype

For females:
f(c) = q = f(X c X c ) f(XcXc) = q2 = (0.2)2 XcXc = (0.04) 1000 = 40
q= 40/1000 q2 = 0.04
q = 0.02
f(C) = p = 1 – q f(X+Xc) = 2pq = 2(0.2) (0.8) X+Xc = (0.32) 1000 = 320

1 – 0.2 2pq = 0.32
p = 0.8
f(X+X+) = p 2 = (0.8)2 X+X+ = (0.64) 1000 = 640

p 2 = 0.64
UP Open University
d) Recall that the existence f ABO blood groups in man is due to multiple
alleles, A, B, and O.
Gene Frequencies Genotype Frequencies
f(O) = r = 0.49 f(OO) = r2 = (0.7)2 = 0.49

r = 0.7 f(AO) = 2pr = 2(0.2) (0.7)
= 0.28
f(A) = p = 1 – (q + r) f(AA) = p 2 = (0.2)2 = 0.04
= 1- q 2 + 2qr + r 2 f(BO) = 2qr = 2(0.1) (0.7)
= 1- 0.15 + 0.49 = 0.14

= 1- 0.54
p = 0.2 f(BB) = q2 = (0.1)2 = 0.01
f(AB) = 2pq = 2(0.2) (0.1)
= 0.04
f(B) = q = 1 – (p + r)
= 1 – (0.2 + 0.7)
q = 0.1
If you got a score of 26/26, congratulations! You got correct calculations in

predicting gene and genotype frequencies. I’m sure you will agree with me
when I say that it is fun to be able to predict the future outcome in a random
mating population. If you scored 13/26, please practice solving the sample
problems in the text. May I remind you that mathematical skills have a low
heritability and therefore there is much more for improvement by practicing
and developing the skill yourself. Good luck again.
UP Open University
Module 19
Population Genetics: Changes
in Gene Frequency
Introduction
Objectives
L et us represent genes in a population with
red and black balls. Consider a box of 20%
red and 20% black balls on a proportion of
50% red and 50% black. In a stable population,
such proportion will not change. However, 1. Enumerate the factors that
with addition or subtraction of red or black effect changes in gene
balls, their proportions will change. frequency; and
Replacement of red with black or vice versa 2. Calculate the amount of
will also cause a change in their proportions. change in gene frequency
If all black balls will be replaced by red balls caused by each of the
the whole population changes to become various factors.
totally red.
The mere addition or subtraction of balls is referred to as immigration and

emigration, respectively. Likewise replacements of balls may represent mutation.
Migration and mutation are just two of the forces that effect changes in gene
frequency. Other forces include selection, the ultimate force to effect a change
in large population. With small populations where mating is not random,
however, changes in gene frequency are caused by genetic drift.
With recurring change, the population may form a new gene pool and effect a
change enough to cause evolution.
Concept Map
Evolution
New Gene Pool
Changes in Gene Frequency
Environment Migration
Random drift Gene Mutation

Pool
Selection
Prerequisite
You should have completed the first part of this unit on genetic equilibrium. A
perfect score in Module 18 indicates that you are ready to start on this second
part of population genetics. This will give you the basic mechanisms of
evolution.
Factors that Cause Changes in Gene

Frequency
The processes that cause changes in gene frequency are classified as either
systematic or dispersive depending on the population size. In a large population,
the systematic process of change occurs. The systematic process is due to
selection, mutation, and migration. This is predictable both in amount and in
direction. On the other hand, in small populations, the dispersive process occurs.
The dispersive process is due to random genetic drift. This is predictable in
amount but not in direction.
UP Open University
Module 19 249
1. Mutation is a permanent heritable change in the genetic material. It is one

of the main sources of variation. Its effect on the population, however, is
dependent on the frequency, direction, or reversibility of the mutation. On
the basis of frequency a mutation is either single or recurrent. A single
mutation can effect a change if selected for. This means that mutant alleles
survive and are passed on to the next generation as shown below:
mutation
A a
a germ cell x A
Aa x AA
Aa : AA
On the other hand, recurrent mutations have an effect upon a population. A

complete change occurs if 100% of one allele is replaced by the alternative allele.
This occurs at a rate consistent with the mutation rate of the allele.
To predict the frequency of a gene with recurrent, one-way mutation of A to a,

follow these steps:
1. Let po = initial frequency of A

u = mutation rate of A to a
2. After one generation, the new frequency of A (po) will be:
p1 = po - upo = po (1-u)
3. After a second generation, the frequency of A (p2) will be:
p2 = p1 - upo
but since p1 = po (1-u) then

p 2 = po (1-u) - upo (1-u)
= po - upo - upo + u2 + po
= po (1-u)2
UP Open University
After n generations, the frequency of A will fall to:
pn = po (1-u)m
and in time, to zero.
Based on direction, a mutation is either forward or backward, one-way or two

way, reversible or irreversible. If the frequency of the forward, A → a is equal
to the backward a → A, then mutational equilibrium is attained, hence there is
no effect on the population.
To predict the frequency of a gene at genetic equilibrium, follow these steps:
1. Let po = initial frequency of A

p = equilibrium frequency of A
qo = initial frequency of a
q = equilibrium frequency of a
u = mutation rate of A to a
v = mutation rate of a to A
2. After one generation, the frequency of A will be p1 which is the sum of the
initial frequency of A, po and the frequency of A derived by reverse mutation
of a → A (vq) less the frequency of gene A that has changed by direct
mutation A → a (upo). This is symbolized as follows:
p1 = po + vqo - upo
3. After n generations, the frequency of A will be:
pn = pn-1 + vqn-1 - upn-1
4. Equilibrium will be established when:
vq - up = 0 or vq = up
5. Since q = 1 - p, then:
v(1 - p) = up
v - vp = up
v = up + vp
v = p (u + v)
v
p̂ =
u+v
UP Open University
Module 19 251
6. To derive q̂ , consider p = 1 - q, then:
u (1 - q) = vq
u - uq = vq
u = vq + uq
u = q (u + v)
u
q̂ =
u+v
Considering the usually observed mutation rates of 5 x 10-5 or less, the approach
to equilibrium is, therefore, very slow and rarely reached.
The mathematical equations for recurrent one-way and mutational equilibrium

are used in predicting the amount of change due to mutation, the number of
generations needed for the population to reach equilibrium with recurrent one-
way mutation, and the frequency of each allele when mutational equilibrium
is reached.
Let us consider an example :
Let: po = initial frequency of allele, A

qo = initial frequency of allele, a
u = rate of forward mutation, A → a
p = frequency of A at generation 1
q1 = frequency of a at generation 1
Given: p = 0.1
qo = 0.9
u = 1 x 10-5
What is the amount of change in the frequency of A (Up) after one generation
with mutation at a rate of 1 x 10-5 ?
The amount of change in the frequency of allele, A is calculated as follows:
p1 = p - upo
Up = p1 - p
= po - upo - po
Up = - upo
= - (1 x 10-5) (0.1)
Up = -(1 x 10-6)
UP Open University
Following the same rate of mutation, you can calculate the number of
generations (t) to change po = 0.1 to pt = 0.09 using the equation:
pt = po (1 - u)t
t
p
(1 - u)t = p
o
0.09
(1 - 0.00001)t =
0.1
0.9999t = 0.9
t = 10.000
Assuming a reversible mutation with the same rate of forward mutation, u of

1x10-5 but with a rate of reverse mutation, v of 5 x 10-5, what will be the
equilibrium frequency of gene a, q under mutation in a randomly mating
population?
This can be predicted using
v
q̂ =
u+v
1 x 10 -5
= −5 + (5x10-5)
(1x10 )
q̂ = 1/6
Likewise, the frequency of the dominant allele, A, p under mutational

equilibrium is p = 1 - q = 5/6.
SAQ 19-1
If the mutation rate of the wild type allele D to the recessive allele d is 5
x 10-5, and the reverse mutation rate of d to D is 1 x 10-5, what will be the
equilibrium frequency of gene d under mutation in a randomly mating
population?
UP Open University
Module 19 253
2. Migration or Gene Flow
In nature, no species is totally isolated from other species. It is therefore a

fact that many populations are affected by migration. Migration also
provides a source of variation. However its effect in the population is
determined by the selective advantage of migrants. The introduction of
new alleles to a population is called immigration while the moving out of
individuals from a population, which causes loss of alleles, is emigration.
When there is migration, two factors are important to the recipient

population: a) the difference in gene frequencies between two populations;
and b) the proportion of migrant genes that are incorporated in each
generation. The relationship is shown in the following mathematical
equations to predict the frequency of a gene after a generation or more of
migration.
1. Let p o = frequency of A in the native population

p1 = frequency of A in the next generation after migration
pm = frequency of A among the migrants
m = rate of migration
1-m = frequency of natives
2. After one generation, the frequency of A, p1 will be the sum of gene A

among the natives [ (1-m) po] and the amount of A introduced (mpm).
p 1 = (1 - m)po + mpm
= po - mpo + mpm
p 1 = po - m (po - pm)
3. The change in allele frequency (Up) is:
Up = p1 - po
4. Substituting the value of p1 , then:
Up = po - m(po - pm) - po
Up = -m (po - pm)
5. After the first generation, the difference in allele frequencies between

the natives and migrants is:
p1 - pm = po - m(po - pm) -pm

= po - mpo + mpm - pm
= (1 - m) po - (1 - m) pm
= (1 - m) (po - pm)
UP Open University
6. After the second generation, the difference in allele frequencies is:
p2 - pm = (1 - m)2 (po - pm)
7. After t generations of migrations, the difference in allele frequencies is:
pt = (1 - m)t (po - pm) + pm
8. The number of generations it will take to reach a desired gene frequency

is predicted using the formula:
p −p
t m
(1 - m)t =
p +p
o m
SAQ 19-2
In an isolated island with a population of 75 individuals, the frequency
of gene A is 0.8. A migrant group of 25 individuals with frequency of A
equal to 0.2 joins the natives to form a population of 100 members. As
a result of one generation of random breeding, what would be the change
in the frequency of gene A?
3. Selection
Differential survival and reproductive capacity or non-random reproduction

of individuals in a population is selection. Selection causes a systematic
process of change. It is the ultimate force that effects a change in gene
frequency. The real test of mutation and migration is selection. While
mutation and migration are the sources of variation, selection ultimately
causes the change.
Types of Selection
Selection is either natural or artificial. Survival and reproduction of the most

fit genotypes constitute natural selection, the guiding force of evolution. On
the other hand, artificial selection refers to the practice of plant and animal
breeders for propagating the most favored genotypes.
Figure 19-1 shows the three kinds of selection based on the effects of the
cumulative forces of the environment acting on the population.
UP Open University
Module 19 255
Classes Classes Classes
a. Stabilizing b. Directional c. Disruptive
Figure 19-1. Kinds of selective effects
Stabilizing selection tends to elimate the extreme phenotypes and preserve

individuals in the population close to the mean. This is true for populations
well adapted to the environment.
Directional selection tends to preserve either one of the extremes. This occurs in
a population where there is a sudden environmental change. As an example,
the flooding in certain areas eliminated lowland rice varieties but consequently
caused the increase in the propagation of upland rice varieties.
Disruptive selection favors the extreme phenotypes. It preserves differences in

the gene pool of a population. This occurs when several ecological niches become
available to a population causing gene flow to cease and allowing subspeciation
and eventually new species formation.
On the basis of the level of selection, this can either be gametic (hybrid) or
zygotic (diploid). In both levels, the force acting on a phenotype to reduce its
fitness or adaptive value is selection pressure or selection coefficient , s.
s=1-w
where w = fitness
therefore with complete selection, s = 1,
w = 1-s
= 1-1
w = 0
UP Open University
For example, hemophilia, bleeders’ disease in man has w = 0.29. Its selection
coefficient, s is as follows:
s=1-w
s = 1 - 0.29
s = 0.71
Gametic selection occurs when there is differential fertility of each gametic

genotype. Both recessive and dominant genes are phenotypically expressed.
Table 1 presents the formula in calculating frequencies after selection and the
rate of change in gene frequency due to gametic selection.
Table 19-1. Effect of gametic selection
Frequency Total
A a
Initial Po qo
Fitness 1 1-s
After selection Po (1) qo (1 - s) Po + qo (1-s) = po + qo - sqo
= 1 - sqo
The amount of change due to gametic selection, Uq is determined as follows:
Uq = q1 - q o
where the frequency of gene a, q1, after one generation with selection against
gene a is equivalent to the product of the initial frequency of a, qo, and the
fitness value of a (1-s) computed relative to the total frequency of after selection,
symbolized as follows:
q (1 − s)
o
q1 =
1 − sq
q sq
o o
q1 = 1 − sq
o
q sq
o o
Uq = 1 − sq - qo
o
UP Open University
Module 19 257
q - sq - q (1 - sq )
o o o o
= 1 - sq
o
2
q - sq - q + sq
o o o o
=
1 - sq
o
- sq (1 - q )
o o
= 1 - sq
o
- sp q
o o
Uq = 1 - sq
o
Zygotic selection occurs when there is differential reproductive capacity of each

genotype. For example, there is zygotic selection against albino plants because
they don’t reach sexual maturity. Table 2 shows the effect of selection against
any of the three genotypes, AA, Aa, or aa, assuming complete selection against
recessive and where there is complete dominance.
Table 19-2. Effect of zygotic selection

(against the recessive and with complete dominance)
Frequency Total
AA Aa aa
Initial p2 2pq q2
Fitness 1 1 1-s
p 2pq q 2 (1 - s)
2
After selection p2 + 2pq + q2 (1-s)
2 2 2
1 - sq 1 - sq 1 - sq = p2 + 2pq + q2 - sq2
= 1 - sq2
To determine the gene frequency after one generation of selection against the
recessive, the following steps should be followed:
1. Let q1 = frequency of gene a after selection

qo = intial frequency of gene a
s = selection pressure or coefficient
1-s = fitness
UP Open University
2. qo = f(a) = f(aa)1 + 1/2 [f(Aa)1]
q 2 (1 - s) + 1/2 (2pq)
= 2
1 − sq
q 2 - sq 2 + pq q - sq 2
= 2
= 2
1 - sq 1 - sq
q (1 - sq)
=
2
1 - sq
q 2 (1 - s) + pq
q1 = 2
1 - sq
q 2 - sq 2 + pq
=
2
1 - sq
q - sq 2
= 2
1 - sq
q (1 - sq)
q1 =
2
1 - sq
3. The same procedure should be followed to get po.
The amount of change in gene frequency due to zygotic selection against

the recessive in a case where there is complete dominance is calculated as
follows:
Uq = q1 - qo
q - sq 2
Uq = - q(1 - sq)2
2
1 - sq
2 3
q - sq - q + sq
=
1 - sq 2
UP Open University
Module 19 259
2
- sq (1 - q)
= 2
1 - sq
- spq 2
Uq = 2
1 - sq
Selection is more rapid if alleles are co-dominant (Table 3). This is because
each genotype is phenotypically expressed.
Table 19-3. Comparison in the number of generations to change the frequency of a

recessive gene (q) under different selection coefficients (s = 1-w) if alleles are
(a)co-dominant(s) and (b) completely dominant
Frequency Change No. of generations

From (qo) To (qn) s=1 s = 0.5 s = 0.10 s = 0.001
(a) (b) (a) (b) (a) (b) (a) (b)
0.99 0.75 3 1 7 8 35 38 3496 3820

0.50 0.25 1 2 2 6 11 31 1099 3099
0.10 0.01 2 90 5 185 24 924 2398 92398
Non random mating includes the following:
a. Assortative (like by like);

b. Disassortative (like by unlike);
c. Inbreeding (between closely related individuals).
This leads to increased homozygosity and decreased heterozygosity which

results in what is referred to as inbreeding depression. The resulting increased
homozygosity brings out the deleterious genes previously hidden in
heterozygous conditions.
SAQ 19-3
In a randomly breeding population, the frequency of gene d is 0.2. If
the relative fitness of genotype DD = Dd = 1 and that of genotype dd =
0.3, what would be the frequencies of genes D and d after one generation
of selection?
UP Open University
4. Random genetic drift refers to changes in gene frequencies due to sampling

variation from generation to generation. This is normally due to sampling
errors in a small population. Its effect is largely dependent on the effective
population size which is the total number of mating individuals.
To illustrate the effect of this disperse process, consider 200 mating pairs in
a population of 1000. Its effective population size is therefore 400 instead
of 1000. According to Ramirez (1991), inequalities between contributions of
different parents to the next generation will also reduce the effective population
size.
Genetic drift is also the basis of the founder principle by Mayr (1952). This
is demonstrated in the diagram below:
Base Population 250AA 500Aa 250aa
Genetic Drift
Founders 5AA + 5AA
mating
New Population of all AA
Table 19-4. Effect of random genetic drift
po = frequency of gene A in the base population

p 1 = frequency of gene A in the new population
Up = change in frequency of gene A caused by random genetic drift
po = f(AA)o + 1/2 f(Aa)o
p1 = f(AA)1 + 1/2 f(Aa)1
Up = p1 - po
UP Open University
Module 19 261
For the given example above:
po = 0.25 + 1/2 (0.5) = 0.5

p1 = 1
Up = 1 - 0.5 = 0.5
SAQ 19-4
In a given population gene C has a frequency of 0.2. If 50 individuals,
all cc from the population, are isolated and allowed to interbreed, what
is the expected frequency of gene c after one generation of random
mating within the isolated population? What is the rate of change in
gene C?
Summary
Population is a group of sexually interbreeding individuals sharing a common
gene pool while genes exist in individuals, their fate depending on factors
affecting the whole populations. The two main attributes of population are the
gene pool and the gene frequencies. Gene pool refers to the sum of all the
genes in the reproductive gametes of a population. Gene frequency refers to
proportion of the different alleles of a particular gene in a population. Under
stable conditions when there is random mating in a large population, the gene
and genotype frequencies will remain constant every generation, a condition
called genetic equilibrium or Hardy-Weinberg equilibrium.
Changes in a population are ascribed to changes in gene frequencies brought

about by various forces: mutation; migration; and selection. In small
populations, however, where mating is not random, changes in gene frequency
are caused by genetic drift. With recurring change, the population may form a
new gene pool that will lead to the evolution of a species.
How did you find the assessment problems? Would you agree with me when
I say that it’s fun to find out for ourselves how to predict the proportion of
gene change depending on the forces in the environment? Give yourself 5 points
for every correct number. If you solved all four problems right, you scored 20
points. This is excellent. You have mastered the lesson and are ready for the
next unit. If you scored 10, give yourself more time to comprehend the lesson.
Go back to the sample problems within the text, solve them on your own, and
check. Practice makes perfect.
UP Open University
References
Ayala, F.J. and J.A. Kiger, Jr. (1980). Modern genetics. The Benjamin/Cummings
Series in the Life Sciences. p. 844.
Burns, G.W. (1972). The dcience of genetics: An introduction to heredity. New York:
MacMillan Pub. Co., Inc. p. 564.
Keeton, W.T. and C.H. Mc Fadden. (1967). Elements of biological science. New
York, London: W.W. Norton and Company. p. 445.
Laude, R.P., A.A. Barrion, G.P. Balaccua, M.S. Mendioro, and D.A. Ramirez.
(1992). Laboratory guide in genetics. UPLB-TLRC, M.M. pp. 105-110.
Ramirez, D.A. (1990). Genetics. 7th ed. UPLB-SEARCA. pp. 155-170.
Strickberger, M.W. (1976). Genetics. New York: MacMillan Pub. Co., Inc. London:
Collier MacMillan Pub. p. 914.
ASAQ 19-1
Given: u = 5 x 10-5
v = 1 x 10-5
Find: q =
5 x 10 - 5
= + (1 x 10-5)
-5
(5 x 10 )
5
Answer: q =
6
UP Open University
Module 19 263
ASAQ 19-2
Given: po = 0.8
pm = 0.2
m = 25/100
Find: Up = p1 - po
p1 = po - m(po - pm)
p1 = 0.8 - 0.25 (0.8 - 0.2)

= 0.8 - 0.15
p1 = 0.65
Up = 0.65 - 0.8
Answer: Up = 0.15
ASAQ 19-3
Given : qo = 0.2
To illustrate the fate of the various genotypes, construct the following table:
Particulars AA Aa aa
Initial frequency (0.8)2 = 0.64 2(0.2) (0.8) = 0.32 (0.2)2 = 0.4

Fitness 1 1 0
Frequency after selection 0.64 0.32 0
Total 0.96 0.96 0
1/2 (0.32)
q1 = = 0.17 Total = 0.64 + 0.32
0.96
= 0.96
0.64 + 1/2 (0.32)
p1 = = 0.83
0.96
UP Open University
ASAQ 19-4
Given: po = 0.2
Find: Up = p1 - po
Considering that all 50 individuals in the isolated group are all cc, i.e., no
dominant alleles were included:
q1 = 1
therefore :
p1 = 1 - 1 = 0
and;
Up = 0 - 0.2
Up = 0.2
There was a complete loss of the dominant allele C in the next generation after
a single random genetic drift of all homozygous recessive individuals, cc.
UP Open University
Module 20
Inheritance of Quantitative
Traits
Introduction
S ome common heritable traits in man are shown in Table 20-1. Examine the
distribution of these traits among members of your family. Start from your
parents, yourself, your brothers and sisters. Identify each family member’s
phenotype with respect to character. Table 20-1 shows the distribution of each
phenotypic class per character in a family case.
Table 20-1. Distribution of phenotypes per character in a family case
Children
Character Classes Father Mother C1 C2 C3 C4
earlobe free (F) vs. adherent (A) F A F F F F

dimples present (P) vs. absent (A) A P A A A A
tongue-rolling roller (R) vs. non-roller (N) R N R R R R
widow’s peak present (W) vs. straight W S W S W S
hairline (S)
height 60 inches to 70 inches 72 60 65 60 65 70
ave. 66 ave. 65
weight 25 kg. to 70 kg. 70 50 65 60 50 65
ave. 60 ave. 60
The classes and the distribution among members of the case family demonstrate
that characters 1 to 4 give clear cut and easily recognizable classes with
discontinuous variation. These are qualitative characters controlled by one or
two major genes which express pronounced phenotype, hence less influenced
by the environment. In contrast characters 5 and 6 give non-discrete classes
with smaller and less striking differences,

Objectives recognizable by measurable units. These are
quantitative characters controlled by the cumulative
After studying this module, or additive effects of many genes (polygenic) each
you should be able to: producing small effect and with their expression
highly influenced by the environment.
1. Differentiate quantitative
from qualitative traits;
2. Explain the inheritance of Definition of Terms
quantitative traits; and
3. Predict the expected geno- Polygene - genes producing small effects on a
type of parents of a cross measured character
given the phenotype segre-
gation ratio of the progeny. Quantitative characters - a trait that varies more or
less continuously among individuals in a
population (Quantitative characters are therefore
classified according to measured values of the trait.)
Concept Map
Traits
Qualitative Quantitative
Classes: discrete non-discrete
Mode of
Classification: perception measurable
Phenotype
variation: discontinuous continuous
Prerequisite
You should have completed the unit on the physical basis of heredity.
UP Open University
Module 20 267
Inheritance of Quantitative Traits

Multiple genes/Polygenes
Table 20-1 shows the phenotype distribution for height and weight in the
case family. Notice that the phenotypes of the F1 are on the average
intermediate to the parents. Greater variation is expected in the next
generation (F2). It would be a variation from one extreme to the other.
The continuous quantitative variation might be due to multiple genes or

polygenes (Yule, 1906). A polygene consists of genes producing small effects
on the measured character. The following are the basic assumptions for
this multiple gene/polygene hypothesis:
1. Each gene does not have individually recognizable phenotypic effect;

2. The genes are independently segregating;
3. These genes have cumulative effect;
4. The genes do not show dominance;
5. The F1 appears intermediate of the parents;
6. The expression of the genes are highly influenced by the environment;
and
7. Classification of the phenotypes is done through measurement of a
recognizable unit.
To illustrate, assume 4 genes for height in a plant species — T1, T2, T3, and T4
each contributing 1.5 inches to the residual height of 60 inches. The gene
segregation pattern and expected genotypes and phenotypes are as follows:
P1 T1T1T2T2T3T3T4T4 P2 t1t1 t2 t2 t3 t3 t4 t4
72 inches 60 inches
ave. of P1 and P2 : 66 inches
F1 T1 t1T2t2T3t3T4t4 x T1 t1T2t2T3t3T4t4
66 inches 66 inches
F2: no. of contributing

alleles 8 7 6 5 4 3 2 1 0
Phenotype 72 70.5 69 67.5 66 64.5 63 61.5 60
Frequency 1 8 28 56 70 56 28 8 1
UP Open University
70
60
50
Frequency
40
30
20
10
0
60 61.5 63 64.5 66 67.5 69 70.5 72
Phenotype
Figure 20-1. Frequency distribution for height controlled by 4 gene pairs
Note that the average parental height is the same as F1 and F2 indicating the
maintenance of the gene pool for the character, height. At F2 , however, the
variability is high. The distribution of F2 resembles a bell-shaped curve fitting a
normal curve in which there is a high proportion of individuals with
intermediate phenotype value. While some differences between parents and
among F1 are due to environment alone, differences among F2 are due to
genotype and environment effect.
Did you figure out how we determine the phenotype for each given genotype?
Let me show you the calculations for the P1 phenotype.
Given: P1 genotype T1T1T2T2T3T3T4T4

residual height = 60 in.
contribution per contributing allele = 1.5
no. of contributing alleles = 8
phenotype = residual height + no. of contributing alleles

(contribution per contributing allele)
For P1 phenotype = 60 + 8 (1.5)

= 60 + 12
= 72 inches
UP Open University
Module 20 269
Try the same calculations for P2 and F1 phenotype. When you have perfected
this, proceed in determining the frequency of each F2 phenotype. This will
allow you to visualize the distribution of the population as shown in Figure
20-1.
Here’s how you calculate the frequency of each F2 phenotype relative to the
total minimum population which is equal to the sum of the frequency of all
possible combinations (Σ = 256). Let me demonstrate this through three
methods: 1) expansion of the binomial equation; 2) Paschal triangle; and 3)
combination formula.
1. Expansion of the binomial equation
The formula to use is (a + b)n

where: a + b are the 2 different alleles, T and t, respectively
n is the total number of alleles
In our example, plant height is controlled by 4 genes, therefore there are 8

alleles. The formula becomes (a + b)8.
How will you expand the binomial equation. This is how to do it.
a. Write first the exponent of a, the exponent must be decreasing.
a8 + a7 + a6 + a5 + a4 + a3 + a2 + a1
b. Write the exponent of b, it must be increasing.
a8 + a7b1 + a6b2 + a5b3 + a4b4 + a3b5 + a2b6 + a1b7 + b8
How will you find the coefficient of each term?
c. For a8, the coefficient is 1.
How about the coefficient of the second term, a7b1?
Take a look at the terms below.
1 a8 + ___a7b1
The coefficient of the second term is obtained by multiplying the

exponent of a and coefficient of the first term (8 x 1 = 8). Then divide 8
by the exponent b which is 1 (8 ÷ 1 = 8). Therefore the coefficient is 8.
1 a8 + 8 a7b1
UP Open University
How about the coefficient of the third term a6b2?
1 a8 + 8 a7b1 + ____a6b2
Take a look at the second term, this time multiply the exponent of a with
the coefficient of the second term (7 x 8 = 56), then divide 56 with the
exponent of b (56 ÷ 2 = 28).
1 a8 + 8 a7b1 + 28 a6b2
How about the coefficient of a5b3?
1 a8 + 8 a7b1 + 28 a6b2 + ____a5b3
6 x 28 = 168 168 ÷ 3 = 56
1 a8 + 8 a7b1 + 28 a6b2 + 56 a5b3
1 a8 + 8 a7b1 + 28 a6b2 + 56 a5b3 + ____a4b4
5 x 56 = 280 280 ÷ 4 = 70
1 a8 + 8 a7b1 + 28 a6b2 + 56 a5b3 + 70 a4b4
1 a8 + 8 a7b1 + 28 a6b2 + 56 a5b3 + 70 a4b4 + ____a3b5
4 x 70 = 280 280 ÷ 5 = 56
1 a8 + 8 a7b1 + 28 a6b2 + 56 a5b3 + 70 a4b4 + 56 a3b5
Can you finish finding the coefficient of the last three terms?
The final equation will now be:
a8 + 8 a7b + 28 a6b2 + 56 a5b3 + 70 a4b4 + 56 a3b5 + 28 a2b6 + 8 a1b7 + 1 b8
Each phenotype corresponds to a combination.
UP Open University
Module 20 271
Example: The combination a8 corresponds to an individual with 8 dominant

alleles (T1T1T2T2T3T3T4T4). How about b8? This corresponds to individuals
with 8 recessive alleles (t1t 1t 2t2 t3t 3t4 t4). Can you figure out a 6b 2? This
corresponds to individuals with 6 dominant alleles and 2 recessive alleles.
Did you get it? Very good!
This time try to figure out the phenotypes. What is the phenotype of a6b2?
Do you know how to get it? It is really simple! Consider this computation.
Given: residual height = 60

No. of dominant alleles = 6
contribution of each dominant allele = 1.5
60 + 6 (1.5) = 69
a6b2 gives a height of 69 inches. You may try this for a4b4. How about getting
the frequency if the F2 is as tall as 69 inches? This is derived by dividing the
number of times a6b2 combination occurs by the total number of possible
combinations. This will be 28/256.
2. Paschal triangle
This method is relatively easy to use compared to the binomial equation.

This is how to do it.
You first write three 1 in this manner.
No. of alleles
1 0
1 1 1
Then you write 1 on left side, add 1 + 1, write 2 in the center of 1 and 1 and
write 1 on the right side.
No. of alleles
1 0
1 1 1
1 2 1 2
You again write 1 on the left side, add 1 + 2, write the answer 3 in the
middle of 1 and 2 and 2 and 1, then write 1 on the right side.
No. of alleles
1 0
1 1 1
1 2 1 2
1 3 3 1 3
UP Open University
You again write 1 on the left side, add 1 + 3, write the answer 4 in the
middle of 1 and 3, add 3 + 3, write 6 in the middle of 3 and 3, add 3 + 1, and
write 4 in the middle of 3 and 1.
No. of alleles
1 0
1 1 1
1 2 1 2
1 3 3 1 3
1 4 6 4 1 4
Do the same procedure until you reach level 8. This corresponds to 8 alleles.
This is now the complete distribution if you use Paschal triangle.
No. of alleles
1 0
1 1 1
1 2 1 2
1 3 3 1 3
1 4 6 4 1 4
1 5 10 10 5 1 5
1 6 15 20 15 6 1 6
1 7 21 35 35 21 7 1 7
1 8 28 56 70 56 28 8 1 8
Therefore, the base of the Paschal triangle corresponding to 8 alleles, is the

distribution for the given sample.
3. Combination formula
nCx = n!
x ! (n - x) !
where n = total no. of alleles

x = total no. of contributing alleles
C = combination
! = factorial which implies that you have to get the product
of the given number with all succeeding numbers
UP Open University
Module 20 273
To illustrate, determine the proportion of the F2 phenotype as tall as the F1.

Such phenotype has 4 contributing alleles and 4 non-contributing alleles.
Therefore:
n = 8
x = 4
n!
8C4 =
x ! (n − x) !
8•7 6•5
=
4• 3• 2 •1
1680
=
24
= 70
Answer: Frequency of F2 phenotype as tall as F1 = 70/256.
Number of genes in a polygene system

In predicting the parental genotypes of a given frequency distribution of the
F2s, we need to know the number of genes controlling the trait. Recall from
Mendelian principles that as the number of gene pairs increases, the relative
proportion of individuals exactly like the parents decreases. Therefore, the
number of segregating gene pairs n is derived from the formula (1/4)n for the
frequency of the homozygous parental extreme. This is summarized as follows:
No. of segregating genes, n Relative frequency of one

parental extreme (1/4)n
1 1/4
2 1/16
3 1/64
4 1/256
5 1/1024
6 1/4096
7 1/16,384
8 1/65,536
9 1/262,144
10 1/1,048,576
n (1/4)n
UP Open University
To illustrate, let us refer back to the sample character, height in man. Consider
that in a community of 250 F2 s for marriages between tall and short parents,
only one is as short as the short parent. What is the genotype of each parent?
To determine the genotype, take the following steps:
1. Determine the number of genes involved.
1 1
(1/4)n = =
250 44
therefore, n ~ 4
2. Give the possible genotype.
P1 : T1T1T2T2T3T3T4T4 x P2 t1t1t2t2t3t3t4t4
tall short
SAQ 20-1A
In sorghum, many widely diverse types of plants exist. In the milotypes
sorghum, 4 recessive genes for short stature have been identified. They
have been designated dw1, dw2, dw3, and dw4. The effect of these
dwarfing genes is to shorten the internode length. A plant homozygous
recessive for these 4 pairs of dwarf genes is 16 in. tall. A plant
homozygous dominant for these 4 pairs of genes is 96 in. tall. Assume
these alleles contribute quantitatively, cumulatively, and equally for
this height difference.
A plant of genotype Dw1 Dw1 Dw2 Dw2 Dw3 Dw3 dw4 dw4 was crossed
with one of genotype dw1 dw1 dw2 dw2 dw3 dw3 Dw4 Dw4. F1 and F2
generations were observed.
a. What are the heights of the parents?

b. What would be the heights of the F1 plants?
c. Show the range of heights expected in the F2 progeny and indicate
the expected number of plants of each height.
d. What would be the expected mean height in the F1 progeny?
For items a, b, and d, give yourself 1 point for each correct answer. In the case
of SAQ-1A item c, give 1 point for each correct phenotype and corresponding
frequency. The perfect score is 21.
UP Open University
Module 20 275
SAQ 20-1B
It is assumed that in hamsters, size is determined by genes having an
equal and additive effect. From a total of 4025 F2 progeny resulting
from cross between large and small strains, 17 were as large as the
average of large parent variety and 16 were as small as the average of
the small parent variety.
a. How many pairs of genes are involved?

b. Give the possible genotypes of the parents.
Give yourself 2 points for a correct answer in item a and 2 points for a correct
genotype in item b. Here, the perfect score is 6.
If you scored 27/27, congratulations. You have just done an excellent work.
You can now proceed to lesson B of this unit. Be sure to keep up the good
work.
If you scored 16/27, do not be disappointed; try solving the sample problem.
Again, practice makes perfect. Reading the lesson once is not enough. The
problems involve mathematical operations and it is best to solve it yourself.
Summary
In contrast to qualitative traits, which show discrete classes and discontinuous
variation, quantitative traits show non-discrete classes with continuous
gradation from one extreme to the other. Quantitative characters are controlled
by a multiple gene system with cumulative action. Statistical methods are
therefore useful in dealing with any quantitative data. These include measures
of averages and variations.
UP Open University
References
Falconer, D.S. (1960). Introduction to quantitative genetics. Ronald Press Co. N.

Y. :365 pp.
Ramirez. (1992). Laboratory guide in genetics. 8th ed. Ex. VIII. Quantitative
Inheritance. TLRC, Manila pp. 107-114.
Ramirez, D.A. (1991). Genetics. 7th ed. SEAMEO-SEARCA-UPLB. Lecture 10.
Qualitative Genetics. pp. 141-154.
Weaver, R.F. and P.W. Hedrick. (1992). Genetics. 2nd ed. Dubuque. Wm. C.
Brown Pub. p. 649.

ASAQ 20-1A
a. To calculate the height of the parents, follow the steps below:
i. Take the residual height which is 16 in.
ii. Determine the contribution of each contributing allele by getting the

difference of the extreme phenotypes and by dividing this by the total
number of alleles as follows:
80
96 in. - 16 in. = = 10 in.
8
iii. Calculate the contribution of all contributing alleles by multiplying the

number of contributing alleles by (ii).
iv. Determine the expected phenotype by adding (i) to (ii).
For the genotype Dw1 Dw1 Dw2 Dw2 Dw3 Dw3 dw4 dw4
16 + 6(10) = 76 in.
For the genotype dw1 dw1 dw2 dw2 dw3 dw3 Dw4 Dw4
16 + 2(10) = 36 in.
UP Open University
Module 20 277
b. To calculate the height of the F1 :
i. Determine the genotype from its parents as follows:
Parents: Dw1 Dw1 Dw2 Dw2 Dw3 Dw3 dw4 dw4 X dw1 dw1 dw2 dw2 dw3
dw3 Dw4 Dw4
Gametes: Dw1Dw2Dw3dw4 dw1 dw2 dw3 Dw4
F1: Dw1 dw1 Dw2 dw2 Dw3 dw3 Dw4 dw4
ii. Calculate the expected phenotype as in 1a (iv).
16 + 4(10) = 56 in.
c. Considering independent segregation of all gene pairs, the range of

combinations of contributing and non-contributing alleles is as follows:
No. of contributing alleles: 8 7 6 5 4 3 2 1 0

Phenotype 96 86 76 66 56 46 36 26 16
Frequency 1 8 28 56 70 56 28 8 1
(a + b)8 = a8 + 8 a7b + 28 a6b2 + 56 a5b3 + 70 a4b4 + 56 a3b5 + 28 a2b6 +8 a1b7 + b8
d. Mean height of the F2 = Σn Xi

i=1
n
= 96(1) + 86(8) + 76(28) + 66(56) + 56(70) +46 (56) + 36(28) + 28(8) + 16(1)
256
= 56 inches
UP Open University
ASAQ 20-1B
a. The number of gene pairs involved (n) is estimated from the following
equation for the frequency of the extreme phenotype, i.e., 1

4n
17
Given: Frequency of the small strain =
4025
16
or Frequency of the large strain =
4025
Using any one of the above frequencies:
1 1 1
= =
4n 251 44
Therefore, n = 4 gene pairs
b. The possible genotypes of the parents are as follows:

Considering the gene T for height, the genotype of the large parent is:
T1T1T2T2T3T3T4T4
and likewise, the genotype of the small parent is:
t1 t1 t2 t2 t3 t3 t4 t4
UP Open University
Module 21
Analysis of Quantitative
Characters
Introduction
Objectives
O bservations on quantitative characters
are done through measurement of a
recognizable unit. Height is measured in
inches, in feet, or in centimeters. On the other
hand, weight is measured in kilograms or in 1. Apply simple statistical tests
pounds. These observations constitute a set for analysis of data for quan-
of quantitative data which is best analyzed titative traits;
using statistical methods. 2. Describe the components of
phenotype variance; and
A population is best described by a measure 3. Calculate heritability in the
of average or population mean u and by a broad and narrow sense.
measure of the deviation of its true mean, the
population variance δ2. Populations, however,
are indefinitely large that measurement of all individuals is impractical. It is
best to constitute a sample set of observations and derived estimates of
population parameters, u and δ 2 . Values commonly estimated are the measures
of averages and variation. The mean (x), mode (x), and median (x) are measures
of averages; the variance (s2), standard deviation (s), standard error (S.E.), and
coefficient of variation (C.V.) are measures of variation.
Definition of Terms
Coefficient of variation - is a measure to compare the variability of different
samples or experiments
Heritability - a measure of resemblance between relatives (In the broad sense,

it is the ratio of the genotypic variance to the total phenotypic variance;
in the narrow sense, it is the ratio of additive variance to the total
phenotypic variance.)
Mean - is the central value of a set of sample observations
Median - is the midpoint in an array of observations
Mode - is the ith observation in an array with the highest frequency
Standard error of the mean - indicates how much the means of other samples
of the same size drawn from the same population may be expected to
vary
Standard deviation - square root of the variance
Variance - a measure of the dispersion of observations around the mean
Concept Map
Qualitative Traits
Phenotype Variance
Genotype (VG) Environment (VP) Genotype x Environment

(VG x E)
Epistasis Dominance Additive gene effect

VI VD VA
Heritability (h2)
Broad sense Narrow sense

(VG /VP) (VA / VP)
UP Open University
Module 21 283
SAQ 21-1
The ear lengths of four inbred varieties of corn to be used for hybrid
seed production were measured. The following data were obtained:
Variety Mean Length (cm) Variance (cm2)
1 12.5 6.25
2 14.0 4.41
3 20.3 10.25
4 21.0 38.55
a. What is the C.V. of each variety? How do these strains compare in

genetic uniformity?
b. Estimate in centimeters the means and variances for height of five

of the sample plants:
X1 = 28 X4 = 32
X2 = 30 X5 = 33
X3 = 27
Components of Phenotype Variance

Like any other trait, the phenotype value (P) of any quantitative trait is
influenced by both the geneotype (G) and the environment (E) as:
P = G + E + GE
Likewise, the genotype value is based on the combined contributions of the

additive effect of genes (A), the allelic interaction at each locus or dominance
(D), and the non-allelic interactions or epistasis (I) as:
G=A+D+I
Therefore the phenotype value can be symbolized as:
P=A+D+I+E
UP Open University
The components of any phenotype variance (VP) are thus expressed in the
equation:
VP = VG + VE
or else
VP = VA + VD + VI + VE
where : VP = phenotype variance

VG = genotype variance
VE = environmental variance
VA = genotype variance due to additive effect
VD = genotype variance due to dominance effect
VI = genotype variance due to epistatic effect
Assuming that the genotype and environment interaction is negligible.
The various components of phenotype variance can be estimated by measuring

the variance of “pure” line parentals, its first filial generations as well as
backcross hybrids (Table 21-1).
Table 21-1. Variance components for measurement in different generations

(Laude, et al., 1992)
VP1 = E
VP2 = E
VF1 = E
VF2 = 1/2 A + 1/4 D + E
VB1 = 1/4 A + 1/4 D + E
VB2 = 1/4 A + 1/4 D + E
VB1 + VB2 = 1/2 A + 1/2 D + 2E
UP Open University
Module 21 285
SAQ 21-2
Given the following set of data on mungbean pod length for P1, P2, F1,
F2, and BCP2, calculate the X and s2 of each population.
P1 P2
5.2 7.6 13.5 11.8
6.5 7.7 12.4 11.8
6.4 6.4 10.4 9.4
6.1 5.9 10.3 9.3
6.5 5.8 11.4 10.8
6.7 6.4 11.4 11.6
6.3 6.0 11.1 10.6
6.8 7.1 10.1 11.2
5.8 7.4 12.4 13.9
F1
10.7 8.25 10.8 8.7 8.1
7.6 9.5 6.9 9.0 11.1
9.4 6.8 10.2 8.4 11.6
6.2 11.4 7.9 8.8 8.8
8.5 8.5 9.4 9.9 8.9
6.1 11.3 8.1 8.2 8.6
10.3 8.3 7.8 10.0 9.6
7.5 8.4 7.6 9.8
10.2 7.9 9.0 8.1
7.6 10.8 7.3 9.7
10.2 8.6 8.0 9.0
9.0 10.6 6.2 9.6
9.5 7.8 7.9 10.5
7.9 11.8 7.8 10.1
10.0 7.4 7.6 9.9
8.0 11.3 9.2 8.9
9.5 9.7 7.8 9.1
7.2 11.2 7.2 8.8
9.5 8.9 8.9 7.7
UP Open University
SAQ 21-2 continued
F2
10.7 9.7 6.9 8.1
7.3 10.2 12.2 10.0
13.4 8.2 10.7 11.1
12.6 11.0 9.6 9.2
10.5 7.8 9.5 9.4
6.5 8.5 12.1 8.0
10.9 8.8 9.3 7.9
8.8 8.0 10.0 10.4
9.5 7.1 9.0 8.6
11.4 10.9 10.4 9.8
8.3 9.8 10.1 9.4
7.6 7.4 7.8 8.6
6.9 10.6 9.9 14.6
10.5 9.0 8.4 9.7
7.7 10.6 6.7 8.7
7.4 9.8 8.5 8.2
10.3 7.4 9.0 9.3
7.6 16.6 13.0 9.2
9.6 14.6 8.5 8.0
6.9 11.1 9.8 11.4
12.0 8.3 7.6 9.5
10.0 10.1 9.9 10.7
9.9 7.3 7.2 10.3
9.9 10.2 9.1 7.5
8.6
BCP2
10.6 9.6 8.1 8.0
11.9 9.8 9.2 8.2
7.8 11.9 9.8 7.6
9.6 11.0 8.1 12.4
8.1 9.2 9.8 9.2
8.8 8.8 7.4 7.4
12.1 8.6 7.9 12.5
11.7 7.5 8.3 10.6
8.6 7.5 8.2 8.8
UP Open University
The degree of resemblance between parents and offsprings is primarily based

on the genetic variance. Therefore, the lower the environmental variance the
higher the predictability. Consider the components of phenotype variance, VP
= VG + VE + VGE. Assuming G x E is negligible, if VG = 0, then VP = VE. The
genetic variance, VG has a value of zero (0) in inbred lines, clones, identical
twins, and repeated measurements on the same individual at one given time.
V O
G
In such cases, h2 = = =0.
V V
P P
On the other hand, if VE = 0, then VP = VG. The environmental variance, VE = 0,

if all external environmental factors such as food, temperature, moisture, and
internal factors (such as age, sex, substrate) are carefully controlled. In such
V
G
cases, heritability h2 = =1.
V
P
These estimates are referred to as heritability in the broad sense. It ranges from
0-1. To exemplify, consider ABO blood group in man which has h2 = 1. One’s
blood type does not change through one’s life time, hence it is used for
identification. On the other hand, taillessness in dogs due to accidental cutting
of the tail has h2 = 0. This is because the trait was not inherited from the parents
but acquired by accident, hence purely environmental. The relationship,
therefore, is that the higher the variability due to genotype, the higher the
heritability value. Heritability estimates near the value 1.0 suggests greater
resemblance between parents and offspring. Table 21-2. gives us an estimate
of heritability in the broad sense of some human traits. Note some interesting
data for teachers. Verbal aptitude is more heritable than aptitude for
mathematics. This implies that a student’s performance in mathematics can be
developed through motivation. Isn’t it a great responsibility for math teachers?
UP Open University
Module 21 289
Table 21-2. Estimates of heritability in the broad sense of some human traits
(adopted from Ramirez, 1991)
Human Trait Per cent Heritability
Height 80
Weight 78
Cephalic Index 75
IQ 80
Aptitude for:
a. Mathematics 12
b. Science 34
c. History and Literature 45
d. Spelling 53
Verbal Aptitude 68
Foot Tapping Speed 50
Social Potency
(leadership/dominating tendency) 61
Social closeness
(need for closeness/comfort/help) 33
Traditionalism (respect for authority,
rules, standard, and high morals) 60
Vulnerability to stress 50+
Dedication to hardwork/achievement 50+
Capacity for imaginative experiences 50+
The different sources of genotype variance, VG = V A + V D + V I, vary in

predictability. VD and VI are less predictable because the phenotype is a result
of the genetic combination which cannot be predicted. VA, however, which
indicates the additive gene effect, is highly predictable considering that gene
pairs are segregating independently. Based on these relationships, heritability
h2 can be estimated as the ratio of the additive variance and the total phenotype
variance, expressed as follows:
V
A
h =
2
V
P
This expression is referred to as heritability in the narrow sense.
UP Open University
Heritability in the narrow sense predicts how much of the parent’s phenotype
is passed on to the progeny. As compared to h2 in the broad sense, h2 in the
narrow sense is more predictable and therefore more useful to plant and animal
breeders. Table 21-3. shows the estimates of heritability values in the narrow
sense of various characters in different species. One character, like egg
production, varies in heritability values among different species, i.e., 21% in
chicken and 18% in Drosophila melanogaster. It is therefore important to keep in
mind that the estimates apply only to a particular population at a particular
time.
Table 21-3. Estimates of narrow sense heritability

of various characters in different species
Character Per cent Heritability
Cattle
Birth weight 49
Gestation length 35
Calving interval 4
Milk yield 43
Conception rate 3
White spotting 95
Chicken
Body weight (8 weeks) 31
Shank length 50
Egg production 21
Egg weight 60
Hatchability 16
Drosophila melanogaster
Abdominal bristle number 52
Thorax length 47
Wing length 45
Egg production 18
Corn (Zea mays L.)

Plant height 70
Yield 25
Ear length 17
UP Open University
Module 21 291
SAQ 21-3
1. Using the components of phenotype variance in SAQ 21-3A,
compute for the following:
a. heritability in the broad sense; and
b. heritability in the narrow sense.
2. Is the trait highly heritable?

3. Why is heritability in the narrow sense more useful to plant and
animal breeders than h2 in the narrow sense?
For each number answered correctly, give yourself a score of five points. The
perfect score is 20. If you got a perfect score, congratulations. You have mastered
estimating heritability values. Do you agree that it was fun? Remember aptitude
for math is very low, hence due to the environment. Proper aptitude and
diligence in doing the mathematical operations count most for math aptitude.
If you scored 10 or less, please study the module again before you solve the
problem. Happy computing!
To calculate the height of the parents, follow the steps below:
i. Take the residual height which is 16 in.
ii. Determine the contribution of each contributing allele by getting the

difference of the extreme phenotypes and by dividing this by the total
number of alleles as follows:
80
96 in. - 16 in. = = 10 in.
8
iii. Calculate the contributions of all contributing alleles by multiplying the

number of contributing alleles by (ii).
iv. Determine the expected phenotype by adding (i) to (ii).
UP Open University
Summary
The phenotype variation is caused by genetic differences (VG), the environmental
differences (VE), and by the genotype and environment interaction (VGE) as
expressed in the following equation:
VP = VG + VE + VGE
The genotype variance is due to several types of gene action, such as the additive
effects of genes (VA), the dominant effect of genes (VD), and the epistatic effect
between genes (VI) expressed as follows:
VG = VA + VD + VI
When “pure” lines are used, these components of variance can be estimated by
measuring the variance in the parental and filial generations.
All these computations can be used in predicting the chances by which the
offsprings will be much more like the selected parents. This is referred to as
heritability, h2, estimated as follows:
V
G
h2 in the broad sense =
V
P
V
A
h2 in the narrow sense =
V
P
In view of the predictability of additive gene effect, h2 in the narrow sense is

therefore more useful to plant and animal breeders that h2 in the broad sense.
UP Open University
Module 22
Evolutionary Genetics
Introduction
L ook at the various species in your environment. They evidently exhibit the
fundamental facts of life: diversity and adaptations. Biological species are
immensely diversified in the structures and functions of their bodies, in the
places that they inhabit, and in the ways they secure their living from the
environment. Yet all of them share the quality of adaptedness. The tenable
explanation to these observations is the theory of evolution. Charles Darwin
and his contemporary Alfred Russel Wallace, presented the theory of evolution
by natural selection as follows:
reproductive ability
of populations to increase
in number of individuals
struggle for
existence
+
natural selection
limited environmental + (survival of
opportunities varieties with
most adaptive
hereditary values)
variations
+
evolution
change in
environment
Do you know what organic

Objectives evolution is?
Organisms now living are the descendants of quite
different ancestral forms. The farther back in the past
you look the more different the ancestors are from their
1. Define organic evolution;
descendants. The changes that occurred served to
2. Explain the Hardy-Weinberg
maintain or to enhance the adaptedness of biological
Law;
species to their environment. Organic diversity arose
3. Explain how the genetic
and increased in evolution as a response of living
mechanisms bring about
matter to the challenges of different environments.
variations in populations of
organisms; and
Evolution is not, however, a matter of the past alone.
4. Discuss the importance of
It is a continuing process. Biological species not only
genetics to evolution of life
have evolved but they are also still evolving. They
on earth.
usually evolve by the gradual accumulation of
differences in morphology, ecology, physiology, or
behavior until reproductive isolation occurred. The
crucial stage of this isolation must be when the genomes of two incipient species
have become sufficiently different for chromosomal pairing and regular
disjunction to be impossible at meiosis. Evolution, therefore, refers to the
change(s) in the genetic constitution of a population of organisms or gene pool
through either sudden or gradual processes. Genetic principles are needed in
understanding evolutionary phenomena.
1. Who is Charles Darwin?
2. What is genetics?
I am sure you got the correct answers? These bits of information are good for
starters so you will be more interested in the rest of the discussion on
Evolutionary Genetics.
SAQ 22-1
How will the theory of evolution explain diversification and adaptation?
UP Open University
Module 22 299
Definition of Terms
Adaptation - a functional or structural characteristic of an organism that allows
it to cope better with its environment
Directional selection - a type of selection in which one of the extremes in the

phenotypic range becomes most fit and thus preserved
Disruptive selection - a type of selection where both extremes of the phenotypic

range are selected, thus preserving differences in the gene pool of a
population
Evolutionary genetics - complex science which deals with the different genetic
mechanisms and factors in organic evolution
Gene pool - sum total of genes in the reproductive gametes of a population
Genetic equilibrium - no change in genotypic ratios and allelic frequencies of

a population
Genetic drift - a non-directional force that changes gene frequency in an

unpredictable rate from generation to generation; variation in gene
frequency is due to chance fluctuation
Hardy-Weinberg Law - law of genetic equilibrium which states that in a large,

randomly mating population with closed gene pool (no mutation,
selection, drift, or migration) the gene frequencies of a population remain
constant from generation to generation
Incipient species - beginning to come into being
Mutation - a sudden change in genotype having no relation to the individual’s

ancestry; refers to changes in a single gene itself (= point mutations)
and to chromosomal aberrations
Natural selection - differential reproduction of alternative genotypes owing to

variable fitness
Organic evolution - sudden or gradual change in the genetic constitution of a

population of organisms (= gene pool) through mechanisms such as
mutations, recombination, genetic drift, selection, migration, as well as
through environmental factors resulting in diversification and
adaptation
Recombination - the creation of a new association of genes or chromosomes or

parts of a gene or a chromosome
UP Open University
Stabilizing selection - a type of selection where the phenotypic extremes tend

to be eliminated
Concept Map
Genetic Equilibrium vs. Evolution
(Hardy-Weinberg Law)
Genetic Mechanism
large population
random reproduction
no genetic drift
Genetic Mutation Recombination Selection
Drift
no mutation
no migratory
Molecular Evolution
Evolution of Genetic System
Genetic Equilibrium = Hardy Weinberg Law

Evolutionary change is not automatic. It occurs only when something disturbs
the genetic equilibrium. This was first recognized in 1908 by G.H. Hardy of
Cambridge University and W. Weinberg, a German physician working
independently. According to the Hardy-Weinberg Law of genetic Equilibrium,
in a large randomly mating population with a closed gene pool (no mutation, selection,
drift, or migration) the gene frequencies remain constant from generation to generation
in sexually reproducing populations. The law, therefore, sets certain conditions of
stability whereby the genotypic ratios and allelic frequencies remain constant.
SAQ 22-2
What do you mean by genetic equilibrium and how is it related to
organic evolution?
The Hardy-Weinberg Law is the foundation knowledge to evolutionary biology

since the exact opposite of the “conditions of stability” are the conditions for
the occurrence of evolution.
UP Open University
Module 22 301
Let us examine the “conditions of stability” that the Hardy-Weinberg Law says
must be met if the gene pool of a population is to be of genetic equilibrium.
A. The population must be large enough to make it highly unlikely that chance
alone could significantly alter allelic frequencies.
How large should the population be?
A population consisting of 10,000 breeding aged individuals can probably

maintain its genetic equilibrium. However, a small isolated population of,
say, less than 100 breeding age members is highly susceptible to random
fluctuations, which can easily lead to the loss of allele from the gene pool
even when the allele is adaptively superior. In such populations, in fact,
there are relatively few alleles with intermediate frequencies, apparently
the tendency is for most alleles either to be soon lost or to become fixed as
the only allele present. Thus chance may cause evolutionary change, called
genetic drift, in small populations.
B. Mutations must not occur, or else there must be mutational equilibrium.
The second condition for genetic equilibrium — either no mutation or

mutational equilibrium- - is never met in any population. Mutations are
always occurring. As for mutational equilibrium, very rarely, if ever, are
the mutations of alleles for the same character in exact equilibrium; i.e., the
number of forward mutations per unit time is rarely exactly the same as
the number of back mutations. The result of this difference is a mutational
pressure tending to cause a slow shift in the allelic frequencies in the
populations. The more stable allele will tend to increase in frequency, and
the more mutable allele will tend to decrease in frequency.
C. There must be no immigration or emigration of members of the pool.
For genetic equilibrium, a gene pool cannot accept immigrants from other
populations, for these might introduce new alleles; and it cannot suffer
loss of alleles by emigration. A high percentage of natural populations,
however, probably experience at least a small amount of gene migration,
generally called gene flow. This factor, which enhances variation, tends to
upset genetic equilibrium.
D. Reproduction must be totally random.
Reproduction refers not only to the mating process but also to the vast
number of factors that contribute to the reproductive continuity of the
population selection of a mate: physical efficiency and frequency of the
mating process; fertility; total number of zygotes produced at each mating;
percentage of zygotes that lead to successful embryonic development and
UP Open University
birth; survival of the young until they are of reproductive age; fertility of
the young; and even, in some cases, survival of post reproductive adults
when their survival affects either the chances of survival of the young or
their reproductive efficiency. If reproduction is to be totally random, all
these factors must be random, i.e., they must be independent of genotype.
This condition is probably never met in any real population. The factors of
reproduction are always correlated with genotype; therefore nonrandom
reproduction or natural selection is the universal rule. Natural selection is
operative in all populations; there is always selection pressure acting to
disturb the Hardy-Weinberg equilibrium.
SAQ 22-3
True or False
1. Hardy-Weinberg Law describes a situation that never occurs in

nature.
2. Natural selection means random reproduction.
Evolutionary Genetic Mechanisms

Do you notice that offsprings resemble their parents?
The process of heredity makes offsprings resemble their parents. Genetic

stability and change are two sides of the same coin. They are both necessary
for the perpetuation and evolution of life. The genetic endowment, or genotype,
of an individual may be compared to a set of instructions or a store of
information that, interacting with the environments in which the organism
lives, governs the organism’s development.
Are you aware of the saying that “no two living things are exactly alike”?
In the evolution of biological species, the differentiation of the genome takes

place by the sudden or gradual reorganization of the genetic material through
different mechanisms and factors in the environment. The complex science,
which deals with the different genetic mechanisms in organic evolution, is
Evolutionary Genetics. It combines a sophisticated theoretical framework with
both strong laboratory components and detailed field observations.
What mechanisms bring about genetic variations?
How do they cause the evolution of living forms?
UP Open University
Module 22 303
Going back to Hardy-Weinberg Law, the mechanisms which provide opposite

effect to the so-called conditions of stability are actually the mechanisms which
bring about genetic variations and alter the genotypic ratios and allelic
frequencies of the populations from generation to generation. These genetic
mechanisms are genetic drift, mutations, recombination migrations, and selection.
Random Changes in Gene Frequency

Genetic drift
What is genetic drift? How does it cause revolutionary change?
When a small random sample of breeding adults is taken from a large group of
individuals, such sample is not expected to have exactly the same composition
as the group. The smaller the sample, the farther it will be from the true natural
population. It will deviate severely from the gene frequency in the previous
generation. The gene frequencies in the offspring will consequently differ from
their parental population. Slight accidents of sampling will result in a small
change in gene frequency each generation until eventually one allele is lost.
This process is called “random genetic drift” since the gene frequencies drift up
and down following chance differences in survival or breeding of the individuals
involved. When the number of breeding individuals is small, the fluctuations
are relatively large, and the population reaches fixation more rapidly. It then
remains in this fixed condition until mutation or immigration brings in a new
allele and the process can start again.
Another effect of small number of breeding individuals is inbreeding or an

increased likelihood of matings taking place between relatives. If two siblings
mate there is a possibility of each passing in a copy of the identical parental
gene. Such alleles are said to be identical by descent, and identical homozygotes
may be produced whenever relatives mate. Thus, the continued mating of
relatives in a small population results in an accumulation of identical
homozygotes until eventually all members carry the same gene at a locus.
Genetic variability is lost at a rate which depends upon the population size,
and separate populations will diverge as a result of the fixation of different
alleles.
Genetic drift may also be caused by occassional change in population size. For
instance, Mayr (1952) indicated that through the founder principle, a population
may occasionally send forth only a few founders to begin a new population.
Whatever gene or chromosome arrangements these founders take with them,
detrimental or beneficial, all stand a good chance of becoming established in
the new population because of this sudden sampling accident.
UP Open University
Mutations
What are mutations? What are their roles in the evolution of life?
Mutations are changes in organisms that are heritable and essentially

permanent. Do you know that new species of life evolved through mutations?
Let me cite some examples.
Sample #1: Marsh grass, Spartina townsendii (2n=126)
In the latter part of the 18th century, Huskin (1930) first collected marsh grass
along the shores of England and France on both sides of the English channel.
The origin of S. townsendii was determined to be as follows:
P1: Spartina alterniflora S. stricta

2n = 70, American species 2n = 56, European species
normal
gametes 35 28
sterile hybrid
F1 : 2n = 63
few induced gametes

n = 63
fusion
2n = 126
Spartina townsendii
Example #2. Cotton, Gossypium
The old world cotton has 25 rather large chromosomes, whereas Central and
South American species have 26 much smaller ones. The cultivated cotton has
52, 26 of which are large and 26 smaller; it is suspected of being an allotetraploid
of a cross between Old and New World species. Later, the cultivated species
UP Open University
Module 22 305
was reconstituted by crossing the two putative parents and using colchicine to
double its chromosome number.
Example #3. Evening primrose, Oenothera lamarckiana
In 1886, the Dutch biologist, Hugo de Vries, found that some individuals in the
progenies of O. lamarckiana differed markedly from the parent plants and from
one another. Some were giants, others dwarfs, and still others had different
flower colors, leaf shapes, or other differences. De Vries observed that these
aberrant or mutant individuals transmitted their characteristics to their
progenies, forming, in his experiments, what he regarded as new species. He
published his results in Mutation Theory (1901). To De Vries, evolution proceeded
by sudden mutational “leaps” that created full-fledged new species. Related
views were expressed by William Bateson (1894) in England, S.I. Korzhinsky
(1899) in Russia, and Richard Goldschmidt (1940) in the United Sates.
SAQ 22-4
What specific type of mutation occurred in Oenothera species?
Are you aware that most mutations do not result in the emergence of new
species? They do, however, create genetic variability which is precisely required
for natural selection to be the guiding agency of evolutionary genetics. Thus
mutations provide the basic raw material for natural selection to act on.
Here are some more examples of mutations.
1. Mutations in Vinegar Fly, Drosophila melanogaster Meigen
In 1909, the American Thomas Hunt Morgan began to study mutations in

D. melanogaster. One of the first observed mutations was the appearance of
a single white-eyed male among a group of normal red-eyed flies. It was
shown that mutation need not be through radical changes in the genetic
constitution of organisms but may run the gamut from changes so slight
that they are detected only by refined statistical methods to changes so
drastic that they are lethal to their carriers.
Approximately 5,000 spontaneous mutants have been identified. For

example, there are known mutations which affect color and shape of the
eyes, color and size of the body, size and shape of wings, and number and
distribution of bristles on the body. In Drosophila, about 1 gene mutates for
every 20 gametes produced; each gamete contains about 20,000 genes.
UP Open University
SAQ 22-5
According to T.H. Morgan, what are the two evolutionary effects of
mutations in D. melanogaster?
2. Mutant Black Fur Rabbit
A mutant black fur rabbit appears in a natural population of brown fur

rabbits. If the mutant rabbit survives and reproduces then it passes the
mutant gene for black fur on to its offspring. Assuming competitive
disadvantage, the mutant gene will be carried to future generations.
3. Resistant Mutants
Placed in a new or unusual environment, a population may have some

mutants that are well adapted to the new environment. Some bacteria
exposed to antibiotics and some insect pests exposed to insecticides have
evolved strains or varieties resistant to these noxious agents. Houseflies,
mosquitoes, and even lice have also been known to become resistant to
DDT. Similarly, some infectious in man that once were easily controlled by
penicillin are now mostly penicillin resistant.
4. Mutation in Corn
In corn (Zea mays), the genes for seed color mutate 492 times per million
gametes, while the genes for shrunken corn seeds mutate at the rate of 1.2
times per million gametes. Although gene mutations are rare and often
detrimental to the organism, they still provide enough new variability for
evolution to occur. This occurs because there are thousands of genes in
each gamete. There may be thousands or perhaps millions of individuals
producing gametes each generation of individuals over the span of
evolutionary time in which some opportunites for mutation occur.
5. Mobile elements, for instance plant mobile elements, are recognized from
their mobility for the last 30 years by McClintock (1947, 1957); Brink and
Nilan (1952). They have been observed as variegated flowers, leaves and
other plant parts by breeders, horticulturists and naturalists for more than
the last 300 years (Peterson, 1985). They are varied in size and functional
capacity of receptor element. A receptor element originates as a defective
regulatory element that has lost the capacity to induce excision events. When
an element (regulatory or receptor) is inserted, the target-site DNA
duplicates a DNA sequence of these or more DNA bases and the size of the
element is excised. Several events may occur, including the retention of the
UP Open University
Module 22 307
duplication, a return to wild type or the alteration in DNA sequences leading

to codon changes, or frameshifts in the transcript that have consequences
on the protein formed from that gene. This would contribute to genetic
diversity.
SAQ 22-6
Is it true that gene mutation is known for every kind of organism?
Recombinations
An organism at any stage of its development is a dynamic system of
developmental processes, a product of all the genes composing its genetic
endowment. Gene effects interact. Many characteristics result from complex
interactions of many genes. In sexual reproduction, recombination of genes
results in varying genotypes in the succeeding generations.
The creative role of sex in evolution is fundamental. It generates ever new

genotypes, among which gene constellations advantageous in old or new
environments may be found.
In meiosis, one set of chromosomes is passed on to each gamete. In sexual

reproduction, the union of any two specific gametes is a chance occurrence.
This means that through meiosis two alleles are separated. Homologous alleles
are then reunited during sexual reproduction. The process of genetic mixing is
known as genetic recombination.
In any sexually reproducing diploid organism there will be at least two alleles
for each gene, each producing a different phenotypic effect. Since there are
many genes on each chromosome, the number of possible gene combinations
is so large that no two individuals are likely to be genotypically identical. Thus,
through genetic recombination there is a constant source of genetic variability
resulting in various new combinations of existing genes.
SAQ 22-7
Explain why recombination is considered as a dominant genetic
mechanism which brings about variations in sexually reproducing
organisms.
UP Open University
Migration
In nature, very few populations are completely isolated from other populations
of the same species. In fact, a high percentage is subjected to at least a small
amount of gene migration in which immigrants from other populations add
new genes to the gene pool as emigrants to other populations remove their
genes from the gene pool. Migrations of individuals with slightly different
genotypes thus cause changes in the gene pools of populations. Although some
populations do not migrate and other populations experience only negligible
migrations, it is possible that migration does affect at least some populations
in nature.
When there is migration the two factors which are important to the recipient
population are:
1. the difference in gene frequencies between the two populations; and

2. the proportion of migrant genes that are incorporated each generation.
Directed Changes in Gene Frequency

Selection
Selection by man is a potent force in forming the phenotypes of some organisms.
All breeds of dogs have been produced by man’s attempts to improve their
appearance or performance for a particular task — whether it be dragging a
sledge across the arctic ice, sitting on a silken cushion, or driving fixes to a
bloody death in a ditch.
In 1950, Reed and Reed showed the changes in gene frequencies due to natural
selection in the laboratory populations of Drosophila. There was competition
between a white eye gene and its wild type allele.
How did they conduct the study?
Reed and Reed (1950) established in bottles populations of Drosophila

melanogaster with known frequencies of mutant and wild type alleles. The
frequencies of genotypes, i.e., sex-linked recessive mutant gene producing white
eyes were assessed. Male Drosophila have only one X chromosome.
Consequently, whatever gene is present at any given locus on this chromosome
will manifest itself in the male’s phenotype. Thus the proportion of males that
had white eyes could be used as an estimate of gene frequency in the sex. The
frequency in the females could only be estimated as the square root of the
frequency of white- eyed flies among them. The gene frequency in the whole
generation was estimated by weighting these two frequencies by the relative
UP Open University
Module 22 309
number of males and females in the population. Results of the study revealed
that the frequency of the white-eyed gene in an experimental population of
Drosophila melanogaster over 25 generations steadily declined.
Clearly, some differential effect is operating to reduce the frequency of the

white-eyed flies. Natural selection is not an all-or-nothing effect, and although
it is easiest to think in terms of individuals dying before they reach reproductive
age, this is not the only way it can act. A reduction in fertility can be just as
powerful selective agent as biological death. In the case of D. melanogaster, in
an illuminated bottle, white-eyed males were only 75% likely to mate
successfully, compared with their normal kin. Vision is an important component
of the courtship between behavior of some Drosophila species. It seems that
white-eyed males cannot see very well, hence they mate less effectively and
suffer a consequent reduction of fitness. Much of the decline in gene frequency
can be explained by this phenomenon.
Natural selection is a consequence of differential reproductive performance. The

Darwinian fitness, also called adaptive or selective value, of a genotype is measured
by the number of its descendants in the next generation in relation to the
numbers contributed by other genotypes in the same population. Vigor,
strength, longevity, and other factors enhance Darwinian fitness, provided only
that they contribute to the reproductive success. Natural selection by favoring
the survival and reproduction of the most fit genotypes is the guiding force in
evolution.
There are three basic types of selection.
1. Stabilizing Selection tends to eliminate the phenotypic extremes. The

phenotypes close to the mean are preserved by the population that are
environmentally well adapted.
2. Directional Selection is the type of selection where one of the extremes in

the phenotypic range becomes most fit and fitness of other phenotypes are
thus prevented. Natural directional selection happens when there are
changes in the environment of a well- adapted population. Within this
change, the mutations which were previously disadvantaged, may become
adapted thus replacing the existing phenotypes, e.g., the evolution of man
from his simian ancestors by severe climatic changes. The emergence of
antibiotic- resistant strains of bacteria, especially among pathogenic bacteria,
and strains of insect pests resistant to insecticides are instances of directional
selection.
3. Disruptive Selection is one where both extremes of the phenotypic range

are selected for, thus preserving differences in the gene pool of a population.
Natural disruptive selection can occur when several ecological niches
become available to a population. Phenotypic extremes may become isolated
UP Open University
from one another by occupying different ecological niches so that the gene
flow interbreeding ceases, subspeciation can follow and eventually lead to
the formation of new species.
It has been proposed that under some circumstances, especially if the

selected forms can exist independently of one another, isolation between
the selected groups might result. For instance, in the selection experiments
on bristle number in Drosophila melanogaster, flies were selected each
generation for high and low bristle number and found that, although
random mating was permitted, mating preferences of these flies went
rapidly in the direction of positive assortative mating, high x high and low
x low. Despite these results, it has been questioned whether or not any
single locality in nature could consistently maintain such severe divergent
selective conditions for a long enough period of time to produce speciation.
Even if such sympatric speciation has occurred, it is probably extremely
uncommon.
Many species become extinct because of the changing environments to

respond too. Natural selection’s creative role is to provide species with
genetic changes for adaptation to these environments.
SAQ 22-8
Explain how selection can direct changes in gene frequency.
Molecular Evolution
In evolutionary genetics, the application of genetics to evolution is now analyzed
both at the grosser and more obvious features and at the molecular level.
Molecular evolutionary approaches can be either analysis of the gene products
or direct investigation of the genes.
Gene products
Evolution at the molecular level is reflected in protein differences. The amino
acid sequence of a polypeptide chain is selected via the genetic code. Proteins
are “chemical fingerprints” of evolutionary history, bearing amino acid
sequences that have changed only as a result of genetic changes. By comparing
the same protein in a variety of species, the similarities and differences between
genes of those species are examined. Organisms that bear large numbers of
amino acid sequences in common may, therefore, be considered to be marked
UP Open University
Module 22 311
more directly related than organisms which differ greatly in amino acid
structures.
Example #1: Sequences of Amino Acids of Hemoglobin in Vertebrates
Since the polypeptide chains in the hemoglobins of vertebrates are remarkably

similar in terms of the length and general amino acid composition, the amino
acid differences between them stand out quite distinctly. It was calculated that
an average of 22 differences occurred between human hemoglobin chains (alpha
and beta) and the similar hemoglobins of the horse, pig, cattle, and rabbit.
Assuming from fossil evidence that a common ancestor existed for these groups
approximately 80 million years ago, this finding can be interpreted to mean
that the human hemoglobins diverged from those of such animals by about 11
new mutations in each hemoglobin line, or an average of about one mutation
per seven million years.
Assuming that there is a fairly constant rate of evolution, it has been proposed
that the evolutionary chains have the following hypothetical path or conjectured
phylogenetic relationships.
chain
myoglobin α chain β chain δ chain
β chain
35 million years ago
Myoglobin, which differs from the beta chain of human hemoglobin in 86

percent of the amino acid sequence, can be assumed to have differentiated
from a molecular ancestor common to both chains about 650 million years ago
(pre-Cambrian era), and the divergence probably occurred in an invertebrate
or prevertebrate progenitor. The split between alpha and beta involves
differences in 52 per cent of the amino acid sequences and can therefore be
ascribed to an evolutionary divergence during the Devanian period at the time
of appearance of the first amphibians. Based on scheme, the most recent split
between the hemoglobin chains occurred approximately 35 million years ago;
UP Open University
accounts for the 7 per cent difference in amino acids between b and d chains. A
fifth hemoglobin chain is being investigated to determine its exact amino acid
sequence and its relation with the other known chains.
These structures indicate that at least six types of polypeptide chains in humans
can be traced back to a common ancestry.
SAQ 22-9
How can the sequence of amino acids in hemoglobin explain the
evolution of living things?
Example #2: Relationship Between Metabolic Pathways
A proposal explaining that the evolution of metabolic pathways began with

the various modes of absorption and utilization of different organic compounds
in the primeval “soup” four to five billion years ago has been presented. These
early waters are believed to have contained a large amount of organic material
produced by interactions among the components of the primitive atmosphere
— hydrogen, methane, ammonia, and water. Such mixtures are capable of
producing a wide variety of important organic compounds, including amino
acid. Since the concentration of organic material in these primeval seas may
have been as high as 10 %, the first living forms would have been able to utilize
large amounts and varieties of compounds necessary for subsistence and
growth.
Within a relatively short time after the appearance of living organisms, however,
some or many of these organic compounds must have diminished. An amino
acid such as histidine, for example, may have become relatively rare but some
of its molecular relatives, such as histidinol, may have remained plentiful.
Adaptive value therefore, would have been conferred upon organisms carrying
enzymes that were capable of catalyzing the reaction histidinol —> histidine.
As the supply of histidinol was depleted, in turn, selection may have operated
to confer adaptive value upon an organism capable of catalyzing a histidinol
precursor into histidinol. In this fashion a metabolic pathway would be
established, beginning with the final compound, e.g., histidine, and leading in
a descending stepwise fashion to compounds which could be used as precursors.
Thus the more primitive enzymes may be those which are the final steps of a
metabolic pathway rather than those at earlier steps.
UP Open University
Module 22 313
SAQ 22-10
Do you think metabolic pathways can provide evolutionary
explanations? Why?
Genes
A direct molecular approach to evolutionary investigation deals with genes.
The base composition of DNA can be compared in a number of different
organisms and analyzed according to the per cent of nitrogen bases, such as
guanine (G) plus cytosine (C), carried in each species. For example, in a study
conducted, the G + C content ranges from about 20 to 75 % between the different
species.
Generally, lower organisms show much greater variability in base composition

between their species than do higher organisms. The differences among lower
organisms, however, do not necessarily mean wide deficiencies in protein
composition. Because of the degeneracy of the genetic code, it is still possible
for an organism to produce the same amino acid at a certain protein position,
but to use a codon with a changed nucleotide content.
The extent of complementary pairing between DNA of one source and DNA of
another source has been established by measuring the degree of in vitro
“hybridization” between the two DNAs. This is promising, indicating a
correspondence between DNA homology and phylogenetic relationships.
SAQ 22-11
How can DNA be related to phylogeny?
Evolution of Genetic Systems

How did the the systems of coding and transferring the genetic material itself
evolve?
Here are some information about the evolution of genetic systems.
1. Genetic systems have evolved and they trace their ancestry back to that
“Aquatic Garden of Eden” out which all life began.
UP Open University
2. According to Oro (1961), Fox and Haroda (1961), the bases, adenine and
uracil, may be spontaneously synthesized from compounds that were
probably present in the early history of the earth.
3. Pannamperuma, et al. (1963) showed the formation of the purine-sugar

combinations, adenosine and deoxyadenosine under presumed primitive
conditions. Heating nucleotides with inorganic phosphate can then produce
the nucleotides of RNA and DNA.
4. The first genetic material is RNA since it now serves as the only connection
between genes and proteins. The self-duplication of RNA is certainly
possible, and is still preserved in RNA viruses. The replacement of RNA as
genetic material by DNA then might have occurred because of at least two
advantages:
a. DNA is more stable, lacking a hydroxyl group at the 2’ position of the

sugars; and
b. Since RNA has evolved the protein-synthesizing system, the enzymes

used for this purpose would not act upon DNA, and DNA could
therefore, restrict itself to the production of templates.
5. The evolution of a gene-protein system led directly to the evolution of a

genetic code.
6. Sonneborn (1965) and Woese (1965) indicated that the first proteins made
from a particular genic template were not always perfectly alike.
Considerable “errors” must have existed in the initial imperfect translation
mechanisms so that many ambiguities could have occurred, e.g., the
assignment of different amino acids to the same codon.
7. Based on the present coding dictionary, evolution has probably proceeded

in an error-reducing direction. First, the amino acids having more than one
codon have codons that are generally identical for the first two nucleotides
(positions I and II), differing only in the third nucleotide (position III). Since
in vitro experiments show that position III in many codons is the one most
easily subject to translational error, such a coding system would serve to
help prevent amino acid substitutions. Second, Woese’s classification can
be followed and so the amino acids can be divided into two broad groups :
the “functional” amino acids (tyrosine, histidine, lysine, glutamic acid,
tryptophan, etc.) involved in establishing enzymatic activity for proteins;
and the “non-functional” amino acids (phenylalanine, leucine, isoleucine,
valine, alanine, threonine, etc.). The translational errors at the next-most
error-prone codon nucleotide (position I) will generally cause the
substitution of an amino acid from the same “groups.” Thus UUU
(phenylalanine) may be misread as CUU, AUU, and GUU but still produce
UP Open University
Module 22 315
an amino acid in the non-functional group. Also, the finding that codons
bearing purines (G, A) at this position may help account for the fact that
the codons of the functional amino acid group are mostly of the latter type,
and the non-functional group generally has codons which are of the former
type.
8. Improvement of the mechanism of organization and transmission of genetic

material is exemplified by the evolution of the chromosome.
In one structure many genes could now be arranged according to their

most efficient relationships and transmitted as a unit.
a. In lower organisms, genes with loci or phage T4 chromosomes indicate

that the chromosome organization plays an essential role in survival.
Furthermore, the fact that all chromosomally mapped strains of E. coli
and Salmonella have the same gene sequence shows that considerable
selection pressure must exist for particular gene relationships to be
maintained in the face of all the many possible chromosome changes.
b. In higher organisms, wide variations in chromosome systems are

present, some of which can be traced through large portions of their
evolutionary history.
For example: Drosophila
The basic chromosome constitution of five long arms and a dot has evolved
by inversing translocations, as well as fusions into a multitude of different
configurations. Wasserman (1960) traced chromosome evolution throughout
a large portion of species in the repleta group while Scalper (1966) did the
same in the melanica group of genus Drosophila.
9. The evolution of genetic systems involves also the development of mitotic

and meiotic mechanisms, as well as the development of sexual and asexual
reproduction in its numerous forms.
10. Origin of T DNA genes of Agrobacterium plasmids
Bacteria, such as Agrobacterium tumefaciens, contain a number of oncogenicity

genes which are transferred to eukaryotic cells (plants). While in the plant
cells, they undergo neoplasmic transformation. The bacterially derived
oncogenicity genes indeed code for enzymes that will continuously supply
the transformed plant cells with cellular growth factors. These bacterially
derived plant oncogenicity genes have most likely evolved from similar
genes present in a number of bacterial plant symbionts and pathogens by
modification of 5’ upstream promoter sequences.
UP Open University
SAQ 22-12
TRUE or FALSE.
a. The evolution of genetic code led directly to the evolution of all

genetic systems.
b. DNA is the first genetic material.
Summary
Organic evolution refers to the change(s) in the genetic constitution of a
population of organisms or gene pool through either sudden or gradual
processes. It results in diversification and adaptation of species. It occurs when
something disturbs the genetic equilibrium.
The four conditions necessary to achieve the Hardy-Weinberg equilibrium (no

genetic drift, no mutation pressure, no migration, and random reproduction
or no selection pressure in a large population) are usually never met. It follows
that complete equilibrium in a gene pool is not expected. Evolutionary change
is a fundamental characteristic of the life of all populations.
The genetic mechanisms, which bring about variations and alter genotypic
ratios and allelic frequencies of the populations, are genetic drift, mutations,
recombination, migration, and selection. In genetic drift, the small random
sample of breeding adults taken from a large group of individuals will have
gene frequency which will deviate from that of the previous generation. Another
effect of small number of breeding individuals is inbreeding or an increased
likelihood of matings taking place between relatives.
Through mutations, new species evolved and in many cases they created genetic
variabilities serving as basic raw materials for natural selection to act on.
Recombination, particularly in sexual reproduction results in varying genotypes

in the succeeding generations.
In migration, the immigrants from other populations add new genes to the
gene pool and emigrants to other populations remove their genes from the
gene pool.
UP Open University
Module 22 317
Selection is the guiding force in evolution. It is the consequence of differential

reproductive performance. The adaptive or selective value of a genotype is
measured by the number of its descendants in the next generation in relation
to the numbers contributed by other genotypes in the same population.
In molecular selection, organisms that bear large numbers of common amino

acid sequences are considered to be more directly related. DNA homology
corresponds with phylogenetic relationship.
The genetic systems coding and transferring the genetic material themselves
have evolved.
References
Brink, R.A. and R.A. Nilan. (1952). The relation between light variegated and
medium variegated pericarp in maize. Genetics. 37:519-544.
Burns, G.W. (1972). The Science of Genetics. 3rd ed.: New York: Macmillan Publ.
Co. Inc.
Fox, S.W. and K. Harada. (1961). Synthesis of uracil under conditions of a
thermal model of prebiological chemistry. Science. 133: 1923-1924.
Mays, E. (1952). Systematics and the Origin of Species. New York: Macmillan
Publ. Co. Inc.
Mays, L.L. (1981). Genetics: A Molecular Approach. New York: Macmillan Publ.
Co. Inc. p. 693.
Mcclintock, B. (1947). Cytogenetic studies of maize and Neuorospora. Carnegie
Int. Washington. Year Book 46: 146-152.
Mcclintock, B. (1951). Chromosome organization and genetic expression. Cold
Spring Harbor Symp. Quant. Biol. 16: 13-47.
Oro, J. (1961). Mechanism of synthesis of adenine from hydrogen cyanide under
possible primitive earth conditions. Nature. 191: 1193-1194.
Parkin, D.T. (1969). An Introduction to Evolutionary Genetics. Edward Arnold,
Great Britain. p. 223.
Peterson, P. A. (1985). Plant mobile elements. CRC.
Ponnamperuma, C., R. MARINER, and C. Sagan. (1963). Formation of
adenosine by ultraviolet irradiation of a solution of adenine and ribose.
Nature 198: 1199-1200.
Reed, S.C. and E.W. Reed. (1950). Natural selection in laboratory populations
of Drosophila II. Competition between a white-eye gene and its wild type
allele. Evolution. 4: 34-42.
Schell, J. (1966). T-DNA genes of Agrobacterium plasmids, appear to be of complex
evolutionary origin. Genetics, Development and Evolution. New York and
London: Plenum Press. p. 361.
Sonneborn, T.M. (1965). Degeneracy of the genetic code: Extent, nature and genetic
implications. In: Evolving Genes and Proteins, V. Bryson and H.J. Vogel
(eds.). New York: Academic Press. pp. 377-397.
UP Open University
Stalker, H.D. (1966). The phylogenetic relationship of the species in Drosophila

melanica group. Genetics. 53: 327-342.
Strickberger, M.W. (1985). Genetics. 3rd ed. New York: MacMillan Publ. Co.
N.Y. p. 868.
Sueoka, N. (1965). On the evolution of informational macromolecules. In: Evolving
Genes and Proteins. V. Bryson and H.J. Vogel (eds.). New York: Academic
Press. pp. 479-496.
Wasserman, M. (1960). Cytological and phylogenetic relationships in the repleta
group of the genus Drosophila. Proc. Nat. Acad. Sci. 46: 842-859.
Woese, C.R. (1965). On the evolution of the genetic code. Proc. Nat. Acad. Sci.
54: 1546-1552.
ASAQ 22-1
Based on the theory of evolution, diversity and adaptation are the products of
organic evolution. Biological species evolve in order to diversify and to become
adapted to their environment.
ASAQ 22-2
Genetic equilibrium means that the genotype ratios and allelic frequencies
of the population remain constant. If there is genetic equilibrium, there is no
organic evolution since the population will not change.
ASAQ 22-3
1. TRUE
2. FALSE
ASAQ 22-4
Translocations in the evening primrose, Oenothera, were largely responsible

for the differences on which De Vries based his mutation theory.
ASAQ 22-5
Mutations in D. melanogaster result in:

1. Emergence of new allopolyploid species;
2. Variabilities serving as the raw material for natural selection to act on.
UP Open University
Module 22 319
ASAQ 22-6
Yes. Gene mutation is known for every kind of organism subjected to genetic
analysis.
ASAQ 22-7
There are many ways by which recombination can occur in sexually reproducing
organisms (meiosis, fertilization, conjugation, transduction, transformation,
etc.).
ASAQ 22-8
Selection can change directly the gene frequency since it is the consequence of
differential reproductive performance.
ASAQ 22-9
The sequences of amino acids in hemoglobin are related via the genetic code.
The number of amino acid sequences common in living things will mean that
these living things are more directly related.
ASAQ 22-10
Yes. Because they consist of organic compounds including amino acids.
ASAQ 22-11
The amount of homology in DNA will reveal the phylogenetic relationship of

species.
ASAQ 22-12
1. TRUE
2. FALSE
UP Open University
Assignments
1. How do mutations cause the evolution of:
a. evening primrose, Oenothera lamarckiana L.; and

b. vinegar fly, Drosophila melanogaster Meigen.
2. Specify the contributions of the following personalities to

Evolutionary Genetics:
a. Dutch Biologist Hugo de Vries; and

b. American geneticist Thomas Hunt Morgan.
3. How does the Hardy-Weinberg Law explain organic evolution?

Evolutionary Genetics?
UP Open University
Module 23
Human Genetics
Introduction
Objectives
M an expresses as many number of traits
as plants, animals, or other lower forms.
The basic genetic mechanisms of these traits
appear to be the same. Experimental breeding
is the most useful tool for genetic studies in 1. Distinguish heritable from
plants and animals. In man, however, this is non-heritable traits;
not feasible for genetic studies. Moreover, we 2. Construct a pedigree chart;
are neither able to subject ourselves to 3. Analyze the pattern of inher-
rigorous experimental conditions nor do we itance of human traits given
have the desire to do so. Therefore, the a pedigree;
method of choice to determine the mode of 4. Predict the outcome of hypo-
inheritance in man is to construct and analyze thetical and actual marriages;
a family history which we refer to as pedigree and
analysis. 5. Decide on given hypothetical
legal paternity suits.
Prerequisites
You should have completed the unit on physical basis of heredity.

Concept Map
Human Genetics
Human Traits Application
Heritable Non-heritable
Patterns of Transmission
Pedigree
Autosomal Sex-linked Sex-Influenced
Dominant Recessive X-linked Y-linked
Dominant Recessive
Heritable Traits in Man

Heredity is the passing on of factors responsible for a trait from generation to
generation. Such factors are referred to as genes. A gene is stable, self-replicating,
able to store diverse biological information, and able to transmit such
information into the cell. Based on this, a heritable trait shows the following
features:
1. It is permanent and non-reversible. Since a genetic material is stable, a trait

remains constant throughout life and never changes or reverts to its
alternative form, i.e., gene A remains as gene A without any alteration
(non-reversible). Consider ABO blood groups in man. A man born with
blood type “O” at birth shall have the same blood type “O” throughout his
lifetime.
UP Open University
Module 23 323
2. Transmissible. The self-replicating ability of a genetic material allows it to

produce exact copies to be passed on to the next generation. We, therefore,
see a great similarity between the parents and the offsprings with respect
to heritable traits.
A man with “O” blood type shall still have an “O” blood type at teenage,
fatherhood, and at grandfatherhood stages. When he marries a woman
with “O” blood type, all their children will have “O” blood type. In contrast,
a fair complexion acquired by an Asian beauty queen residing in America
by mere skin bleaching may turn dark again after a month’s stay in the
Philippines. When the woman marries a Caucasian, the children are still
“mulatto.”
Listed below are some heritable traits in man. The alternative of a trait first
mentioned before “vs.” is dominant over the alternative which is recessive.
• curly hair vs. straight hair

• hairy body vs. sparse hair body
• normal skin pigmentation vs. albinism
• near sightedness vs. normal vision
• farsightedness vs. normal vision
• hereditary cataract vs. normal vision
• astigmatism vs. normal vision
• normal hearing vs. deaf-mutism
• broad lips vs. thin lips
• large eyes vs. small eyes
• long lashes vs. short lashes
• polydactyly vs. normal number of digits
• brachydactyly (short digits) vs. normal length of digits
• syndactyly vs. normal digits
• hypertension vs. normal blood pressure
• diabetes insipidus vs. normal
• normal mentality vs. schizophrenia
• normal intellect vs. feeble-mindedness
• migraine vs. normal
• dimpled cheeks vs. normal cheeks
UP Open University
SAQ 23-1A
For the following list of human traits, mark all heritable traits H and all
non-heritable traits NH. Indicate your answers on the space provided
before each item.
____ a. Curliness of the hair acquired from a beauty parlor

____ b. Adherence of the ear lobe
____ c. Absence of lower leg due to amputation by accident
____ d. tongue-rolling
____ e. albinism
____ f. presence of dimples
____ g. black hair due to hair dye
____ h. sickle cell anemia
____ i. Polydactyly
____ j. anemia due to iron deficiency
How did you perform? If you scored 8 out of 10, congratulations! You are now
ready to answer SAQ 23-1B. This will allow you to characterize heritable traits.
If you scored below 4, do not worry. Give yourself another chance. Go back to
the text. This time concentrate on the examples of heritable traits given.
UP Open University
Module 23 333
Applications of Pedigree Analysis

Pedigree analysis gives basic information on the transmission of a given trait.
It allows us to predict the outcome of particular marriages. These are all very
helpful in genetic counselling work and in settling legal paternity suits or cases
of mix-up babies in hospitals.
Following the Mendelian principles of independent segregation and assortment,

you can work back from a given segregation among progeny the possible
parental combination which can provide a strong evidence in settling paternity
suits. This is specially applied to cases where heritability of the trait is
predominantly genetic and less, or not, influenced by the environment.
SAQ 23-4
On the basis of the blood group analysis, write F if the accusation is
false and T if it is true.
a. A well-known actor in California was accused of fathering the child

of a former friend. Three qualified physicians analyzed blood
tests performed on the child, the mother, and the alleged father.
The results presented to the court were as follows:
alleged father - Type O

mother - Type A
daughter - Type B
b. A mother gave birth to her first child, a boy, immediately before an

earthquake that resulted in a mixing up of babies in the hospital.
The couple identified a baby boy resembling the husband’s features
as their child. The following results of the blood typing were
presented in court:
alleged child - A
mother - O
father - A
c. A millionaire declared in his last will the transfer of all his properties
to his legal son.
alleged rightful heir - O

millionaire - A
mother - B
UP Open University
If you scored 3, you got a perfect score. Congratulations! With more practice
on actual cases, you are a potential genetic counselor.
Summary
The principles of genetic mechanism in all living forms also apply to man.
Since experimental breeding is not feasible in determining the mode of
inheritance in man, pedigree analysis is the only means of determining: a) the
traits which are familial; b) the modes of inheritance of human traits.
A pedigree chart is an orderly presentation of individuals in a family using a

standardized set of symbols. Following the Mendelian principles of heredity,
one can determine whether a trait is due to a dominant or recessive gene or
whether the gene is in an autosome or in a sex chromosome. A pedigree chart
has many uses and it is fun to construct, too. Anybody can construct one for
his or her own family for a desired trait.
Pedigree analysis allows one to identify the most probable genotype of each
family member and predict the outcome of hypothetical and actual marriages.
This will in turn give strong proof for settlement of legal paternity suits.
References
Cummings, M.R. (1988). Human heredity: Principles and issues. West Publ. Co.
USA pp 63-65.
Laude, R.P., A.A. Barrion, G.P. Balaccua, M.S. Mendioro, and D.A. Ramirez.
(1992). Laboratory Guide in Genetics. UPLB-TLRC. M. M. pp. 111-124.
Ramirez, D.A. (1990). Lecture in genetics. SEAMEO-SEARCA-UPLB.
pp. 212-223.
UP Open University
Module 23 335
ASAQ 23-1A
The correct answers are:
a. NH because the trait is merely temporary (After a month she becomes

straight-haired.)
b. H because this does not change throughout life and his/her children will
inherit this
c. NH because these dogs will not bear tailless puppies
d. H because tongue-rollers remain tongue-rollers throughout life and pass
this on to their children
e. H because albino individuals cannot revert to normal even with prolonged
exposure to the sun
f. H because a couple without dimples will not bear children with dimples (A
marriage, however, of one individual with dimples to one without dimples
will produce at least 50% of offsprings with dimples.)
g. NH because the black hair is only good for three or more months after
which application of hair dye must be repeated to turn the hair black again
h. H because no amount of iron treatment will ever make the sickle cell anemic
individual normal again
i. H because parents with polydactyly will be polydactyl throughout life and
will have polydactyl offsprings
j. NH because proper and timely iron therapy will allow the anemic patient
to become normal again
ASAQ 23-1B
The following features should have been excluded in the circle:
1. Temporary - Recall that a genetic material which controls a heritable trait is

stable, hence once expressed will remain manifested throughout an
individual’s lifetime.
2. Reversible - When a trait reverts to its alternative form, it cannot be expressed

on to the next generation and is therefore not heritable.
Read your lesson again or you’ll miss this opportunity to contribute your best
to the next generation.
UP Open University
ASAQ 23-2A
The correct answers are:
1. c 6. d
2. f 7. a
3. h 8. i
4. b 9. g
5. e 10. j
ASAQ 23-2B
Following the standardized set of symbols, the pedigree chart of the given
family is as follows:
I
1 2
II
1 2
III
1 2 3
ASAQ 23-2C
You can check your family pedigree against the standardized set of symbols.
ASAQ 23-3A
The correct answer is:
a. autosomal dominance
b. The genotypes of the individuals in the family are as follows:
A I-1 aa B I-1 aa C I-1 Aa

A I-2 Aa B I-2 Aa C I-2 aa
A II- 1 Aa B II-1 Aa C II-1 Aa
A II- 2 aa B II-2 aa C II-2 Aa
A II- 3 Aa B II-3 Aa C II-3 aa
A II- 4 aa B II-4 aa C II-4 aa
A II- 5 Aa C II-5 Aa
UP Open University
Module 23 337
ASAQ 23-3B
The predicted outcomes of individuals with free earlobes in the following

hypothetical marriages are as follows:
a. 3/4
b. 3/4
c. 3/4
d. 1/2
e. 0
ASAQ 23-4
The correct answers to the given paternity suits are as follows:
a. F
b. T
c. T
UP Open University
Module 24
Recombinant DNA Technology
Introduction
A ny new combination of traits other than the parental types is called

recombination. Recall the following cross for shape and color of green pea
seeds in our discussion of Mendelian genetics:
P1 and P2 : Round, yellow x Wrinkled, green
F1 : Round, yellow
Testcross : Round , yellow x Wrinkled, green
F2 : 1 Round, yellow (Parental)

1 Round, green (Recombinant)
1 Wrinkled, yellow (Recombinant)
1 Wrinkled, green (Parental)
Here, new combinations which occurred at a frequency of 50% resulted from

independent segregation and assortment of genes independently controlling
each trait. Recall further another cross for flower color and pollen shape in
sweet peas when we were discussing linkage:
P1 and P2 : Purple, long x Red, round
F1 : purple, long
Testcross: purple, long x red, round
F2 : 296 (Parental)
19 (Recombinant)
27 (Recombinant)
85 (Parental)
Here, new combinations at a frequency 46/47 or 10.7%,

Objectives i.e., < 50% resulted from exchange in chromosome
segments bearing the genes by crossing-over. It is
evident, therefore, that hybridization results in
recombinations through independent segregation and
assortment of gene pairs or crossing-over. In both cases,
however, the new combinations produced are products
1. Identify the steps involved in
of events occurring by chance.
the recombinant DNA tech-
nology;
However, the discovery, of DNA as the genetic material
2. Enumerate the various re-
and knowledge about its structure, function, and the
quirements for each step in
prerequisites of each process by which the gene is able
the recombinant DNA tech-
to perform its function has narrowed down genetic
nology; and
engineering to the molecular manipulation of the DNA
3. Discuss the applications of
called recombinant DNA technology. By this process, one
recombinant DNA technol-
can form desired new combinations.
ogy.
Prerequisite
You should have fully understood the physical and chemical bases of heredity.
These are presented in Units II, III, and V. This chapter is basically an application
of these basic principles of heredity.
Definition of Terms
Chimera - product of joining DNA molecules from different sources
Ligase - enzyme joining oligonucleotides by forming phosphodiester bonds
Recombinations - the creation of a new combination of DNA fragments from

different sources
Recombinant DNA Technology - is a process of gene manipulation involving

breaking and joining of DNA molecules inserted into a suitable carrier
and allowed to replicate in a host cell
UP Open University
Module 24 341
Restriction Endonuclease - is an enzyme that recognizes specific nucleotide

sequences in the DNA, then makes a double-strand cleavage on the
DNA molecule
RFLP - term that donates the differences in molecular weight of homologous

fragments of restriction enzyme-digested genomic DNA sometimes
observed in two genetically distinct individuals
Concept Map
RECOMBINANTS
HYBRIDIZATION RECOMBINANT DNA TECHNOLOGY

(Conventional approach) (Innovative Approach)
APPLICATIONS
Microorganisms Plants Animals Humans
The General Procedure in the Genetic

Engineering or Recombinant DNA Technology
Genetic engineering has become a reality when the following elements were
discovered one by one and finally integrated:
1. A method of breaking and joining DNA molecules derived from different

sources thereby forming the recombinant DNA;
UP Open University
2. A suitable gene carrier that can replicate both itself and a foreign DNA
segment linked to it;
3. A means of introducing the composite DNA molecule or chimera into

functional host cell; and
4. A method of selecting from a large population of cells a clone of recipient

cells that has acquired the molecular chimera.
DNA can be isolated by treatment with proteins to lyze the cell and by
purification through centrifugation. The isolated DNA are treated with
restriction enzymes to produce segments. Specific base segments in DNA are
recognized and cleaved or cut by these restriction enzymes.
Plasmid, are the most common vectors or cloning vehicles. They are
extrachromosomal DNA molecules found naturally in bacterial cells. This
circular DNA can replicate independently of the cell’s chromosome; and thus
it is a good cloning vehicle.
Selection of host cells with the recombinant DNA is done on the basis of a
genetic marker. For example, if the plasmid used as a vector contains the genes
for ampicillin resistance, you can choose for cells with recombinant DNA by
growing the cells in a medium with ampicillin. All those which survive contain
the recombinant DNA while those which do not contain the recombinant DNA
die.
UP Open University
Module 24 343
pSC 101 plasmid Foreign DNA

Cleavage
replicator site
Cleavage
sites
Tetracycline Cleavage by Cleavage by

resistance Endonuclease Endonuclease
Annealing
DNA Ligase
Plasmid Chimera
Transformation
Plasmid Chromosome
Transformed Cell
Replication
Daughter Cells
Figure 24-1. General procedure in genetic engineering or recombinant DNA

technology (adopted from D.A. Ramirez, 1991)
UP Open University
The first and probably the most profitable application of recombinant DNA
technology is the incorporation of the human insulin gene into the genome of
the bacterium Escherichia coli. The engineered E. coli produced human insulin
in much larger quantities, making insulin abundant and reasonably priced.
This particular biotechnology has made a genetic engineering company,
Genetech, and its stockholders millionaires overnight.
Briefly, the procedure is as follows (Figure 2):
1. Chemical synthesis of the two human insulin genes:
a. For polypeptide chain A

b. For polypeptide chain B
2. Linking of the synthetic genes to the Lactose operon:
a. Gene A + Lac Operon

b. Gene B + Lac Operon
3. Insertion of the hybrid DNA into the plasmids:
a. Gene A + Lac Operon into the Plasmid A

b. Gene B + Lac Operon into the Plasmid B
4. Incorporation of plasmid chimera into E. coli :
a. Plasmid A [ with Gene A + Lac Operon ] into E. coli

b. Plasmid B [ with Gene B + Lac Operon ] into E. coli
5. Expression of gene action of transgenic E. coli :
a. E. coli A : Insulin A chain attached to galactosidase

b. E. coli B : Insulin B chain attached to galactosidase
6. Treatment with cyanogen bromide to remove galactosidase:
a. Insulin A
b. Insulin B
7. Mixing of the two polypeptide chains produces the active human insulin.
UP Open University
Module 24 345
Chemical Synthesis of Insulin Genes
Genes linked to the Lac Operon
Hybrid DNA inserted into Plasmids
Plasmid inserted into E.coli
Insulin A chain Insulin B chain
β-galactosidase β-galactosidase
Treatment with Cyanogen bromide
A chain B chain
Mix
Active human insulin
Figure 24-2. Synthesis of human insulin by Eschiricia coli through genetics

engineering (adopted from D.A. Ramirez, 1991)
UP Open University
After this initial success, application of recombinant DNA technology made

use of vectors other than plasmids such as virus and bacteria. In plant genetic
engineering the bacterium Agrobacterium tumifaciens is the most popular vector.
More recently, direct incorporation of foreign genes into the host species has
become a routine procedure. The gene or DNA gun is one of the many
inventions to accomplish direct DNA incorporation.
Activity 24-1
Construct a model to demonstrate the recombinant DNA technology
using the following materials:
a. white colored rope to represent the genomic DNA;

b. blue colored rope to represent a plasmid DNA;
c. a pair of scissors to represent restriction endonucleases; and
d. tape to represent DNA ligases.
Steps to demonstrate the recombinant DNA technology:
a. Construct an isolated circular plasmid using the blue rope. Identify

a suitable selection marker.
b. Obtain a circular genomic DNA (white colored rope) and identify

the gene of interest.
c. Use a pair of scissors to represent a restriction endonuclease; cleave

the plasmid.
d. Ligate DNA into the restricted plasmid.
e. Incorporate recombinant DNA into the host cell.
f. Identify a possible method for screening or selection of host with

the recombinant DNA.
UP Open University
Module 24 347
SAQ 24-1
a. Illustrate the assembled plasmid and the foreign DNA. Diagram
the steps in the production of recombinant DNA. Label.
b. Identify the steps involved in the production of a recombinant DNA

and the protein/enzyme requirement for each.
c. How would you select the host cell that has incorporated the plasmid
with the foreign DNA (recombinant DNA)?
For each correct answer, give yourself a score of 5. If you got 15 points, you are
excellent! You are now ready to appreciate the applications of the recombinant
DNA technology. If you scored 10 points or less, please go over the module
again and try the activity once more.
Applications of Recombinant DNA Technology

The initial success of the recombinant DNA technology in the insertion of the
human insulin gene into E. coli was followed by many similar researches on
microbial, plant, and animal genomes.
Among humans recombinant DNA technology has been extensively used by

the Human Genome Mapping Organization (HUGO) established in May 1989.
HUGO aims to sequence and map the entire human genome. Subsequently,
genetic mapping has provided the basis for preventing and treating the most
common human chronic diseases. Some diseases have been given priority, such
as thalassemia, cystic fibrosis, Huntington’s chorea, and Duchenne’s muscular
dystrophy. Another application of this technique is in DNA fingerprinting
with Restriction Fragment Length Polymorphism (RFLP). This is commonly
applied in forensic cases. Since DNA is present in all cells, body fluid samples,
as blood and semen that can be collected from the scene of the crime, may be
sequenced. The DNA of the suspect is then matched with the DNA obtained.
This way a match would identify whether the suspect is guilty or not. In the
U.S. where it has been used, 80 criminals of rape and murder have been
convicted. This technique is highly reliable since the likelihood of two unrelated
individuals to have the same DNA sequence is 1 < 1/1M.
UP Open University
Genetic engineering is also important in cancer research. Genetically engineered

probes for cancer cells have been developed. These are GST-Pi (glutathione-S-
transferase), which is used to neutralize poisons, and MDR (multiple drug
resistance), which helps pump toxin out of cells. Researchers at Yale University
and Mt. Sinai School of Medicine have produced blood clot agents through
recombinant DNA. Cloning of the gene for tissue factor that trigger coagulation
will lead to the development of antibodies to measure tissue factor availability
for early detection of thrombosis. Genetic engineering has also been used in
studies on mitochondrial DNA and aging.
In other organisms, the following have been developed using recombinant

DNA technology:
1. A super-ovulation hormone called bFSH or bovine follicle-stimulating

hormone. Developed by Integrated Genetics Inc., it causes super-ovulation
in cattle producing as many as 6 ova (eggs) per ovulation;
2. Sequencing the gene for pancreatic peptide developed by Japanese scientists

for reducing appetite and various aspects of digestion by acting on the
hypothalamus;
3. Transgenic fishes (genetically engineered fishes) developed by Scandinavian

researchers using salmon (These organisms contained a growth hormone
gene and a gene for beta-galactosidase making them grow faster than the
normal ones.); and
4. In Australia, transgenic livestock and poultry whose inserted growth

hormone gene causes an increase in efficiency in feed conversion by 30%.
The following cases are some successful applications of the recombinant DNA
technology in plants.
Transgenic Plants for Insect Pest Resistance

1. Incorporation of the toxin gene of Bacillus thuringensis into corn, tomato,
cotton, tobacco , rice, and other crops
The bacterium B. thuringensis has long been used as a biological control

pesticide. It is because this bacterium produces compounds toxic to different
insect pests attacking corn, tomato, cotton, tobacco, etc. By incorporating
the bacterial gene responsible for toxin production, the transgenic tomato,
corn, cotton, or tobacco can produce its own insecticide. For example, when
leaves of transgenic tomatoes were fed to the larvae of tomato fruitworm,
these larvae were killed within 48 hours and the transgenic plants did not
UP Open University
Module 24 349
exhibit any feeding damage on the leaves. Another example is the case of
hornworm larvae being fed transgenic tobacco leaves. The larvae stopped
feeding on the transgenic leaves within one day and they were all dead
within three days.
2. Incorporation of the trypsin inhibitor gene cowpea into tobacco and sweet
potato.
Trypsin is an enzyme found in the guts of insects. When the insect larvae
feed on the transgenic plants (tobacco budworm on tobacco and weevil on
sweet potato), they are disabled by the trypsin inhibitor produced by the
transgenic plant. The larvae are unable to break down proteins in their
digestive systems and are, therefore, deprived of essential nutrients.
Consequently, these larvae die.
Transgenic Plants for Disease Resistance

1. Incorporation of genes for the protein coats of plant viruses
The gene for the protein coat of the rice dwarf virus (RDV) was incorporated
in rice, producing the rice dwarf virus resistant transgenic rice.
Genes for protein coats of viruses causing diseases of corn, tomato, tobacco,
wheat, and other crops were also incorporated into these crops, producing
virus resistant transgenics.
2. Incorporation of chitinase genes into the solanaceous species produced

transgenic plants resistant to the common soil-borne pathogen, Rhizoctonia
solani.
Transgenic Plants for Herbicide Resistance

Weeds have always been a serious problem in crop production. The use of
herbicide has not always been successful because of its broad spectrum. Even
the crops intended to be protected may be killed by herbicides. Incorporation
of genes from soil bacteria or fungi resulted in transgenics resistant to herbicides.
1. Bar gene from Streptomyces hygrospicus was incorporated into tomato and
white potato producing transgenics resistant to the herbicide
phosphonothricin, an inhibitor of glutamic synthetase in plants.
UP Open University
2. Bromoxil-specific nitritase (bxn) gene from Klebsiella ozaenae incorporated

into tobacco produced transgenic tobacco resistant to the herbicide
bromoxynil. The action of the bxn gene is to detoxify the herbicide by
breaking it down to a non-toxic metabolite.
Transgenic Plants with Improved Qualities

1. Tomatoes were engineered so that the production of the enzyme
polygalacturonase (PG) was blocked genetically. PG is the enzyme that
breaks down pectin in the cell walls and causes the softening of ripe tomato
fruits and eventually rotting within a few days. This is done by incorporating
a synthetic gene which produces strands of anti-sense RNA. This RNA in
turn binds the messenger RNA for polygalacturonase, thus preventing the
production of the enzyme. The PG level is kept low and, therefore, prevents
the breakdown of the cell walls of the ripe tomato fruit and prolongs the
shelflife of the fruit for several weeks more than the non - transgenic
tomatoes.
2. Incorporation of genes from soybean proteins in white potato produces

transgenics with high protein contents in the leaves and tubers.
3. Through the fusion of cells from commercial orange and trifoliate orange, a
new bread citrus named oretachi was produced. It had the winter resistance
of trifoliate orange and the flavor, texture, and color of commercially
cultivated oranges.
4. Naturally decaffeinated coffee beans are produced by transgenic coffee.

This is produced by incorporating a gene for antibiotic resistance into Coffea
arabica.
Even in lower forms of life, genetic engineering has its uses. An iron-oxidizing
bacterium has been cloned for use in mining to leach metals such as copper
and uranium. Pseudomonas aureofaciens and two lactose genes from E. coli are
used to track other engineered organisms in the environment. Furthermore, a
bacterium was genetically engineered to glow in the dark for the detection of
any class of toxic agents such as lead and polychlorinated biphenyls.
Applications of Recombinant DNA in Animals

Genetic engineering and biotechnology are highly successful not only in the
modification and improvement of plants but work has also been done on
microorganisms, as well as animals. In fact, the industrial applications of
genetically engineered microorganisms are so broad. These microorganisms
UP Open University
Module 24 351
are indispensable in the genetic engineering of both plants and animals. Among
the more common applications would be in pharmaceuticals and medicine.
Aside from the obvious reason of using improved stocks of agricultural animals,
genetic engineering has found a way of using these animals for the improvement
of human health. The first generation of therapeutic molecules produced by
recombinant DNA technology employed bacterial cells as recipients of
transferred human genes. The second generation of such technology may
employ higher plants and animals to produce proteins for medical therapy.
As an example of “molecular farming”, researchers in Britain have introduced

human genes into sheep so that the proteins encoded by these genes are
synthesized only in the mammary glands and are secreted into the milk. In
this method, human gene products are purified from the milk with minimum
inconvenience to the sheep. The human genes used in these experiments include
factor IX, a blood-clotting protein missing in some forms of hemophilia, and
the alpha-1-antitrypsin, a deficiency associated with the development of
emphysema, a degenerative disease.
In another bit of genetic engineering, human and cow growth hormone genes
have been transferred into pigs in an attempt to develop leaner, faster - growing
pigs. The genes were transferred by microinjection into newly fertilized eggs
that were implanted into a foster mother. Although the transgenic (carrying a
transferred gene) pigs grow faster on a high protein diet and are leaner than
normal pigs, they also have a number of problems, such as ulcers, arthritis,
and premature death resulting from excessive production of growth hormone.
If the hormone production can be regulated, the appearance of transgenic pools
may not be far behind.
SAQ 24-2
Enumerate the possible applications of recombinant DNA technology
and explain each of them.
SAQ 24-3
Read the pocket book “The Double Helix” by James D. Watson. This will
indeed be a very worthwhile reading. It will even increase your interest
in genetics.
UP Open University
Summary
Recombinant DNA technology refers to the molecular manipulation of the DNA.
It is generally considered genetic engineering, which includes conventional
plant and animal breeding.
The recombinant DNA technology became a reality with the discovery of the
following, which are the basic steps in the process:
a. a method of breaking and joining DNA molecules derived from different

sources;
b. a suitable gene carrier;
c. a means of introducing the composite DNA molecules into a functional

host cell; and
d. a method of selecting for cells with the recombinant DNA.
The first and probably the most profitable application of the recombinant DNA
is the incorporation of the human insulin gene into the genome of the bacterium
Eschericia coli, which made human insulin more abundant and reasonably
priced. Following this were notable successful applications of the recombinant
DNA technology in plants, animals, and microorganisms: transgenic corn,
tobacco, cotton, tomato, and rice for insect pest resistance; transgenic rice for
disease resistance; transgenic tomato and white potato for herbicide resistance;
transgenic tomato for controlled ripening; and transgenic livestock and fishes
developed for rapid growth. All of these, however are not yet available to
commercial producers due to biosafety concerns. Most countries, including
the Philippines, require very strict evaluation and testing procedure for the
transgenic organisms before their release to the environment to avoid
undesirable consequences.
References
Genetic Engineering and Biotechnology Monitor. (1985-1990). Issues 1 to 27,

UNIDO, Vienna, Austria.
International Program on Rice Biotechnology. (1990). Proceedings of 4th Annual
Meeting. Rockefeller Foundation.
Ramirez, D.A. (1991). Genetics. Lecture 13. pp. 181-194. UPLB-SEAMEO
SEARCA.
Strengthening collaboration in biotechnology: International Research and
Private Sector. Proceedings of Conference in Rosslyn, VA. U.S.A. April
1988.
UP Open University
Module 24 353
ASAQ 24-1
a. Refer to Figure 24-1.
b. Steps Requirements
b1. plasmid DNA and foreign DNA restriction endonuclease

cleavage
b2. insertion of a selected piece ligase

of DNA from a foreign source
into a cleaved plasmid DNA
b3. introduction of cloned DNA

into a host cell
c. This is done by growing the transformed cells in a selection medium

supplemented with substrates according to plasmid marker, such as
tetracycline. All those which survive in a medium with tetracycline are
recipients of the cloned DNA.
ASAQ 24-2
The following are some possible applications of the recombinant DNA

technology:
1. transgenic cattle with gene for super-ovulation hormone;

2. transgenic fish with gene for beta-galactosidase that allows rapid growth;
3. transgenic livestock with gene for growth hormone that allows increased
efficiency in feed conversion;
4. transgenic corn, tomato, cotton, tobacco with toxin gene of Bacillus
thuringensis that confers insect pest resistance;
5. transgenic plants with chitinase gene that confers disease resistance;
6. transgenic solanaceous species with bar gene that confers herbicide
resistance;
7. transgenic tobacco with nitritase gene with herbicide resistance;
8. transgenic tomato with gene for anti-sense RNA that confers fruit ripening;
9. transgenic potato with gene from soybean proteins; and
10. transgenic orange “oretachi” with gene for winter resistance.
UP Open University

Bio D 1 12 PDF

Загружено:

Сведения о документе

Оригинальное название

Авторское право

Доступные форматы

Поделиться этим документом

Поделиться или встроить документ

Параметры публикации

Этот документ был вам полезен?

Это неприемлемый материал?

Авторское право:

Доступные форматы

Bio D 1 12 PDF

Загружено:

Авторское право:

Доступные форматы

Principles of Genetics

University of the Philippines

Copyright © 1998 by Merlyn S. Mendioro, Adelina A. Barrion, Rita P. Laude,

Published in the Philippines by the UP Open University

First Published 1998

Layout by Helen M. Creer

Printed in the Philippines

UPOU through the leadership of Chancellor Ma. Cristina D. Padolina stressed

• Writers/Authors : Dr. Rita P. Laude

• Instructional Designer : Dr. Felix Librero

• Readers : Writers exchange modules and serve as readers

• Language Editor : Dr. Teresa Velasco

• Encoder : Ms. Elizabeth A. Melgar

• Illustrator : Mr. Victor Jun M. Ulat

Dr. Rita P. Laude

Module 2 Cell Cycle, 17

Module 3 Cell Division Phase: Mitosis, 25

Module 4 Cell Division Phase: Meiosis, 35

Module 5 Mendelian Principles of Heredity, 51

Module 6 Allelic and Non-Allelic Interactions, 67

Module 7 Definition and Types of Linkage, 87

Module 8 Linkage and Recombination: Sex Linkage, 103

Module 9 Chromosome Mapping in Eukaryotes, 113

Module 10 The Structure and Properties of the Genetic Material, 121

Module 11 An Overview of the Central Dogma of Molecular Biology, 135

Module 12 DNA Replication, 143

Module 13 Transcription, 153

Module 14 Translation, 161

Module 15 Gene Regulation and Genetic Control of Development, 173

Module 16 Mutations, 191

Module 17 Delayed Chromosomal and Extrachromosomal Inheritance, 217

Module 18 Population Genetics: Genetic Equilibrium, 233

Module 19 Population Genetics: Changes in Gene Frequency, 247

Module 20 Inheritance of Quantitative Traits, 265

Module 21 Analysis of Quantitative Characters, 279

Module 22 Evolutionary Genetics, 287

Module 23 Human Genetics, 311

Module 24 Recombinant DNA Technology, 329

T he production of offspring in each gene- After studying this module,

The field of biological science dealing with the mechanisms of heredity,

1. What is the relationship between reproduction and heredity?

2. Correlate Genetics with Biology.

Biodiversity - varying living forms in the biosphere

Biogenesis - origin of living organisms from other living organisms

Chromosome - threadlike structure found in the nucleus of the cell; carrier

Cytogenetics - a branch of biology that deals with the study of heredity

Cytology - branch of biology that deals with the structure, function,

Cytoplasm - the protoplasm of a cell external to the nuclear membrane

DNA - Deoxyribonucleic acid, the primary genetic material of all cells

Epigenesis - development of new characters in an initially undifferentiated

Gamete - a mature reproductive cell capable of fusing with a similar cell

Gemmule - hypothetical particle of heredity postulated in the theory of

Gene - nucleotide sequence coding for a polypeptide which may be an

Genetic engineering - manipulation of genes to provide variations

Germplasm - germ cells collectively or sex cells

Heredity - genetic transmission of characteristics from parents to offspring

Nucleoplasm - the protoplasm of a nucleus

Pangenesis - hypothesis that every somatic cell generates self-

Preformation - biological theory that all parts of future organisms exist

Sex chromosome - chromosome responsible for the determination of the

Somatoplasm - cells of all other parts of the body produced by the

Variation - marked differences or deviations from characteristics, form,

The Beginnings of Genetics