Академический Документы
Профессиональный Документы
Культура Документы
1997
~ Pergamon © 1997ElsevierScienceLtd
All rightsreserved.Printedin GreatBritain
0045-6535/97$17.00+0.00
PII: S0045-6535(97)00219-1
ANALYSIS OF OIL COMPONENTS AND HYDROCARBON-UTILIZING
MICROORGANISMS DURING LABORATORY-SCALE BIOREMEDIATION
OF OIL-CONTAMINATED SOIL OF KUWAIT
Byung-Hoon Cho 1, Hiroyuki Chino 2, Hirokazu Tsuji 2, Takashi Kunito 1, Hideo Makishima 3,
1.Introduction
The gulf war started on January 17, 1991 and ended on February 28, 1991 resulting in huge
scale oil contamination of the Kuwait desert soil (1, 2). The Kuwait desert is an important resource
for Kuwaiti that serves as a wild life habitat, and for farming, grazing, and recreation; thus,
1613
1614
remediation of the oil-contaminated desert soil is desired. We have been studying bioremediation
of the Kuwait oil-contaminated soil. In the previous paper (3) we reported that coconut charcoal
enhanced the biodegradation of contaminated hydrocarbons and that the amount of toxic
compounds produced during bioremediation was very small. This paper reports the result of
analyses of biodegraded oil components and isolation of petroleum hydrocarbon-utilizing
microorganisms.
°C). The samples were then eluted with 300 ml of n-heptane, and the eluents were collected as
saturated hydrocarbon fractions. Then, alumina columns were eluted with 300 ml of toluene, and
the eluents were collected as aromatic hydrocarbon fractions. The alumina columns were further
eluted sequentially with 80 ml methanol, 80 ml toluene, and 100 ml methanol, and the total eluents
were collected as resin fractions. The weight of each fraction was measured. Structural group
analyses by Field Desorption Mass-Spectrometry (FDMS, FDMS was done by JEOL AX-505H
Mass Spectrometry) were carried out on saturated and aromatic fractions. Elementary analyses
were carried out for each total TPH using a Perkin Elmer 240C CHN analyzer and a Mitsubishi
Kasei QR02 S analyzer. Gel permeation chromatography (GPC) was carried out for each total TPH
using a Waters ALC/GPC 201.
2.2.Isolation ofpetroleum hydrocarbon-utilizing bacteria
Hydrocarbon-utilizing bacteria were enriched in the liquid medium circulating flasks (Fig. 1)
for 2 months at 30 °(2. Liquid medium of 1000 ml contained 0.8 g KH2PO4, 1.2 g K2HPO4, 1.0 g
NH4NO3, 0.2 g MgSO4 " 7H2 O, 5 mg yeast extract (Difco), 5 mg Fe2(SO4)3, 5 mg Na2MoO4
2H20, and 5 mg MnSO4 • 4H2 O, and the pH was adjusted to 7.0 with NaOH. About 0.1 g of the
1615
I -x
p P w w ~
Oil contaminated soil "-------T~ ~
Glass filter
Silicon rubber
Air
Liquid medium
enriched soils was further enriched for 7 days at 30 °C in 10 ml of liquid medium containing 1% n-
ends of 16S rDNA (5). The amplified DNA was purified with MicroSpin S-400 HR columns
(Pharmacia Biotech, Inc.), and the sequences were determined with the 373A DNA sequencer from
Perkin Elmer, Inc., with dye primers (5'CAGGACTACCAGGGTATCTAAT3' and
5'AGGGqTGCGCTCGTTG3') that hybridize positions 803 to 787 and positions 1100 to 1115 of
the Escherichia coli numbering system of 16S rDNA. Dye primers were synthesized according to
the protocol supplied by Perkin Elmer, Inc. Identification of bacteria from 16S rDNA sequences
was carried out to compare the obtained sequence and DNA database using Genetyx software
(Software Science, Inc., Tokyo, Japan).
FD-MS spectrometry was carried out for the untreated soil and 18-week incubated soils of
columns 7 and 10 (Table 3). When the soils were incubated, the contents of larger z numbers
decreased clearly in the saturated fractions and slightly in the aromatic fractions. This fact
indicated that the saturated fractions were biodegraded more rapidly than the aromatic fractions.
% of oil component
Fraction Z number*
+2(-6) 0(-8) -2(-10) -4(-12) -6(-14) -8(-16) -10(-18)
Control
Saturated 26 21 13 9 13 10 8
Aromatic 19 14 12 16 14 13 13
Column 7
Saturated 11 15 15 12 19 16 11
Aromatic 16 14 12 16 15 14 14
Column 10
Saturated 15 17 14 11 17 17 10
Aromatic 17 14 12 15 15 13 13
Column C H(H/C) N 0 S
Therefore, the results of FD-MS correspond with the results of the composition analyses. The
results of elementary analyses are shown in Table 4. The content of sulfur was higher than the
average content of crude petroleum. When the soils were incubated, the content of sulfur
increased slightly. This fact indicated that the compounds containing sulfur were more stable
toward the bioremediation. The results of GPC analyses are shown in Table 5. The average
molecular weight decreased after incubation.
Molecular weight
While Gram positive bacteria and fungi can survive under dry conditions, Gram negative bacteria
dislike dry conditions. Judging from the physicochemical characteristics of Kuwait desert soil, the
numbers of Gram negative bacteria are considered to be very small. Therefore, the Kuwait desert
soil has the most unfavorable characteristics for the biodegradation of aromatic compounds. In fact
the analyses of chemical components of biodegraded oil revealed that the biodegradation of
aromatic compounds was very slow. The fact that the liquid culture enriched with aromatic
compounds did not show apparent growth of microorganisms also indicates the low population of
aromatic compound-utilizing bacteria.
4.Conclusions
In the present study, we carried out laboratory scale bioremediation experiments for Kuwait
oil-contaminated soil and reached the following conclusions from the chemical analysis of
bioremediated oil and isolation of petroleum hydrocarbon-utilizing bacteria.
1)The saturated fraction was biodegraded more rapidly than the other fractions.
2)The aromatic fraction was biodegraded but its biodegradation speed was very slow.
3)Compounds containing sulfur were relatively resistant to the biodegradation.
4)The population of aromatic compound-utilizing bacteria is probably low in the Kuwait oil-
contaminated soil, and this fact may be related to the slow biodegradation of aromatic compounds.
5_..Acknowledgements
This research was carried out as a joint program between the Petroleum Energy Center (PEC),
Tokyo, Japan, and the Kuwait Institute for Scientific Research (KISR), Safat, Kuwait. The authors
are grateful for the kind suppor{ of Drs. N. A1-Awadhi, R. AI-Daher, A. ElNawawy, and M. T.
Balba of KISR. The authors are also grateful for the kind assistance of A. Hirano of the Japan
Bioindustry Association, and of H. Nakamura and K. Hirano of PEC.
References
1. N. AI-Awadhi, M. S. Abdal, E. J. Briskey, and K. Williamson, Assessment of technologies for
the remediation of oil-contaminated soil resulting from exploded oil wells and burning oil
fires in Kuwait, Proceeding of Air and Waste ManagementAssociation Meeting, pp.21-26.
Kansas City, Missouri, USA (1992).
i