Chapter 3

Materials Used
3.1. Company of Instruments Used

 Centrifuge- Plasto Craft

 Centrifuge – Eppendorf
 Weighing Balance- Mettler Toledo
 Microcentrifuge
 LAF- esco
 Micropipettes – Cole Palmer, Thermo Scientific F3
 Plasmid Isolation Kit – Roche
 PCR purification kit, AGE Purification Kit - Roche
 Media- HiMedia, SRL, Merck
 DNA Ladder- Thermo Scientific 1kb Gene Ruler (250bp-10,000kb)
 Glassware- Borosil
3.2. List of Organisms Used
3.2.1 Escherichia coli strains used in the study
Table 3.1: List of Escherichia coli strains used in the study

Strain Description Source

DH5α Wild type In-house
DH5α Containing pCSN44 In-house
XL1-Blue Wild Type In-house
XL1-Blue Containing 10kb Unknown segment In-house
XL1-Blue Containing pCSN44 In-house
BL21 Containing pET28a + SIX1 In-house
Lemo21 (DE3) Containing pET28a + SIX1 In-house

3.2.2 Fusarium oxysporum f. sp. cubense used in the study

Table 3.2: List of Fusarium oxysporum f. sp. cubense strain used in the study

Strain Description Source

Foc race 1- vcg 0125 Wild type In-house

3.3 Plasmids used in the study

Table 3.3: List of Plasmids used in the study

Plasmid Description Source

High copy Number bacterial plasmid containing marker
pET28a providing Kanamycin resistance with 789bp of SIX1 gene In-house
cloned between --- and ---
 High copy number plasmid which is common in both
bacteria and filamentous fungus containing marker
pCSN44 In-house
providing Ampicillin resistance in bacteria and Hygromycin
resistance in fungus
High copy number bacterial plasmid containing 10kb
pBSKS(+) Unknown downstream fragment cloned at Sma1 restriction In-house
site. It contains marker providing Ampicillin resistance

3.4 Primers used in the study

Table 3.4: List of primers used in the study

Primer Primer Sequence (5’ to 3’) Tm* Direction

SIX1-1157
ATTGCGGCCGCATCATCTGTAACTCGCCCCG 31bp 81°C Forward
Upstream
SIX1-1157 CACACTAGTCTTGTCGAAAGCTCAAAATCCG
31bp 71°C Reverse
Upstream
SIX1-1157
ATTAGCGCTGGTCCAAAGCCTCCTAACACTAT 32bp 73°C Forward
Downstream
CCAGCATGCTGCTTGTGTCTGAATTGATTGAT
SIX1-1157 C 33bp 74°C Reverse
Downstream
pET28a/32a -
Forward
SIX1
pET28a/32a -
Reverse
SIX1
Hygromycin
coding Forward
cassette
Hygromycin
coding Reverse
cassette
* The Tm of the primers were calculated using Tm calculator by New England Biolabs.Inc
version 1.12.0
3.5 List of Antibiotics used in the study
Table 3.5: List of Antibiotics used in the study

Antibiotic Stock Working

Kanamycin 40mg/mL 50µg/mL
Chloramphenicol 32mg/mL 30µg/mL
Ampicillin 100mg/ml 100µg/mL
3.6 New Constructs Generated in the study
Table 3.6: List of Constructs generated in the study

Plasmid Insert
2kb 1157 Upstream between Not1 and Spe1 sites
pCSN44
2kb 1157 Downstream between Afe1 and Sph1 sites
pBSKS Containing 10kb unknown fragment at Sma1 Site

3.7 Stock Solutions

The stock solutions for Agarose Gel Electrophoresis and SDS-PAGE are as follows
Table 3.7: Stock solutions made for Agarose Gel Electrophoresis

Reagent Molarity Temperature for storage

EDTA 0.5M Room Temperature
Acrylamide Mix 30% 4°C in Brown Bottle
Tris-Cl (pH: 8.8) 1.5M Room Temperature
Tris-Cl (pH: 6.8) 1.0M Room Temperature
Ammonium Per Sulphate 10% 4°C in Dark (Brown Bottle)

3.8 Reagents Prepared

3.8.1 Genomic DNA isolation from Fusarium oxysporum f. sp. cubense – Wild type
5M Potassium Acetate
4.90grams of Potassium Acetate was weighed and dissolved in minimum amount of
Distilled water. The volume was made up to 10mL after it was completely dissolved.
This solution was stored at room temperature.
3M Sodium Acetate
4.082grams of Sodium Acetate was dissolved in minimum amount of distilled water.
The volume was made up to 10mL after it was completely dissolved. This solution
was stored at room temperature.
1mM of β-mercaptoethanol
34.5µL of β-mercaptoethanol from the stock of 14.4M was added to 65.5µL of
distilled water. 8µL of this was added to 1mL of TNE buffer to make the final
concentration of 8µM in the solution.