Вы находитесь на странице: 1из 42

DEPARTAMENTO DE ANTIOQUIA

SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA


INSTITUCIÓN EDUCATIVA LICEO CAUCASIA

1. Dado un plano cualquiera, es posible trazar una combinación geométrica, siguiendo siete pasos.

1) Se marca un punto A cualquiera en el plano.


2) A partir de allí se traza una elipse achatada en la parte superior e inferior.
3) Se traza una elipse congruente con posición en el punto medio B que se intersecta con la anterior
en los puntos m, n.
4) Se traza una línea recta que pasa por los puntos m y el centro de la elipse superior en el punto
B.
5) Se bifurca de la misma manera una elipse en la parte inferior de la inicial que intersecta con ésta
en los puntos o y p.
6) Se traza una línea recta que pasa por el punto p y el centro de la elipse inferior.
7) Se trazan dos paralelas verticales entre los puntos m y o; y n y p que intersectan a las rectas
paralelas horizontales, formando el paralelogramo m, r, p, q.

La figura que muestra correctamente la construcción geométrica descrita es:

2. Una institución educativa participará en un foro sobre valores al cual deben asistir 5 participantes
con una ponencia. Las directivas han establecido que el 60% de los participantes deben ser
estudiantes de grado DÉCIMO, el 40% restante de grado UNDÉCIMO. En el grado décimo hay 5
personas preparadas, en el grado undécimo sólo 4 están preparadas. ¿Cuántas combinaciones de
grupos resultan de la institución educativa para enviar al foro de valores?

A. 16
B. 24
C. 40
D. 60
DEPARTAMENTO DE ANTIOQUIA
SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA
INSTITUCIÓN EDUCATIVA LICEO CAUCASIA
3. La Figura muestra las diferencias de penetración de Internet y PCs en Colombia cuando se
segmenta por estrato socio-económico. Es claro que mientras en los estratos 4, 5 y 6 las
penetraciones son altas, en los estratos 2 y 3 son bastante menores y en el estrato 1 casi nulas.

Figura 1. Penetración de Internet y PCs segmentada por estratos (Fuentes: SUI, DANE).

De acuerdo con lo anterior, se puede afirmar:

A. Que el reto del gobierno es hacer de la población de estratos 1, 2 y 3 un mercado al cual se


pueda llegar con terminales y servicio asequibles, atendiendo que la mayoría de la población se
encuentra ubicada allí (68%).
B. Que el reto de las compañías de servicios de internet y PCs es cubrir el 100% de la población en
estratos 4, 5 y 6, porque cuentan con un mayor poder adquisitivo, y así maximizar sus ganancias.
C. Que el reto del gobierno es hacer de la población de estratos 5 y 6 un mercado dominante, ya
que allí radican los dueños de las empresas y microempresas que generan crecimiento
económico al país, con sólo un 5% de la población.
D. Que el reto del gobierno y de las empresas de telecomunicaciones es hacer de la población de
estratos 1, 2 y 3 un mercado al cual se pueda llegar con terminales y servicio asequibles,
atendiendo que la mayoría de la población se encuentra ubicada allí (88%).

4. Se tiene una escalera acostada a una pared como se muestra en la figura siguiente:

De acuerdo con esto, el valor del ángulo Ø es:

A. (4Sen90º)/12
B. 4/13
C. 3Sen90º
D. (13Sen90º)/4
DEPARTAMENTO DE ANTIOQUIA
SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA
INSTITUCIÓN EDUCATIVA LICEO CAUCASIA
5. El siguiente gráfico muestra el tiempo promedio que esperaba un usuario del servicio de salud en
Colombia, en el año 2007, para ser atendido en urgencias según el régimen de afiliación declarado.

Según esta información, es correcto establecer que no existía gran variación en los tiempos de
espera para ser atendido en las diferentes situaciones, porque

A. el tiempo de espera de un usuario no afiliado para ser atendido era menor que el tiempo
de espera de un usuario adscrito a cualquier régimen.
B. los tiempos de espera de los usuarios eran cercanos al promedio.
C. el tiempo de espera de un usuario adscrito al régimen especial era mayor que el tiempo
de espera de un usuario adscrito a cualquier régimen o no afiliado. D. los tiempos de
espera de los usuarios no eran superiores a 50 minutos.

6. Se encuestó a un grupo de personas, de diferentes edades, sobre el dinero que gastaron en


transporte público en el último mes. Las respuestas se registraron en la tabla.

De acuerdo con la información de la tabla, la edad de estas


personas y el dinero que gastaron en transporte público
están correlacionados, porque

A. las personas menores de 30 años gastan menos dinero.


B. a mayor edad más dinero se invierte en transporte y
viceversa.
C. a menor edad más dinero se invierte en transporte y
viceversa.
D. las personas mayores de 30 años gastan más dinero.

7. La tabla presenta el número de estudiantes admitidos en relación con la cantidad de inscritos en


algunas universidades de una ciudad latinoamericana.
¿En cuál de las universidades mencionadas, un estudiante
tiene mayor probabilidad de ser admitido?

A. Milenaria.
B. Las Palmas.
C. El Prado.
D. Kantiana
DEPARTAMENTO DE ANTIOQUIA
SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA
INSTITUCIÓN EDUCATIVA LICEO CAUCASIA

8. La Figura muestra el análisis de la industria de TI (Tecnología de la Información) colombiana y su


comparación con India y Estados Unidos desde 6 dimensiones: costos, recurso humano,
infraestructura, ambiente de negocios y riesgo. madurez de la industria. Colombia tiene ventajas
relativas en costos, infraestructura, ambiente de negocios y riesgo.

Figura 2. Ventajas competitivas de la industria TI colombiana en costos, infraestructura, ambiente de negocios y riesgo.

De acuerdo con la información anterior, se puede afirmar:

A. Que la mayor debilidad en la industria TI la presenta India en los aspectos de costo, recurso
humano y madurez de la industria al tener una menor valoración.
B. Que el mayor atractivo con mayor puntuación lo obtiene Estados Unidos en el componente de
costo con 4.75
C. Que Colombia presenta brechas muy grandes en disponibilidad de recurso humano y madurez
de la industria que limitan el desarrollo del sector.
D. Que Colombia presenta una mayor evaluación atractiva en comparación con la India y Estados
Unidos en materia de la industria TI.

9. Se tienen dos números reales k y j, de tal manera que j es mayor que K, y se tiene el número real
g, así:

Otro número real mayor que j, está ubicado entre otro número real. ¿Cuál de éstos NO podría ser
el número?
𝑔+𝑗
A. k + j B. 2g + k C. D. K + 2j
DEPARTAMENTO DE ANTIOQUIA
SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA
INSTITUCIÓN EDUCATIVA LICEO CAUCASIA
2
10. En el informe del Ministerio de Agricultura de México del mes de Julio de 2008, se publicó la
siguiente gráfica en la que se muestra la variación en los precios del aguacate en ese país, así:

De acuerdo con lo anterior, el analista asegura que el sector ha tenido un crecimiento ya que el
precio promedio del año 2007 se situó en 12 pesos mexicanos y en el 2008 en 14 pesos,
respectivamente. Un comentarista asegura que esta comparación no es posible, ya que

A. el precio promedio de los aguacates en el año 2007 realmente fue de 14 pesos y no de 12.
B. el precio promedio de los aguacates en el año 2008 corresponde a la medida del precio
registrado por la Mediana, la cual es 14,25.
C. en el 2007 la tendencia de los precios fue a aumentar en más de un 50% a partir del mes de
agosto.
D. en el 2008 sólo se registran los precios de los aguacates hasta el mes de junio.

11. En un laboratorio se tiene en un experimento una población de 8000 abejas cuyo crecimiento está
t
dado por la función f(x) = 3 .100, siendo t la variable de tiempo. Se considera que hay
sobrepoblación cuando ésta supera más de 10 veces la población inicial del primer período. A
partir de qué período t comienza a haber sobrepoblación:
A. t = 3 B. t = 4
C. t = 5 D. t
=6

12. En un hábitat especial, se cuenta con una población inicial de 8000 abejas, las cuales se multiplican
periódicamente en un 25%, con base en esta información, ¿cuál es la función que expresa el
crecimiento poblacional de las abejas en este hábitat?

n
A. f(x) = 8.000 (1 - 0,25)
n
B. f(x) = 8.000 + x(1 + 0,25)

C. f(x) = 8.000 (1 + n)0,25


DEPARTAMENTO DE ANTIOQUIA
SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA
INSTITUCIÓN EDUCATIVA LICEO CAUCASIA
n
D. f(x) = 8.000 (1 + 0,25)
5
13. El área rectangular que forma cualquier punto de la función f(x) = representada en la gráfica,
𝑥
con los ejes de las x y y, está dada por la expresión: Area = xf(x)

De acuerdo con lo anterior, cuál de las siguientes gráficas representa el área del rectángulo con los ejes

x y y, de en cualquiera de los puntos de la función f(x) = :


DEPARTAMENTO DE ANTIOQUIA
SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA
INSTITUCIÓN EDUCATIVA LICEO CAUCASIA
14. La tabla relaciona los rangos de ingresos en SALARIOS MÍNIMOS MENSUALES LEGALES VIGENTES
(SMMLV), los puntajes del SISBEN y el valor del Subsidio Familiar de Vivienda de Interés Social que
aporta el gobierno en SMMLV como complemento del ahorro y/o los recursos que le permitan
adquirir, para construir en sitio propio o mejorar una vivienda de interés social a las familias
beneficiarias de Colombia. De acuerdo al rango de los ingresos de las familias, se determina la
cantidad de SMMLV que le serán otorgados como subsidio de vivienda.

Un estudiante elaboró la siguiente gráfica:

El profesor de sociales le escribió que la gráfica estaba mal elaborada. ¿Cuál de las siguientes razones
corresponde a la razón que le dio al profesor al estudiante de retroalimentación?

A. La gráfica está mal elaborada porque mezcla valores en pesos y rangos de subsidios.
B. La gráfica está mal elaborada porque los valores están continuos y los subsidios son valores
discontinuos fijos según los valores dados en la tabla.
C. La gráfica está mal elaborada porque no muestra la relación verdadera de las dos variables en
los puntos trazados, mostrando discontinuidad.
D. La gráfica está mal elaborada por la escala en que los valores están representados.

15. En un plano cartesiano se traza un paralelogramo ubicando un vértice en el punto (-4, 2) y otro
vértice en el punto (-2, 8) y el eje de las y lo divide simétricamente en dos. Con base en lo anterior,
cuál es la coordenada de los otros dos puntos que forman los vértices restantes:

A. (-4, 2), (2, -8) B. (2, 2), (4, 8) C. (4, -2), (2, -8) D. (4, 2), (2, 8)
DEPARTAMENTO DE ANTIOQUIA
SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA
INSTITUCIÓN EDUCATIVA LICEO CAUCASIA
16. El trabajador Plutarco descargó de Internet su volante de pago del mes de Junio de 2014 y nota
que existe un error en las deducciones, debido a que le han descontado más de la cuenta por dos
días que pidió de permiso no remunerado para atender unas diligencias personales.

NOMBRE DEL EMPLEADO: PLUTARCO PATRICIO PORRAS DE LOS PALOTES


CARGO: APUNTATIEMPOS – HORAS DE CLASES DICTADAS
NOMINA DEL MES DE JULIO DE 2014
CÓDIGO
CONCEPTOS INGRESOS DEDUCCIONES
CONCEPTO
CIS001 Sueldo Básico 30 $ 960.000
CIS002 Subsidio Transporte 1 $ 72.000
CIS004 Horas extras diurnas 10 $ 40.000
CISN03 Ausencias 2 $ 128.000
APC001 Aportes Parafiscales (SENA, ICBF, Caja de 9% $ 86.400
Compensación Familiar)
APC002 Seguridad Social (Salud y Pensión) 8% $ 76.800
APCOOP Aportes Cuota de Ahorro Cooperativa de Vivienda 1 $ 30.000
TOTAL $ 1.072.000 $ 321.200

NETO A PAGAR $ 750.800

¿Qué procedimiento debió haber utilizado el trabajador para identificar el error en la deducción?

A. Restó los ingresos de las deducciones y luego halló la diferencia en 2 días descontados.
B. Calculó el valor de un día a partir del sueldo básico, multiplicó por 2 y comparó con el valor
deducido en el volante de pago.
C. Al total de ingresos lo dividió entre 30 días y luego le restó los 2 días no laborados y comparó con
la deducción correspondiente.
D. Dividió el valor deducido por ausencia entre 2 y luego halló el valor de trabajar un día, dividiendo
el total de ingresos entre 30.

17. En un municipio se realizó una encuesta sobre las preferencias de medios de transporte a 100
hombres y a 100 mujeres y se tabuló en un informe; los datos arrojaron que el 40% de las mujeres
toma el bus para ir al trabajo y el 45% de los hombres prefieren caminar y un 15% prefieren otro
medio de transporte. ¿Cuál de las siguientes tablas corresponde a los resultados de este ejercicio?
DEPARTAMENTO DE ANTIOQUIA
SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA
INSTITUCIÓN EDUCATIVA LICEO CAUCASIA

18. La figura de abajo muestra el desglose de las emisiones totales a nivel mundial (30 Gigatoneladas)
de CO2 a partir de combustibles fósiles, en el año 2008, por región. Para los Estados Unidos y
Europa, las emisiones se desglosan por sector y por modo de transporte en el sector. La
información proviene de los informes publicados por la Agencia de Energía Internacional, la
Agencia de Medioambiente Europeo y la Agencia de Protección Medioambiental de los Estados
Unidos.

A partir de la información representada, se puede concluir que:

A. En los Estados Unidos, los autos de pasajeros y camiones livianos representan


aproximadamente el 20% de las emisiones de CO2 provenientes de combustibles fósiles, o
aproximadamente el 4% de las emisiones globales de CO2 provenientes de combustibles
fósiles.
B. Que globalmente, las emisiones de autos de pasajeros y camiones livianos corresponde a
aproximadamente un 16% de todas las emisiones de CO2 provenientes de combustibles
fósiles.
DEPARTAMENTO DE ANTIOQUIA
SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA
INSTITUCIÓN EDUCATIVA LICEO CAUCASIA
C. En los Estados Unidos, los autos de pasajeros y camiones livianos representan
aproximadamente el 26% de las emisiones de CO2 provenientes de combustibles fósiles, o
aproximadamente el 6% de las emisiones globales de CO2 provenientes de combustibles
fósiles.
D. En los Estados Unidos, los autos de pasajeros y camiones livianos representan
aproximadamente el 30% de las emisiones de CO2 provenientes de combustibles fósiles, o
aproximadamente el 5% de las emisiones globales de CO2 provenientes de combustibles
fósiles.

RESPONDA LAS PREGUNTAS 19 Y 20 A PARTIR DE LA SIGUIENTE INFORMACIÓN.

La gráfica muestra la tendencia que ha tenido la esperanza de vida en los distintos continentes y
regiones del mundo entre los años 1950 al 2000. Se observa que las tasas de esperanza de vida para
la gran mayoría de los países mejoraron considerablemente a lo largo de los años. A algunas regiones
le fue mejor que a otras.

19. De acuerdo con la información se puede afirmar que en el año 2000,


A. La esperanza de vida de un asiático es 1/3 menor que la de un europeo.
B. La esperanza de vida de un latinoamericano es de aproximadamente un 87.5% de la
esperanza de vida de un norteamericano.
C. La esperanza de vida de un habitante de Oceanía es 1/4 mayor a la de un habitante de Asia.
D. La esperanza de vida de los europeos y de los habitantes de África descendió en la misma
proporción.

20. La gráfica que expresa la variación porcentual de la esperanza de vida entre los años 1995 y 2000
para un habitante de Norteamérica y uno de Latinoamérica es:
DEPARTAMENTO DE ANTIOQUIA
SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA
INSTITUCIÓN EDUCATIVA LICEO CAUCASIA

21. En un plano cartesiano se tiene la elipse trazada con centro en el origen (0, 0), definida por la
función 9x2 + 16x2 = 576, y dentro de cada corte de la elipse con las abscisas x y y , se traza una
línea formando un romboide como se muestra en la figura con las líneas de color azul.

De acuerdo con la información anterior, cuál es el


valor del perímetro del romboide en el interior de la
elipse:

A. 36 B. 48 C. 40
D. 60

22. Dadas las siguiente ecuaciones: x2 – 6x – 8y + 33


=0 y x2 + y2 – 12y + 6y -4 = 0, corresponde respectivamente a:

A. Una circunferencia y una hipérbole.


B. Una elipse y una circunferencia.
C. Una parábola y una circunferencia.
D. Una hipérbole y una elipse.

23. Una heladería del barrio ofrece 5 sabores de helados distintos de frutas tropicales y permite que
los clientes combinen 2 sabores en los conos. ¿Cuántas combinaciones distintas de conos pueden
obtener un cliente en la heladería?

A. 8
B. 10
C. 12
D. 6
DEPARTAMENTO DE ANTIOQUIA
SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA
INSTITUCIÓN EDUCATIVA LICEO CAUCASIA

24. Una fábrica de calzado diseñó un código de producción de su línea juvenil con destino a Europa el
cual consistía en un código encriptado en barras y un código alfanumérico en el que los dos
primeros caracteres corresponden a dos de las 27 letras del idioma castellano cualquiera, sin
repetir, y los tres siguientes y últimos caracteres corresponden a números arábigos, los cuales sí
pueden repetirse, según se muestra en la figura:

De acuerdo con lo anterior, el número total de códigos que se Pueden elaborar es: A.
850.000
B. 702.000
C. 960.000
D. 450.00

25. Se tienen dos monedas como las que se muestran a continuación. ¿Cuál es la probabilidad de que
al lanzar dos monedas al aire salgan dos CARAS?

A. 0,5
B. 0,25
C. 0,75
D. 0,6

26. Se saca una canica de una bolsa con 2 canicas blancas, 2 amarillas, y una azul. Se observa el color,
se pone de nuevo en la bolsa, y se saca otra canica. ¿Cuál es la probabilidad de sacar una canica
amarilla ambas veces?

A. 0,4 B. 0,2 C. 0,1 D. 0,5

PREGUNTAS ABIERTAS DE MATEMÁTICAS


Responde las preguntas 27 a 29 en la hoja de respuestas en el espacio estipulado. Utiliza letra
clara y procura no salirte del recuadro.

27. José pesaba 90 kilos y adelgazó un 20% de su peso en un mes; ahora quiere volver a su peso inicial.
¿Qué porcentaje de su peso debe aumentar ahora? Escriba en las líneas el planteamiento, sin
realizar las operaciones.

28. La profundidad del puerto de Santa Marta estaba en 18 metros y permitía buques de calado hasta
los 15 metros para dejar 3 metros de holgura como medida constante atendiendo que en el fondo
se ubican unas tuberías de oleoducto para cargue Offshore (mar adentro). Si el nivel del mar se
reduce en un 15%, exprese el planteamiento para calcular la capacidad máxima de calado de los
buques, sin realizar las operaciones.
DEPARTAMENTO DE ANTIOQUIA
SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA
INSTITUCIÓN EDUCATIVA LICEO CAUCASIA
29. Si en un experimento se toma 1/5 de abejas de un panal que tiene un volumen de 200 cm3 y por
cada cm3 se encuentran 7 abejas. Al introducirlas en el nuevo hábitat éstas se reproducen en una
tercera parte en términos de una semana. Exprese el planteamiento de la operación para calcular
la cantidad de

RESPONDA LAS PREGUNTAS 30 A 34 A PARTIR DE LA SIGUIENTE INFORMACIÓN.

LAS SAGAS ISLANDESAS

En la antigüedad escandinava se llamaba saga a las pequeñas leyendas sobre seres heroicos,
mitológicos, etc., como las que de hecho aparecen en las Eddas. Sin embargo, en el siglo XIII apareció
en Islandia un género literario al que se aplicó la misma denominación y que no tiene prácticamente
relación directa con aquellas antiguas leyendas: la saga propiamente dicha.

La palabra islandesa saga quiere decir “lo dicho, lo contado”. En general, podríamos traducirla por
“narración” y así se puede aplicar también a las historias narrativas escritas en Islandia y Noruega sobre
los reyes de este último país. Sin embargo, el sentido fundamental del término ha pasado a referirse
fundamentalmente a un tipo determinado de obra literaria que se produjo en Islandia entre los siglos
XIII y XIV, aunque hay epígonos posteriores.

Los estudiosos clasifican las sagas en varios tipos; sin embargo el principal de ellos es el de las Sagas
Islandesas; dentro de este grupo existen algunas de carácter fundamentalmente histórico, mientras
que otras unen, a partes iguales, realidad histórica y ficción, las hay también en que predomina lo
ficticio e incluso es claro que algunas son simples obras de ficción sin base histórica. Sin embargo, en
general podemos decir que una saga es una narración, cuya acción transcurre en torno a la época de
la colonización de Islandia, hasta la conversión del país al cristianismo, en torno al año 1000 y en la
que se cuenta la vida de un personaje islandés.

Podríamos compararlas con novelas históricas o con biografías noveladas. En unas y en otras, el autor
sitúa la acción en un tiempo pasado y, asesorándose mediante libros de historia, biografías, etc., hace
una narración que puede ser completamente inventada, aunque siempre haya algunos elementos de
carácter histórico. Los personajes, o el personaje principal, pueden ser inventados también, o reales,
en cuyo caso el elemento histórico puede ser más o menos importante, incluso hasta predominar con
claridad. Lo mismo sucedía con las sagas, tanto por la forma en que trabaja el autor como por su propio
carácter literario.

Desde los principios del país, colonizado a partir del año 874, los islandeses gustaban de componer
historias en verso y, posiblemente, también en prosa sobre personajes de la historia de su país,
especialmente de la época de la colonización. Estas historias no se escribían, sino que tenían carácter
exclusivamente oral. Su función era múltiple: por un lado servían de entretenimiento, pero también
guardaban los recuerdos históricos, las genealogías de las familias, los hechos más importantes que
habían sucedido en el país, en cada región y en cada una de sus familias principales; servían así, en
cierto modo, para mantener la relación entre familias del mismo origen establecidas en lugares
distintos de la isla.

Estas historias orales se conservarían entonces a lo largo de varios siglos, pues suponemos que se
originarían poco después de la muerte de los personajes, si no en vida de éstos. Esto explicaría,
DEPARTAMENTO DE ANTIOQUIA
SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA
INSTITUCIÓN EDUCATIVA LICEO CAUCASIA
aparentemente al menos, varias cosas. En primer lugar, ciertos rasgos estilísticos de las sagas, propios
del lenguaje hablado y no del escrito; además, la existencia de variaciones más o menos grandes entre
diversos manuscritos de las sagas.
Fuente: Texto basado en prefacio de Enrique Bernárdez a “Textos mitológicos de las Eddas”. Libros de los Malos
Tiempos. Literaturas Germánicas medievales, Jorge Luis Borges, Alianza Editorial.

30. Cuando se dice que la palabra islandesa saga quiere decir “lo dicho, lo contado”, esto último permite:

A. Definir qué es una saga.


B. Sugerir la naturaleza del género.
C. Caracterizar un tipo especial de relato.
D. Diferenciar las sagas islandesas de las leyendas.

31. Cuando se afirma que las sagas islandesas tienen ciertos rasgos estilísticos propios del lenguaje hablado
y no del escrito, se quiere señalar que:
A. Los escandinavos no escribieron los relatos contenidos en las sagas islandesas.
B. El lenguaje hablado no tiene rigurosidad que exige el lenguaje escrito.
C. El desarrollo escritural del Norte de Europa fue incipiente en el siglo XIII.
D. El origen de estos relatos se funda en la tradición oral del pueblo nórdico.

32. Del texto anterior se puede afirmar que es un texto explicativo porque:

A. Expresa opiniones.
B. Demuestra ideas.
C. Aclara un fenómeno.
D. Expone un pensamiento.

33. Del texto se puede inferir que las historias en verso que componían los islandeses trataban de personajes
de la época de la colonización, porque:

A. Durante esta época los islandeses libraron duros enfrentamientos con otros pueblos.
B. Estos eran los personajes verdaderamente nombrados y destacados de la época.
C. En ellas se quiere exaltar el espíritu heroico, expansionista y guerrero de los islandeses.
D. La vida de estos personajes otorgó a las sagas un valor propiamente literario.

34. En el texto, la palabra “epígono” quiere dar a entender que:

A. Hay ejemplos de este tipo de sagas, posteriores a las sagas que se produjeron en Islandia entre los
siglos XIII y XIV.
B. Todas las sagas islandesas son obras literarias que se produjeron en Islandia entre los siglos XIII y
XIV.
C. Los relatos de seres heroicos y mitológicos que aparecieron en Islandia, son elaboraciones
posteriores a las Eddas.
D. Fue en Islandia donde se desarrolló profusamente la epopeya en prosa de personajes históricos y
héroes míticos.

RESPONDA LAS PREGUNTAS 35 A 43 DE ACUERDO CON LA SIGUIENTE INFORMACIÓN


DEPARTAMENTO DE ANTIOQUIA
SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA
INSTITUCIÓN EDUCATIVA LICEO CAUCASIA
EL LENGUAJE EN EL COMIENZO DEL <<MUNDO>>

[…] El lenguaje hace la diferencia sustancial entre el hombre y el primate. Sin lenguaje no hay
pensamiento, y el tejido de relaciones por fuera del lenguaje aún no es social, pues se funda mucho
más en la simple instintividad gregaria que en la acción comunicativa entre sujetos. El trabajo de
transformación sustituye al trabajo de simple recolección, y se humaniza en la medida en que el
pensamiento le confiere la opción de convertirse en una actividad orientada al logro de idealidades
[…].
Según Claude Lévi-Strauss* antes el lenguaje era el reino del canto y, quizás, agregamos nosotros, el
dominio de los gruñidos onomatopéyicos. El canto ha sobrevivido en las culturas históricas
subsiguientes, pero se ha ennoblecido y humanizado gracias al lenguaje, al progreso de los
instrumentos y a la evolución de las formas musicales. Los fines arcaicos y primarios del canto animal
fueron, pues, sobrepasados por los fines del lenguaje simbólico que terminó apoderándose de lo
humano, imprimiéndole otro rumbo. La onomatopeya sobrevive como huella vestigial, y los gruñidos
del hombre ya no dicen tanto como en otro tiempo pudieron haber dicho.

Gracias al lenguaje simbólico que proyecta sobre lo real el soplo de su propio <<sentido>>, el
<<mundo>> fue posible como mundo y como representación de un <<todo>> exterior coherente.
Comunicación entre sujetos y sentido del <<mundo>> y de la existencia humana, he ahí lo que el
lenguaje fundó e hizo posible. Desde ese mismo momento ya no fuimos sólo causalidad en el mundo,
azar entre el azar de las cosas, sino una especie de protagonistas <<inteligentes>> en medio de la
gramática de un realidad supuestamente dotada de sentido, condecorados y distinguidos como
habíamos sido con la ilusión del <<hombre puesto en ese mundo cargado de sentido>>, tal y como si
ese sentido fuera algo realmente existente de manera objetiva y no una simple proyección o atribución
del sujeto a la causalidad de lo real, dominado como había quedado por el reino de su lenguaje y el
carácter <<carcelario>> de sus códigos. Se pensó, pues, que el sentido tan anhelado era un atributo
objetivo del mundo y no algo atribuido por el sujeto al mundo, una simple proyección o exhalación de
los códigos y convenciones de la lengua sobre la causalidad de lo real.

35. El texto anterior está organizado de la siguiente manera:

A. Primer párrafo: afirmación e introducción. Segundo párrafo: explicación sustentada por una figura
de autoridad. Tercer párrafo: reflexión.
B. Primer párrafo: introducción y explicación. Segundo párrafo: explicación sustentada por el hecho
histórico. Tercer párrafo: conclusión.
C. Primer párrafo: explicación e introducción. Segundo párrafo: explicación sustentada por el hecho
histórico. Tercer párrafo: explicación.
D. Primer párrafo: introducción y planteamiento del problema. Segundo párrafo: explicación
sustentada por una figura de autoridad. Tercer párrafo: explicación a modo de conclusión.

36. En el tercer párrafo del texto se habla específicamente:

A. Del hombre y del primate. B. De la significación y del sentido.


C. Del trabajo y del hombre. D. De la realidad y del azar.

37. En el texto, la nota de pie de página se utiliza para referenciar:

A. Una obra. B. Un intertexto. C. Una fuente D. Un autor.


DEPARTAMENTO DE ANTIOQUIA
SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA
INSTITUCIÓN EDUCATIVA LICEO CAUCASIA
38. De acuerdo con la perspectiva del texto sobre la diferencia sustancial entre el hombre y el primate, el
enunciado que guarda relación directa con éste es:

A. La transformación del primate a hombre es consecuencia de cambios genéticos en el seno de una


población.
B. El hombre y el primate, al ser productos de la creación divina, son especies inmutables.
C. La transformación del primate al hombre no se da a través de un proceso gradual, sino, por el
contrario, mediante cambios drásticos.
D. El fenómeno de paso de primate a hombre se da mediante el proceso de transformaciones fortuitas
y sucesivas.
39. Teniendo en cuenta la forma en que el autor plantea el desarrollo del texto, se puede afirmar que su
perspectiva es:

A. Positiva, porque se interesa en la reorganización de la vida social para el bien de la humanidad.


B. Evolucionista, porque considera todo proceso de cambio como producto de transformaciones.
C. Historicista, porque considera la realidad como producto de un devenir histórico.
D. Estructuralista, porque entiende en gran medida a la cultura humana como un sistema.

40. En la expresión “se pensó pues, que el sentido tan anhelado era un atributo objetivo del mundo y no
algo atribuido por el sujeto al mundo…”, la palabra subrayada expresa:
A. Contraposición, porque da paso a la contrastación de ideas que sustentan una idea anterior.
B. Causalidad, porque da paso a la presentación de razones que sustentan una idea anterior.
C. Consecución, porque da paso a la exposición de consecuencias que se desprenden de una idea
anterior.
D. Oposición, porque da paso a la refutación de ideas que sustentan una idea anterior.

41. Al tener en cuenta la estructura del texto anterior, este puede ubicarse dentro de los textos:

A. Narrativos.
B. Argumentativos.
C. Explicativos.
D. Descriptivos.

42. En la expresión: “Gracias al lenguaje simbólico que proyecta sobre lo real el soplo de su propio
<<sentido>>, el <<mundo>> fue posible como mundo y como representación de un <<todo>> exterior
coherente…”, al describir la palabra mundo con comillas, y sin estas respectivamente, se:

A. Establece la primera como mundo posible y la segunda como representación de un todo exterior
coherente.
B. Aclara que en la primera existen múltiples concepciones del mundo y en la segunda se limita al
mundo como espacio físico.
C. Enfatiza que la primera hace referencia al mundo antes del lenguaje y la segunda después de la
inserción del lenguaje simbólico en éste.
D. Aclara que la primera se refiere al mundo subjetivo y la segunda a la multiplicidad de realidades
sobre éste.
DEPARTAMENTO DE ANTIOQUIA
SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA
INSTITUCIÓN EDUCATIVA LICEO CAUCASIA
43. En la expresión “Según Claude Levi-Strauss, antes el lenguaje era el reino del canto…”, la palabra
subrayada es:

A. Una preposición que tiene como función conectar la introducción y la afirmación del primer
párrafo con la explicación del segundo párrafo.
B. Una conjunción adversativa que tiene como función oponer la afirmación y la introducción del
primer párrafo con la explicación del segundo párrafo.
C. Una preposición que tiene como función relacionar la introducción y el planteamiento del
problema del primer párrafo con la explicación del segundo párrafo.
D. Una conjunción adversativa que tiene como función contraponer la explicación y la introducción
del primer párrafo con la explicación del segundo.

RESPONDA LAS PREGUNTAS 44 Y 45 A PARTIR DE LA SIGUIENTE CARICATURA.

44. En la historieta de Carlitos se emplean puntos suspensivos, signos de admiración e interrogación con el
objetivo de:

A. Llamar la atención del receptor.


B. Enfatizar el diálogo.
C. Inferir en los implícitos
D. Reflexionar acerca del tema.
45. Los conectores en el texto escrito permiten relacionar palabras y oraciones para obtener:

A. Contraposición de las ideas.


B. La significación del texto.
C. Sinonimia en las proposiciones.
D. Placer en la lectura.

RESPONDA LAS PREGUNTAS 46 A 48 DE ACUERDO CON LA SIGUIENTE INFORMACIÓN

“Nadie es justo por voluntad sino porque no tiene el poder de cometer injusticias. Esto lo percibiremos
mejor si nos imaginamos las cosas del siguiente modo: demos tanto al justo como al injusto el poder
hacer lo que cada uno de ellos quiere, y a continuación sigámoslos para observar hasta dónde lo lleva
a cada uno el deseo. Entonces sorprenderemos al justo tomando el mismo camino que el injusto,
siguiendo sus propios intereses, los que toda criatura persigue por naturaleza como un bien, pero que
la fuerza de la ley obliga a seguir el camino del respeto por la igualdad.
DEPARTAMENTO DE ANTIOQUIA
SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA
INSTITUCIÓN EDUCATIVA LICEO CAUCASIA
El poder del que hablo sería efectivo al máximo si aquellos hombres adquirieran una fuerza tal como
la que se dice que cierta vez tuvo Giges, el antepasado del lidio. Giges era un pastor que servía al
entonces rey de Lidia. Un día sobrevino una gran tormenta y un terremoto que rasgó la tierra y produjo
un abismo en el lugar en que Giges llevaba el ganado a pastorear. Asombrado al ver esto, descendió
al abismo y halló, entre otras maravillas que narran los mitos, un caballo de bronce, hueco y con
ventanillas, a través de las cuales divisó adentro un cadáver de tamaño más grande que el de un
hombre, según parecía, y que no tenía nada excepto un anillo de oro en la mano. Giges le quitó el
anillo y salió del abismo. Ahora bien, los pastores hacían su reunión habitual para dar al rey el informe
mensual concerniente a la hacienda, cuando llegó Giges llevando el anillo. Tras sentarse entre los
demás, casualmente volvió el engaste del anillo hacia el interior de su mano. Al suceder esto se tornó
invisible para los que estaban sentados allí, quienes se pusieron a hablar de él como si se hubiera ido.
Giges se asombró, y luego, examinando el anillo, dio vuelta al engaste hacia afuera y tornó a hacerse
visible. Al advertirlo, experimentó con el anillo para ver si tenía tal propiedad, y comprobó que así era:
cuando giraba el engaste hacia adentro, su dueño se hacía invisible, y cuando lo giraba hacia afuera,
se hacía visible. En cuanto se hubo cerciorado de ello, maquinó el modo de formar parte de los que
fueron a la residencia del rey como informantes y, una vez allí, sedujo a la reina y con ayuda de ella
mató al rey y se apoderó del reino.

Por consiguiente, si hubiesen dos anillos como el de Giges y se diera uno a un hombre justo y otro a
uno injusto, ninguno perseveraría en la justicia ni soportaría abstenerse de bienes ajenos, cuando
podría tanto apoderarse impunemente de lo que quisiera del mercado, como, al entrar en las casas,
acostarse con la mujer que prefiera, y tanto matar a unos como librar de las cadenas a otros, según su
voluntad, y hacer todo como si fuera igual a un dios entre los hombres. En esto, el hombre justo no
haría nada diferente del injusto, sino que ambos marcharían por el mismo camino. E incluso se diría
que eso es una importante prueba de que nadie es justo si no es forzado a serlo, por no considerarse
a la justicia como un bien individual, ya que allí donde cada uno se cree capaz de cometer injusticias,
las comete. En efecto, todo hombre piensa que la injusticia le brinda más ventajas individuales que la
justicia, y está en lo cierto, si habla de acuerdo con esta teoría”.
Tomado de: Platón IV, D (1986). República, Traducción y notas de C. Eggers Lan, Madrid, Gredos.

46. Según la estructura del texto anterior, ¿cuál es el propósito general del autor al introducir el relato
sobre el anillo de Giges?

A. Promover en su audiencia la idea de que es más ventajoso seguir el camino de la injusticia,


señalando los beneficios que obtuvo Giges gracias al poder del anillo.
B. Convencer a su audiencia de que todos cometen injusticias cuando tienen la oportunidad, tal
como hizo Giges al ver el poder que le otorgaba el anillo.
C. Reforzar en su audiencia la idea de que todos cometen injusticias, al ilustrar con el caso de Giges
que quien obtenga el poder del anillo perseguirá la injusticia a su voluntad.
D. Persuadir a su audiencia de que la justicia se hace por voluntad, al mostrar que Giges no requirió
más impulsos para ser injusto que el poder del anillo.

47. ¿Cuál de las siguientes afirmaciones es un supuesto subyacente a la afirmación: “Todo hombre
piensa que la injusticia le brinda más ventajas individuales que la justicia, y está en lo cierto, si habla
de acuerdo con esta teoría”?

A. La injusticia brinda las mismas ventajas individuales que la justicia también brinda.
B. La justicia, al igual que la injusticia, brinda ventajas individuales.
C. La injusticia a diferencia de la justicia, brinda pocas ventajas individuales.
DEPARTAMENTO DE ANTIOQUIA
SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA
INSTITUCIÓN EDUCATIVA LICEO CAUCASIA
D. La justicia no brinda ninguna de las ventajas individuales que la injusticia brinda.

48. ¿Cuál de las siguientes afirmaciones presenta una razón de la cual se deriva la tesis principal del
texto anterior, según la cual nadie es justo por voluntad sino por obligación?

A. La gente se ve obligada a actuar justamente.


B. Solo la igualdad garantiza el respeto por la ley.
C. La injusticia brinda las mismas ventajas individuales que la justicia.
D. Siempre que una persona cuente con la libertad para cometer injusticias lo hará.

RESPONDA LAS PREGUNTAS 49 A 53 A PARTIR DE LA SIGUIENTE IMAGEN


DEPARTAMENTO DE ANTIOQUIA
SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA
INSTITUCIÓN EDUCATIVA LICEO CAUCASIA
49. El aspecto que se critica en la caricatura es: A. La tristeza de caperucita.
B. La muerte de los animales.
C. La desnutrición de la naturaleza.
D. El uso de la madera.

50. El mensaje se presenta en términos: A. Irónicos.


B. Trágicos.
C. Dramáticos.
D. Cómicos.

51. El autor no titula su obra porque:

A. Usa el lenguaje directo.


B. El lenguaje recoge su significado total.
C. No requiere formalizar el texto.
D. El contexto se lo exige.

52. La imagen del cazador y del lobo nos permiten suponer que:

A. El lobo estaba muerto cuando talaron el bosque.


B. El cazador fue muerto por el lobo.
C. El lobo probablemente no ha muerto.
D. El cazador mató a lobo.

53. La caricatura anterior es un texto porque:

A. Argumenta una idea y prioriza personajes.


B. Cuenta una historia y codifica los mensajes.
C. Transmite una idea secuencial e involucra personajes.
D. Narra una historia y sustenta una tesis.
RESPONDA LAS PREGUNTAS 54 A 58 A PARTIR DEL SIGUIENTE TEXTO

“Esta selva sádica y virgen provoca al ánimo la alucinación del peligro próximo. El vegetal es un ser
sensible cuya psicología desconocemos En estas soledades, cuando nos habla, solo entiende su idioma
el pensamiento. Bajo su poder los nervios del hombre se convierten en el haz de cuerdas, distendidas
hacia el asfalto, hacia la traición, hacia la acechanza. Los sentidos humanos nos equivocan sus
facultades: el ojo siente, la espada ve, la nariz explora, las piernas calculan y la sangre clama: ‘huyamos,
huyamos’ “.
La vorágine. José Eustasio Rivera. Página 187

54. El texto anterior es de tipo:


A. Narrativo, porque cuenta un suceso ocurrido.
B. Descriptivo, porque dice cómo ha ocurrido un suceso.
C. Expositivo, porque pretende dar a conocer una idea.
DEPARTAMENTO DE ANTIOQUIA
SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA
INSTITUCIÓN EDUCATIVA LICEO CAUCASIA
D. Explicativo, porque desarrolla un tema.

55. Los sentimientos hacia la selva, que motivan la reflexión del autor son:

A. Desesperanza y rabia.
B. Angustia y rencor.
C. Temor y angustia.
D. Rabia y temor.

56. El texto plantea que en la selva los sentimientos humanos se trastornan porque: A. Existe
constantemente la necesidad de huir.
B. Se genera un sentimiento de autoprotección.
C. La vegetación es peligrosa y desconocida.
D. Se pierde el sentido de seguridad.

57. En la frase: “Esta selva sádica y virgen procura …,” el autor hace una
A. Comparación.
B. Semejanza.
C. Descripción.
D. Personificación.

58. La expresión entre comillas “huyamos, huyamos”, es utilizada para ilustrar: A. La soledad de los
hombres.
B. La desconfianza hacia la selva
C. Una situación de temor.
D. Una actitud de cobardía.
RESPONDA LAS PREGUNAS 59 A 62 DE ACUERDO CON LA SIGUIENTE INFORMACIÓN

Robert Coover
CUENTO SÚBITO
Érase una vez un cuento que, de repente, cuando aún era posible, comenzó. Para el héroe, que se puso
en camino, no había en eso nada repentino, por supuesto; ni en el ponerse en camino, cosa que se
había pasado la vida entera esperando, ni tampoco en el desenlace, pues éste, cualquiera que fuese,
le parecía, como el horizonte, estar siempre en algún otro sitio. Pero para el dragón, como era muy
bruto, todo resultó repentino. Se sentía súbitamente hambriento, y, sin más, súbitamente, ya estaba
comiendo algo. Siempre era como la primera vez. Y entonces, súbitamente, recordó haber comido ya
algo parecido: cierto sabor agrío y familiar… Pero, de la misma manera repentina, se le olvidó. El héroe,
al encontrarse repentinamente con el dragón (llevaba años de penoso viaje por selvas encantadas,
desiertos interminables, ciudades carbonizadas por el aliento de los dragones, de modo que la palabra
repentinamente no le parecía la más apropiada), sin saber cómo sintió envidia, al desenvainar la
espada (desenlace posible que se le había presentado de pronto, como si el horizonte, con el
desesperado espejismo de lo repentino, se hubiera inclinado), de la libertad sin tensiones del dragón.
¿Libertad?, podría haber preguntado el dragón de no haber sido por lo bruto que era, mientras
rumiaba el súbito y agrio sabor familiar (¿un recuerdo…?) en su propio aliento. Pero ¿de qué?
(Olvidado).
Tomado de. Coover, Robert. (2005) Cuento Súbito, en: Arias García, Benito (ed). Grandes minicuentos
fantásticos, Bogotá, Colombia: Alfaguara. p. 68 (Trabajo original publicado en 1986).
DEPARTAMENTO DE ANTIOQUIA
SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA
INSTITUCIÓN EDUCATIVA LICEO CAUCASIA
59. En el texto, el enunciado: “El héroe, al encontrarse repentinamente con el dragón (llevaba años de
penoso viaje por selvas encantadas, desiertos interminables, ciudades carbonizadas por el aliento
de los dragones, […]”, la expresión subrayada corresponde a una secuencia:

A. Dialogal que incluye la voz del dragón que entra para contradecir lo dicho por el héroe.
B. Instructiva que presenta, paso a paso, los lugares por los que debe transitar el héroe.
C. Argumentativa que justifica la razón por la cual el personaje llegó hasta el dragón.
D. Descriptiva que presenta los detalles de la travesía que realizó el héroe.

60. Cuando en el texto aparece información encerrada entre paréntesis, se hace con el propósito de:

A. Incluir una voz que reflexiona sobre el proceso de construcción del cuento.
B. Resaltar anécdotas relacionadas con la corrección del cuento.
C. Permitir la aparición de voces provenientes de la tradición literaria.
D. Insertar fragmentos de otra narración que apoyan el desarrollo del cuento travesía que realizó
el héroe.
61. En el texto se dice que al dragón todo le ocurre de forma repentina y parece que todo le sucediera
por primera vez. Esto se debe a:
A. La condición de ignorancia que ha decidido adoptar y que le lleva a pensar que siempre vive en
el tiempo pasado.
B. La filosofía que maneja y que le impulsa a pensar que siempre debe vivir todo como si fuera la
primera vez.
C. La condición de ignorancia a la que es sometido y que le impide tener conciencia del tiempo y
de lo que ha vivido anteriormente.
D. La filosofía de la que es partidario, que le obliga a olvidar todo lo que ha vivido previamente.

62. En el enunciado: “Y entonces, súbitamente recordó haber comido ya algo parecido: cierto sabor
agrío y familiar… Pero, de la misma manera repentina, se olvidó”, la partícula subrayada permite
contraponer la acción de recordar y olvidar. Por la función que cumple esta palabra dentro del
texto, se puede categorizar como:
A. Conjunción condicional.
B. Conjunción comparativa.
C. Conjunción copulativa.
D. Conjunción adversativa.

RESPONDA LAS PREGUNAS 63 A 68 DE ACUERDO CON LA SIGUIENTE INFORMACIÓN

BREVE CODA SOBRE LOS CUENTOS FANTÁSTICOS


Julio Cortázar
Primera observación:
Lo fantástico como nostalgia. Toda suspensión of disbelief obra como una tregua en el seco implacable
asedio que el determinismo hace al hombre. En esa tregua, la nostalgia introduce una variante en la
afirmación de Ortega: hay hombres que en algún momento cesan de ser ellos y su circunstancia, hay
una hora en la que se anhela ser uno mismo y lo inesperado, uno mismo y el momento en que la puerta
que antes y después da al zaguán se entorna lentamente para dejarnos ver el prado donde relincha el
unicornio.
DEPARTAMENTO DE ANTIOQUIA
SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA
INSTITUCIÓN EDUCATIVA LICEO CAUCASIA
Segunda observación:
Lo fantástico exige un desarrollo temporal ordinario. Su irrupción altera instantáneamente el presente,
pero la puerta que da al zaguán ha sido y será la misma en el pasado y el futuro. Sólo la alteración
momentánea dentro de la regularidad delata lo fantástico, pero es necesario que lo excepcional pase
a ser también la regla sin desplazar las estructuras ordinarias entre las cuales se ha insertado. Descubrir
en una nube el perfil de Beethoven sería inquietante si durara diez segundos antes de deshilacharse y
volverse fragata o paloma; su carácter fantástico sólo se afirmaría en caso de que el perfil de
Beethoven siguiera allí mientras el resto de las nubes se conduce con su desintencionado desorden
sempiterno. En la mala literatura fantástica, los perfiles sobrenaturales suelen introducirse como cuñas
instantáneas y efímeras en la sólida masa de lo consuetudinario: así, una señora que se ha ganado el
odio minucioso del lector, es meritoriamente estrangulada a último minuto gracias a una mano
fantasmal que entra por la chimenea y se va por la ventana sin mayores rodeos, aparte de que en esos
casos el autor se cree obligado a proveer una “explicación” a base de antepasados vengativos o
maleficios malayos. Agregó que la peor literatura de este género es sin embargo la que opta por el
procedimiento inverso, es decir el desplazamiento de lo temporal ordinario por una especie de
“fulltime” de lo fantástico, invadiendo la casi totalidad del escenario con gran despliegue de cotillón
sobrenatural, como en el socorrido modelo de la casa encantada donde todo rezuma manifestaciones
insólitas, desde que el protagonista hace sonar el aldabón de las primeras frases hasta la ventana de
la bohardilla donde culmina espasmódicamente el relato. En los dos extremos (insuficiente instalación
en la circunstancia ordinaria, y rechazo casi total de esta última) se peca por impermeabilidad, se
trabaja con materias heterogéneas momentáneamente vinculadas pero en las que no hay ósmosis,
articulación convincente. El buen lector siente que nada tiene que hacer allí esa mano estranguladora
ni ese caballero que de resultas de una apuesta se instala para pasar la noche en una tétrica morada.
Este tipo de cuentos que abruma las antologías del género recuerda la receta de Edward Lear para
fabricar un pastel cuyo glorioso nombre he olvidado: Se toma un cerdo, se lo ata a una estaca y se le
pega violentamente, mientras por otra parte se prepara con diversos ingredientes una masa cuya
cocción sólo se interrumpe para seguir apaleando al cerdo. Si al cabo de tres días no se ha logrado que
la masa y el cerdo formen un todo homogéneo, puede considerarse que el pastel es un fracaso, por lo
cual se soltará al cerdo y se tirará la masa a la basura. Que es precisamente lo que hacemos con los
cuentos donde no hay ósmosis, donde lo fantástico y lo habitual se yuxtaponen sin que nazca el pastel
que esperábamos saborear estremecidamente.
Fragmento tomado de: “Del cuento breve y sus alrededores”, del libro: “Último round”,
Julio Cortazar. 1969, Siglo Veintiuno Editores.

63. De acuerdo con la estructura global, se puede considerar que el texto es:
A. Narrativo.
B. Descriptivo.
C. Argumentativo.
D. Informativo.

64. El propósito de Cortázar, al utilizar el símil de la nube con el perfil de Beethoven, es:
A. Demostrar dos ideas.
B. Sustentar una idea.
C. Oponer dos ideas.
D. Describir una idea.
DEPARTAMENTO DE ANTIOQUIA
SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA
INSTITUCIÓN EDUCATIVA LICEO CAUCASIA
65. Según Cortázar, el ejemplo de cuento de la señora que se ha ganado el odio minucioso del lector y
que es meritoriamente estrangulada a último minuto, constituiría una mala trama, porque en el
relato:

A. La situación irrumpe sin articulación entre lo habitual y lo fantástico.


B. Se reconoce un proceso de ósmosis entre lo real y lo fantástico.
C. Hay una insuficiente instalación narrativa de lo real en lo fantástico.
D. Hay desplazamiento de lo temporal por un “full-time” de lo fantástico.

66. “Sólo la alteración momentánea dentro de la regularidad delata lo fantástico, pero es necesario que
lo excepcional pasa a ser la regla sin desplazar las estructuras ordinarias…” En el fragmento
anterior, la frase subrayada se utiliza para planear una
A. Negación.
B. Oposición.
C. Afirmación.
D. Condición.

67. La expresión que recoge la variante hecha por Cortázar a la afirmación de Ortega: “Hay hombres
que en algún momento cesan de ser ellos y sus circunstancias”, podría ser:
A. El hombre es lo que es, y sólo lo que es.
B. El hombre está siempre determinado por el mundo circundante.
C. El hombre no sólo es lo que es, sino lo que anhela.
D. El hombre no siempre está determinado por sus circunstancias.

68. En el texto, la intención del autor es:


A. Formular principios para la interpretación de un cuento.
B. Mostrar diferentes perspectivas sobre qué es un cuento fantástico.
C. Mostrar su perspectiva sobre cómo se elabora el efecto de lo fantástico en un cuento.
D. Formular una crítica en contra de lo expuesto por Ortega.
DEPARTAMENTO DE ANTIOQUIA
SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA
INSTITUCIÓN EDUCATIVA LICEO CAUCASIA
DEMOCRACIA EN ATENAS PARTE
A:
Tucídides fue un historiador y militar que vivió en el siglo V, A.C., durante el período clásico griego. Nació en Atenas.
Durante la Guerra del Peloponeso ente Atenas y Esparta (431 a 404 A.C.) estuvo al mando de la flota cuya misión
consistía en proteger la ciudad de Anfípolis, en Tracia. Tucídides falló en llegar a la ciudad a tiempo, por lo que cayó
en las manos de Brasidas, el general espartano quien lo forzó a un exilio de 20 años. Esto le otorgó la oportunidad
de recolectar información detallada de las dos facciones de la guerra y la posibilidad de investigar para su obra
Historia de la Guerra del Peloponeso.

Tucídides es considerado como uno de los grandes historiadores de los tiempos de Atenas. Se enfoca en las causas
naturales y en la conducta de cada individuo, mas que en el destino o en la intervención divina para explicar la
evolución de la historia. En su obra, los hechos no se presentan como meras anécdotas, más bien, son explicados en
un intento por indagar por las razones que llevaron a los actores principales a actuar de esa manera. El énfasis de
Tucídides en la conducta de los individuos es la razón por la que él algunas veces introduce discursos ficticios: éstos
le ayudan a explicar las motivaciones de los personajes históricos.

PARTE B:
Tucídides le atribuye a Pericles (Siglo V A.C.), el legislador de Atenas, el siguiente discurso en honor a los soldados que
cayeron en el primer año de la Guerra del Peloponeso.

Nuestro sistema de gobierno no copia las leyes de nuestros estados vecinos; nosotros somos más bien el patrón de
los demás, que imitadores. Nuestro sistema se denomina Democracia, debido a que su administración depende de
las mayorías en lugar de las minorías. Nuestras leyes ofrecen igual derechos a todos en los asuntos privados, mientras
que el prestigio en la vida pública depende del mérito, más que por encima de la clase social.

La clase social no inhibe a una persona de ostentar cualquier cargo público (…). Y, al mismo tiempo en que no
intervenimos en los asuntos privados, no quebrantamos las leyes que regulan lo público. Guardamos obediencia a
quienes colocamos en posiciones de autoridad, y obedecemos las leyes, especialmente las leyes de protección del
oprimido, y aquellas leyes que no se encuentran escritas pero que son una vergüenza reconocida el quebrantar.

Aún más, proveemos muchísimas formas para el placer de la mente. Los juegos y sacrificios que celebramos durante
todo el año, y la elegancia de nuestros sitios privados de residencia, constituyen una fuente diaria de placer que
ayuda a desvanecer cualquier preocupación; mientras que los múltiples habitantes de la ciudad introducen los
productos del mundo en Atenas, de tal manera que para los residentes de Atenas, los frutos de otros países les son
tan familiares como los propios.

PREGUNTAS ABIERTAS DE LECTURA CRÍTICA:


De acuerdo con el texto de arriba sobre la Democracia en Atenas, responde las siguientes preguntas,
escribiendo en la HOJA DE RESPUESTAS, dentro de las dos líneas, sin salirte de ellas

69. Uno de los propósitos del discurso en la parte B consistía en honrar a los soldados caídos en el
primer año de la Guerra del Peloponeso. ¿Cuál fue OTRO propósito de este discurso?
70. ¿Quién escribió el discurso en la parte B? Refiérase al texto para justificar su respuesta en las líneas.
DEPARTAMENTO DE ANTIOQUIA
SECRETARIA DE EDUCACIÓN Y CULTURA DE ANTIOQUIA
INSTITUCIÓN EDUCATIVA LICEO CAUCASIA
71. La acción de tutela es un mecanismo que busca la ¿Qué debería tener en cuenta este último rector para que
protección inmediata de los derechos su proyecto tenga éxito?
fundamentales de los ciudadanos. Por tanto, esta se
A. Que los estudiantes aprendan sobre el proceso de
puede presentar ante un juez cuando:
reciclaje.
A. Se vulnera el derecho a la salud, porque está en B. Que solo debe ayudar a los niños que sobresalen
riesgo la vida de la persona. académicamente.
B. Alguien es expulsado de una agremiación, a C. Que el colegio no debe pedir una lista de útiles
pesar de estar al día en los pagos. escolares.
C. Se busca proteger un derecho colectivo de D. Que el colegio no debe exigirles uniformes a los
constituir juntas de acción comunal. estudiantes.
D. Se legisla sobre un derecho a la vida y el acceso 74.Según investigaciones recientes, en Colombia el 17% de las
a un trabajo digno para las personas. adolescentes entre los 15 y 19 años alguna vez han estado
embarazadas y el 14% ya son madres. Para enfrentar este
72. La gravedad de los transgénicos no radica en ser
problema se contemplan diferentes alternativas. Algunos
cancerígenos –lo cual no está demostrado
proponen incrementar de manera significativa el acceso de
científicamente-, temor este que puede alejarse con
los adolescentes a preservativos, instalando dispensadores
una simple etiqueta que indique su naturaleza, como
gratuitos en sitios públicos frecuentados por jóvenes. Otros
se hace actualmente en la Unión Europea. La
argumentan que lo mejor es incrementar las campañas de
gravedad de ellos está centrada en una disminución,
educación sexual en colegios públicos y privados. Respecto
hasta desaparecer casi totalmente, de la
a las dos soluciones propuestas, puede afirmarse que estas
investigación científica en nuestros países, puesto
son:
que no tiene sentido investigar plagas,
enfermedades, productividad y resistencia a A. Complementarias, pues tanto el acceso a los
condiciones adversas, cuando todo ello lo tienen preservativos como un mejor conocimiento sobre la
resuelto los transgénicos. Al desaparecer nuestra sexualidad son medidas que se refuerzan.
investigación, todos estos factores se volverán B. Innecesarias, pues ninguna de esas medidas puede
críticos y el sector entrará en colapso. reducir de manera significativa el índice de embarazos
Fuente: http://www.eltiempo.com/archivo/documento/MAM- en adolescentes.
460658

Del texto anterior se puede inferir que:


A. Los transgénicos producen daños irreversibles
en el organismo humano.
B. La agricultura crece en la medida en que los
transgénicos se universalizan.
C. La investigación en el desarrollo agrícola tiende
a disminuir considerablemente.
D. La investigación agrícola se beneficia
ostensiblemente con los transgénicos.
73.El rector de un colegio busca ayudar a los estudiantes de
bajos recursos económicos para que pudieran comprar los
útiles escolares y uniforme. Implementó entonces un
programa de recolección de los desechos reciclables en las
instalaciones del colegio. Con la venta de estos desechos
pudo recaudar dinero.
El rector de otro colegio quisiera ayudar a sus estudiantes
de la misma manera.
¡Por el Nivel Superior¡ - SIMULACRO 2 – SESION1 - PRUEBA TIPO SABER 11 – 27

C. Contradictorias, pues la educación sexual busca Sobre lo que buscan cada una de las organizaciones
primordialmente que los adolescentes no tengan que mencionadas se puede afirmar que:
acudir al uso de preservativos.
D. Contraproducentes, pues la educación sexual y la A. es semejante, porque las dos buscan el
disponibilidad de preservativos llevan a los aprovechamiento económico del humedal para el
adolescentes a tener más relaciones sexuales. bienestar de los campesinos.
B. es semejante, porque las dos buscan defender a toda
75.El Consejo Académico de un colegio decidió nombrar
costa las riquezas naturales de la región.
como representantes al Consejo Estudiantil a los
estudiantes con mejor desempeño académico y de C. es diferente, porque una defiende al ecosistema aunque
convivencia, en lugar de realizar las elecciones ordinarias. esto signifique no poder dar tierras a los campesinos y
De esta decisión se puede afirmar que: la otra quiere ayudarlos, aunque se dañe el ecosistema.
D. es diferente, porque una busca que los campesinos se
A. es importante porque estimula a los estudiantes a que asienten y trabajen en otra región y la otra busca que se
estudien y sean mejores compañeros. preserve el ecosistema del humedal.
B. dificulta la disponibilidad de tiempo para el desarrollo
normal de las actividades académicas. 78. Un programa impulsado por países europeos lleva varios
años apoyando a jóvenes bogotanos de estratos 1, 2 y 3
C. vulnera el derecho de los estudiantes a tener y utilizar
con buen manejo del inglés, para que creen sus propios
mecanismos de participación.
negocios. Después de 5 años de operación, detectan que
D. promueve en los estudiantes la comprensión de la el 30% de los negocios son restaurantes de comida
importancia del Consejo Estudiantil. internacional, 30% salones de belleza, 20% tiendas de ropa
formal, 10% librerías y 10% escuelas de baile. Ante el éxito
76. La violencia sexual contra las mujeres es un problema del proyecto, deciden abrir una convocatoria para replicar
mundial. Hace poco tiempo, el jefe de policía de una el modelo en Riohacha, Leticia, Arauca y Florencia.
ciudad muy importante, en un país desarrollado, declaró Basados en la experiencia bogotana, establecieron que en
al respecto: “Para evitar estas situaciones, lo mejor sería cada ciudad debían apoyarse las mismas tipologías de
que las mujeres dejaran de salir con minifaldas o escotes negocio y en los mismos porcentajes. Probablemente
provocadores a la calle. Así evitarían ser víctimas de acoso implementar este mismo modelo en estas ciudades, no
o violencia sexual”. resulte pertinente porque en ellas:
¿Qué intereses está favoreciendo esta declaración? A. los jóvenes no están interesados en hacer negocios sino
en estudiar.
A. Los de las mujeres, porque está aconsejándoles cómo
vestir para no ser víctimas. B. no es viable mantener un programa por tan largo
tiempo.
B. Los de los policías, porque su función no es la de
manejar casos de acoso. C. las necesidades de la población, lo que se demanda,
puede ser muy distinto.
C. Los de los agresores, porque está dándoles una
justificación a lo que hacen. D. los jóvenes no tienen buen dominio del inglés.
D. Los de la ciudad, porque el acoso sexual afecta la 79. El cabildo abierto es la posibilidad que tienen las
percepción de seguridad. comunidades para incidir en las decisiones públicas, esta
figura es propia de:
77. En una región de Colombia, una organización estatal A. la presidencia, la vicepresidencia y el gabinete
promueve proyectos de agricultura para la reintegración ministerial.
de campesinos desplazados. Con este objetivo, se B. las juntas de acción comunal y las alcaldías.
propone la utilización de unos terrenos que forman parte C. las gobernaciones departamentales y los sindicatos.
de un ecosistema de humedal. Una organización
D. las juntas de acción local y los consejos municipales.
ambientalista rechaza esta decisión porque afectará este
ecosistema. 80. La consulta popular es un mecanismo de participación
ciudadana en el cual:
A. a los ciudadanos se les da la opción de elegir con el voto.

Cisneros School 2014


¡Por el Nivel Superior¡ - SIMULACRO 2 – SESION1 - PRUEBA TIPO SABER 11 – 28

B. a los ciudadanos se les permite presentar proyectos interlocutor válido que representaba los intereses de esta
normativos. nación. Sin embargo, Palestina no se reconoce como un
C. a los ciudadanos se les pregunta por el alza anual de los Estado propiamente dicho, porque:
precios.
A. su estatus como observador en las Naciones Unidas le
D. a los ciudadanos se les pregunta sobre temas otorga derecho a voz pero no a voto.
específicos.
B. carece del reconocimiento internacional
81.Pekín y otras partes de China sufren de elevados niveles como territorio con fronteras perfectamente
de contaminación. Debido a la contaminación en Pekín, definidas.
algunos días las autoridades cancelan las actividades
C. en los territorios de Gaza y Cisjordania viven
deportivas en el exterior en colegios y guarderías y aproximadamente 230.000 colonos israelíes.
recomiendan a niños y ancianos que no salgan a la calle.
D. más de la mitad de la población palestina vive en
Aunque se han cerrado centenares de fábricas en la
Líbano y Jordania, en calidad de refugiada.
capital y en otros puntos del país, la situación no mejora.
Los expertos consideran que la única solución es que la 84. Lea atentamente los siguientes fragmentos:
segunda economía mundial reduzca de forma paulatina su
“Los años 1978-79 marcaron la renovación de la actividad
dependencia de las industrias pesadas y apueste por un
de las guerrillas tras años de crisis internas y apatía de la
modelo de energía mixta. Las industrias pesadas, entre
lucha armada. Siguiendo al M-19, las guerrillas
ellas los sectores de la construcción y el manufacturero,
intensificaron sus operaciones militares y de propaganda.
aportaron el 46 % del producto interior bruto (PIB) en
Frente al engrandecimiento del M-19, especialmente entre
2012. “China debería rebajar esta cifra hasta 9 puntos
las clases medias e intelectuales, las guerrillas entablaron
porcentuales entre 2013 y 2030 si quiere cumplir su
una especie de competencia donde cada una aspiraba a ser
objetivo de reducción de la contaminación”, señala un
la legítima depositaria de la oposición armada en un sistema
experto.
político tradicionalmente marcado por el bipartidismo entre
(Adaptado de: http://www.elpais.com.co/elpais/internacional/noticias/ conservadores y liberales”.
pese-medidas-pekin-y-parte-china-siguen-bajo-elevada-contaminacion).
Lair, Eric (2000). “Colombia: una guerra contra los civiles”.
En: Revista Colombia Internacional. No: 49-50
En esta situación, ¿qué consideraciones están en conflicto?
“Los cambios sucedidos durante los años noventa ponen de
A. La educativa y la ambiental. presente el enorme poderío militar alcanzado por la
B. La cultural y la educativa. guerrilla, sustentado en el hecho de que ha encontrado
C. La económica y la ambiental. fuentes de recursos económicos muy importantes (…) Para
D. La cultural y la económica. el caso colombiano es importante tener en cuenta que la
prolongación del conflicto armado tiene como fundamento
82.En la participación democrática los ciudadanos pueden
la autonomía adquirida por las guerrillas, sobre todo en el
participar en la dirección de su gobierno de manera
campo financiero, haciendo que tenga menor importancia
directa e indirecta, la forma de participación directa es:
la búsqueda de un mayor apoyo social y político, que es la
A. cuando el ciudadano por medio del voto nombra y/o necesidad inherente a toda guerrilla”.
escoge a otro ciudadano para que lo represente. Echandía Castilla, Camilo (2000) “El conflicto armado en Colombia en los
B. cuando el ciudadano es tenido en cuenta como años noventa: cambios en las estrategias y efectos económicos”. En:
Revista Colombia Internacional. No: 49-50
candidato o aspirante a alguna institución.
C. cuando el ciudadano protesta constantemente para Analizando estos fragmentos, que describen las
postularse como candidato para ser elegido. características del conflicto armado en Colombia en dos
D. cuando el ciudadano fomenta de manera activa y momentos históricos distintos, puede concluirse que:
dinámica en su comunidad e influye a los otros. A. los aspectos económicos son tan relevantes actualmente
83.En 1994, como parte del proceso de paz entre el gobierno para comprender el conflicto armado como lo fueron los
israelí y la Organización para la Liberación de Palestina aspectos políticos en la década de los 70’s.
(OLP), se llevaron a cabo los acuerdos de Oslo. La
Autoridad Nacional Palestina se creó como un

Cisneros School 2014


¡Por el Nivel Superior¡ - SIMULACRO 2 – SESION1 - PRUEBA TIPO SABER 11 – 29

B. las razones de los grupos guerrilleros para permanecer D. los cambios en el sistema político colombiano, a partir de
en armas no cambiaron sustancialmente entre finales de la Constitución de 1991, produjeron un cambio en la
la década de los años 1970 y finales la década de los 90’s. dinámica del conflicto armado interno.
C. las fuentes alternativas de financiación de los grupos
guerrilleros no han generado cambios sustanciales en sus LA PREGUNTA SIGUIENTE, SE RESPONDE DE ACUERDO CON EL
aspiraciones políticas. SIGUIENTE MAPA.

Cisneros School 2014


¡Por el Nivel Superior¡ - SIMULACRO 2 – SESION1 - PRUEBA TIPO 30
SABER 11 –

Cisneros School 2014


¡Por el Nivel Superior¡ - SIMULACRO 2 – SESION1 - PRUEBA TIPO SABER 11 – 31

85.Analizando este mapa, donde se muestra la densidad de mediano plazo, pero de lo que sí debemos estar seguros
población en distintas zonas del territorio colombiano, es que será un día que recordaremos pues partirá la
puede inferirse que: historia del mundo moderno en dos. Ojalá sea para bien y
por vez única la violencia, que siempre ha sido la partera
A. los centros urbanos de la costa Atlántica son mucho
de la historia, en este caso nos deje como hijo un mundo
menos poblados que los centros urbanos del interior
mejor en el que los terroristas no tengan cabida”.
del país.
http://www.eltiempo.com/archivo/documento/MAM-674965
B. las zonas selváticas del sur del país están más
densamente pobladas que las zonas costeras del litoral
Pacífico. ¿Con cuál de los siguientes acontecimientos de la historia
política contemporánea se relaciona, de manera más directa,
C. los centros urbanos de la zona Andina tiene mayor
este discurso?
densidad de población que los centros urbanos de la
zona suroriental del país.
A. La caída del muro de Berlín.
D. los territorios de frontera están más densamente
B. Los atentados con bombas nucleares a las poblaciones de
poblados que los territorios ubicados alrededor de la
Hiroshima y Nagasaki.
cordillera Central.
C. El golpe de Estado al presidente Mohamed Mursi en
86. Un Tratado de Libre Comercio (TLC) implica la eliminación Egipto.
de impuestos a los productos que dos países o más D. Los atentados del 11 de septiembre en Estados Unidos.
comercializan mutuamente. De este modo, el Estado
suprime una forma de protección a los productos 89.¿En cuál de las siguientes situaciones ejerce su labor un
nacionales. Una forma de proteger a los pequeños veedor ciudadano?
agricultores es que el Estado:
A. El comportamiento de los ciudadanos en vías públicas.
A. fomente el crédito bancario. B. Las sanciones de funcionarios públicos.
B. Invierta en alta tecnología. C. El gasto de dineros públicos en proyectos sociales.
C. Subsidie la producción. D. Las protestas de sindicalistas y estudiantes.
D. Congele el precio de la gasolina.
90.Para conceder un crédito, el Banco Mundial (BM) evalúa la
capacidad de pago de un país. Cuando se dice que el Estado
87. Un grupo de estudiantes quiere investigar sobre culturas está en déficit, es decir, tiene más egresos que ingresos, el
juveniles. ¿Cuál de los siguientes problemas está BM recomienda la reducción del gasto a través de:
relacionado con esta temática?
A. La captación de ahorro interno.
B. El pago de la deuda externa.
A. Preferencias musicales y artísticas de los jóvenes de
determinada región. C. El despido de funcionarios y empleados públicos.
B. Incidencia de jóvenes estudiantes en instituciones D. El fortalecimiento de la banca central.
educativas.
91.Los defensores de los productos transgénicos resaltan
C. Participación políica en jóvenes entre los 18 y los 20
como beneficios de estas semillas el hecho de que
años.
producen mayor resistencia a diferentes plagas y
D. Relación entre rendimiento académico y profesión de
enfermedades, unos rendimientos más altos, unas
los padres.
producciones de mayor calidad y mejor contenido
nutricional y una mayor tolerancia al calor, al frío y a las
88. “Muchos de nosotros recordaremos este día por el resto sequías. Para asegurar que estas semillas no ocasionen
de nuestros días. Para quienes no vivimos las dos grandes daño a la salud humana ni al medio ambiente, el
guerras mundiales del siglo pasado, quizás este sea el mecanismo más adecuado para su uso es:
hecho más grave que presenciemos, así sea por televisión,
a lo largo de nuestra vida. Aún no sabemos qué A. Una detallada evaluación de bioseguridad.
repercusiones militares, políticas y económicas tenga a

Cisneros School 2014


¡Por el Nivel Superior¡ - SIMULACRO 2 – SESION1 - PRUEBA TIPO SABER 11 – 32

B. La importación de semillas productivas de países A. En el país A, la tasa promedio de impuestos es 33 % del


industrializados. salario de los habitantes.
C. Una política de resiembra y expansión de estos cultivos. B. En el país B, el Gobierno autoriza aumentar el impuesto
D. La liberación comercial de estas tecnologías. del IVA.
92. El siguiente es un fragmento de un discurso pronunciado C. En el país C, el Gobierno quita los subsidios para los
por un líder social, ante la Asamblea General de las servicios públicos.
Naciones Unidas, el 3 de octubre de 1994. “En todo lo que D. En el país D, el Gobierno aumenta los impuestos de
hagamos tenemos que asegurar la cicatrización de las patrimonio y renta.
heridas que se infligieron a todo nuestro pueblo a través
de la gran línea divisoria impuesta a nuestra sociedad por 94.El socialismo busca la igualdad social, política y económica.
siglos de colonialismo y apartheid. Debemos garantizar Para alcanzar este propósito, propone:
que el color, la raza y el género sean sólo un don dado por
Dios a cada uno de nosotros y no una marca o un atributo A. privatizar los medios de producción y lograr desmontar
indeleble que otorgue a algunos una condición especial los sindicatos de las empresas transnacionales y
(…). El camino que tendremos que recorrer para llegar a multinacionales.
ese destino no será fácil. Todos sabemos con qué B. impulsar el consumo y la capacidad de endeudamiento
empecinamiento el racismo puede aferrarse a la mente y de los trabajadores como factores fundamentales para
con qué profundidad puede infectar el alma humana. dinamizar la economía.
Cuando está sostenido por el orden racial del mundo C. ofrecer bienes y servicios según el esquema de los
material, como fue en nuestro país, ese empecinamiento tratados de libre comercio y la apertura económica de las
puede multiplicarse 100 veces. Sin embargo, por dura fronteras nacionales.
que pueda ser esta batalla, no nos rendiremos. Sea cual D. lograr la tenencia colectiva de los medios de producción
fuere el tiempo que demande, no cesaremos. El hecho de y la consolidación del poder político en las clases
que el racismo degrada tanto al perpetrador como a la trabajadoras.
víctima nos exige que, para ser leales a nuestro
compromiso de proteger la dignidad humana, luchemos
hasta lograr la victoria”. 95. Un proceso anabólico es aquel en el que dos o más
moléculas se unen para formar un compuesto más
Con este discurso, el líder buscaba probablemente: complejo y un proceso catabólico consiste en reacciones de
A. exponer las secuelas sociales que ha dejado, en una degradación a partir de una molécula compleja para formar
nación, un dominio colonial violento y racista. otras más simples.
B. visibilizar los vínculos entre el racismo y la economía Las plantas y los árboles transforman el dióxido de carbono
que comprometieron el futuro de un país en vías de absorbiéndolo y convirtiéndolo en oxígeno, tal como se
desarrollo. representa en la siguiente reacción:
C. condenar el racismo, e informar que han emprendido
una lucha para erradicarlo y superar las secuelas que
ha dejado.
D. alertar sobre una violación sistemática de los Derechos
6CO2 + 6H2O 6CH2O + 6O2
Humanos por parte de invasores blancos en una nación
de gente de color. De lo anterior, se puede afirmar que:

93.Algunas tendencias del liberalismo promueven cobrar A. La fotosíntesis es un proceso catabólico, debido a que
mayores impuestos a la parte de la población que posee consiste en la degradación del gas carbónico con el agua
más recursos, y menores impuestos a aquellas personas para formar la glucosa y el oxígeno que emanan las
que posean menos. plantas.
B. La fotosíntesis es un proceso anabólico, porque dos
¿Cuál de las siguientes situaciones es compatible con lo
compuestos sencillos como el dióxido de carbono y el
anterior?
agua, producen una sustancia más compleja como lo es

Cisneros School 2014


¡Por el Nivel Superior¡ - SIMULACRO 2 – SESION1 - PRUEBA TIPO SABER 11 – 33

el monosacárido de la glucosa con desprendimiento de B. Contiene el colorante con el cual se logra la detección
oxígeno. del almidón.
C. La fotosíntesis es un proceso anabólico, porque en la C. Contiene más almidón que el que contiene la papa.
respiración celular se requiere de la glucosa para la D. Permite establecer el color esperado para la detección
producción de ATP en las mitocondrias, lo cual es una del almidón.
sustancia compleja. 98.En una especie de pato se pueden encontrar individuos con
D. La fotosíntesis es un proceso catabólico, porque la cuello corto e individuos con cuello largo, aunque hay una
reacción corresponde a un proceso de degradación de mayor cantidad de patos con cuello largo. En un
varias sustancias para producir la glucosa y el oxígeno experimento se aparearon una hembra y un macho de
que es una sustancia simple. cuello largo; de sus hijos 3/4 son de cuello largo y 1/4 son
de cuello corto.
96. Una estudiante encontró la siguiente información sobre
métodos anticonceptivos. De los genotipos de los padres puede afirmarse que

A. ambos padres eran heterocigotos.


B. el macho era heterocigoto y la hembra era homocigoto
recesivo.
C. el macho era heterocigoto y la hembra era homocigoto
dominante.
D. ambos padres eran homocigotos dominantes.

99.Una estudiante desea conocer las proteínas presentes en la


¿Qué método debería escoger la estudiante para sangre. Para ello, emplea una técnica que las separa de
protegerse de enfermedades de transmisión sexual y no acuerdo con su peso molecular y produce una respuesta en
quedar embarazada? diferentes instantes de tiempo cada vez que una proteína
es detectada.
A. El DIU, porque impide el paso de espermatozoides.
Ella obtiene los resultados mostrados en la siguiente gráfica,
B. Los óvulos, porque eliminan todos los
en donde cada pico representa una proteína diferente:
espermatozoides.
C. El diafragma, porque está hecho de látex.
D. Ninguno, porque éstos solamente
previenen el embarazo.

97. El objetivo de una práctica es la detección de almidón


en la papa, utilizando lugol como colorante. Se realizan
cuatro experimentos con las condiciones que se
muestran en la tabla:

Una proteína con peso molecular de 120 kDa podría


separarse en un tiempo:

A. Entre 25 y 35 minutos.
B. Entre 5 y 25 minutos.
En esta práctica, el experimento 4 es importante porque: C. Entre 35 y 45 minutos.
D. Después de 45 minutos.
A. Permite que el almidón se encuentre soluble.

Cisneros School 2014


¡Por el Nivel Superior¡ - SIMULACRO 2 – SESION1 - PRUEBA TIPO SABER 11 – 34

100. En un experimento se introducen en un frasco levaduras mantiene en su interior. Luego de unos minutos, al verlas
a 30ºC con glucosa como fuente de energía. Después de al microscopio, las levaduras presentan su coloración
un tiempo se agrega un colorante rojo que ingresa por normal y el medio se observa rojo. Con base en la
difusión a las células, el cual es tóxico para ellas si se
información anterior, ¿por qué las levaduras no se murieron con
el colorante?
A. Porque las levaduras lo utilizaron para la producción de
energía.
B. Porque las levaduras lo expulsaron utilizando energía.
C. Porque el colorante se degradó por la temperatura del medio.
D. Porque la toxicidad del colorante se redujo en presencia de
glucosa.

101. Un estudiante cree que la tasa fotosintética en las


plantas depende entre otros factores de
la concentración de CO2, y de la cantidad de luz disponible.
Para ello, él realiza el experimento que se muestra en el
siguiente dibujo.

El estudiante coloca los frascos en distancias diferentes a una


fuente de luz y cuenta el número de burbujas de
O2 que produce la planta por fotosíntesis en cada frasco. Con base
en esta información, ¿cuál de las siguientes gráficas mostraría los
resultados
esperados
por el

estudiante?

Cisneros School 2014


¡Por el Nivel Superior¡ - SIMULACRO 2 – SESION1 - PRUEBA TIPO SABER 11 – 35

102. Uno de los factores importantes para la conservación apropiada de los especímenes en los museos es mantener
determinadas condiciones ambientales del lugar donde se exponen y almacenan. Para realizar este control, los
encargados de las colecciones toman datos constantemente. En la tabla se muestran algunos
instrumentos de medición presentes en un museo.
consumidores terciarios si las plantas redujeran la
absorción de nitrógeno en el ecosistema?

A. Los consumidores terciarios no podrían consumir las


planas del ecosistema.
B. Se reduciría el número de consumidores terciarios en
el ecosistema.
Variable Temperatu Intensid Humeda p Voltaj Presión
de ra ad de la d H e atmosféri C. Los consumidores terciarios fijarían el nitrógeno
medid Luz ca presente en la atmósfera.
a D. Se transformará su nicho a consumidores de primer
grado.
¿Cuáles instrumentos son apropiados para medir las 105. En una secuencia de bases de ARN mensajero transcrito
condiciones ambientales que podrían deteriorar los se tiene: AUGCCCUCUAGUGGAGUAAUCCACUGGUAA, de
especímenes almacenados en las colecciones? acuerdo con lo anterior, la secuencia de ADN de donde
A. Higrómetro, barómetro y potenciómetro. fue tomado es:
B. Termómetro, voltímetro y luxómetro. A. TACGGGAGATCTCCTCATTAGCTGACCATT
C. Barómetro, potenciómetro y voltímetro. B. TACGGGAGATCACCTCATTAGGTGACCATT
D. Luxómetro, higrómetro y termómetro. C. UACGGGAGAUCACCUCAUUAGGTGACCAUU
103. Se sabe que los ratones pierden pelo si su dieta no D. TACGGGAGATCACCTCTAAAGGTGACCATT
contiene la vitamina inositol y por eso se ha especulado 106. Un grupo de cultivadores de lulo quiere evaluar cuál es
que el inositol puede prevenir la calvicie en los humanos. el efecto del fósforo en el suelo y de un hongo que se
Antes de iniciar un experimento para estudiar el efecto asocia con la raíz de las plantas, sobre el crecimiento de
del inositol en los hombres calvos, ¿cuál de las siguientes las plantas durante los primeros 15 días. Para lograrlo,
actividades sería la más apropiada? realizaron un experimento modificando las dos variables
A. Preguntarles a 50 personas calvas y a 50 personas con y evaluando el crecimiento de las plantas con base en su
abundante pelo si han consumido inositol, elaborar masa seca. Los resultados se muestran en la gráfica:
una gráfica y analizarla.
B. Formar 2 grupos con 50 ratones cada uno, darle
inositol sólo a uno de los grupos y ver qué pasa con el
pelo.
C. Establecer cuántas marcas de productos
farmacéuticos venden inositol para prevenir la
calvicie.
D. Investigar en libros y documentos si el metabolismo
del inositol es igual en humanos y en ratones.

104. El nitrógeno entra en las cadenas tróficas después de que


las plantas lo absorben del suelo y lo transforman en
proteínas. Los consumidores primarios obtienen el
nitrógeno al consumir las proteínas de las plantas. Con
base en esta información, ¿qué sucedería con los 107. Con los resultados obtenidos, los cultivadores
concluyeron que para asegurar plantas con mayor masa

Cisneros School 2014


¡Por el Nivel Superior¡ - SIMULACRO 2 – SESION1 - PRUEBA TIPO SABER 11 – 36

deben sembrar plantas con asociación del hongo en una


concentración de fósforo en el suelo cercana a 0,2 mg/L.
Con base en los resultados del experimento, se puede
afirmar que la conclusión anterior es:

A. Acertada, porque la concentración de 0,2 mg/L de


fósforo generó los mayores crecimientos en plantas
con la asociación del hongo.
B. Acertada, porque el fósforo es un nutriente esencial
para el crecimiento del hongo y la planta.
C. Equivocada, porque las plantas con la asociación del
hongo tuvieron un crecimiento significativo en todas las
concentraciones de fósforo.
D. Equivocada, porque las plantas sin la asociación con el
hongo tienen más masa a 0,2 mg/L comparadas con las
otras concentraciones.
108. La siguiente gráfica muestra las concentra ciones
normales de la hormona folículoestimulante (FSH)
responsable del desarrollo del folículo ovárico y la
hormona lutenizante (LH) responsable de la ovulación.

109. Un botánico encontró una especia de planta con hojas


Los anticonceptivos orales combinados son hormonas
(estrógenos y progestinas) cuya función es alterar la
secreción normal de las hormonas hipofisarias. Estos
anticonceptivos inhiben la producción de FSH y baja los
niveles de LH. Según esta información, ¿cuál de las
siguientes gráficas representa la actividad hormonal de una
mujer que consume anticonceptivos orales?

Cisneros School 2014


¡Por el Nivel Superior¡ - SIMULACRO 2 – SESION1 - PRUEBA TIPO SABER 11 – 37

B. Sustituir la glucosa del torrente sanguíneo por


hormonas.
C. Regular el funcionamiento del organismo a través de
la secreción de hormonas.
D. Producir energía para todo el organismo a través de la
degradación de la glucosa.

111. En un laboratorio se investiga el efecto de varios


medicamentos sobre diferentes organismos.
Se descubrió que estos medicamentos actúan sobre
determinadas partes de la célula, como se muestra en la
tabla.
Medicamento Efecto

Incrementa la de
X producción
cloroplastos.
Incrementa la producción de
W
mitocondrias.
Según la información anterior, ¿qué tipo de organismos
se beneficiarían con estos medicamentos?

A. Medicamento W: plantas y animales. Medicamento X:


grandes, raíces y tallos largos en un bosque donde hay solo animales.
poca entrada de luz y baja disponibilidad de nutrientes
B. Medicamento X: solo plantas. Medicamento W: solo
en el suelo.
animales.
¿Qué funciones se pueden relacionar con las características C. Medicamento W: solo plantas. Medicamento X: solo
que presenta esta especie de planta? animales.
D. Medicamento X: solo plantas. Medicamento W:
A. Acumular nutrientes y agua en las hojas.
plantas y animales.
B. Captar luz y nutrientes de forma eficiente.
C. Conservar mayor cantidad de agua. 112. La figura muestra la absorción de glucosa en una célula
D. Defenderse de los animales herbívoros. epitelial del intestino.

110. Un ejemplo del funcionamiento del sistema endocrino es:


Al disminuir la concentración de glucosa en la sangre se
segrega glucagón, una hormona que permite que el
azúcar almacenado en algunos músculos sea liberado en
el torrene sanguíneo. Por otro lado, si hay una alta
concentración de glucosa en la sangre, se produce
insulina, una hormona que disminuye los niveles de
glucosa en el torrente sanguíneo porque la almacena en
el hígado y los músculos.
La glucosa entra en las células epiteliales por transporte
Con base en la información anterior, ¿cuál de las siguientes
activo, el cual se lleva a cabo en un evento de
funciones se relaciona con el sistema endocrino?
cotransporte con sodio (Na+). Para que tenga lugar este
A. Responder con la producción de hormonas a todos los proceso se necesita una alta concentración extracelular
estímulos que recibe el organismo. de Na+ generada por la actividad de la bomba
sodiopotasio (Na+ - K+).
Cisneros School 2014
¡Por el Nivel Superior¡ - SIMULACRO 2 – SESION1 - PRUEBA TIPO SABER 11 – 38

¿Qué pasaría con el transporte de glucosa, si hubiera una D. El H2SO4, porque como su volumen es menor que el
que principalmente contienen ácido clorhídrico (HCl). El
tratamiento más común es el uso de antiácidos que
generalmente contienen hidróxido de aluminio, Al(OH)3,
que reacciona con el ácido clorhídrico como se muestra
en la siguiente reacción:

De acuerdo con lo anterior, los productos de esta


reacción son:

A. AlCl3 + 3H2
B. 2AlCl3 + 3H2
C. AlCl3 + 3H2O
D. AlCl + H2O
118. El etileno, CH2 = CH2, es uno de los contaminantes
ausencia de K+ en el ambiente extracelular de las células de la solución de HNO3 se encuentra más
epiteliales del intestino? concentrado.
A. El transporte de la glucosa sería normal por ser
independiente de la presencia de K+ 114. Observe la siguiente ecuación:
B. El transporte de glucosa se interrumpiría por AgNO3 + NaCl AgCl + NaNO3
disminución de Na+ extracelular.
C. El transporte de glucosa aumentaría al haber más Na+ Esta reacción química se clasifica como una reacción de:
disponible.
A. Sustitución simple, porque un solo elemento sustituye
D. El transporte de glucosa ocurriría solamente a través a otro en los productos.
de la bomba Na+ - K+
B. Doble sustitución, porque ocurre un intercambio de
113. En la extracción minera de oro se emplea cianuro de elementos.
sodio, zinc y ácidos fuertes durante el proceso de C. Sustitución simple, porque a partir de sustancias
purificación. Los ácidos fuertes que pueden emplearse simples se origina sustancias complejas.
son ácido sulfúrico (H2SO4) de una concentración D. Doble sustitución, porque a partir de sustancias
volumen-volumen del 78% o ácido nítrico (HNO3) que complejas se origina sustancias simples.
contenga 112 mL de ácido por cada 200 mL de solución. 115. Se realiza un experimento de solubilidad en donde el agua
Si en la extracción del oro se requiere usar el ácido de es el soluto y el alcohol es el disolvente, y se recolecta la
mayor concentración, ¿qué ácido debería emplearse? información en la siguiente gráfica:

A. El HNO3, porque como su volumen es mayor que el de


la solución de H2SO4 tiene una mayor concentración.
B. El H2SO4, porque la concentración volumenvolumen
del HNO3 es del 56%.
C. El HNO3, porque su concentración volumen-volumen
es del 112%.

Cisneros School 2014


¡Por el Nivel Superior¡ - SIMULACRO 2 – SESION1 - PRUEBA TIPO SABER 11 – 39

Si se mantiene la tendencia, del experimento se puede el aldehído también se oxida para producir un ácido
esperar que, en 110 g de agua, los alcoholes presentan el carboxílico. En la siguiente tabla se muestran los grupos
siguiente comportamiento: funcionales característicos de algunas funciones
orgánicas.
A. Más de diez átomos de carbono son insolubles y con
menos de cuatro son muy solubles.
B. Menos de cuatro átomos de carbono son insolubles.
C. Más de diez átomos de carbono son muy solubles.
D. Más de diez átomos y con menos de cuatro átomos de
carbono son insolubles.
116. El bronce es una aleación metálica de cobre y estaño
usada durante décadas en la fabricación de utensilios y
armas. Esta aleación contiene entre 3% y 20% de estaño,
lo que le brinda propiedades físicas y mecánicas diferentes
a las del cobre puro. Respecto al bronce, es correcto Teniendo en cuenta la información anterior, la serie
afirmar que este: de ecuaciones que representa la reacción descrita
para el etileno es: A.
A. Es una mezcla, porque tiene dos elementos que no
se encuentran combinados químicamente.
B. Es un elemento, porque al combinar el cobre y el
estaño se forma CuSn.
C. Es una mezcla, porque el cobre y el estaño no
pueden separarse por métodos físicos.
D. Es un elemento, porque el bronce se encuentra en la
tabla periódica.

117. La acidez estomacal se da por exceso de jugos gástricos

atmosféricos. En presencia de agua forma un alcohol


primario que a su vez se oxida para producir un aldehído;
Cisneros School 2014
¡Por el Nivel Superior¡ - SIMULACRO 2 – SESION1 - PRUEBA TIPO SABER 11 – 40

B.

C.

D.

119. En el laboratorio de bioquímica se analizan 3 muestras (R,


Spruebas para su identificación,
y T) que corresponden obteniéndose
a un azúcar, una los 121. Una estudiante dispone de los siguientes métodos de
proteína y un

almidón. Para su identificación se utilizan pruebas Podemos afirmar que cuando se apague el mechero:
estándar como son: a) El test de Lugol: que permite
reconocer almidones al dar coloración azul-morado, b) el A. Todo el oxígeno ha reaccionado y queda sin
reactivo de Felhing: que reconoce azúcares dando combustir 1 mol de etanol.
coloración naranja o rojo, y c) La prueba Xanto-proteica: B. Tanto el oxígeno como el etanol, han reaccionado
que como su nombre lo indica, identifica proteínas al del todo.
colorearlas de amarillo. C. Todo el oxígeno ha reaccionado y quedan 2/3 de
moles de etanol.
Para la determinación cualitativa se tomaron muestras de
D. Queda un remanente de 1/3 de moles de etanol.
cada sustancia y se efectuaron las correspondientes

siguientes resultados: A. Proteína, almidón y azúcar.


MUESTR PRUEBA DE IDENTIFICACIÓN B. Proteína, azúcar y almidón.
A LUGOL FELHING XANTO- C. Azúcar, almidón y proteína.
PROTEICA D. Almidón, proteína y azúcar.
R Negativa Negativ Amarillo
a 120. Dentro de una campana se tiene 1 mol de alcohol y 1 mol
S Azulmorad Negativ Negativ de oxígeno, según la ecuación de combustión del alcohol:
o a a
T Negativa Naranja Negativ
a
De acuerdo con las pruebas de identificación aplicadas se separación de mezclas en el laboratorio del colegio.
puede afirmar que R, S y T son respectivamente:
Cisneros School 2014
¡Por el Nivel Superior¡ - SIMULACRO 2 – SESION1 - PRUEBA TIPO SABER 11 – 41

MÉTODO DE Ella desea separar una mezcla de arena, agua y aceite.


SEPARACIÓN FUNDAMENTO Según la información anterior, ¿cuál sería el mejor
procedimiento para realizar esa separación?
Separación de dos o más
líquidos solubles entre sí y A. Destilar y luego cristalizar.
Destilación
que tienen diferentes puntos B. Cristalizar y luego decantar.
de ebullición. C. Filtrar y luego decantar.
Separación de un sólido D. Decantar y luego cristalizar.
soluble del líquido que lo
Cristalización
contiene, al forzar la
formación de cristales. 122. En un experimento, un sólido de identidad desconocida se
Separación de un sólido calienta y se mide su temperatura cada minuto hasta que
insoluble de un líquido, al se evapora, obteniendo la siguiente tabla:
Filtración
retener el sólido en un papel El acero es un material que contiene los elementos hierro y
poroso. carbono. Dos muestras distintas de acero tienen diferente
Separación de dos o más cantidades de estos elementos, pero ambas muestras
líquidos insolubles entre sí y
Decantación
que tienen diferentes
densidades.
tienen composición uniforme. Usando el diagrama anterior,
¿cómo clasificaría al acero?

A. Como mezcla homogénea, porque está formado por


diferentes elementos y es uniforme.
B. Como sustancia pura, porque tiene composición uniforme
y es un solo compuesto.
C. Como mezcla heterogénea porque está formado por
diferentes elementos.
D. Como sustancia pura, porque muestras distintas tienen
composiciones diferentes.

124. Se hace reaccionar los elementos Z y Y, y se obtiene el


compuesto ZY. De acuerdo con la información anterior,
es correcto afirmar que el compuesto ZY presenta un
enlace:

A. Iónico, porque la fuerza con que el elemento Y atrae


los electrones es tan alta que logra arrancar el
Para identificar el sólido se cuenta con los datos de la tabla:
electrón del átomo Z.
Temperatura de Temperatura de B. Covalente, porque el elemento Y atrae con la misma
Sustancia fuerza los electrones de Z, siendo idénticamente
fusión (ºC) ebullición (ºC)
compartidos.
Benceno 5.5 80.2
C. Iónico, porque la fuerza con que el elemento Z atrae
Agua 0 100
los electrones es tan alta que logra arrancar el
Acetonitrilo -15 82 electrón del átomo Y.
2-butanol -115 100

Cisneros School 2014


¡Por el Nivel Superior¡ - 42
SIMULACRO 2 – SESION1 - PRUEBA TIPO
SABER 11 –
¿A qué sustancia corresponde el sólido inicial? D. Covalente, porque aunque el elemento Z atrae con
más fuerza los electrones de Y, son idénticamente
A. Al benceno.
compartidos.
B. Al agua.
C. Al acetonitrilo. 125. La carga con la cual un átomo se enlaza con otro para
formar un compuesto se llama estado de oxidación y se
D. Al 2-butanol.
calcula a partir de las siguientes reglas:
123. La materia puede clasificarse analizando su composición 1. La sumatoria de los estados de oxidación por átomo, para
como se muestra en el diagrama: un compuesto eléctricamente neutro, debe ser = 0.
2. El estado de oxidación del hidrógeno es generalmente
1+
3. El estado de oxidación del oxígeno es generalmente 2-

De acuerdo con la anterior información en el ácido nítrico


(HNO3), el nitrógeno (N) tiene un estado de oxidación:

A. 1+ B. 4+ C. 5+ D. 6+

HASTA EL FINAL. Corrige los errores cometidos, y aumenta el


desempeño de la calificación final. ¡ÉXITO!
AHORA TE QUEDA TIEMPO PARA REVISAR DESDE EL COMIENZO

Cisneros School 2014