Banner ID#____________________
BIOL 0470 GENETICS
Final Exam
December 19, 2015
Question
1) (40 pts) ________________
2) (40 pts) ________________
3) (40 pts) ________________
4) (40 pts) ________________
5) (40 pts) ________________
TOTAL (200) ____________________
Adjusted Score ___________________
This is the final exam for BIOL 0470
Genetics.
Please put your Banner ID# on each
page of this exam.
By turning in this exam you indicate
your adherence to the Brown code of
ethics, agree that all work is your
own, and vouch that you have not
knowingly aided another student.
The exam consists of 5 questions for
a total of 200 points. You may use
the front and back of each page.
Make sure your answers, as opposed
to your scratch work, are clearly
labeled. If important material is on
the back of a page, please note this
on the front of the relevant page.
For problems involving numerical
calculations you will help yourself
and your TAs by showing the
numbers you use in your calculation
as well as the final answer.
If you have questions about the test
items, please ask one of the
instructors. Do not consult with
other test takers.
Good Luck!
Banner ID#____________________

QUESTION ONE (40pts) You are studying the human pedigree shown below in which
a rare mutation is segregating. The mutation gives rise to a progressive deafness and is
caused by a small deletion removing one gene.

(A) (4pts) What mode(s) of inheritance are consistent with the pattern of inheritance?
Provide a brief explanation.

(B) (4pts) Using your knowledge of the dosage compensation mechanism in humans,
explain how this pattern could potentially reflect XLR inheritance.

(C) (4pts) Assuming that the disease incidence is 1/100 in a given population (which
this pedigree is a part of), and AR inheritance, what is the risk of II-1 and II-2
having an affected child?
Banner ID#____________________

(D) (12pts) You subsequently learn that the locus for the deafness gene is subject to
paternal imprinting. Fathers methylate the DNA of the deafness gene during
spermatogenesis, which silences its expression in progeny from the paternally
inherited copy. Keep the original assumption that the disease is a very rare
disorder. With this information, mark the pedigree with the chromosomes, the
status of mutation at the deafness gene, and the silencing status. Use a black box
to indicate the presence of the deletion, and X to indicate the presence of the
silencing mark on the DNA. Your answer should explain the affected and
unaffected individuals, and the original unaffected carrier. The following
example below shows two ways of indicating an unaffected male:

(E) (2pt) Based on the paternal imprinting model, what are the risks of couple 1 (II-1,
II-2) and couple 2 (II-3, II-4) having an affected child?

(F) (2pt) Again, based on the paternal imprinting model, what are the risks of
couple 1 (II-1, II-2) and couple 2 (II-3, II-4) having an unaffected carrier?
Banner ID#____________________

(G) (12pts) You have a restriction enzyme cutting assay for methylation status for
the deafness locus. This restriction enzyme will only cut the DNA of the
unmethylated sequence. Some sites are never methylated and can always be cut
(labeled methylation INsensitive on map below). Other sites can be methylated
(labeled methylation sensitive on the map below)You obtain DNA from the
individuals in the pedigree, digest the DNA with the restriction enzyme, run it on
a gel, blot the gel and probe it with a piece of labeled DNA covering the entire
1KB region shown on the map below:

The map shows the position of the cutting sites, and the methylation sensitive site,
and the extent of the deletion on the wild type chromosome. Indicate the size(s) of
the expected bands on the gel from each individual by drawing in the band(s) of the
expected sizes from cutting genomic DNA with the enzyme.
Banner ID#____________________

QUESTION TWO (40pts) You are working with two Drosophila mutants that are
recessive autosomal. The brown (B) and tan (T) loci control the deposition of color
in the eye and are unlinked. Wild Type eyes are red. b/b animals have a brown
colored eye, and t/t individuals have a tan eye color. A double mutant lacks all eye
color (b/b;t/t).

(A) (4pts) You cross a brown-eyed animal to a tan-eyed animal. The F1 progeny are
then crossed to each other. What phenotypic ratios of progeny do you expect in
the F2 generation?

(B) (8pts) You also have a mutation in the eyeless gene (E), which is unlinked to the
B or T loci. Recessive mutations in eyeless (e) cause a complete lack of eye
tissue. You cross an eyeless (e/e) animal to a brown-eyed animal (b/b). The F1
animals are then crossed to each other. What phenotypic ratios of progeny do you
expect in the F2 generation? What genetic concept does this cross demonstrate
(briefly)?
Banner ID#____________________

(C) (8pts) You have obtained a suppressor of the eyeless phenotype. You name the
gene, Reverser (R), because the mutation restores normal eye development. It is
unlinked to the eyeless locus. Importantly, the suppressor mutation is dominant
(R) to the wild-type allele (r), and functions to make an R/r; e/e animal wild-type
for eyes. Importantly, R/R animals are embryonic lethal. You have a stock of
R/r;e/e animals. What is important about keeping this stock around? (i.e. who do
you cross to each other? Is the stock stable over time, balanced?)

(D) (8pts) You cross a R/r;E/e animal to another R/r;E/e animal. What phenotypic
ratios do you get in the progeny?
Banner ID#____________________

(E) (4pts) You learn that the brown and tan loci are far apart on opposite arms of the
third chromosome (the centromere is between them). They are far enough apart
that they appear unlinked. You take a brown tan double mutant stock and blast it
with X-rays. Among many mutated lines, you obtain a new stock that has some
interesting properties. When you cross the brown tan double mutant to a wild-
type stock, and cross the F1, the brown and tan loci now appear to be linked by
10mu (rather than unlinked) in the F2. You also see many unhatched eggs in the
F2 cross vials. Describe two types of mutations that could confer this strange
genetic behavior.

(F) (8pts) You look at the polytene chromosomes under the microscope and see a
pericentric inversion on the third chromosome. Given the mapping results in the
F2 offspring in part E (showing linkage of B and T loci at 10mu) draw a map of
the inversion chromosome that explains the new linkage. Explain briefly why
you get unhatched eggs.
Banner ID#____________________

QUESTION THREE (40 pts) Mutagenesis and reversion: the Ames test

Ten-fold serial dilutions of a saturated Salmonella culture were prepared using sterile
water. The number of colonies resulting from each 10µl “spot” of diluted culture is
shown below.

# of colonies on plate
Dilution
containing histidine
10-1 Too many to count
10-2 Too many to count
10-3 Too many to count
10-4 Too many to count
10-5 48
10-6 6
10-7 0
10-8 0

(A, 6 Points) Using these results, calculate the concentration of live cells (CFUs) in the
original Salmonella culture. Show your work and express your answer as a range of
CFUs/mL using two data points given in the table.

The following graph displays reversion rates for two different Salmonella typhimurium
strains, 1535 and 1538, in the presence of two different mutagens that were tested at
different concentrations. Both starting strains are his-, meaning that neither can grow
unless the growth medium provided is supplemented with histidine. In these
experiments, revertants capable of growth on media lacking histidine are identified.

The differences between the mutant strains are summarized in the following table:

Strain Affected Gene Nature of Mutation

T >C base substitution in HisG that results
1535 His G
in an amino acid substitution
A single nucleotide deletion in HisD that
1538 His D
results in a frameshift
Banner ID#____________________

Use the information in the graph to

answer the following questions
(B-E).

(B, 4 points) Of the two

Salmonella strains (TA1535 and
TA1538), which has a higher rate
of spontaneous reversion?

(C, 4 pts) Give the approximate

rate of spontaneous reversion in
that strain.

(D, 6 points) Does NaN3 cause reversion mutations in TA1538? Explain your answer by
citing data from the graph.

(E, 8 pts) Which of two mutagens is more likely to cause missense mutations? Why? Cite
data from the graph and information about the two strains in your answer.

The following table gives the wild type DNA sequence and amino acid sequence for a
region in the middle of the Salmonella typhimurium His G gene. It also gives the
sequence of the same region in the TA1538 strain.

Strain Sequence
Wild type cgcgcggacaccgcccggcaggccctgagc
R A D T A R Q A L S

TA1538 cgcgcggacaccgcc-ggcaggccctgagc

(F, 6 points) How does the mutation (deletion indicated by a dash) in TA1538 affect the
coding sequence of His D? Write the altered amino acid sequence (genetic code given on
next page).
Banner ID#____________________

(G, 6 points) Write the above DNA sequence (and the corresponding amino acid
sequence) including a mutation(s) likely to revert the His D mutation found in TA1538
after treatment with 4NOP. Circle the reversion mutation(s) in the DNA.
Banner ID#____________________

QUESTION FOUR (40 points)

Genetic Analysis of the lac operon.
This is a map of the E. coli lac operon:
Glucose must be absent for the Promoter (P) to be activated by cAMP-CAP. The operon
is induced by IPTG. I encodes the lac repressor protein, which can bind O and IPTG.
Fill in the missing information in the following chart (empty boxes). Each part (1-
6) represents an experiment. There are two different conditions for each experiment (A or
B). Your goal is to fill in the table with experimental observations that unambiguously
lead to the indicated conclusion. Each empty box is worth 1 point. The genotypes of the
strains used are listed after the experiment number. The endogenous alleles and those
donated by F’ factors are given. The presence or absence of glucose and IPTG in the
media is indicated (yes/no). Whether expression of active Z or Y protein is detected is
also given (yes = the enzyme activity is detected; no = the enzyme activity was not
detected).
The following alleles were used (use only these alleles):
+ = wild type for the gene/element
- = loss of the indicated gene/element.
p = a polar loss of function allele
Is = ‘super repressor’, disrupts ability of I gene product to bind IPTG

endogenous F' donated Experimental Experimental

alleles alleles conditions Observations
Y
Z enzyme
Glucose IPTG enzyme
Experiment I P O Z Y I P O Z Y activity Conclusion
(yes/no) (yes/no) activity
(yes/no)
(yes/no)
A yes
Presence of Glucose blocks
1 + + + + + none
induction of lac operon
B yes yes yes

A no yes Loss of O results in

2 + + none constitutive expression of
B no no structural genes

no yes Z and Y are endoded on the

3 + none same mRNA molecule. Z is 5'
no no of Y.

yes
4 + + + + - + + - - + O is cis-acting

no
The I gene product functions
5 + + + + + + - +
in trans
no

no yes Is represses the structural

6 s - - - - + + genes in presence of IPTG
no no no and functions in trans
Banner ID#____________________

QUESTIONS 5. Human Genetics and models to study human disease. Mary Claire
King and her collaborators accumulated data like the following fictitious data while
identifying the BRCA1 gene:
LOD Scores at given recombination frequencies
Marker 0.001 0.05 0.1 0.2 0.3
D17S61 0.06 1.02 2.02 4.72 1.53
D17S62 0.18 1.23 5.82 2.44 1.44
D17S63 -4.56 -3.01 -0.02 0.06 0.11
D17S64 2.37 6.78 2.67 1.52 0.89
D17S65 0.33 1.23 8.57 2.88 1.55

(A, 6 pts) Which marker(s) are not likely to be linked to BRCA1? Provide support for
your answer from the table.

(B, 6 pts) Which marker(s) are likely to be closest to BRCA1? Provide support for your
answer from the table.

You are interested in using CRISPR-CAS to produce mice with BRCA1 mutations
identified in human families. Here is a table from Miki et al., 1994, the paper that
reported the sequence of the human BRCA1 gene.
Banner ID#____________________

(C, 4 pts) You design a strategy that will take advantage CAS9 to initiate a double-
stranded break followed by repair by the non-homologous end-joining pathway. You
figure the mutation identified in Kindred 1910 will be easiest to start with. State your
reasoning in one sentence.

The following is an excerpt of the mouse BRCA1 sequence. There are a total of 1812
codons in the gene; codon 1756 is labeled:

gaa gtc aaa gga gat gtt gtg act gga aga aat cac caa ggt cca

agg cga tcc aga gaa tcc cgg gaa aag ctc ttc aag ggc cta cag
1756

gtc tat tgt tgt gag ccc ttc acc aac

(D, 8 pts) You seem to have gotten remarkably lucky. Write the sequence of the RNA
you will design to guide CAS9 to initiate a double-stranded break after the first
nucleotide in codon 1756. Circle the sequence CAS9 will use to bind the DNA in this
region (PAM sequence) before checking for complementarity to the guide RNA.

(E, 4 pts) You have perfected the technique of injecting custom CRISPR RNAs and
CAS9 protein into mouse zygotes. In previous experiments, 70% of animals derived from
injected zygotes carried mutation(s); 35% were homozygous. You inject 100 zygotes
with your BRCA1 CRISPR along with CAS9 and produce 60 adult animals. 40 are
heterozygous for the intended mutation; 0 are homozygous mutant. Propose an
explanation for your lack of success at producing homozygous mutant animals. Note: you
are really good at this – technical failure is not an acceptable explanation.

(F, 4 pts) All of the heterozygous mice develop tumors after 1-2 months. You reason this
phenotype is due to haploinsufficiency rather than gain-of-function of your engineered
mutant allele. Explain your reasoning in one sentence using the nature of the mutation
you engineered in your argument.
Banner ID#____________________

(G, 8 pts) Design a transgenic approach that will allow you to differentiate between
haploinsufficiency and gain-of-function. Explain the basic experimental approach in one
sentence and give an outcome that would support the haploinsufficiency model.