Академический Документы
Профессиональный Документы
Культура Документы
I. Oña, C. Casal, M. dela Paz, IRRI; Q. Zhang, Institute of Crop Breeding and
Cultivation, CAAS, Key Laboratory of Crop Genetics and Breeding, Ministry of
Agriculture, People’s Republic of China; F. Xie, and C.M. Vera Cruz, IRRI
A gene for bacterial blight (BB) resistance from Oryza rufipogon (RBB16) was
identified and designated as Xa23 (Zhang et al 1998). The near-isogenic lines
(NILs) introgressed with Xa23 gene were highly resistant to all strains of
Xanthomonas oryzae pv. oryzae from the Philippines, China, and Japan, and the
gene was expressed at all growth stages (Zhang et al 2001). The broad-spectrum
resistance of Xa23 makes it a potential donor in hybrid parental lines for hybrid
rice production where BB is a major constraint. To confirm the resistance
spectrum of the Xa23 gene, three lines with this gene—CA312, CBB23, and
IRBB23—were compared with single gene BB NILs and pyramid lines with a
combination of three to five Xa genes in the background of indica variety IR24 at
IRRI.
Plants at seedling (21 d after sowing [DAS]), maximum tillering (45 DAS),
and adult stages (75 DAS) were inoculated simultaneously with Xoo races 6
(PXO99) and 10 (PXO341). Xoo race 6 (PXO99) has broad-spectrum virulence to at
least eight individual Xa/xa genes (Xa1, Xa2, Xa3, Xa4, xa5, Xa7, xa8, Xa10, Xa11,
and Xa14) and has moderate virulence to Xa21. Xoo race 10 (PXO341) is virulent
to Xa21 but not to Xa4, xa5, and Xa7. The experiment, in randomized complete
block design with two replications, was conducted in the screenhouse; the plants
were inoculated using the standard leaf-clip method. BB severity was assessed at
10 d post inoculation (dpi) for 21-d-old plants and at 14 dpi for 45-d- and 75-d-
old plants by measuring the length (cm) of BB lesions (five leaves per plant for
each Xoo race). All lines were checked for Xa23 gene using 03STS1, a sequence-
tagged site (STS) marker and C189, an expressed-sequence tag (EST) marker
flanking the Xa23 gene at a distance of 0.4 cM and 0.8 cM, respectively (Fan et al
2006, Wang et al 2005).
BB was most severe in IR24, the susceptible check (see table). The lines
IRBB23, CBB23, and CA312 that carry the Xa23 gene showed high levels of
resistance to both PXO99 and PXO341 at three growth stages. Lesion length in
these lines was consistently short at all growth stages (range was from 0.22 cm to
2010 1
International Rice Research Notes (0117-4185)
Plant breeding
1.55 cm) when inoculated with the two diagnostic Xoo strains. The Xa23 lines
consistently showed very short lesions similar to those in pyramid lines IRBB60,
IRBB62, IRBB64, and IRBB66 in IR24 background containing three to five gene
combinations at all growth stages. The high level of resistance of lines with the
Xa23 gene was comparable with the combined resistance in IRBB lines with
various combinations of Xa4, xa5, Xa7, xa13, and Xa21, thereby confirming the
broad-spectrum resistance of Xa23.
Bacterial blight severity (based on lesion length, cm) of near-isogenic lines (NILs)
with single resistance (R) gene and pyramid lines carrying various combinations
of bacterial blight resistance genes at three growth stages.a
Line R gene Seedling stage Maximum tillering Adult stage
(21 DASb) stage (75 DAS)
(45 DAS)
PXO99 PXO341 PXO99 PXO341 PXO99 PXO341
CA312 Xa23 0.2 a 0.9 a 0.2 a 0.3 a 0.3 a 0.2 a
CBB23 Xa23 0.3 a 1.2 ab 1.5 ab 1.1 ab 1.0 a 0.9 a
IRBB23 Xa23 0.3 a 0.6 a 1.2 a 0.4 ab 0.3 a 0.5 a
IRBB13 xa13 6.0 b 14.7 e 3.9 c 23.3 e 2.1 ab 21.3 c
IRBB21 Xa21 5.9 b 12.3 e 7.9 d 15.8 d 4.3 b 11.5 b
IRBB4 Xa4 20.6 c 8.3 d 18.7 ef 4.0 c 11.1 c 2.4 a
IRBB5 xa5 19.7 c 2.3 abc 17.6 e 2.3 bc 9.7 c 1.4 a
IRBB7 Xa7 18.4 c 5.6 cd 20.1 f 3.6 c 15.6 d 0.5 a
IRBB60 Xa4+xa5+xa13+Xa21 1.7 a 0.3 a 1.9 ab 0.7 ab 0.9 a 0.3 a
IRBB62 Xa4+Xa7+Xa21 0.5 a 4.6 bc 6.1 d 0.5 ab 0.9 a 1.3 a
IRBB64 Xa4+xa5+Xa7+Xa21 1.6 a 0.2 a 3.3 bc 0.8 ab 1.6 ab 0.3 a
IRBB66 Xa4+xa5+Xa7+xa13+Xa21 1.0 a 0.2 a 0.9 a 0.3 ab 0.4 a 0.5 a
IR24c Xa18d 20.6 c 19.9 f 19.3 ef 21.4 e 14.9 d 20.7 c
aMeans of lesion length within a column followed by different letters are significantly different at
P<0.05. bDays after sowing. cIR24 is the genetic background of all IRBB NILs and pyramid lines.
CBB23 is an indica line; CA312 is in a japonica background. dSusceptible against all known
Xanthomonas oryzae pv. oryzae races in the Philippines.
Using STS markers (see figure, A) and EST markers (see figure, B), the
presence of Xa23 allele (red arrow) in CA312, CBB23, and IRBB23 was confirmed.
The resistance to PXO99 and PXO341 in these lines was associated with the Xa23
gene. As expected, the Xa23 allele was not present in any of the IRBB lines used
in this study and in IR24, whereas CA312, CBB23, and IRBB23 did not carry any
of the five Xa genes in the IRBB pyramid lines.
2010 2
International Rice Research Notes (0117-4185)
Plant breeding
IRBB13
IRBB21
IRBB23
IRBB60
IRBB62
IRBB64
IRBB66
CBB23
CA312
IRBB4
IRBB5
IRBB7
1Kb+
1Kb+
IR24
1650 bp
S R S S S S S R S S S S R
1000 bp
B
IRBB13
IRBB21
IRBB23
IRBB60
IRBB62
IRBB64
IRBB66
CBB23
CA312
IRBB4
IRBB5
IRBB7
1Kb+
1Kb+
IR24
S R S S S S S R S S S S R 1000 bp
850 bp
650 bp
Detection of Xa23 allele in near-isogenic lines and pyramid lines for bacterial blight resistance. Polymorphic
PCR products using (A) 03STS1 STS marker (03STS1 forward primer: 5’ – CTCGGTTTCCGTCTTCTCAG – 3‘; 03STS1
reverse primer: 5’ – GACTTTGCGTGCTTTCCAGC – 3’) showing a ~ 1.1 Kb R allele (red arrow) and a ~ 1.2 Kb S
allele; and (B) C189, EST marker (C189 forward primer : 5’ – TAAGTTCTACATCGACCCCA – 3‘; C189 reverse
primer: 5’ – CACATGAAGAGCTGGAAACG – 3’) showing a ~ 800 bp R allele (red arrow) and a ~ 900 bp S
allele.
References
Fan YL, Chen XW, Wang CL, Zhu LH, Zhang Q, Zhao KJ. 2006. Mapping the rice bacterial blight
resistance gene Xa23 with RFLP markers and converting RFLP to STS marker. Acta
Agron. Sin. 32(6):931-935.
Wang CL, Qi HX, Pan HJ, Li JB, Fan YL. Zhang Q, Zhao KJ. 2005. EST-marker flanking the rice
bacterial blight resistance gene Xa23 and their application in marker-assisted selection.
Sci. Agric. Sin. 38(10):1996-2001.
Zhang Q, Lin SC, Zhao BY, Wang CL, Yang WC, Zhou YL, Li DY, Chen CB, Zhu LH. 1998.
Identification and tagging a new gene for resistance to bacterial blight (Xanthomonas
oryzae pv. oryzae) from O. rufipogon. Rice Genet. Newsl. 15:138-141.
Zhang Q, Wang CL, Zhao KJ, Zhao YL, Vera Cruz CM, Zhu XD, Li DY, Jiang QX. 2001. The
effectiveness of advanced rice lines with new resistance gene Xa23 to rice bacterial blight.
Rice Genet. Newsl. 18:71-72.
2010 3
International Rice Research Notes (0117-4185)