Annex1B to DepEd Order No. 42, s.
2016
GRADES 1 to 12
DAILY LESSON LOG
I. OBJECTIVES
A. Content Standards
B. Performance Standards
C. Objectives/Learning
Competencies
II. CONTENT
A. References/ Learning Resources
IV. PROCEDURES
A. Reviewing previous lesson or
presenting the new lesson
B. Establishing a purpose for the organelle are defined by its physical properties.
lesson
C. Presenting examples/ instances
of the new lesson
D. Discussing new concepts and
practicing new skills #1
E. Discussing new concepts and
practicing new skills #2
School CLAVER NATIONAL HIGH SCHOOL-SHS Grade Level 12
Teacher ROYLENE MAE E. SAMONTINA Learning Area GENERAL BIOLOGY 1
Teaching Dates and Time September 16-20, 2019 Semester 1st
Session 1 Session 2
(GRADE 12 – GRACIOUSNESS M,T,W(10::45-11:45) ((GRADE 12 – GRACIOUSNESS F(10::45-11:45)
The learners demonstrate an understanding of the structures and functions of biological molecules (i.e., carbohydrates, lipids, nucleic acids, and proteins)
The learners shall be able to identify key structural features of biological molecules that are important for their functions (e.g., 5’ and 3’ OH of DNA, 2’ OH of RNA, complementary
base pairing, N and C termini of proteins, R groups of the different amino acids, etc.).
 discuss the different levels of protein structure (i.e., primary, secondary, tertiary,  discuss structural and functional differences between DNA and RNA
and quaternary)  discuss key structural features of DNA, RNA, and proteins
 discuss how protein structural features may influence their functions
AMINO ACIDS AND PROTEINS PT. 2
Teaching Guide
Curriculum Guide
Campbell, N.A. et. al. (2008). Biology 8th Edition Pearson International. Pearson/Benjamin Cummings Publishing.
Reece, J.U. (2011). Campbell Biology, 9th ed. San Francisco, CA: Pearson Benjamin Cummings
Direct Instruction Interactive Discussion:
1. Facilitate a review on the cell and its organelles. Emphasize that the specific The teacher will discuss the different terms that were introduced using power
functions for each organelle type are compartmentalized and that the functions of each point presentation.
Elaborate on the main functions of the biomolecules:
2. Explain to the learners that the lesson will focus on understanding the important • DNA—is the repository of genetic information
physical properties of certain biomolecules (i.e., DNA, RNA and proteins) and how these • RNA—serve as the transcripts and regulators of expressed genetic information
properties allow the biomolecules to serve specific functions within the cell. • Proteins—are the functional products and executors of cellular functions
3. Discuss the Central Dogma of Molecular Biology: DNA RNA Proteins.
MOTIVATION (5 MINS)
1. Divide the class into groups and instruct them to identify or enumerate the
most important functions of DNA, RNA, and proteins.
2. Consolidate the learners’ responses on the board.
F. Developing mastery
(Leads to Formative Assessment 3)
G. Finding practical applications of
concepts and skills in daily living
H. Making generalizations and
abstractions about the lesson
I. Evaluating learning
EVALUATION (10 MINS) PRACTICE (5 MINS)
Given the following coding sequence for DNA, provide the sequence of the
Ask the learners to identify the type of biomolecule represented by a given chain
structure: • DNA • RNA • Protein complementary (template) sequence.
Coding sequence:
You may ask the learners to identify the important structural features in these chain
structures. The features are listed in Table 1 in the Instruction/ Delivery section of this 5’ ATGCATAGATTAGGATATCCCAGATAG 3’
Teaching Guide. ENRICHMENT (5 MINS)
 J. Additional activities for application A similar exercise of generating non-coding sequences (DNA), transcripts (RNA), and Convert the given coding sequence into an mRNA transcript: Complementary Non-
or remediation translated polypeptides may be performed to test the learners’ understanding of the coding / Template sequence: 3’ TACGTATCTAATCCTATAGGGTCTATC 5’
topic. 2. Translate the given mRNA transcript into a polypeptide sequence: Coding sequence
~ mRNA transcript: 5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’

V. REMARKS
Reflect on your teaching and assess yourself as a teacher. This about your student’s progress this week. What works? What else needs to be done to help the students learn? Identify what help your
VI. REFLECTION instructional supervisors can provide you so when you meet them, you can ask them relevant questions.

Prepared by: Checked by: Noted by: Approved by:

ROYLENE MAE E. SAMONTINA NOEL D. PECATO MARIA M. ACELO MARISOL M. GALIDO

SHS T-II MT – I, SHS Coordinator Sec. School Head Teacher IV Sec. School Principal V

Annex1B to DepEd Order No. 42, s.2016

GRADES 1 to 12
DAILY LESSON LOG
I. OBJECTIVES
A. Content Standards
B. Performance Standards
C. Objectives/ Learning 1. Identify the geographic, linguistic and ethnic dimensions of Philippine literary
Competencies
II. CONTENT
III. LEARNING RESOURCES
A. References/ Learning Resources
IV. PROCEDURES
A. Reviewing previous lesson or
presenting the new lesson
B. Establishing a purpose for the
lesson
C. Presenting examples/ instances
of the new lesson
D. Discussing new concepts and
practicing new skills #1
School Agusan National High School-SHS Grade Level 11
Teacher Jean Albie B. Sitcharon Learning Area 21st Century Literature
Teaching Dates and Time June 26 & 28, 2017 (6:00am-12:00nn) Semester 1st
Session 1 Session 2
( 11- C.S. Lewis (6am-8am),11- Jobs (8am-10am), 11-Voltaire (10am-12nn) ) ( 11- C.S. Lewis (6am-8am),11- Jobs (8am-10am), 11-Voltaire (10am-12nn) )
Objectives must be met over the week and connected to the curriculum standards. To meet the objectives, necessary procedures must be followed and if needed, additional lessons, exercises, and
remedial activities may be done for developing the content knowledge and competencies. These are assessed using Formative Assessment Strategies, Valuing objectives support the learning of
content and competencies and enable children to find significance and joy in learning the lessons. Weekly objectives shall be derived from the curriculum guides.
The learner will be able to understand and appreciate the elements and context The learner will be able to understand and appreciate the elements and
of 21st Century Literature of the Philippines and the World. context of 21st Century Literature of the Philippines and the World.
The Learner will be able to demonstrate understanding and appreciation of 21 st The Learner will be able to demonstrate understanding and appreciation of
Century Literature from the Philippines and the World through: 21st Century Literature from the Philippines and the World through:
1. A written close analysis and critical interpretation of a literary text in 3. A written close analysis and critical interpretation of a literary text in
terms of form and theme, with a description of its context derived from terms of form and theme, with a description of its context derived
research; and from research; and
2. An adaptation of a text into other creative forms using multimedia. 4. An adaptation of a text into other creative forms using multimedia.
1. Identify the geographic, linguistic and ethnic dimensions of Philippine
history from pre-colonial to the contemporary; literary history from pre-colonial to the contemporary;
2. Identify representative texts and authors from each region (e.g. engage in 2. Identify representative texts and authors from each region (e.g. engage in
oral history research with focus on key personalities from the student’s region/ oral history research with focus on key personalities from the student’s
province/ town; and region/ province/ town; and
Value contributions of local writers to the development of regional literary Value contributions of local writers to the development of regional literary
traditions. traditions.
Content is what the lesson is all about. It pertains to the subject matter that the teacher aims to teach. In the CG, the content can be tackled in a week or two.
Introduction to 21st Century Literature From the Philippines and the World Introduction to 21st Century Literature From the Philippines and the World
List the materials to be used in different days. Varied sources of materials sustain children’s interest in the lesson and in learning. Ensure that there is a mix of concrete and manipulative materials
as well as paper-based materials. Hands-on learning promotes concept development.
Textbook: 21st Century Literature from the Philippines and the World by Marikit Textbook: 21st Century Literature from the Philippines and the World by
Tara A. Uychoco. Marikit Tara A. Uychoco.
Internet: google.com, slideshare.net, deped.gov.ph Internet: google.com, slideshare.net, deped.gov.ph
These steps should be done across the week. Spread out the activities appropriately so that students will learn well. Always be guided with demonstration of learning by students which you can
enter from formative assessment activities. Sustain learning systematically by providing students with multiple ways to learn new things, practice their learning, question their learning processes,
and draw conclusions about what they learn in relation to their life experiences and previous knowledge. Indicate the time allotment fo googr each step.
• Review on the previous topic. (5 minutes)
 The teacher will ask questions: (June 26, 2017 was a Holiday. The activities that should have been given on
 What is literature? that date will be done in this session/ meeting)
 What can you say about the Literature here in the Philippines?
 Describe the 21st Century Literature. How is it different from the other The class will be grouped into 5 for the reporting.
forms of literature? Rubrics for evaluation and scoring will be prepared by the teacher.
 Give examples of literature that is popular in today’s generation.
 E. Discussing new concepts and
practicing new skills #2
F. Developing mastery
(Leads to Formative Assessment 3)
G. Finding practical applications of
concepts and skills in daily living
H. Making generalizations and
abstractions about the lesson
I. Evaluating learning
J. Additional activities for application
or remediation
V. REMARKS
VI. REFLECTION
A. No. of learners who earned 80% in
the evaluation
B. No. of learners who require additional
activities for remediation who scored
below 80%
C. Did the remedial lesson work? No. of
learners who have caught up with the
lesson
D. No. of learners who continue to
require remediation
E. Which of my teaching strategies
worked well? Why did these work?
F. What difficulties did I encounter which
my principal or supervisor can help me
solve?
G. What innovation or localized materials
did I use/discover which I wish to share
with other teachers?
Annex1B to DepEd Order No. 42, s.2016
GRADES 1 to 12
 Where can we find these kinds of texts or books?
 The teacher will group the class into five. Each group will be given a Individual Activity:(Assignment)
topic that they need to report in the next session/ meeting.
 Group 1: Reading and Revolution: The revolution According to Map your family tree.
Raymundo Mata Try to find out who your relatives are as far back as your great-great-
 Group 2: The Death of A Hero: Padre Faura Witnesses the Execution of grandfather, if possible.
Rizal Draw your family tree, and beside the names of your relatives, make a sketch
 Group 3: Authoritarianism: Apo on the Wall by PJ Patino of the historical events that happened in their lifetime.
 Group 4: Survival: The Safe House
 Group 5: Poverty: Lengua Para Diablo (The Devil Ate My Words)
Reflect on your teaching and assess yourself as a teacher. This about your student’s progress this week. What works? What else needs to be done to help the students learn?
Identify what help your instructional supervisors can provide you so when you meet them, you can ask them relevant questions.
The learners who got 80% in the evaluation are majority of the students in the sections I handled. They all listened to the discussion and actively participated in
the class activities.
There are only a very few learners who got scores below 80%. Some of them were having problems in the spelling and were not careful in following the
directions given in the activities/ quizzes.
The remedial lessons worked effectively for those who had some difficulty in coping up with the lessons. Those students were absent in the time of the
discussions/activities but eventually they were able to cope up with the advanced learners. I let the students work in groups in order for the advanced learners
to guide and tutor some of the learners who had difficulties. This occurrence is beneficial for both parties.
Fortunately, all learners were able to cope up with the lessons and nobody is left behind to do further remedial classes.
As I have noticed, scaffolding and implementing group activities worked well in most of my classes. The students were properly guided on the lesson and
everyone enjoyed learning and working in groups. They were also able to learn by themselves and make use of their skills and prior knowledge.
The major thing that I want to provide for my students is adequate number of books and learning materials which the school lacks. Learning would be more
effective if each student could have their own set of books to work on and use as reference.
Each teacher has his/her own way and tools to help him/her effectively pass on the knowledge and skills the learner should acquire for their advantage in this
globally competitive world. These tools and ways are not foreign to anybody and almost all teachers had used most of these already. But if ever I could discover
anything that would benefit the learners in this school, I would be glad to share it with my fellow teachers.
School Agusan National High School-SHS Grade Level 11
Teacher Jean Albie B. Sitcharon Learning Area 21st Century Literature
DAILY LESSON LOG
I. OBJECTIVES
A. Content Standards
B. Performance Standards
C. Objectives/ Learning 1. Identify the geographic, linguistic and ethnic dimensions of Philippine literary
Competencies
II. CONTENT
III. LEARNING RESOURCES
A. References/ Learning Resources
IV. PROCEDURES
A. Reviewing previous lesson or
presenting the new lesson
B. Establishing a purpose for the
lesson
C. Presenting examples/ instances background knowledge about the literary piece assigned to them.
of the new lesson
D. Discussing new concepts and What do you know about the publication Noli Me Tangere?
practicing new skills #1
E. Discussing new concepts and when the Noli was published in 1887?
practicing new skills #2
Teaching Dates and Time July 3 & 5, 2017 (6:00am-12:00nn) Semester 1st
Session 1 Session 2
( 11- C.S. Lewis (6am-8am),11- Jobs (8am-10am), 11-Voltaire (10am-12nn) ) ( 11- C.S. Lewis (6am-8am),11- Jobs (8am-10am), 11-Voltaire (10am-12nn) )
Objectives must be met over the week and connected to the curriculum standards. To meet the objectives, necessary procedures must be followed and if needed, additional lessons, exercises, and
remedial activities may be done for developing the content knowledge and competencies. These are assessed using Formative Assessment Strategies, Valuing objectives support the learning of
content and competencies and enable children to find significance and joy in learning the lessons. Weekly objectives shall be derived from the curriculum guides.
The learner will be able to understand and appreciate the elements and context The learner will be able to understand and appreciate the elements and
of 21st Century Literature of the Philippines and the World. context of 21st Century Literature of the Philippines and the World.
The Learner will be able to demonstrate understanding and appreciation of 21 st The Learner will be able to demonstrate understanding and appreciation of
Century Literature from the Philippines and the World through: 21st Century Literature from the Philippines and the World through:
1. A written close analysis and critical interpretation of a literary text in 3. A written close analysis and critical interpretation of a literary text in
terms of form and theme, with a description of its context derived from terms of form and theme, with a description of its context derived
research; and from research; and
2. An adaptation of a text into other creative forms using multimedia. 4. An adaptation of a text into other creative forms using multimedia.
1. Identify the geographic, linguistic and ethnic dimensions of Philippine
history from pre-colonial to the contemporary; literary history from pre-colonial to the contemporary;
2. Identify representative texts and authors from each region (e.g. engage in 2. Identify representative texts and authors from each region (e.g. engage in
oral history research with focus on key personalities from the student’s region/ oral history research with focus on key personalities from the student’s
province/ town; and region/ province/ town; and
Value contributions of local writers to the development of regional literary Value contributions of local writers to the development of regional literary
traditions. traditions.
Content is what the lesson is all about. It pertains to the subject matter that the teacher aims to teach. In the CG, the content can be tackled in a week or two.
Reading and Revolution: The Revolution According to Raymundo Mata The Death of a Hero: Padre Faura Witnesses the Execution of Rizal
List the materials to be used in different days. Varied sources of materials sustain children’s interest in the lesson and in learning. Ensure that there is a mix of concrete and manipulative materials
as well as paper-based materials. Hands-on learning promotes concept development.
Textbook: 21st Century Literature from the Philippines and the World by Marikit Textbook: 21st Century Literature from the Philippines and the World by
Tara A. Uychoco. Marikit Tara A. Uychoco.
Internet: google.com, slideshare.net, deped.gov.ph Internet: google.com, slideshare.net, deped.gov.ph
These steps should be done across the week. Spread out the activities appropriately so that students will learn well. Always be guided with demonstration of learning by students which you can
enter from formative assessment activities. Sustain learning systematically by providing students with multiple ways to learn new things, practice their learning, question their learning processes,
and draw conclusions about what they learn in relation to their life experiences and previous knowledge. Indicate the time allotment fo googr each step.
• The Family Tree will be posted on the board and there will be a brief Review about the previous topic.
discussion about it. Motivation: What do you know about Rizal? What do you feel about Rizal?
• The teacher will let the first group report their topic. Why do people often compare and contrast Rizal and Bonifacio?
The group will first have an introduction about the author and some
Semantic Mapping:
Questions to be raised: With a classmate, create a semantic map about everything you know about
Rizal, and all of his achievements and contributions to the Philippine society.
Do you think that novels in the Philippines are as important as they used to be The teacher will show how a semantic map looks like.
F. Developing mastery
(Leads to Formative Assessment 3)
G. Finding practical applications of
concepts and skills in daily living
H. Making generalizations and
abstractions about the lesson
I. Evaluating learning
J. Additional activities for application
or remediation
V. REMARKS
VI. REFLECTION
A. No. of learners who earned 80% in
the evaluation
B. No. of learners who require additional
activities for remediation who scored
below 80%
C. Did the remedial lesson work? No. of
learners who have caught up with the
lesson
D. No. of learners who continue to
require remediation
E. Which of my teaching strategies
worked well? Why did these work?
F. What difficulties did I encounter which
my principal or supervisor can help me
solve?
G. What innovation or localized materials
did I use/discover which I wish to share
with other teachers?
GRADES 1 to 12
DAILY LESSON LOG
The discussion about the topic begins. The teacher will observe and just guide Viewing;
the reporting but everything is solely focused on the students. Look for the Joey Ayala song Mi Ultimo Adios, with English subtitles on
Youtube.
Activities will be given related to the topic.
(example)Small group activity: With a small group, create a poster showing the Evaluation: In a small group, write and perform a song about Jose Rizal. You
relationship between reading and revolution in the past, and the importance of may use lines from either Rizal or Remoto’s poem. The rubrics in grading your
reading and society in the present day. On a piece of paper, write the title of song will be as follows:
your poster and your insights about the importance of reading and nurturing a  40 % creativity
nation of readers. Display the poster around your classroom, and look at the  40% Critical Thinking
posters made by the rest of the class.  20% Melody
Reflect on your teaching and assess yourself as a teacher. This about your student’s progress this week. What works? What else needs to be done to help the students learn?
Identify what help your instructional supervisors can provide you so when you meet them, you can ask them relevant questions.
The learners who got 80% in the evaluation are majority of the students in the sections I handled. They all listened to the discussion and actively participated in
the class activities.
There are only a very few learners who got scores below 80%. Some of them were having problems in the spelling and were not careful in following the
directions given in the activities/ quizzes.
The remedial lessons worked effectively for those who had some difficulty in coping up with the lessons. Those students were absent in the time of the
discussions/activities but eventually they were able to cope up with the advanced learners. I let the students work in groups in order for the advanced learners
to guide and tutor some of the learners who had difficulties. This occurrence is beneficial for both parties.
Fortunately, all learners were able to cope up with the lessons and nobody is left behind to do further remedial classes.
As I have noticed, scaffolding and implementing group activities worked well in most of my classes. The students were properly guided on the lesson and
everyone enjoyed learning and working in groups. They were also able to learn by themselves and make use of their skills and prior knowledge.
The major thing that I want to provide for my students is adequate number of books and learning materials which the school lacks. Learning would be more
effective if each student could have their own set of books to work on and use as reference.
Each teacher has his/her own way and tools to help him/her effectively pass on the knowledge and skills the learner should acquire for their advantage in this
globally competitive world. These tools and ways are not foreign to anybody and almost all teachers had used most of these already. But if ever I could discover
anything that would benefit the learners in this school, I would be glad to share it with my fellow teachers.
School Agusan National High School-SHS Grade Level 11
Teacher Jean Albie B. Sitcharon Learning Area 21st Century Literature
Teaching Dates and Time July 10-14 , 2017 (6:00am-11:00nn) Semester 1st
Session 1 Session 2

I. OBJECTIVES
A. Content Standards
B. Performance Standards
C. Objectives/ Learning 1. Identify the geographic, linguistic and ethnic dimensions of Philippine literary
Competencies
II. CONTENT
III. LEARNING RESOURCES
A. References/ Learning Resources
IV. PROCEDURES
A. Reviewing previous lesson or
presenting the new lesson
B. Establishing a purpose for the
lesson
C. Presenting examples/ instances
of the new lesson
D. Discussing new concepts and
practicing new skills #1
E. Discussing new concepts and
practicing new skills #2
( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am), ( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am),
11-Twain (F 6:00am-11:00am) ) 11-Twain (F 6:00am-11:00am) )
Objectives must be met over the week and connected to the curriculum standards. To meet the objectives, necessary procedures must be followed and if needed, additional lessons, exercises, and
remedial activities may be done for developing the content knowledge and competencies. These are assessed using Formative Assessment Strategies, Valuing objectives support the learning of
content and competencies and enable children to find significance and joy in learning the lessons. Weekly objectives shall be derived from the curriculum guides.
The learner will be able to understand and appreciate the elements and context The learner will be able to understand and appreciate the elements and
of 21st Century Literature of the Philippines and the World. context of 21st Century Literature of the Philippines and the World.
The Learner will be able to demonstrate understanding and appreciation of 21 st The Learner will be able to demonstrate understanding and appreciation of
Century Literature from the Philippines and the World through: 21st Century Literature from the Philippines and the World through:
 A written close analysis and critical interpretation of a literary text in  A written close analysis and critical interpretation of a literary text in
terms of form and theme, with a description of its context derived from terms of form and theme, with a description of its context derived
research; and from research; and
 An adaptation of a text into other creative forms using multimedia.  An adaptation of a text into other creative forms using multimedia.
1. Identify the geographic, linguistic and ethnic dimensions of Philippine
history from pre-colonial to the contemporary; literary history from pre-colonial to the contemporary;
2. Identify representative texts and authors from each region (e.g. engage in 2. Identify representative texts and authors from each region (e.g. engage in
oral history research with focus on key personalities from the student’s region/ oral history research with focus on key personalities from the student’s
province/ town; and region/ province/ town; and
Value contributions of local writers to the development of regional literary Value contributions of local writers to the development of regional literary
traditions. traditions.
Content is what the lesson is all about. It pertains to the subject matter that the teacher aims to teach. In the CG, the content can be tackled in a week or two.
Pre-Colonial Philippine Literature and 21 st Century Genre Pre-Colonial Philippine Literature and 21 st Century Genre
List the materials to be used in different days. Varied sources of materials sustain children’s interest in the lesson and in learning. Ensure that there is a mix of concrete and manipulative materials
as well as paper-based materials. Hands-on learning promotes concept development.
Textbook: 21st Century Literature from the Philippines and the World by Marikit Textbook: 21st Century Literature from the Philippines and the World by
Tara A. Uychoco. Marikit Tara A. Uychoco.
Internet: google.com, slideshare.net, deped.gov.ph Internet: google.com, slideshare.net, deped.gov.ph
These steps should be done across the week. Spread out the activities appropriately so that students will learn well. Always be guided with demonstration of learning by students which you can
enter from formative assessment activities. Sustain learning systematically by providing students with multiple ways to learn new things, practice their learning, question their learning processes,
and draw conclusions about what they learn in relation to their life experiences and previous knowledge. Indicate the time allotment fo googr each step.
1. Review the Previous topic. 1. Review the previous topic.
2. Introduce the Literature of the formative past by the various groups of 2. Ask the students the importance of Literature.
people who inhabited the archipelago. 3. What is universality? Artistry? Permanence?
3. Describe the tone, measure and features of the Pre-colonial Lit. 4. Introduce the different Literary Approaches.
4. Discuss the following: 5. Discuss the following:
 Riddle (with examples)  Literary compositions that influenced the world
 Proverbs (with examples)  Genres of Fiction
 Salawikain (with examples)  Genres of Non-fiction
F. Developing mastery
(Leads to Formative Assessment 3)
G. Finding practical applications of
concepts and skills in daily living
H. Making generalizations and
abstractions about the lesson
I. Evaluating learning
J. Additional activities for application
or remediation
V. REMARKS
VI. REFLECTION
A. No. of learners who earned 80% in
the evaluation
B. No. of learners who require additional
activities for remediation who scored
below 80%
C. Did the remedial lesson work? No. of
learners who have caught up with the
lesson
D. No. of learners who continue to
require remediation
E. Which of my teaching strategies
worked well? Why did these work?
F. What difficulties did I encounter which
my principal or supervisor can help me
solve?
G. What innovation or localized materials
did I use/discover which I wish to share
with other teachers?
Prepared by:
JEAN ALBIE B. SITCHARON
SHS faculty
GRADES 1 to 12
Group Task: Individual task:
The class will be divided into 5 groups. Each group will be given 5 examples of How did the following literary compositions below influenced our beliefs,
either of the three (3) Riddle, Proverbs,Sayings. They have to give their own culture and tradition?
interpretation for each.  The Bible or the Sacred Writing
 Koran
Assignment:  The Iliad and Odyssey
Research about Fiction and Non-fiction.  The Mahabharata
Give at least 5 examples; 3 from the Philippines.  Uncle Tom’s Cabin
September 9 –Town Fiesta, September 13 – Araw ng Claver
Reflect on your teaching and assess yourself as a teacher. This about your student’s progress this week. What works? What else needs to be done to help the students learn?
Identify what help your instructional supervisors can provide you so when you meet them, you can ask them relevant questions.
The learners who got 80% in the evaluation are majority of the students in the sections I handled. They all listened to the discussion and actively participated in
the class activities.
There are only a very few learners who got scores below 80%. Some of them were having problems in the spelling and were not careful in following the
directions given in the activities/ quizzes.
The remedial lessons worked effectively for those who had some difficulty in coping up with the lessons. Those students were absent in the time of the
discussions/activities but eventually they were able to cope up with the advanced learners. I let the students work in groups in order for the advanced learners
to guide and tutor some of the learners who had difficulties. This occurrence is beneficial for both parties.
Fortunately, all learners were able to cope up with the lessons and nobody is left behind to do further remedial classes.
As I have noticed, scaffolding and implementing group activities worked well in most of my classes. The students were properly guided on the lesson and
everyone enjoyed learning and working in groups. They were also able to learn by themselves and make use of their skills and prior knowledge.
The major thing that I want to provide for my students is adequate number of books and learning materials which the school lacks. Learning would be more
effective if each student could have their own set of books to work on and use as reference.
Each teacher has his/her own way and tools to help him/her effectively pass on the knowledge and skills the learner should acquire for their advantage in this
globally competitive world. These tools and ways are not foreign to anybody and almost all teachers had used most of these already. But if ever I could discover
anything that would benefit the learners in this school, I would be glad to share it with my fellow teachers.
Noted by:
MARLYNE M. VILLAREAL
MT I/SHS Track Head
School Agusan National High School-SHS Grade Level 11
Teacher Jean Albie B. Sitcharon Learning Area 21st Century Literature
DAILY LESSON LOG
I. OBJECTIVES
A. Content Standards
B. Performance Standards
C. Objectives/ Learning 1. Identify the geographic, linguistic and ethnic dimensions of Philippine literary
Competencies
II. CONTENT
III. LEARNING RESOURCES
A. References/ Learning Resources
IV. PROCEDURES
A. Reviewing previous lesson or
presenting the new lesson
B. Establishing a purpose for the
lesson
C. Presenting examples/ instances
of the new lesson
D. Discussing new concepts and
practicing new skills #1
E. Discussing new concepts and - Discuss the geographic, linguistic and ethnic dimension of Phil. Lit. History.
practicing new skills #2
Teaching Dates and Time July 16-20 , 2017 (6:00am-11:00nn) Semester 1st
Session 1 Session 2
( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am), ( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am),
11-Twain (F 6:00am-11:00am) ) 11-Twain (F 6:00am-11:00am) )
Objectives must be met over the week and connected to the curriculum standards. To meet the objectives, necessary procedures must be followed and if needed, additional lessons, exercises, and
remedial activities may be done for developing the content knowledge and competencies. These are assessed using Formative Assessment Strategies, Valuing objectives support the learning of
content and competencies and enable children to find significance and joy in learning the lessons. Weekly objectives shall be derived from the curriculum guides.
The learner will be able to understand and appreciate the elements and context The learner will be able to understand and appreciate the elements and
of 21st Century Literature of the Philippines and the World. context of 21st Century Literature of the Philippines and the World.
The Learner will be able to demonstrate understanding and appreciation of 21 st The Learner will be able to demonstrate understanding and appreciation of
Century Literature from the Philippines and the World through: 21st Century Literature from the Philippines and the World through:
 A written close analysis and critical interpretation of a literary text in  A written close analysis and critical interpretation of a literary text in
terms of form and theme, with a description of its context derived from terms of form and theme, with a description of its context derived
research; and from research; and
 An adaptation of a text into other creative forms using multimedia.  An adaptation of a text into other creative forms using multimedia.
1. Identify the geographic, linguistic and ethnic dimensions of Philippine
history from pre-colonial to the contemporary; literary history from pre-colonial to the contemporary;
2. Identify representative texts and authors from each region (e.g. engage in 2. Identify representative texts and authors from each region (e.g. engage in
oral history research with focus on key personalities from the student’s region/ oral history research with focus on key personalities from the student’s
province/ town; and Value contributions of local writers to the development of region/ province/ town; and Value contributions of local writers to the
regional literary traditions. development of regional literary traditions.
Content is what the lesson is all about. It pertains to the subject matter that the teacher aims to teach. In the CG, the content can be tackled in a week or two.
Poetry: “Mayon” by Kristian Sendon Cordero (Camarines Sur) Poetry: “Third World Geography” by Cirilo F. Bautista (Manila)
List the materials to be used in different days. Varied sources of materials sustain children’s interest in the lesson and in learning. Ensure that there is a mix of concrete and manipulative materials
as well as paper-based materials. Hands-on learning promotes concept development.
Textbook: 21st Century Literature from the Philippines and the World by Marikit Textbook: 21st Century Literature from the Philippines and the World by
Tara A. Uychoco. Marikit Tara A. Uychoco.
Internet: google.com, slideshare.net, deped.gov.ph Internet: google.com, slideshare.net, deped.gov.ph
These steps should be done across the week. Spread out the activities appropriately so that students will learn well. Always be guided with demonstration of learning by students which you can
enter from formative assessment activities. Sustain learning systematically by providing students with multiple ways to learn new things, practice their learning, question their learning processes,
and draw conclusions about what they learn in relation to their life experiences and previous knowledge. Indicate the time allotment fo googr each step.
-Review the previous topic. -Review the previous topic.
Ask the following questions: Ask:
• What do you think about Mayon Volcano?  What are the different scenarios in the present time that show
 Why do you think people love this tourist destination? oppression?
 Have you seen Mount Mayon up close? If yes, how did you react when  How do 21st Century people combat oppression in their simple ways?
you saw it for the first time?  Give a short actual historical data on what happened during the
 Can other events have the same effect on us as a volcanic eruption? Martial Law.
Name some. -Discuss allegory and the different kinds of poetic devices such as dramatic
situations in the development of meaning in a poem.
F. Developing mastery
(Leads to Formative Assessment 3)
G. Finding practical applications of
concepts and skills in daily living
H. Making generalizations and
abstractions about the lesson
I. Evaluating learning
J. Additional activities for application
or remediation
V. REFLECTION
A. No. of learners who earned 80% in
the evaluation
B. No. of learners who require additional
activities for remediation who scored
below 80%
C. Did the remedial lesson work? No. of
learners who have caught up with the
lesson
D. No. of learners who continue to
require remediation
E. Which of my teaching strategies
worked well? Why did these work?
F. What difficulties did I encounter which
my principal or supervisor can help me
solve?
G. What innovation or localized materials
did I use/discover which I wish to share
with other teachers?
Prepared by:
JEAN ALBIE B. SITCHARON
SHS faculty
GRADES 1 to 12
Group Activity: Students will:
The class will be divided into four. There are four stations in the classroom  Cut out news clippings of oppression happening in other parts of the
where photos and biography of Filipino writers/ artists are posted. Each group world, paste this on a sheet of paper and write your reaction about it.
will be given 3 minutes to list down the info of each artist/ writer. After the  Write about the realities of struggles that happen in a country faced
given time is over, the group will move to the next station in their right side. within an oppressive ruler.
This sequence will continue until the first group reaches station four. The group  Relate the details and images in the poem and how it can be related
who can write the 17 artists/writers will be declared as the winner. to actual historical events in history.
(The teacher will show a figure of the column with the information you need to  Explain the dramatic situation presented in the poem.
gather to finish your task.)  Explain how allefory was demonstrated in the poem by identifying
the literal and symbolic meaning of the poem.
Reflect on your teaching and assess yourself as a teacher. This about your student’s progress this week. What works? What else needs to be done to help the students learn?
Identify what help your instructional supervisors can provide you so when you meet them, you can ask them relevant questions.
The learners who got 80% in the evaluation are majority of the students in the sections I handled. They all listened to the discussion and actively participated in
the class activities.
There are only a very few learners who got scores below 80%. Some of them were having problems in the spelling and were not careful in following the
directions given in the activities/ quizzes.
The remedial lessons worked effectively for those who had some difficulty in coping up with the lessons. Those students were absent in the time of the
discussions/activities but eventually they were able to cope up with the advanced learners. I let the students work in groups in order for the advanced learners
to guide and tutor some of the learners who had difficulties. This occurrence is beneficial for both parties.
Fortunately, all learners were able to cope up with the lessons and nobody is left behind to do further remedial classes.
As I have noticed, scaffolding and implementing group activities worked well in most of my classes. The students were properly guided on the lesson and
everyone enjoyed learning and working in groups. They were also able to learn by themselves and make use of their skills and prior knowledge.
The major thing that I want to provide for my students is adequate number of books and learning materials which the school lacks. Learning would be more
effective if each student could have their own set of books to work on and use as reference.
Each teacher has his/her own way and tools to help him/her effectively pass on the knowledge and skills the learner should acquire for their advantage in this
globally competitive world. These tools and ways are not foreign to anybody and almost all teachers had used most of these already. But if ever I could discover
anything that would benefit the learners in this school, I would be glad to share it with my fellow teachers.
Noted by:
MARLYNE M. VILLAREAL
MT I/SHS Track Head
School Agusan National High School-SHS Grade Level 11
Teacher Jean Albie B. Sitcharon Learning Area 21st Century Literature
DAILY LESSON LOG
I. OBJECTIVES
A. Content Standards
B. Performance Standards
C. Objectives/ Learning 1. Identify the geographic, linguistic and ethnic dimensions of Philippine literary
Competencies
II. CONTENT
III. LEARNING RESOURCES
A. References/ Learning Resources
IV. PROCEDURES
A. Reviewing previous lesson or
presenting the new lesson
B. Establishing a purpose for the
lesson
C. Presenting examples/ instances •Poetic Devices (Imagery, Symbolism< Allegory, Figures of Speech, Mood,
of the new lesson
D. Discussing new concepts and •Elements of an Essay (Idea, Motive,Structure,Evidence,Explanation,Coherence,
practicing new skills #1
E. Discussing new concepts and
practicing new skills #2
Teaching Dates and Time July 24-28, 2017 (6:00am-11:00nn) Semester 1st
Session 1 Session 2
( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am), ( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am),
11-Twain (F 6:00am-11:00am) ) 11-Twain (F 6:00am-11:00am) )
Objectives must be met over the week and connected to the curriculum standards. To meet the objectives, necessary procedures must be followed and if needed, additional lessons, exercises, and
remedial activities may be done for developing the content knowledge and competencies. These are assessed using Formative Assessment Strategies, Valuing objectives support the learning of
content and competencies and enable children to find significance and joy in learning the lessons. Weekly objectives shall be derived from the curriculum guides.
The learner will be able to understand and appreciate the elements and context The learner will be able to understand and appreciate the elements and
of 21st Century Literature of the Philippines and the World. context of 21st Century Literature of the Philippines and the World.
The Learner will be able to demonstrate understanding and appreciation of 21 st The Learner will be able to demonstrate understanding and appreciation of
Century Literature from the Philippines and the World through: 21st Century Literature from the Philippines and the World through:
 A written close analysis and critical interpretation of a literary text in  A written close analysis and critical interpretation of a literary text in
terms of form and theme, with a description of its context derived from terms of form and theme, with a description of its context derived
research; and from research; and
 An adaptation of a text into other creative forms using multimedia.  An adaptation of a text into other creative forms using multimedia.
1. Identify the geographic, linguistic and ethnic dimensions of Philippine
history from pre-colonial to the contemporary; literary history from pre-colonial to the contemporary;
2. Identify representative texts and authors from each region (e.g. engage in 2. Identify representative texts and authors from each region (e.g. engage in
oral history research with focus on key personalities from the student’s region/ oral history research with focus on key personalities from the student’s
province/ town; and Value contributions of local writers to the development of region/ province/ town; and Value contributions of local writers to the
regional literary traditions. development of regional literary traditions.
Content is what the lesson is all about. It pertains to the subject matter that the teacher aims to teach. In the CG, the content can be tackled in a week or two.
Lesson 3: Home of the Ashfall- Lesson 6: The Love of Magdalena Jalandoni 1st and 2nd Summative Test
List the materials to be used in different days. Varied sources of materials sustain children’s interest in the lesson and in learning. Ensure that there is a mix of concrete and manipulative materials
as well as paper-based materials. Hands-on learning promotes concept development.
Textbook: 21st Century Literature from the Philippines and the World by Marikit Textbook: 21st Century Literature from the Philippines and the World by
Tara A. Uychoco. Marikit Tara A. Uychoco.
Internet: google.com, slideshare.net, deped.gov.ph Internet: google.com, slideshare.net, deped.gov.ph
These steps should be done across the week. Spread out the activities appropriately so that students will learn well. Always be guided with demonstration of learning by students which you can
enter from formative assessment activities. Sustain learning systematically by providing students with multiple ways to learn new things, practice their learning, question their learning processes,
and draw conclusions about what they learn in relation to their life experiences and previous knowledge. Indicate the time allotment fo googr each step.
- Review of the previous lesson. -Give reminders on how to take the test, like, focus on their won paper and
-Discuss the following: manage their time wisely, etc.
•Elements of a short story (Plot, Setting, Characters, Conflict, Point of View, - Distribute the examination sheets and write on the board the time bthey
Theme) started and the time they should have to submit their papers.
Below are some of the instructions/direction on the summative test:
Rhyme) 1st Summative:
I. True or False
Implication, Presence) True 1. 21st Century Literature are literary works created within the last
decade.
F. Developing mastery
(Leads to Formative Assessment 3)
G. Finding practical applications of
concepts and skills in daily living
H. Making generalizations and
abstractions about the lesson
I. Evaluating learning
J. Additional activities for application
or remediation
V. REFLECTION
A. No. of learners who earned 80% in
the evaluation
B. No. of learners who require additional
activities for remediation who scored
below 80%
C. Did the remedial lesson work? No. of
learners who have caught up with the
lesson
D. No. of learners who continue to
require remediation
E. Which of my teaching strategies
worked well? Why did these work?
F. What difficulties did I encounter which
my principal or supervisor can help me
solve?
G. What innovation or localized materials
did I use/discover which I wish to share
with other teachers?
Prepared by:
JEAN ALBIE B. SITCHARON
SHS faculty
GRADES 1 to 12
DAILY LESSON LOG
Activities: II. Identification
Lesson 4:Identify the prediction that they made in the story that eventually did Kristian Sendon Cordero 2. This is the author of the poem “Mayon”.
not happen. III. Questions
- Write instances when the author built up tension in the story. 1. What are the different scenarios in the present time that show oppression?
Lesson 5: 2nd Summative
Question: What does the advent of social media like facebook and twitter mean I. Identification
to our concept of being “at home”? Digi-Fiction 1. It is a 21st Literary genre that combines three media.
Lesson 6: Imagine you are a cultural worker trying to educate people about the II. Matching type. (Match Column a to b and column b to c.
importance and contribution of women in the Phil. Society.
Reflect on your teaching and assess yourself as a teacher. This about your student’s progress this week. What works? What else needs to be done to help the students learn?
Identify what help your instructional supervisors can provide you so when you meet them, you can ask them relevant questions.
The learners who got 80% in the evaluation are majority of the students in the sections I handled. They all listened to the discussion and actively participated in
the class activities.
There are only a very few learners who got scores below 80%. Some of them were having problems in the spelling and were not careful in following the
directions given in the activities/ quizzes.
The remedial lessons worked effectively for those who had some difficulty in coping up with the lessons. Those students were absent in the time of the
discussions/activities but eventually they were able to cope up with the advanced learners. I let the students work in groups in order for the advanced learners
to guide and tutor some of the learners who had difficulties. This occurrence is beneficial for both parties.
Fortunately, all learners were able to cope up with the lessons and nobody is left behind to do further remedial classes.
As I have noticed, scaffolding and implementing group activities worked well in most of my classes. The students were properly guided on the lesson and
everyone enjoyed learning and working in groups. They were also able to learn by themselves and make use of their skills and prior knowledge.
The major thing that I want to provide for my students is adequate number of books and learning materials which the school lacks. Learning would be more
effective if each student could have their own set of books to work on and use as reference.
Each teacher has his/her own way and tools to help him/her effectively pass on the knowledge and skills the learner should acquire for their advantage in this
globally competitive world. These tools and ways are not foreign to anybody and almost all teachers had used most of these already. But if ever I could discover
anything that would benefit the learners in this school, I would be glad to share it with my fellow teachers.
Noted by:
MARLYNE M. VILLAREAL
MT I/SHS Track Head
School Agusan National High School-SHS Grade Level 11
Teacher Jean Albie B. Sitcharon Learning Area 21st Century Literature
Teaching Dates and Time July 31- August 4, 2017 (6:00am-11:00nn) Semester 1st

I. OBJECTIVES
A. Content Standards
B. Performance Standards
C. Objectives/ Learning 1. Identify the geographic, linguistic and ethnic dimensions of Philippine literary
Competencies
II. CONTENT
III. LEARNING RESOURCES
A. References/ Learning Resources
IV. PROCEDURES
A. Reviewing previous lesson or
presenting the new lesson
B. Establishing a purpose for the
lesson
C. Presenting examples/ instances Below are some of the instructions/direction on the summative test:
of the new lesson
D. Discussing new concepts and I. True or False
practicing new skills #1
E. Discussing new concepts and II. Identification
practicing new skills #2
F. Developing mastery
Session 1 Session 2
( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am), ( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am),
11-Twain (F 6:00am-11:00am) ) 11-Twain (F 6:00am-11:00am) )
Objectives must be met over the week and connected to the curriculum standards. To meet the objectives, necessary procedures must be followed and if needed, additional lessons, exercises, and
remedial activities may be done for developing the content knowledge and competencies. These are assessed using Formative Assessment Strategies, Valuing objectives support the learning of
content and competencies and enable children to find significance and joy in learning the lessons. Weekly objectives shall be derived from the curriculum guides.
The learner will be able to understand and appreciate the elements and context The learner will be able to understand and appreciate the elements and
of 21st Century Literature of the Philippines and the World. context of 21st Century Literature of the Philippines and the World.
The Learner will be able to demonstrate understanding and appreciation of 21 st The Learner will be able to demonstrate understanding and appreciation of
Century Literature from the Philippines and the World through: 21st Century Literature from the Philippines and the World through:
 A written close analysis and critical interpretation of a literary text in  A written close analysis and critical interpretation of a literary text in
terms of form and theme, with a description of its context derived from terms of form and theme, with a description of its context derived
research; and from research; and
 An adaptation of a text into other creative forms using multimedia.  An adaptation of a text into other creative forms using multimedia.
1. Identify the geographic, linguistic and ethnic dimensions of Philippine
history from pre-colonial to the contemporary; literary history from pre-colonial to the contemporary;
2. Identify representative texts and authors from each region (e.g. engage in 2. Identify representative texts and authors from each region (e.g. engage in
oral history research with focus on key personalities from the student’s region/ oral history research with focus on key personalities from the student’s
province/ town; and Value contributions of local writers to the development of region/ province/ town; and Value contributions of local writers to the
regional literary traditions. development of regional literary traditions.
Content is what the lesson is all about. It pertains to the subject matter that the teacher aims to teach. In the CG, the content can be tackled in a week or two.
3rd Summative Test Checking of Summative Tests
List the materials to be used in different days. Varied sources of materials sustain children’s interest in the lesson and in learning. Ensure that there is a mix of concrete and manipulative materials
as well as paper-based materials. Hands-on learning promotes concept development.
Textbook: 21st Century Literature from the Philippines and the World by Marikit Textbook: 21st Century Literature from the Philippines and the World by
TaraA. Uychoco. Marikit Tara A. Uychoco.
Internet: google.com, slideshare.net, deped.gov.ph Internet: google.com, slideshare.net, deped.gov.ph
These steps should be done across the week. Spread out the activities appropriately so that students will learn well. Always be guided with demonstration of learning by students which you can
enter from formative assessment activities. Sustain learning systematically by providing students with multiple ways to learn new things, practice their learning, question their learning processes,
and draw conclusions about what they learn in relation to their life experiences and previous knowledge. Indicate the time allotment fo googr each step.
-Give reminders on how to take the test, like, focus on their own paper and Prepare a marking scheme or rubric
manage their time wisely, etc.
- Distribute the examination sheets and write on the board the time bthey  Look at what others have done.
started and the time they should have to submit their papers.  Make a marking scheme usable by non-experts.
 Give consequential marks. 
1st Summative:  Review the marking scheme after the exam. 
 When marking, make notes on exams. 
True 1. 21st Century Literature are literary works created within the last decade.
Monitor the quality of your exams
Kristian Sendon Cordero 2. This is the author of the poem “Mayon”.
(Leads to Formative Assessment 3)
G. Finding practical applications of
concepts and skills in daily living
H. Making generalizations and
abstractions about the lesson
I. Evaluating learning
J. Additional activities for application
or remediation
V. REFLECTION
A. No. of learners who earned 80% in
the evaluation
B. No. of learners who require additional
activities for remediation who scored
below 80%
C. Did the remedial lesson work? No. of
learners who have caught up with the
lesson
D. No. of learners who continue to
require remediation
E. Which of my teaching strategies
worked well? Why did these work?
F. What difficulties did I encounter which
my principal or supervisor can help me
solve?
G. What innovation or localized materials
did I use/discover which I wish to share
with other teachers?
Prepared by:
JEAN ALBIE B. SITCHARON
SHS faculty
GRADES 1 to 12
DAILY LESSON LOG
I. OBJECTIVES
III. Questions
1. What are the different scenarios in the present time that show oppression?  Write impressions on your exam and keep them. 
2nd Summative
 Collect numerical data.
I. Identification  Get student feedback. 
Digi-Fiction 1. It is a 21st Literary genre that combines three media.
II. Matching type. (Match Column a to b and column b to c.
Reflect on your teaching and assess yourself as a teacher. This about your student’s progress this week. What works? What else needs to be done to help the students learn?
Identify what help your instructional supervisors can provide you so when you meet them, you can ask them relevant questions.
The learners who got 80% in the evaluation are majority of the students in the sections I handled. They all listened to the discussion and actively participated in
the class activities.
There are only a very few learners who got scores below 80%. Some of them were having problems in the spelling and were not careful in following the
directions given in the activities/ quizzes.
The remedial lessons worked effectively for those who had some difficulty in coping up with the lessons. Those students were absent in the time of the
discussions/activities but eventually they were able to cope up with the advanced learners. I let the students work in groups in order for the advanced learners
to guide and tutor some of the learners who had difficulties. This occurrence is beneficial for both parties.
Fortunately, all learners were able to cope up with the lessons and nobody is left behind to do further remedial classes.
As I have noticed, scaffolding and implementing group activities worked well in most of my classes. The students were properly guided on the lesson and
everyone enjoyed learning and working in groups. They were also able to learn by themselves and make use of their skills and prior knowledge.
The major thing that I want to provide for my students is adequate number of books and learning materials which the school lacks. Learning would be more
effective if each student could have their own set of books to work on and use as reference.
Each teacher has his/her own way and tools to help him/her effectively pass on the knowledge and skills the learner should acquire for their advantage in this
globally competitive world. These tools and ways are not foreign to anybody and almost all teachers had used most of these already. But if ever I could discover
anything that would benefit the learners in this school, I would be glad to share it with my fellow teachers.
Noted by:
MARLYNE M. VILLAREAL
MT I/SHS Track Head
School Agusan National High School-SHS Grade Level 11
Teacher Jean Albie B. Sitcharon Learning Area 21st Century Literature
Teaching Dates and Time August 7-11, 2017 (6:00am-11:00nn) Semester 1st
Session 1 Session 2
( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am), ( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am),
11-Twain (F 6:00am-11:00am) ) 11-Twain (F 6:00am-11:00am) )
Objectives must be met over the week and connected to the curriculum standards. To meet the objectives, necessary procedures must be followed and if needed, additional lessons, exercises, and

A. Content Standards
B. Performance Standards
C. Objectives/ Learning 1. Identify the geographic, linguistic and ethnic dimensions of Philippine literary
Competencies
II. CONTENT
III. LEARNING RESOURCES
A. References/ Learning Resources
IV. PROCEDURES
A. Reviewing previous lesson or
presenting the new lesson
B. Establishing a purpose for the
lesson
C. Presenting examples/ instances
of the new lesson
D. Discussing new concepts and
practicing new skills #1
E. Discussing new concepts and
practicing new skills #2
F. Developing mastery
(Leads to Formative Assessment 3)
G. Finding practical applications of
concepts and skills in daily living
H. Making generalizations and
abstractions about the lesson
remedial activities may be done for developing the content knowledge and competencies. These are assessed using Formative Assessment Strategies, Valuing objectives support the learning of
content and competencies and enable children to find significance and joy in learning the lessons. Weekly objectives shall be derived from the curriculum guides.
The learner will be able to understand and appreciate the elements and context The learner will be able to understand and appreciate the elements and
of 21st Century Literature of the Philippines and the World. context of 21st Century Literature of the Philippines and the World.
The Learner will be able to demonstrate understanding and appreciation of 21 st The Learner will be able to demonstrate understanding and appreciation of
Century Literature from the Philippines and the World through: 21st Century Literature from the Philippines and the World through:
 A written close analysis and critical interpretation of a literary text in  A written close analysis and critical interpretation of a literary text in
terms of form and theme, with a description of its context derived from terms of form and theme, with a description of its context derived
research; and from research; and
 An adaptation of a text into other creative forms using multimedia.  An adaptation of a text into other creative forms using multimedia.
1. Identify the geographic, linguistic and ethnic dimensions of Philippine
history from pre-colonial to the contemporary; literary history from pre-colonial to the contemporary;
2. Identify representative texts and authors from each region (e.g. engage in 2. Identify representative texts and authors from each region (e.g. engage in
oral history research with focus on key personalities from the student’s region/ oral history research with focus on key personalities from the student’s
province/ town; and Value contributions of local writers to the development of region/ province/ town; and Value contributions of local writers to the
regional literary traditions. development of regional literary traditions.
Content is what the lesson is all about. It pertains to the subject matter that the teacher aims to teach. In the CG, the content can be tackled in a week or two.
REVIEW OF LESSONS with quizzes 1st Quarter Final Examination
List the materials to be used in different days. Varied sources of materials sustain children’s interest in the lesson and in learning. Ensure that there is a mix of concrete and manipulative materials
as well as paper-based materials. Hands-on learning promotes concept development.
Textbook: 21st Century Literature from the Philippines and the World by Marikit Textbook: 21st Century Literature from the Philippines and the World by
TaraA. Uychoco. Marikit Tara A. Uychoco.
Internet: google.com, slideshare.net, deped.gov.ph Internet: google.com, slideshare.net, deped.gov.ph
These steps should be done across the week. Spread out the activities appropriately so that students will learn well. Always be guided with demonstration of learning by students which you can
enter from formative assessment activities. Sustain learning systematically by providing students with multiple ways to learn new things, practice their learning, question their learning processes,
and draw conclusions about what they learn in relation to their life experiences and previous knowledge. Indicate the time allotment fo googr each step.
• The days prior to the examination date will be used for review and recap of
lessons and activities. • The students will be having their final exams in the subjects they are taking.
• The teacher will give the coverage for the exams. • Senior High teachers are the proctors.
• Below are some items or questions that might help in the review: • The exams in each subject will be conducted by department and students
will be shuffled in different rooms in a particular date of examination.
1. Which of the following songs from the Post-war and contemporary
• Exam type may vary depending on the subject.
period depicts the patriotic struggle from the American Period down to
the 1986 EDSA People uprising? • Students will be told to follow the corresponding rules in taking an exam.
• Each subject has an allotted time for students to answer.
2. Which figure of speech is used in the following lines? “By time did
beckon to the flowers, and they by noon most cunningly did steal away” • After the students have taken the exam, proctors will collect and
keep the test papers for checking.
I. Evaluating learning
J. Additional activities for application
or remediation
V. REFLECTION
A. No. of learners who earned 80% in
the evaluation
B. No. of learners who require additional
activities for remediation who scored
below 80%
C. Did the remedial lesson work? No. of
learners who have caught up with the
lesson
D. No. of learners who continue to
require remediation
E. Which of my teaching strategies
worked well? Why did these work?
F. What difficulties did I encounter which
my principal or supervisor can help me
solve?
G. What innovation or localized materials
did I use/discover which I wish to share
with other teachers?
Prepared by:
3. Which among the novels of Dr. Jose Rizal describes the Spaniards as a
disgrace which provided more hardships to the love ones of the
Filipinos?
Reflect on your teaching and assess yourself as a teacher. This about your student’s progress this week. What works? What else needs to be done to help the students learn?
Identify what help your instructional supervisors can provide you so when you meet them, you can ask them relevant questions.
The learners who got 80% in the evaluation are majority of the students in the sections I handled. They all listened to the discussion and actively participated in
the class activities.
There are only a very few learners who got scores below 80%. Some of them were having problems in the spelling and were not careful in following the
directions given in the activities/ quizzes.
The remedial lessons worked effectively for those who had some difficulty in coping up with the lessons. Those students were absent in the time of the
discussions/activities but eventually they were able to cope up with the advanced learners. I let the students work in groups in order for the advanced learners
to guide and tutor some of the learners who had difficulties. This occurrence is beneficial for both parties.
Fortunately, all learners were able to cope up with the lessons and nobody is left behind to do further remedial classes.
As I have noticed, scaffolding and implementing group activities worked well in most of my classes. The students were properly guided on the lesson and
everyone enjoyed learning and working in groups. They were also able to learn by themselves and make use of their skills and prior knowledge.
The major thing that I want to provide for my students is adequate number of books and learning materials which the school lacks. Learning would be more
effective if each student could have their own set of books to work on and use as reference.
Each teacher has his/her own way and tools to help him/her effectively pass on the knowledge and skills the learner should acquire for their advantage in this
globally competitive world. These tools and ways are not foreign to anybody and almost all teachers had used most of these already. But if ever I could discover
anything that would benefit the learners in this school, I would be glad to share it with my fellow teachers.
Noted by:

JEAN ALBIE B. SITCHARON MARLYNE M. VILLAREAL

SHS faculty MT I/SHS Track Head

GRADES 1 to 12 School Agusan National High School-SHS Grade Level 11

DAILY LESSON LOG Teacher Jean Albie B. Sitcharon Learning Area 21st Century Literature
Teaching Dates and Time August 14-18, 2017 (6:00am-11:00nn) Semester 2nd
Session 1 Session 2
( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am), ( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am),
11-Twain (F 6:00am-11:00am) ) 11-Twain (F 6:00am-11:00am) )
Objectives must be met over the week and connected to the curriculum standards. To meet the objectives, necessary procedures must be followed and if needed, additional lessons, exercises, and
I. OBJECTIVES remedial activities may be done for developing the content knowledge and competencies. These are assessed using Formative Assessment Strategies, Valuing objectives support the learning of
content and competencies and enable children to find significance and joy in learning the lessons. Weekly objectives shall be derived from the curriculum guides.
A. Content Standards The learner will be able to understand and appreciate the elements and context The learner will be able to understand and appreciate the elements and

B. Performance Standards
C. Objectives/ Learning 1. Identify the geographic, linguistic and ethnic dimensions of Philippine literary
Competencies
II. CONTENT
III. LEARNING RESOURCES
A. References/ Learning Resources
IV. PROCEDURES
A. Reviewing previous lesson or
presenting the new lesson
B. Establishing a purpose for the
lesson
C. Presenting examples/ instances
of the new lesson
D. Discussing new concepts and
practicing new skills #1
E. Discussing new concepts and
practicing new skills #2
F. Developing mastery
(Leads to Formative Assessment 3)
G. Finding practical applications of
concepts and skills in daily living
H. Making generalizations and
abstractions about the lesson
I. Evaluating learning
J. Additional activities for application
or remediation
of 21st Century Literature of the Philippines and the World. context of 21st Century Literature of the Philippines and the World.
The Learner will be able to demonstrate understanding and appreciation of 21 st The Learner will be able to demonstrate understanding and appreciation of
Century Literature from the Philippines and the World through: 21st Century Literature from the Philippines and the World through:
 A written close analysis and critical interpretation of a literary text in  A written close analysis and critical interpretation of a literary text in
terms of form and theme, with a description of its context derived from terms of form and theme, with a description of its context derived
research; and from research; and
 An adaptation of a text into other creative forms using multimedia.  An adaptation of a text into other creative forms using multimedia.
1. Identify the geographic, linguistic and ethnic dimensions of Philippine
history from pre-colonial to the contemporary; literary history from pre-colonial to the contemporary;
2. Identify representative texts and authors from each region (e.g. engage in 2. Identify representative texts and authors from each region (e.g. engage in
oral history research with focus on key personalities from the student’s region/ oral history research with focus on key personalities from the student’s
province/ town; and Value contributions of local writers to the development of region/ province/ town; and Value contributions of local writers to the
regional literary traditions. development of regional literary traditions.
Content is what the lesson is all about. It pertains to the subject matter that the teacher aims to teach. In the CG, the content can be tackled in a week or two.
Checking of 1st Quarter Final Examination Remedial Examination/ Special Examination
List the materials to be used in different days. Varied sources of materials sustain children’s interest in the lesson and in learning. Ensure that there is a mix of concrete and manipulative materials
as well as paper-based materials. Hands-on learning promotes concept development.
Textbook: 21st Century Literature from the Philippines and the World by Marikit Textbook: 21st Century Literature from the Philippines and the World by
TaraA. Uychoco. Marikit Tara A. Uychoco.
Internet: google.com, slideshare.net, deped.gov.ph Internet: google.com, slideshare.net, deped.gov.ph
These steps should be done across the week. Spread out the activities appropriately so that students will learn well. Always be guided with demonstration of learning by students which you can
enter from formative assessment activities. Sustain learning systematically by providing students with multiple ways to learn new things, practice their learning, question their learning processes,
and draw conclusions about what they learn in relation to their life experiences and previous knowledge. Indicate the time allotment fo googr each step.
 The students who were not able to pass the exam/ who have
 The teacher will ask who among the students did not take the exam and low scores will have a remedial lesson/exam in a scheduled
will let them stay in another room/ vacant corner to take the final exam.
date.
 The teacher will distribute the answer sheets for students to check,
provided that these test questionnaires are owned by a different  The teacher will have a recap on some lessons in the previous
section of the same subject to avoid any form of cheating or dishonesty. quarter and will give a brief quiz or activity related to it.
 Students will be told to write their name and section on the test  The teacher will give a syllabus of the new lesson in the 2 nd
questionnaires they are checking with a date indicated.
 Students are asked by the teacher to put a correction inside an open-
quarter.
 The projects and outputs of students in the previous quarter
close parenthesis before the number of an item with error.
 The purpose of this activity is for students to read and go over the items will be given back to them.
which corresponds to a particular lesson in the subject and know if their  The students will be grouped for the preparation of activities
answers are correct or not.
 An item analysis will follow after the checking of test papers.
and reporting in the next quarter.

V. REFLECTION
A. No. of learners who earned 80% in
the evaluation
B. No. of learners who require additional
activities for remediation who scored
below 80%
C. Did the remedial lesson work? No. of
learners who have caught up with the
lesson
D. No. of learners who continue to
require remediation
E. Which of my teaching strategies
worked well? Why did these work?
F. What difficulties did I encounter which
my principal or supervisor can help me
solve?
G. What innovation or localized materials
did I use/discover which I wish to share
with other teachers?
Prepared by:
JEAN ALBIE B. SITCHARON
SHS faculty
GRADES 1 to 12
DAILY LESSON LOG
I. OBJECTIVES
A. Content Standards
B. Performance Standards
Reflect on your teaching and assess yourself as a teacher. This about your student’s progress this week. What works? What else needs to be done to help the students learn?
Identify what help your instructional supervisors can provide you so when you meet them, you can ask them relevant questions.
The learners who got 80% in the evaluation are majority of the students in the sections I handled. They all listened to the discussion and actively participated in
the class activities.
There are only a very few learners who got scores below 80%. Some of them were having problems in the spelling and were not careful in following the
directions given in the activities/ quizzes.
The remedial lessons worked effectively for those who had some difficulty in coping up with the lessons. Those students were absent in the time of the
discussions/activities but eventually they were able to cope up with the advanced learners. I let the students work in groups in order for the advanced learners
to guide and tutor some of the learners who had difficulties. This occurrence is beneficial for both parties.
Fortunately, all learners were able to cope up with the lessons and nobody is left behind to do further remedial classes.
As I have noticed, scaffolding and implementing group activities worked well in most of my classes. The students were properly guided on the lesson and
everyone enjoyed learning and working in groups. They were also able to learn by themselves and make use of their skills and prior knowledge.
The major thing that I want to provide for my students is adequate number of books and learning materials which the school lacks. Learning would be more
effective if each student could have their own set of books to work on and use as reference.
Each teacher has his/her own way and tools to help him/her effectively pass on the knowledge and skills the learner should acquire for their advantage in this
globally competitive world. These tools and ways are not foreign to anybody and almost all teachers had used most of these already. But if ever I could discover
anything that would benefit the learners in this school, I would be glad to share it with my fellow teachers.
Noted by:
MARLYNE M. VILLAREAL
MT I/SHS Track Head
School Agusan National High School-SHS Grade Level 11
Teacher Jean Albie B. Sitcharon Learning Area 21st Century Literature
Teaching Dates and Time August 21-25, 2017 (6:00am-11:00nn) Semester 2nd
Session 1 Session 2
( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am), ( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am),
11-Twain (F 6:00am-11:00am) ) 11-Twain (F 6:00am-11:00am) )
Objectives must be met over the week and connected to the curriculum standards. To meet the objectives, necessary procedures must be followed and if needed, additional lessons, exercises, and
remedial activities may be done for developing the content knowledge and competencies. These are assessed using Formative Assessment Strategies, Valuing objectives support the learning of
content and competencies and enable children to find significance and joy in learning the lessons. Weekly objectives shall be derived from the curriculum guides.
The learner will be able to understand and appreciate the elements and context The learner will be able to understand and appreciate the elements and
of 21st Century Literature of the Philippines and the World. context of 21st Century Literature of the Philippines and the World.
The Learner will be able to demonstrate understanding and appreciation of 21 st The Learner will be able to demonstrate understanding and appreciation of
Century Literature from the Philippines and the World through: 21st Century Literature from the Philippines and the World through:

C. Objectives/ Learning 1. Identify the geographic, linguistic and ethnic dimensions of Philippine literary
Competencies
II. CONTENT
III. LEARNING RESOURCES
A. References/ Learning Resources
IV. PROCEDURES
A. Reviewing previous lesson or
presenting the new lesson
B. Establishing a purpose for the
lesson
C. Presenting examples/ instances
of the new lesson
D. Discussing new concepts and
practicing new skills #1
E. Discussing new concepts and
practicing new skills #2
F. Developing mastery
(Leads to Formative Assessment 3)
G. Finding practical applications of
concepts and skills in daily living
H. Making generalizations and
abstractions about the lesson
I. Evaluating learning
J. Additional activities for application
or remediation

A written close analysis and critical interpretation of a literary text in  A written close analysis and critical interpretation of a literary text in
terms of form and theme, with a description of its context derived from terms of form and theme, with a description of its context derived
research; and from research; and
 An adaptation of a text into other creative forms using multimedia.  An adaptation of a text into other creative forms using multimedia.
1. Identify the geographic, linguistic and ethnic dimensions of Philippine
history from pre-colonial to the contemporary; literary history from pre-colonial to the contemporary;
2. Identify representative texts and authors from each region (e.g. engage in 2. Identify representative texts and authors from each region (e.g. engage in
oral history research with focus on key personalities from the student’s region/ oral history research with focus on key personalities from the student’s
province/ town; and Value contributions of local writers to the development of region/ province/ town; and Value contributions of local writers to the
regional literary traditions. development of regional literary traditions.
Content is what the lesson is all about. It pertains to the subject matter that the teacher aims to teach. In the CG, the content can be tackled in a week or two.
Diagnostic Test Philippine Diaspora
List the materials to be used in different days. Varied sources of materials sustain children’s interest in the lesson and in learning. Ensure that there is a mix of concrete and manipulative materials
as well as paper-based materials. Hands-on learning promotes concept development.
Textbook: 21st Century Literature from the Philippines and the World by Marikit Textbook: 21st Century Literature from the Philippines and the World by
TaraA. Uychoco. Marikit Tara A. Uychoco.
Internet: google.com, slideshare.net, deped.gov.ph Internet: google.com, slideshare.net, deped.gov.ph
These steps should be done across the week. Spread out the activities appropriately so that students will learn well. Always be guided with demonstration of learning by students which you can
enter from formative assessment activities. Sustain learning systematically by providing students with multiple ways to learn new things, practice their learning, question their learning processes,
and draw conclusions about what they learn in relation to their life experiences and previous knowledge. Indicate the time allotment fo googr each step.
Respond critically to the following questions and worksheets to process the selection. Motivation
1. The author is a native of Title: Colored Cards
a. Metro Manila b. Dau, Pampanga Time Frame: 15 minutes
c. San Fernando Pampanga d. Angeles, Pampanga Instructions:
2. The author thought that the volcano that would most likely erupt would be 1. The teacher will distribute colored cards to the students.
a. Mayon c. Pinatubo 2. Each of them will write on the card given to them the most shocking phenomenon
b. Halcon d. Arayat they had experienced and write a short description about it.
3. The author was initially, ______ at the sight of the white- covered sorroundings 3. The student will post the card on the wall
a. scared c. curious 4. Some will ask to share their output.
b. overjoyed d. angry
4. At the river, the author's legs shock because Process Questions
a. he was tired from the trip 1. How did you overcome those phenomena?
b. he was so thrilled to be home 2. Are you still in shock or did you already move on from those?
c. he was saddened by the appearance of the town 3. What have you learned from those experiences?
d. he was shocked at the devastation.  Interview family members or friends who were alive during the eruption and
5. The author felt embarrassed at being carried because ask them about their most unforgettable memory of the event.
a. he thought the barker thought he ws a sissy.  Record this or you may have a picture of it.
b. he thought he ws being mocked for his weight  Further discussion and application will be on the next day of the lesson.
c. he thought that he could cross the river himself
d. he thought that he would fall off.

V. REFLECTION
A. No. of learners who earned 80% in
the evaluation
B. No. of learners who require additional
activities for remediation who scored
below 80%
C. Did the remedial lesson work? No. of
learners who have caught up with the
lesson
D. No. of learners who continue to
require remediation
E. Which of my teaching strategies
worked well? Why did these work?
F. What difficulties did I encounter which
my principal or supervisor can help me
solve?
G. What innovation or localized materials
did I use/discover which I wish to share
with other teachers?
Prepared by:
JEAN ALBIE B. SITCHARON
SHS faculty
GRADES 1 to 12
DAILY LESSON LOG
I. OBJECTIVES
A. Content Standards
B. Performance Standards
Reflect on your teaching and assess yourself as a teacher. This about your student’s progress this week. What works? What else needs to be done to help the students learn?
Identify what help your instructional supervisors can provide you so when you meet them, you can ask them relevant questions.
The learners who got 80% in the evaluation are majority of the students in the sections I handled. They all listened to the discussion and actively participated in
the class activities.
There are only a very few learners who got scores below 80%. Some of them were having problems in the spelling and were not careful in following the
directions given in the activities/ quizzes.
The remedial lessons worked effectively for those who had some difficulty in coping up with the lessons. Those students were absent in the time of the
discussions/activities but eventually they were able to cope up with the advanced learners. I let the students work in groups in order for the advanced learners
to guide and tutor some of the learners who had difficulties. This occurrence is beneficial for both parties.
Fortunately, all learners were able to cope up with the lessons and nobody is left behind to do further remedial classes.
As I have noticed, scaffolding and implementing group activities worked well in most of my classes. The students were properly guided on the lesson and
everyone enjoyed learning and working in groups. They were also able to learn by themselves and make use of their skills and prior knowledge.
The major thing that I want to provide for my students is adequate number of books and learning materials which the school lacks. Learning would be more
effective if each student could have their own set of books to work on and use as reference.
Each teacher has his/her own way and tools to help him/her effectively pass on the knowledge and skills the learner should acquire for their advantage in this
globally competitive world. These tools and ways are not foreign to anybody and almost all teachers had used most of these already. But if ever I could discover
anything that would benefit the learners in this school, I would be glad to share it with my fellow teachers.
Noted by:
MARLYNE M. VILLAREAL
MT I/SHS Track Head
School Agusan National High School-SHS Grade Level 11
Teacher Jean Albie B. Sitcharon Learning Area 21st Century Literature
Teaching Dates and Time August 28-Sept.1, 2017 (6:00am-11:00nn) Semester 1st Semester (2nd Quarter)
Session 1 Session 2
( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am), ( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am),
11-Twain (F 6:00am-11:00am) ) 11-Twain (F 6:00am-11:00am) )
Objectives must be met over the week and connected to the curriculum standards. To meet the objectives, necessary procedures must be followed and if needed, additional lessons, exercises, and
remedial activities may be done for developing the content knowledge and competencies. These are assessed using Formative Assessment Strategies, Valuing objectives support the learning of
content and competencies and enable children to find significance and joy in learning the lessons. Weekly objectives shall be derived from the curriculum guides.
The learner will be able to understand and appreciate the elements and context The learner will be able to understand and appreciate the elements and
of 21st Century Literature of the Philippines and the World. context of 21st Century Literature of the Philippines and the World.
The Learner will be able to demonstrate understanding and appreciation of 21 st The Learner will be able to demonstrate understanding and appreciation of
Century Literature from the Philippines and the World through: 21st Century Literature from the Philippines and the World through:
 A written close analysis and critical interpretation of a literary text in  A written close analysis and critical interpretation of a literary text in

C. Objectives/ Learning 1. Identify the geographic, linguistic and ethnic dimensions of Philippine literary
Competencies
II. CONTENT
III. LEARNING RESOURCES
A. References/ Learning Resources
IV. PROCEDURES
A. Reviewing previous lesson or
presenting the new lesson
B. Establishing a purpose for the
lesson
C. Presenting examples/ instances
of the new lesson
D. Discussing new concepts and
practicing new skills #1
E. Discussing new concepts and
practicing new skills #2
F. Developing mastery
(Leads to Formative Assessment 3)
G. Finding practical applications of
concepts and skills in daily living
H. Making generalizations and
abstractions about the lesson
I. Evaluating learning
J. Additional activities for application
or remediation
V. REFLECTION
A. No. of learners who earned 80% in
the evaluation
terms of form and theme, with a description of its context derived from terms of form and theme, with a description of its context derived
research; and from research; and
 An adaptation of a text into other creative forms using multimedia.  An adaptation of a text into other creative forms using multimedia.
1. Identify the geographic, linguistic and ethnic dimensions of Philippine
history from pre-colonial to the contemporary; literary history from pre-colonial to the contemporary;
2. Identify representative texts and authors from each region (e.g. engage in 2. Identify representative texts and authors from each region (e.g. engage in
oral history research with focus on key personalities from the student’s region/ oral history research with focus on key personalities from the student’s
province/ town; and Value contributions of local writers to the development of region/ province/ town; and Value contributions of local writers to the
regional literary traditions. development of regional literary traditions.
Content is what the lesson is all about. It pertains to the subject matter that the teacher aims to teach. In the CG, the content can be tackled in a week or two.
Short Story Analysis: Turban Legend by R.Zamora Linmark Short Story Analysis: Waiting by Ron Darvin
List the materials to be used in different days. Varied sources of materials sustain children’s interest in the lesson and in learning. Ensure that there is a mix of concrete and manipulative materials
as well as paper-based materials. Hands-on learning promotes concept development.
Textbook: 21st Century Literature from the Philippines and the World by Marikit Textbook: 21st Century Literature from the Philippines and the World by
TaraA. Uychoco. Marikit Tara A. Uychoco.
Internet: google.com, slideshare.net, deped.gov.ph Internet: google.com, slideshare.net, deped.gov.ph
These steps should be done across the week. Spread out the activities appropriately so that students will learn well. Always be guided with demonstration of learning by students which you can
enter from formative assessment activities. Sustain learning systematically by providing students with multiple ways to learn new things, practice their learning, question their learning processes,
and draw conclusions about what they learn in relation to their life experiences and previous knowledge. Indicate the time allotment fo googr each step.
The teacher will have a quick recap about the elements of a short story and will The teacher will let the students read another short story and make an
let the students read one and make an analysis of it using the following format analysis of it using the following format below:
below: - On a whole sheet of yellow paper:
- On a whole sheet of yellow paper: f. Title of the story
a. Title of the story g. Author and short biography
b. Author and short biography h. Setting of the story
c. Setting of the story i. Characters and description
d. Characters and description j. Plot
e. Plot k. Conflict
1. Exposition/ introduction l. Point of View
2. Rising Action m. Theme
3. Climax Answer five (5) related questions about the story: (e.g.
4. Falling Action There is a juxtaposition of tuna salad with all of the other Filipino dishes,
5. Denouement why?; How do you feel toward Miguel? Why do you feel that way?; what
Answer five (5) related questions about the story: (e.g. Why do Filipinos love does Miguel want? Can Isabel ever give it to him? Why or why not?; Why is
balikbayan boxes? What does a balikbayan box symbolize?) Miguel being difficult? Is it just because he’s a teenager? Explain your
answer.)
Reflect on your teaching and assess yourself as a teacher. This about your student’s progress this week. What works? What else needs to be done to help the students learn?
Identify what help your instructional supervisors can provide you so when you meet them, you can ask them relevant questions.
The learners who got 80% in the evaluation are majority of the students in the sections I handled. They all listened to the discussion and actively participated in
the class activities.
B. No. of learners who require additional There are only a very few learners who got scores below 80%. Some of them were having problems in the spelling and were not careful in following the
activities for remediation who scored
below 80%
directions given in the activities/ quizzes.
C. Did the remedial lesson work? No. of The remedial lessons worked effectively for those who had some difficulty in coping up with the lessons. Those students were absent in the time of the
learners who have caught up with the
lesson
discussions/activities but eventually they were able to cope up with the advanced learners. I let the students work in groups in order for the advanced learners
to guide and tutor some of the learners who had difficulties. This occurrence is beneficial for both parties.
D. No. of learners who continue to Fortunately, all learners were able to cope up with the lessons and nobody is left behind to do further remedial classes.
require remediation
E. Which of my teaching strategies As I have noticed, scaffolding and implementing group activities worked well in most of my classes. The students were properly guided on the lesson and
worked well? Why did these work?
everyone enjoyed learning and working in groups. They were also able to learn by themselves and make use of their skills and prior knowledge.
The major thing that I want to provide for my students is adequate number of books and learning materials which the school lacks. Learning would be more
F. What difficulties did I encounter which
my principal or supervisor can help me
effective if each student could have their own set of books to work on and use as reference.
solve?
G. What innovation or localized materials Each teacher has his/her own way and tools to help him/her effectively pass on the knowledge and skills the learner should acquire for their advantage in this
did I use/discover which I wish to share
with other teachers?
globally competitive world. These tools and ways are not foreign to anybody and almost all teachers had used most of these already. But if ever I could discover
anything that would benefit the learners in this school, I would be glad to share it with my fellow teachers.
Prepared by: Noted by:

JEAN ALBIE B. SITCHARON MARLYNE M. VILLAREAL

SHS faculty MT I/SHS Track Head

GRADES 1 to 12 School Agusan National High School-SHS Grade Level 11

DAILY LESSON LOG Teacher Jean Albie B. Sitcharon Learning Area 21st Century Literature
Teaching Dates and Time September 4-8, 2017 (6:00am-11:00nn) Semester 1st Semester (2nd Quarter)
Session 1 Session 2
( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am), ( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am),
11-Twain (F 6:00am-11:00am) ) 11-Twain (F 6:00am-11:00am) )
Objectives must be met over the week and connected to the curriculum standards. To meet the objectives, necessary procedures must be followed and if needed, additional lessons, exercises, and
I. OBJECTIVES remedial activities may be done for developing the content knowledge and competencies. These are assessed using Formative Assessment Strategies, Valuing objectives support the learning of
content and competencies and enable children to find significance and joy in learning the lessons. Weekly objectives shall be derived from the curriculum guides.
A. Content Standards The learner will be able to understand and appreciate the elements and context The learner will be able to understand and appreciate the elements and
of 21st Century Literature of the Philippines and the World. context of 21st Century Literature of the Philippines and the World.
B. Performance Standards The Learner will be able to demonstrate understanding and appreciation of 21 st The Learner will be able to demonstrate understanding and appreciation of
Century Literature from the Philippines and the World through: 21st Century Literature from the Philippines and the World through:
 A written close analysis and critical interpretation of a literary text in  A written close analysis and critical interpretation of a literary text in
terms of form and theme, with a description of its context derived from terms of form and theme, with a description of its context derived
research; and from research; and
 An adaptation of a text into other creative forms using multimedia.  An adaptation of a text into other creative forms using multimedia.
C. Objectives/ Learning 1. Identify the geographic, linguistic and ethnic dimensions of Philippine literary 1. Identify the geographic, linguistic and ethnic dimensions of Philippine
Competencies

II. CONTENT
III. LEARNING RESOURCES
A. References/ Learning Resources
IV. PROCEDURES
A. Reviewing previous lesson or
presenting the new lesson
B. Establishing a purpose for the
lesson
C. Presenting examples/ instances
of the new lesson
D. Discussing new concepts and
practicing new skills #1
E. Discussing new concepts and
practicing new skills #2
F. Developing mastery
(Leads to Formative Assessment 3)
G. Finding practical applications of
concepts and skills in daily living
H. Making generalizations and
abstractions about the lesson
I. Evaluating learning
J. Additional activities for application
or remediation
V. REFLECTION
A. No. of learners who earned 80% in
the evaluation
B. No. of learners who require additional
activities for remediation who scored
below 80%
C. Did the remedial lesson work? No. of
learners who have caught up with the
history from pre-colonial to the contemporary; literary history from pre-colonial to the contemporary;
2. Identify representative texts and authors from each region (e.g. engage in 2. Identify representative texts and authors from each region (e.g. engage in
oral history research with focus on key personalities from the student’s region/ oral history research with focus on key personalities from the student’s
province/ town; and Value contributions of local writers to the development of region/ province/ town; and Value contributions of local writers to the
regional literary traditions. development of regional literary traditions.
Content is what the lesson is all about. It pertains to the subject matter that the teacher aims to teach. In the CG, the content can be tackled in a week or two.
Introduction to Afro-Asian Literature Movie Analysis: “Dead Poet’s Society”
List the materials to be used in different days. Varied sources of materials sustain children’s interest in the lesson and in learning. Ensure that there is a mix of concrete and manipulative materials
as well as paper-based materials. Hands-on learning promotes concept development.
Textbook: 21st Century Literature from the Philippines and the World by Marikit Internet: google.com, slideshare.net, deped.gov.ph
TaraA. Uychoco.
Internet: google.com, slideshare.net, deped.gov.ph
These steps should be done across the week. Spread out the activities appropriately so that students will learn well. Always be guided with demonstration of learning by students which you can
enter from formative assessment activities. Sustain learning systematically by providing students with multiple ways to learn new things, practice their learning, question their learning processes,
and draw conclusions about what they learn in relation to their life experiences and previous knowledge. Indicate the time allotment fo googr each step.
The teacher will present a slideshow about Afro-Asian Literature. Some of the  The students will be watching a movie with a length time of 2 hours
information are as follows: and 23 minutes.
 Africa- The Dark Continent  They will be asked to take notes of some details of the following
 Egypt- The Gift of The Nile about the movie that would be helpful in their activity related to the
 Israel- Jewish republic of Asia said movie:
 Arabia- Cradle of Islam - Title
- Director
 Iran- Home of the Aryans
- Casts/ Character with description
- Setting (Date and Place)
The students will be asked to take down notes or if they have their phones, - Plot
they could record the discussion or take some photos of the slides.
- Conflict
Answer the following questions: - Theme
1. What is the world’s most populous nation?
Direction: Make a reaction paper about the movie. Guide questions will be
2. What is the name of a system that groups people according to birth? given below.
3. What is the sacred book of Islam? 1. What are the four pillars of the university in the movie?
4. Explain the analect: “ If a man in the morning go the right way, he will 2. What are the values taught by Mr.Keating to his students?
die in the evening without regret.” 3. What is the Dead Poet’s Society? Explain their activities.
Reflect on your teaching and assess yourself as a teacher. This about your student’s progress this week. What works? What else needs to be done to help the students learn?
Identify what help your instructional supervisors can provide you so when you meet them, you can ask them relevant questions.
The learners who got 80% in the evaluation are majority of the students in the sections I handled. They all listened to the discussion and actively participated in
the class activities.
There are only a very few learners who got scores below 80%. Some of them were having problems in the spelling and were not careful in following the
directions given in the activities/ quizzes.
The remedial lessons worked effectively for those who had some difficulty in coping up with the lessons. Those students were absent in the time of the
discussions/activities but eventually they were able to cope up with the advanced learners. I let the students work in groups in order for the advanced learners
 lesson to guide and tutor some of the learners who had difficulties. This occurrence is beneficial for both parties.
D. No. of learners who continue to Fortunately, all learners were able to cope up with the lessons and nobody is left behind to do further remedial classes.
require remediation
E. Which of my teaching strategies As I have noticed, scaffolding and implementing group activities worked well in most of my classes. The students were properly guided on the lesson and
worked well? Why did these work?
everyone enjoyed learning and working in groups. They were also able to learn by themselves and make use of their skills and prior knowledge.
The major thing that I want to provide for my students is adequate number of books and learning materials which the school lacks. Learning would be more
F. What difficulties did I encounter which
my principal or supervisor can help me
effective if each student could have their own set of books to work on and use as reference.
solve?
G. What innovation or localized materials Each teacher has his/her own way and tools to help him/her effectively pass on the knowledge and skills the learner should acquire for their advantage in this
did I use/discover which I wish to share
with other teachers?
globally competitive world. These tools and ways are not foreign to anybody and almost all teachers had used most of these already. But if ever I could discover
anything that would benefit the learners in this school, I would be glad to share it with my fellow teachers.
Prepared by: Noted by:

JEAN ALBIE B. SITCHARON MARLYNE M. VILLAREAL

SHS faculty MT I/SHS Track Head

Annex1B to DepEd Order No. 42, s.2016

GRADES 1 to 12 School Agusan National High School-SHS Grade Level 11

DAILY LESSON LOG Teacher Jean Albie B. Sitcharon Learning Area 21st Century Literature
Teaching Dates and Time September 11-15, 2017 (6:00am-11:00nn) Semester 1st Semester (2nd Quarter)
Session 1 Session 2
( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am), ( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am),
11-Twain (F 6:00am-11:00am) ) 11-Twain (F 6:00am-11:00am) )
I. OBJECTIVES Objectives must be met over the week and connected to the curriculum standards. To meet the objectives, necessary procedures must be followed and if needed, additional lessons, exercises, and
remedial activities may be done for developing the content knowledge and competencies. These are assessed using Formative Assessment Strategies, Valuing objectives support the learning of
content and competencies and enable children to find significance and joy in learning the lessons. Weekly objectives shall be derived from the curriculum guides.
A. Content Standards The learners will be able to understand and appreciate literary text in various The learners will be able to understand and appreciate literary text in various
genres across national literature and culture. genres across national literature and culture.
B. Performance Standards The learners will be able to demonstrate understanding and appreciation of 21 st The learners will be able to demonstrate understanding and appreciation of
Century Literature of the World through: (1) a written close analysis and critical 21st Century Literature of the World through: (1) a written close analysis and
interpretation of a literary text in terms of form and theme, with a description critical interpretation of a literary text in terms of form and theme, with a
of its context derived from research. description of its context derived from research.
C. Objectives/ Learning Identify representative texts and authors from Asia, North America, Europe, Identify representative texts and authors from Asia, North America, Europe,
Competencies Latin America and Africa. Latin America and Africa.
II. CONTENT Content is what the lesson is all about. It pertains to the subject matter that the teacher aims to teach. In the CG, the content can be tackled in a week or two.
Literary Genres, traditions and forms from different national literature and Literary Genres, traditions and forms from different national literature and
 cultures, namely, Asian, Anglo-American, Europe, Latin America and African. cultures, namely, Asian, Anglo-American, Europe, Latin America and African.
III. LEARNING RESOURCES List the materials to be used in different days. Varied sources of materials sustain children’s interest in the lesson and in learning. Ensure that there is a mix of concrete and manipulative materials
as well as paper-based materials. Hands-on learning promotes concept development.
A. References/ Learning Resources Textbook: 21st Century Literature from the Philippines and the World by Marikit Textbook: 21st Century Literature from the Philippines and the World by
TaraA. Uychoco. Marikit TaraA. Uychoco.
Internet: google.com, slideshare.net, deped.gov.ph Internet: google.com, slideshare.net, deped.gov.ph
IV. PROCEDURES These steps should be done across the week. Spread out the activities appropriately so that students will learn well. Always be guided with demonstration of learning by students which you can
enter from formative assessment activities. Sustain learning systematically by providing students with multiple ways to learn new things, practice their learning, question their learning processes,
and draw conclusions about what they learn in relation to their life experiences and previous knowledge. Indicate the time allotment fo googr each step.
A. Reviewing previous lesson or
presenting the new lesson 
The teacher will ask the students about the film “Dead Poet’s Society”  The teacher facilitates the discussion and students will answer

The teacher ask the students about some literary works they know and comprehensively.
B. Establishing a purpose for the
lesson are familiar with that originated from other countries.  The teacher will ask the students on what particular culture was
C. Presenting examples/ instances  The teacher then asks the students to compare and contrasts the presented in the slides shown by the teacher and how it is being
of the new lesson literary pieces of other countries from our own. presented.
D. Discussing new concepts and  The teacher will then discuss the origin and history of literature from  The teacher will discuss on the various literatures present all over the
practicing new skills #1 other countries/continents. globe and how each culture from these countries are presented.
E. Discussing new concepts and
practicing new skills #2  A quiz will be given by the teacher which is related to the discussion.
F. Developing mastery Activities: (Sample questions) The class will be grouped into 5. They will give their insights on the different
(Leads to Formative Assessment 3) 1. What do you mean by “Antiquity”? literature that was presented.
G. Finding practical applications of 2. This is the most popular romantic novel that originated in Japan? The group activity will serve as the formative test of the day.
concepts and skills in daily living 3. What is the oldest written work in China?
H. Making generalizations and
abstractions about the lesson
I. Evaluating learning
J. Additional activities for application
or remediation
V. REFLECTION Reflect on your teaching and assess yourself as a teacher. This about your student’s progress this week. What works? What else needs to be done to help the students learn?
Identify what help your instructional supervisors can provide you so when you meet them, you can ask them relevant questions.
A. No. of learners who earned 80% in The learners who got 80% in the evaluation are majority of the students in the sections I handled. They all listened to the discussion and actively participated in
the evaluation
the class activities.
B. No. of learners who require additional There are only a very few learners who got scores below 80%. Some of them were having problems in the spelling and were not careful in following the
activities for remediation who scored
below 80%
directions given in the activities/ quizzes.
C. Did the remedial lesson work? No. of The remedial lessons worked effectively for those who had some difficulty in coping up with the lessons. Those students were absent in the time of the
learners who have caught up with the
lesson
discussions/activities but eventually they were able to cope up with the advanced learners. I let the students work in groups in order for the advanced learners
to guide and tutor some of the learners who had difficulties. This occurrence is beneficial for both parties.
D. No. of learners who continue to Fortunately, all learners were able to cope up with the lessons and nobody is left behind to do further remedial classes.
require remediation
E. Which of my teaching strategies As I have noticed, scaffolding and implementing group activities worked well in most of my classes. The students were properly guided on the lesson and
worked well? Why did these work?
everyone enjoyed learning and working in groups. They were also able to learn by themselves and make use of their skills and prior knowledge.
The major thing that I want to provide for my students is adequate number of books and learning materials which the school lacks. Learning would be more
F. What difficulties did I encounter which
effective if each student could have their own set of books to work on and use as reference.
 my principal or supervisor can help me
solve?
G. What innovation or localized materials Each teacher has his/her own way and tools to help him/her effectively pass on the knowledge and skills the learner should acquire for their advantage in this
did I use/discover which I wish to share
with other teachers?
globally competitive world. These tools and ways are not foreign to anybody and almost all teachers had used most of these already. But if ever I could discover
anything that would benefit the learners in this school, I would be glad to share it with my fellow teachers.
Prepared by: Noted by:

JEAN ALBIE B. SITCHARON MARLYNE M. VILLAREAL

SHS faculty MT I/SHS Track Head

Annex1B to DepEd Order No. 42, s.2016

GRADES 1 to 12 School Agusan National High School-SHS Grade Level 11

DAILY LESSON LOG Teacher Jean Albie B. Sitcharon Learning Area 21st Century Literature
Teaching Dates and Time September 18-22, 2017 (6:00am-11:00nn) Semester 1st Semester (2nd Quarter)
Session 1 Session 2
( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am), ( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am),
11-Twain (F 6:00am-11:00am) ) 11-Twain (F 6:00am-11:00am) )
I. OBJECTIVES Objectives must be met over the week and connected to the curriculum standards. To meet the objectives, necessary procedures must be followed and if needed, additional lessons, exercises, and
remedial activities may be done for developing the content knowledge and competencies. These are assessed using Formative Assessment Strategies, Valuing objectives support the learning of
content and competencies and enable children to find significance and joy in learning the lessons. Weekly objectives shall be derived from the curriculum guides.
A. Content Standards The learners will be able to understand and appreciate literary text in various The learners will be able to understand and appreciate literary text in various
genres across national literature and culture. genres across national literature and culture.
B. Performance Standards The learners will be able to demonstrate understanding and appreciation of 21 st The learners will be able to demonstrate understanding and appreciation of
Century Literature of the World through: (1) a written close analysis and critical 21st Century Literature of the World through: (1) a written close analysis and
interpretation of a literary text in terms of form and theme, with a description critical interpretation of a literary text in terms of form and theme, with a
of its context derived from research. description of its context derived from research.
C. Objectives/ Learning Identify representative texts and authors from Asia, North America, Europe, Identify representative texts and authors from Asia, North America, Europe,
Competencies Latin America and Africa. Latin America and Africa.
II. CONTENT Content is what the lesson is all about. It pertains to the subject matter that the teacher aims to teach. In the CG, the content can be tackled in a week or two.
Literary Genres, traditions and forms from different national literature and Literary Genres, traditions and forms from different national literature and
cultures, namely, Asian, Anglo-American, Europe, Latin America and African. cultures, namely, Asian, Anglo-American, Europe, Latin America and African.
III. LEARNING RESOURCES List the materials to be used in different days. Varied sources of materials sustain children’s interest in the lesson and in learning. Ensure that there is a mix of concrete and manipulative materials
as well as paper-based materials. Hands-on learning promotes concept development.
A. References/ Learning Resources Textbook: 21st Century Literature from the Philippines and the World by Marikit Textbook: 21st Century Literature from the Philippines and the World by
TaraA. Uychoco. Marikit TaraA. Uychoco.
Internet: google.com, slideshare.net, deped.gov.ph Internet: google.com, slideshare.net, deped.gov.ph
IV. PROCEDURES These steps should be done across the week. Spread out the activities appropriately so that students will learn well. Always be guided with demonstration of learning by students which you can
enter from formative assessment activities. Sustain learning systematically by providing students with multiple ways to learn new things, practice their learning, question their learning processes,
and draw conclusions about what they learn in relation to their life experiences and previous knowledge. Indicate the time allotment fo googr each step.
A. Reviewing previous lesson or Group Reporting: (Group 1- Group 4) Group Reporting: (Continuation- G5-> G7)
presenting the new lesson The class will be grouped into seven and they will be given a continent/ country  The teacher will give a short quiz related to the lesson presented by
that they have to introduce and report elaborately through a PowerPoint the first 4 reporters.
B. Establishing a purpose for the
lesson presentation:  The reporting will continue starting from group 5 until group 7.
C. Presenting examples/ instances Here are the continents/countries they need to discuss:  Another quiz will be given by the teacher related to the report of
of the new lesson  Afro-Asian Literature grouo 5-group 7.
D. Discussing new concepts and  Japanese Literature  Group activity:
practicing new skills #1  Indian Literature  Gallery walk: The class which was divided into 7 will prepare a
E. Discussing new concepts and
practicing new skills #2  Anglo-American Literature gallery/exhibit of their assigned continent/country for the next
F. Developing mastery  Chinese Literature meeting. The teacher will evaluate the each exhibit with the guide of
(Leads to Formative Assessment 3)  Greek Literature rubrics.
G. Finding practical applications of  Roman Literature
concepts and skills in daily living  Latin (European) Literature
H. Making generalizations and
abstractions about the lesson Individual Activity:
I. Evaluating learning On a long bond paper, summarize a famous epic from a certaion country
J. Additional activities for application or continent. Make a characterization diagram/ chart. Identify from what
or remediation continent it originated from and who is the author.
V. REFLECTION Reflect on your teaching and assess yourself as a teacher. This about your student’s progress this week. What works? What else needs to be done to help the students learn?
Identify what help your instructional supervisors can provide you so when you meet them, you can ask them relevant questions.
A. No. of learners who earned 80% in The learners who got 80% in the evaluation are majority of the students in the sections I handled. They all listened to the discussion and actively participated in
the evaluation
the class activities.
B. No. of learners who require additional There are only a very few learners who got scores below 80%. Some of them were having problems in the spelling and were not careful in following the
activities for remediation who scored
below 80%
directions given in the activities/ quizzes.
C. Did the remedial lesson work? No. of The remedial lessons worked effectively for those who had some difficulty in coping up with the lessons. Those students were absent in the time of the
learners who have caught up with the
lesson
discussions/activities but eventually they were able to cope up with the advanced learners. I let the students work in groups in order for the advanced learners
to guide and tutor some of the learners who had difficulties. This occurrence is beneficial for both parties.
D. No. of learners who continue to Fortunately, all learners were able to cope up with the lessons and nobody is left behind to do further remedial classes.
require remediation
E. Which of my teaching strategies As I have noticed, scaffolding and implementing group activities worked well in most of my classes. The students were properly guided on the lesson and
worked well? Why did these work?
everyone enjoyed learning and working in groups. They were also able to learn by themselves and make use of their skills and prior knowledge.
The major thing that I want to provide for my students is adequate number of books and learning materials which the school lacks. Learning would be more
F. What difficulties did I encounter which
my principal or supervisor can help me
effective if each student could have their own set of books to work on and use as reference.
solve?
G. What innovation or localized materials Each teacher has his/her own way and tools to help him/her effectively pass on the knowledge and skills the learner should acquire for their advantage in this
 did I use/discover which I wish to share globally competitive world. These tools and ways are not foreign to anybody and almost all teachers had used most of these already. But if ever I could discover
with other teachers?
anything that would benefit the learners in this school, I would be glad to share it with my fellow teachers.
Prepared by: Noted by:

JEAN ALBIE B. SITCHARON MARLYNE M. VILLAREAL

SHS faculty MT I/SHS Track Head

Annex1B to DepEd Order No. 42, s.2016

GRADES 1 to 12 School Agusan National High School-SHS Grade Level 11

DAILY LESSON LOG Teacher Jean Albie B. Sitcharon Learning Area 21st Century Literature
Teaching Dates and Time September 25-29, 2017 (6:00am-11:00nn) Semester 1st Semester (2nd Quarter)
Session 1 Session 2
( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am), ( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am),
11-Twain (F 6:00am-11:00am) ) 11-Twain (F 6:00am-11:00am) )
I. OBJECTIVES Objectives must be met over the week and connected to the curriculum standards. To meet the objectives, necessary procedures must be followed and if needed, additional lessons, exercises, and
remedial activities may be done for developing the content knowledge and competencies. These are assessed using Formative Assessment Strategies, Valuing objectives support the learning of
content and competencies and enable children to find significance and joy in learning the lessons. Weekly objectives shall be derived from the curriculum guides.
A. Content Standards The learners will be able to understand and appreciate literary text in various The learners will be able to understand and appreciate literary text in various
genres across national literature and culture. genres across national literature and culture.
B. Performance Standards The learners will be able to demonstrate understanding and appreciation of 21 st The learners will be able to demonstrate understanding and appreciation of
Century Literature of the World through: (1) a written close analysis and critical 21st Century Literature of the World through: (1) a written close analysis and
interpretation of a literary text in terms of form and theme, with a description critical interpretation of a literary text in terms of form and theme, with a
of its context derived from research. description of its context derived from research.
C. Objectives/ Learning Identify representative texts and authors from Asia, North America, Europe, Identify representative texts and authors from Asia, North America, Europe,
Competencies Latin America and Africa. Latin America and Africa.
II. CONTENT Content is what the lesson is all about. It pertains to the subject matter that the teacher aims to teach. In the CG, the content can be tackled in a week or two.
Literary Genres, traditions and forms from different national literature and Literary Genres, traditions and forms from different national literature and
cultures, namely, Asian, Anglo-American, Europe, Latin America and African. cultures, namely, Asian, Anglo-American, Europe, Latin America and African.
III. LEARNING RESOURCES List the materials to be used in different days. Varied sources of materials sustain children’s interest in the lesson and in learning. Ensure that there is a mix of concrete and manipulative materials
as well as paper-based materials. Hands-on learning promotes concept development.
A. References/ Learning Resources Textbook: 21st Century Literature from the Philippines and the World by Marikit Textbook: 21st Century Literature from the Philippines and the World by
TaraA. Uychoco. Marikit TaraA. Uychoco.
 Internet: google.com, slideshare.net, deped.gov.ph Internet: google.com, slideshare.net, deped.gov.ph
IV. PROCEDURES These steps should be done across the week. Spread out the activities appropriately so that students will learn well. Always be guided with demonstration of learning by students which you can
enter from formative assessment activities. Sustain learning systematically by providing students with multiple ways to learn new things, practice their learning, question their learning processes,
and draw conclusions about what they learn in relation to their life experiences and previous knowledge. Indicate the time allotment fo googr each step.
A. Reviewing previous lesson or Group Reporting: (Group 4- Group 7) Gallery Walk: (Group1-Group7)
presenting the new lesson The class will be grouped into seven and they will be given a continent/ country  Gallery walk: The class which was divided into 7 will prepare a
that they have to introduce and report elaborately through a PowerPoint gallery/exhibit of their assigned continent/country. The teacher will
B. Establishing a purpose for the
lesson presentation: evaluate the each exhibit with the guide of a rubrics.
C. Presenting examples/ instances Here are the continents/countries they need to discuss: What each group will do:
of the new lesson  Afro-Asian Literature They will creatively present the literature and culture of their
D. Discussing new concepts and  Japanese Literature assigned country/continent in any of the following ways:
practicing new skills #1  Indian Literature  Mock interview
E. Discussing new concepts and
practicing new skills #2  Anglo-American Literature  Exhibit
F. Developing mastery  Chinese Literature  Song/Dance Presentation
(Leads to Formative Assessment 3)  Greek Literature  Drama/Play
G. Finding practical applications of  Roman Literature Individual Tasks:
concepts and skills in daily living  Latin (European) Literature Each student will list down the 10 information each group had
H. Making generalizations and presented/ showed about their assigned topic. This will be written on
abstractions about the lesson Individual Activity:
On a long bond paper, summarize a famous epic from a certaion country a one whole sheet of yellow paper.
I. Evaluating learning
J. Additional activities for application or continent. Make a characterization diagram/ chart. Identify from what
or remediation continent it originated from and who is the author.
V. REFLECTION Reflect on your teaching and assess yourself as a teacher. This about your student’s progress this week. What works? What else needs to be done to help the students learn?
Identify what help your instructional supervisors can provide you so when you meet them, you can ask them relevant questions.
A. No. of learners who earned 80% in The learners who got 80% in the evaluation are majority of the students in the sections I handled. They all listened to the discussion and actively participated in
the evaluation
the class activities.
B. No. of learners who require additional There are only a very few learners who got scores below 80%. Some of them were having problems in the spelling and were not careful in following the
activities for remediation who scored
below 80%
directions given in the activities/ quizzes.
C. Did the remedial lesson work? No. of The remedial lessons worked effectively for those who had some difficulty in coping up with the lessons. Those students were absent in the time of the
learners who have caught up with the
lesson
discussions/activities but eventually they were able to cope up with the advanced learners. I let the students work in groups in order for the advanced learners
to guide and tutor some of the learners who had difficulties. This occurrence is beneficial for both parties.
D. No. of learners who continue to Fortunately, all learners were able to cope up with the lessons and nobody is left behind to do further remedial classes.
require remediation
E. Which of my teaching strategies As I have noticed, scaffolding and implementing group activities worked well in most of my classes. The students were properly guided on the lesson and
worked well? Why did these work?
everyone enjoyed learning and working in groups. They were also able to learn by themselves and make use of their skills and prior knowledge.
The major thing that I want to provide for my students is adequate number of books and learning materials which the school lacks. Learning would be more
F. What difficulties did I encounter which
my principal or supervisor can help me
effective if each student could have their own set of books to work on and use as reference.
solve?
G. What innovation or localized materials Each teacher has his/her own way and tools to help him/her effectively pass on the knowledge and skills the learner should acquire for their advantage in this
did I use/discover which I wish to share
with other teachers?
globally competitive world. These tools and ways are not foreign to anybody and almost all teachers had used most of these already. But if ever I could discover
anything that would benefit the learners in this school, I would be glad to share it with my fellow teachers.
 Prepared by: Noted by:

JEAN ALBIE B. SITCHARON MARLYNE M. VILLAREAL

SHS faculty MT I/SHS Track Head

Annex1B to DepEd Order No. 42, s.2016

GRADES 1 to 12 School Agusan National High School-SHS Grade Level 11

DAILY LESSON LOG Teacher Jean Albie B. Sitcharon Learning Area 21st Century Literature
Teaching Dates and Time October 2-6, 2017 (6:00am-11:00nn) Semester 1st Semester (2nd Quarter)
Session 1 Session 2
( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am), ( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am),
11-Twain (F 6:00am-11:00am) ) 11-Twain (F 6:00am-11:00am) )
I. OBJECTIVES Objectives must be met over the week and connected to the curriculum standards. To meet the objectives, necessary procedures must be followed and if needed, additional lessons, exercises, and
remedial activities may be done for developing the content knowledge and competencies. These are assessed using Formative Assessment Strategies, Valuing objectives support the learning of
content and competencies and enable children to find significance and joy in learning the lessons. Weekly objectives shall be derived from the curriculum guides.
A. Content Standards The learners will be able to understand and appreciate literary text in various The learners will be able to understand and appreciate literary text in various
genres across national literature and culture. genres across national literature and culture.
B. Performance Standards The learners will be able to demonstrate understanding and appreciation of 21 st The learners will be able to demonstrate understanding and appreciation of
Century Literature of the World through: (1) a written close analysis and critical 21st Century Literature of the World through: (1) a written close analysis and
interpretation of a literary text in terms of form and theme, with a description critical interpretation of a literary text in terms of form and theme, with a
of its context derived from research. description of its context derived from research.
C. Objectives/ Learning Identify representative texts and authors from Asia, North America, Europe, Identify representative texts and authors from Asia, North America, Europe,
Competencies Latin America and Africa. Latin America and Africa.
II. CONTENT Content is what the lesson is all about. It pertains to the subject matter that the teacher aims to teach. In the CG, the content can be tackled in a week or two.
Literary Genres, traditions and forms from different national literature and Literary Genres, traditions and forms from different national literature and
cultures, namely, Asian, Anglo-American, Europe, Latin America and African. cultures, namely, Asian, Anglo-American, Europe, Latin America and African.
III. LEARNING RESOURCES List the materials to be used in different days. Varied sources of materials sustain children’s interest in the lesson and in learning. Ensure that there is a mix of concrete and manipulative materials
as well as paper-based materials. Hands-on learning promotes concept development.
A. References/ Learning Resources Textbook: 21st Century Literature from the Philippines and the World by Marikit Textbook: 21st Century Literature from the Philippines and the World by
TaraA. Uychoco. Marikit TaraA. Uychoco.
Internet: google.com, slideshare.net, deped.gov.ph Internet: google.com, slideshare.net, deped.gov.ph
IV. PROCEDURES These steps should be done across the week. Spread out the activities appropriately so that students will learn well. Always be guided with demonstration of learning by students which you can
enter from formative assessment activities. Sustain learning systematically by providing students with multiple ways to learn new things, practice their learning, question their learning processes,
 and draw conclusions about what they learn in relation to their life experiences and previous knowledge. Indicate the time allotment fo googr each step.
A. Reviewing previous lesson or Beowulf/ Canterbury Tales by Geoffrey Chaucer 2 nd Summative Test
presenting the new lesson  The teacher will announce the winner of the Gallery Walk. The teacher will give summative test with the following coverage:
 Like as promised, the group who won will be exempted from taking the a) World Literature
B. Establishing a purpose for the
lesson 2nd summative test and will automatically receive a perfect score. b) Beowulf
C. Presenting examples/ instances  The teacher will proceed to the discussion of the following literary c) The Iliad and Odyssey
of the new lesson pieces: d) Ramayana
D. Discussing new concepts and  Beowulf The class will be asked to prepare a one whole sheet of paper for the
practicing new skills #1
 Canterburry Tales answer sheet and will be given a time duration of 2 hours to answer the
E. Discussing new concepts and
practicing new skills #2  The teacher will show a powerpoint presentation about the epic 50-item test.
F. Developing mastery Beowulf and the Story Cantrebury Tales.
(Leads to Formative Assessment 3) Questions will be given for students to answer.
G. Finding practical applications of
concepts and skills in daily living Group Project:
H. Making generalizations and
abstractions about the lesson The class will be grouped into two. Each group will be making a movie of
I. Evaluating learning 15-20 minute time duration with any genre. (A rubrics will be used by the
J. Additional activities for application teacher to evaluate their performance and output).
or remediation
V. REFLECTION Reflect on your teaching and assess yourself as a teacher. This about your student’s progress this week. What works? What else needs to be done to help the students learn?
Identify what help your instructional supervisors can provide you so when you meet them, you can ask them relevant questions.
A. No. of learners who earned 80% in The learners who got 80% in the evaluation are majority of the students in the sections I handled. They all listened to the discussion and actively participated in
the evaluation
the class activities.
B. No. of learners who require additional There are only a very few learners who got scores below 80%. Some of them were having problems in the spelling and were not careful in following the
activities for remediation who scored
below 80%
directions given in the activities/ quizzes.
C. Did the remedial lesson work? No. of The remedial lessons worked effectively for those who had some difficulty in coping up with the lessons. Those students were absent in the time of the
learners who have caught up with the
lesson
discussions/activities but eventually they were able to cope up with the advanced learners. I let the students work in groups in order for the advanced learners
to guide and tutor some of the learners who had difficulties. This occurrence is beneficial for both parties.
D. No. of learners who continue to Fortunately, all learners were able to cope up with the lessons and nobody is left behind to do further remedial classes.
require remediation
E. Which of my teaching strategies As I have noticed, scaffolding and implementing group activities worked well in most of my classes. The students were properly guided on the lesson and
worked well? Why did these work?
everyone enjoyed learning and working in groups. They were also able to learn by themselves and make use of their skills and prior knowledge.
The major thing that I want to provide for my students is adequate number of books and learning materials which the school lacks. Learning would be more
F. What difficulties did I encounter which
my principal or supervisor can help me
effective if each student could have their own set of books to work on and use as reference.
solve?
G. What innovation or localized materials Each teacher has his/her own way and tools to help him/her effectively pass on the knowledge and skills the learner should acquire for their advantage in this
did I use/discover which I wish to share
with other teachers?
globally competitive world. These tools and ways are not foreign to anybody and almost all teachers had used most of these already. But if ever I could discover
anything that would benefit the learners in this school, I would be glad to share it with my fellow teachers.
Prepared by: Noted by:

JEAN ALBIE B. SITCHARON MARLYNE M. VILLAREAL

 SHS faculty MT I/SHS Track Head

Annex1B to DepEd Order No. 42, s.2016

GRADES 1 to 12 School Agusan National High School-SHS Grade Level 11

DAILY LESSON LOG Teacher Jean Albie B. Sitcharon Learning Area 21st Century Literature
Teaching Dates and Time October 9-13, 2017 (6:00am-11:00nn) Semester 1st Semester (2nd Quarter)
Session 1 Session 2
( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am), ( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am),
11-Twain (F 6:00am-11:00am) ) 11-Twain (F 6:00am-11:00am) )
I. OBJECTIVES Objectives must be met over the week and connected to the curriculum standards. To meet the objectives, necessary procedures must be followed and if needed, additional lessons, exercises, and
remedial activities may be done for developing the content knowledge and competencies. These are assessed using Formative Assessment Strategies, Valuing objectives support the learning of
content and competencies and enable children to find significance and joy in learning the lessons. Weekly objectives shall be derived from the curriculum guides.
A. Content Standards The learners will be able to understand and appreciate literary text in various The learners will be able to understand and appreciate literary text in various
genres across national literature and culture. genres across national literature and culture.
B. Performance Standards The learners will be able to demonstrate understanding and appreciation of 21 st The learners will be able to demonstrate understanding and appreciation of
Century Literature of the World through: (1) a written close analysis and critical 21st Century Literature of the World through: (1) a written close analysis and
interpretation of a literary text in terms of form and theme, with a description critical interpretation of a literary text in terms of form and theme, with a
of its context derived from research. description of its context derived from research.
C. Objectives/ Learning Identify representative texts and authors from Asia, North America, Europe, Identify representative texts and authors from Asia, North America, Europe,
Competencies Latin America and Africa. Latin America and Africa.
II. CONTENT Content is what the lesson is all about. It pertains to the subject matter that the teacher aims to teach. In the CG, the content can be tackled in a week or two.
Literary Genres, traditions and forms from different national literature and Literary Genres, traditions and forms from different national literature and
cultures, namely, Asian, Anglo-American, Europe, Latin America and African. cultures, namely, Asian, Anglo-American, Europe, Latin America and African.
III. LEARNING RESOURCES List the materials to be used in different days. Varied sources of materials sustain children’s interest in the lesson and in learning. Ensure that there is a mix of concrete and manipulative materials
as well as paper-based materials. Hands-on learning promotes concept development.
A. References/ Learning Resources Textbook: 21st Century Literature from the Philippines and the World by Marikit Textbook: 21st Century Literature from the Philippines and the World by
TaraA. Uychoco. Marikit TaraA. Uychoco.
Internet: google.com, slideshare.net, deped.gov.ph Internet: google.com, slideshare.net, deped.gov.ph
IV. PROCEDURES These steps should be done across the week. Spread out the activities appropriately so that students will learn well. Always be guided with demonstration of learning by students which you can
enter from formative assessment activities. Sustain learning systematically by providing students with multiple ways to learn new things, practice their learning, question their learning processes,
and draw conclusions about what they learn in relation to their life experiences and previous knowledge. Indicate the time allotment fo googr each step.
A. Reviewing previous lesson or Beowulf/ Canterbury Tales by Geoffrey Chaucer 2 nd Summative Test
presenting the new lesson

B. Establishing a purpose for the
lesson
C. Presenting examples/ instances
of the new lesson
D. Discussing new concepts and
practicing new skills #1
E. Discussing new concepts and
practicing new skills #2
F. Developing mastery
(Leads to Formative Assessment 3)
G. Finding practical applications of
concepts and skills in daily living
H. Making generalizations and
abstractions about the lesson
I. Evaluating learning
J. Additional activities for application
or remediation
V. REFLECTION
A. No. of learners who earned 80% in
the evaluation
B. No. of learners who require additional
activities for remediation who scored
below 80%
C. Did the remedial lesson work? No. of
learners who have caught up with the
lesson
D. No. of learners who continue to
require remediation
E. Which of my teaching strategies
worked well? Why did these work?
F. What difficulties did I encounter which
my principal or supervisor can help me
solve?
G. What innovation or localized materials
did I use/discover which I wish to share
with other teachers?
Prepared by:
(The teacher attended a seminar on teaching literature at Davao and reported on Tuesday which (The teacher attended a seminar on teaching literature at Davao and reported on Tuesday
happens to be the day for the NAT Examination. Wednesday classes was scheduled for Tuesday which happens to be the day for the NAT Examination. Wednesday classes was scheduled for
and Thursday regular subjects. In the following day , which is Thursday, there was a School Tuesday and Thursday regular subjects. In the following day , which is Thursday, there was a
Reaserch Congress. Friday, a Fun Run Zumba happened. So, basically this week had been full of School Reaserch Congress. Friday, a Fun Run Zumba happened. So, basically this week had
extra-curricular activities. This lesson will continue for the following week.) been full of extra-curricular activities. This lesson will continue for the following week.)
 The teacher will announce the winner of the Gallery Walk. The teacher will give summative test with the following coverage:
 Like as promised, the group who won will be exempted from taking the e) World Literature
2nd summative test and will automatically receive a perfect score. f) Beowulf
 The teacher will proceed to the discussion of the following literary g) The Iliad and Odyssey
pieces: h) Ramayana
 Beowulf The class will be asked to prepare a one whole sheet of paper for the
 Canterburry Tales answer sheet and will be given a time duration of 2 hours to answer the
 The teacher will show a powerpoint presentation about the epic 50-item test.
Beowulf and the Story Cantrebury Tales.
Questions will be given for students to answer.
Group Project:
The class will be grouped into two. Each group will be making a movie of
15-20 minute time duration with any genre. (A rubrics will be used by the
teacher to evaluate their performance and output).
Reflect on your teaching and assess yourself as a teacher. This about your student’s progress this week. What works? What else needs to be done to help the students learn?
Identify what help your instructional supervisors can provide you so when you meet them, you can ask them relevant questions.
The learners who got 80% in the evaluation are majority of the students in the sections I handled. They all listened to the discussion and actively participated in
the class activities.
There are only a very few learners who got scores below 80%. Some of them were having problems in the spelling and were not careful in following the
directions given in the activities/ quizzes.
The remedial lessons worked effectively for those who had some difficulty in coping up with the lessons. Those students were absent in the time of the
discussions/activities but eventually they were able to cope up with the advanced learners. I let the students work in groups in order for the advanced learners
to guide and tutor some of the learners who had difficulties. This occurrence is beneficial for both parties.
Fortunately, all learners were able to cope up with the lessons and nobody is left behind to do further remedial classes.
As I have noticed, scaffolding and implementing group activities worked well in most of my classes. The students were properly guided on the lesson and
everyone enjoyed learning and working in groups. They were also able to learn by themselves and make use of their skills and prior knowledge.
The major thing that I want to provide for my students is adequate number of books and learning materials which the school lacks. Learning would be more
effective if each student could have their own set of books to work on and use as reference.
Each teacher has his/her own way and tools to help him/her effectively pass on the knowledge and skills the learner should acquire for their advantage in this
globally competitive world. These tools and ways are not foreign to anybody and almost all teachers had used most of these already. But if ever I could discover
anything that would benefit the learners in this school, I would be glad to share it with my fellow teachers.
Noted by:
 JEAN ALBIE B. SITCHARON MARLYNE M. VILLAREAL
SHS faculty MT I/SHS Track Head

Annex1B to DepEd Order No. 42, s.2016

GRADES 1 to 12 School Agusan National High School-SHS Grade Level 11

DAILY LESSON LOG Teacher Jean Albie B. Sitcharon Learning Area 21st Century Literature
Teaching Dates and Time October 16-20, 2017 (6:00am-11:00nn) Semester 1st Semester (2nd Quarter)
Session 1 Session 2
( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am), ( 11- C.S. Lewis (M/W 6am-8am), 11-Marx (T/TH 6:00am-8:00am),
11-Twain (F 6:00am-11:00am) ) 11-Twain (F 6:00am-11:00am) )
I. OBJECTIVES Objectives must be met over the week and connected to the curriculum standards. To meet the objectives, necessary procedures must be followed and if needed, additional lessons, exercises, and
remedial activities may be done for developing the content knowledge and competencies. These are assessed using Formative Assessment Strategies, Valuing objectives support the learning of
content and competencies and enable children to find significance and joy in learning the lessons. Weekly objectives shall be derived from the curriculum guides.
A. Content Standards The learners will be able to understand and appreciate literary text in various The learners will be able to understand and appreciate literary text in various
genres across national literature and culture. genres across national literature and culture.
B. Performance Standards The learners will be able to demonstrate understanding and appreciation of 21 st The learners will be able to demonstrate understanding and appreciation of
Century Literature of the World through: (1) a written close analysis and critical 21st Century Literature of the World through: (1) a written close analysis and
interpretation of a literary text in terms of form and theme, with a description critical interpretation of a literary text in terms of form and theme, with a
of its context derived from research. description of its context derived from research.
C. Objectives/ Learning Review Quizzes/ Summative Tests 2nd Quarter Final Examination
Competencies
II. CONTENT Content is what the lesson is all about. It pertains to the subject matter that the teacher aims to teach. In the CG, the content can be tackled in a week or two.
Literary Genres, traditions and forms from different national literature and Literary Genres, traditions and forms from different national literature and
cultures, namely, Asian, Anglo-American, Europe, Latin America and African. cultures, namely, Asian, Anglo-American, Europe, Latin America and African.
III. LEARNING RESOURCES List the materials to be used in different days. Varied sources of materials sustain children’s interest in the lesson and in learning. Ensure that there is a mix of concrete and manipulative materials
as well as paper-based materials. Hands-on learning promotes concept development.
A. References/ Learning Resources Textbook: 21st Century Literature from the Philippines and the World by Marikit Textbook: 21st Century Literature from the Philippines and the World by
TaraA. Uychoco. Marikit TaraA. Uychoco.
Internet: google.com, slideshare.net, deped.gov.ph Internet: google.com, slideshare.net, deped.gov.ph
IV. PROCEDURES These steps should be done across the week. Spread out the activities appropriately so that students will learn well. Always be guided with demonstration of learning by students which you can
enter from formative assessment activities. Sustain learning systematically by providing students with multiple ways to learn new things, practice their learning, question their learning processes,
and draw conclusions about what they learn in relation to their life experiences and previous knowledge. Indicate the time allotment fo googr each step.
A. Reviewing previous lesson or • The students will be having their final exams in the subjects they are
presenting the new lesson  The days prior to the examination date will be used for review taking.
and recap of lessons and activities. • Senior High teachers are the proctors.
B. Establishing a purpose for the
lesson • The exams in each subject will be conducted by department and
C. Presenting examples/ instances
of the new lesson
D. Discussing new concepts and
practicing new skills #1
E. Discussing new concepts and
practicing new skills #2
F. Developing mastery
(Leads to Formative Assessment 3)
G. Finding practical applications of
concepts and skills in daily living
H. Making generalizations and
abstractions about the lesson
I. Evaluating learning
J. Additional activities for application
or remediation
V. REFLECTION
A. No. of learners who earned 80% in
the evaluation
B. No. of learners who require additional
activities for remediation who scored
below 80%
C. Did the remedial lesson work? No. of
learners who have caught up with the
lesson
D. No. of learners who continue to
require remediation
E. Which of my teaching strategies
worked well? Why did these work?
F. What difficulties did I encounter which
my principal or supervisor can help me
solve?
G. What innovation or localized materials
did I use/discover which I wish to share
with other teachers?
Prepared by:
JEAN ALBIE B. SITCHARON
SHS faculty
students will be shuffled in different rooms in a particular date of
 The teacher will give the coverage for the exams. examination.
• Exam type may vary depending on the subject.
 As to this subject, the teacher will be presenting the guidelines or • Students will be told to follow the corresponding rules in taking an
exam.
rubrics of the outputs that the class will submit or comply in
• Each subject has an allotted time for students to answer.
relation to their filmmaking. • After the students have taken the exam, proctors will collect and keep
 Each class in the 21st Century Literature will submit the ff: the test papers for checking.
- Movie Information Sheet
- Movie Poster (jpeg format)
- Movie Video (mp4 format)
Reflect on your teaching and assess yourself as a teacher. This about your student’s progress this week. What works? What else needs to be done to help the students learn?
Identify what help your instructional supervisors can provide you so when you meet them, you can ask them relevant questions.
The learners who got 80% in the evaluation are majority of the students in the sections I handled. They all listened to the discussion and actively participated in
the class activities.
There are only a very few learners who got scores below 80%. Some of them were having problems in the spelling and were not careful in following the
directions given in the activities/ quizzes.
The remedial lessons worked effectively for those who had some difficulty in coping up with the lessons. Those students were absent in the time of the
discussions/activities but eventually they were able to cope up with the advanced learners. I let the students work in groups in order for the advanced learners
to guide and tutor some of the learners who had difficulties. This occurrence is beneficial for both parties.
Fortunately, all learners were able to cope up with the lessons and nobody is left behind to do further remedial classes.
As I have noticed, scaffolding and implementing group activities worked well in most of my classes. The students were properly guided on the lesson and
everyone enjoyed learning and working in groups. They were also able to learn by themselves and make use of their skills and prior knowledge.
The major thing that I want to provide for my students is adequate number of books and learning materials which the school lacks. Learning would be more
effective if each student could have their own set of books to work on and use as reference.
Each teacher has his/her own way and tools to help him/her effectively pass on the knowledge and skills the learner should acquire for their advantage in this
globally competitive world. These tools and ways are not foreign to anybody and almost all teachers had used most of these already. But if ever I could discover
anything that would benefit the learners in this school, I would be glad to share it with my fellow teachers.
Noted by:
MARLYNE M. VILLAREAL
MT I/SHS Track Head