Вы находитесь на странице: 1из 63

Epigenetics

ISSN: 1559-2294 (Print) 1559-2308 (Online) Journal homepage: https://www.tandfonline.com/loi/kepi20

Identification of PBMC-Expressed MiRNAs for


Rheumatoid Arthritis

Xiaowei Zhu, Longfei Wu, Xingbo Mo, Wei Xia, Yufan Guo, Mingjun Wang,
Keqin Zeng, Jian Wu, Yinghua Qiu, Xiang Lin, Xin Lu, Feiyan Deng & Shufeng
Lei

To cite this article: Xiaowei Zhu, Longfei Wu, Xingbo Mo, Wei Xia, Yufan Guo, Mingjun
Wang, Keqin Zeng, Jian Wu, Yinghua Qiu, Xiang Lin, Xin Lu, Feiyan Deng & Shufeng Lei
(2019): Identification of PBMC-Expressed MiRNAs for Rheumatoid Arthritis, Epigenetics, DOI:
10.1080/15592294.2019.1676613

To link to this article: https://doi.org/10.1080/15592294.2019.1676613

View supplementary material

Accepted author version posted online: 07


Oct 2019.

Submit your article to this journal

View related articles

View Crossmark data

Full Terms & Conditions of access and use can be found at


https://www.tandfonline.com/action/journalInformation?journalCode=kepi20
Publisher: Taylor & Francis & Informa UK Limited, trading as Taylor & Francis
Group

Journal: Epigenetics

DOI: 10.1080/15592294.2019.1676613

Identification of PBMC-Expressed MiRNAs for Rheumatoid

t
ip
Arthritis

cr
Xiaowei Zhu1,2,3#, Longfei Wu1,2#, Xingbo Mo1,2, Wei Xia1,2, Yufan Guo4, Mingjun

us
Wang4, Keqin Zeng4, Jian Wu4, Yinghua Qiu1,2, Xiang Lin1,2, Xin Lu1,2, Feiyan
Deng1,2*, Shufeng Lei1,2*
an
1
Center for Genetic Epidemiology and Genomics, School of Public Health, Medical
M
College of Soochow University, Suzhou, Jiangsu, P. R. China
2
Jiangsu Key Laboratory of Preventive and Translational Medicine for Geriatric
ed

Diseases, Soochow University, Suzhou, Jiangsu, P. R. China


3
Zhangjiagang Center for Disease Prevention and Control, Suzhou, Jiangsu, P. R.
pt

China
4
Department of Rheumatology, the First Affiliated Hospital of Soochow University,
ce

Suzhou, Jiangsu, P. R. China


Ac

Running Title: Zhu X and Wu L / Identification of PBMC-Expressed miRNAs

#
These two authors contributed equally to this work.

*Corresponding authors:
Shu-Feng Lei, Email: leisf@suda.edu.cn;
Fei-Yan Deng, Email: fdeng@suda.edu.cn
Postal address: Center for Genetic Epidemiology and Genomics, School of Public
Health, Medical School of Soochow University, Suzhou, Jiangsu 215123, P. R.
China
Tel/Fax: +86-0512-65883357

t
ip
cr
us
an
M
ed
pt
ce
Ac
Abstract
Post-transcriptional regulation by miRNAs plays an important role in the
pathogenesis of rheumatoid arthritis (RA), however, the roles of specific miRNAs in
RA pathogenesis remain largely unclear. This study performed dual-omics (miRNA
and mRNA) integration analysis and in-depth cellular and molecular functional
exploration to identify novel RA-associated miRNAs and to understand their
underlying pathogenic mechanism. Based on the miRNA and mRNA expression

t
ip
profiles in peripheral blood mononuclear cells (PBMCs) from a discovery sample set
(25 RA cases and 18 healthy controls), 18 differentially expressed miRNAs

cr
(DEMIRs) (|Fold-change|>2 and P<0.05) were identified and corresponding

us
interaction networks of DEMIRs and mRNA were constructed. After the expression
validation of the DEMIRs in a validation sample set (35 RA cases and 35 healthy
an
controls), miR-99b-5p was highlighted. The over-expression of newly discovered
miR-99b-5p is able to suppress T cell apoptosis, promote cell proliferation and
activation, increase expression of proinflammatory cytokines (IL-2, IL-6, TNF-α,
M

and IFN-γ), and inhibit expression of its target genes mTOR and RASSF4. This
study comprehensively identified PBMC-expressed miRNAs along with
ed

corresponding regulatory networks significant for RA and discovered miR-99b-5p as


a novel post-transcriptional mediator involved in RA pathogenesis. The findings
pt

improved our understanding of RA pathogenesis and provided novel insights into the
molecular mechanisms underlying RA pathogenesis.
ce

KEYWORDS: Rheumatoid arthritis; MiRNA; MiR-99b-5p


Ac
1. Introduction
Rheumatoid arthritis (RA) is a serious autoimmune disease characterized by
inflammatory synovitis and progressive impairment of joints [1]. Previous studies
have shown multiple genetic and environmental factors to be associated with RA,
however, the role of genetic and environmental factors in RA pathogenesis remains
largely unclear [2]. Epigenetic factors not only serve as a bridge between genotype
and phenotype but also as a reflection of the specific mechanism of environmental

t
ip
factors in pathogenesis [3]. Post-transcriptional regulation by miRNAs, as an
important epigenetic mechanism, exerts essential effects on gene expression through

cr
binding to mRNA 3’ untranslated region (3’UTR), influences mRNA degradation or

us
translation repression, and contributes to the variation in cell development process
including proliferation, differentiation, apoptosis, oxidative stress, and so on.
an
Accumulating evidence has suggested that miRNAs exert important effects on the
RA pathogenesis [4-6].
M

Previous studies have identified several RA-associated miRNAs [6-10]. These


miRNAs participate in the regulation of multiple RA-related cytokine signaling
ed

pathways [11], which leads to the development of synovial tissue lesions, the
dysregulation of immune cells [12-14], and the aggravation of joints by inducing
pt

osteoclastogenesis and the secretion of metalloproteinase [15, 16]. However, due to


relatively lower coverage of miRNA screening in previous studies [9, 10], the
ce

miRNAs identified for RA are thus far limited. Furthermore, most previous studies
on miRNA lacked in-depth investigation of target genes or regulatory networks.
Ac

Therefore, comprehensive and in-depth studies are needed for better understanding
the significance of miRNA in RA pathogenesis.

To identify novel RA-associated miRNAs and understand their underlying


pathogenic mechanism, this study generated dual-omics datasets (miRNA and
mRNA) from peripheral blood mononuclear cells (PBMCs) of a discovery sample.
Subsequently, we identified and validated DEMIRs along with corresponding target
genes in a validation sample and constructed RA-associated expression regulatory
network in PBMCs. We evaluated the clinical significance of all DEMIRs and
explored the functional effects of highlighted miRNA on RA-relevant immune cells
(Jurkat T cells). Concisely, we found that PBMC-expressed miRNAs, together with
their target genes, were interacted and significantly regulated with RA. The
miR-99b-5p targets RASSF4 and mTOR, influences immune cell behavior, and
contributes to inflammation and rheumatoid arthritis. The workflow of the present

t
ip
study is schematically presented in Figure S1.

cr
2. Results

us
2.1 Identification of differentially expressed miRNAs between RA cases and
controls
an
Among the 2,578 miRNAs tested by Affymetrix miRNA 4.0, 18 differentially
expressed miRNAs (DEMIRs) (17 down-regulated and 1 up-regulated) were
identified between 25 RA cases and 18 controls included in the discovery sample set
M

(|Fold-change|>2 and P<0.05). (Table 1, Figure S2). Hierarchical clustering analysis


showed that these DEMIRs have the ability to discriminate most of the RA cases and
ed

controls (Figure S3).


pt

2.2 Integrative analysis (miRNA &mRNA) and interaction network


ce

construction
To explore the role of the identified miRNAs in the pathogenesis of RA, we
integrated miRNA and mRNA data generated from the discovery sample and
Ac

constructed interaction networks for significant miRNAs and mRNAs. We predicted


target genes of DEMIR using three publicly available bioinformatics databases
(TargetScan, miRDB and miRanda). A total of 1,243 target genes were
simultaneously predicted by using the 3 databases. Among them, 921 genes were
covered and quantified in the miRNA microarray. Among the 921 genes, 592 were
differentially expressed between RA cases and controls (P<0.05). Pearson correlation
analysis further showed that 141 of the 592 DEGs were significantly correlated with
9 DEMIRs, which constituted 149 significant pairs (P<0.05) for subsequent network
analysis.

The 9 DEMIRs and 141 putative target genes contributed to multiple complex
regulatory networks (Figure 1A). Among the 149 pairs of DEMIRs and DEGs,
miR-101-3p and its putative target ARID1A demonstrated the strongest correlation
(r= -0.66, Table S1). The primary network was comprised of 4 miRNAs

t
ip
(miR-101-3p, miR-1184, miR-1246, and miR-142-5p) and their target genes (the
total is 129) with each miRNA targeting at least 16 genes. Network analyses helped

cr
to find 8 common target genes (TMF1, ICK, SLC30A7, UBR7, ZSWIM6, ARID1A,

us
SH2B3 and EDEM3) of different miRNAs. When focused on strong correlation pairs
(r<-0.4), 2 miRNAs (miR-101-3p and miR-1184) and their target genes (the total is
an
36) formed a big network (Figure 1B) with ARID1A as the common target gene. The
target genes have known RA associated functions (e.g., SH2B3, COTL1 and
SPRED2) [17-19]. Mining the literature, we found 11 genes were also involved in
M

the immune inflammation (Table S2).


ed

2.3 Clinical evaluation for the identified miRNAs


Receiver-operating characteristic (ROC) analyses were performed to assess the
pt

discriminative capacity of the 18 DEMIRs, respectively (Table S3). The area under
the curve (AUC) ranged from 0.698 to 0.876 for the 18 DEMIRs, most of which
ce

showed great power in discriminating between RA patients and healthy subjects.


Ac

As shown in Table S3, significant correlations were observed between


hsa-miR-26b-5p and C-reactive protein (CRP; r=-0.425, P=0.034), between
hsa-miR-3201, hsa-miR-8084, and erythrocyte sedimentation rate (ESR; r=-0.409
and -0.407, P=0.043 and 0.043), between hsa-miR-3613-3p and 28-joint Disease
Activity Score (DAS28; r=0.423, P=0.035), between hsa-miR-4448 and swollen
joint count (SJC; r=0.398, P=0.049), and between hsa-miR-1184, hsa-miR-3613-3p,
hsa-miR-4668-5p and tender joint count (TJC; r=0.459, 0.498 and 0.496, P=0.021,
0.011 and 0.012), respectively.

2.4 Validation of the DEMIRs in additional sample


RT-qPCR assays in a validation sample (35 RA cases and 35 healthy controls)
showed that 3 (miR-99b-5p, miR-26b-5p and miR-7641) of the 9 selected miRNAs
presented significant differential expression between RA cases and controls (P<0.05,
Figure 2), as well as consistent expression trends with the discovery sample.

t
ip
2.5 Functional role of miR-99b-5p in Jurkat T cells

cr
Among the 18 DEMIRs, the miR-99b-5p was the only up-regulated miRNA in RA in

us
the discovery sample. Additionally, the miR-99b-5p was verified to have
significantly higher expression in T lymphocytes among RA patients in contrast to
an
healthy controls (P=0.039, Figure S4). Therefore, the Jurkat cells (T cells) were
selected as target cells in investigating the in-deep functions of miR-99b-5p. We first
constructed the miR-99b-5p over-expression (OE) Jurkat cell line (using lentiviral
M

particles) and the empty vector (negative control, OE-NC) cell line. The percentage
of GFP-positive cells determined by flow cytometry was 84.6% in the stable
ed

transfected Jurkat cell culture with miR-99b-5p lentivirus. The relative amount of
miR-99b-5p was over 5.23-fold higher in OE cells than that in NC cells (Figure 3A).
pt

We further investigated the functional effect on behaviors of Jurkat T cells after


treatment with miR-99b-5p inhibitor. Compared with the treatment with inhibitor
ce

negative control, the expression of miR-99b-5p reduced to 0.3-fold after treating


with miR-99b-5p inhibitor in Jurkat cells (Figure 4A).
Ac

CCK-8 assays revealed that the proliferative ability of Jurkat cells was significantly
increased in OE cells compared with NC cells (P<0.05, Figure 3B). Conversely,
miR-99b-5p-inhibitor cells exhibited lower proliferation rate compared with the
negative controls (P<0.01) (Figure 4B). Flow cytometry analysis showed the effects
of miR-99b-5p on cell apoptosis and cell cycle (raw data shown in Figure S5). As
shown in Figure 3C, the overexpression of miR-99b-5p significantly decreased the
percentage of apoptotic cells compared with the NC cells (P<0.001). Furthermore,
cell cycle analysis revealed that the overexpression of miR-99b-5p significantly
increased cells at G2/M phase (Figure 3D) suggesting that the miR-99b-5p
stimulated cell division and proliferation. Together, these results suggested that
miR-99b-5p promotes Jurkat T cell growth by stimulating proliferation and
inhibiting apoptosis.

t
ip
Cell surface CD69 and CD25 are early and middle T lymphocyte activation markers.
Without phytohemagglutinin (PHA) stimulation, the positive rates of CD69 and

cr
CD25 Jurkat cells were low in both miR-99b-5p OE cells and NC cells (Figure 3E,

us
Figure S5). With PHA stimulation, the positive rates of both antigens significantly
increased in both OE and NC cells (P<0.01). Moreover, the overexpression of
an
miR-99b-5p caused a significant increase in the CD69 and CD25 positive rate
compared with the negative controls (P<0.05). The results indicated that the
overexpression of miR-99b-5p could effectively promote Jurkat T cell activation.
M

The overexpression of miR-99b-5p significantly elevated the expression of


ed

proinflammatory cytokines, including IL-2, IL-6, TNF-α and IFN-γ (P<0.05, Figure
3F). However, no significant difference was suggested for IL-1β, IL-4 and IL-8.
pt
ce

2.6 Prediction and validation of target genes for miR-99b-5p


Based on the 3 publicly available bioinformatics databases (TargetScan, miRDB and
miRanda), a total of 10 target genes of miR-99b-5p were predicted from either one
Ac

of the 3 databases for subsequent analysis.

The 10 genes were all significantly differentially expressed between RA cases and
controls in the discovery sample (P<0.05) and were negatively correlated with
miR-99b-5p (P<0.05, r=-0.32~-0.62) (Table S4). Furthermore, RT-qPCR of the 10
target genes in Jurkat cells showed that, 6 genes were significantly down-regulated
in the OE cells out of 7 successfully quantified genes compared to the NC cells
(Figure 5A).

According to the correlation coefficient of target gene mRNA level with miR-99b-5p
level and the fold change with RA in the microarray analyses of the discovery
sample, 2 of the 7 validated target genes (mTOR with highest correlation and
RASSF4 with highest fold change) were further tested the differential expression in
an additional human sample (35 RA cases vs. 35 controls). The differential

t
ip
expression between RA cases and controls for both mTOR and RASSF4 genes were
replicated in PBMC in vivo (Figure 5B).

cr
us
Previous study has validated the miR-99b-5p could decrease the expression of mTOR
by directly targeting to its 3’UTR [20]. The dual luciferase assay of 293T cells was
an
performed with co-transfecting the wild-type or mutant-type 3’UTR of mTOR and
miR-99b-5p mimics. The relative luciferase activity of the wild-type mTOR 3’ UTR
construct was found significantly lower than controls, whereas that of the mutated
M

site was not significantly changed. In the present study, the dual-luciferase assays
using pmirGLO vector showed that compared with NC cells, the overexpression of
ed

miR-99b-5p significantly inhibited the luciferase activity of wild-type 3’UTR of


RASSF4, which was rescued when the 3’UTRs of RASSF4 was mutated. The data
pt

suggested that miR-99b-5p indeed inhibits RASSF4 mRNA level through binding to
the 3’UTR of RASSF4 (Figure 5C).
ce

To further explore the function of miR-99b-5p target gene, we conducted the Pearson
Ac

correlations between the target genes and inflammatory cytokines by using the gene
expression levels detected in Jurkat T cells and PBMCs (Table S5). Highly negative
correlations were found between IL-2 and the 2 targets including mTOR and RASSF4
in Jurkat T cells (P<0.05). Significant negative correlations were also found between
RASSF4 and IL-6 in both Jurkat and PBMCs (P<0.05). The above results taken
together gave us clues that miR-99b-5p may induce the expression of inflammatory
cytokines through regulating the targets negatively. More functional studies are
called for the further underlying mechanisms.

3. Discussion
By performing high-throughput miRNA and mRNA expression microarray analyses
for RA, this study comprehensively identified PBMC-expressed miRNAs and their
regulatory networks significant for RA, and discovered miR-99b-5p as a novel
post-transcriptional mediator involved in RA pathogenesis. The miRNA-mRNA

t
ip
integrative analysis improved our understanding of the targeted regulation
mechanism of miRNA and provided novel candidate miRNA biomarkers for RA

cr
diagnosis, as supported by both in vivo and in vitro validations, high discriminative

us
capacity, and significant correlation with the RA-associated clinical variables.
Pursuant molecular biological assays dissected the miR-99b-5p-mediated regulatory
an
effects on target gene expression, inflammatory cytokine expression, T cell growth
(proliferation, apoptosis, cycle), and activation. The above dual-omics integration
analysis and in-depth cellular and molecular functional exploration shed new lights
M

on the underlying association mechanisms between key miRNA and RA, highlighted
specific biological pathways, and provided novel biomarkers for developing
ed

molecular diagnosis and treatment strategies for RA.


pt

Previous studies have reported that RA is associated with altered miRNA levels in
various tissues or cells [6-8, 21]. Our study has found 18 aberrantly expressed
ce

miRNAs in PBMCs of RA cases, most of which had not been reported previously.
Interestingly, three significant miRNAs (miR-29b-3p, miR-29c-3p and miR-26b-5p),
Ac

identified herein in PBMCs, were non-significant in whole blood [9]. The miR-1246
was down-regulated in PBMC in RA cases in the present study, but up-regulated in
serum of RA cases as reported previously [22]. These conflicting results imply cell-
and tissue- specific expression pattern of disease-related miRNAs.

This study demonstrated the significance and functional relevance of newly


discovered miR-99b-5p to RA. Located in the non-coding regions of Sperm
Acrosome Associated 6 (SPACA6) on chromosomes 19, miR-99b-5p is a member of
the miR-99b family that is highly conserved among 58 different species [23].
Previous studies have reported that the miR-99b-5p regulates the oncogenesis
process in various cancers and has the potential to serve as an important tumor
biomarker for cancer diagnosis, prognosis and therapy [20, 23-25]. Yet, this study is
the first to reveal that miR-99b-5p is involved in RA pathogenesis. Specifically, the
miR-99b-5p is significantly up-regulated in RA cases, which could significantly

t
ip
promote T cell growth, activation, and expression of multiple proinflammatory
cytokines (IL-2, IL-6, TNF-α and IFN-γ), and therefore play an important role in

cr
inflammatory response and RA development. Previous research about the effect of

us
miR-99b-5p on osteoclast development and differentiation [26] serves as additional
evidence supporting the role of miR-99b-5p in RA pathogenesis and progression,
which manifests bone and joint damage.
an
Supported by in vivo and in vitro evidences, we identified mTOR and RASSF4 as
M

potential target genes of miR-99b-5p. Specifically, both gene expression levels were
negatively correlated with miR-99b-5p level in Jurkat T cell culture as well as
ed

circulating PBMC and significantly down-regulated in PBMC in RA cases. The


mTOR is a serine/threonine kinase that regulates cell growth, proliferation and
pt

survival via two distinctive multi-protein complexes, mTOR complex-1 (mTORC1)


and mTOR complex-2 (mTORC2) [27]. The frequent hyperactivity and promotion
ce

on aberrant cell survival, via the specific PI3K/AKT/mTOR signaling pathway, in


various cancers makes mTOR a desirable target for anticancer drug discovery
Ac

[27-29]. However, the role of mTOR in RA pathogenesis was unclear. Due to the
complexity of immune and structural cells, including T cells, B cells, macrophages
and fibroblasts [30-33], mTOR inhibition was not necessarily applicable for RA
treatment. The newly disclosed mechanism, i.e., mTOR is regulated by miR-99b-5p,
provides supportive evidences for research and development on RA treatment.
RASSF4 belongs to the RAS-associated domain family, which has the degraded
expression and acts as tumor suppressor in different tumor types [34-36]. With the
CpG islands spanning across the promoter and exon of RASSF4, the gene was
frequently inactivated by promoter methylation and contributed to inhibition of cell
growth, interference of tumorigenesis-related signal transduction, and consequently
suppression of tumor development [36]. The present study examined RASSF4
expression in RA and demonstrated that miR-99b-5p inhibited the expression of
RASSF4 by directly targeting its 3’UTR. The mRNA level of RASSF4 was found
significantly decreased by miR-99b-5p over-expression in T cells in vitro and

t
ip
reduced in PBMC of RA populations. Taken together, the above evidences suggested
that RASSF4 mRNA expression level could be regulated by DNA methylation and

cr
miRNA expression and play important roles in pathogenesis of various diseases.

us
Target genes that shared with the different DEMIRs in the miRNA regulatory
an
network also attracted our attention. Among the whole correlation pairs, the target
gene ARID1A was detected to have the strongest negative correlation with
miR-101-3p and remained to be the only one common gene in the higher correlation
M

pairs. The gene is implicated in transcriptional activation and repression of select


genes by acting as a subunit within the SWI/SNF chromatin remodeling complex
ed

[37]. Knockdown of the gene resulted in the reduction of the anti-inflammatory


cytokine IL-4 [38]. The ARID1A mutations have been found to cooperate with
pt

PI3K/AKT/mTOR pathway mutation on pro-tumorigenic cytokine signaling [39]


through which contributing to several cancer etiology [40-42]. The common gene
ce

SH2B3 encoded for the lymphocyte adaptor protein LNK and participated in T cell
growth, cytokine signaling, and immune responses [43, 44]. The gene has been
Ac

found to have the SNP site (rs10774624) associated with RA [17]. Enrichment
analysis performed in the present study also found SH2B3 was involved in the
neurotrophin signaling pathway, which exerted vital roles in the etiology of immune
disorders [45-48].

In summary, this study identified 18 newly discovered miRNAs and their regulated
gene expression networks significantly regulated in PBMC during RA pathogenesis.
Furthermore, the present study highlighted that miR-99b-5p, via targeting and
inhibiting mTOR and RASSF4 mRNA expression, inhibited T cell apoptosis,
stimulated T cell proliferation, and promoted T cell activation and proinflammatory
cytokine expression thus playing a significant role in inflammation and RA
pathogenesis. The findings improved our understanding of RA pathogenesis and
provided novel insights into the molecular mechanisms underlying RA pathogenesis.

t
ip
4. Materials and methods
4.1 Study population and sample preparation

cr
A discovery sample of 43 subjects (25 RA cases and 18 controls) was recruited for

us
miRNA and mRNA microarray profiling in PBMCs. Another sample of 35 RA cases
and 35 controls was recruited for validation purpose (Table S6). All the RA patients
an
met the 2010 criteria of the American College of Rheumatology and the European
Union League Against Rheumatism. All patients had an examination of tender and
swollen joints and disease activity score of 28 joints (DAS28) recorded. Laboratory
M

investigations included C-reactive protein (CRP) and erythrocyte sedimentation rate


(ESR). Active RA was defined as having a 28-joint disease activity score (DAS28)
ed

of 2.6 or higher. For health controls, subjects with severe cardiovascular diseases,
liver and kidney dysfunction, malignant tumor and other immune diseases including
pt

systemic lupus erythematosus, ankylosing spondylitis were excluded. No significant


differences in age and BMI were detected between the cases and controls in either
ce

discovery or validation sample (Table S6). The study was approved by the ethical
committee of Soochow University. All the study subjects signed informed consents
Ac

before enrollment.

4.2 Transcriptome-wide miRNA and mRNA expression profiling


The transcriptome-wide miRNA and mRNA expression profiles were determined
using Affymetrix miRNA 4.0 and lncRNA&mRNA Human Gene Expression
Microarray V4.0 (CapitalBio, Beijing, China), respectively. Peripheral blood
samples were collected from each subject and total RNA was then extracted from
PBMCs which separated by density gradient centrifugation from blood samples.
About 1.0 ug of total RNA per sample was converted in microarray to profile
miRNA and mRNA expression. Fold-change and/or P-value of two-sided Student’s
t-test were calculated to demonstrate the expression difference of miRNAs and
mRNAs.

t
4.3 Network construction based on the expression levels of miRNA and mRNA

ip
This study used 3 online prediction tools (TargetScan, miRDB, and miRanda) to
predict target genes for the identified miRNAs. Pearson’s correlation analysis was

cr
conducted, and the significant and negatively correlated pairs of miRNA-mRNA

us
were retained. The target genes were annotated through PUBMED literature
searching or through DAVID (https://david.ncifcrf.gov/). Based on the correlation,
an
the regulatory network of miRNA-mRNA was constructed and visualized using
Cytoscape3.2.1 software.
M

4.4 Validation for the expressions of the identified miRNA and corresponding
targets
ed

The expression of the miRNAs and mRNA was validated using real-time reverse
transcription quantitative polymerase chain reaction (RT-qPCR). Total RNA was
pt

extracted from PBMCs or CD3+ T lymphocytes using TRIzol reagent. Each sample
was analyzed in triplicate. All the specific primers were designed and purchased
ce

from CT Bioscience (CT Bioscience, Changzhou, China). The gene expression


levels were relatively quantified by using the comparative cycle threshold (Ct)
Ac

method. The miRNA and mRNA expression levels were normalized against
RNU48/U6 and beta-2-microglobulin (B2M), respectively.

4.5 Functional effects of miR-99b-5p on RA-relevant immune cells


To study the role of miR-99b-5p in RA, we constructed the miR-99b-5p
overexpression and low-expression Jurkat cell lines. Jurkat cell is an immortalized
human lymphocyte cell line, which has been commonly used as a cell model in the
research field of autoimmune diseases [49, 50]. The full-length and 1000bp up- and
downstream sequences of miR-99b-5p was synthesized and cloned in to the
pCDH-CMV-MCS-EF1-copGFP lentiviral expression vector. The miR-99b-5p
inhibitor was synthesized by GenePharma (Shanghai, China). The resulting construct
of miR-99b-5p overexpression plasma was verified by sequencing. The miRNA
expression of miR-99b-5p was detected by RT-PCR according to standard protocols
as previously described.

t
ip
For the cell proliferation assay, the cell counting kit-8 (CCK-8) was used to detect

cr
cell proliferation. The cell apoptosis was assessed using PE Annexin V Apoptosis

us
Detection Kit. The cell cycle was assessed using propidium iodide (PI) staining. For
the cell activation assay, we determined the positive rate of T cell activation
an
biomarkers (CD69 and CD25) by flow cytometry and expression of cytokines (IL-2,
IL-6, TNF-α, IFN-γ, IL-1β, IL-8, proinflammatory cytokines; IL-4
anti-inflammatory cytokine) by RT-qPCR in Jurkat cells. The luciferase reporter
M

plasmids (wild-type or mutant-type RASSF4 3’UTR) were constructed using the


pmirGLO vector. 2.0µg of pmirGLO vector with wild-type or mutant-type RASSF4
ed

3’UTR was co-transfected with miR-99b-5p overexpression lentivirus into Jurkat T


cells using DharmaFECT Duo Transfection Reagent (Active Motif, USA). The
pt

relative luciferase activity was assessed using Dual-Luciferase Reporter Assay


system. The primer information was shown in Table S7.
ce

4.6 Statistical analyses


Ac

Two-sided Student’s t-test was used to compare the differential expression between
RA cases and controls, as well as between miRNA over-expression cell lines and
controls. Receiver-operating characteristic (ROC) analysis was conducted to
determine the cutoff points that yielded the highest sensitivity, specificity, and
accuracy in molecular diagnosis of RA. Pearson’s correlation analysis was
performed to test the association between miRNA expression levels and the clinical
variables, including C-reactive protein, erythrocyte sedimentation rate, 28-joint
Disease Activity Score, swollen joint count, and tender joint count. P< 0.05 was
considered as statistically significant.

4.7 Data statement


The microarray data for miRNA expression has been submitted to the GEO database
with accession number (GSE124373).

t
ip
See Supplementary Methods for full details.

cr
Authors’ contributions

us
XZ, LW and SL designed the study. XZ, LW, WX, YG, MW, KZ, JW, YQ, XLin and
XLu collected the data. XZ, LW, XM and WX were involved in data cleaning and
an
data analysis. XZ drafted the manuscript. LW, FD and SL contributed to data
interpretation, critical revision of the manuscript for important intellectual content,
and approved the final version of the manuscript. All authors have read and approved
M

the final manuscript.


ed

Disclosure statement
The authors have declared no competing interests.
pt
ce

Acknowledgements
This study was supported by grants from the National Natural Science Foundation of
Ac

China (81473046, 81872681, 31401079, 81373010, 81502868, 81401343,


81541068), the Natural Science Foundation of Jiangsu Province (BK20150346), a
Project of the Priority Academic Program Development of Jiangsu Higher Education
Institutions and a Project of Entrepreneurship and Innovation of Jiangsu Province.
We thank the help from Mr. Amanda Hall Pendegraft (The University of Alabama at
Birmingham, USA) for fixing the typos and grammar errors.
References
[1] O'shea JJ, Laurence A, Mcinnes IB. Back to the future: oral targeted therapy for
RA and other autoimmune diseases. Nat Rev Rheumatol. 2013; 9: 173-182.
[2] Arend WP, Firestein GS. Pre-rheumatoid arthritis: predisposition and transition
to clinical synovitis. Nat Rev Rheumatol. 2012; 8: 573-586.
[3] Viatte S, Plant D, Raychaudhuri S. Genetics and epigenetics of rheumatoid
arthritis. Nat Rev Rheumatol. 2013; 9: 141-153.

t
ip
[4] Chen JQ, Papp G, Szodoray P, et al. The role of microRNAs in the pathogenesis
of autoimmune diseases. Autoimmun Rev. 2016; 15: 1171-1180.

cr
[5] Chen XM, Huang QC, Yang SL, et al. Role of Micro RNAs in the Pathogenesis

us
of Rheumatoid Arthritis: Novel Perspectives Based on Review of the Literature.
Medicine (Baltimore). 2015; 94: e1326.
an
[6] Churov AV, Oleinik EK, Knip M. MicroRNAs in rheumatoid arthritis: altered
expression and diagnostic potential. Autoimmun Rev. 2015; 14: 1029-1037.
[7] Miao CG, Yang YY, He X, et al. New advances of microRNAs in the
M

pathogenesis of rheumatoid arthritis, with a focus on the crosstalk between DNA


methylation and the microRNA machinery. Cell Signal. 2013; 25: 1118-1125.
ed

[8] Long L, Yu P, Liu Y, et al. Upregulated microRNA-155 expression in peripheral


blood mononuclear cells and fibroblast-like synoviocytes in rheumatoid arthritis.
pt

Clin Dev Immunol. 2013; 2013: 296139.


[9] Anaparti V, Smolik I, Meng X, et al. Whole blood microRNA expression pattern
ce

differentiates patients with rheumatoid arthritis, their seropositive first-degree


relatives, and healthy unrelated control subjects. Arthritis Res Ther. 2017; 19: 249.
Ac

[10] Wang W, Zhang Y, Zhu B, et al. Plasma microRNA expression profiles in


Chinese patients with rheumatoid arthritis. Oncotarget. 2015; 6: 42557-42568.
[11] Sharma AR, Sharma G, Lee SS, et al. miRNA-Regulated Key Components of
Cytokine Signaling Pathways and Inflammation in Rheumatoid Arthritis. Med Res
Rev. 2016; 36: 425-439.
[12] Guo Y, Tan LJ, Lei SF, et al. Genome-wide association study identifies
ALDH7A1 as a novel susceptibility gene for osteoporosis. PLoS Genet. 2010; 6:
e1000806.
[13] Stanczyk J, Pedrioli DM, Brentano F, et al. Altered expression of MicroRNA in
synovial fibroblasts and synovial tissue in rheumatoid arthritis. Arthritis Rheum.
2008; 58: 1001-1009.
[14] Stanczyk J, Ospelt C, Karouzakis E, et al. Altered expression of microRNA-203
in rheumatoid arthritis synovial fibroblasts and its role in fibroblast activation.
Arthritis Rheum. 2011; 63: 373-381.

t
ip
[15] Nakasa T, Shibuya H, Nagata Y, et al. The inhibitory effect of microRNA-146a
expression on bone destruction in collagen-induced arthritis. Arthritis Rheum. 2011;

cr
63: 1582-1590.

us
[16] Philippe L, Alsaleh G, Suffert G, et al. TLR2 expression is regulated by
microRNA miR-19 in rheumatoid fibroblast-like synoviocytes. J Immunol. 2012;
188: 454-461.
an
[17] Jansen H, Willenborg C, Lieb W, et al. Rheumatoid Arthritis and Coronary
Artery Disease: Genetic Analyses Do Not Support a Causal Relation. J Rheumatol.
M

2017; 44: 4-10.


[18] Jin EH, Shim SC, Kim HG, et al. Polymorphisms of COTL1 gene identified by
ed

proteomic approach and their association with autoimmune disorders. Exp Mol Med.
2009; 41: 354-361.
pt

[19] Lopez Herraez D, Martinez-Bueno M, Riba L, et al. Rheumatoid arthritis in


Latin Americans enriched for Amerindian ancestry is associated with loci in
ce

chromosomes 1, 12, and 13, and the HLA class II region. Arthritis Rheum. 2013; 65:
1457-1467.
Ac

[20] Li W, Chang J, Wang S, et al. miRNA-99b-5p suppresses liver metastasis of


colorectal cancer by down-regulating mTOR. Oncotarget. 2015; 6: 24448-24462.
[21] Khalifa O, Pers YM, Ferreira R, et al. X-Linked miRNAs Associated with
Gender Differences in Rheumatoid Arthritis. Int J Mol Sci. 2016; 17.
[22] Krissansen GW, Yang Y, Mcqueen FM, et al. Overexpression of miR-595 and
miR-1246 in the sera of patients with active forms of inflammatory bowel disease.
Inflamm Bowel Dis. 2015; 21: 520-530.
[23] Lukamowicz-Rajska M, Mittmann C, Prummer M, et al. MiR-99b-5p expression
and response to tyrosine kinase inhibitor treatment in clear cell renal cell carcinoma
patients. Oncotarget. 2016; 7: 78433-78447.
[24] Sun D, Lee YS, Malhotra A, et al. miR-99 family of MicroRNAs suppresses the
expression of prostate-specific antigen and prostate cancer cell proliferation. Cancer
Res. 2011; 71: 1313-1324.
[25] Slattery ML, Pellatt AJ, Lee FY, et al. Infrequently expressed miRNAs influence

t
ip
survival after diagnosis with colorectal cancer. Oncotarget. 2017; 8: 83845-83859.
[26] De La Rica L, Garcia-Gomez A, Comet NR, et al. NF-kappaB-direct activation

cr
of microRNAs with repressive effects on monocyte-specific genes is critical for

us
osteoclast differentiation. Genome Biol. 2015; 16: 2.
[27] Shor B, Gibbons JJ, Abraham RT, et al. Targeting mTOR globally in cancer:
an
thinking beyond rapamycin. Cell Cycle. 2009; 8: 3831-3837.
[28] Baselga J. Targeting the phosphoinositide-3 (PI3) kinase pathway in breast
cancer. Oncologist. 2011; 16 Suppl 1: 12-19.
M

[29] Sudarsanam S, Johnson DE. Functional consequences of mTOR inhibition. Curr


Opin Drug Discov Devel. 2010; 13: 31-40.
ed

[30] Malemud CJ. The PI3K/Akt/PTEN/mTOR pathway: a fruitful target for


inducing cell death in rheumatoid arthritis? Future Med Chem. 2015; 7: 1137-1147.
pt

[31] Yang Z, Fujii H, Mohan SV, et al. Phosphofructokinase deficiency impairs ATP
generation, autophagy, and redox balance in rheumatoid arthritis T cells. J Exp Med.
ce

2013; 210: 2119-2134.


[32] Laragione T, Gulko PS. mTOR regulates the invasive properties of synovial
Ac

fibroblasts in rheumatoid arthritis. Mol Med. 2010; 16: 352-358.


[33] Jones RG, Pearce EJ. MenTORing Immunity: mTOR Signaling in the
Development and Function of Tissue-Resident Immune Cells. Immunity. 2017; 46:
730-742.
[34] De Smedt E, Maes K, Verhulst S, et al. Loss of RASSF4 expression in multiple
myeloma promotes RAS-driven malignant progression. Cancer Res. 2017.
[35] Han Y, Dong Q, Hao J, et al. RASSF4 is downregulated in nonsmall cell lung
cancer and inhibits cancer cell proliferation and invasion. Tumour Biol. 2016; 37:
4865-4871.
[36] Guo W, Dong Z, Guo Y, et al. Decreased expression and frequent promoter
hypermethylation of RASSF2 and RASSF6 correlate with malignant progression and
poor prognosis of gastric cardia adenocarcinoma. Mol Carcinog. 2016; 55:
1655-1666.
[37] Chandler RL, Brennan J, Schisler JC, et al. ARID1a-DNA interactions are

t
ip
required for promoter occupancy by SWI/SNF. Mol Cell Biol. 2013; 33: 265-280.
[38] Wurster AL, Pazin MJ. BRG1-mediated chromatin remodeling regulates

cr
differentiation and gene expression of T helper cells. Mol Cell Biol. 2008; 28:

us
7274-7285.
[39] Chandler RL, Damrauer JS, Raab JR, et al. Coexistent ARID1A-PIK3CA
an
mutations promote ovarian clear-cell tumorigenesis through pro-tumorigenic
inflammatory cytokine signalling. Nat Commun. 2015; 6: 6118.
[40] Guichard C, Amaddeo G, Imbeaud S, et al. Integrated analysis of somatic
M

mutations and focal copy-number changes identifies key genes and pathways in
hepatocellular carcinoma. Nat Genet. 2012; 44: 694-698.
ed

[41] Jones S, Wang TL, Shih Ie M, et al. Frequent mutations of chromatin


remodeling gene ARID1A in ovarian clear cell carcinoma. Science. 2010; 330:
pt

228-231.
[42] Buglioni S, Melucci E, Sperati F, et al. The clinical significance of PD-L1 in
ce

advanced gastric cancer is dependent on ARID1A mutations and ATM expression.


Oncoimmunology. 2018; 7: e1457602.
Ac

[43] Saleh MA, Mcmaster WG, Wu J, et al. Lymphocyte adaptor protein LNK
deficiency exacerbates hypertension and end-organ inflammation. J Clin Invest.
2015; 125: 1189-1202.
[44] Devalliere J, Charreau B. The adaptor Lnk (SH2B3): an emerging regulator in
vascular cells and a link between immune and inflammatory signaling. Biochem
Pharmacol. 2011; 82: 1391-1402.
[45] Bandola J, Richter C, Ryser M, et al. Neurotrophin Receptor p75NTR Regulates
Immune Function of Plasmacytoid Dendritic Cells. Front Immunol. 2017; 8: 981.
[46] Virchow JC, Julius P, Lommatzsch M, et al. Neurotrophins are increased in
bronchoalveolar lavage fluid after segmental allergen provocation. Am J Respir Crit
Care Med. 1998; 158: 2002-2005.
[47] Copray S, Kust B, Emmer B, et al. Deficient p75 low-affinity neurotrophin
receptor expression exacerbates experimental allergic encephalomyelitis in C57/BL6
mice. J Neuroimmunol. 2004; 148: 41-53.

t
ip
[48] Anand P, Terenghi G, Warner G, et al. The role of endogenous nerve growth
factor in human diabetic neuropathy. Nat Med. 1996; 2: 703-707.

cr
[49] Lai NS, Yu HC, Tung CH, et al. The role of aberrant expression of T cell

us
miRNAs affected by TNF-alpha in the immunopathogenesis of rheumatoid arthritis.
Arthritis Res Ther. 2017; 19: 261.
an
[50] Houtman M, Shchetynsky K, Chemin K, et al. T cells are influenced by a long
non-coding RNA in the autoimmune associated PTPN2 locus. J Autoimmun. 2018.
M
ed
pt
ce
Ac
Figure Legends
Figure 1. Networks constructed by the DEMIRs and DEGs
A. Regulatory networks constructed by all negatively correlated miRNAs and target
mRNAs (listed in Table S1). B. Regulatory networks constructed by highly
correlated miRNA-mRNA pairs (r< -0.4).

t
Figure 2. Differential expressions of miRNAs in the validation sample

ip
The sample consisted of 35 RA cases and 35 healthy subjects. The expression level
of each miRNA had been normalized against RNU48. P values were calculated by

cr
the two-sided Student’s t-test. * P<0.05, ** P<0.01. The miRNAs with

us
non-significant differential expression or inconsistent direction with the discovery
sample were shown in Figure S6.
an
Figure 3. Functional effect of miR-99b-5p overexpression on behaviors of
M
Jurkat T cells
A. Relative expression of miR-99b-5p in OE cells and OE-NC cells using RT-qPCR.
The expression was normalized against U6. B. Cell proliferation using cell counting
ed

kit-8 assay. C. Cell apoptosis using Annexin V/PI double staining. D. Cell cycle
using PI staining. E. Cell activation assay with (+) or without (-) phytohemagglutinin
pt

(PHA) stimulation. F. Expression changes of inflammatory cytokines. The


expression level of each mRNA was normalized against glyceraldehyde-3-phosphate
ce

dehydrogenase (GAPDH). Two-sided Student’s t-test was used for the comparisons
between groups. * P<0.05, ** P<0.01, *** P<0.001. OE: over-expression cells,
Ac

OE-NC: negative control cells.

Figure 4. Functional effect on behaviors of Jurkat T cells by using miR-99b-5p


inhibitor
A. Relative expression of miR-99b-5p in miR-99b-5p inhibitor cells and
inhibitor-NC cells using RT-qPCR. The expression was normalized against U6. B.
Cell proliferation using cell counting kit-8 assay. Two-sided Student’s t-test was
used for the comparisons between groups. ** P<0.01, *** P<0.001.

Figure 5. Effect of miR-99b-5p on target gene expression


A. Relative mRNA levels of 7 target genes in miR-99b-5p OE cells and OE-NC cells
using RT-qPCR. The expression was normalized against
glyceraldehyde-3-phosphate dehydrogenase (GAPDH). B. Relative mRNA levels of
2 target genes in human PBMC in 35 RA cases and 35 controls using RT-qPCR. The

t
ip
expression was normalized against beta-2-microglobulin (B2M). C. Dual luciferase
assay of Jurkat T cells co-transfected with the luciferase reporter plasmid containing

cr
the wild-type or mutant-type RASSF4-3’UTR and miR-99b-5p overexpression

us
lentivirus or negative vector. Two-sided Student’s t-test was used for the
comparisons between groups. * P<0.05, ** P<0.01, *** P<0.001. OE:
an
over-expression cells, OE-NC: negative control cells.
M
Table 1. Differentially expressed miRNAs between RA cases and controls
ed
pt
ce
Ac
Supplementary material
For more details of the Materials and Methods, please see the Supplemental
Methods.

Supplemetary figures
Figure S1 Overview of the study strategy
DEMIRs, differential expressed miRNAs; DEGs, differential expressed genes; ROC,

t
ip
receiver-operating characteristic; CRP, C-reaction protein; ESR, erythrocyte
sedimentation rate; DAS28, 28-joint disease activity score; TJC, Tender joint count;

cr
SJC, Swollen joint count.

us
Figure S2 Volcano-Plot of the identified DEMIRs in RA cases vs. healthy
controls
an
The fold change and P value were calculated by the division of expression and
two-sided Student’s t-test between RA patients and controls.
M

Figure S3 Hierarchical clustering analysis of the 18 identified DEMIRs


ed

Each column represented the expression profile of a sample and each row
represented a miRNA. The color intensity determined the expression level. The
pt

higher intensity of red and green corresponded to the higher up-regulated and
down-regulated expression.
ce

Figure S4 Expression validations by RT-qPCR of miR-99b-5p in T lymphocytes


Ac

in vivo
The sample consisted of 7 RA cases and 7 healthy subjects. The expression level of
miR-99b-5p had been normalized against U6. P values were calculated by the
two-sided Student’s t-test. * P<0.05

Figure S5 Functional roles of miR-99b-5p in Jurkat T cells analyzed by flow


cytometry
A. Cell apoptosis assay using Annexin V/PI double staining. The listed number
represented the percentage of apoptosis cells. B. Cell cycle assay using PI staining.
C. Cell activation with (+) or without (-) phytohemagglutinin (PHA) stimulation. C1
showed the detection of CD69 positive cells and C2 showed the detection of CD25
positive cells. %Gated referred to the percentage of positive cells. OE, miR-99b-5p
overexpression cells; OE-NC, negative control cells.

t
ip
Figure S6 Expression validations by RT-qPCR of the identified miRNAs with
non-significant differential expression or inconsistent direction with the

cr
discovery sample

us
The subjects consisted of 35 RA patients and 35 health controls. Relative amount of
each miRNA was expressed after normalizing to RNU48. Statistical significance was
an
calculated by two-sided Student’s t-test.* P<0.05, ** P<0.01.
M
Supplemetary tables
Table S1. Significant and negative correlated pairs between 9 DEMIRs and 141
target mRNAs (genes)
ed

Table S2. Analysis for the genes negatively correlated with DEMIRs using
pt

DAVID (A) and literatures searching (B)


ce

Table S3. Clinical evaluation for the 18 identified DEMIRs


Ac

Table S4. Analysis for miR-99b-5p target genes by expression detection in vivo
and vitro (A) and enrichment analysis using DAVID (B)

Table S5. Correlations between inflammatory cytokines and targets of


miR-99b-5p

Table S6. Basic characteristics of the female study subjects


Table S7. Primer information

t
ip
cr
us
an
M
ed
pt
ce
Ac
Table 1 Differentially expressed miRNAs between RA cases and controls
Fold change with
miRNA Location P value
RA

hsa-miR-99b-5p chr19:52195871-52195892 (+) 2.07 3.17E-02

hsa-miR-101-3p chr1:65524125-65524145 (-) -2.09 1.71E-04

hsa-miR-1184 chrX:154115651-154115673 (-) -3.66 4.92E-04

t
hsa-miR-1246 chr2:177465752-177465770 (-) -5.66 7.04E-06

ip
hsa-miR-142-3p chr17:56408606-56408628 (-) -2.16 1.20E-02

hsa-miR-142-5p chr17:56408644-56408664 (-) -3.75 1.36E-04

cr
hsa-miR-195-5p chr17:6920986-6921006 (-) -2.33 1.64E-02

us
hsa-miR-26b-5p chr2:219267380-219267400 (+) -2.28 1.61E-02

hsa-miR-29b-3p chr7:130562226-130562248 (-) -2.67 6.27E-03

hsa-miR-29c-3p
an
chr1:207975210-207975231 (-) -3.24 2.58E-03

hsa-miR-3201 chr22:48670176-48670192 (+) -2.44 6.74E-03


M
hsa-miR-3607-5p chr5:85916325-85916346 (+) -2.5 1.18E-03

hsa-miR-3613-3p chr13:50570562-50570585 (-) -2.49 1.23E-02

hsa-miR-3651 chr9:95054743-95054766 (-) -2.18 5.01E-03


ed

hsa-miR-4448 chr3:183604648-183604667 (+) -2.1 1.91E-05

hsa-miR-4668-5p chr9:114694380-114694402 (+) -2.36 6.85E-03


pt

hsa-miR-7641 chr11:104123325-104123343 (+) -2.19 2.58E-02


ce

hsa-miR-8084 chr8:94041989-94042011 (+) -2.04 2.13E-02

Notes: The location of the miRNA in Affymetrix miRNA 4.0 microarray was referred to the
Ac

Human Genome Build37 version available at NCBI. The P value was generated by two-sided

Student’s t-test of expression levels between active RA cases and controls. Fold change “+”: up

regulation; “-”: down regulation.


Ac
ce

Fig 1
pt
ed
M
an
us
cr
ip
t
Fig 2
Ac
ce
pt
ed
M
an
us
cr
ip
t
Fig 3
Ac
ce
pt
ed
M
an
us
cr
ip
t
Fig 4
Ac
ce
pt
ed
M
an
us
cr
ip
t
Fig 5
Ac
ce
pt
ed
M
an
us
cr
ip
t
Supplementary Methods

Identification of PBMC-Expressed miRNAs for Rheumatoid

Arthritis

Xiaowei Zhu1,2,3#, Longfei Wu1,2#, Xingbo Mo1,2, Wei Xia1,2, Yufan Guo4, Mingjun

t
ip
Wang4, Keqin Zeng4, Jian Wu4, Yinghua Qiu1,2, Xiang Lin1,2, Xin Lu1,2, Feiyan
Deng1,2*, Shufeng Lei1,2*

cr
us
1. Center for Genetic Epidemiology and Genomics, School of Public Health,
Medical College of Soochow University, Suzhou, Jiangsu 215123, P. R. China
an
2. Jiangsu Key Laboratory of Preventive and Translational Medicine for Geriatric
Diseases, Soochow University, Suzhou, Jiangsu 215123, P. R. China
3. Zhangjiagang Center for Disease Prevention and Control, Suzhou, Jiangsu
M

215618, P. R. China
4. Department of Rheumatology, the First Affiliated Hospital of Soochow University,
ed

Suzhou, Jiangsu, P. R. China


pt

*Corresponding authors:
Email: leisf@suda.edu.cn (Lei S), fdeng@suda.edu.cn (Deng F)
ce

#
These authors contribute equally to this work.
Ac

Running Title: Zhu X and Wu L / Identification of PBMC-Expressed miRNAs


Supplementary Methods
Study subjects and sample preparation
For the transcriptome-wide miRNA expression microarray analysis, a total of 25
subjects with active RA and 18 healthy controls were recruited. For the miRNA and
mRNA expression validation, another sample of 35 subjects with active RA and 35
healthy controls were recruited. The subjects were recruited in the department of
rheumatology of the First Affiliated Hospital of Soochow University, during

t
ip
December 2014 to July 2015. All the patients with RA met the standard of American
College of Rheumatology and the European Union League Against Rheumatism set

cr
in 2010. All patients had an examination of tender and swollen joints and disease

us
activity score of 28 joints (DAS28) recorded. Laboratory investigations included
C-reactive protein (CRP) and erythrocyte sedimentation rate (ESR). Active RA was
an
defined as having a 28-joint disease activity score (DAS28) of 2.6 or higher. For
health controls, subjects with severe cardiovascular diseases, liver and kidney
dysfunction, malignant tumor and other immune diseases including systemic lupus
M

erythematosus, ankylosing spondylitis were excluded. No significant differences in


age and BMI were detected between the cases and controls (Table S6). The study
ed

was approved by the ethical committee of Soochow University. All subjects signed
informed consents.
pt

Peripheral blood samples were collected from each subject and stored in vacuum
ce

blood collection tubes containing sodium citrate. Peripheral blood mononuclear cells
(PBMCs) were separated by density gradient centrifugation from blood samples
Ac

(Greiner Bio-one, Frickenhausen, Germany). Total RNA was then extracted from
PBMCs using TRIzol reagent (Invitrogen, USA) according to manufacturer’s
instructions. The total RNA was purified using mirVana™ miRNA Isolation Kit
(Ambion, Woodward, Austin, TX, USA) or NucleoSpin® RNA clean-up kit
(MACHEREY- NAGEL, Germany), quantified using NanoDrop ND-2000
spectrophotometer (Thermo Fisher Scientific, USA) and controlled using Agilent
Bioanalyzer 2100 (Agilent Technologies, USA). All samples showed good quality of
RNA (260/280 nm absorbance ratios >1.8 and RNA Integrity Number (RIN)>7).

Transcriptome-wide miRNA and mRNA expression profiling


The transcriptome-wide miRNA expression profiling was analyzed using Affymetrix
miRNA 4.0 (CapitalBio, Beijing, China). The microarray contains mature miRNAs
across 203 species in Sanger miRBasev20.0, including 2,578 human mature

t
ip
miRNAs. About 1.0 ug of total RNA per sample was converted in microarray to
profile miRNA expression. Briefly, the total RNA was poly-A tailed using the poly A

cr
polymerase and connected with the biotin-labeled 3DNA dendrimer for the miRNA

us
labeling. The labeling process was completed using FlashTagTM Biotin RNA
Labeling Kit (Genisphere, Hatfield, PA, USA). The hybridization cocktail was then
an
added into biotin-labeled RNA using Eukaryotic Hybridization Control Kit
(Affymetrix, Santa Clara, CA, USA). After incubating for 5 minutes at 99°C, 5
minutes at 45°C and centrifugation for 5minutes at 13200rpm to remove insoluble
M

impurities, the mixture was hybridized on miRNA arrays at 48°C for 16 hours. The
microarrays were then washed and stained using Affymetrix Fluidics Station 450,
ed

and scanned using Affymetrix GeneChip Scanner 3000. The scanning image was
converted into digital signal using Affymetrix GeneChip Command Console
pt

(AGCC).The data normalization and quality control was processed by Robust


Multi-array Average (RMA) plug in of Affymetrix Expression Console. Fold-change
ce

and P value were calculated to index the expression difference of miRNAs between
RA patients and healthy controls.
Ac

The transcriptome-wide mRNA expression profiling was analyzed using lncRNA


& mRNA Human Gene Expression Microarray V4.0 (CaptialBio, Beijing, China)
according to the manufacturer’s instructions. Total RNA was reverse-transcribed into
double stranded cDNA with T7 Oligo (dT) Primer and T7 random hexamers
followed by the cRNA generation. The cRNA was then purified and reverse
transcribed into cDNA using CbcScript reverse transcriptase. The purified cDNA
was labeled by Cy5-dCTP and hybridized to the assay at 45°C overnight. After
washing, the microarray was scanned using Agilent G2565CA Microarray Scanner
and analyzed using Agilent Feature Extraction v10.7. The data was finally
normalized and controlled using Agilent GeneSpring GX program v12.0. Probes
with incomplete annotation information and detection rate less than 80% were
excluded. Only the most significant probe of mRNA associated with RA was
retained when there were multiple probes for the same mRNA. Two-sided Student’s

t
ip
t-test was used to identify differentially expressed genes between RA patients and
healthy controls.

cr
us
Expression validation of differentially expressed miRNAs and corresponding
targets in population
an
The differential expression of significant miRNAs and mRNAs were validated in
another sample including 35 RA patients and 35 healthy controls using real-time
reverse transcription quantitative polymerase chain reaction (RT-qPCR). Total RNA
M

was extracted from PBMC using TRIzol reagent.


ed

For the miRNAs, 9 out of 18 miRNAs were selected for validation. The selection
was mainly based on the following criteria: (1) the miRNA has not been validated in
pt

RA patients by RT-qPCR in the previous studies; (2) the miRNA had the relatively
higher fold change value in the present study; (3) the miRNA had relatively higher
ce

expression values in microarray analysis. 100 ng of total RNA was


reverse-transcribed into cDNA using a miRNA Reverse Transcription Kit (CT
Ac

Bioscience, Changzhou, China) with stem-loop RT primer according to the


manufacture’s protocol. Briefly, the reactions were incubated for 30min at 16 ,
30min at 42 , 5min at 85 and then stored at 4 . RT-qPCR was performed by
Roche light cycler 480II with SYBR Green MasterMix (CT Bioscience, Changzhou,
China). The reactions were incubated at 95 for 2min, followed by 45 cycles of 95
for 10s, 60 for 20s and 40 for 30s.
For mRNAs, we used mRNA Reverse Transcription Kit (CT Bioscience,
Changzhou, China) to reverse-transcribe total RNA into cDNA. The reactions were
incubated for 60min at 42 , 5min at 85 and stored at 4 thereafter. In the qPCR
analyses, the reactions were incubated at 95 for 10min, followed by 45 cycles of
95 for 10s, 60 for 20s and 40 for 30s.

The differential expression of miR-99b-5p in primary T cells was validated in

t
ip
additional samples including 7 RA patients and 7 healthy controls by using RT-qPCR.
10 ml peripheral blood was obtained and PBMCs were purified by density gradient

cr
centrifugation over Ficoll-Paque (Lymphoprep, density: 1.077g/ml, STEMCELL

us
Technologies, Vancouver, Canada). T cells were then isolated using the EasySep
Human Whole Blood CD3 Positive Selection Kit (STEMCELL Technologies,
an
Vancouver, Canada). An aliquot of CD3+ T lymphocytes were harvested for RNA
extraction. The expression level of miR-99b-5p was detected using qRT-PCR as
shown above.
M

Each sample was analyzed in triplicate. All the specific primers were designed
ed

and purchased from CT Bioscience (CT Bioscience, Changzhou, China). The gene
expression levels were relatively quantified by using the comparative cycle threshold
pt

(Ct) method. The miRNA and mRNA expression levels were normalized against
RNU48/U6 and beta-2-microglobulin (B2M), respectively.
ce

Functional assays of miR-99b-5p in Jurkat T cells


Ac

Cell culture
Jurkat T cells and 293 T cells were purchased from the Cell Bank of the Chinese
Academy of Sciences (Shanghai, China) and were cultured in a humidified incubator
at 37 and 5% CO2. Jurkat T cells were maintained in RPMI 1640 cell culture
medium (Hyclone, Thermo scientific, USA) supplemented with 20% fetal bovine
serum (FBS; Biological Industries, Israel) and 1% penicillin-streptomycin (TransGen,
Beijing, China). 293T cells were cultured in DMEM (Hyclone, Thermo scientific,
USA) supplemented with 10% FBS and 1% penicillin-streptomycin.

Lentiviral construction, production and transfection


Lentivirus vectors were constructed using the pCDH-CMV-MCS-EF1-copGFP
system (System Biosciences, USA;
https://www.systembio.com/products/gene-expression-systems/lentiviral-vectors/pcd

t
ip
h-cmv-mcs-ef1-alpha-copgfp/). Briefly, we first exacted DNA from PBMCs of
human blood samples and performed PCR amplification for the miRNA fragment

cr
with the primer designed by Primer5 (Table S7).The primer was based on the whole

us
and 1000bp up- and downstream sequences of miR-99b-5p obtained from Ensembl
(http://www.ensembl.org). The fragment was then cloned into the
an
pCDH-CMV-MCS-EF1-copGFP miRNA expression vector. With the process of
enzyme digestion, purification and enzyme connection, the target plasmid
(pCDH-99b-GFP) was generated. Gel electrophoresis and DNA sequencing were
M

used to validate the plasmid. The empty vector of pCDH was used as a negative
control in this study.
ed

The sequencing-verified recombinant plasmid and the lentivirus Packaging


pt

plasmid ps-PAX2, envelope plasmid pMD2.G and pCDH- CMV-MCS-EF1-copGFP


plasmids (SBI, Mountain View, CA) were then co-transfected into 293T cells with
ce

Lipofectamine 3000 (Invitrogen, USA) to generate the lentivirus. The viral titer of
lentivirus concentrated from the culture supernatants was detected according to the
Ac

manufacture’s protocols (Applied Biological Materials Inc, Canada).

The recombinant lentivirus was then harvested and transfected into Jurkat T cells
to construct the miR-99b-5p over-expression cell lines. The lentivirus transfection
efficiency was measured by flow cytometry (Beckman Instruments Inc., USA) and
the miRNA expression was assessed using RT-qPCR (primer information shown in
Table S7), which were performed to guarantee the quality of target cell line. Briefly,
2ug of total RNA was reverse-transcribed with TransScript miRNA First-Strand
cDNA Synthesis kit (TranGen Biotech, Beijing, China). The real-time qPCR were
then performed using Promega GoTaq qPCR Master Mix (Promega Corp, USA) by
Applied Biosystems Quanstudio6 Flex (Thermo Fisher Scientific, USA). The
reactions were incubated at 94 for 30s, followed by 45 cycles of 94 for 5s, 55
for 15s and 72 for 10s.

t
ip
The miR-99b-5p inhibitor was synthesized by GenePharma (Shanghai, China).
160nM of the inhibitor or the negative control was added into the Jurkat T cells to

cr
inhibit the expression of the miR-99b-5p in Jurkat cell lines. The miRNA expression

us
of miR-99b-5p was validated by RT-qPCR using the same protocol shown above.
The primer information of the miR-99b-5p inhibitor was shown in Table S7.
an
Cell proliferation assay
The miR-99b-5p stably transfected cells or negative control cells were seeded into
M

96-well plates at a density of 5×104 cells per well. After 12, 24 and 48 hours of
culture, the cells were treated with 10uL cell counting kit-8 (CCK-8) solution and
ed

incubated for 1h. The optical density (OD) at the wavelength of 450nm was detected
by enzyme-linked immunometric meter (BioTek Instruments Inc., USA). Each group
pt

was made in quintuplicate.


ce

The Jurkat T cells with 200nM of the inhibitor and the negative control was
seeded into 96-well plates at a density of 2×104 cells per well and cultured for 48h.
Ac

The cell proliferation was conducted at 0/24/48/72h after the incubation according to
the standard protocol as previously described.

Cell apoptosis assay


The cell apoptosis was assessed using PE Annexin V Apoptosis Detection Kit (BD
Biosciences, Becton, Dickinson and Company, USA). The stably transfected cells
were harvested by centrifugation, washed twice by PBS and stained with Annexin V
and PI according to the manufacturer’s instructions. After incubation in the dark for
15min at room temperature, cells were resuspended with 1×Annexin V binding
buffer and examined by flow cytometry (Beckman Instruments Inc., USA).

Cell cycle assay


For the assay of cell cycle, the stably transfected cells were collected, washed, and
fixed with ice-cold 70% ethanol according to the protocol of Beyotime Biotech

t
ip
(Shanghai, China). After storage at 4 overnight, the cells were washed,
resuspended with PBS, and treated with propidium iodide(PI) staining solution mix

cr
(Beyotime) for 30min in the dark. Flow cytometry (Beckman Instruments Inc., USA)

us
was used for detection of the cells in different phases.

Cell activation assay


an
The stably transfected cells were treated with or without 5ug/ml phytohemagglutinin
(PHA; Beyotime Biotechnology, Shanghai, China) for 48h. Afterwards, the cells
M

were collected, washed and incubated with 3uL allophycocyanin (APC)-conjugated


human CD25 or human CD69 antibody (BioLegend, USA) for 30min in the dark.
ed

The positive rate of CD25 and CD69 in Jurkat T cells were assessed by flow
cytometry.
pt

RT-qPCR was performed to measure the mRNA expression levels of 7 cytokines


ce

in Jurkat cells overexpressing miR-99b-5p according to the standard protocol.


Briefly, total RNA was extracted from stably transfected Jurkat T cells and negative
Ac

controls. The RNA quality was controlled and quantified using electrophoresis and
NanoDrop ND-2000 spectrophotometer (Thermo Fisher Scientific, USA). A total of
2ug RNA was reverse-transcribed using GoScript Reverse Transcriptase Kit
(Promega, USA). The qPCR analysis was performed using GoTaq qPCR Master Mix
(Promega, USA) with Applied Biosystems Quanstudio6 Flex (ABI, Thermo Fisher
Scientific, USA). The expression of 7 miRNA target genes in Jurkat T cells was also
assessed according to the standard protocol. The primer information was shown in
Table S7.

Luciferase reporter assay


The luciferase reporter plasmid was constructed using the pmirGLO vector
(Promega, USA;
https://www.promega.com.cn/products/reporter-assays-and-transfection/reporter-vect

t
ip
ors-and-cell-lines/pmirglo-dual-luciferase-mirna-target-expression-vector/?catNum=
E1330). The fragment of wild-type and mutant-type RASSF4 3’UTR were amplified

cr
by PCR and cloned into the pmirGLO vector (primer information shown in Table

us
S7). The plasmids were validated by DNA sequencing. Jurkat T cells were seeded in
6-well plates the day before transfection. 2.0µg of pmirGLO vector with wild-type or
an
mutant-type RASSF4 3’UTR was co-transfected with miR-99b-5p overexpression
lentivirus into Jurkat T cells using DharmaFECT Duo Transfection Reagent (Active
Motif, USA). The relative luciferase activity was assessed using Dual-Luciferase
M

Reporter Assay system (Promega, USA) and normalized for transfection efficiency
by Renilla-luciferase.
ed
pt
ce
Ac
Fig.. S1 Overviiew of the study strateegy

t
ip
cr
us
an
M
ed
pt
ce
Ac
Fig.. S2 Volcan
no-Plot of th
he identifieed DEMIRss in RA casses vs. healtthy controlls

t
ip
cr
us
an
M
ed
pt
ce
Ac
Fig.. S3 Hierarrchical clustering anallysis of the 18 identified DEMIR
Rs

t
ip
cr
us
an
M
ed
pt
ce
Ac
Fig. S4 Expression validations by RT-qPCR of miR-99b-5p in T lymphocytes in
vivo

t
ip
cr
us
an
M
ed
pt
ce
Ac
Fig. S5 Functional roles of miR-99b-5p in Jurkat T cells analyzed by flow
cytometry

t
ip
cr
us
an
M
ed
pt
ce
Ac
Fig. S6 Expression validations by RT-qPCR of the identified miRNAs with
insignificant differential expression or inconsistent direction with the discovery
sample

t
ip
cr
us
an
M
ed
pt
ce
Ac
Table S1. Significant and negative correlated pairs between 9 DEMIRs and 141
target mRNAs (genes)
Fold Corresponding Correlation P value for
Gene P value
change miRNA coefficient correlation

SOCS5 1.82 1.62E-04 miR-101-3p -0.33 3.08E-02

ZFP36L2 1.98 8.82E-07 miR-101-3p -0.33 2.87E-02

t
CDYL 1.55 6.96E-05 miR-101-3p -0.57 6.83E-05

ip
RANBP9 1.42 2.13E-04 miR-101-3p -0.45 2.24E-03

NLK 1.26 4.27E-02 miR-101-3p -0.41 6.91E-03

cr
ATXN1L 1.39 8.50E-05 miR-101-3p -0.38 1.08E-02

us
STAG2 1.81 7.11E-06 miR-101-3p -0.41 6.64E-03

RAP2C 1.44 7.91E-05 miR-101-3p -0.42 4.89E-03

ZNF746 2.00 2.25E-06


an
miR-101-3p -0.41 7.00E-03

UBE2A 1.46 9.42E-05 miR-101-3p -0.30 4.85E-02


M
ARID1A 1.79 6.78E-08 miR-101-3p -0.66 1.41E-06

SMARCD1 1.79 1.34E-06 miR-101-3p -0.44 2.83E-03

SH2B3 1.61 1.58E-06 miR-101-3p -0.45 2.72E-03


ed

ICK 1.49 8.07E-04 miR-101-3p -0.32 3.90E-02

CBFA2T2 1.28 2.67E-04 miR-101-3p -0.33 2.85E-02


pt

ZBTB34 1.96 6.14E-06 miR-101-3p -0.33 3.26E-02


ce

ATXN1 1.75 4.62E-08 miR-101-3p -0.48 1.12E-03

SUB1 1.41 1.45E-05 miR-101-3p -0.49 7.75E-04

GLCCI1 1.34 5.23E-03 miR-101-3p -0.32 3.57E-02


Ac

UBE2D2 1.87 9.16E-06 miR-101-3p -0.34 2.69E-02

ZSWIM6 1.34 4.61E-04 miR-101-3p -0.36 1.64E-02

ERBB2IP 1.84 2.65E-06 miR-101-3p -0.40 8.35E-03

ANKRD11 1.36 3.94E-05 miR-101-3p -0.43 3.90E-03

ZNF207 1.62 1.09E-05 miR-101-3p -0.40 8.55E-03

GAB1 1.80 5.77E-04 miR-101-3p -0.32 3.58E-02


ARAP2 1.50 2.07E-04 miR-101-3p -0.46 2.08E-03

RAB1A 2.04 1.02E-05 miR-101-3p -0.32 3.43E-02

SYNCRIP 1.47 1.96E-03 miR-101-3p -0.31 4.01E-02

DDIT4 1.64 4.60E-04 miR-101-3p -0.53 2.67E-04

IMPA1 1.28 3.59E-04 miR-101-3p -0.33 3.17E-02

RAP1B 1.46 7.75E-04 miR-101-3p -0.42 5.22E-03

DOT1L 1.35 4.52E-07 miR-101-3p -0.53 2.62E-04

t
ip
EDEM3 1.65 2.52E-06 miR-101-3p -0.44 3.53E-03

ASAP1 1.59 1.16E-07 miR-101-3p -0.57 7.58E-05

cr
RAB4A 1.36 6.54E-04 miR-101-3p -0.34 2.45E-02

us
METAP1 1.36 1.93E-03 miR-101-3p -0.30 4.97E-02

KDM3B 2.79 3.20E-07 miR-101-3p -0.40 7.40E-03

MAML3 1.11 3.19E-02


an
miR-101-3p -0.35 2.31E-02

ZBED4 1.77 2.33E-05 miR-101-3p -0.36 1.61E-02

HNRNPF 1.56 1.50E-05 miR-101-3p -0.32 3.50E-02


M

BBX 1.58 5.00E-05 miR-101-3p -0.33 3.17E-02

FAM60A 1.74 4.01E-06 miR-101-3p -0.34 2.80E-02


ed

SACM1L 1.32 7.94E-04 miR-101-3p -0.36 1.93E-02

ZCCHC2 1.68 1.60E-05 miR-101-3p -0.36 1.93E-02


pt

NSD1 1.33 1.33E-02 miR-101-3p -0.34 2.76E-02

KDM6B 1.47 1.15E-03 miR-101-3p -0.34 2.45E-02


ce

RNF38 1.56 4.91E-08 miR-101-3p -0.54 2.17E-04

MLEC 1.28 4.25E-03 miR-101-3p -0.40 7.94E-03


Ac

GNB1 1.24 4.45E-03 miR-101-3p -0.46 2.00E-03

UBR7 1.38 1.56E-04 miR-101-3p -0.42 4.67E-03

PHTF2 1.81 2.97E-07 miR-101-3p -0.40 7.34E-03

TMF1 1.61 5.01E-06 miR-101-3p -0.40 8.06E-03

C1orf52 1.33 1.32E-04 miR-101-3p -0.44 3.37E-03

SMARCA4 1.39 6.77E-05 miR-101-3p -0.41 5.80E-03


GDE1 2.47 1.91E-06 miR-101-3p -0.44 3.44E-03

COTL1 1.61 1.22E-06 miR-101-3p -0.51 5.18E-04

USP38 1.22 1.05E-02 miR-101-3p -0.41 6.05E-03

C10orf12 1.53 8.99E-05 miR-101-3p -0.48 1.13E-03

RAB11FIP2 1.97 5.91E-08 miR-1184 -0.51 4.83E-04

NPPA 1.50 2.67E-05 miR-1184 -0.45 2.78E-03

ENDOD1 1.69 9.13E-04 miR-1184 -0.35 2.31E-02

t
ip
DNM3 1.55 4.30E-03 miR-1184 -0.33 2.94E-02

TPP1 1.92 3.24E-07 miR-1184 -0.47 1.58E-03

cr
PHF5A 1.54 2.33E-05 miR-1184 -0.38 1.23E-02

us
LRRC59 1.26 3.06E-02 miR-1184 -0.30 4.91E-02

VDAC2 1.52 9.24E-06 miR-1184 -0.35 2.30E-02

RILPL2 1.72 3.50E-07


an
miR-1184 -0.38 1.31E-02

ZNF223 1.22 2.20E-02 miR-1184 -0.31 4.19E-02

UBR7 1.38 1.56E-04 miR-1184 -0.33 3.00E-02


M

ZSWIM6 1.34 4.61E-04 miR-1184 -0.46 1.87E-03

BCL2L11 1.53 1.42E-05 miR-1184 -0.34 2.70E-02


ed

PRNP 2.29 2.12E-06 miR-1184 -0.36 1.78E-02

ARID1A 1.79 6.78E-08 miR-1184 -0.41 5.90E-03


pt

SLK 1.25 2.16E-04 miR-1184 -0.45 2.19E-03

TAL1 1.99 8.03E-04 miR-1184 -0.40 7.94E-03


ce

CD97 1.61 8.91E-05 miR-1184 -0.32 3.81E-02

DPH3 1.69 4.97E-05 miR-1184 -0.35 1.97E-02


Ac

SPRED2 1.51 2.99E-06 miR-1184 -0.49 8.17E-04

SLC30A7 2.26 1.97E-07 miR-1184 -0.32 3.78E-02

C10orf32 2.21 9.42E-08 miR-1184 -0.40 8.20E-03

CDKN2D 2.01 4.76E-06 miR-1184 -0.50 5.69E-04

VAPB 2.06 1.45E-06 miR-1184 -0.31 4.12E-02

NR1D2 1.82 2.46E-04 miR-1184 -0.37 1.42E-02


RNF11 1.37 8.52E-03 miR-1184 -0.43 4.38E-03

RAB27A 1.48 7.14E-04 miR-1184 -0.30 4.73E-02

GRIA4 1.13 4.63E-02 miR-1184 -0.38 1.29E-02

ZNF217 1.43 6.32E-03 miR-1184 -0.41 6.71E-03

CREBL2 1.88 5.05E-07 miR-1246 -0.35 2.34E-02

SEPHS1 1.51 2.39E-05 miR-1246 -0.34 2.44E-02

MIER1 1.55 2.58E-06 miR-1246 -0.33 2.85E-02

t
ip
FERMT2 1.52 3.54E-05 miR-1246 -0.59 3.45E-05

QTRTD1 1.65 3.19E-05 miR-1246 -0.31 4.60E-02

cr
IFIT5 1.86 6.26E-05 miR-1246 -0.38 1.31E-02

us
MBNL2 1.40 2.20E-03 miR-1246 -0.34 2.80E-02

NUP153 2.01 4.04E-07 miR-1246 -0.35 2.20E-02

FRMD3 1.95 5.39E-05


an
miR-1246 -0.34 2.50E-02

AKAP2 3.66 3.98E-07 miR-1246 -0.37 1.55E-02

CDC73 1.30 4.65E-03 miR-1246 -0.32 3.42E-02


M

SEC22C 1.25 1.70E-02 miR-1246 -0.31 4.35E-02

SDHC 1.60 5.71E-08 miR-1246 -0.37 1.53E-02


ed

ISCA1 1.56 7.30E-05 miR-1246 -0.37 1.59E-02

TAP2 1.25 2.43E-02 miR-1246 -0.39 9.45E-03


pt

SH2B3 1.61 1.58E-06 miR-1246 -0.36 1.69E-02

BACH1 1.42 7.94E-04 miR-142-3p -0.39 1.05E-02


ce

TFG 1.36 4.96E-08 miR-142-3p -0.46 1.77E-03

FNDC3A 1.27 2.02E-03 miR-142-3p -0.41 6.41E-03


Ac

AHR 2.05 8.72E-05 miR-142-5p -0.31 4.56E-02

RAP1A 1.60 5.96E-07 miR-142-5p -0.40 7.89E-03

ACTN4 1.52 3.19E-06 miR-142-5p -0.31 3.99E-02

PTP4A1 1.68 2.61E-04 miR-142-5p -0.50 7.19E-04

KLF10 1.93 8.07E-04 miR-142-5p -0.32 3.38E-02

FAM199X 1.26 1.90E-02 miR-142-5p -0.38 1.18E-02


HIPK1 2.05 1.27E-06 miR-142-5p -0.33 3.34E-02

RHOQ 1.48 4.07E-06 miR-142-5p -0.38 1.14E-02

ICK 1.49 8.07E-04 miR-142-5p -0.36 1.86E-02

NFE2L2 2.34 7.34E-09 miR-142-5p -0.44 2.97E-03

TMF1 1.61 5.01E-06 miR-142-5p -0.37 1.48E-02

CUL4A 1.22 1.87E-04 miR-142-5p -0.39 8.83E-03

CUL2 1.32 6.17E-04 miR-142-5p -0.45 2.63E-03

t
ip
SYNJ1 1.23 2.72E-03 miR-142-5p -0.41 6.56E-03

BTBD1 1.41 1.67E-03 miR-142-5p -0.32 3.94E-02

cr
SGMS1 1.32 8.57E-03 miR-142-5p -0.48 1.05E-03

us
BNIP2 2.54 1.48E-07 miR-142-5p -0.31 4.44E-02

ARHGEF6 1.33 4.87E-03 miR-142-5p -0.33 3.08E-02

RPS6KA5 1.46 9.56E-03


an
miR-142-5p -0.42 5.50E-03

LEPROT 1.44 1.36E-03 miR-142-5p -0.40 7.29E-03

MGAT4B 1.58 3.28E-05 miR-142-5p -0.47 1.29E-03


M

DUSP2 1.37 1.63E-03 miR-142-5p -0.45 2.73E-03

DNAJC7 1.19 4.86E-03 miR-142-5p -0.47 1.57E-03


ed

EIF4E3 1.27 2.08E-02 miR-142-5p -0.44 3.10E-03

SPCS2 1.16 2.43E-02 miR-142-5p -0.41 5.83E-03


pt

TRIP11 1.34 2.98E-03 miR-142-5p -0.31 4.11E-02

PCBP2 1.29 3.56E-05 miR-142-5p -0.54 2.17E-04


ce

DDHD1 1.21 1.53E-02 miR-142-5p -0.38 1.26E-02

FAM107B 1.88 9.34E-07 miR-142-5p -0.39 9.34E-03


Ac

TIAM1 1.66 1.76E-04 miR-142-5p -0.33 3.18E-02

SLC30A7 2.26 1.97E-07 miR-142-5p -0.33 3.30E-02

WDR26 1.87 3.29E-06 miR-142-5p -0.31 4.20E-02

CD69 2.17 1.33E-04 miR-142-5p -0.51 4.97E-04

IPO7 1.25 1.83E-02 miR-195-5p -0.31 4.10E-02

RAB10 1.45 1.54E-04 miR-195-5p -0.31 4.07E-02


EDEM3 1.65 2.52E-06 miR-26b-5p -0.33 3.27E-02

TAF11 1.11 3.75E-02 miR-29b-3p -0.43 3.86E-03

ERC1 1.88 5.07E-08 miR-29b-3p -0.34 2.53E-02

GNA13 1.40 1.51E-05 miR-29b-3p -0.37 1.46E-02

RFX7 1.99 9.39E-07 miR-29b-3p -0.40 8.27E-03

TRMT6 1.74 7.01E-07 miR-3201 -0.37 1.46E-02

SLC7A1 1.53 5.75E-04 miR-3201 -0.39 1.07E-02

t
ip
PNRC1 1.54 1.74E-04 miR-3201 -0.30 4.97E-02

Notes: The fold change was calculated by the division of expression levels between RA patients

cr
and controls. P value was generated from the Student’s t-test. The association between miRNA

us
and mRNA was evaluated by Pearson's correlation analysis.
an
M
ed
pt
ce
Ac
Table S2. Analysis for the genes negatively correlated with DEMIRs using
DAVID (A) and literatures searching (B)
Table S2-A Enrichment analysis for the 141 genes negatively correlated with
DEMIRs using DAVID
P Fold
KEGG Pathway Genes
Value Enrichment

Neurotrophin signaling RPS6KA5, GAB1, SH2B3, RAP1A, 0.013 5.31

t
ip
pathway RAP1B

Renal cell carcinoma CUL2, GAB1, RAP1A, RAP1B 0.014 7.72

cr
Endocytosis DNM3, RAB11FIP2, RAB4A, ASAP1, 0.037 3.17

us
RAB10, ARAP2

Table S2-B Literatures searching for the 57 genes that have strong negative
an
correlations (r<-0.4) with DEMIRs
Target gene DEMIRs RA susceptibility Immune/Bone-related
M

ARID1A miR-101-3p、miR-1184 PMID:25625625、18852284

SH2B3 miR-101-3p PMID:27744395 PMID:21723852


ed

DDIT4 miR-101-3p PMID:21917559

RAP1B miR-101-3p PMID:25092872


pt

DOT1L miR-101-3p PMID:22566624

ASAP1 miR-101-3p PMID:24865276


ce

SMARCA4 miR-101-3p PMID:23321680

COTL1 miR-101-3p PMID:19307756


Ac

TPP1 miR-1184 PMID:21833529

SPRED2 miR-1184 PMID:23460240 PMID:28993690

NFE2L2 miR-142-5p PMID:24311378

DUSP2 miR-142-5p PMID:30458195

Notes: PMID: Pubmed ID, search website: www.ncbi.nlm.nih.gov/pubmed/. We search the 57

genes but only 12 genes have known immune inflammation functions.

54
Ac
ce
pt
ed

55
M
an
us
cr
ip
t
Table S3. Clinical evaluation for the 18 identified DEMIRs
ROC analyses Correlation with clinical variables (R(P-value))

miRNA AUC P
CRP ESR DAS28 TJC SJC
(95%CI) value

hsa-miR-44 0.876(0.755- <0.00 -0.115(0. 0.3(0.145 0.373(0.0 0.208(0.3 0.398(0.0

48 0.996) 1 583) ) 66) 18) 49)

t
hsa-miR-12 0.858(0.736- <0.00 -0.212(0. -0.012(0. 0.162(0.4 0.147(0.4 0.289(0.1

ip
46 0.979) 1 31) 954) 4) 82) 62)

hsa-miR-14 0.82(0.685-0. <0.00 -0.047(0. -0.135(0. 0.179(0.3 0.145(0.4 0.245(0.2

cr
2-5p 955) 1 824) 518) 92) 89) 37)

us
hsa-miR-36 0.813(0.677- 1.00E -0.136(0. -0.06(0.7 0.177(0.3 0.06(0.77 0.264(0.2

07-5p 0.95) -03 518) 76) 97) 5) 03)

hsa-miR-29 0.804(0.661- 1.00E


an
-0.194(0. -0.111(0. 0.214(0.3 0.239(0.2 0.29(0.16

c-3p 0.948) -03 352) 598) 04) 49) )


M
hsa-miR-10 0.798(0.649- 1.00E 0.157(0.4 0.138(0.5 0.354(0.0 0.185(0.3 0.372(0.0

1-3p 0.947) -03 55) 12) 83) 77) 67)

hsa-miR-11 0.789(0.653- 1.00E -0.142(0. -0.124(0. 0.35(0.08 0.459(0.0 0.126(0.5


ed

84 0.925) -03 499) 555) 6) 21) 49)

hsa-miR-26 0.767(0.609- 3.00E -0.425(0. 0.101(0.6 0.07(0.73 0.138(0.5 0.396(0.0


pt

b-5p 0.924) -03 034) 31) 9) 09) 5)


ce

hsa-miR-29 0.747(0.59-0. 6.00E -0.114(0. 0.104(0.6 0.177(0.3 0.187(0.3 0.301(0.1

b-3p 904) -03 587) 2) 96) 7) 44)

hsa-miR-76 0.747(0.599- 6.00E -0.387(0. -0.157(0. 0.205(0.3 0.374(0.0 0.189(0.3


Ac

41 0.894) -03 056) 453) 26) 65) 65)

hsa-miR-14 0.74(0.579-0. 8.00E -0.058(0. 0.097(0.6 0.215(0.3 0.296(0.1 0.14(0.50

2-3p 901) -03 784) 45) 03) 51) 4)

hsa-miR-32 0.739(0.59-0. 8.00E -0.305(0. -0.409(0. -0.094(0. 0.073(0.7 -0.11(0.6

01 888) -03 138) 043) 654) 27) 01)

hsa-miR-99 0.738(0.585- 8.00E -0.112(0. -0.039(0. -0.167(0. -0.196(0. 0.107(0.6

56
b-5p 0.891) -03 595) 854) 424) 348) 12)

hsa-miR-36 0.738(0.587- 8.00E -0.203(0. -0.393(0. 0.016(0.9 -0.031(0. 0.115(0.5

51 0.889) -03 331) 052) 39) 882) 83)

hsa-miR-46 0.727(0.578- 1.20E -0.18(0.3 -0.069(0. 0.371(0.0 0.496(0.0 0.111(0.5

68-5p 0.876) -02 88) 742) 68) 12) 97)

hsa-miR-19 0.722(0.565- 1.40E -0.126(0. -0.005(0. 0.05(0.81 0.018(0.9 0.172(0.4

5-5p 0.88) -02 55) 981) 3) 31) 12)

t
ip
hsa-miR-80 0.711(0.558- 1.90E -0.323(0. -0.407(0. -0.16(0.4 0.052(0.8 -0.136(0.

84 0.864) -02 115) 043) 44) 04) 518)

cr
hsa-miR-36 0.698(0.542- 2.80E -0.007(0. 0.029(0.8 0.423(0.0 0.498(0.0 0.132(0.5

us
13-3p 0.854) -02 975) 89) 35) 11) 31)

Notes: Receiver-operating characteristic (ROC) curve analysis was used to evaluate the
an
discriminative capacity of the differentially expressed miRNAs. AUC, area under the curve;

95%CI, 95% confidence interval. Pearson’s correlation analysis was performed to evaluate the
M
associations between miRNAs and clinical variables. R, correlation coefficient; CRP, C-reaction

protein; ESR, erythrocyte sedimentation rate; DAS28, 28-joint disease activity score; TJC, Tender

joint count; SJC, Swollen joint count.


ed
pt
ce
Ac

57
Table S4. Analysis for miR-99b-5p target genes by expression detection in vivo
and vitro (A) and enrichment analysis using DAVID (B)
Table S4-A miR-99b-5p target gene expression in PBMCs in vivo and in Jurkat
T cells in vitro
Validation Validation

Discovery Phase (in PBMC) Phase (in Phase (in

t
Correspon Jurkat cell) PBMC)

ip
Gene ding Correla P value
Fold Fold Fold

cr
miRNA tion for P P P
chan chan chan
coefficie correlati value value value
ge ge ge

us
nt on

mTOR miR-99b-5 -0.62 8.41E-06 -1.17 3.89E- -2.26 1.09E- -2.22 4.87E-

p
an 02 03 02

NLRC miR-99b-5 -0.52 4.08E-04 -1.24 2.57E- -4.38 3.41E- NA NA


M
5 p 02 04

C2orf5 miR-99b-5 -0.48 1.10E-03 -1.25 3.79E- -4.69 1.02E- NA NA

6 p 03 04
ed

TRIM miR-99b-5 -0.42 5.51E-03 -1.12 4.41E- -4.83 9.24E- NA NA

52 p 02 06
pt

OGFO miR-99b-5 -0.40 7.57E-03 -1.18 1.45E- -1.48 7.52E- NA NA


ce

D2 p 02 02

PRKC miR-99b-5 -0.39 1.07E-02 -1.22 2.10E- -3.49 1.39E- NA NA

Z p 04 03
Ac

RASS miR-99b-5 -0.36 1.75E-02 -1.45 1.14E- -1.59 1.66E- -1.82 2.18E-

F4 p 02 02 03

ZNF22 miR-99b-5 -0.44 3.32E-03 -1.18 6.86E- NA NA NA NA

6 p 04

LRCH miR-99b-5 -0.36 1.93E-02 -1.12 3.64E- NA NA NA NA

4 p 02

58
CTBP miR-99b-5 -0.32 3.45E-02 -1.52 4.85E- NA NA NA NA

2 p 05

Notes: Two targets (mTOR, RASSF4) were subjected to validations in independent sample by

qRT-PCR. Among all the miR-99b-5p target genes, mTOR was the strongest correlated one, and

RASSF4 presented the largest fold change of differential expression in discovery phase. Primers

for the last three target genes failed to work. NA: not available.

t
Table S4-B Enrichment analysis for the target genes of miR-99b-5p using

ip
DAVID

cr
KEGG Pathway Genes P-Value Fold Enrichment

Type II diabetes mellitus PRKCZ, mTOR 0.014 95.54

us
Insulin resistance PRKCZ, mTOR 0.031 42.46

Insulin signaling pathway PRKCZ, mTOR 0.040 33.23


an
M
ed
pt
ce
Ac

59
Table S5. Correlations between inflammatory cytokines and targets of
miR-99b-5p

In Jurkat In PBMC
R P value R P value

mTOR IL-2 -0.878 0.021 NA NA


IL-6 -0.711 0.113 -0.251 0.104
TNFα -0.024 0.964 0.104 0.507

t
ip
IFNΓ -0.806 0.053 0.328 0.032
RASSF4 IL-2 NA NA

cr
-0.852 0.031
IL-6 -0.914 0.011 -0.471 0.001

us
TNFα -0.042 0.937 -0.136 0.385
IFNΓ -0.628 0.182 0.235 0.129
an
Notes: R, correlation coefficient; NA, the gene expression of IL-2 was not been
detected in microarray due to the lack of probes.
M
ed
pt
ce
Ac

60
Table S6. Basic characteristics of the female study subjects
Discovery Phase Validation Phase

P P
Cases Controls Cases Controls
value value

Sample size (n) 25 18 - 35 35 -

Age (year) 45.60±9.84 47.11±14.09 0.68 46.44±10.99 47.57±13.99 0.75

BMI (kg/m2)

t
22.07±3.31 22.32±2.79 0.81 22.24±3.67 22.32±2.79 0.94

ip
DAS28 4.46±0.99 NA - 5.08±1.32 NA -

CRP (mg/L) 13.51±16.74 NA - 18.37±31.17 NA -

cr
ESR (mm/h) 42.61±27.50 NA - 48.29±29.46 NA -

us
TJC 8.64±6.49 NA - 10±7.70 NA -

SJC 5.48±3.83 NA - 6.79±5.43 NA -


an
Notes: Variables were expressed as the mean±standard deviation. P-value was from the result of

two-sided Student’s t-test between active RA cases and healthy controls. BMI, body mass index;
M
DAS28, 28-joint Disease Activity Score; CRP, C reactive protein; ESR, equivalent series

resistance; TJC, tender joint count; SJC, swollen joint count; NA, not applicable.
ed
pt
ce
Ac

61
Primer information
Sense primers Antisense primers

p (lenti) forward: TCTAGAGAAGCCAGGTTTTCTATCAG reverse: GAATTCTCCTCCTCAACTATACAACC

p inhibitor forward: CGCAAGGUCGGUUCUACGGGUG

p (qPCR) forward: CACCCGTAGAACCGACCTT

forward: CTCGCTTCGGCAGCACA reverse: AACGCTTCACGAATTTGCGT

t
forward:GCTTATTACAGTGGCAATGAGG reverse:AGATTCGTAGCTGGATGCC

ip
forward:CATTGCACTAAGTCTTGCACTTGTCA reverse:CGTTGATATTGCTGATTAAGTCCCTG

forward:CGGCAACTTTGACCACGGACACAAGTGCGATA reverse:ACGTACTCTGGTTGGCTTCCTTCACAGGAC

cr
forward:GATTCAATGAGGAGACTTGCC reverse:TGTTCTGGAGGTACTCTAGGT

us
forward:ATGACTTCCAAGCTGGCCGTGGCT reverse:TCTCAGCCCTCTTCAAAAACTTCTC

forward:GGCTCCAGGCGGTGCTTGTTC reverse:AGACGGCGATGCGGCTGATG

forward:GCATCGTTTTGGGTTCTCTTGGCTGTTACTGC
an reverse:CTCCTTTTTCGCTTCCCTGTTTTAGCTGCTG

forward:TTCATTCTTTCATTGGAGACGG reverse:CTCGAACCCTGTTAATAATCTGG
M
forward:CACTTCTACAATCATAAGACCTCC reverse:TTGTCATGGTGCTGTTGAC

forward:CTTTAACAGGAGAGCGTACTG reverse:CAGTTGATGCACCTGTAGC

forward:GACAAAGAGGCCATCTGTG reverse:CAGTTATGCCTGGTACTCCT
ed

forward:AGAAGCCTTCATACAACATGAC reverse:GAAAGTTCCTCGATGATAACACC

forward:CTGTACCTGCTGGAGACAC reverse:ACTCACTTAGCCTGAGTGTC
pt

forward:ACAGTATCGGAGGAGAAGC reverse:AGTTGTTCATGGTGTTGGG
ce

forward:GAAGGTGAAGGTCGGAGT reverse:CTTCTACCACTACCCTAAAG

WT-3'UTR forward:GGGTTTAAACAGGAATGCTGCTGGGAAAAG reverse:GCTCTAGAGCACACCTTTATTGAGCACC

MT-3'UTR forward:GAAGCTCCAGTAATCCTGCCCATCAAGAGCATAG reverse:CTTGATGGGCAGGATTACTGGAGCTTCTA


Ac

CTTGGAAGCCACCA TTAGAGATGG

-99b-5p (lenti) was used in the PCR amplification for the miRNA fragment. miR-99b-5p (qPCR) and U6 (qPCR) were used for the validation

RASSF4 WT-3'UTR and RASSF4 MT-3'UTR were used in the PCR amplification for the fragment of the wide-type (WT) and mutant-ty

d region (3'UTR) of RASSF4.

62

Оценить