Вы находитесь на странице: 1из 173

Национальная академия наук Беларуси

Институт генетики и цитологии НАН Беларуси


Общественное объединение
«Белорусское общество генетиков и селекционеров»

III Международная научная конференция

«Генетика и биотехнология XXI века: проблемы,


достижения, перспективы»,
посвященная 115-летию со дня рождения академика А.Р. Жебрака

XI съезд Белорусского общества генетиков и селекционеров

Материалы конференции

23–25 ноября 2016 г.

г. Минск, Республика Беларусь

Минск
Институт генетики и цитологии НАН Беларуси, 2016
УДК 577.21

Генетика и биотехнология XXI века: проблемы, достижения, перспективы: материалы


III Международной научной конференции, посвященной 115-летию со дня рождения академика
А.Р. Жебрака. XI съезд Белорусского общества генетиков и селекционеров. Минск, 23–25 ноября
2016 г. / Ред. колл.: А.В. Кильчевский и др.; Институт генетики и цитологии НАН Беларуси. –
Минск, 2016. – 172 с. – ISBN 978-985-90385-3-2.

В сборник включены материалы III Международной научной конференции «Генетика и био-


технология XXI века: проблемы, достижения, перспективы», посвященной 115-летию со дня
рождения академика А.Р. Жебрака, в рамках секций:

Секция 1. Молекулярная генетика, геномика и биоинформатика.


Секция 2. Генетика человека, медицинская и спортивная генетика.
Секция 3. Генетика, селекция и биотехнология.

Тексты публикуются в авторской версии без редакционных изменений

УДК 577.21

ISBN 978-985-90385-3-2 © Институт генетики и цитологии НАН Беларуси, 2016


© Institute of Genetics and Cytology NASB, 2016
Организационный комитет
Международной научной конференции

Кильчевский А.В., член-корреспондент НАН Беларуси (председатель)


Хотылева Л.В., академик НАН Беларуси (сопредседатель)
Лемеш В.А., директор Института генетики и цитологии НАН Беларуси, кандидат биол.
наук, доцент (сопредседатель)
Гриб С.И., академик НАН Беларуси
Инге-Вечтомов С.Г., академик РАН
Колчанов Н.А., академик РАН
Рашаль И.Д., академик Латвийской АН
Харченко П.Н., академик РАСХН
Шейко И.П., академик НАН Беларуси
Привалов Ф.И., член-кореспондент НАН Беларуси
Давыденко О.Г., член-корреспондент НАН Беларуси
Кунах В.А., член-корреспондент НАН Украины
Янковский Н.К., член-корреспондент РАН
Падутов В.Е., член-корреспондент НАН Беларуси
Раманкулов Е.М., член-корреспондент КазНАЕН
Титок В.В., член-корреспондент НАН Беларуси
Максимова Н.П., доктор биол. наук
Моссэ И.Б., доктор биол. наук
Сычева Е.А., кандидат биол. наук



Секретариат

Дромашко С.Е., доктор биол. наук, профессор


Гузенко Е.В., кандидат биол. наук
Булойчик А.А., кандидат биол. наук
Широкая И.В.
Клевец Е.А.
4 Содержание

СОДЕРЖАНИЕ

Секция 1. Молекулярная генетика, геномика и биоинформатика......................... 13


С.И. Абугалиева, Е.К. Туруспеков
ДНК-баркодирование редких и эндемичных видов растений Казахстана........................................14
О.Ю. Баранов
ИСПОЛЬЗОВАНИЕ ДАННЫХ ВЫСОКОПРОИЗВОДИТЕЛЬНОГО СЕКВЕНИРОВАНИЯ ДЛЯ ОЦЕНКИ
ГЕНЕТИКО-ТАКСОНОМИЧЕСКИХ ВЗАИМООТНОШЕНИЙ МИКРОМИЦЕТОВ.........................................................15
Е.Г. Веремеенко, И.А. Кашкан, Е.В. Новосадова, Н.П. Максимова
СТРУКТУРНО-ФУНКЦИОНАЛЬНАЯ ХАРАКТЕРИСТИКА rpeA-ГЕНА БАКТЕРИЙ PSEUDOMONAS
CHLORORAPHIS SSP. AURANTIACA.............................................................................................................................16
Е.Г. Веремеенко, Ю.А. Шилова, Н.П. Максимова
ИНСЕРЦИОННЫЙ МУТАГЕНЕЗ psrA-ГЕНА У БАКТЕРИЙ P. CHLORORAPHIS SSP. AURANTIACA B-162.............17
М.М. Воробьева, Д.И. Лавриеня, Н.В. Воронова, С.В. Буга
ГЕНЕТИЧЕСКАЯ ВАРИАБЕЛЬНОСТЬ У ТЛЕЙ: СВЯЗЬ ГОСТАЛЬНОЙ ПЛАСТИЧНОСТИ И ИЗМЕНЧИВОСТИ
НАИБОЛЕЕ КОНСЕРВАТИВНЫХ УЧАСТКОВ МИТОХОНДРИАЛЬНОГО ГЕНОМА ..................................................18
Н.В. Воронова, Ю.В. Бондаренко, М.М. Воробьева, П.Ю. Кветко, А.В. Кривая
МАТЕМАТИЧЕСКОЕ МОДЕЛИРОВАНИЕ СКОРОСТИ НАКОПЛЕНИЯ НУКЛЕОТИДНЫХ ЗАМЕН В
ЭВОЛЮЦИОННО КОНСЕРВАТИВНЫХ ГЕНАХ............................................................................................................19
Н.В. Воронова, Ю.М. Борисов
МОЛЕКУЛЯРНАЯ ДИАГНОСТИКА ШИРОКОЙ ГИБРИДНОЙ ЗОНЫ ЮЖНЫХ И СЕВЕРНЫХ ФОРМ МЫШЕЙ
SYLVAEMUS FLAVICOLLIS НА ТЕРРИТОРИИ БЕЛАРУСИ..........................................................................................20
Д.В. Галиновский, Т.А. Подвицкий, Н.В. Анисимова, Л.В. Хотылева, А.В. Кильчевский
АНАЛИЗ ЭКСПРЕССИИ ГЕНОВ БИОГЕНЕЗА КЛЕТОЧНОЙ СТЕНКИ ВОЛОКОН ЛЬНА С ПРИВЛЕЧЕНИЕМ
ДАННЫХ КОЛИЧЕСТВЕННОЙ ПЦР И РНК-СЕКВЕНИРОВАНИЯ...............................................................................21
М.В. Глазков
ХРОМОСОМНЫЕ И ИСКУССТВЕННЫЕ (ТРАНСГЕННЫЕ) ДОМЕНЫ ГЕНОВ ЭУКАРИОТ......................................22
Н.О. Дашенкова, А.С. Микаелян
ИССЛЕДОВАНИЕ КЛОНАЛЬНЫХ КЛЕТОЧНЫХ КУЛЬТУР, ВЫДЕЛЕННЫХ ИЗ ОПУХОЛЕВОЙ ТКАНИ ГЦК
МЫШИ, НА МАРКЕРЫ ЭПИТЕЛИО-МЕЗЕНХИМНОГО ПЕРЕХОДА.........................................................................23
А.В. Доцев, В.Р. Харзинова, И.М. Охлопков, Г. Брем, Н.А. Зиновьева
ОЦЕНКА ГЕНЕТИЧЕСКОГО РАЗНООБРАЗИЯ ДИКИХ СЕВЕРНЫХ ОЛЕНЕЙ СЕВЕРО-ЗАПАДНОЙ ЯКУТИИ
С ИСПОЛЬЗОВАНИЕМ SNP-МАРКЕРОВ......................................................................................................................24
Б.В. Иващук, Я.В. Пирко, Я.Б. Блюм
ПОИСК ГЕНОВ УСТОЙЧИВОСТИ К СТЕБЛЕВОЙ РЖАВЧИНЕ У ЗЛАКОВ С ПОМОЩЬЮ
ПОСЛЕДОВАТЕЛЬНОСТИ NB ДОМЕНА БЕЛКОВ КЛАССА NB-LRR...........................................................................25
В.А. Лемеш, М.В. Богданова, В.И. Сакович
СЕКВЕНИРОВАНИЕ SAD, FAD2 И FAD3 ГЕНОВ ДЕСАТУРАЗ ЛЬНА . .......................................................................26
Е.Д. Луценко, М.В. Останков, Н.А. Бондарович, А.Н. Гольцев
ОЦЕНКА ЭКСПРЕССИИ ГЕНА FOXP3 В КЛЕТКАХ СЕЛЕЗЕНКИ В МОДЕЛИ АДЪЮВАНТНОГО АРТРИТА
ДО И ПОСЛЕ ПРИМЕНЕНИЯ КЛЕТОК ПЛАЦЕНТЫ.....................................................................................................27
А.В. Мезенцев, А.Г. Соболева, Ю. Могулевцева, А.Д. Золотаренко, С.А. Брускин
РЕКОНСТРУКЦИЯ ЭПИДЕРМИСА МЫШИ, СОДЕРЖАЩЕГО ГЕНЕТИЧЕСКИ МОДИФИЦИРОВАННЫЕ
КЛЕТКИ ЧЕЛОВЕКА........................................................................................................................................................28
М.Е. Михайлова, А.И. Киреева, Е.Л. Романишко, Н.И. Тиханович, Н.А. Камыш
ДНК-ДИАГНОСТИКА ГЕНЕТИЧЕСКОГО ДЕФЕКТА КРУПНОГО РОГАТОГО СКОТА ГОЛШТИНСКОЙ ПОРОДЫ,
ДЕТЕРМИНИРУЮЩЕГО СИНДРОМ БРАХИСПИНЫ (BY) . ..........................................................................................29

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Содержание 5

М.Е. Михайлова, Е.Л. Романишко, А.И. Киреева


ВЫЯВЛЕНИЕ ПОЛИМОРФИЗМА (A3072G) ГЕНА ИНСУЛИНОПОДОБНОГО ФАКТОРА РОСТА pIGF2
(ИНТРОН 3) У СВИНЕЙ (SUS SCROFA) МЕТОДОМ СЕКВЕНИРОВАНИЯ ................................................................30
Р.Е. Нугманова, Е.В. Жолдыбаева
РАЗРАБОТКА ТЕСТ-СИСТЕМЫ НА ОСНОВЕ ПОЛИМЕРАЗНОЙ ЦЕПНОЙ РЕАКЦИИ В РЕЖИМЕ РЕАЛЬНОГО
ВРЕМЕНИ ДЛЯ ПОДБОРА ИНДИВИДУАЛЬНЫХ ДОЗ ЛЕКАРСТВЕННЫХ ПРЕПАРАТОВ, ИСПОЛЬЗУЕМЫХ
ПРИ ЛЕЧЕНИИ КИСЛОТОЗАВИСИМЫХ ЗАБОЛЕВАНИЙ ЖЕЛУДОЧНО-КИШЕЧНОГО ТРАКТА...............................31
Ю.Л. Орлов, Е.В. Кулакова, А.М. Спицина, И.В. Чадаева, В.Н. Бабенко
КОМПЬЮТЕРНЫЕ МЕТОДЫ АНАЛИЗА ХРОМОСОМНЫХ КОНТАКТОВ В ЯДРЕ КЛЕТКИ НА ОСНОВЕ
СЕКВЕНИРОВАНИЯ........................................................................................................................................................32
А.Н. Рабоконь, А.Е. Демкович, Я.В. Пирко, М.В. Богданова, В.И. Сакович, В.А. Лемеш, Я.Б. Блюм
ИССЛЕДОВАНИЕ ПОЛИМОРФИЗМА ДЛИНЫ ИНТРОНОВ ГЕНОВ β‑ТУБУЛИНА У ЛАНДРАС LINUM
USITATISSIMUM L...........................................................................................................................................................33
В.В. Рассадина, А.В. Усатов, М.С. Макаренко, Н.Г. Аверина
ВЛИЯНИЕ ПЛАСТИДНЫХ МУТАЦИЙ В ГЕНАХ rpoA И rpoC2 НА БИОГЕНЕЗ ФОТОСИНТЕТИЧЕСКОГО
АППАРАТА В ЛИСТЬЯХ ПОДСОЛНЕЧНИКА.................................................................................................................34
И.Э. Рубель, О.Ю. Баранов, С.В. Пантелеев, О.А. Разумова, В.А. Гущин, В.В. Макаров
СТРУКТУРНО-ФУНКЦИОНАЛЬНАЯ ОРГАНИЗАЦИЯ ВИРУСОПОДОБНЫХ ГЕНЕТИЧЕСКИХ ЭЛЕМЕНТОВ
СОСНЫ ОБЫКНОВЕННОЙ И ЕЛИ ЕВРОПЕЙСКОЙ....................................................................................................35
Н.Н. Рудакова, М.Г. Алексеева, Д.А. Мавлетова, А.А. Ватлин, О.Б. Беккер, Н.В. Захаревич, В.Н. Даниленко
АМИНОГЛИКОЗИДФОСФОТРАНСФЕРАЗЫ АКТИНОБАКТЕРИЙ: СТРУКТУРА И ФУНКЦИИ, ВКЛАД
В УСТОЙЧИВОСТЬ К АМИНОГЛИКОЗИДНЫМ АНТБИОТИКАМ У ВОЗБУДИТЕЛЕЙ ТУБЕРКУЛЕЗА
И АКТИНОМИКОЗОВ......................................................................................................................................................36
С.А. Руднева, А.А. Хаченкова, Л.Ф. Курило
ЭПИГЕНЕТИЧЕСКИЕ МЕХАНИЗМЫ РЕГУЛЯЦИИ СПЕРМАТОГЕНЕЗА....................................................................37
Т.В. Сизова, И.А. Иванов, В.Е. Спангенберг, О.И. Карпова
ДЛИНА ПЕТЕЛЬ ХРОМАТИНА В ПРОФАЗЕ I МЕЙОЗА ГЕНОМА МЫШИ ЗАВИСИТ ОТ КОМПОЗИЦИОННОГО
СОСТАВА ДНК..................................................................................................................................................................38
A.А. Стахеев, С.К. Завриев
ОСОБЕННОСТИ ГЕНЕТИЧЕСКОГО АППАРАТА БИОСИНТЕЗА ТРИХОТЕЦЕНОВЫХ ТОКСИНОВ
У АСКОМИЦЕТНЫХ ГРИБОВ РОДА FUSARIUM: МЕХАНИЗМЫ ЭВОЛЮЦИИ, СТРУКТУРНЫЙ И
ФУНКЦИОНАЛЬНЫЙ АНАЛИЗ НЕОХАРАКТЕРИЗОВАННЫХ ГЕНОВ........................................................................39
В.Н. Стефанова, Н.Г. Иванова, И.В. Матвеев, О.А.Епишко, О.И. Подгорная
ПОИСК И ИЗУЧЕНИЕ ТАНДЕМНЫХ ПОВТОРОВ В ГЕНОМАХ РАЗНЫХ ПОРОД ДОМАШНЕЙ СВИНЬИ..............40
П.В. Тарлыков, Е.В. Жолдыбаева, М.Л. Филипенко, Е.М. Раманкулов
РАЗРАБОТКА ПРОТОКОЛА РЕПАРАЦИИ ПАЛЕОДНК ДЛЯ ЭФФЕКТИВНОГО МОЛЕКУЛЯРНО-
ГЕНЕТИЧЕСКОГО АНАЛИЗА..........................................................................................................................................41
И.В. Чадаева, В.Н. Бабенко, А.О. Брагин, Ю.Л. Орлов
АЛЬТЕРНАТИВНЫЙ СПЛАЙСИНГ И ДИФФЕРЕНЦИАЛЬНАЯ ЭКСПРЕССИЯ ГЕНОВ В ТКАНЯХ МОЗГА КРЫС....... 42
А.Б. Шевцов, Е.С. Шевцова, Д.К. Камалова, Т.Б. Карибаев, И.И. Сытник, Е.М. Раманкулов,
К.К. Муканов
Анализ множественных тандемных повторов (MLVA-16) штаммов бруцелл, выделенных в
Казахстане с 1947 по 2015 годы............................................................................................................................... 43
Т. Шестакова, Е. Чернолев, О. Табэрэ, А. Муту, А. Порт, М. Дука
ОЦЕНКА ГЕНЕТИЧЕСКОГО РАЗНООБРАЗИЯ ПОПУЛЯЦИЙ ЗАРАЗИХИ ПОДСОЛНЕЧНИКА В РЕСПУБЛИКЕ
МОЛДОВА С ПОМОЩЬЮ МИКРОСАТЕЛЛИТНЫХ МАРКЕРОВ ....................................................................................44
Н.А. Шкутэ
ВЛИЯНИЕ ФАКТОРОВ ВНЕШНЕЙ СРЕДЫ НА ЭПИГЕНЕТИЧЕСКИЕ ИЗМЕНЕНИЯ ГЕНОМА................................45
Г.В. Шпаковский, Ю.В. Долудин, А.В. Аралов, И.Ю. Словохотов, В.Н. Клыков, Д.Г. Шпаковский,
Е.К. Шематорова
НОВЫЕ КОМПЛЕКСЫ ГЕННОЙ ЭКСПРЕССИИ И ИХ РОЛЬ В ВОЗНИКНОВЕНИИ И ЭВОЛЮЦИИ РОДА HOMO....... 46

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
6 Содержание

P.C. Li, R.N. Kalendar, B.B. Khassenov


EXPRESSION AND PURIFICATION OF LARGE FRAGMENT OF POLYMERASE FROM GEOBACILLUS
STEAROTHERMOPHILUS...............................................................................................................................................47
T.P. Lipinskaya, A.I. Makarenko
USING OF DNA-BARCODING FOR IDENTIFICATION OF ALIEN INVASIVE SPECIES OF CRUSTACEANS...............48
S.N. Matveevsky, E.Yu. Ivanitskaya, V.E. Spangenberg, O.L. Kolomiets
MEIOTIC SEX CHROMOSOME INACTIVATION IN BLIND MOLE RATS........................................................................49

Секция 2. Генетика человека, медицинская и спортивная генетика.................... 50


С.К. Абельденов, М.К. Сапарбаев, Е.М. Раманкулов, Б.Б. Хасенов
ЗАВИСИМОСТЬ АП ЭНДОНУКЛЕАЗНОЙ АКТИВНОСТИ МИКОБАКТЕРИАЛЬНЫХ ФЕРМЕНТОВ РЕПАРАЦИИ
ОТ ДВУХВАЛЕНТНЫХ КАТИОНОВ МЕТАЛЛОВ...................................................................................................................51
А.М. Айткулова, Е.В. Жолдыбаева, Б.Д. Джамантаева, Е.Ж. Медетов, Е.Т. Махамбетов
РОЛЬ ПОЛИМОРФИЗМА -174G/С ГЕНА IL-6 ПРИ РИСКЕ РАЗВИТИЯ И РАЗРЫВОВ АНЕВРИЗМ СОСУДОВ
ГОЛОВНОГО МОЗГА В КАЗАХСКОЙ ПОПУЛЯЦИИ......................................................................................................52
Е.А. Аксенова, Н.А. Мартусевич, Н.П. Митьковская
Генотипирование пациентов с ревматоидным артритом, отличающихся по реакции
на лечение метотрексатом...................................................................................................................................53
А.С. Бабенко, Л.В. Статкевич, Н.А. Балашенко, С.Н. Шевцова, С.Е. Дромашко
ЭКСПРЕССИЯ ГЕНОВ TP53, CDKN1A, MYC, TERF1, TERF2, NFX1, HIF1A, EPAS1, CTNNB1 И EGFR В
ОБРАЗЦАХ КУЛЬТУРЫ КЛЕТОК РАКА ЛЕГКОГО ЧЕЛОВЕКА А549............................................................................54
З.И. Бисултанова, П.М. Джамбетова
ОСОБЕННОСТИ РАСПРОСТРАНЕНИЯ ПОЛИМОРФНЫХ ВАРИАНТОВ ГЕНОВ BRCA1/2 В ЧЕЧЕНСКОЙ
ПОПУЛЯЦИИ....................................................................................................................................................................55
В.А. Будевич, А.В. Зураев, И.Б. Моссэ, Л.Г. Гелис, Е.А. Медведева, С.Ф. Золотухина
АНАЛИЗ ВЛИЯНИЯ ИНДИВИДУАЛЬНЫХ ГЕНЕТИЧЕСКИХ ОСОБЕННОСТЕЙ ПАЦИЕНТА НА УСПЕШНОСТЬ
ЛЕЧЕНИЯ ЛЕКАРСТВЕННЫМ ПРЕПАРАТОМ КЛОПИДОГРЕЛ........................................................................................ 56
В.М. Веремейчик, Н.Н. Кузуб, С.Р. Боровко, А.В. Павлюченко, А.Г. Шимко
ПОЛИМОРФИЗМ НОВЫХ АУТОСОМНЫХ ДНК-МАРКЕРОВ ГЕНОМА ЧЕЛОВЕКА у населения БЕЛАРУСИ.......57
В.В. Гринев, O. Heidenreich
ГИБРИДНЫЙ ОНКОГЕН RUNX1-RUNX1T1 КАК НЕПРЯМОЙ РЕГУЛЯТОР АЛЬТЕРНАТИВНОГО СПЛАЙСИНГА
В ЛЕЙКОЗНЫХ КЛЕТКАХ ЧЕЛОВЕКА....................................................................................................................................... 58
Т.М. Гринчук, Ю.С. Попелышко, З.В. Ковалева
ИЗМЕНЕНИЯ В СТРУКТУРЕ КАРИОТИПА ЭНДОМЕТРИАЛЬНЫХ МЕЗЕНХИМНЫХ СТВОЛОВЫХ КЛЕТОК
IN VITRO ПОСЛЕ ОБЛУЧЕНИЯ РЕНТГЕНОВСКИМИ ЛУЧАМИ В СУБЛЕТАЛЬНОЙ ДОЗЕ......................................59
О.А. Громыко, Е.И. Головатая, И.Н. Мотюк
ПРЕНАТАЛЬНАЯ ДИАГНОСТИКА ХРОМОСОМНОГО ДИСБАЛАНСА У ПЛОДА В РЕЗУЛЬТАТЕ СЕГРЕГАЦИИ
3:1 ПРИ МУЖСКОМ НОСИТЕЛЬСТВЕ РЕЦИПРОКНОЙ ТРАНСЛОКАЦИИ....................................................................60
Н.Б. Гусина, Е.С. Будейко, С.О. Мясников, Т.С. Зимовина, Е.Г. Требко, О.А. Громыко, А.А. Гусина
ГЕНЕТИЧЕСКИЕ ДЕФЕКТЫ СУЛЬФАТАЗ ЧЕЛОВЕКА В РЕСПУБЛИКЕ БЕЛАРУСЬ.................................................61
И.Б. Моссэ, А.Л. Гончар, Л.А. Кундас, М.Д. Амельянович, Н.Г. Седляр
ВЫЯВЛЕНИЕ ФАКТОРОВ РИСКА НАСЛЕДСТВЕННОЙ ТРОМБОФИЛИИ В ЦЕЛЯХ ПРОФИЛАКТИКИ ПОТЕРЬ
БЕРЕМЕННОСТИ......................................................................................................................................................................62
А.А. Гусина, А.В. Зиновик, Т.С. Зимовина, Т.М. Ефимчик, Н.Б. Гусина
ТЕСТИРОВАНИЕ НА НАСЛЕДСТВЕННЫЕ ТРОМБОФИЛИИ: НА ПОЛЬЗУ ИЛИ ВО ВРЕД?....................................63
С.Е. Дромашко, Н.А. Балашенко, С.Н. Шевцова, О.В. Квитко, Я.И. Шейко
НЕИНВАЗИВНОЕ ПОЛУЧЕНИЕ КЛЕТОК ЧЕЛОВЕКА В ЦЕЛЯХ РЕГЕНЕРАТИВНОЙ МЕДИЦИНЫ........................64
А.А. Ершова-Павлова, Г.А. Карпенко, Е.П. Ринкевич, А.А. Славщик, Р.Д. Хмель, И.В. Наумчик, Г.И. Лазюк
СИСТЕМА МОНИТОРИНГА В ОЦЕНКЕ НАРУШЕНИЙ ЭМБРИОНАЛЬНОГО РАЗВИТИЯ В ПОПУЛЯЦИИ БЕЛАРУСИ...... 65

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Содержание 7

А.В. Зураев, В.А. Будевич, Л.В. Кухтинская, И.Б. Моссэ


ИЗУЧЕНИЕ ПОЛИМОРФНЫХ ВАРИАНТОВ ГЕНА SLC6A4 В КАЧЕСТВЕ МАРКЕРОВ
ПСИХОЭМОЦИОНАЛЬНОЙ АДАПТАЦИИ ЧЕЛОВЕКА ...............................................................................................66
И.Н. Ильюшёнок, O. Heidenreich, В.В. Гринев
РЕКОНСТРУКЦИЯ ВЗВЕШЕННОГО ЭКЗОННОГО ГРАФА ГИБРИДНОГО ОНКОГЕНА RUNX1-RUNX1T1 НА
ОСНОВЕ ДАННЫХ RNA-Seq..........................................................................................................................................67
Е.А. Климов, А.В. Малахова, Е.А. Наумова, З.Г. Кокаева, А.А. Анучина, Ю.Э. Азимова, Н.М. Фокина,
Г.Р. Табеева, О.И. Рудько
ПОИСК МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИХ МАРКЁРОВ ПАНИЧЕСКИХ РАССТРОЙСТВ.........................................68
О.Л. Коломиец, А.А. Кашинцова, В.Е. Спангенберг, Е.Е. Брагина
КОМПЛЕКСНОЕ ИССЛЕДОВАНИЕ МЕЙОЗА И СПЕРМАТОГЕНЕЗА У ПАЦИЕНТОВ С АЗООСПЕРМИЕЙ...........69
В.А. Кордюм
ОСНОВЫ СИГНАЛЬНО-КЛЕТОЧНОЙ ТЕРАПИИ..........................................................................................................70
О.Л. Курбатова, И.С. Цыбовский, В.М. Веремейчик, И.Г. Удина
ГЕНЕТИКО-ДЕМОГРАФИЧЕСКИЕ ХАРАКТЕРИСТИКИ ДВУХ МЕГАПОЛИСОВ – МОСКВЫ И МИНСКА.................71
А.А. Лазаревич
РАСШИРЕНИЕ ТОЛЩИНЫ ВОРОТНИКОВОГО ПРОСТРАНСТВА У ПЛОДА ПЕРВОГО ТРИМЕСТРА
КАК МАРКЕР СИСТЕМНЫХ СКЕЛЕТНЫХ ДИСПЛАЗИЙ.............................................................................................72
О.Д. Левданский, М.С. Родькин, Д.Е. Данилов, В.С. Панкратов, А. Около-Кулак, А.В. Троян,
И.А. Карпов, О.Г. Давыденко
ВЛИЯНИЕ ПОЛИМОРФИЗМА ГЕНОВ IL28B, CCL5, CCR5 И TNFα НА ЭФФЕКТИВНОСТЬ ТЕРАПИИ
ХРОНИЧЕСКОГО ГЕПАТИТА С......................................................................................................................................73
И.Б. Моссэ, П.М. Морозик, М.Д. Амельянович, К.В. Жур, Е.В. Нестеренко, П.В. Евлеев
АНАЛИЗ ГЕНЕТИЧЕСКИХ МАРКЕРОВ ПАТОЛОГИИ КОСТНО-МЫШЕЧНОЙ СИСТЕМЫ У СПОРТСМЕНОВ.......74
И.В. Наумчик
РОЛЬ МЕДИЦИНСКОЙ ГЕНЕТИКИ В ПРОФИЛАКТИКЕ ВРОЖДЕННЫХ И НАСЛЕДСТВЕННЫХ ЗАБОЛЕВАНИЙ....... 75
И.В. Новикова, А.А. Лазаревич, Н.А. Венчикова, О.А. Тарлецкая, И.В. Соловьева, Э.И. Мараховская,
С.И. Ковалев
ПОРОКИ РАЗВИТИЯ ДЫХАТЕЛЬНОЙ СИСТЕМЫ У ПЛОДОВ, АБОРТИРОВАННЫХ ПО ГЕНЕТИЧЕСКИМ
ПОКАЗАНИЯМ ВО ВТОРОМ ТРИМЕСТРЕ БЕРЕМЕННОСТИ.....................................................................................76
В.Ю. Нугис, Е.Э. Западинская, М.Г. Козлова, О.А. Тихонова
РЕЗУЛЬТАТЫ ЦИТОГЕНЕТИЧЕСКИХ ИССЛЕДОВАНИЙ ЛИКВИДАТОРОВ И ЖИТЕЛЕЙ ЗАГРЯЗНЕННЫХ
ТЕРРИТОРИЙ СПУСТЯ 28–29 ЛЕТ ПОСЛЕ АВАРИИ НА ЧЕРНОБЫЛЬСКОЙ АЭС . ...............................................77
Г.М. Порубова, С.Н. Сиренко, И.В. Демянцева
ГЕНЕТИЧЕСКИЙ СКРИНИНГ ЗАБОЛЕВАЕМОСТИ РАКОМ МОЛОЧНОЙ ЖЕЛЕЗЫ И ЯИЧНИКОВ ЖЕНСКОГО
НАСЕЛЕНИЯ Г. МИНСКА......................................................................................................................................................78
О.В. Прибушеня, Е.И. Головатая, С.А. Котова, Е.А. Шило, И.С. Цыбовский
ТЕТРАГАМЕТИЧЕСКИЙ ХИМЕРИЗМ У ПАЦИЕНТА С ПЕРВИЧНЫМ БЕСПЛОДИЕМ..............................................79
О.В. Прибушеня, Е.И. Головатая, А.Л. Маркевич, И.И. Прибушеня
СТРУКТУРА ХРОМОСОМНЫХ АНОМАЛИЙ У ПАЦИЕНТОВ С ТЯЖЕЛЫМ НАРУШЕНИЕМ СПЕРМАТОГЕНЕЗА....... 80
О.В. Прибушеня, Г.И. Лазюк
ЧАСТОТА И СТРУКТУРА ВРОЖДЕННЫХ ПОРОКОВ РАЗВИТИЯ ПРИ МНОГОПЛОДНОЙ БЕРЕМЕННОСТИ.......81
Н.И. Рябоконь, Н.В. Никитченко, Т.Д. Кужир, О.В. Прибушеня, А.А. Ершова-Павлова, И.В. Наумчик
Метод ДНК-комет в диагностике генетически обусловленных форм мужского бесплодия....... 82
Л.Н. Сивицкая, Н.Г. Даниленко, Т.Г. Вайханская, Т.В. Курушко, А.М. Шимкевич, О.Г. Давыденко
МУТАЦИИ В ГЕНЕ ЛАМИНА А/С (LMNA) У БЕЛОРУССКИХ ПАЦИЕНТОВ С ЛАМИНОПАТИЯМИ..........................83
И.Г. Удина, П.Р. Бутовская, О.Е. Лазебный, В.А. Васильев, Д.В. Шибалев, Е.В. Веселовская, М.Л. Бутовская
ИЗУЧЕНИЕ МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКОГО ПОЛИМОРФИЗМА ДОПАМИНОВОЙ, СЕРОТОНИНОВОЙ
И АНДРОГЕННОЙ СИСТЕМ И АНТРОПОЛОГИЧЕСКИХ И ПСИХОЛОГИЧЕСКИХ ХАРАКТЕРИСТИК У БОРЦОВ
ВЫСШЕЙ КАТЕГОРИИ................................................................................................................................................................ 84

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
8 Содержание

Н.Н. Чакова, Н.О. Воловик, С.С. Ниязова, А.Н. Щаюк, Л.М. Беляева, Н.В. Микульчик, Д.В. Буза


ОЦЕНКА ЗНАЧИМОСТИ ПОЛИМОРФНЫХ ЛОКУСОВ ГЕНА БЕТА-2 АДРЕНОРЕЦЕПТОРА В ПАТОГЕНЕЗЕ
АТОПИЧЕСКИХ ЗАБОЛЕВАНИЙ У ДЕТЕЙ БЕЛАРУСИ...............................................................................................85
А.А. Яцкив, Н.В. Никитченко, Т.А. Глушкова, Е.В. Сечко, А.М. Чичко, А.В. Сукало, Р.И. Гончарова
АЛЛЕЛЬНЫЙ СТАТУС ПОЛИМОРФНЫХ ЛОКУСОВ G/T RS7574865 ГЕНА STAT4 И C/T RS5742909 ГЕНА
CTLA4 У БЕЛОРУССКИХ ПАЦИЕНТОВ С ЮВЕНИЛЬНЫМ ИДИОПАТИЧЕСКИМ АРТРИТОМ................................86

Секция 3. Генетика, селекция и биотехнология....................................................... 87


А.А. Адамбаева, Р.Б. Ахмедов, М.С. Кобозева, В.В. Заякин, А.А. Султанов, И.Я. Нам
АЛЛЕЛЬНЫЙ ПОЛИМОРФИЗМ ГЕНА BoLA-DRB3 У БОЛЬНЫХ БРУЦЕЛЛЕЗОМ КОРОВ КАЗАХСТАНА...............88
А.В. Амосова, С.А. Зощук, Н.Л. Большева, М.О. Твардовская, И.О. Андреев, О.Ю. Юркевич,
Т.Е. Саматадзе, В.А. Кунах, О.В. Муравенко
СРАВНИТЕЛЬНЫЙ МОЛЕКУЛЯРНО-ЦИТОГЕНЕТИЧЕСКИЙ АНАЛИЗ DESCHAMPSIA ANTARCTICA DESV.
(ПРИБРЕЖНАЯ АНТАРКТИКА) И РОДСТВЕННЫХ ВИДОВ..................................................................................... 89
В.С. Анохина, И.Б. Саук, И.Ю. Романчук
генетическая детерминация алкалоидности отдельных коллекционных образцов
люпина желтого и узколистного.......................................................................................................................90
Р.Б. Ахмедов, М.С. Кобозева, В.В. Заякин, И.Я. Нам
ГЕНЕТИЧЕСКИЙ ПОЛИМОРФИЗМ BoLA-DRB3 У КОРОВ ПРИ ПЕРСИСТЕНТНОМ ЛИМФОЦИТОЗЕ...................91
С.Х. Бабаева, Х.И. Бободжанова, Н.В. Кухарчик
ВЛИЯНИЕ КОНЦЕНТРАЦИИ 6-БА НА РАЗВИТИЕ МИКРОПОБЕГОВ ВИНОГРАДА..................................................92
О.Г. Бабак, С.В. Кубрак, Г.В. Шпаковский, А.В. Кильчевский
ОСОБЕННОСТИ РОСТА И РАЗВИТИЯ ТРАНСГЕННЫХ РАСТЕНИЙ ТОМАТА (Solanum lycopersicum L.),
ЭКСПРЕССИРУЮЩИХ кДНК CYP11А1 ЦИТОХРОМА Р450 ЖИВОТНОГО ПРОИСХОЖДЕНИЯ.................................. 93
Д.М. Бекенов, А.А. Спанов, А.И. Сембаева, И.Я. Нам, А.М. Омбаев
ИСПОЛЬЗОВАНИЕ КЛЕТОЧНЫХ БИОТЕХНОЛОГИЙ ДЛЯ УСКОРЕННОГО ВОСПРОИЗВОДСТВА КРУПНОГО
РОГАТОГО СКОТА..................................................................................................................................................................94
П.А. Борозан
Кремнистая зародышевая плазма в селекции раннеспелых гибридов кукурузы........................95
А.А. Булойчик, Т.В. Долматович
ИДЕНТИФИКАЦИЯ ГЕНОВ УСТОЙЧИВОСТИ К ГРИБНЫМ БОЛЕЗНЯМ У ОЗИМЫХ СОРТОВ МЯГКОЙ
ПШЕНИЦЫ.......................................................................................................................................................................96
П.П. Васько
ПРОДУКТИВНОСТЬ ФЕСТУЛОЛИУМА МОРФОТИПОВ РАЙГРАСА И ОВСЯНИЦЫ.................................................97
Т.А. Воейкова, О.А. Журавлева, Н.В. Булушова, Т.С. Кубасова, Т.Т. Исмагулова, В.П. Вейко,
К.В. Шайтан, В.Г. Дебабов
«ЗЕЛЕНЫЙ СИНТЕЗ» НАНОЧАСТИЦ СУЛЬФИДА СЕРЕБРА МИКРООРГАНИЗМАМИ И АНАЛИЗ БЕЛКОВОГО
ПОКРЫТИЯ ЧАСТИЦ.............................................................................................................................................................. 98
Е.А. Волуевич
ИСПОЛЬЗОВАНИЕ ГЕНОВ С ПЛЕЙОТРОПНЫМИ ЭФФЕКТАМИ ДЛЯ ПОВЫШЕНИЯ УСТОЙЧИВОСТИ
ПШЕНИЦЫ К ГРИБНЫМ ПАТОГЕНАМ..........................................................................................................................99
Е.В. Воронкова, В.И. Лукша, О.Н. Гукасян, А.В. Левый, А.П. Ермишин
НОВЫЙ ЛОКУС, АССОЦИИРОВАННЫЙ С УСТОЙЧИВОСТЬЮ К PVY У КАРТОФЕЛЯ, ЛОКАЛИЗОВАН
НА ХРОМОСОМЕ V ......................................................................................................................................................100
И.А. Гордей, О.М. Люсиков, И.С. Гордей, В.Е. Шимко
ПРОБЛЕМЫ И МЕТОДЫ ЦИТОГЕНОМИКИ ХЛЕБНЫХ ЗЛАКОВ..............................................................................101
И.С. Гордей
СТРУКТУРНО-ФУНКЦИОНАЛЬНЫЕ ИЗМЕНЕНИЯ ГЕНОМА РЖИ (SECALE CEREALE L.) ПРИ ЗИГОТИЧЕСКОЙ
ПОЛИПЛОИДИЗАЦИИ................................................................................................................................................................102

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Содержание 9

С.И. Гордей, Е.Н. Кулинкович
Создание новых форм яровой пшеницы с использованием внутривидовой, отдаленной
гибридизации, эмбриокультуры in vitro и экспериментального мутагенеза для селекции
на урожайность, болезнеустойчивость и качество продукции................................................................ 103
Т.Е. Денискова, А.В. Доцев, М.И. Селионова, Г. Брем, К. Виммерс, Х. Рейер, Е.А. Гладырь,
А.-М.М. Айбазов, Н.А. Зиновьева
ИЗУЧЕНИЕ ГЕНЕТИЧЕСКОГО РАЗНООБРАЗИЯ ПОРОД ОВЕЦ ДАГЕСТАНА НА ОСНОВЕ полногеномного
SNP-СКРИНИНГА........................................................................................................................................................................... 104
Т.В. Долматович, А.А. Булойчик, С.И. Гриб
Молекулярный анализ сортов мягкой яровой пшеницы на наличие генов устойчивости
к бурой ржавчине..........................................................................................................................................................105
Н.И. Дробот, Е.А. Сычева, Е.Б. Бондаревич, Л.А. Соловей, Н.И. Дубовец
АНАЛИЗ АЛЛЕЛЬНОГО СОСТОЯНИЯ ГЕНОВ ХОЗЯЙСТВЕННО-ЦЕННЫХ ПРИЗНАКОВ У РЕКОМБИНАНТНЫХ
ЛИНИЙ ТРИТИКАЛЕ..................................................................................................................................................................... 106
М. Дука, С. Клапко, О. Табэрэ, Л. Цапу
РАСПРОСТРАНЕНИЕ ЗАРАЗИХИ (OROBANCHE CUMANA WALLR.) НА ПОЛЯХ ПОДСОЛНЕЧНИКА
В РЕСПУБЛИКЕ МОЛДОВА..........................................................................................................................................107
Р.С. Ержебаева, А.М. Абекова, А. Васим
ПОЛУЧЕНИЕ ДИГАПЛОИДНЫХ ЛИНИЙ ПШЕНИЦЫ И ТРИТИКАЛЕ МЕТОДОМ КУЛЬТУРЫ ПЫЛЬНИКОВ.... 108
О.И. Зайцева, А.Т. Бабкенов, Е.К. Каиржанов, С.А. Бабкенова, В.А. Лемеш
АЛЛЕЛЬНОЕ РАЗНООБРАЗИЕ ГЕНОВ ВЫСОКОМОЛЕКУЛЯРНЫХ ГЛЮТЕНИНОВ У МЯГКОЙ ПШЕНИЦЫ....109
С.Т. Захидов, Н.М. Муджири, В.М. Рудой, О.В. Дементьева, И.А. Зеленина, Т.Л. Маршак
ПРЯМЫЕ И КОМБИНИРОВАННЫЕ ДЕЙСТВИЯ НАНОЧАСТИЦ ЗОЛОТА НА ГЕНЕТИЧЕСКИЕ СТРУКТУРЫ
МУЖСКИХ ПОЛОВЫХ КЛЕТОК МЫШЕЙ................................................................................................................... 110
С.И. Ивановская, В.Е. Падутов, Д.И. Каган
УРОВЕНЬ ГЕНЕТИЧЕСКОЙ ИЗМЕНЧИВОСТИ СОСНЫ ОБЫКНОВЕННОЙ В ДРЕВОСТОЯХ РАЗЛИЧНОГО
КЛАССА ВОЗРАСТА....................................................................................................................................................... 111
Д.И. Каган, В.Е. Падутов, В.М. Арнольбик, С.И. Ивановская, Т.С. Маркевич
ГЕНЕТИЧЕСКИЙ АНАЛИЗ ЛОКУСА MT15-D02 PICEA ABIES (L.) KARST. НА ТЕРРИТОРИИ НАЦИОНАЛЬНОГО
ПАРКА «БЕЛОВЕЖСКАЯ ПУЩА».............................................................................................................................................112
В.Н. Кипень, А.О. Рябцева, С.А. Котова, Н.В. Журина, А.И. Ганджа, И.С. Цыбовский
КЛАССИФИКАЦИЯ КОММЕРЧЕСКИХ ПОРОД ДОМАШНИХ СВИНЕЙ C УЧЕТОМ ПОЛИМОРФНЫХ
ВАРИАНТОВ В ГЕНЕ МЕЛАНОКОРТИНА MC1R........................................................................................................ 113
М.С. Кобозева, Р.Б. Ахмедов, В.В. Заякин, И.Я. Нам
ИНФОРМАТИВНОСТЬ МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКОГО АНАЛИЗА БИОТИПОВ ВОЗБУДИТЕЛЯ
АНТРАКНОЗА ЛЮПИНА............................................................................................................................................... 114
З.А. Козловская
ИСПОЛЬЗОВАНИЕ ВИДОВОГО РАЗНООБРАЗИЯ ГЕНЕТИЧЕСКИХ РЕСУРСОВ РАСТЕНИЙ В СОЗДАНИИ
СОРТОВ ПЛОДОВЫХ КУЛЬТУР................................................................................................................................... 115
Е.В.Колбанова
Определение устойчивости смородины чёрной к почковому клещу с использованием
молекулярного маркера гена Се...................................................................................................................... 116
Е.В. Колбанова
ОПТИМИЗАЦИЯ ДИАГНОСТИКИ ВИРУСА РЕВЕРСИИ СМОРОДИНЫ ЧЁРНОЙ (BLACKCURRANT REVERSION
VIRUS, BRV) ....................................................................................................................................................................................117
О.О. Коломиец, С.В. Глушен
ОЦЕНКА ПРОЛИФЕРАТИВНОЙ АКТИВНОСТИ КЛЕТОК МЕТОДОМ ДИНАМИЧЕСКОЙ ДНК-ЦИТОМЕТРИИ...... 118
О.Ю. Конева, Е.А. Ровба, А.М. Слуквин, Н.Б. Кульжанов
ПРИМЕНЕНИЕ МЕТОДОВ SSR-PCR В ИССЛЕДОВАНИЯХ У СТЕРЛЯДИ (ACIPENSER RUTHENUS L.) ............ 119

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
10 Содержание

В.Н. Кузнецова, А.И. Будевич


НЕКОТОРЫЕ ФАКТОРЫ, ВЛИЯЮЩИЕ НА ЭФФЕКТИВНОСТЬ ПОЛУЧЕНИЯ И СОХРАННОСТЬ ГЕННЫХ
КОНСТРУКЦИЙ..............................................................................................................................................................120
Т.И. Кузьмина, И.Я. Шахтамиров, Х.М. Мутиева
ВСВ-ДИАГНОСТИКА ООЦИТОВ ЖИВОТНЫХ В ТЕХНОЛОГИИ ЭКСТРАКОРПОРАЛЬНОГО СОЗРЕВАНИЯ
ЖЕНСКИХ ГАМЕТ . .......................................................................................................................................................121
Л.В. Кухарева, Б.Ю. Аношенко, С.В. Кубрак, Т.В. Гиль, В.В. Титок
Исходный материал полезных травянистых растений для селекции и внедрения
в практику зеленого строительства..............................................................................................................122
И.В. Лазебная, А.В. Перчун, Г.Е. Сулимова
ВНУТРИПОРОДНАЯ ИЗМЕНЧИВОСТЬ ГЕНА DGAT1 В СВЯЗИ С МОЛОЧНОЙ И МЯСНОЙ
ПРОДУКТИВНОСТЬЮ КРУПНОГО РОГАТОГО СКОТА КОСТРОМСКОЙ ПОРОДЫ................................................123
В.А. Лемеш, Г.В. Мозгова, Я.Э. Пилюк, С.А. Тронза, Е.С. Бык
ИДЕНТИФИКАЦИЯ ГЕНОВ УСТОЙЧИВОСТИ К LEPTOSPHAERIA MACULANS У БЕЛОРУССКИХ ФОРМ
РАПСА (BRASSICA NAPUS L.)......................................................................................................................................124
Л.Г. Лешина, О.В. Булко, П.А. Драгун, О.В. Молчан
ИССЛЕДОВАНИЕ ВЛИЯНИЯ ХЛОРИДНОГО ЗАСОЛЕНИЯ НА РАСТЕНИЯ И КУЛЬТУРЫ КЛЕТОК БАРВИНКА
МАЛОГО VINCA MINOR L....................................................................................................................................................125
Д.И. Литвин, В.Д. Федына, А.И. Емец, Я.Б. Блюм
РЕАЛИЗАЦИЯ СТРЕСС-ИНДУЦИРОВАННОЙ АУТОФАГИИ У РАСТЕНИЙ КАК ЗАВИСИМЫЙ
ОТ МИКРОТРУБОЧКОВОГО ЦИТОСКЕЛЕТА ПУТЬ...................................................................................................126
В.И. Лукша, О.Н. Свиточ, Е.В. Воронкова, О.Н. Гукасян, В.М. Жарич, А.П. Ермишин
ИСПОЛЬЗОВАНИЕ МИТОТИЧЕСКОГО УДВОЕНИЯ ХРОМОСОМ У ДИГАПЛОИДОВ ДЛЯ ПОЛУЧЕНИЯ
МУЛЬТИПЛЕКСНЫХ РОДИТЕЛЬСКИХ ЛИНИЙ КАРТОФЕЛЯ ..................................................................................127
С.В. Майсеня, И.Э. Рубель, О.Ю. Баранов
СКРИНИНГ СЕЛЕКЦИОННЫХ ОБРАЗЦОВ САХАРНОЙ СВЕКЛЫ ДЛЯ ВЫЯВЛЕНИЯ ПОТЕНЦИАЛЬНЫХ
ИСТОЧНИКОВ РЕЗИСТЕНТНОСТИ К РИЗОМАНИИ С ПОМОЩЬЮ ДНК-МАРКИРОВАНИЯ.................................128
Е.Н. Макеева
НАГОЙСКИЙ ПРОТОКОЛ КАК ПРАВОВОЙ МЕХАНИЗМ СОХРАНЕНИЯ И ВЗАИМОВЫГОДНОГО
ИСПОЛЬЗОВАНИЯ ГЕНЕТИЧЕСКИХ РЕСУРСОВ......................................................................................................129
О.А. Межнина, О.Ю. Урбанович
ОЦЕНКА ЭФФЕКТИВНОСТИ ОТДЕЛЬНЫХ SSR-МАРКЕРОВ ДЛЯ ИЗУЧЕНИЯ ГЕНЕТИЧЕСКОГО
РАЗНООБРАЗИЯ СМОРОДИНЫ ЧЕРНОЙ (RIBES NIGRUM)....................................................................................130
М.Е. Михайлова, А.И. Киреева, Е.Л. Романишко, Н.И. Тиханович, Н.А. Камыш
МОНОГЕННЫЕ НАСЛЕДСТВЕННЫЕ ЗАБОЛЕВАНИЯ, СНИЖАЮЩИЕ ЖИЗНЕСПОСОБНОСТЬ
И ПЛОДОВИТОСТЬ У СЕЛЬСКОХОЗЯЙСТВЕННЫХ ЖИВОТНЫХ ..........................................................................131
М.О. Моисеева, Т.В. Никонович, А.В. Кильчевский
корреляционный Анализ основных параметров адаптивной способности и
экологической стабильности по признакам урожайности гибридов перца сладкого.........132
Н.А. Невестенко, М.М. Добродькин, И.Г. Пугачева, Т.В. Никитинская, О.Г. Бабак, А.В. Кильчевский
Изучение перспективных линий ПЕРЦА СЛАДКОГО по ХОЗЯЙСТВЕННО ЦЕННЫм ПРИЗНАКам
в пленочных теплицах.........................................................................................................................................133
С.Н. Нековаль, А.В. Беляева, О.А. Маскаленко, Ю.А. Молчанова, С.А. Дешпет
ОЦЕНКА НОВЫХ МЕЖВИДОВЫХ ГИБРИДОВ ТОМАТА ДЛЯ ИСПОЛЬЗОВАНИЯ ИХ В СЕЛЕКЦИИ...................134
Т.В. Никитинская, К.К. Яцевич, Н.А. Некрашевич, С.В. Кубрак, О.Г. Бабак, А.В. Кильчевский
ГОМОЛОГИЯ МАРКИРУЕМЫХ ПОСЛЕДОВАТЕЛЬНОСТЕЙ ГЕНА Anthocyanin У ОВОЩНЫХ
ПАСЛЕНОВЫХ КУЛЬТУР..............................................................................................................................................135
И.П. Новгородова, Н.А. Зиновьева, В.И. Фисинин
ИСПОЛЬЗОВАНИЕ МИКРОСАТЕЛЛИТНЫХ МАРКЕРОВ В ПТИЦЕВОДСТВЕ.........................................................136
А.Ю. Носова, О.И. Зайцева, В.А. Лемеш
Видовая идентификация продукции лососёвых рыб.............................................................................137

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Содержание 11

Л.В. Обуховская, Т.Н. Куделина, О.В. Молчан


ВЛИЯНИЕ СПЕКТРАЛЬНОГО СОСТАВА СВЕТА НА ПРИЖИВАЕМОСТЬ, РОСТ И РАЗВИТИЕ
МИКРОКЛОНАЛЬНО РАЗМНОЖЕННЫХ РЕГЕНЕРАНТОВ BETULA PENDULA VAR. CARELICA (MERCL.)
ПРИ АДАПТАЦИИ EX VITRO........................................................................................................................................138
О.А. Орловская, И.Н. Леонова, С.И. Вакула, Л.В. Хотылева
ОЦЕНКА ПРОДУКТИВНОСТИ УСТОЙЧИВЫХ К ГРИБНЫМ БОЛЕЗНЯМ ЛИНИЙ ПШЕНИЦЫ T. AESTIVUM
С ГЕНЕТИЧЕСКИМ МАТЕРИАЛОМ T. TIMOPHEEVII.................................................................................................139
Т.В. Печковская, А.В. Якимович, А.В. Кильчевский
ДНК-СКРИНИНГ КАПУСТЫ БЕЛОКОЧАННОЙ (BRASSICA OLERACEA L. VAR. CAPITATA L. F. ALBA DC.) НА
наличие локусов УСТОЙЧИВОСТи К КИЛЕ.........................................................................................................140
Ф.И. Привалов, С.И. Гриб, И.С. Матыс
СОЗДАНИЕ И ЭФФЕКТИВНОСТЬ ИСПОЛЬЗОВАНИЯ ГЕНЕТИЧЕСКОГО ФОНДА РЕСУРСОВ РАСТЕНИЙ В
РЕСПУБЛИКЕ БЕЛАРУСЬ ...........................................................................................................................................141
С.В. Пыкало, А.В. Бавол, О.В. Дубровная
IRAP-АНАЛИЗ ПОЛИМОРФИЗМА ДНК УСТОЙЧИВЫХ К ВОДНОМУ ДЕФИЦИТУ РАСТЕНИЙ ТРИТИКАЛЕ........142
О.А. Разумова, Д.И. Каган, С.И. Ивановская, А.И. Сидор
УРОВЕНЬ ГЕНЕТИЧЕСКОГО РАЗНООБРАЗИЯ В ЛЕСОСЕМЕННЫХ ПЛАНТАЦИЯХ ДУБА ЧЕРЕШЧАТОГО
МОГИЛЕВСКОЙ ОБЛАСТИ...........................................................................................................................................143
А.О. Рябцева, В.Н.Кипень, С.А. Котова, Н.В. Журина, А.И. Ганджа, К. Рембала , И.С. Цыбовский
ЭКСПЕРИМЕНТАЛЬНАЯ ОЦЕНКА ЕСТЕСТВЕННОЙ ГИБРИДИЗАЦИИ ДИКОГО и Домашнего подвидов
Кабана европейского................................................................................................................................................... 144
Д.В. Савчин, О.Ю. Урбанович, И.В. Федосеева, Г.Б. Боровский
СОЗДАНИЕ ВЕКТОРНЫХ КОНСТРУКЦИЙ С ГЕНОМ NDB2 ARABIDOPSIS THALIANA ДЛЯ 
ТРАНСФОРМАЦИИ РАСТЕНИЙ...................................................................................................................................145
А.И. Сидор, А.И. Ковалевич, Н.С. Луферова
ХАРАКТЕРИСТИКА УСЛОВИЙ МЕСТОПРОИЗРАСТАНИЯ НАСАЖДЕНИЙ КАРЕЛЬСКОЙ БЕРЕЗЫ В ЛЕСАХ
БЕЛАРУСИ........................................................................................................................................................................ 146
О.Г. Силкова, Ю.Н. Иванова, Е.А. Кривошеина, Е.Б. Бондаревич, Л.А. Соловей, Н.И. Дубовец
ИНТРОГРЕССИЯ ХРОМОСОМЫ РЖИ 1R ВЫЗЫВАЕТ НЕСТАБИЛЬНОСТЬ ХРОМОСОМ В СУБГЕНОМАХ
ПШЕНИЦЫ.....................................................................................................................................................................147
И.С. Слука, М.М. Добродькин, И.Г. Пугачева, Н.А. Некрашевич, О.Г. Бабак, А.В. Кильчевский
ИЗУЧЕНИЕ ХОЗЯЙСТВЕННО ЦЕННЫХ ПРИЗНАКОВ ТОМАТА разновидности ЧЕРРИ (LYCOPERSICON
ESCULENTUM VAR. CERASIFORME) В ПЛЕНОЧНЫХ ТЕПЛИЦАХ..........................................................................148
Е.Н. Сысолятин, Н.В. Анисимова, О.Г. Бабак, А.В. Кильчевский
ГЕНОТИПИРОВАНИЕ УЗКОЛИСТНОГО ЛЮПИНА С ПОМОЩЬЮ SRAP-МАРКЕРОВ И ВЫРОЖДЕННЫХ
ПРАЙМЕРОВ..................................................................................................................................................................149
А.Н. Тарасюк, П.В. Самохина
ОЦЕНКА РЕКОМБИНОГЕННОЙ АКТИВНОСТИ СТЕРОИДНЫХ СОЕДИНЕНИЙ НА ДРОЗОФИЛЕ.......................150
А.А. Траспов, О.В.Костюнина, И.А. Домский, А.В. Экономов, Н.А. Зиновьева
ИЗУЧЕНИЕ генетической СТРУКТУРЫ ПОПУЛЯЦИИ КАБАНА, ОБИТАЮЩЕГО НА ЕВРОПЕЙСКОЙ
ТЕРРИТОРИИ РОССИЙСКОЙ ФЕДЕРАЦИИ..............................................................................................................151
А.М. Тургимбаева, М.К. Сапарбаев, Е.М. Раманкулов, Б.Б. Хасенов
ПОЛУЧЕНИЕ РЕКОМБИНАНТНОЙ XTH АП-ЭНДОНУКЛЕАЗЫ HELICOBACTER PYLORI.....................................152
Э.П. Урбан
ОСНОВНЫЕ РЕЗУЛЬТАТЫ СЕЛЕКЦИИ ОЗИМОЙ ТЕТРАПЛОИДНОЙ РЖИ В БЕЛАРУСИ...................................153
А.М. Федота, Н.Г. Лысенко, С.Ю. Рубан, А.И. Колесник, И.В. Горайчук
ИССЛЕДОВАНИЕ АССОЦИАЦИИ ПОЛИМОРФНЫХ ВАРИАНТОВ ГЕНОВ ГОРМОНА РОСТА И РЕЦЕПТОРОВ
ГОРМОНА РОСТА С КОЛИЧЕСТВЕННЫМИ ПРИЗНАКАМИ У ЖИВОТНЫХ АБЕРДИН-АНГУССКОЙ ПОРОДЫ.......154
M.Н. Шаптуренко
МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКАЯ ДИВЕРГЕНЦИЯ КАК КРИТЕРИЙ ОТБОРА В СЕЛЕКЦИИ РАСТЕНИЙ НА
ГЕТЕРОЗИС...................................................................................................................................................................156

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
12 Содержание

О.П. Шатарнов, Т.М. Шатарнова, Т.А. Силкова, Н.С. Фомченко, О.Г. Давыденко


ИЗУЧЕНИЕ ЛИНЕЙНОГО И ГИБРИДНОГО МАТЕРИАЛА ПОДСОЛНЕЧНИКА С ПОМОЩЬЮ
МОЛЕКУЛЯРНЫХ МАРКЕРОВ.....................................................................................................................................157
Я.И. Шейко, Ю.М. Рудый, С.В. Свенторжицкий, С.В. Кралько
ГЕНЕТИЧЕСКОЕ МАРКИРОВАНИЕ КОЛЛЕКЦИОННОГО ГЕНОФОНДА КАРПА ПО ЛОКУСУ ТРАНСФЕРРИНА.....158
В.Е. Шимко, И.А. Гордей, Е.Б. Бондаревич, О.М. Люсиков
ГЕНЕТИЧЕСКИЕ ОСОБЕННОСТИ САМОНЕСОВМЕСТИМОСТИ (S-ЛОКУС) ЦМС И САМОФЕРТИЛЬНОСТИ
У ОЗИМОЙ РЖИ (SECALE CEREALE L.)..................................................................................................................... 159
О.Ю. Юркевич, Т.Е. Саматадзе, С.А. Зощук, А.В. Амосова, М.А. Левинских, В.Н. Сычев, О.В. Муравенко
ОЦЕНКА ВЛИЯНИЯ УСЛОВИЙ МИКРОГРАВИТАЦИИ НА ГЕНОМ ГОРОХА PISUM SATIVUM, ВЫРАЩЕННОГО
НА БОРТУ МЕЖДУНАРОДНОЙ КОСМИЧЕСКОЙ СТАНЦИИ............................................................................................160
A.S. Axambayeva, Zh.S. Shagyrova, A.V. Shustov
SUCCESFUL PRODUCTION OF ADHESIVE PROTEIN FP-131 FOR NOVEL BIOMATERIALS IN A DUAL-VECTOR
BACTERIAL EXPRESSION SUSTEM.....................................................................................................................................161
O. V. Bilynska
IMPROVED BIOTECHNOLOGY FOR SPRING BARLEY (H. vulgare L.) HAPLOID PRODUCTION AND ITS
APPLICATION IN SPECIAL BREEDING PROGRAMS .................................................................................................162
V.A. Katsan, А.І. Potopalsky
IZATISON CONSTITUENTS DMSO AND PEG 400 CAN ALSO INFLUENCE ON THE PRODUCTIVITY
AND ADAPTABILITY OF THE OAT PLANTS..................................................................................................................163
Y.G. Kim, A.Zh. Baltabekova, Zh.S. Shagyrova, Ye. Zhiyenbay, A.V. Shustov
VIRAL RNA-BASED VECTOR PROVIDES HIGH-LEVEL PRODUCTION OF THE MODEL BIOPHARMACEUTICAL
PROTEIN (G-CSF) IN THE CULTURED MAMMALIAN CELLS...........................................................................................164
S.I. Mustyatsa, P.A. Borozan
CHANGES IN THE DEVELOPMENT OF INBRED LINES AND HYBRIDS IN MAIZE BREEDING PROGRAM
FROM MOLDOVA...........................................................................................................................................................165
G.V. Rusu, P.A. Borozan, S.I. Mustyatsa
IMPROVING SEED PRODUCTION OF EARLY HYBRIDS MAIZE................................................................................166
Y. Turuspekov, K. Yermekbayev, S. Griffiths, S. Abugalieva
QTL mapping of stress tolerance related traits in wheat based on use of SNP genotyping
Illumina arrays....................................................................................................................................................................167
M.M. Yakubova
UTILIZATION OF ORGANIC WASTE TO REDUCE THE LEVEL OF LAND DEGRADATION.......................................168
M.M. Yakubova, O.V. Usmanova, T.P. Usmanov, B.A. Solihzod
MUTUAL INFLUENCE OF ECOLOGY, GENOTYPE AND COENOSIS ON COMPETITIVENESS OF A.thaliana
IN MODEL POPULATIONS.............................................................................................................................................169

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 1
Молекулярная генетика, геномика
и биоинформатика
14 Секция 1. Молекулярная генетика, геномика и биоинформатика

С.И. Абугалиева, Е.К. Туруспеков

ДНК-баркодирование редких и эндемичных видов растений


Казахстана

Институт биологии и биотехнологии растений


Республика Казахстан,050040, г. Алматы, ул. Тимирязева, 45
e-mail: absaule@yahoo.com

В Казахстане, являющемся девятой по территории страной мира, произрастает более 6 ты-


сяч видов растений. Согласно «Флоре Казахстана», составленной в начале второй половины
прошлого столетия, на территории Казахстана каждый восьмой вид высших растений был опи-
сан как эндемик, т.е. вид, произрастающий только в одном определенном районе мира. Так, в
качестве эндемичных здесь было описано около половины родов семейства Chenopodiaceae,
около трети – семейства Brassicaceae, четверти Asteraceae, каждый пятый род Apiaceae, Bor-
aginaceae, Lamiaceae. Большое разнообразие эндемичных, редких и исчезающих видов рас-
тений сосредоточено, сохраняется и изучается в особо охраняемых природных территориях
Республики Казахстан (ООПТ). В настоящее время система особо охраняемых природных
территорий Республики Казахстан насчитывает 10 государственных природных заповедников
(ГПЗ), 12 государственных национальных природных парков (ГНПП), 5 государственных при-
родных резерватов, 5 государственных ботанических садов, 5 государственных заповедных
зон, 50 государственных природных заказников, 26 государственных памятников природы,
3 государственных региональных природных парка.
Вопросы сбора и изучения генетических ресурсов растений на ботаническом уровне успеш-
но решаются в Институте ботаники и фитоинтродукции (г. Алматы), Алтайском ботаническом
саду (БС), Мангышлакском Экспериментальном БС, Восточно-Казахстанском государствен-
ном университете им. С. Аманжолова, Карагандинском ГУ, заповедниках и парках и других.
В 2015 году в Институте биологии и биотехнологии растений КН МОН РК была иниции-
рована научно-техническая Программа «Изучение генетического разнообразия и сохранение
генетических ресурсов эндемичных, редких и хозяйственно ценных видов растений в Респу-
блике Казахстан», рассчитанная на 2015–2017 годы. Данная программа направлена на изучение
генетического разнообразия эндемичных, редких, исчезающих и дикорастущих ценных видов
растений, собранных в 9 ГПЗ и 6 ГНПП страны, с использованием ДНК-маркеров ядерного и
хлоропластного геномов. К настоящему времени, в сотрудничестве с ботаническими учреж-
дениями Казахстана и ООПТ, собрано около 400 популяций 277 видов растений. Каждая по-
пуляция представлена, по крайней мере, растительным материалом 20 растений, собранным
с использованием соответствующего подхода, без нанесения ущерба природе. Зафиксирована
соответствующая информация: ботаническое описание, паспорт вида, место сбора, данные
GPS. Образцы исходной ДНК, выделенные из собранных растений, заложены в низкотемпе-
ратурный морозильник (-80 °C). К настоящему времени все 400 популяций проанализированы
с использованием matK, наиболее универсальным ДНК-маркером хлоропластного генома. Ре-
зультаты работы будут использованы для уточнения систематики флоры Казахстана и изучения
филогенеза редких и эндемичных видов растений.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 1. Молекулярная генетика, геномика и биоинформатика 15

О.Ю. Баранов

ИСПОЛЬЗОВАНИЕ ДАННЫХ ВЫСОКОПРОИЗВОДИТЕЛЬНОГО


СЕКВЕНИРОВАНИЯ ДЛЯ ОЦЕНКИ ГЕНЕТИКО-ТАКСОНОМИЧЕСКИХ
ВЗАИМООТНОШЕНИЙ МИКРОМИЦЕТОВ

Институт леса НАН Беларуси


Республика Беларусь, 246001, г. Гомель, ул. Пролетарская, 71
e-mail: betula-belarus@mail.ru

В ходе сравнительного анализа нуклеотидной последовательности секвенированной на-


ми молекулы мтДНК Phoma sp.1 с геномами митохондрий других микромицетов был рассчи-
тан уровень генетической дифференциации и построена дендрограмма, иллюстрирующая
генетико-таксономические взаимоотношения между изученными видами. Нуклеотидные по-
следовательности мтДНК аскомицетных грибов (Beauveria bassiana, Beauveria pseudobassiana,
Cordyceps millitaris, Madurella mycetomatis, Talaromyces marneffei, Aspergillus nidulans, Candida
norvegica) были взяты из GeneBank NCBI. Рассчитанный уровень генетической дифференциа-
ции зачастую являлся некорректным – для большинства классов различия превысили 100%.
Уровень дифференциации для близкородственных видов (Beauveria bassiana и Beauveria pseu-
dobassiana) превысил 0,1, близкородственных родов (Beauveria и Cordyceps) – 0,25. Кроме того,
на дендрограмме род Madurella (класс Sordariomycetes) образовал общий кластер с Candida
(класс Saccharomycetes), отделившись от родов Beauveria-Cordyceps (класс Sordariomycetes).
При этом род Phoma (класс Dothideomycetes) образовал общий кластер с Beauveria-Cordyceps
(класс Sordariomycetes). Представители класса Eurotiomycetes (Talaromyces и Aspergillus) об-
разовали единый кластер с уровнем межвидовых различий 0,34, который присоединился к
кластеру Beauveria-Cordyceps-Phoma.
При анализе локусов мтДНК по отдельности уровень различий между видами был суще-
ственно ниже. При использовании совокупной группы отдельных локусов, имеющих равную
или отличающуюся скорость филогенетических изменений, уровень межвидовой дифферен-
циации представлял собой усредненную величину и также не зависел от размеров анализи-
руемых регионов.
Сходные результаты были получены при анализе мтДНК двух видов микромицетов поряд-
ка Pleosporales – Phaeosphaeria nodorum и Phoma sp1. Размер геномов данных видов составил
49 761 п.н. для Phaeosphaeria nodorum и 31 916 п.н. – для Phoma sp1. Уровень межвидовых раз-
личий при прямом сопоставлении нуклеотидных последовательностей мтДНК превысил 0,6.
Детальный анализ структурно-функциональной организации митохондриальных геномов пока-
зал, что основным фактором определяющим высокий уровень межвидовых различий являлась
не собственная вариабельность генов, а различия в последовательности расположения генов
и межгенных спейсеров в молекуле мтДНК. Так, например, одной из особенностей структуры
сравниваемых мтДНК Phaeosphaeria nodorum и Phoma sp1. и определяющих различия в их
размере является отсутствие у Phoma sp1. трех генов, кодирующих ORF-белки, относящихся
к ретротранспозонам семейства LINE. Несмотря на это, оба вида, в целом, характеризовались
сходным набором структурных генов, кодирующих ферменты, рибосомальные и транспорт-
ные РНК, последовательность расположения генов, детерминирующих ферменты дыхатель-
ной цепи, была различной.
Таким образом, на основании полученных данных видно, что одним из ведущих факторов
на надгенном уровне, определяющем межвидовые различия, кроме варьирования нуклеотидной
структуры локусов, является их структурная организация (порядок расположения) в геноме.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
16 Секция 1. Молекулярная генетика, геномика и биоинформатика

Е.Г. Веремеенко, И.А. Кашкан, Е.В. Новосадова, Н.П. Максимова

СТРУКТУРНО-ФУНКЦИОНАЛЬНАЯ ХАРАКТЕРИСТИКА rpeA-ГЕНА БАКТЕРИЙ


PSEUDOMONAS CHLORORAPHIS SSP. AURANTIACA

Белорусский государственный университет


Республика Беларусь, 220030, г. Минск, пр. Независимости, 4
e-mail: veremeenkoKatya@yandex.ru

Продукция феназинов бактериями осуществляется только при их культивировании на


полноценных питательных средах, что при промышленном производстве значительно услож-
няет их последующее выделение и очистку от примесей. Актуальным является получение
штаммов-продуцентов феназиновых антибиотиков, способных к их синтезу на минеральных
средах простого состава. Известным геном, продукт которого принимает участие в контроле
синтеза феназинов на минеральных средах, является rpeA, кодирующий гистидиновую сенсор-
ную киназу. Ранее нами впервые с помощью НГ-мутагенеза был получен штамм P. chlororaphis
ssp. aurantica В-162/17, способный к синтезу феназинов на минимальной среде М9, однако
природа мутации, приводящей к приобретению такой способности, остается неизвестной.
Было сделано предположение, что продукция феназинов на минимальной среде мутантным
штаммом В-162/17 обусловлена мутацией в rpeA-гена, приводящей к его инактивации, и сня-
тию блока синтеза феназинов в этих условиях. Для проверки данной гипотезы ПЦР-продукты
rpeA-генов штамма дикого типа (В-162) и мутантного штамма (В-162/17) были клонированы в
составе pTZ57R/T-вектора и подвергнуты секвенциальному анализу. С помощью программы
MEGA 6.0.6 было проведено выравнивание нуклеотидных последовательностей, в результате
чего у бактерий штамма B-162/17 были выявлены нуклеотидные замены в положениях 156,
541 и 1297. На основании полученных данных для обоих штаммов с помощью ресурса Snap-
Gene 3.1.2 была определена первичная структура соответствующих белков. Сравнение дан-
ных последовательностей с помощью программы MEGA 6.0.6 выявило наличие единственной
аминокислотной замены в положении 181 (произошла замена глицина на серин). Другие ну-
клеотидные замены, в силу вырожденности генетического кода, не привели к изменению пер-
вичной структуры белка. В онлайн-программе Uniprot (http://www.uniprot.org) данная замена
расценивается как значимая, т.к. аминокислота одной группы меняется на аминокислоту другой
группы, отличную по свойствам от исходной, что потенциально может сказаться на изменении
свойств белка. С помощью онлайн-программы SwissModel (http://swissmodel.expasy.org) была
построена 3D-структура гистидинкиназы RpeA-штаммов B-162 и B-162/17. Согласно данным
этой программы, 3D-структуры белков обоих штаммов идентичны. На следующем этапе ра-
боты было необходимо выяснить, в каком из доменов белка произошла замена. Для этого с
помощью сервиса NSBI по поиску консервативных доменов (www.ncbi.nlm.nih.gov/Structure/
cdd/wrpsb.cgi) была проанализирована доменная структура RpeA-белка. В результате у него
было обнаружено четыре консервативных домена: АТФазный домен (HATPase_c), фосфоак-
цепторный (HisKA), гистидинкиназный (HAMP) и домен, обеспечивающий взаимодействие
с белком-эффектором (PRK10604). Замена аминокислоты произошла в гистидинкиназном до-
мене с координатами 163-207. Поскольку данная замена не затрагивает реакционный центр
фермента, можно думать, что она не повлекла за собой изменения свойств белка. Таким об-
разом, способность штамма В-162/17 к синтезу феназиновых антибиотиков на минеральных
средах может быть обусловлена мутациями в иных генах, кодирующих другие компоненты
этого же сигнального пути (например, rpeB), либо наличием дополнительных сигнальных ка-
скадов, не зависимых от rpeA/rpeB-системы.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 1. Молекулярная генетика, геномика и биоинформатика 17

Е.Г. Веремеенко, Ю.А. Шилова, Н.П. Максимова

ИНСЕРЦИОННЫЙ МУТАГЕНЕЗ psrA-ГЕНА У БАКТЕРИЙ P. CHLORORAPHIS


SSP. AURANTIACA B-162

Белорусский государственный университет


Республика Беларусь, 220030, г. Минск, пр. Независимости, 4
e-mail: veremeenkoKatya@yandex.ru

Продукт psrA-гена является транскрипционным фактором, относящимся к TetR-семейству


регуляторов транскрипции. У бактерий Pseudomonas этот белок задействован в глобальной
регуляции вторичного метаболизма, в том числе синтезе феназиновых соединений, которые
в настоящее время вызывают все больший интерес не только как альтернатива многим из-
вестным антибиотикам, к которым патогенные микроорганизмы проявляют устойчивость, но
и в плане их использования в качестве средств, обладающих противоопухолевым действием.
Конкретная регуляторная роль PsrA-белка в процессе синтеза феназинов еще не установлена,
а имеющиеся в этом отношении экспериментальные данные носят противоречивый характер.
Например, для одного и того же штамма, Pseudomonas chlororaphis PCL1391, различными ав-
торами были продемонстрированы противоположные эффекты (как повышение уровня синте-
за феназинов, так и его понижение), однако механизм этого явления не изучался. Выяснение
роли PsrA-белка в контроле продукции феназинов имеет не только важное фундаментальное
значение, но и практическое – для разработки новых подходов создания сверхпродуцентов
данных соединений.
Одним из перспективных подходов выяснения функции гена является его направленная
инактивация с последующим анализом патерной экспрессии. Удобным инструментом для этих
целей является суицидальный интегративный вектор pK18mob. Фрагмент, размером 230 п.о.,
соответствующий средней части psrA-гена бактерий P. chlororaphis ssp. aurantiaca B-162, был
клонирован в составе этого вектора для создания области гомологии с одноименным геном
бактериальной хромосомы, что обеспечивало дальнейшую интеграцию полученной генно-
инженерной конструкции в нужную область генома. Затем вектор pK18mob::230psrA (4770 п.о.)
был трансформирован в клетки мобилизующего штамма E. coli BW19851. При переносе век-
тора с помощью конъюгации в клетки штамма B-162 было отобрано 59 трансконъюгантов.
По характеру продукции феназинов полученные клоны были разделены на три группы: 1 –
сохранившие исходный уровень; 2 – с пониженным уровнем, вплоть до его полного отсут-
ствия; 3 – с повышенной от 2 до 4 раз продукцией феназинов. Для определения места вставки
генно-инженерной конструкции в хромосому штамма В-162 был проведен ПЦР-анализ с ис-
пользованием в качестве матрицы тотальной ДНК бактерий дикого типа (контроль) и полу-
ченных трансконъюгантов с разным уровнем экспрессии psrA-гена. У бактерий дикого типа
был обнаружен фрагмент 750 п.о., что соответствует полноразмерному psrA-гену, а для всех
рекомбинантов – фрагмент размером в 4770 п.о., который соответствовал исходному psrA-
гену, плюс плазмида pK18mob::230psrA, что говорило о наличии вставки в область psrA-гена.
Наблюдаемые различия в продукции феназинов у трансконьюгантов могут быть связаны с
тем, что вставка генно-инженерной конструкции происходила в различные участки psrA-гена
в пределах области гомологии в 230 п.о., что по-разному отразилось на структуре и функцио-
нальной активности синтезируемого продукта (регуляторного PrA-белка). Вполне возможно,
что различная локализация вставки в составе psrA-гена обеспечила вариации в конформацион-
ной структуре самого PsrA-белка и, соответственно, его активности. Для окончательной рас-
шифровки наблюдаемых эффектов требуется проведение секвенционного аналиаза, который
позволит идентифицировать область инсерции.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
18 Секция 1. Молекулярная генетика, геномика и биоинформатика

М.М. Воробьева, Д.И. Лавриеня, Н.В. Воронова, С.В. Буга

ГЕНЕТИЧЕСКАЯ ВАРИАБЕЛЬНОСТЬ У ТЛЕЙ: СВЯЗЬ ГОСТАЛЬНОЙ


ПЛАСТИЧНОСТИ И ИЗМЕНЧИВОСТИ НАИБОЛЕЕ КОНСЕРВАТИВНЫХ
УЧАСТКОВ МИТОХОНДРИАЛЬНОГО ГЕНОМА

Белорусский государственный университет


Республика Беларусь, 220030, г. Минск, пр. Независимости, 4
e-mail: masch.89@mail.ru

Большинство рецентных видов тлей в процессе эволюции сформировали способность к пи-


танию на конкретном, чаще узком спектре кормовых растений. Только около двух десятков
эволюционно молодых видов являются истинными генералистами и способны размножаться
на сотнях, а иногда тысячах видов растений из филогенетически удаленных семейств, карди-
нально различающихся составом вторичных метаболитов. Эти виды ныне, как правило, кос-
мополиты и зачастую гостально связаны с разными растениями на территориях со значитель-
но различающимся климатом, однако везде они успешно осваивают ресурсы, демонстрируя
предельно высокий биотический потенциал.
Как известно, высокий уровень генетической вариабельности лежит в основе способности
вида адаптироваться к меняющимся условиям среды. В соответствии с этим положением, тли
с широким спектром кормовых растений должны обладать более высоким уровнем генетиче-
ской вариабельности, чем узкие специалисты, поскольку, обитая на разных растениях-хозяевах,
они подвергаются действию разнонаправленного естественного отбора.
В рамках настоящего исследования мы провели сравнительный анализ генетической из-
менчивости тлей с широким и узким спектрами кормовых растений, используя последователь-
ности митохондриального гена субъединицы I цитохромоксидазы с (COI), который известен
высокой консервативностью и функционально не связан с питанием или метаболизмом ком-
понентов пищи. Общая выборка составила 1171 последовательностей COI видов c относи-
тельно широким (Aphis fabae Scop., Aphis gossypii Glov., Myzus persicae Šulz., Aphis craccivora
Koch), относительно узким (Aphis pomi Deg., Myzus cerasi F.) и узким (Aphis ruborum Börn.,
Aphis nerii B.d.F.) спектрами кормовых растений. Оценивали число (h) и дивергенцию (Нd)
гаплотипов, внутривидовые генетические дистанции (GD), среднее число нуклеотидных раз-
личий (k) и нуклеотидное разнообразие (Pi). В результате у тлей с узким спектром кормовых
растений выявлено больше гаплотипов (до 19 гаплотипов на 100 нуклеотидных последова-
тельностей), чем у видов с широкими спектрами кормовых растений (до 12 гаплотипов). При
оценке дивергенции между гаплотипами оказалось, что значение Hd колебалось в интервале от
0,3% до 0,8% и было выше у видов-специалистов. Средние значения генетических дистанций
у тлей-специалистов варьировали от 0,001 до 0,007, в то время как у генералистов – от 0,001
до 0,002. Среднее число нуклеотидных различий у видов с узкими спектрами кормовых рас-
тений оказалось несколько выше и составило 3%, в то время как у тлей с широкими спектрами
не превышало 1%. Более высокий уровень нуклеотидного разнообразия был так же отмечен
у видов-специалистов (0,005), в то время как у генералистов значение Pi было значительно ни-
же (0,001). Таким образом, несмотря на общепринятые представления о более высоком уровне
генетического разнообразия у видов, демонстрирующих высокую способность к адаптациям
и расширению ареалов, у тлей наблюдается обратная тенденция. Виды-генералисты с макси-
мально широким спектром кормовых растений демонстрируют заметно меньший уровень ге-
нетической изменчивости, чем виды-специалисты.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 1. Молекулярная генетика, геномика и биоинформатика 19

Н.В. Воронова, Ю.В. Бондаренко, М.М. Воробьева, П.Ю. Кветко, А.В. Кривая

МАТЕМАТИЧЕСКОЕ МОДЕЛИРОВАНИЕ СКОРОСТИ НАКОПЛЕНИЯ


НУКЛЕОТИДНЫХ ЗАМЕН В ЭВОЛЮЦИОННО КОНСЕРВАТИВНЫХ ГЕНАХ

Белорусский государственный университет


Республика Беларусь, 220030, г. Минск, пр. Независимости, 4
e-mail: nvoronova@bsu.by

Одним из наиболее сложных вопросов эволюционной генетики является оценка скорости


изменений конкретных генов в ситуации, когда этот процесс нельзя проследить эксперимен-
тально. Известно, что число и характер нуклеотидных замен, произошедших в дивергировав-
ших геномных последовательностях за одно и то же эволюционное время, могут существен-
но отличаться, причем эти различия могут как коррелировать со скоростью появления новых
признаков, так и нет, а закономерности этих процессов до сих пор не известны.
Для моделирования in silico процессов накопления однонуклеотидных замен в генах COI,
COII, cytb и EF1a у животных были использованы 10 522 уникальные последовательности
2636 видов животных из подотряда Sternorrhyncha: некоторые из них (78) были расшифрованы
в процессе исследования, остальные получены из GenBank и BOLD. Все сравнения и расче-
ты проводили для строго совпадающих участков генов: последовательности выравнивали по
референсу с использованием алгоритма Muscle c назначенным пенальти за вставку пробелов.
Генетические дистанции рассчитывали методом максимального правдоподобия композитной
последовательности (MCL) в программе MEGA7; статистический анализ провели в програм-
мах STATISTICA (непараметрический метод множественного сравнения средних) и MATLAB.
В международных базах нуклеотидных последовательностей подотряд Sternorrhyncha со-
ставляет в среднем 10% от общего числа описанных видов. Парные генетические дистанции
были рассчитаны для каждого надсемейства отдельно с использованием всех депонированных
последовательностей этих видов по состоянию на март 2016 г. Оценка нормальности распре-
деления парных генетических дистанций была проведена независимо, и процесс накопления
генетических дистанций в таксоне был описан как процесс Орштайна-Уленбека:
dX ( t ) = a (θ - X ( t ))dt + σ dBt
,
GD min
где a≡0, dBt – независимое нормальное распределение с N (0, dt), σ – генетическая дистанция
σ≈
между двумя ближайшими узлами на филогенетическом
2
dX ( t ) = a (θ - X ( t ))dt + σ dBПри этом можно принять, что:
дереве.
t
2 ( N -1)σ
〈υ 〉 ~ GD min
dXσT≈( t ) = a(θ - X ( t ))dt + σ dB
2 t
〈υi 〉 σ i ( Ni -1)T j
= t GD min
X σ( t ))описываться
((θN-будет
= 2a-1) -1)
В этих условиях скорость накопления
〈υ j 〉 dXσσ〈υ (j≈замен
(〉)N~ j 2 Ti
dt + σ dBt как процесс Винера:
T
GD min
σ 〈≈υ〈υ〉i ~〉 2 (σNi -1) ( Nσi -1)
, Tj
2=
〈υ j2〉 ( Nσ-1) T
j (σN j -1)Ti
〈〉υ~i 〉 σ i ( Ni -1)T j возраст таксона. Тогда:  
где N – число описанных видов, T –〈υэволюционный = T
〈υ j 〉 σ j ( N j -1)Ti
〈υi 〉 σ i ( Ni -1)T j
=
〈υ j 〉 σ j ( N j -1)Ti
Тестирование модели на данных об изменчивости генов насекомых подотряда Sternorrhyncha
показало, что расчетные значения в разных таксонах варьируют и хорошо соотносятся с ре-
зультатами, полученными другими методами. Использование предлагаемой модели позволяет
оценить скорость накопления нуклеотидных замен с использованием ограниченных выборок
как эволюционный процесс, происходящий на уровне таксонов.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
20 Секция 1. Молекулярная генетика, геномика и биоинформатика

Н.В. Воронова1, Ю.М. Борисов2

МОЛЕКУЛЯРНАЯ ДИАГНОСТИКА ШИРОКОЙ ГИБРИДНОЙ ЗОНЫ ЮЖНЫХ


И СЕВЕРНЫХ ФОРМ МЫШЕЙ SYLVAEMUS FLAVICOLLIS
НА ТЕРРИТОРИИ БЕЛАРУСИ

Белорусский государственный университет


1

Республика Беларусь, 220030, г. Минск, пр. Независимости, 4


2
Институт проблем экологии и эволюции им. А.Н. Северцова РАН
Россия, 119071, г. Москва, Ленинский пр. 33
e-mail: nvoronova@bsu.by

Выяснение путей формирования фауны Беларуси – одна из ключевых проблем зоогеогра-


фии, а в последнее время нового направления – филогеографии, основывающейся на исполь-
зовании молекулярных маркеров для выяснения ареалов и связей генетически дифференци-
рованных популяций.
Строгая генетическая разобщённость южных и северных внутривидовых форм S. flavicollis
и их парапатрия указывают на то, что они заселяли территорию Восточной Европы в голоцене
из разных рефугиумов и независимо друг от друга.
Предполагается, что существующая ныне северная форма – результат послеледниковой
реколонизации и быстрой экспансии вида с юго-запада Европы через почти всю западную
Палеарктику, тогда как южная форма – результат более медленного, возможно, ограниченного
Альпами и Карпатами, восстановления ареала из Итало-Балканского центра на северо-восток.
История формирования современных ареалов южных и северных форм этих мышей связана
с восстановлением лесных биоценозов и их расселением из различных рефугиумов (Michaux
et al., 2005).
Для изучения генетической неоднородности популяций S. flavicollis на территории Беларуси
провели сравнительный анализ нуклеотидной последовательности 5'-области гена субъединицы
I цитохромоксидазы с (COI); длина сравниваемой области – 617 п.н. Всего было исследовано
17 мышей, отловленных в Украине (окр. г. Киев) и на юге Беларуси, а также в центральной
Беларуси (окр. г. Березино). У исследованных образцов было обнаружено 8 гаплотипов COI
(9 полиморфных сайтов) с дивергенцией (Hd), равной 0,73%. На филогенетических деревьях,
вне зависимости от выбранного метода построения, последовательности разделялись на два
кластера с высоким уровнем статистической значимости топологии ветвей (97%). При этом
все образцы, обозначенные как северные, вошли в один кластер, в то время как южные равно-
мерно распределились в обеих группах, не сформировав общего узла на филогенетическом
древе. Эти данные хорошо соответствуют широко принятым представлениям о существовании
на территории Беларуси гибридной зоны между южными и северными формами желтогорлой
мыши. Однако, тот факт, что образцы, относимые к южным популяциям, не образовали на фи-
логенетическом дереве сколько-нибудь обособленной группы, может указывать на существо-
вание на территории Беларуси значительно более широкой гибридной зоны между южными
и северными популяциями S. flavicollis, чем это предполагалось ранее.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 1. Молекулярная генетика, геномика и биоинформатика 21

Д.В. Галиновский, Т.А. Подвицкий, Н.В. Анисимова, Л.В. Хотылева, А.В. Кильчевский

АНАЛИЗ ЭКСПРЕССИИ ГЕНОВ БИОГЕНЕЗА КЛЕТОЧНОЙ СТЕНКИ ВОЛОКОН


ЛЬНА С ПРИВЛЕЧЕНИЕМ ДАННЫХ КОЛИЧЕСТВЕННОЙ ПЦР
И РНК-СЕКВЕНИРОВАНИЯ

Институт генетики и цитологии НАН Беларуси


Беларусь, 220072, г. Минск, ул. Академическая, 27
e-mail: D.Galinousky@igc.by

Льноволокно является важным сырьем как для инновационной, так и для традиционной
индустрии. Ценные селекционные сорта льна, продуцирующие высококачественное волокно,
были получены благодаря длительной селекции данной культуры. Льноволокно относят к лу-
бяному волокну, которое формируется за счет гипертрофии клеточной стенки клеток данной
ткани. Биоинженерное улучшение льноволокна сдерживается недостатком фундаментальных
знаний о биогенезе волокон льна. Исследования профиля экспрессии генов, ассоциированных
с биогенезом клеточной стенки у различных подвидов льна, позволят идентифицировать ге-
ны, ответственные за качество льноволокна. Цель данной работы – оценка экспрессии генов,
включенных в биогенез волокон льна (CesA- и Csl-генов), методами количественной ПЦР и
РНК-секвенирования.
Методами биоинформационного анализа в геноме льна обнаружены 38 последователь-
ностей генов, которые имеют домен Pfam 03552 (кодируют CesA или Csl-гены). В результате
филогенетического анализа данные гены были отнесены к группам CesA, CslD, CslB, CslE,
CslG. Для детекции Csl-генов льна методом ПЦР созданы праймеры (по одной паре для CslB
и CslE, две – для генов CslG и семь – для CslD). Уровень экспрессии CesA- и Csl-генов оцени-
вали в количественной ПЦР.
Оценку экспрессии CesA- и Csl-генов проводили на стадии быстрого роста в стебле льна-
долгунца (subsp. elongatum Vav. et Ell., сорт Блакіт) и льна-прыгунца (subsp. crepitans Boenn.,
ландраса Dehiscent.). Наибольшим уровнем экспрессии среди CesA-генов обладали гены, ас-
социированные с вторичной клеточной стенкой (CesA4 и CesA7). Cреди Csl наибольшим уров-
нем обладали CslD-гены из подгруппы, обозначенной нами D2D3, они экспрессировались на
уровне CesA-генов вторичной клеточной стенки. Гены CslG экспрессировались в 2,2–4,9 раз,
а гены CslE в 16,9–37,5 раз слабее CesA-генов. Между образцами льна различных подвидов
статистически значимые различия были обнаружены в экспрессии генов CslD1 (Lus10000755,
Lus10011736) и CslG4 (Lus10023057, Lus10032415, Lus10032416, Lus10023056).
Для анализа данных РНК-секвенирования использовали проект PRJNA251268, который
содержал профили экспрессии флоэмы и ксилемы стебля масличного льна сорта Bethune. Был
использован инструмент псевдо-выравнивания «kallisto» и R-пакет Sleuth для вычисления
значения TPM для всех указанных выше генов, а также для нормализации результатов и DE-
анализа. По данным РНК-секвенирования, уровень экспрессии CesA-генов, отвечающих за
синтез первичной клеточной стенки, примерно одинаковый в ксилеме и флоэме, а экспрессия
CesA-генов вторичной клеточной стенки в 7–8 раз выше в ксилеме. Многие Csl-гены, по дан-
ным РНК-секвенирования, не экспрессируются или экспрессируются слабо как в ксилеме, так
и во флоэме, в общем пуле Csl-генов доминируют CslD-гены. Гены CslB и CslG демонстриро-
вали более высокий уровень экспрессии во флоэме по сравнению с ксилемой.
Работа выполнена при поддержке НАН Беларуси – договор Б15УК/А-041 и БРФФИ до-
говор – Б15-147 и Б15М-101.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
22 Секция 1. Молекулярная генетика, геномика и биоинформатика

М.В. Глазков

ХРОМОСОМНЫЕ И ИСКУССТВЕННЫЕ (ТРАНСГЕННЫЕ) ДОМЕНЫ


ГЕНОВ ЭУКАРИОТ

Институт биологии развития им. Н.К. Кольцова РАН


Росссия, 119334, г. Москва, ул. Вавилова, 26
e-mail: mvglazkov@yandex.ru

Трансгеноз используется при решении как фундаментальных, так и прикладных задач.


Одним из центральных этапов трансгеноза является создание определенного дизайна гене-
тической конструкции, вводимой в реципиентную клетку или организм. Структура трансгена
во многом определяет как уровень экспрессии переносимой генетической конструкции, так
и ее стабильность в ряду клеточных поколений, ее биологическую безопасность. Оптимальной
структурой трансгена была бы конструкция искусственного хромосомного домена, воспроизво-
дящего нативный хромосомный домен. В этом случае можно ожидать стабильную и высокую
экспрессию трансгена вне зависимости от сайтов его интеграции в «хозяйские» хромосомы.
Мы сравнили факторы, участвующие в формировании хромосомного домена генов тепло-
вого шока (hsp 70Aa и hsp 70Ab) локуса 87А7 Drosophila melanogaster, методами биоинфор-
матики и факторы, участвующие в формировании искусственного хромосомного домена, со-
держащего гены yellow и white D. melanogaster, методом трансгеноза.
Полученные результаты свидетельствуют о том, что в формировании хромосомного до-
мена независимой экспрессии генов теплового шока могут принимать участие 3 элемента:
1) участки связывания интерфазных хромосом с ядерной оболочкой; 2) короткие «комплемен-
тарные» треки полипуринов/полипиримидинов; 3) scs/scs’-нсуляторы, а также их белкиZw5 и
BEAF32. В формировании искусственного хромосомного домена трансгенов (yellow и white)
принимают участие 2 элемента: 1) участки связывания интерфазных хромосом с ядерной обо-
лочкой; 2) инсулятор (Wari).
Обсуждается вопрос о доменной организации эукариотических хромосом и использовании
этих данных для нужд медицины и сельского хозяйства.
Работа выполнена при финансовой поддержке программы фундаментальных исследований
Президиума РАН «Биоразнообразие природных систем», подпрограмма «Генофонды живой
природы и их сохранение».

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 1. Молекулярная генетика, геномика и биоинформатика 23

Н.О. Дашенкова, А.С. Микаелян

ИССЛЕДОВАНИЕ КЛОНАЛЬНЫХ КЛЕТОЧНЫХ КУЛЬТУР, ВЫДЕЛЕННЫХ


ИЗ ОПУХОЛЕВОЙ ТКАНИ ГЦК МЫШИ, НА МАРКЕРЫ
ЭПИТЕЛИО-МЕЗЕНХИМНОГО ПЕРЕХОДА

Институт биологии развития им. Н.К. Кольцова РАН


Россия, 119334, г. Москва, ул. Вавилова, 26
e-mail: n.goncharova@idbras.ru, a.mikaelyan@idbras.ru

Со́лидные опухоли, в том числе гепатоцеллюлярная карцинома (ГЦК), обладают выражен-


ной гетерогенностью и могут состоять из нескольких клональных субпопуляций раковых кле-
ток, обладающих различными потенциями к метастазированию, скоростью роста, экспрессией
маркеров и т.п. Опухолевые клетки ГЦК имеют эпителиальное происхождение и способны
к изменению своего фенотипа – эпителио-мезенхимному переходу (ЭМП).
В научной литературе можно найти данные о сигнальных каскадах и молекулах, участву-
ющих в программе ЭМП, как в эмбриональном развитии, так и при заживлении ран или кан-
церогенезе. В частности, показано, что в норме цитоплазматический домен адгезивного бел-
ка Е-кадгерина (ген Cdh1) связывается с белком бета-катенином (ген Ctnnb1), что приводит
к усилению клеточной адгезии и образованию эпителиального пласта. Однако при патологи-
ческих процессах, например, при канцерогенезе может происходить мутация бета-катенина,
что приводит к его ядерному накоплению, активации Wnt-сигнального каскада и повышению
подвижности клеток за счет разборки плотных контактов и снижению адгезивных взаимодей-
ствий клеток.
ЭМП осуществляется под контролем и при участии транскрипционных факторов Snail,
Slug, Twist, Zeb1, Zeb2, которые способствуют замещению гена Cdh1 на ген N-кадгерина (Cdh2)
и дальнейшему изменению фенотипа клеток.
Для характеристики неоднородности клеточных популяций в ГЦК мыши нами были полу-
чены 11 клональных культур опухолевых клеток, три из них – методом single cell cloning. Ис-
следование на экспрессию маркеров ЭМП были проведены методом ПЦР в реальном времени.
Для сравнения использовали образцы, полученные из коммерческой линии клеток HEPA1-6, куль-
туры мышиных эмбриональных фибробластов (MEF), а также из ткани нативной печени мыши.
Анализ относительной экспрессии исследуемых генов показал в большей или меньшей
степени повышенную экспрессию Ctnnb1 почти во всех культурах ГЦК. Это указывает на раз-
ную степень злокачественности выделенных культур ГЦК. Кроме того, было показано, что
в 8 культурах ГЦК из 11 уровень экспрессии Cdh1 ниже, чем Cdh2, что свидетельствует о по-
вышенной способности данных культур к миграции.
Была показана повышенная экспрессия гена, ответственного за маркерный белок злока-
чественной трансформации клеток – Vimentin. Наибольшая экспрессия Vimentin наблюдалась
в двух из трех культур, которые были выделены из единичных клеток, фенотипически похо-
жих на раковые стволовые клетки.
Во всех культурах экспрессия Zeb1 была выше, чем Zeb2, что коррелирует с повышенным
уровнем экспрессии Snail относительно контроля. Транскрипционные факторы Slug и Twist
мало экспрессировались во всех культурах ГЦК.
Таким образом, анализ клональных клеточных культур ГЦК показал возможную пластич-
ность клеточных популяций в изначальной опухоли по степени злокачественности и потен-
циям к миграции. Сосуществование различных клеточных популяций может приводить к до-
полнительной активации опухолевой прогрессии.
Работа поддержана РФФИ (№16-34-00769).

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
24 Секция 1. Молекулярная генетика, геномика и биоинформатика

А.В. Доцев1, В.Р. Харзинова1, И.М. Охлопков2, Г. Брем1,3, Н.А. Зиновьева1

ОЦЕНКА ГЕНЕТИЧЕСКОГО РАЗНООБРАЗИЯ ДИКИХ СЕВЕРНЫХ ОЛЕНЕЙ


СЕВЕРО-ЗАПАДНОЙ ЯКУТИИ С ИСПОЛЬЗОВАНИЕМ SNP-МАРКЕРОВ

1
Всероссийский институт животноводства им. Л.К.Эрнста
Россия, 142132, Московская обл., Подольский р-н, п. Дубровицы, 60
e-mail: asnd@mail.ru
2
Институт биологических проблем криолитозоны СО РАН
Россия, 677000, г. Якутск, пр. Ленина, 41
3
Institut fur Tierzucht und Genetik, University of Veterinary Medicine, Austria, Vienna

На территории северо-западной Якутии обитает самая многочисленная на данный момент


тундровая популяция северных оленей в этой республике – лено-оленекская. По последним
данным авиаучета, проведенного в 2013 году, ее численность составляет 90–95 тыс. особей.
Также на эту территорию отмечаются заходы на зимовку диких северных оленей таймырской
популяции из Красноярского края, причем их количество с каждым годом растет.
Целью нашего исследования являлся анализ генетического разнообразия лено-оленекской
и таймырской популяций северного оленя.
Для изучения генетического разнообразия мы использовали 769 SNP-маркеров, отобран-
ных с использованием ДНК-чипа средней плотности (Illumina Bovine SNP50 Bead Chip), раз-
работанного для крупного рогатого скота. В качестве набора информативных локусов были
использованы только полиморфные SNP, выявленные у разных групп северного оленя, как
диких (лено-оленекской (n = 27), таймырской (n = 19), островной (n = 6), таежной (n = 4) и чу-
котской (n = 1) популяций), так и домашних (ненецкой (n = 11), эвенской (n = 32) и эвенкий-
ской (n = 20) пород, а также тувинской породной группы (n = 17)). Все отобранные локусы
удовлетворяли следующим требованиям: уровень качества генотипирования (GC) – не ниже
0,3, процент генотипирования (GENO) – не менее 90% и минимальная частота встречаемости
полиморфизма (MAF) – не менее 1%. Статистическая обработка данных проводилась с помо-
щью программы PLINK 1.07.
Всего в лено-оленекской популяции было выявлено 599 полиморфных локусов, что со-
ставляет 78% от общего числа гетерозигот, встречающихся у северных оленей. Показатели
наблюдаемой (Ho) и ожидаемой (He) гетерозиготности были равны 0,198±0,007 и 0,201±0,006,
соответственно. Количество полиморфных локусов у одной особи варьировало от 99 до 131
и в среднем составило 116,3±1,8. Показатель инбридинга (FIS) имел значение 0,015. Показатель
аллельного разнообразия (Ar) – 1,70.
В таймырской популяции был выявлен 541 полиморфный локус (70% от общего числа ге-
терозигот). Показатели наблюдаемой и ожидаемой гетерозиготности были равны 0,222±0,007
и 0,221±0,007, соответственно. Количество полиморфных локусов у одной особи варьирова-
ло от 110 до 137 и в среднем составило 120,1±2,0. Показатель инбридинга (FIS) имел значение
-0,003, показатель аллельного разнообразия (Ar) – 1,72.
При сравнении полиморфных SNP, выявленных в этих популяциях, оказалось, что 468 (70%)
SNP являлись для них общими, 131 (19%) – наблюдались только у лено-оленекской и 73 (11%) –
только у таймырской популяции.
Таким образом, наши исследования показали, что популяции северного оленя, обитающие
на территории северо-западной Якутии, обладают богатым генофондом и имеют схожие гене-
тические профили как в качественном, так и в количественном отношении.
Исследования выполнены при поддержке РНФ, проект № 16-16-10068.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 1. Молекулярная генетика, геномика и биоинформатика 25

Б.В. Иващук, Я.В. Пирко, Я.Б. Блюм

ПОИСК ГЕНОВ УСТОЙЧИВОСТИ К СТЕБЛЕВОЙ РЖАВЧИНЕ У ЗЛАКОВ


С ПОМОЩЬЮ ПОСЛЕДОВАТЕЛЬНОСТИ NB ДОМЕНА БЕЛКОВ КЛАССА NB-LRR

Институт пищевой биотехнологии и геномики НАН Украины


Украина, 04123, г. Киев, ул. Осиповского, 2А
e-mail: antutilo@gmail.com, cellbio@cellbio.freenet.viaduk.net

Стеблевая ржавчина – заболевание злаков, причиной которой является биотрофный гриб


Puccinia graminis f. sp. tritici. Недавнее появление нового агрессивного штамма Ug99 этого фи-
топатогена поставило под угрозу мировое производство зерна пшеницы, поскольку около 70%
всех сортов этого злака не обладают устойчивостью к нему. На сегодняшний день наиболее эф-
фективным способом борьбы со стеблевой ржавчиной является пирамидирование генов устой-
чивости к этому патогену. Основной класс генов, обеспечивающий устойчивость к стеблевой
ржавчине пшеницы, представлен генами, кодирующими NB-LRR белки (Nucleotide-Binding
Leucine Rich Repeat Protein). Ранее обнаруженные гены Sr33, Sr35, Rpg5 и RGA1, обеспечи-
вающие устойчивость к Ug99, принадлежат именно к этому классу генов. Также установлено,
что гены Rpg5 и RGA1 ячменя имеют гомологи в пшенице и других злаках. Принимая во вни-
мание общее происхождение этих генов у пшеницы и ячменя, было решено использовать их
белковые последовательности, а также последовательности их гомологов для поиска новых
генов устойчивости к стеблевой ржавчине.
Для идентификации новых генов устойчивости к стеблевой ржавчине, кодирующих NB-LRR
белки, были разработаны вырожденные праймеры: F-5`- TTIAAIGGNTGGATHGARGAGAA-3`
и R-5`-TGITCITCYTCNACRCARTARCC-3`. В исследованиях использовали 20 сортов пшени-
цы зарубежной и украинской селекции, из проростков семян которых выделяли ДНК и РНК.
Из РНК при помощи обратной транскриптазы получали кДНК. Полученные ДНК и кДНК ис-
пользовали для ПЦР. Продукты ПЦР разделяли в 1,5%-ном агарозном геле. Фрагменты очи-
щали, встраивали в вектор pTZ57R/T и клонировали в бактериальных клетках E. coli DH5α.
Наличие вставки проверяли используя рестриктазы BamHI и EcoRI. Образцы со вставками
секвенировали с помощью генетического анализатора ABI Prism 3130. Полученные последо-
вательности использовали для BLAST геномного поиска гомологичных последовательностей
у Triticum aestivum, Aegilops tausсhii и Triticum urartu. Последовательности с наибольшей степе-
нью идентичности к секвенированным фрагментам отбирали для филогенетического анализа.
Проведенный поиск в геномах вышеупомянутых видов злаков позволил обнаружить
высокоидентичные последовательности гомологов генов, а именно: Wheat 3B:757222000-
757223300, Wheat IWGSCI:v443 16692:10100-11500, Aegil Scaffold69664:51900-52250, Urartu
Scaffold8649: 300 – 640, Wheat 7A:170241500-170241840, Urartu Scaffold105073:42200-43400,
Wheat7B:239538800-239540000, Wheat 7B:239430000-239431200 и Wheat 5D:146292000-
146293000 (обозначения взяты с Ensembl Plants). Оказалось, что одна часть выявленных по-
следовательностей принадлежит уже предсказанным генам (например, RPM1 Ae. tauschii),
а другая – последовательностям ещё не идентифицированных генов. Таким образом, используя
праймеры, специально разработанные на основе последовательностей NB-LRR белков генов
устойчивости к стеблевой ржавчине, в геномах злаков были идентифицированы уже известные
и, возможно, новые гены, обеспечивающие устойчивость к этому заболеванию.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
26 Секция 1. Молекулярная генетика, геномика и биоинформатика

В.А. Лемеш, М.В. Богданова, В.И. Сакович

СЕКВЕНИРОВАНИЕ SAD, FAD2 И FAD3 ГЕНОВ ДЕСАТУРАЗ ЛЬНА

Институт генетики и цитологии НАН Беларуси


Республика Беларусь, 220072, г. Минск, ул. Академическая, 27
e-mail: m.bogdanova@igc.by

Масличный лен является ценной технической культурой многостороннего использования.


Традиционные сорта масличного льна содержат 45–50% масла. В состав льняного масла вхо-
дит пять основных жирных кислот – пальмитиновая (С16:0, ~6%), стеариновая (С18:0, ~2,5%),
олеиновая (С18:1 цис-Δ9; ~19%), линолевая (С18:2 цис-Δ9, 12; ω-6; ~24%) и α-линоленовая
(С18: 3 цис-Δ9, 12, 15; ω-3; ~55–57%) кислоты.
У льна определены и охарактеризованы многие гены, кодирующие ферменты биосинте-
за жирных кислот, однако мало известно о степени генетической изменчивости этих генов,
существующих аллельных вариантах и их связи с составом жирных кислот. Изучение вариа-
бельности генов десатураз позволит выявить функционально значимые полиморфизмы и об-
наружить внутригенные маркеры, позволяющие с высокой степенью достоверности выделять
перспективные для селекции образцы льна масличного с желаемым соотношением основных
ненасыщенных жирных кислот в масле семян.
Материалом для исследования служили три образца масличного льна (Linum usitatissimum L.,
convar. humile Mill.), характеризующиеся различным соотношением жирных кислот в льня-
ном масле – сорт Amon (содержание α-линоленовой кислоты <5%), линия гк-394 (содержа-
ние α-линоленовой кислоты 20–30%), сорт Циан содержание α-линоленовой кислоты >50%).
Для амплификации фрагментов шести генов десатураз было подобрано 58 ген-специфических
перекрывающихся праймеров – по 12 праймеров для sad1, sad2, fad3a, fad3b, 6 – для fad2a
и 4 – для fad2b. Выделение продуктов амплификации из геля и их очистку проводили с помо-
щью Wizard® SV Gel and PCR Clean-Up System (Promega, США) по протоколам фирмы про-
изводителя. Секвенирующую реакцию проводили с использованием набора для секвенирова-
ния BigDye Terminator v3.1 Сycle Sequencing Kit (Applied Biosystems, США). Нуклеотидные
последовательности анализировали на генетическом анализаторе ABI Prism 3500 (Applied
Biosystems, США). Сборку перекрывающихся последовательностей проводили с помощью
ассемблера CAP3, множественное выравнивание, трансляцию и определение открытых рамок
считывания с использованием ClustalW в программе Unipro UGENE v1.19.0.
Выявлено, что sad гены имеют схожую структуру и состоят из трех экзонов и двух интро-
нов. Длина кодирующей области составляет 2515 п.н. для sad1 и 2519 п.н. для sad2. Оба гена
кодируют белки, состоящие из 396 аминокислотных остатков. Sad1 и sad2 гены идентичны на
91% по нуклеотидной и на 99% по аминокислотной последовательностям. Fad2a и fad2b ге-
ны не имеют интронов. Длина кодирующей области составляет 1137 пар оснований для fad2a
и 1149 п.н. – для fad2b. Fad2a ген кодирует белок, состоящий из 378 аминокислотных остат-
ков, fad2b – из 382 аминокислотных остатков. Данные гены идентичны на 82% по нуклеотид-
ной и на 87% по аминокислотной последовательностям. Кодирующие области fad3a и fad3b
генов составляют 3280 и 3002 п.н. сооветственно, оба гена заключают в себе шесть экзонов и
пять интронов. Белковые последовательности состоят из 392 и 391 аминокислотного остатка.
Fad3a и fad3b гены идентичны на 85% по нуклеотидной и на 94% по аминокислотной после-
довательностям.
В дальнейшем полученные данные будут соотнесены с составом жирных кислот масла
семян льна для выявления влияния различных аллельных вариантов генов десатураз на жир-
нокислотный состав масла.
Работа выполнена при финансовой поддержке БРФФИ (№ Б15-032).

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 1. Молекулярная генетика, геномика и биоинформатика 27

Е.Д. Луценко, М.В. Останков, Н.А. Бондарович, А.Н. Гольцев

ОЦЕНКА ЭКСПРЕССИИ ГЕНА FOXP3 В КЛЕТКАХ СЕЛЕЗЕНКИ В МОДЕЛИ


АДЪЮВАНТНОГО АРТРИТА ДО И ПОСЛЕ ПРИМЕНЕНИЯ КЛЕТОК ПЛАЦЕНТЫ

Институт проблем криобиологии и криомедицины НАН Украины


Украина, 61001, г.Харьков, ул. Переяславская, 23
e-mail: cryopato@gmail.com

Плацента является источником ряда регуляторных факторов (ИЛ-2, ИЛ-10, ТРФβ, ИДО),
являющихся индукторами экспрессии транскрипционного фактора Foxp3, определяющего су-
прессорный эффект Т-регуляторных клеток (Т-рег). Ранее нами в экспериментальной модели
ревматоидного артрита – адъювантном артрите (АА) – были получены данные, подтвержда-
ющие определенную связь клинической манифестации патологии с изменением содержания
Т-рег СD4+СD25+ клеток в лимфоидных органах мышей до и после применения криоконсер-
вированных клеток плаценты. В контексте изучения механизма реализации иммунорегуля-
торного действия нативной и криоконсервированной в различных режимах суспензии клеток
плаценты (СКП) целью данной работы было определение экспрессии гена foxp3 в клетках се-
лезенки животных с АА до и после введения СКП.
Работа выполнена на мышах линии СВА/Н. СКП получали путем гомогенизации плаценты
на 18–19-е сутки гестации. Криоконсервирование СКП проводили под защитой 10% раствора
диметилсульфоксида (суспензия КД) или пропандиосахароля (суспензия КП). АА индуцировали
субплантарным введением полного адъюванта Фрейнда. Развитие АА выражали в виде индекса
артрита, который оценивали по отношению диаметра опытного голеностопного сустава к диа-
метру интактного в течение 28 суток ежедневно. Нативную (нСКП) или криоконсервированную
СКП вводили внутривенно на 7-е сутки индукции патологии. Контрольным животным вводили
преднизолон (Биофарма, Украина) или клетки костного мозга. Методом прямой иммунофлюо-
ресценции с использованием моноклональных антител к мембранным структурам СD4 и СD25
(BD Pharmingen TM) определяли количество СD4+СD25+ Т-рег клеток на проточном цитофлюо-
риметре (FACS Calibur, BD) в селезенке животных с АА до и после введения СКП. Экспрессию
гена foxp3 оценивали в клетках селезенки мышей методом мультиплексной полимеразной цеп-
ной реакции с этапом обратной транскрипции (ОТ-ПЦР) на 14-е и 28-е сутки после индукции
АА. В ПЦР использовали пары праймеров к гену foxp3 и гену «домашнего хозяйства» – β-actin.
Количество транскриптов исследуемых генов сравнивали на основе относительной полуколи-
чественной оценки продуктов амплификации в биоанализаторе Agilent 2100 (США).
Снижение клинических признаков развития АА наблюдалось после введения как натив-
ных, так и криоконсервированных клеток. Эффект вводимых клеток плаценты в отношении
Т-рег определялся режимом криоконсервирования. Уменьшение отека сустава коррелирова-
ло с содержанием Т-рег клеток в селезенке у животных после введения нСКП или КД. Было
установлено снижение уровня экспрессии foxp3 в клетках селезенки животных с АА на 28-е
сутки, что свидетельствует об участии этого фактора в патогенезе АА в отдаленные сроки раз-
вития патологии. Снижение индекса отека коррелировало с уровнем экспрессии foxp3 в клетках
селезенки во всех исследованных группах. Суспензии КД и КП обладали разной иммуносу-
прессорной активностью, что доказывает значимость условий криоконсервирования плаценты
в проявлении ее регуляторной активности.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
28 Секция 1. Молекулярная генетика, геномика и биоинформатика

А.В. Мезенцев, А.Г. Соболева, Ю. Могулевцева, А.Д. Золотаренко, С.А. Брускин

РЕКОНСТРУКЦИЯ ЭПИДЕРМИСА МЫШИ, СОДЕРЖАЩЕГО ГЕНЕТИЧЕСКИ


МОДИФИЦИРОВАННЫЕ КЛЕТКИ ЧЕЛОВЕКА

Институт общей генетики им. Н.И. Вавилова РАН


Россия, 119991, г. Москва, ул. Губкина, 3
e-mail: mesentsev@vigg.ru

Органотипические модели кожи, созданные из двух и более типов клеток, позволяют ими-
тировать развитие патологического процесса наследственных заболеваний, а также тестиро-
вать экспериментальные препараты на стадии доклинических испытаний.
Целью представленной работы была характеристика новой экспериментальной модели ко-
жи, созданной на основе иммортализованных кератиноцитов человека (HaCaT) и первичных
кератиноцитов мыши. Нашей непосредственной задачей было провести трехмерную рекон-
струкцию эпидермиса из указанных типов клеток и описать изменения в полученных образцах,
вызванные подавлением экспрессии транскрипционного фактора FOSL1.
Для проведения трехмерной реконструкции эпидермиса кератиноциты человека и мыши
(1:1) высевали на коллагеновый гель, содержавший первичные фибробласты мыши, предвари-
тельно обработанные митомицином. Культивирование проводили на границе разделения фаз
в течение 10–14 дней. Клетки HaCaT с пониженной экспрессией FOSL1 получали методом
лентивирусной трансдукции, используя вектор вирусного происхождения с закодированной в
его геноме малой ингибирующей РНК к FOSL1 (FOSL1 миРНК). Для проведения гистологи-
ческих исследований из образцов получали срезы, используя криогеновый метод. Чтобы оце-
нить изменения генной экспрессии использовали метод количественной ПЦР.
Согласно результатам гистологического анализа, реконструированный эпидермис состоял
из 10–15 рядов клеток. При этом базальный слой был представлен несколькими рядами клеток.
Большинство клеток базального слоя утратили характерную для здорового эпидермиса кубо-
видную форму. Граница же между базальным и шиповатым слоями была размыта. Гранулярный
слой был прерывист. Ороговение верхних слоев клеток было выражено слабо. В некоторых
клетках ороговевшего слоя наблюдалась задержка в деградации ядер (паракератоз). После 10
дней культивирования количество флуоресцирующих клеток HaCaT в полученных образцах
составляло не менее 25%. При этом флуоресцирующие клетки были преимущественно сосре-
доточены в базальном и шиповатом слоях. Анализ изменений экспрессии генов в образцах,
обработанных и не обработанных ростовыми факторами – фактором некроза опухоли (ФНО),
интерфероном гамма (ИФНГ) и интерлейкином 17 (ИЛ17) – показал, что ФНО оказывает наи-
более сильное влияние на экспрессию FOSL1-зависимых генов. Напротив, влияние ИФНГ и
ИЛ17 на гены, контролируемые FOSL1, было разнонаправленым и менее выраженым.
Полученная экспериментальная модель может быть использована для изучения роли от-
дельных генов, как в патогенезе наследственных заболеваний, так и в поддержании нормаль-
ного гомеостаза кожи.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 1. Молекулярная генетика, геномика и биоинформатика 29

М.Е. Михайлова, А.И. Киреева, Е.Л. Романишко, Н.И. Тиханович, Н.А. Камыш

ДНК-ДИАГНОСТИКА ГЕНЕТИЧЕСКОГО ДЕФЕКТА КРУПНОГО РОГАТОГО СКОТА


ГОЛШТИНСКОЙ ПОРОДЫ, ДЕТЕРМИНИРУЮЩЕГО
СИНДРОМ БРАХИСПИНЫ (BY)

Институт генетики и цитологии НАН Беларуси


Республика Беларусь, 220072, г. Минск, ул. Академическая, 27
e-mail: M.Mikhailova@igc.by

ДНК-технология проведения диагностического анализа для выявления генетического де-


фекта крупного рогатого скота (КРС) голштинской породы, детерминирующего синдром бра-
хиспины (BY), осуществляется с использованием метода полимеразной цепной реакции (ПЦР).
Мутация брахиспина, или синдром короткой спины, впервые выявлена в Голландии и Да-
нии у мертворожденных телят с укороченным позвоночником.
Синдром брахиспина характеризуется также выраженным снижением массы тела, задерж-
кой роста, тяжелым пороком развития позвонков, приводящих к значительному укорочению
позвоночника у животных. Кроме того, выявляются пороки развития внутренних органов,
в частности сердца, почек и яичек. Также показано, что статус животного-носителя брахи-
спины коррелирует с фертильностью (гаплотип фертильности HH0), которая является одним
из наиболее важных показателей плодовитости у крупного рогатого скота.
Эту мутацию передал своим сыновьям Клейтусу № 1879085 и Лейдману № 1983348 бык
С.Х. Традишн № 1682485 линии Вис Айдиал. Известно, что в голштинской породе КРС в ка-
надской и американской популяциях крупного рогатого скота гетерозиготных носителей му-
тации выявлено 5% и 8% соответственно.
Метод относится к молекулярной генетике, изучающей дефекты в геноме, приводящие
к развитию генетических аномалий, которые представляют собой наследственно обусловлен-
ные, нежелательные с точки зрения здоровья популяции и племенного использования живот-
ных, отклонения в росте и развитии клеток, органов, систем органов и организма в целом.
Проводится генотипирование ДНК-полиморфизмов КРС, расположенных в гене FANCI
(Fanconi Anemia Complementation Group) для идентификации животных-носителей мутантно-
го аллеля, детерминирующего синдром брахиспины. Метод позволяет осуществлять анализ
нуклеотидной последовательности ДНК животного с целью выявления делеции 3.3 т.п.н., обу-
славливающей генетический дефект, для предотвращения распространения данной мутации
в поголовье скота.
Исследованы животные на носительство мутантной аллели, детерминирующей синдром
брахиспина (BY) из сельскохозяйственных предприятий Брестской области. Среди проте-
стированных бычков-носителей мутантной аллели, детерминирующей синдром брахиспина,
не выявлено.
Возможность выявления животных-носителей BY может быть эффективно использована
для проведения генетического контроля с целью нераспространения мутации в популяции
КРС в Республике Беларусь, а также для селекции с целью увеличения воспроизводства стада.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
30 Секция 1. Молекулярная генетика, геномика и биоинформатика

М.Е. Михайлова, Е.Л. Романишко, А.И. Киреева

ВЫЯВЛЕНИЕ ПОЛИМОРФИЗМА (A3072G) ГЕНА ИНСУЛИНОПОДОБНОГО


ФАКТОРА РОСТА pIGF2 (ИНТРОН 3) У СВИНЕЙ (SUS SCROFA)
МЕТОДОМ СЕКВЕНИРОВАНИЯ

Институт генетики и цитологии НАН Беларуси


Республика Беларусь, 220072, г. Минск, ул. Академическая, 27
e-mail: M.Mikhailova@igc.by

Известно, что на ростовые процессы организма влияет комплекс факторов, важную роль
в этих процессах играет гормон роста. Регуляция синтеза гормона роста представляет собой
многоуровневый каскад взаимодействий белок-рецепторов, тесно связанных между собой.
Ключевыми звеньями соматропинового каскада являются инсулиноподобные факторы роста-1
и 2 (IGF-1 и IGF-2), запускающие внутриклеточные ответы на воздействие соматотропина.
Выявление нуклеотидной замены G→A в третьем интроне импринтингового гена рIGF-2
актуально, так как экспрессия мутантного аллеля А связана с интенсивным мышечным ро-
стом, а в геноме экспрессируется только отцовский аллель, поэтому важно проводить ДНК-
диагностику хряков. Определен полиморфизм (A3072G) гена рIGF-2 (3-й интрон) методом
секвенирования.
Ген рIGF-2 – один из QTL-локусов, значимых для селекционной работы в свиноводстве,
для которого характерна моноаллельная отцовская экспрессия. Различие в активности алле-
лей гена рIGF2 вызвано геномным импринтингом, в основе которого лежит специфическое
для особей разного пола метилирование цитозиновых оснований ДНК, которое выключает
транскрипцию одного из родительских аллелей. Цитозиновые основания ДНК метилируют-
ся в основном в CpG-динуклеотидах. Замена (A3072G) в 3 интроне гена pIGF-2 находится
в районе, богатом СрG-участками, что усложняет подбор праймеров. Для ПЦР отобраны 7 пар
праймеров, с одной из пар был получен специфичный фрагмент гена pIGF-2. Секвенированны
аллельные варианты (АА, АG, GG) гена pIGF-2 с использованием BigDye® Terminator (v3.1).
Оценка и обработка данных проводились с помощью программного обеспечения Sequencing
Analysis-5.4, которое является частью автоматического генетического анализатора Applied
Biosystems 3500.
Определены частоты встречаемости аллелей и генотипов по локусу гена pIGF-2. Уста-
новлено, что исследованные выборки животных белорусской крупной белой породы свиней
и заводского типа породы йоркшир значительно отличались по частоте встречаемости особей
с предпочтительным генотипом QQ. Так в выборке животных заводского типа породы йорк-
шир частота встречаемости генотипа QQ – 47%, а у животных белорусской крупной белой
породы – 7%. Для ускорения отбора особей с желательным генотипом QQ необходимо вести
отбор не только против животных с гомозиготным генотипом qq, но и против животных с ге-
терозиготным генотипом Qq, поскольку потомство таких хряков в дальнейшем получит одну
из нежелательных аллелей, а полученный желательный аллель Q от матери не будет работать
в следствии наличия на нем «отпечатка» импринтинга.
При анализе молодняка белорусской крупной белой породы на контрольном откорме в за-
висимости от генотипа отца по гену рIGF-2 выявлено, что животные, полученные от хряков
с генотипом рIGF–2 QQ, по показателю толщина шпика превосходили животных с отцовским
генотипом Qq на 1,83 мм, или 7%, и животных с отцовским генотипом qq – на 1,52 мм, или
6% (P<0,05). Исходя из полученных данных, ген IGF-2 можно рекомендовать к использованию
в качестве маркера в селекции свиней.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 1. Молекулярная генетика, геномика и биоинформатика 31

Р.Е. Нугманова, Е.В. Жолдыбаева

РАЗРАБОТКА ТЕСТ-СИСТЕМЫ НА ОСНОВЕ ПОЛИМЕРАЗНОЙ ЦЕПНОЙ РЕАКЦИИ


В РЕЖИМЕ РЕАЛЬНОГО ВРЕМЕНИ ДЛЯ ПОДБОРА ИНДИВИДУАЛЬНЫХ ДОЗ
ЛЕКАРСТВЕННЫХ ПРЕПАРАТОВ, ИСПОЛЬЗУЕМЫХ ПРИ ЛЕЧЕНИИ
КИСЛОТОЗАВИСИМЫХ ЗАБОЛЕВАНИЙ ЖЕЛУДОЧНО-КИШЕЧНОГО ТРАКТА

РГП «Национальный центр биотехнологии» КН МОН РК


Республика Казахстан, 010000, г. Астана, Коргалжинское ш., 13/5
e-mail: zholdybayeva@biocenter.kz

Кислотозависимые заболевания (КЗЗ) характеризуются нарушениями продукции соляной


кислоты, поражая пищевод, желудок и двенадциперстную кишку. При КЗЗ назначается терапия
ингибиторами протонной помпы (ИПП), которые уменьшают агрессивное воздействие соля-
ной кислоты. Однако заметен разный кислоподавляющий эффект данных препаратов, в силу
генетических особенностей пациента, а также общего состояния организма. При лечении кис-
лотозависимых заболеваний рекомендуется проводить генотипирование гена CYP2C19 пациен-
та, так как это позволит подобрать оптимальный препарат для эффективного лечения. Целью
исследования является разработка тест-системы методом ПЦР в режиме реального времени
для подбора индивидуальных доз лекарственных препаратов, используемых при лечении КЗЗ.
Выделение ДНК из крови проводили методом высаливания. Генотипирование проводили
методом Real-time PCR с использованием специфических зондов TaqMan® SNP Genotyping
Assay. Для дизайна праймеров и флуоресцентно-меченных зондов к выбранным мишеням ис-
пользовали программму The Primer Express® Software v3.0.1.
Для выбора лекарственных препаратов группы ИПП был проведен анализ баз данных, со-
держащих фармакогенетические данные (National Center for Biotechnology Information, U.S.
National Library of Medicine http://www.ncbi.nlm.nih.gov/; The Pharmacogenomics Knowledge Base
[PharmGKB] www.pharmgkb.org/; Pharmacogenetics of Membrane Transporters Database [UCSF
PMT] pharmacogenetics.ucsf.edu/) и другие. Были изучены препараты, которые официально
зарегистрированы в Республике Казахстан. Различные этнические группы могут различаться
по характеру ответа на лекарственное воздействие. Для исследования популяционных частот
было проведено генотипирование на основе аллель-специфичной ПЦР в режиме реального
времени на контрольной выборки (условно-здоровые). В исследование было включено 500 до-
бровольцев, которые являлись условно-здоровыми, по этнической принадлежности являлись
казахами, по гендерному и возрастному признаку не было ограничений. Результаты геноти-
пирования показали, что CYP2C19*4, CYP2C19*5, CYP2C19*6, CYP2C19*7 и CYP2C19*12
не встречаются в казахской популяции. CYP2C19*2 в казахской популяции встречается в ге-
терозиготном состоянии с частотой 0,32 %, CYP2C19*17 в гетерозигтном состоянии встреча-
ется с частотой 0,16 %. Носительство аллеля CYP2C19*3 в гетерозиготном состоянии встре-
чается с частотой 0,08 %. Таким образом, в лабораторной фармакогенетической диагностике
для определения чувствительности к ИПП следует проводить генотипирование по следующим
полиморфным маркерам: CYP2C19*2, CYP2C19*3 и CYP2C19*17. Были подобраны праймеры
и зонды ко всем выбранным мишеням, проведен их синтез. Проведена оптимизация условий
для проведения ПЦР в режиме реального времени. В настоящее время проводится апробация
разработанного диагностического теста на клинических образцах.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
32 Секция 1. Молекулярная генетика, геномика и биоинформатика

Ю.Л. Орлов, Е.В. Кулакова, А.М. Спицина, И.В. Чадаева, В.Н. Бабенко

КОМПЬЮТЕРНЫЕ МЕТОДЫ АНАЛИЗА ХРОМОСОМНЫХ КОНТАКТОВ В ЯДРЕ


КЛЕТКИ НА ОСНОВЕ СЕКВЕНИРОВАНИЯ

Институт цитологии и генетики СО РАН


Россия, 630090, г. Новосибирск, пр-т Лаврентьева, 10
e-mail: orlov@bionet.nsc.ru

Проблема совместной регуляции экспрессии генов человека имеет большое фундамен-


тальное и прикладное значение. С помощью методов, основанных на иммунопреципитации
хроматина (ChIP) и последующем высокопроизводительном секвенировании ДНК, стало воз-
можным определение сайтов связывания транскрипционных факторов и регуляторных районов
эукариот в масштабе генома. Технология ChIA-PET (Chromatin Interaction Analysis by Paired-
End-Tag Sequencing) позволяет исследовать не только отдельные сайты связывания, но и пары
таких сайтов на хромосомах, расположенные рядом в трехмерном пространстве ядра клетки.
В последние годы с использованием методов Hi-C, ChIA-PET получены новые знания
об особенностях трехмерной архитектуры (укладки) генома человека в интерфазном ядре. Ме-
тоды основаны на лигировании сближенных в пространстве фрагментов хромосомной ДНК
с последующим высокопроизводительным параллельным секвенированием и картированием
(компьютерным выравниванием) секвенированных фрагментов на полный геном. На основе
этих данных для генома человека сконструированы карты сближенности фрагментов ДНК
с разрешением до сотен нуклеотидов. Кроме того, построены модели пространственного
расположения хромосом в ядре клетки, указывающие на наличие хромосомных территорий.
Хромосомные территории – сближенные в пространстве ядра районы хромосом, которые обе-
спечивают формирование транскрипционных фабрик и транскрипционных доменов. Послед-
ние содержат группы коэкспрессирующихся генов (хромосомные опероны), обслуживаемые
общими пулами РНК-полимераз и транскрипционных факторов. Возникает задача изучения
качественно новых кодов регуляции транскрипции, реализующихся на надхроматиновом уров-
не, таких как транскрипционные домены.
Использование методов определения контактов через секвенирование сближенных фраг-
ментов ДНК позволило выявить ряд важных особенностей пространственной организации
генома в клетках эукариот. Показано, что укладка длинных молекул ДНК в очень небольшом
объеме ядра достигается за счет упаковки по модели «фрактальной глобулы». При таком спо-
собе упаковки близко расположенные участки молекулы ДНК предпочтительно взаимодей-
ствуют друг с другом, формируя глобулу первого порядка. Модель «фрактальной глобулы»
позволяет объяснить компактизацию длинной молекулы ДНК.
С помощью собственных компьютерных программ проанализирована информация о хро-
мосомных контактах, опосредованных рецептором эстрогена ER, полученных с помощью
метода ChIA-PET. Рассмотрены хромосомные контакты между регуляторными (промоторны-
ми) районами генов, образуемые комплексом РНК-полимеразы II. Показано, что удаленные
контакты хроматина в геноме человека встречаются между дистальными участками связыва-
ния рецептора эстрогенов ER и промоторами генов-мишеней этого фактора, что определяет
структурную основу регуляции экспрессии. Анализ хромосомных контактов, опосредованных
комплексами РНК-полимеразы II, в ядрах клеток человека выявил обогащенность контакти-
рующих участков сайтами связывания различных транскрипционных факторов.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 1. Молекулярная генетика, геномика и биоинформатика 33

А.Н. Рабоконь1, А.Е. Демкович1, Я.В. Пирко1, М.В. Богданова2, В.И. Сакович2,


В.А. Лемеш2, Я.Б. Блюм1

ИССЛЕДОВАНИЕ ПОЛИМОРФИЗМА ДЛИНЫ ИНТРОНОВ ГЕНОВ β‑ТУБУЛИНА


У ЛАНДРАС LINUM USITATISSIMUM L.

Институт пищевой биотехнологии и геномики НАН Украины,


1

Украина, 04123, г. Киев, ул. Осиповского, 2а


e-mail: rabokonnastya@gmail.com, cellbio@cellbio.freenet.viaduk.net
2
Институт генетики и цитологии НАН Беларуси
Республика Беларусь, 220072, г. Минск, ул. Академическая, 27

В настоящее время для идентификации сортов сельскохозяйственных культур, в том числе


льна (Linum usitatissimum L.), применяются различные молекулярные маркеры. В этой связи
перспективен новый развивающийся метод, использующий полиморфизм длин интронов генов
β-тубулина (tubulin-based polymorphism – TBP). ТВР-метод основывается на том, что в связи
с ключевой ролью полипептидов β‑тубулина (составляющих основу микротрубочек) в жиз-
ни клетки, последовательность их экзонов (в отличии от интронов) довольно консервативна
у всех эукариотических организмов. Целью работы было оценить возможность использования
ТВР-маркеров в генетических исследованиях ландрас льна.
Были исследованы белорусские ландрасы L. usitatissimum: 24 – долгунцового, 3 – мас-
личного, 2 – долгунцово-масличного типов, 2 образца стародавнего сорта и 1 образец улуч-
шенного сорта. Геномную ДНК экстрагировали из проростков с помощью ЦТАБ-метода.
ПЦР проводили с праймерами TBP-F: 5’-AACTGGGCBAARGGNCAYTAYAC-3’; TBP-R:5’-
ACCATRCAYTCRTCDGCRTTYTC-3’. Продукты амплификации разделяли с помощью элек-
трофореза в 6%-ном неденатурирующем полиакриламидном геле, используя 1х ТВЕ-буфер.
Ампликоны окрашивали нитратом серебра. Значения стандартной генетической дистанции
Нея (DS) были использованы для кластерного анализа и построения филогенетического дере-
ва с применением метода невзвешенных парногрупповых средних (UPGMA). Полиморфизм
маркеров оценивали по среднему значению PIC (Polymorphism Information Content).
Основная зона распределения фрагментов находилась в диапазоне от 400 п.н. до 1900 п.н.
17 из 30 выявленных фрагментов оказались идентичными для всех изученных растений, а 13 –
полиморфными, с размером около 435 п.н., 460 п.н., 480 п.н., 505 п.н., 645 п.н., 670 п.н., 690 п.н.,
800 п.н., 1030 п.н., 1130 п.н., 1600 п.н., 1685 п.н., 1865 п.н.. Часть исследованных генотипов
льна характеризовалась специфическим набором ампликонов. Среднее значение PIC соста-
вило 0,136. При кластерном анализе анализированные образцы разделились на три группы.
Первую группу (со 100% бутстреп поддержкой) образовали улучшенный сорт долгунца К-7236
и ландраса долгунцового типа К-183. Вторую группу составили 9 ландрас долгунцового типа,
3 ландрасы масличного типа, ландраса маслично-долгунцового типа и стародавний сорт К-37.
Среднее значение DS в этой группе составило 0,214. Третью группу сформировали оставшиеся
15 ландрас долгунцового типа и 1 – долгунцово-масличного типа (К-5991). В третьей груп-
пе полный набор обнаруженных ампликонов имели образцы ландрас К-594, К-5475, К-5991,
а среднее значение генетической дистанции Нея (DS) составило 0,144. В целом использование
ТВР-метода позволило дифференцировать изученные ландрасы L. usitatissimum, что также
подтверждают довольно высокие значения генетических дистанций между ними. Метод мо-
жет быть полезен для оценки генетической чистоты и однородности сортов льна, применим
в молекулярно-филогенетическом анализе этого вида.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
34 Секция 1. Молекулярная генетика, геномика и биоинформатика

В.В. Рассадина1, А.В. Усатов2, М.С. Макаренко2, Н.Г. Аверина1

ВЛИЯНИЕ ПЛАСТИДНЫХ МУТАЦИЙ В ГЕНАХ rpoA И rpoC2 НА БИОГЕНЕЗ


ФОТОСИНТЕТИЧЕСКОГО АППАРАТА В ЛИСТЬЯХ ПОДСОЛНЕЧНИКА

1
Институт биофизики и клеточной инженерии НАН Беларуси
Республика Беларусь, 220072, г. Минск, ул. Академическая, 27
e-mail: valentina_rassadina@rambler.ru
2
Южный федеральный университет
Россия, 344091, г. Ростов-на-Дону, пр. Стачки, 194/1
e-mail: usatova@mail.ru

Развитие и функционирование хлоропластов в фотосинтезирующих тканях растений про-


текает под взаимным контролем ядерного и хлоропластного геномов. Для изучения механиз-
мов биогенеза фотосинтетического аппарата (ФСА) широко используются хлорофилл (Хл)
дефицитные мутанты, как ядерной, так и внеядерной природы.
Изучение активности системы биосинтеза тетрапирролов (Хл и гема) и структурно-
функциональной организации ФСА пигмент-дефицитного пестролистного пластидного мутанта
подсолнечника (Helianthus annuus L.) var 10, индуцированного N-нитрозо-N-метилмочевиной
на основе инбредной линии 3629, позволило предположить, что мутация var 10 не вызывает
изменений в первичной структуре пластогенов, детерминирующих синтез компонентов ФСА,
но нарушает регуляцию их экспрессии. Фенотипическое проявление мутации зависит от ин-
тенсивности света: на свету низкой интенсивности общее количество Хл в молодых растени-
ях мутанта и линии 3629 сопоставимо, однако наблюдается избирательное снижение люми-
несценции комплексов ФС I. На свету высокой интенсивности формируется мутантная ткань
с низким содержанием пигментов (около 0,2% Хл и 8% каротиноидов от их содержания в ис-
ходной линии 3629). По данным РАМ-флуориметрии в мутантной ткани отсутствует перенос
электронов в электрон-транспортной цепи ФСА. При этом активность системы биосинтеза Хл
не лимитирует сборку пигмент-белковых комплексов ФСА. Регуляция активности хлорофил-
лобразования осуществляется в зависимости от потребности в пигменте на уровне изменения
активности начальных (образование 5-аминолевулиновой кислоты) и завершающих (этерифи-
кация хлорофиллида) этапов процесса.
Полногеномное секвенирование хлоропластной ДНК мутантных листьев var 10 позво-
лило локализовать две точковые мутации, приводящих к несинонимичным заменам в генах
rpoA (Thr203Ile) и rpoC2 (Leu768Phe), кодирующих α- и β’-субъединицы пластидной РНК-
полимеразы. Сопоставление собственных экспериментальных данных о динамике фенотипи-
ческого проявления мутации var 10 в ходе онтогенеза растений подсолнечника и ее зависи-
мости от внешних условий (интенсивность освещения, температура) и литературных данных
о механизмах экспрессии пластидных генов позволяет предположить, что выявленные несино-
нимичные замены в генах rpoA и rpoC2 не приводят к полной инактивации пластидной РНК-
полимеразы, но влияют на способность формировать полноценный голофермент, который,
благодаря связи с сигма-факторами, осуществляет транскрипцию пластидных генов в соответ-
ствии с динамично меняющимися факторами среды и стадиями формирования хлоропластов.
Работа выполнена при поддержке Министерства образования и науки РФ, проект
№ 40.91.2014/K.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 1. Молекулярная генетика, геномика и биоинформатика 35

И.Э. Рубель1, О.Ю. Баранов1, С.В. Пантелеев1, О.А. Разумова1, В.А. Гущин2, В.В. Макаров2

СТРУКТУРНО-ФУНКЦИОНАЛЬНАЯ ОРГАНИЗАЦИЯ ВИРУСОПОДОБНЫХ


ГЕНЕТИЧЕСКИХ ЭЛЕМЕНТОВ СОСНЫ ОБЫКНОВЕННОЙ И ЕЛИ ЕВРОПЕЙСКОЙ

Институт леса НАН Беларуси


1

Республика Беларусь, 246001, г. Гомель, ул. Пролетарская, 71


2
НИИ физико-химической биологии имени А.Н. Белозерского МГУ имени М.В.Ломоносова
Россия, 119234, г. Москва, ул. Ленинские горы, 1б12
e-mail: illiarubel@yahoo.com

Вирусоподобными генетическими элементами (ВГЭ) называют нуклеотидные последо-


вательности, интегрированные в геномную ДНК клетки-хозяина и имеющие локусы, гомоло-
гичные генам вирусов из ряда семейств. В геноме хвойных, как и растений в целом, наиболее
распространенным типом ВГЭ являются ретротранспозоны, которые, по существующим пред-
ставлениям, имеют общего предшественника с ретровирусами. Ретротранспозоны – мобильные
генетические элементы I класса, их транспозиция происходит по механизму «копирование-
вставка». К этой группе у высших растений относятся ретротранспозоны, содержащие длин-
ные концевые повторы (LTR – long terminal repeat), и элементы, не содержащие их. Среди по-
следних выделяют длинные диспергированные повторы (LINE) и короткие диспергированные
повторы (SINE). Хотя инфекционные свойства у вирусоподобных генетических элементов
утрачены, они играют негативную роль в лесном хозяйстве, поскольку результатом их транс-
позиции могут стать различные нарушения структурно-функциональной организации генома:
инсерции, приводящие к образованию транскрипционных разрывов в экзонных участках генов
растения или увеличению размеров интронов, а также делеции и транслокации. Это приводит
к появлению нежелательных фенотипических эффектов у древесных и травянистых растений.
Цель данной работы – изучение нуклеотидной структуры вирусоподобных генетиче-
ских элементов ели европейской (Picea abies (L.) H. Karst.) и сосны обыкновенной (Pinus
sylvestris L.).
При помощи системы высокопроизводительного секвенирования на основе полупрово-
дниковой детекции протонов (технология Ion Torrent) было проведено секвенирование ДНК-
и кДНК-библиотек ели европейской и сосны обыкновенной. С целью изучения разнообразия
вирусоподобных генетических элементов хвойных осуществили поиск и аннотацию последо-
вательностей, имеющих сходство с уже описанными ВГЭ, используя онлайн-сервис BLAST
базы данных GenBank NCBI.
В результате анализа было выявлено 86 протяженных последовательностей (контигов)
ели европейской и сосны обыкновенной – потенциальные кандидаты в вирусоподобные ге-
нетические элементы. Было установлено, что они имеют сходство с различными типами ре-
тротранспозонов. При этом 77 из идентифицированных последовательностей относились
к LTR-содержащим ретротранспозонам группы Ty3/Gypsy, 4 контига – к группе Ty1/Copia,
а 5 – к ретротранспозонам семейства LINE.
Интересно отметить, что обнаруженные последовательности оказались уникальными,
а значительная их часть содержала фрагменты различных генов первичного и вторичного ме-
таболизма хвойных (3-каренсинтетазы, (-)энт-кауренсинтетазы, цитохрома P450 подсемейства
CYP720B и др.), что может косвенно свидетельствовать об их роли в формировании адаптив-
ной изменчивости растений.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
36 Секция 1. Молекулярная генетика, геномика и биоинформатика

Н.Н. Рудакова, М.Г. Алексеева, Д.А. Мавлетова, А.А. Ватлин, О.Б. Беккер, Н.В. Захаревич,
В.Н. Даниленко

АМИНОГЛИКОЗИДФОСФОТРАНСФЕРАЗЫ АКТИНОБАКТЕРИЙ: СТРУКТУРА


И ФУНКЦИИ, ВКЛАД В УСТОЙЧИВОСТЬ К АМИНОГЛИКОЗИДНЫМ
АНТБИОТИКАМ У ВОЗБУДИТЕЛЕЙ ТУБЕРКУЛЕЗА И АКТИНОМИКОЗОВ

Институт общей генетики им. Н.И. Вавилова РАН


Россия, 119991, г. Москва, ГСП-1 Москва, ул. Губкина, д. 3
e-mail: valerid@vigg.ru

Для лечения туберкулеза и актиномикозов в комплексной терапии часто применяются ан-


тибиотики, в том числе и аминогликозидные. Появление лекарственно-устойчивых бактерий
создает необходимость разработки новых лекарственных средств, действующих на новые бак-
териальные биомишени. Одной из таких биомишеней являются аминогликозидфосфотрансфе-
разы (Aph). Хорошо известны гены аph, локализованные на плазмидах и мобильных элементах
штаммов, выделенных из клинических изолятов. У актинобактерий – штаммов-продуцентов
аминогликозидных антибиотиков – были обнаружены Aph ферменты второго типа. Позже были
выявлены Aph ферменты третьего типа, обуславливающие природную устойчивость к амино-
гликозидам у других актинобактерий, включая Mycobacterium tuberculosis, Actinomyces israelii
и Staphylococcus albus.
Биоинформатический анализ, проведенный нами, показал, что в геномах актинобактерий
присутствует от 4 до 14 генов аминогликозидфосфотрансфераз. Они определяют исходный
(природный) уровень устойчивости к данным антибиотикам. Ранее нами была идентифициро-
вана и охарактеризована аминогликозид-3´-фосфотрансфераза нового типа – AphVIII – в штам-
ме Streptomyces rimosus АТСС10970 (продуценте окситетрациклина), важной особенностью
которой является зависимость активности фермента от уровня его фосфорилирования серин-
треониновыми протеинкиназами.
Недавно было проведено полногеномное секвенирование штамма Streptomyces rimosus
subsp. rimosus АТСС10970. При биоинформатическом анализе генома нами было выявлено
14 aph генов, обозначенных как aphSR1–aphSR14 (включая aphSR5-aphVIII). На основании фи-
логенетического сходства с 7 существующими подсемействами аминогликозидфосфотрансфе-
раз для клонирования в E. coli был отобран ген aphSR3 (locus_tag SRIM_08058), обозначенный
нами как aph(3”)-IIa. Штамм E. coli BL21(DE3) pET16b:aph(3”)-IIa устойчив к стрептомицину
в концентрации 150 мкг/мл, но чувствителен к канамицину (в отличие от aphVIII). Выделен
белок Aph(3”)-IIa в препаративном количестве, с использованием меченой АТФ и с помощью
люминесцентной реакции показана высокая способность фермента к автофосфорилированию
и фосфорилированию субстрата – стрептомицина.
В лаборатории генетики микроорганизмов ИОГен РАН проведено полногеномное секвени-
рование штамма Streptomyces fradiae ATCC19609, сверхчувствительного к аминогликозидным
антибиотикам, было обнаружено 9 генов аph. В геномах патогенных бактерий M. tuberculosis
было выявлено 5 генов aph, S. albus – 6, A. israelii – 4 гена. Исследование их функций являет-
ся важным для изучения механизма устойчивости патогенных актинобактерий к аминоглико-
зидным антибиотикам.
В настоящее время проводится клонирование aph генов, относящихся к другим классам
в Е. coli, исследование спектра и уровня устойчивости к аминогликозидным антибиотикам, вы-
деление рекомбинантных белков, исследование субстратной специфичности и других функций.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 1. Молекулярная генетика, геномика и биоинформатика 37

С.А. Руднева, А.А. Хаченкова, Л.Ф. Курило

ЭПИГЕНЕТИЧЕСКИЕ МЕХАНИЗМЫ РЕГУЛЯЦИИ СПЕРМАТОГЕНЕЗА

Медико-генетический научный центр


Россия, 115478, г. Москва, ул. Москворечье, 1
e-mail: reprоlab@med.gen.ru

Мужские половые клетки имеют сложный транскриптом. Помимо матричных РНК, коди-
рующих белки, в нем присутствует много некодирующих РНК, включая микроРНК. Известно,
что микроРНК (миРНК) являются важными регуляторами экспрессии генов. Они функциони-
руют в основном посттранскрипционно, контролируя стабильность или трансляцию их целе-
вых мессенджеров – мРНК. Эти миРНК экспрессируются в клетке и во время сперматогенеза
участвуют в контроле каждого этапа дифференцировки мужских половых клеток. Поскольку
совершенно разные группы генов экспрессируются в митотических сперматогониях, в мейо-
тических сперматоцитах и в гаплоидных сперматидах.
Систематизируя литературные данные, мы охарактеризовали все известные к настоящему
моменту микроРНК, участвующие в сперматогенезе, оценили их функциональную значимость
на разных этапах дифференцировки половых клеток и наметили ряд наиболее перспективных
микроРНК, которые возможно использовать в качестве маркеров для создания диагностиче-
ских панелей мужского бесплодия.

Предполагаемые функции миРНК в половых клетках:


В сперматогониях: miRNA-21 (устойчивость к апоптозу), miR-20, -106a, miR-221/222,
miR-146 (подавление дальнейшей дифференцировки). Делеция в районе miR-17-92 приводит
к синдрому яичек малого размера и нарушению сперматогенеза у мышей.
В сперматоцитах и сперматидах на разных стадиях развития: miRNA-34c (индукция апоп-
тоза), miR-449 (регуляция мейоза), miRNA-18 (регуляция (деградация) мРНК транскрипцион-
ного фактора Нsf2), miR-469 (регуляция (деградация) мРНК транзиторных белков TP2 и про-
таминов Prm2), miRNA-122a (регуляция (деградация) мРНК транзиторных белков TP2).

Потенциальные биомаркеры мужского бесплодия:


МикроРНК в сперме человека при олигоастенозооспермии:
Повышенный уровень : miR-141, -200a. Пониженный уровень: miR-34b, -15b, -34c-5p, -34b,
-449a, -1973, -122, -16, -19a.
При астенозооспермии:
Повышенный уровень: miR-200a, -141. Пониженный уровень : miRNA-1973, -34b, -122.
МикроРНК в семенной плазме:
Пониженный уровень при необструктивной азооспермии, повышенный уровень при асте-
нозооспермии: miR-34c-5p, -122, -146b-5p, -181a, -374b, -509–5p, -513a-5p.
Пониженный уровень при необструктивной азооспермии: miR-141, -429, -7-1-3p.

Показано, что некоторые SNP в 3'-нетранслируемой области генов, вовлеченных в спер-


матогенез (в пределах сайтов связывания микроРНК), могут быть связаны с идиопатическим
мужским бесплодием. Выявлено шесть полиморфизмов (два – в CYP19, Serpina5 и четы-
ре – в CGA, CPEB1 и CPEB2), участвующих в понижении уровня экспрессии генов во время
сперматогенеза и мейоза, а с помощью программ биоинформатики, таких как Pictar, Miranda,
TargetScan, высказано предположение, что данные SNP могут влиять на связывание (сродство)
с микроРНК.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
38 Секция 1. Молекулярная генетика, геномика и биоинформатика

Т.В. Сизова1, И.А. Иванов2, В.Е. Спангенберг1, О.И. Карпова3

ДЛИНА ПЕТЕЛЬ ХРОМАТИНА В ПРОФАЗЕ I МЕЙОЗА ГЕНОМА МЫШИ ЗАВИСИТ


ОТ КОМПОЗИЦИОННОГО СОСТАВА ДНК

Институт общей генетики им. Н.И. Вавилова РАН


1

Российская Федерация, 119991, г. Москва, ГСП-1, ул. Губкина, 3


2
Московский авиационный институт (государственный технический университет)
Российская Федерация, 125993, г. Москва, A-80, ГСП-3, Волоколамское шоссе, 4
3
Московский государственный университет им М.В. Ломоносова
Российская Федерация, 119991, г. Москва, Ленинские горы, 1
e-mail: olonare@mail.ru

На стадии профазы I мейоза хромосомы представляют собой петли, которые заякорены


на боковых элементах синаптонемного комплекса (СК). Считается, что в пределах биологиче-
ских видов длина петель хроматина варьирует не более чем в два раза, и нет различия по длине
этих петель между районами G- и R-бэндов. Молекулярной основой хромосомного бэндинга
являются изохоры – протяженные (в среднем около 1 млн. пар оснований), относительно го-
могенные участки ДНК, принадлежащие к небольшому количеству семейств. В геноме мыши
выявлены 4 изохорных семейства: L1, L2, H1 и H2, характеризующиеся увеличивающимся
уровнем GC. Изохоры связаны с основными структурными и функциональными свойствами
генома, такими, как плотность генов, время репликации и т.д.
В настоящее время доступна база данных размером 10,2 МБ, содержащая 64 283 последо-
вательности ДНК, на стадии профазы I мейоза связанных по всей длине хромосом с белком
SCP3 в геноме мыши (Mus musculus). Полностью секвенирован и аннотирован ряд геномов
млекопитающих, в них определены границы изохор. Существует также программное обеспе-
чение, позволяющее выравнивать последовательность ДНК с полным геномом.
Мы выровняли со сборкой GRCm38.p3 генома мыши все последовательности ДНК из ука-
занной выше базы данных и отобрали те из них, чье положение в геноме определяется одно-
значно. Затем мы соотнесли распределение этих последовательностей с распределением изохор.
В результате сравнения получены данные, свидетельствующие о том, что длина петель вдоль
одной хромосомы может различаться на порядок, при этом в состав длинных петель входят
участки ДНК, соответствующие GC-бедным изохорам, а коротких – GC-бедным.
Работа поддержана грантом РФФИ №16-04-01-447А.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 1. Молекулярная генетика, геномика и биоинформатика 39

A.А. Стахеев, С.К. Завриев

ОСОБЕННОСТИ ГЕНЕТИЧЕСКОГО АППАРАТА БИОСИНТЕЗА ТРИХОТЕЦЕНОВЫХ


ТОКСИНОВ У АСКОМИЦЕТНЫХ ГРИБОВ РОДА FUSARIUM: МЕХАНИЗМЫ
ЭВОЛЮЦИИ, СТРУКТУРНЫЙ И ФУНКЦИОНАЛЬНЫЙ АНАЛИЗ
НЕОХАРАКТЕРИЗОВАННЫХ ГЕНОВ

Институт биоорганической химии имени академиков М.М. Шемякина и Ю.А. Овчинникова РАН


Российская Федерация, 117997, г. Москва, ул. Миклухо-Маклая, 16/10
e-mail: stakheev.aa@gmail.com

Аскомицетные грибы рода Fusarium могут наносить существенный ущерб сельскому хо-
зяйству, а также представлять угрозу для здоровья человека и животных, поскольку являются
продуцентами широкого спектра вторичных токсических метаболитов – фузариотоксинов.
Наиболее распространённой группой токсических соединений, продуцируемых грибами рода
Fusarium, являются трихотеценовые микотоксины, представляющие собой сесквитерпеноид-
ные соединения, разделяемые на 4 основных группы (A–D) в зависимости от строения боковой
цепи. Примером опасности, которую представляют эти соединения, может служить вспыш-
ка алиментарно-токсической алейкии в Поволжье, Западной Сибири и на Урале, результатом
которой стала гибель порядка 40 тысяч человек. Как было установлено, основной причиной
вспышки стало потребление в пищу перезимовавшего в поле зерна, контаминированного три-
хотеценовыми токсинами, прежде всего Т-2 токсином и деацетоксисцирпенолом (ДАС).
Основными продуцентами трихотеценовых токсинов являются виды F. graminearum,
F. culmorum, F. sporotrichioides, F. poae. Серьёзный интерес также представляют недавно вы-
деленные в качестве отдельных видов F. langsethiae, F. ussurianum, F. sibiricum. Гены, ответ-
ственные за синтез трихотеценовых токсинов, сгруппированы в 3 кластера, расположенных на
разных хромосомах. Общее число генов, вовлеченных в биосинтетический каскад, составляет
15 генов, некоторые из которых могут быть нефункциональными в зависимости от конкрет-
ного вида и его токсинового профиля. Изучение структуры трихотеценового кластера важно
для понимания эволюции грибных геномов, а также механизмов приспособления грибов к
условиям среды обитания.
В составе основного кластера, состоящего из 12 генов, присутствуют 2 гена, функция которых
до сегодняшнего дня не установлена – TRI9 и TRI14. Кроме того, структуры этих генов опреде-
лены лишь у двух видов – F. graminearum и F. sporotrichioides. Проблема их функциональной ха-
рактеристики затрудняется тем, что в международных базах данных не содержится информации
о каких-либо сходных по структуре генов с известной функцией у других организмов.
В настоящей работе определена структура генов TRI9 и TRI14 у 8 видов грибов рода
Fusarium, характеризующихся различными хемотипами и образующих разные количества три-
хотеценовых токсинов. С помощью методов биоинформатики определены вероятные структуры
белков, кодируемых этими генами, а также проведен филогенетический анализ исследованной
выборки штаммов. Изучена динамика экспрессии генов TRI9 и TRI14 на разных этапах разви-
тия культуры гриба. Кроме того, проведена подготовительная работа по получению мутантных
по генам TRI9 и TRI14 штаммов видов F. graminearum, F. sporotrichioides и F. poae.
Работа выполнена при финансовой поддержке гранта РФФИ 16-34-01369.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
40 Секция 1. Молекулярная генетика, геномика и биоинформатика

В.Н. Стефанова1, Н.Г. Иванова1, И.В. Матвеев1, О.А.Епишко2, О.И. Подгорная1

ПОИСК И ИЗУЧЕНИЕ ТАНДЕМНЫХ ПОВТОРОВ В ГЕНОМАХ РАЗНЫХ ПОРОД


ДОМАШНЕЙ СВИНЬИ

Институт цитологии РАН


1

Россия, 194064, г. Санкт-Петербург, Тихорецкий пр., 4


e-mail: vestefan@mail.ru
2
Гродненский государственный аграрный университет
Республика Беларусь, 230023, г. Гродно, ул. Академическая, 10
e-mail:labgen@mail.ru

Работа посвящена изучению конститутивного гетерохроматина, который состоит в основ-


ном из тандемных повторов (ТП), функциональное значение которого в геноме эукариот
остается невыясненным. ТП являются основными компонентами таких структурных важных
компонентов хромосом как теломеры, центромеры и гетерохроматиновые районы. Области
конститутивного гетерохроматина, обогащенные ТП, обычно отсутствуют или недостаточно
представлены в геномных сборках. Это объясняется тем, что ТП плохо поддаются клонирова-
нию, однако захватываются при секвенировании за счет высокого содержания в геноме.
Ранее в нашей лаборатории была показана возможность поиска ТП в полногеномной сборке
(WGS) генома M. musculus методами биоинформатики (Komissarov et al., 2011). В настоящей
работе проведен поиск и классификация ТП в геномных сборках четырех пород свиньи Sus
scrofa: дюрок, китайская карликовая, тибетская, геттингенская карликовая. Качество сборок
геномов у этих пород сопоставимо между собой, но значительно хуже, чем у хорошо собран-
ных геномов человека и мыши. В четырех сборках обнаружено 126 семейств ТП, из которых
5 уже были внесены в базу данных повторов RepBase как клонированные экспериментально.
121 семейство ТП обнаружено впервые. Среди семейств ТП есть как общие для всех проана-
лизированных пород (12 семейств), так и семейства ТП, специфичные для каждой породы.
Был проанализирован состав мономеров семейств ТП, при этом обнаружили много семейств,
мономеры которых имеют гомологию с ретроэлементами. Оказалось, что многие ТП свиньи
образованы на основе определенного фрагмента LINE1, что согласуется с данными для мы-
ши и человека (Kuznetsova et al., 2016). Вместе с тем обнаружено много полей семейств ТП,
мономеры которых образованы из фрагментов SINE, что, видимо, является характерной осо-
бенностью генома свиньи. Результаты, полученные в данной работе, объясняют специфическое
распределение SINE и LINE ретроэлементов на хромосомах свиньи в отличие от хромосом
человека и мыши, известное по литературным данным.
На основе полученных данных были сконструированы олигонуклеотидные пробы к неко-
торым из ТП, обнаруженных in silico. С помощью FISH картировали как известные ранее, так
и вновь обнаруженные семейства ТП на хромосомах свиньи. ТП были выявлены в прицен-
тромерных районах всех акроцентриков в кариотипе свиньи или всех суб- и метацентриков.
Таким образом, доказана применимость метода олиго-FISH для картирования ТП.
В дальнейшем конкретные последовательности ТП, представленные в работе, позволят
создавать олигонуклеотидные пробы, специфичные как для отдельных хромосом свиньи так
и, возможно, специфичные для определенных пород, что можно будет использовать для гено-
типирования пород свиней.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 1. Молекулярная генетика, геномика и биоинформатика 41

П.В. Тарлыков1, Е.В. Жолдыбаева1, М.Л. Филипенко2, Е.М. Раманкулов1,3

РАЗРАБОТКА ПРОТОКОЛА РЕПАРАЦИИ ПАЛЕОДНК ДЛЯ ЭФФЕКТИВНОГО


МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКОГО АНАЛИЗА

РГП «Национальный центр биотехнологии» КН МОН РК


1

Республика Казахстан, 010000, г. Астана, Кургальжинское ш., 13/5


2
Институт химической биологии и фундаментальной медицины СО РАН
Россия, 630090, г. Новосибирск, пр. Ак. Лаврентьева, 8
3
Школа наук и технологий Назарбаев Университета
Республика Казахстан, 010000, г. Астана, пр. Кабанбай Батыра, 53
e-mail: pavel.tarlykov@gmail.com

В настоящее время палеогенетика помогает ответить на вопросы происхождения, эволюции
и коэволюции человека, домашних животных и их инфекционных агентов (вирусов и бакте-
рий), тем самым представляя собой важное научное направление. Работы по изучению древней
ДНК зачастую публикуются в высокорейтинговых журналах, что подтверждает их значимость
и живой интерес мировой общественности к этим результатам.
В то же время работа с древней ДНК сопряжена с рядом определенных трудностей. Из-
вестно, что с течением времени содержащаяся в останках растительного или животного про-
исхождения ДНК разрушается путем накопления модифицированных оснований ДНК, что
значительно осложняет ее дальнейший анализ. Для решения этой проблемы был разработан
протокол репарации древней ДНК для повышения эффективности молекулярно-генетического
анализа при работе с останками животного происхождения. Репарация модифицированных
оснований ДНК, которые имеются у палеоДНК, осуществлялась за счет репарационного кок-
тейля, представляющего собой смесь нескольких ферментов. В частности, основу разработан-
ного репарационного коктейля составляет фермент урацил-ДНК-гликозилаза. Данный фермент
катализирует высвобождение урацила из урацил-содержащих одно- или двуцепочечной ДНК
или из цепи ДНК, находящейся в дуплексе с цепью РНК, образуя апуриновое основание. В до-
полнение к этому в репарационной коктейль был включен фермент эндонуклеаза-8 для рас-
щепления сайта после воздействия урацил-ДНК-гликозилазы. Совместное использование
этих двух компонентов обеспечивает наиболее эффективную репарацию ДНК, что было под-
тверждено в ходе применения разработанного репарационного коктейля на ДНК, выделенной
из древних костных останков овец. Другие варианты репарационных смесей, к примеру, смесь,
содержащая Т4 лигазу и ДНК полимеразу I, показали более низкую степень репарации ДНК.
Использование указанных результатов позволяет существенно расширить спектр проводи-
мых палеогенетических работ, а также повысить уровень исследований по работе с древним
биоматериалом, получаемым в результате археологических исследований.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
42 Секция 1. Молекулярная генетика, геномика и биоинформатика

И.В. Чадаева, В.Н. Бабенко, А.О. Брагин, Ю.Л. Орлов

АЛЬТЕРНАТИВНЫЙ СПЛАЙСИНГ И ДИФФЕРЕНЦИАЛЬНАЯ ЭКСПРЕССИЯ


ГЕНОВ В ТКАНЯХ МОЗГА КРЫС

Институт цитологии и генетики СО РАН


Россия, 630090, г. Новосибирск, пр-т. Лаврентьева, 10
e-mail: ichadaeva@bionet.nsc.ru

Неотъемлемой частью процесса дифференциации и функционирования генов нервной тка-


ни высших эукариот является альтернативный сплайсинг. При этом процесс специализации
тканеспецифической экспрессии является многоуровневым, включающим в себя процессы
репликации, транскрипции и сплайсинга, а также микро-РНК (миРНК) регуляции факторов,
участвующих в регуляции сплайсинга экспрессии генов нервной ткани. Особенностью многих
нейроспецифических генов является необычно большая длина этих генов, что служит под-
тверждением присутствия альтернативного сплайсинга. Степень интенсивности сплайсинга,
в свою очередь, связана с длиной генов, а именно, с длиной интронов и числом экзонов.
Эпигенетические факторы, такие как модификации гистонов и метилирование ДНК, могут
быть вовлечены в определение процесса сплайсинга. В нашей работе рассмотрен дифферен-
циальный альтернативный сплайсинг генов при сравнении двух линий крыс – агрессивных
и ручных – на основе анализа данных RNA-Seq. Использовали образцы тканей из нескольких
отделов головного мозга, связанных с агрессивным поведением у крыс. Эксперименты выпол-
нены на самцах серых крыс-пасюков, прошедших селекцию на агрессивность («агрессивные»
n = 10) и на прирученность («ручные» n = 12). В работе использовали 12 образцов нервной
ткани: образцы (2 реплики) из 3-х отделов головного мозга агрессивных и ручных крыс – ги-
поталамус, покрышка среднего мозга (ПСМ) и периакведуктум серого вещества (ПСВ). За-
бор биологического материала осуществляли после декапитации животных. Образцы нервной
ткани головного мозга крыс обеих линий были изъяты в соответствии со специализированной
картой, представленной в Allen Mouse Brain Atlas. После препарирования образцы тканей моз-
га крыс были отданы в компанию «Геноаналитика» (Москва), где мРНК были экстрагированы
с использованием Dynabeads mRNA Purification Kit (Ambion). Библиотеки кДНК были получе-
ны с помощью инструментального набора Illumina (США) в соответствии с протоколом про-
изводителя и направлены на секвенирование. Для каждого образца было получено порядка
20 миллионов прочтений.
С помощью РНК-профилирования определен основной класс нейронных альтернативно
сплайсирующихся генов, таких как гены синаптической специализации, среди которых вы-
делены профили дифференциально сплайсирующихся изоформ. Наблюдаемое достоверное
различие пропорций альтернативных транскриптов в ряде генов синапса при анализе трех
отделов мозга между агрессивными и ручными крысами может обуславливать соответствую-
щее специфическое поведение. Отклонения пропорций транскриптов синапса может быть
обусловлено изменением экспрессии нейроспецифических РНК-связывающих белков сплай-
синга, таких как SLM1(2), NOVA, PTB2 и других.
Были выявлены следующие нейроспецифические энхансеры сплайсинга, одновременно
модифицирующие структуру мРНК значительного числа генов: NOVA1/2, FOX1/2, nSR100/
SRM4, а также сайленсеры PTB1/2. При этом была показана динамическая конкуренция ука-
занных энхансеров и репрессора PTB1, различная в отделах мозга и стадиях его развития.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 1. Молекулярная генетика, геномика и биоинформатика 43

А.Б. Шевцов1, Е.С. Шевцова1, Д.К. Камалова1, Т.Б. Карибаев2, И.И. Сытник2, Е.М. Раманкулов1,
К.К. Муканов1

Анализ множественных тандемных повторов (MLVA-16) штаммов


бруцелл, выделенных в Казахстане с 1947 по 2015 годы

1
РГП «Национальный центр биотехнологии» КН МОН РК
Республика Казахстан, 010000, г. Астана, Кургальжинское шоссе, 13/5
e-mail: shevtsov@biocenter.kz
2
РГП «Национальный референтный центр по ветеринарии» МСХ РК
Республика Казахстан, 010000, г. Астана, ул 150 лет Абая, 22/3
e-mail: ncmr@minagri.kz

Бруцеллез как зоонозная инфекция наносит большой экономический и социальный ущерб.


Бруцеллез относится к числу эндемичных инфекций в ряде стран мира. В Казахстане успеш-
ная реализация программы борьбы с данной инфекцией позволила сократить случаи впер-
вые выявленного бруцеллеза с 24 случаев на 100 000 населения в 2004 году до 8,5 случаев
в 2013 году. Однако недостаточный контроль за передвижением животных является основным
фактором распространения бруцеллеза. Современные молекулярно-генетические методы по-
зволяют отслеживать источник вспышки инфекции и выявлять вновь появляющиеся геноти-
пы. Для генетических исследований бруцелл наибольшей дискриминационной способностью
обладает метод анализа множественных тандемных повторов (MLVA-16). Ранее проведенные
нами исследования показали низкое генетическое разнообразие 124 штаммов Brucella abor-
tus, выделенных от животных из двух областей республики, индекс генетического разнообра-
зия (HGDI) MLVA-16 составил 0,491. Данная дискриминационная способность недостаточна
для эпидемиологического мониторинга, что возможно было связано с маленьким ареалом от-
бора проб. В связи с этим, в рамках данных исследований нами расширен ареал отбора проб,
а также были использованы образцы, хранящиеся в депозитарии с 1948 года.
Всего было использовано 94 штамма B. abortus, 69 из которых были выделены от серопо-
ложительных животных с 2007 по 2015 годы, а 25 образцов были взяты из депозитария с пе-
риодом выделения с 1948 по 1985 годы. ДНК выделяли из 48-часовых культур, инактивирован-
ных хлороформом, c использованием DNeasy Blood Tissue Kit (Qiagen) согласно инструкции
производителя. MLVA-генотипирование было осуществлено с использованием мультиплекс-
ного ПЦР и капиллярного электрофореза. Анализ фрагментов проводили с использованием
программного обеспечения Gene-mapper 4.1 (Applied Biosystems). Построение дендограммы
проводили с использованием программного обеспечения BioNumerics 7.5 (Applied Maths). Кла-
стерный анализ был проведен методом невзвешенного попарного среднего (UPGMA). Индекс
Хантера-Гастона (HGDI) был использован для оценки генетического разнообразия каждого
локуса, а также панелей MLVA-8, MLVA-11, MLVA-16. 94 штамма на основе MLVA-16 были
кластеризованы в 28 генотипов из которых 16 были представлены одним штаммом. Локусы
Bruce-09, Bruce-07 и Bruce-04 из панели 2В имели самый высокий HGDI – 0,779, 0,764 и 0,553
соответственно. Дискриминационная способность для набора 16 VNTR-локусов, рассчитанная
с использованием индекса Хантера-Гастона, составила 0,948. На основе MLVA-8 к 36 гено-
типу были отнесены 91% анализируемых штаммов. Остальные штаммы были отнесены к 38
и 28 генотипу, два штамма не удалось отнести ни к одному из ранее известных генотипов.
Установлено, что MLVA профиль более 47% штаммов имеют локализованное географическое
распространение. Таким образом, высокая дискриминационная способность и географическая
локализация отдельных MLVA-типов позволяет использовать метод MLVA для молекулярного
эпидемиологического обследования.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
44 Секция 1. Молекулярная генетика, геномика и биоинформатика

Т. Шестакова, Е. Чернолев, О. Табэрэ, А. Муту, А. Порт, М. Дука

ОЦЕНКА ГЕНЕТИЧЕСКОГО РАЗНООБРАЗИЯ ПОПУЛЯЦИЙ ЗАРАЗИХИ


ПОДСОЛНЕЧНИКА В РЕСПУБЛИКЕ МОЛДОВА С ПОМОЩЬЮ
МИКРОСАТЕЛЛИТНЫХ МАРКЕРОВ

Центр Функциональной Генетики, Университет Академии Наук Молдовы


Республика Молдова, MD-2028, г. Кишинэу, ул. Академическая, 3/2
e-mail: tatiana.shestacova@gmail.com

Подсолнечник является одной из самых важных культур для сельского хозяйства Респу-
блики Молдова, занимая третье место по культивируемой площади после пшеницы и куку-
рузы. На территории Республики Молдова одним из наиболее опасных растений-паразитов,
которые значительно снижают урожайность подсолнечника, является заразиха (Orobanche cu-
mana Wallr.). Вирулентность данного паразита напрямую зависит от физиологической расы.
На данный момент, известны восемь физиологических рас заразихи подсолнечника (A–H).
Иформация о географическом распространении физиологических рас патогена является важ-
ной для фермеров и селекционеров, позволяя подбирать соответствующие гибридные формы
для выращивания в различных регионах.
Таким образом, целью данной работы являлась оценка генетического разнообразия различ-
ных популяций заразихи из Республики Молдова. Сбор биологического материала осущест-
влялся в 80 населенных пунктах из 27 районов Республики Молдова. Всего были исследованы
44 популяции (41 – из Республики Молдова и по одной – из Румынии, Украины и Испании).
Образцы ДНК выделяли с помощью набора реактивов GeneJET Plant Genomic DNA Purification
Mini Kit (Thermo Scientific). Для оценки генетического разнообразия использовали 15 микро-
сателлитных маркеров (Ocum-52, -59, -70, -74, -75, -81, -87, -108, -122, -141, -160, -174, -196,
-197 и -206), ранее описанных в литературе как высокополиморфные. ПЦР осуществлялась со
следующей концентрацией компонентов реационной смеси: 200 мкM дНТФ, 2,0 мM MgCl2,
1,0 ед. ДНК-полимеразы DreamTaq Green DNA Polymerase (Thermo Scientific), 0,4 мкM каждо-
го праймера, 50 нг ДНК. Реакция проходила в объёме 15 мкл. Для амплификации использова-
ли следующую программу: 95 °С – 3 мин; 35 циклов 95 °С – 30 с, 57 °С – 45 с, 72 °С – 1 мин;
72 °С – 5 мин. Результаты амплификации анализировали в 8%-ном полиакриламидном геле в
ТБЕ-буффере.
В ходе исследования был выявлен различный уровень генетического полиморфизма изу-
чаемых популяций. Наибольший уровень полиморфизма был отмечен для трёх маркеров из
15-ти изучаемых – Ocum-197, -160 и -59. В дальнейшем планируется установить связь между
генетическим профилем популяции, полученном с помощью микросателлитных маркеров,
физиологической расой и географическим распространением / ареалом. Эти данные позволят
выявить специфические маркеры для дискриминации физиологических рас и установления
филогенетических связей между популяциями, что имеет важное теоретическое и приклад-
ное значение.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 1. Молекулярная генетика, геномика и биоинформатика 45

Н.А. Шкутэ

ВЛИЯНИЕ ФАКТОРОВ ВНЕШНЕЙ СРЕДЫ НА ЭПИГЕНЕТИЧЕСКИЕ


ИЗМЕНЕНИЯ ГЕНОМА

Life science and tehnology institute of Daugavpils University


Latvia, LV-5400, Daugavpils, Parades str., 1A
e-mail: natalja.skute@du.lv

Эпигенетические изменения представляет собой наследуемые изменения фенотипа, которые


не связаны с изменениями первичной структуры ДНК. Такие изменения включают в себя моди-
фикацию гистонов, интерференцию РНК, метилирование ядерной ДНК и др. Эпигинетические
изменеия определяют клеточную дифференцировку и специфичность, пластичность, а также
клеточную регенерацию, память, старение и смерть, а также участвуют в импритинге хромо-
сом, репрограммировании генома клеток при трансплантации и во многих других процессах.
Эпигенетические изменения происходят в онтогенезе и при различных заболеваниях
под влиянием стресса, диеты. Существует целый ряд эпигенетических болезней. Эпигенети-
ческие методы используют в диагностике и терапии многих заболеваний. Однако эпигенети-
ческие изменения могут служить также индикатором влияния факторов окружающей среды
на организмы и популяции в целом. Недавние исследования показали, что эпигенетическая из-
менчивость и разнообразие в популяции коррелируют с ее гетерозиготностью и инбридингом.
Существуют большое разноообразие методов для определения эпигенетических измене-
ний как в целом геноме, так и на уровне отдельных генов и молекул: гистонов и РНК. В нашей
лаборатории был успешно апробирован и применен люминометрический метод для анализа
эпигенетического состояния популяций различных видов растений и животных, а также про-
ведены эксперименты по влиянию различных факторов на метилирование ядерной ДНК в ла-
бораторных условиях.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
46 Секция 1. Молекулярная генетика, геномика и биоинформатика

Г.В. Шпаковский, Ю.В. Долудин, А.В. Аралов, И.Ю. Словохотов, В.Н. Клыков,
Д.Г. Шпаковский, Е.К. Шематорова

НОВЫЕ КОМПЛЕКСЫ ГЕННОЙ ЭКСПРЕССИИ И ИХ РОЛЬ В ВОЗНИКНОВЕНИИ


И ЭВОЛЮЦИИ РОДА HOMO

Институт биоорганической химии имени академиков М.М. Шемякина и Ю.А. Овчинникова РАН


Россия, 117997, г. Москва, ГСП-7, ул. Миклухо-Маклая, 16/10
e-mail: gvs@ibch.ru

Важным источником эволюционных инноваций являются хромосомные перестройки. Ис-


следования последних лет показали, что важнейшую роль в эволюции сложных, уже сложив-
шихся высокоорганизованных геномов играют сегментные дупликации, способствующие воз-
никновению новых генных семейств и, как следствие, ускорению эволюционного процесса.
Среди такого рода перестроек наиболее частыми и ценными являются внутрихромосомные
дупликации целых генов или их протяжённых фрагментов. C позиций антропогенеза наи-
больший интерес представляют относительно недавние, специфичные для высших приматов,
дупликации.
Мы изучили молекулярную эволюцию генов POLR2J системы транскрипции и PMS2 си-
стемы репарации MMR и показали, что появление и совершенствование генетической струк-
туры обоих этих генных семейств чётко коррелируют с основными этапами биологической
эволюции высших приматов. Это позволяет рассматривать семейства генов PMS2 и POLR2J
в качестве удобных и достоверных молекулярных маркеров антропогенеза (Генетика, 2010,
46: 1254–1257). Для того, чтобы понять роль новых генов РНК-полимеразного хозяйства POL-
R2J2 и POLR2J3 в дивергенции систем регуляции генной экспрессии у человека мы с помо-
щью генетического (дрожжевая двухгибридная система) и биохимических (соосаждения бел-
ков из клеточных лизатов, иммунопреципитация) подходов провели поиск белков-партнёров
целого ряда специфических для человека белков (hRPB11ba, hRPB11bb и hRPB11сa, hRPB-
11cb), продуцируемых в результате экспрессии этих эволюционно молодых генов в нервной
(эмбриональный мозг) и иммунной (клеточная линия Jurkat) тканях Homo sapiens. Кроме того,
всесторонне изучены взаимодействия трёх главных изоформ субъединицы POLR2J (hRPB11a,
hRPB11ba и hRPB11bb) c субъединицами POLR2C (hRPB3) и POLR2F (hRPB6) в составе соот-
ветствующих комплексов РНК-полимеразы II человека, состоящих из двенадцати субъединиц
каждый. Показано, что взаимодействия именно этих белков (hRPB11-hRPB3 и hRPB11-hRPB6)
определяют специфику каждого из трёх РНК-полимеразных комплексов Homo sapiens. С по-
мощью делеционного картирования определены минимальные зоны взаимодействий всех трёх
изоформ hRPB11 с субъединицами hRPB3 и hRPB6, что позволило объяснить более сильные
контакты в случае минорной изоформы hRPB11ba. С помощью генетических (супрессорный
анализ, дрожжевая двухгибридная система) подходов обнаружено взаимодействие субъединиц
hRPB6 и hRPB8 в составе РНК-полимеразы II Homo sapiens, что хорошо согласуется с отме-
ченным нами ранее смещением субъединицы hRPB6 в сторону гетеродимера hRPB11-hRPB3
в составе базового фермента транскрипции человека (взаимодействие субъединиц hRPB6
и hRPB11 выявлено нами впервые).
Определён уровень экспрессии специфической, впервые обнаруженной нами мРНК
COMMD4d в различных органах человека и с помощью детального анализа интерактома белка
COMMD4d в нервной и иммунной тканях Homo sapiens определены основные функциональные
модули этого белка – важного партнёра минорной изоформы субъединицы РНК-полимеразы II
человека hRPB11ba.
Работа выполнена при финансовой поддержке Российского фонда фундаментальных ис-
следований (проект № 14-04-01485).

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 1. Молекулярная генетика, геномика и биоинформатика 47

P.C. Li, R.N. Kalendar, B.B. Khassenov

EXPRESSION AND PURIFICATION OF LARGE FRAGMENT OF POLYMERASE


FROM GEOBACILLUS STEAROTHERMOPHILUS

RSE “National Center for Biotechnology”


Republic of Kazakhstan, 010000, Astana, Kurgalzhynskoye Hwy, 13/5
e-mail: p.li@biocenter.kz

Loop-mediated isothermal amplification (LAMP) is relatively new method of diagnostics based


on large fragment of polymerase isolated from Geobacillus stearothermophilus (Bst polymerase)
and specialized set of nested primers (2–3 pairs). It allows performing rapid DNA amplification dur-
ing short period of time. Bst polymerase is a large fragment of polymerase from G.stearothermophilus
with lack of 5’-3’exonuclease activity due to absence of such domain, but it has helicase and poly-
merase activity which makes LAMP possible.
Thus the work consisted of several stages. First step was to amplify polymerase gene from
the host – G.stearothermophilus strain (ATCC 12980). It was cultivated in selective media at tem-
perature 55 °C. Next step was to isolate genomic DNA and amplify gene of full-length polymerase.
Amplified gene was cloned into expression plasmid vector with restriction sites Nde I and Bam HI
to make producing strain by transformation of competent cells with obtained construction and isolate
full-length polymerase to check the expression itself. Protein’s molecular weight determined with
SDS-PAGE was 100.9 kDa which correlates with calculated data.
Results of structural analysis of Bst polymerase protein allowed us to suggest that 5’-3’ exonucle-
ase domain consists of 286 amino acids residues (from Met1 to Met286). The next stage was to cut
the exonuclease domain located at the beginning of protein chain by reducing the length of original
polymerase gene by amplification lesser fragment. Amplified fragment was cloned into expression
vector with restriction sites Nde I/Bam HI. Transformation of E. coli competent cells BL-21(DE3)
with modified vector. Purification of Bst polymerase was performed by affinity chromatography
with Ni2+. According to SDS-PAGE picture molecular weight of purified enzyme was 68.8 kDa as
well as calculated weight. Since Bst polymerase is DNA-binding enzyme we performed additional
purification based on specialized sepharose with heparin to increase purity. As result we obtained
11.2 mg of Bst polymerase. Enzyme was placed at -20⁰C in storage buffer.
Testing of LAMP was performed with positive control (Bst-pol NEB) and negative control which
was no polymerase. Matrix for amplification was DNA fragment of Cassandra retrotransposon from
the wheat genome. Results were almost identical. “Laddered” bands in positive control lane and test-
ing lane with the same size and shape.
Additionally, we developed an extension to the FastPCR software allows the design set of nest-
ed primers both pairs combinations of six primer regions or combinations of eight primer regions
with loop primers. Primer combinations are optimized based on lengths, melting temperatures,
primer’s PCR efficiency, linguistic complexity and spacing among primer sites. We compare effi-
ciency of LAMP amplification and sensitivity our software for LAMP assays design with both LAVA
and PrimerExplorer software. We have designed and demonstrated our software for efficient LAMP
assays design. The software is available for download at http://primerdigital.com/fastpcr.html.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
48 Секция 1. Молекулярная генетика, геномика и биоинформатика

T.P. Lipinskaya, A.I. Makarenko

USING OF DNA-BARCODING FOR IDENTIFICATION OF ALIEN INVASIVE SPECIES


OF CRUSTACEANS

The Scientific and Practical Center for Bioresources


27 Akademicheskaya Street, Minsk BY-220072, Republic of Belarus
e-mail: tatsiana.lipinskaya@gmail.com

DNA-barcoding has been proposed by P. Heber (2003) as a molecular method to identify species.
This method uses the short standard genetic sequence from a standard part of the genome. The standard
barcode for almost all animal groups is a 648 base-pair region in the mitochondrial cytochrome c
oxidase 1 gene (COI). Study of COI using for species identification of crustaceans was conducted
in 2007 (Costa et al., 2007). They confirmed that use of COI gene was successful to identify Crustacea
specimens correctly.
9 alien invasive species of amphipods are revealed in Belarus nowadays (Semenchenko et al.,
2009). There is a problem to identify these specimens on early developmental stage. Molecular
methods can help to solve this problem.
Analysis of 77 specimens belonging to 9 alien invasive species was conducted. Material for this
study was collected in 2007–2014 and stored in ethanol at room temperature. DNA-analysis was
carried out during the Global Taxonomy Initiative Course on rapid identification of invasive alien
species for achieving Aichi Biodiversity Target 9 at the Biodiversity Institute of Ontario (Guelph,
Canada) in 2015. DNA was extracted from amphipods according to standard barcoding protocol
(CCDB Protocols) for invertebrates (non-CTAB).
CrustDR1 and CrustDF1 were used for PCR analysis (Steinke, 2007, unpublished). All sequences
were aligned using CodonCode and analyzed in BOLD and MEGA (Tamura et al., 2013). Sequence
analyses were conducted using MEGA 4.0 (Tamura et al. 2007). Nucleotide sequence divergence
was calculated using the Kimura two-parameter distances. A neighbor-joining method was used
to construct a phylogenetic tree. Confidence in the resulting relationships was assessed using a
bootstrap procedure with 1000 replications.
Only 19 COI sequences belonging to 5 alien invasive species (Chelicorophium curvispinum
(Sars, 1895), Dikerogammarus haemobaphes (Eichwald, 1841), Dikerogammarus villosus bispinosus
(Martynov 1925), Echinogammarus ischnus (Stebbing, 1899), E. trichiatus (Martynov, 1932)) were
derived.
Sequence divergence for all sequences compared at the species level. The mean within-species
distance for D. haemobaphes was 0.56 ± 0.01%, whereas maximal distance was 2.46%; these values
for E. ischnus were 1.58 ± 0.22% and 2.16% correspondingly. Only one sequence was obtained
for D.  villosus bispinosus and E. trichiatus. The sequence of D.  villosus bispinosus belonged
to D. haemobaphes cluster. We analyzed all available sequences in BOLD database for species
belonging to Dikerogammarus genus. We obtained that between-species distance for D. villosus
bispinosus and D.  villosus varied from 20.35% to 75%, whereas between-species distance
for D. villosus bispinosus and D. haemobaphes was 0–2,31%. Thus, the sequence of D. villosus
bispinosus was resembled D. haemobaphes sequence, although adults of these species can be well
distinguished. To solve this discrepancy we are planning to conduct additional study.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 1. Молекулярная генетика, геномика и биоинформатика 49

S.N. Matveevsky1, E.Yu. Ivanitskaya2, V.E. Spangenberg1, O.L. Kolomiets1

MEIOTIC SEX CHROMOSOME INACTIVATION IN BLIND MOLE RATS

1
N.I. Vavilov Institute of General Genetics
Russia, 199911, Moscow, Gubkin str. 3
2
Institute of Evolution, Haifa University
Israel, 31905, Haifa, Mount Carmel
e-mail: sergey8585@mail.ru

Meiotic sex chromosome inactivation (MSCI) is the process of transcriptional silencing of sex
chromosomes: chromatin of the X and the Y undergoes remodeling by incorporation and modifi-
cation of specific proteins that result the formation of a subnuclear heterochromatic domain called
the sex body.
In the last decade a large number of studies have been devoted to the MSCI in different animals.
Investigation of chromatin remodelling is possible by immunodetection of specific epigenetic MSCI
markers, such as BRCA1, ATR, γH2AFX, SUMO-1, ubiH2A. It has been previously found that ATR,
γH2AFX, SUMO-1, ubiH2A play an important role in maintaining an inactive form of the chromatin
and, in general, in the formation of a sex body. MSCI is an example of a general mechanism called
meiotic silencing of unsynapsed chromatin (MSUC).
Israeli subterranean mole rats of Nannospalax ehrenbergi involves four chromosome forms: 2n =
52, 54, 58 and 60. The X chromosome is a big submetacentric, and the Y is a small acrocentric. The G-
banding pattern of sex chromosomes in all cytotypes is the same, however, the Y chromosomes of
52 and 54 cytotypes differ from cytotypes 58 and 60 by presence of interstitial blocks of telomeric
sequences (Ivanitskaya et al., 2008).
Taking into consideration the mole rat chromosome variability including specificity of the Y-
chromosome, both electron microscopy and immunocytochemistry were applied for a comprehen-
sive analysis of synapsis, behaviour and chromatin configuration of the sex bivalent in pachytene
spermatocytes in the cytotype of 2n = 60 for the first time.
Mole rat sex chromosomes form a short synaptic segment in the pseudoautosomal region (PAR)
at meiotic prophase I. Usual unpaired site of the Y lies along thickened unpaired site of the X-chro-
mosome. At early – mid pachytene stage, the sex bivalent gradually moves from the centre of the nu-
cleus to its periphery and forms a so-called XY or sex body.
HORMAD1 is required for normal synaptonemal complex (SC) formation and for the efficient
build-up of ATR on asynaptic chromosome regions, crucial process for MSUC and MSCI progression
(Daniel et al., 2011). HORMAD1 signals were immunodetected along the chromosome axial elements
in mole rat zygotene spermatocytes. At the middle pachytene stage, when chromosome synapsis is
completed, HORMAD1 is localized only in asynaptic segments of the XY bivalent.
ATR is located along asynaptic axis of the sex bivalent at mid pachytene. ATR surrounds XY
in peripheral sex body at the late pachytene.
At the zygotene stage, γH2AFX localization has two patterns: either along unpaired chromosomal
regions or full filling of the entire meiotic nucleus. γH2AFX covers chromatin within the entire sex
bivalent at the mid pachytene.
SUMO-1 and ubiH2A have similar localization: the signals are distributed diffusely in chromatin
of the sex bivalent in pachytene spermatocytes.
Thus, the MSCI in mole rat spermatocytes appear to be quite similar to the same process in mamma-
lian males. However, uniform distributed SCP3 within mole rat sex body was often detected at the late
pachytene, that is not typical for other mammals with the exception of the human sex bivalent.
This work was partially supported by the Presidium of the Russian Academy of Sciences Program
“Biodiversity of natural systems”, subprogram “Gene pool of wildlife and conservation”.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 2

Генетика человека, медицинская


и спортивная генетика
Секция 2. Генетика человека, медицинская и спортивная генетика 51

С.К. Абельденов, М.К. Сапарбаев, Е.М. Раманкулов, Б.Б. Хасенов

ЗАВИСИМОСТЬ АП ЭНДОНУКЛЕАЗНОЙ АКТИВНОСТИ МИКОБАКТЕРИАЛЬНЫХ


ФЕРМЕНТОВ РЕПАРАЦИИ ОТ ДВУХВАЛЕНТНЫХ КАТИОНОВ МЕТАЛЛОВ

РГП «Национальный центр биотехнологии» КН МОН РК


Республика Казахстан, 010000, г. Астана, Кургальжинское шоссе, 13/5
e-mail: abeldenov@gmail.com

В 2014 году в мире, по оценке Всемирной организации здравоохранения, заболело


туберкулезом (ТБ) приблизительно 9,6 млн. человек, 1,5 млн. человек умерли от данного
заболевания. За последние годы в Казахстане складывается неблагоприятная обстановка
с туберкулезом с множественной лекарственной устойчивостью.
В ходе инфицирования возбудитель туберкулеза Mycobacterium tuberculosis встречается
с различными реактивными формами промежуточных соединений кислорода и азота. Попа-
дая в организм, клеточная ДНК патогена M. tuberculosis подвергается воздействию реактив-
ных форм кислорода и азота внутриклеточного и внеклеточного происхождения, что в свою
очередь приводит к повреждениям ДНК. Данные повреждения либо являются летальными,
либо приводят к мутациям. Микобактерии, находясь в таких стрессовых условиях, должны
поддерживать стабильность своего генома, поэтому изучение систем репарации ДНК у пато-
гена является очень важным для понимания механизмов мутагенеза и возникновения штаммов
с устойчивостью к лекарствам.
Целью исследований является изучение влияния катионов двухвалентных металлов на ак-
тивность расщепления апуринового/апиримидинового сайта микобактериальными фермента-
ми репарации XthA и Nfo.
Были получены рекомбинантные аналоги микобактериальных ферментов репарации XthA
и Nfo. АП-эндонуклеазную активность определяли на радиоактивно меченых олигодезоксири-
бонуклеотидах, содержащих тетрагидрофуран (THF, синтетический аналог АП сайта). Была
измерена зависимость активности данных ферментов от катионов различных металлов MgCl2,
CaCl2, MnCl2, ZnCl2, CoCl2, NiCl2 и FeCl2. В результате было обнаружено, что присутствие ио-
нов Mg2+, Mn2+ и Co2+ стимулирует АП эндонуклеазную активность XthA, в то время как ак-
тивность Nfo была стимулирована в присутствии хлорида Mg2+ и Ca2+ и в меньшей степени в
присутствии ионов Mn2+ и Co2+. Активность XthA и Nfo при рН 6,5 линейно увеличивается и
достигает максимальных значений при 10 мМ концентрации Mg2+ и Mn2+.
Кроме того, для дополнительного подтверждения роли рН в необходимости в ионах метал-
лов микобактериальных AП эндонуклеаз было измерено расщепление радиоактивно меченого
субстрата в присутствии 10 мМ MnCl2 в диапазоне рН от 5,0 до 7,5 и различных концентраций
фермента (от 2 до 50 нм). Результаты показали, что в присутствии 10 мМ Mn2+ оба фермен-
та обладают самой высокой АП эндонуклеазной активностью при рН 6,5, в то время как при
рН 7,5 высокая концентрация Mn2+ полностью ингибирует АП эндонуклеазную активность
XthA и Nfo. Результаты позволяют предположить, что в естественных условиях, in vivo, функ-
ции репарации ДНК микобактериальных АП эндонуклеаз могут быть субъектом для регули-
рования с помощью рН и природы имеющихся катионов металлов. Эти свойства позволяют
бактерии адаптироваться к изменяющимся условиям на разных этапах инфекции.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
52 Секция 2. Генетика человека, медицинская и спортивная генетика

А.М. Айткулова1, Е.В. Жолдыбаева1, Б.Д. Джамантаева2, Е.Ж. Медетов2, Е.Т. Махамбетов2

РОЛЬ ПОЛИМОРФИЗМА -174G/С ГЕНА IL-6 ПРИ РИСКЕ РАЗВИТИЯ


И РАЗРЫВОВ АНЕВРИЗМ СОСУДОВ ГОЛОВНОГО МОЗГА
В КАЗАХСКОЙ ПОПУЛЯЦИИ

РГП «Национальный центр биотехнологии» КН МОН РК


1

Республика Казахстан, 010000, г. Астана, Кургальжинское шоссе, 13/5


2
АО «Национальный центр нейрохирургии»
Республика Казахстан, 010000, пр. Туран, 34/1

Интерлейкин-6 (IL-6) играет множественную роль в ангиогенезе и ремоделировании со-


судов. В ряде исследований, проведенных на азиатской и европейской популяциях выявлена
ассоциация между полиморфизмом -174G/C гена IL-6 с риском развития и разрывов аневризм.
Целью исследования являлась оценка роли полиморфизма -174G/C гена IL-6 при риске развития
и разрывов аневризм сосудов головного мозга в казахской популяции.
В исследование были включены 206 пациентов казахской национальности в возрасте от
16–84 лет: 133 пациента с аневризмами сосудов головного мозга и 73 контрольная группа без
аневризм сосудов головного мозга (при наличии МРТ/МРА/КТА) и отсутствием в анамнезе
острых нарушений мозгового кровообращения (ОНМК) по геморрагическому типу. Сбор об-
разцов (венозная кровь) проводился на базе Национальногоцентра нейрохирургии, невро-
логических отделений ГКБ № 1 и Железнодоржной больницы г. Астаны после подписания
пациентами или близкими родственниками информированного согласия. Выделение ДНК из
крови проводили методом высаливания. Генотипирование проводили методом Real-time PCR
с использованием специфических зондов TaqMan® SNP Genotyping Assay. Выделение ДНК и
генотипирование выполнялись на базе Национального центра биотехнологии г. Астаны.
В результате проведения КТА/МРА головного мозга, пациенты были разделены на 2 группы:
исследуемая группа – с наличием в анамнезе аневризмы сосудов головного мозга с разрывом
и без разрыва и контрольная группа. Анализ данных генотипирования не выявил различий в
распределении частот генотипов в исследуемой и контрольной группах. Распределение частот
генотипов соответствует закону Харди-Вайнберга и выглядит следующим образом: 7,5% – му-
тантный (М), 33,8% – гетерозиготный (Н) и 58,6% – дикий тип (W)-исследуемая и 2,7%(M),
31,5% (H), 65,8%(W) – контрольная группы, соответственно. Статистический анализ данных
не выявил достоверной ассоциации (OR = 1,20, CI 95% [0,65–2,23], p = 0,28) гена IL6 с риском
развития и разрыва аневризм.
В данном исследовании не выявлено значимых ассоциации полиморфизма -174G/C гена
IL6 с риском развития и разрывов аневризм сосудов головного мозга в казахской популяции.
Требуются дальнейшие исследования на выборке большего размера.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 2. Генетика человека, медицинская и спортивная генетика 53

Е.А. Аксенова1, Н.А. Мартусевич2, Н.П. Митьковская2

Генотипирование пациентов с ревматоидным артритом,


отличающихся по реакции на лечение метотрексатом

1
Институт генетики и цитологии НАН Беларуси
Республика Беларусь, 220072, г. Минск, ул. Академическая, 27
e-mail: axenova_elena@mail.ru
2
Белорусский государственный медицинский университет
Республика Беларусь,220116 г. Минск, пр. Дзержинского, 83

Для лечения пациентов с ревматоидным артритом (РА) одним из базисных препаратов яв-
ляется метотрексат (МТХ). Задачей нашего исследования было проанализировать генотипы
пациентов с ревматоидным артритом, отличающихся по степени отзывчивости (чувствитель-
ности), а также токсической реакции на МТХ по полиморфным аллелям генов, участвующих
в молекулярных механизмах терапии МТХ: C677T (rs1801133), A1298C (rs1801131) гена ме-
тилентетрагидрофолат редуктазы (MTHFR), 347C>G однонуклеотидного полиморфизма гена
аминоимидазол-карбоксамидорибозид-трансформилаза/инозинмонофосфат-цикло-гидролазы
(ATIC), c.80G>A локуса гена SLC19A1, кодирующего мембранный белок-транспортер (пере-
носчик) фолатов (Reduced Folate Carrier – RFC1).
Всего было проанализировано 33 пациента с РА, отличающихся по степени отзывчивости
(чувствительности), а также токсической реакции на МТХ. Среди пациентов, для которых отмече-
на либо неэффективность лечения МТХ, либо токсическая реакция на этот препарат, преобладали
гомозиготные генотипы -1298AA (у 51,8% пациентов); -677CС и -677CТ (по 46,4% пациентов)
гена MTHFR; гетерозиготный генотип 347CG (у 53,6% пациентов) гена ATIC и гомозиготный
генотип c.80AА (у 67,9% пациентов) гена SLC19A1. Не выявлено ни одного обладателя неблаго-
приятного с точки зрения эффективности лечения МТХ генотипа c.80GG гена SLC19A1. Среди
6 пациентов с положительной эффективностью лечения не выявлено ни одного обладателя 347GG
ATIC и -677ТТ MTHFR генотипов. Тогда как среди 7 пациентов с отсутствием эффективности
лечения (в дозе МТХ 20 мг в неделю) данные генотипы встречались с одинаковой частотой –
14,3%, а генотип -1298СС MTHFR у этих пациентов не был обнаружен (у пациентов с хорошей
эффективностью этот генотип обнаружен с частотой 16,7%).
Распределение генотипов у 14 пациентов с гепатотоксической реакцией (превышение
биохимических показателей ферментов печени более чем в 3 раза) было следующим: MTHFR
-1298СС – 28,6%; -1298СА – 14,3%; -1298АА – 57,1%; MTHFR -677СС – 50,0%; -677СТ – 42,9%;
-677ТТ – 7,1%; ATIC 347CС – 42,9%; 347CG – 50,0%; 347GG – 7,1%; SLC19A1 c.80AА – 57,1%;
c.80AG – 42,9%. Интересно, что частота генотипов по гену SLC19A1 у пациентов хорошей эф-
фективностью лечения и ее отсутствием была примерно одинаковая: c.80AА – 83,3%; c.80AG –
16,7%. и c.80AА – 85,7%; c.80AG – 14,3%. соответственно. У 71,4% пациентов с отсутствием
эффективности лечения обнаружен генотип -1298СА MTHFR, а у пациентов с хорошей эф-
фективностью преобладал генотип -1298АА MTHFR (66,7%). Почти в 2 раза реже встречался
генотип 347GG ATIC у пациентов с отсутствием эффективности лечения (28,6%), по сравне-
нию с пациентами с хорошей эффективностью лечения (50,0%). В силу маленькой выборки,
подсчитать статистическую достоверность результатов не удалось. Сопоставление генотипов
по всем четырем изученным генам определенной взаимосвязи между генотипом и реакцией
на лечение МТХ не выявило.
Работа выполнена по заданию 1.2.109 ГПНИ «Медицина и фармация», подпрограмма
«Фундаментальная и прикладная медицина».

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
54 Секция 2. Генетика человека, медицинская и спортивная генетика

А.С. Бабенко1, Л.В. Статкевич1, Н.А. Балашенко2, С.Н. Шевцова2, С.Е. Дромашко2

ЭКСПРЕССИЯ ГЕНОВ TP53, CDKN1A, MYC, TERF1, TERF2, NFX1, HIF1A, EPAS1,
CTNNB1 И EGFR В ОБРАЗЦАХ КУЛЬТУРЫ КЛЕТОК РАКА ЛЕГКОГО
ЧЕЛОВЕКА А549

1
РНПЦ онкологии и медицинской радиологии имени Н.Н. Александрова МЗ РБ
Республика Беларусь, 223040, Минский р-н, а/г Лесной
e-mail: labmdbt@gmail.com
2
Институт генетики и цитологии НАН Беларуси
Республика Беларусь, 220072, г. Минск, ул. Академическая, 27
e-mail: shevtsova308@gmail.com

Пролиферативная активность соматических клеток эукариот в норме находится под кон-


тролем. Доказано, что нарушения в работе контролирующих механизмов могут привести как
к состояниям, несовместимым с жизнью клеток, так и к развитию злокачественных новооб-
разований. Различные нарушения активности ферментного комплекса теломеразы, регули-
рующего клеточную пролиферацию, также способны стать одной из причин формирования
новообразований и опухолевой прогрессии. В настоящее время выявлен комплекс белков,
ассоциированных с реализацией нарушений пролиферации клеток по механизму, связанному
с теломеразным комплексом. При этом точных данных о способах их взаимодействия и взаи-
мосвязи в процессе внутриклеточного функционирования до сих пор остается чрезвычайно
мало. В связи с этим, целью настоящего исследования явилось изучение экспрессии генов TP53,
CDKN1A, MYC, TERF1, TERF2, NFX1, HIF1A, EPAS1, CTNNB1 и EGFR в образцах культуры
клеток рака легкого человека А549 и оценка корреляционной взаимосвязи между показателя-
ми, установленными для генов-мишеней.
Исследование проводили с применением 10 образцов культуры клеток человека А549. Об-
щую фракцию РНК выделяли с использованием набора «РНК-БЕЛ» (РНПЦ ОМР им. Н.Н. Алек-
сандрова, Беларусь), реакцию обратной транскрипции проводили с применением набора
реагентов «РЕВЕРТА» (Амплисенс, Россия). Дизайн специфических олигонуклеотидов
для проведения ПЦР в режиме реального времени осуществляли с помощью программы Prim-
er 3. ПЦР проводили с использованием реагентов компании «Праймтех» (Беларусь). Оценку
экспрессии генов-мишеней проводили с использованием метода 2-dCt.
В результате проведенных исследований было установлено, что средние значения уровней
экспрессии целевых генов составили: 5,5 ± 0,3 – для NFX1, 1,3 ± 0,1 – для EPAS1, 0,9 ± 0,2 – для
EGFR, 0,5 ± 0,2 – для CDKN1, 5,8 ± 0,2 – для TERF2, 4 ± 0,3 – для TP53, 6,4 ± 0,2 – для TERF1,
1,5 ± 0,2 – для CTNNB, 1,2 ± 0,2 – для MYC. Характерно, что наиболее высокие значения уров-
ня экспрессии отмечены для генов TERF1, TERF2 и NFX1, непосредственно ассоциированных
в структурно-функциональном отношении с теломеразным комплексом.
Выявлена корреляционная взаимосвязь между уровнем экспрессии генов TERF1, TERF2
и NFX1 в линии клеток рака легкого человека А549. Дальнейшее изучение экспрессии ука-
занных генов может расширить представление об их роли в развитии аберрантных состояний
систем контроля пролиферации клеток у человека в норме и при развитии злокачественных
новообразований, что может иметь практическое значение для прогноза и лечения онкологи-
ческих заболеваний.
Исследование поддержано грантом Белорусского республиканского фонда фундаменталь-
ных исследований № М15-107.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 2. Генетика человека, медицинская и спортивная генетика 55

З.И. Бисултанова, П.М. Джамбетова

ОСОБЕННОСТИ РАСПРОСТРАНЕНИЯ ПОЛИМОРФНЫХ ВАРИАНТОВ ГЕНОВ


BRCA1/2 В ЧЕЧЕНСКОЙ ПОПУЛЯЦИИ

Чеченский государственный университет


Россия, Чеченская Республика, 364907, г. Грозный, ул. Шерипова, 32
e-mail: petimat-lg@rambler.ru

Рак молочной железы (РМЖ) является наиболее распространенной формой рака у женщин,
и в России ежегодно регистрируются более 60 000 новых случаев злокачественных новооб-
разований груди и более 23 000 смертей. Частота распространения РМЖ в разных регионах
России различна, по данным официальной статистики (2013), стандартизованные показатели
заболеваемости РМЖ на территории варьируют в пределах 28,21%–61,02%. Причины различий
в частоте встречаемости РМЖ по России связаны как с «чистотой» официальных данных, так
и действительными различиями в природе этноспецифических факторов, прямо или опосре-
дованно влияющих на возникновение опухоли. За последние годы исследования молекуляр-
ной природы раковых опухолей дали убедительные доказательства генетической детермини-
рованности злокачественного процесса. На сегодняшний день одними из наиболее изученных
биомаркеров РМЖ и рака яичников (РЯ) являются гены BRCA1 и BRCA2, прогностический
и клинический эффект мутаций которых показан в многочисленных исследованиях. До 30%
случаев рака молочной железы приписаны герминальным мутациям генов BRCA1 и BRCA2.
Согласно международным базам данных, более чем 1400 мутаций типировано в гене BRCA1
и около 1100 – в BRCA2. В разных популяционных группах наблюдается широкая вариабель-
ность в спектре выявляемых мутаций в генах BRCA1 и BRCA2, из которых наиболее часто
встречающимися являются: в гене BRCA1 – 185delAG, 4153delA, 3819del GTAAA, 3875del
GTCT, 300T>G (Cys61Gly), 2080delA и в BRCA2 – мутация 6174delT. Однако с наибольшей ча-
стотой во многих из них встречается вариант BRCA1 c.5266dup (5382insC), для которого пред-
полагают эффект основателя. Молекулярно-генетические исследования РМЖ, проведенные
в ряде российских регионов показали, что мутация c.5266dup встречается в основном у лиц,
имеющих славянское происхождение, и не обнаруживается у представителей других этносов.
В проведенном нами ПДРФ-анализе ДНК 215 больных РМЖ женщин чеченской нацио-
нальности со спорадическими и наследственными формами и 300 потенциально здоровых
лиц, у которых на момент забора крови не было выявлено онкопатологий, также не была об-
наружена мутация c.5266dup в гене BRCA1. Мы продолжили скрининг вышеперечисленных
мутаций в чеченской популяции с использованием набора реагентов Онкогенетика (ООО
«ДНК-Технология»), предназначенного для определения аллельных вариантов генов BRCA1/2
методом ПЦР в режиме реального времени. В исследовании была использована геномная ДНК,
выделенная из периферической крови этнических чеченок (n=54) с диагнозом РМЖ (без ве-
рификации по молекулярным подтипам типам и стадиям), средний возраст которых составил
45,6 лет. Этническую принадлежность устанавливали анкетированием. В исследованной вы-
борке женщин с наследственными и спорадическими формами злокачественных новообразо-
ваний груди нами не было обнаружено ни одной из исследуемых мутаций. Анализ результатов
амплификации позволяет предположить генетическую гетерогенность полиморфизмов и под-
тверждает необходимость дальнейшего исследования генов BRCA1/2, исходя из их медицин-
ской и социальной значимости.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
56 Секция 2. Генетика человека, медицинская и спортивная генетика

В.А. Будевич1, А.В. Зураев1, И.Б. Моссэ1, Л.Г. Гелис2, Е.А. Медведева2, С.Ф. Золотухина2

АНАЛИЗ ВЛИЯНИЯ ИНДИВИДУАЛЬНЫХ ГЕНЕТИЧЕСКИХ ОСОБЕННОСТЕЙ


ПАЦИЕНТА НА УСПЕШНОСТЬ ЛЕЧЕНИЯ ЛЕКАРСТВЕННЫМ
ПРЕПАРАТОМ КЛОПИДОГРЕЛ

1
Институт генетики и цитологии НАН Беларуси
Республика Беларусь, 220072, г. Минск, ул. Академическая, 27
e-mail: vl.budevich@gmail.com
2
Республиканский научно-практический центр «Кардиология»
Республика Беларусь, 220036, г. Минск, ул. Р. Люксембург, 110

Исследование полиморфизмов генов, обусловливающих чувствительность к лекарственным


препаратам является необходимым, поскольку результаты лечения часто зависят от генотипов
пациентов. Эти данные позволяют принять правильное решение – либо назначить данный пре-
парат в нужной дозировке, либо заменить его на более подходящий аналог.
Клопидогрел – лекарственное средство, назначаемое пациентам, страдающим разными
формами ишемической болезни сердца. Генами-кандидатами для установления индивидуаль-
ной чувствительности пациентов к данному препарату являются: CYP2C19, CYP3A4, P2RY12.
Целью данного исследования был поиск ассоциаций между полиморфизмами генов CY-
P2C19*2 (rs4244285), CYP2C19*17 (rs12248560), CYP3A4 (rs2740574), P2RY12 (rs6785930)
и исходами лечения клопидогрелом пациентов белорусской популяции.
В исследование было включено две группы пациентов с нестабильной стенокардией. Одна
группа сформирована из тех, у кого наблюдались осложнения на фоне терапии клопидогрелом
(26,7%), в то время как вторая группа представлена пациентами, имеющими положительную
динамику лечения. Исследование полиморфизма генов проводили методом полимеразной цеп-
ной реакции с детекцией в реальном времени.
Наиболее информативным для определения резистентности к клопидогрелу оказался поли-
морфизм гена CYP2C19*2: сумма частот генотипов GA и AA в группе пациентов, получивших
осложнения во время терапии клопидогрелом, была в 7,3 раза выше, чем в группе пациентов,
имеющих положительную динамику лечения (OR = 13,7; 95%CI 2,97–62,99).
Полученные результаты генотипирования пациентов сопоставлены с клиническими пара-
метрами. Эти данные используются врачами для изменения терапии в отношении тех пациен-
тов, для которых лечение клопидогрелом не является эффективным.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 2. Генетика человека, медицинская и спортивная генетика 57

В.М. Веремейчик, Н.Н. Кузуб, С.Р. Боровко, А.В. Павлюченко, А.Г. Шимко

ПОЛИМОРФИЗМ НОВЫХ АУТОСОМНЫХ ДНК-МАРКЕРОВ ГЕНОМА ЧЕЛОВЕКА


у населения БЕЛАРУСИ

Государственный комитет судебных экспертиз Республики Беларусь


Беларусь, 220073, г. Минск, ул. Кальварийская, 43
e-mail: Veraveremeichik@gmail.com

Более 30 лет назад возникла судебно-генетическая экспертиза, нашедшая широкое при-


менение как в мировой, так и в отечественной практике. В современных криминалистических
исследованиях наибольшее признание получили аутосомные ДНК-маркеры, в частности ло-
кусы с короткими тандемными повторами (STR), вследствие характерной для них короткой
длины аллелей, что важно при работе с деградированным материалом, а также значительного
полиморфизма, обеспечивающего возможность с высоким уровнем достоверности идентифи-
цировать личность и установить биологическое родство.
На сегодняшний день во всем мире ведется активная работа по созданию референтных баз
данных для различных типов ДНК-маркеров. В Республике Беларусь ранее на основе генетико-
статистического анализа распределения аллелей в трех массивах биологических образцов насе-
ления Беларуси, собранных различными методами (n = 13 216), был показан высокий уровень
гомогенности 18 аутосомных STR-локусов, что дало научные основания для начала формиро-
вания единой референтной ДНК-базы данных для всей территории Беларуси.
Вместе с тем, в последние годы в отечественной экспертной практике нашли широкое при-
менение такие новейшие наборы для генотипирования, как GlobalFiler™ PCR Amplification Kit
фирмы Applied Biosystems, а также PowerPlex® Fusion System и PowerPlex® Fusion 6С System
фирмы Promega. В состав данных наборов, помимо исследованных ранее 17, входят и новые
аутосомные STR-локусы, полиморфизм которых у населения Беларуси также требует изучения.
В ходе проведенного исследования были проанализированы полные генетические про-
фили 11 280 образцов в 21 аутосомном STR-локусе, полученные в Государственном комитете
судебных экспертиз Республики Беларусь в 2014–2015 гг. при амплификации образцов ДНК
с использованием набора для генотипирования GlobalFiler™ PCR Amplification Kit.
С использованием критерия χ2 было показано соответствие исследованной выборки равно-
весию Харди-Вайнберга. При тестировании на независимое наследование аллелей между ло-
кусами все проанализированные пары локусов показали отсутствие сцепленного наследования
аллелей между ними, что позволяет использовать правило перемножения вероятностей при рас-
чете частот встречаемости генотипов в ходе проведения судебно-генетических экспертиз.
Предварительная оценка результатов показывает высокий уровень полиморфизма новых
STR-локусов: выявлено от 12 (в локусе D22S1045) до 68 (в локусе SE33) аллелей. Наблюдаемая
гетерозиготность (Ho) для исследованных локусов находится в пределах от 0,741 (для D22S1045)
до 0,944 (для SE33). Не обнаружено значительных различий между величинами теоретической
и наблюдаемой гетерозиготности. Дискриминирующий потенциал (PD) новых STR-локусов до-
статочно высок и варьирует от 0,894 (в локусе D22S1045) до 0,995 (в локусе SE33).
Проведенное исследование показало высокую информативность сочетания локусов, вхо-
дящих в новейшие наборы для генотипирования, как при исследовании населения Беларуси,
так и при решении задач судебно-геномной экспертизы, связанных с установлением биологи-
ческого родства и идентификацией личности.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
58 Секция 2. Генетика человека, медицинская и спортивная генетика

В.В. Гринев1, O. Heidenreich2

ГИБРИДНЫЙ ОНКОГЕН RUNX1-RUNX1T1 КАК НЕПРЯМОЙ РЕГУЛЯТОР


АЛЬТЕРНАТИВНОГО СПЛАЙСИНГА В ЛЕЙКОЗНЫХ КЛЕТКАХ ЧЕЛОВЕКА

Белорусский государственный университет


1

Республика Беларусь, 220030, г. Минск, пр. Независимости, 4


e-mail: grinev_vv@bsu.by
2
Paediatric Oncology & Haematology Group, the Northern Institute for Cancer Research Paul O’Gorman
Building, Medical School, Framlington Place
Newcastle upon Tyne, NE2 4HH, UK
e-mail: olaf.heidenreich@newcastle.ac.uk

Транслокация t(8;21) является одной из наиболее распространенных хромосомных пере-


строек, встречающихся в клетках острого миелоидного лейкоза человека. На уровне сетевой
организации гемопоэтических стволовых клеток данная транслокация приводит к образова-
нию нового гибридного онкогена-хаба RUNX1-RUNX1T1 с активностью транскрипционного
регулятора, который, согласно современным представлениям, является одним из факторов ини-
циации и формирования острого миелоидного лейкоза у человека. Механизмы лейкозогенной
активности этого онкогена разнообразны и в полной мере еще не изучены.
На различных клеточных моделях и с использованием различных экспериментальных
и аналитических подходов рядом исследовательских групп было показано, что онкоген RUNX1-
RUNX1T1, являясь транскрипционным фактором, может контролировать работу нескольких
тысяч генов, экспрессирующихся в гемопоэтических клетках. Отдельно среди таких генов
стоит группа генов, кодирующих факторы сплайсинга и белки контроля качества и выживае-
мости РНК. Эти данные указывают на то, что в лейкозных клетках онкоген RUNX1-RUNX1T1
может влиять на особенности сплайсинга РНК на глобальном уровне.
Действительно, нами было обнаружено, что белковые продукты онкогена RUNX1-RUNX1T1
являются непрямыми регуляторами глобального сплайсинга в клетках положительной по транс-
локации t(8;21)(q22;q22) формы острого миелоидного лейкоза. Такая новая функция онкогена
реализуется через два механизма: 1) контроль выбора альтернативных точек начала транскрип-
ции у ряда подконтрольных белкам RUNX1-RUNX1T1 генов-мишеней; 2) контроль экспрессии
генов, кодирующих факторы сплайсинга, а также факторы контроля качества и выживаемости
РНК. Первый механизм приводит к появлению в лейкозных клетках дифференциально экспрес-
сирующихся изоформ мРНК с альтернативной структурой 5’UTR-регионов. Второй механизм
генерирует альтернативные транскрипты с новыми сочетаниями внутренних экзонов. При этом
оба механизма начинают проявляться уже на уровне зарождающихся РНК, хотя окончательно
количественные различия между изоформами складываются на уровне зрелых РНК. Кроме
того, нами установлено, что в лейкозных клетках выбор генов, РНК-продукты которых будут
подвергаться альтернативному сплайсингу, происходит не случайным образом, а детерминиро-
ван множеством сиквенс-характеристик, а также функциональных и эпигенетических факто-
ров. При этом дифференциально экспрессирующиеся изоформы мРНК кодируют структурно
и, как следствие, функционально различающиеся белки. Таким образом, результаты нашего
исследования вскрыли новый уровень сложности в организации лейкозных клеток, детерми-
нированный онкогеном RUNX1-RUNX1T1.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 2. Генетика человека, медицинская и спортивная генетика 59

Т.М. Гринчук, Ю.С. Попелышко, З.В. Ковалева

ИЗМЕНЕНИЯ В СТРУКТУРЕ КАРИОТИПА ЭНДОМЕТРИАЛЬНЫХ МЕЗЕНХИМНЫХ


СТВОЛОВЫХ КЛЕТОК IN VITRO ПОСЛЕ ОБЛУЧЕНИЯ РЕНТГЕНОВСКИМИ ЛУЧАМИ
В СУБЛЕТАЛЬНОЙ ДОЗЕ

Институт цитологии РАН


Россия, 194064, г. Санкт-Петербург, Тихорецкий пр., 4
e-mail: grintat@bk.ru

Задачей настоящей работы было изучить влияние рентгеновского излучения на структуру


кариотипа стволовых клеток человека. Объектом исследования послужили эндометриальные
мезенхимные стволовые клетки (эМСК) in vitro, исходно выделенные из десквамированного
эндометрия менструальной крови здоровой женщины. В качестве контроля использовались
эМСК на 13-ом пассаже (пас.) после введения в культуру, характеризующиеся повышенной
кариотипической стабильностью (более 80% метафазных пластинок), отклонения от стандарт-
ного кариотипа носили случайный характер.
Облучение эМСК проводили сублетальной дозой 5 Гр на 9-ом пас. После облучения клет-
ки продолжали культивировать в нормальных условиях. На 13-ом пас. их кариотипировали.
В работе был использован метод дифференциальной окраски хромосом на G-диски. Цито-
генетический анализ показал, что потомки облученных клеток в своем большинстве (более
80%) характеризовались нестабильностью структуры кариотипа. Количество хромосом око-
лодиплоидного ряда в клетках варьировало от 42 до 47. Основными типами кариотипических
изменений были анеуплоидия, связанная с нарушением копийности хромосомного материала,
и поломки хромосом, как прицентромерные, так и терминальные. Поломки в хромосомах 1, 4
и Х были неслучайными. В пределах кариотипа в поломки могли быть вовлечены несколько
разнотипных хромосом. Интересно, что у ликвидаторов и лиц, пострадавших в результате ава-
рии на ЧАЭС, был также выявлен повышенный уровень стабильных и нестабильных хромо-
сомных аберраций с преимущественным вовлечением в перестройки материала хромосомы 4.
Результаты настоящей работы позволили говорить о том, что воздействие на эМСК рентге-
новского излучения в сублетальной дозе 5 Гр приводит к неслучайному нарушению структуры
генома на уровне кариотипа. Анеуплоидизация эМСК, подверженных облучению, и возникно-
вение большого числа клеток с закономерными и случайными перестройками хромосомного
материала позволяют постулировать возникновение данных нарушений в структуре кариотипа
в связи со сбоем в программе клеточного деления.
Работа выполнена при финансовой поддержке Российского научного фонда (проект 14-
50-00068).

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
60 Секция 2. Генетика человека, медицинская и спортивная генетика

О.А. Громыко, Е.И. Головатая, И.Н. Мотюк

ПРЕНАТАЛЬНАЯ ДИАГНОСТИКА ХРОМОСОМНОГО ДИСБАЛАНСА У ПЛОДА


В РЕЗУЛЬТАТЕ СЕГРЕГАЦИИ 3:1 ПРИ МУЖСКОМ НОСИТЕЛЬСТВЕ
РЕЦИПРОКНОЙ ТРАНСЛОКАЦИИ

ГУ РПНЦ «Мать и дитя»


Республика Беларусь, г. Минск, ул. Орловская, 66
e-mail: ksusha21a@mail.ru

Реципрокные транслокации относятся к наиболее частым структурным перестройкам


хромосом человека. Для носителей таких перестроек характерен повышенный риск рожде-
ния детей с несбалансированным кариотипом и риск спонтанных абортов. Это обусловлено
формированием несбалансированных гамет вследствие мейотической сегрегации хромосом.
Сегрегация 3:1 относится к редко встречающемуся типу сегрегации хромосом в мейозе у но-
сителей сбалансированных реципрокных транслокаций. Существует два варианта такой се-
грегации: с трисомией или моносомией по одной из дериватных хромосом и с аутосомной
трисомией или моносомией.
Мы представляем случай пренатальной диагностики мозаичного несбалансированного
кариотипа у плода 47,XY,+der(16)t(8;16)(p23;q24)pat[17]/ 46,XY[33], который был результатом
сегрегации 3:1 с трисомией по одной из дериватных хромосом вследствие отцовского носи-
тельства сбалансированной реципрокной транслокации .
Цитогенетические анализы выполнялись методом стандартного кариотипирования с ис-
пользованием дифференциального окрашивания (GTG-banding) на клетках амниотической
жидкости и лимфоцитах периферической крови. Тип структурной перестройки был подтверж-
ден методом флуоресцентной гибридизации in situ (FISH) с использованием субтеломерных
флуоресцентных зондов 16q (spectrum green) и 16p (spectrum red) (Vysis).
Пациентка Б., белоруска, 27 лет, здорова. Брак первый, неродственный. Беременность
первая. При проведении комбинированного скрининга на хромосомную патологию плода
в первом триместре беременности получен риск 1:191 по синдрому Дауна. При ультразвуковой
диагностике в 16 недель беременности выявлен порок сердца плода: тетрада Фало с атрезией
легочной артерии. Была проведена инвазивная пренатальная диагностика в сроке 17 недель
гестации. При кариотипировании клеток амниотической жидкости выявлен мозаичный несба-
лансированный кариотип у плода 47,XY,+mar[17]/46,XY[33]. С помощью FISH-диагностики
установлено, что маркер содержит материал 16 хромосомы. Также выполнено кариотипиро-
вание лимфоцитов крови супругов, выявлено мужское носительство сбалансированной реци-
прокной транслокации: 46,XY,t(8;16)(p23;q24). В итоге был уставлен окончательный кариотип
плода: 47,XY,+der(16)t(8;16)(p23;q24)pat[17]/46,XY[33]. Семья приняла решение о прерывании
беременности. При патологоанатомическом исследовании абортуса диагностированы множе-
ственные врожденные пороки развития: врожденный порок сердца, косолапость, нарушение
лобуляции левого легкого, фимоз.
Несбалансированный кариотип у плода явился результатом сегрегации 3:1 в мейозе при
формировании мужской гаметы, что привело к анеуплоидии с дополнительной дериватной
хромосомой. В одном из последующих митотических делений произошло нерасхождение 16-х
хромосом, в результате чего возникла клеточная линия с нормальным кариотипом.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 2. Генетика человека, медицинская и спортивная генетика 61

Н.Б. Гусина, Е.С. Будейко, С.О. Мясников, Т.С. Зимовина, Е.Г. Требко, О.А. Громыко, А.А. Гусина

ГЕНЕТИЧЕСКИЕ ДЕФЕКТЫ СУЛЬФАТАЗ ЧЕЛОВЕКА В РЕСПУБЛИКЕ БЕЛАРУСЬ

ГУ «Республиканский научно-практический центр «Мать и дитя»


Республика Беларусь, 20053, г. Минск, ул. Орловская 53, корп. 9.
e-mail: nina_gusina@tut.by

Сульфатазы – группа ферментов, осуществляющих гидролитическое отщепление органи-


ческого сульфата от различных субстратов: сложных липидов, углеводов, гликозаминоглика-
нов, гормонов. С дефектами сульфатаз связаны многие наследственные заболевания человека.
Приводим результаты исследований генетической природы ряда наследственных дефектов
сульфатаз у жителей Республики Беларусь.
Мукополисахаридозы (МПС) – наследственные нарушения обмена гликозаминоглаканов,
в большинстве являются следствием генетических дефектов сульфатаз (МПС II, III A, IIID, IV
А, VI типов). В диагностической практике генетические исследования при МПС в основном ис-
пользуют секвенирование геномной ДНК пациентов. В качестве примера приводим МПС VI типа.
Мукополисахаридоз VI  типа (МПС VI, синдром Марото-Лами) – редкое аутосомно-
рецессивное заболевание, в основе которого лежит дефицит лизосомного фермента,
N-ацетилгалактозамин-4-сульфатазы (арилсульфатазы В, ARSB). К настоящему времени из-
вестно более 130 мутаций гена ARSB. Частота отдельных мутантных аллелей очень мала,
большинство мутаций уникальны. Нами изучены 10 неродственных семей (11 пациентов
и 15 здоровых членов семей). Во всех случаях диагноз МПС VI был установлен биохими-
чески (повышение экскреции дерматан сульфата и дефицит активности арилсульфатазы В
в лейкоцитах). Для идентификации мутаций гена ARSB проводилось прямое секвенирование
геномной ДНК. В результате исследования удалось установить 100% мутантных аллелей,
обусловивших развитие МПС VI у пациентов. Всего выявлено 8 мутантных аллелей, 6 мис-
сенс- (p.W57C, p.T92K, p.R152W, p.R160Q, p.Y210C, p.Y266S) и 2 нонсенс-мутации (p.Q97X,
p.R160X), а также 1 непатологический полиморфизм. Миссенс-мутации R152W и Y266S соста-
вили 70% (40 и 30% соответственно) от всех мутантных аллелей в данной группе пациентов.
Наши результаты указывают на возможный «эффект основателя» и определенные корреляции
«генотип-фенотип» у пациентов с МПС VI, жителей Беларуси. Так, мутация p.R152W ассо-
циирована с мягкими, а комплексный аллель [p. A33V; p. Y266S] – с тяжелыми клиническими
проявлениями заболевания. Скрининг на данные 2 наиболее распространенных мутантных
аллеля является диагностически значимым для пациентов с МПС VI, жителей нашей страны.
Тот же диагностический алгоритм используется и для других наследственных дефектов
сульфатаз, в частности, метахроматической лейкодистрофии, обусловленной генетическим
дефектом арилсульфатазы А (ARSA).
Наследственный Х-сцепленный ихтиоз, дефект стероид-сульфатазы (STS, ARSC1) обу-
словлен крупной делецией района Хр22.3. Для диагностики заболевания использовалась
молекулярно-цитогенетическая технология FISH с локус-специфической пробой LSI STS SO/
CEP X SG. За 2013–2016 годы диагностировано 16 пациентов.
Таким образом, современная диагностическая практика способна не только успешно уста-
новить диагноз, но и выяснить генетическую природу наследственного заболевания, что важно
для многих аспектов жизни пациентов.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
62 Секция 2. Генетика человека, медицинская и спортивная генетика

И.Б. Моссэ, А.Л. Гончар, Л.А. Кундас, М.Д. Амельянович, Н.Г. Седляр

ВЫЯВЛЕНИЕ ФАКТОРОВ РИСКА НАСЛЕДСТВЕННОЙ ТРОМБОФИЛИИ В ЦЕЛЯХ


ПРОФИЛАКТИКИ ПОТЕРЬ БЕРЕМЕННОСТИ

Институт генетики и цитологии НАН Беларуси


Республика Беларусь, 220072, г. Минск, ул. Академическая, 27
e-mail: i.mosse@igc.by

Привычное невынашивание беременности представляет собой полиэтиологический сим-


птомокомплекс, в основе развития которого наиболее часто лежат структурные изменения эн-
дометрия, инфекционные, эндокринные, иммунологические, идиопатические и генетические
факторы в различных сочетаниях.
В последнее время одной из главных причин потерь беременности стали считать наслед-
ственную тромбофилию – патологическое состояние организма, характеризующееся повы-
шенной склонностью к тромбообразованию. Данная патология может не иметь клинических
симптомов до появления провоцирующих факторов, одним из которых как раз и является бе-
ременность.
Нами исследована ассоциация невынашивания беременности с двумя мутациями (фактор V
Leiden и мутация G20210-A в гене протромбина) и 12-ю полиморфными вариантами генов:
факторов свертывания крови F1 (Thr312Ala) и F13 (Val34Leu), гена ингибитора активатора
плазминогена PAI-1 (675 4G/5G), гена эндотелиальной синтазы окиси азота eNOS (4а/4b и Glu-
298Asp), гена ангиотензин-превращающего фермента ACE (Alu Ins/Del), гена аполипротеина Е
АРОЕ (Cys112Arg +Arg158Cys), гена фактора роста эндотелия сосудов VEGF (G-634C), гена
индуцируемого гипоксией фактора HIF1A (C1772T), гена метионин-синтазы MTR (А2756G)
и гена метилентетрагидро-фолатредуктазы MTHFR (C677T и A1298C – необходимость анализа
двух полиморфных вариантов данного гена обусловлена тем, что гетерозигота по полимор-
физму C677T является фактором риска гипергомоцистинемии только при совместном носи-
тельстве с алеллем 677T того же гена).
Сравнение генотипов 2500 пациенток с неизвестными причинами невынашивания бере-
менности и 700 женщин контрольной группы (не имевших в анамнезе патологий беременно-
сти) позволило выявить наиболее информативные маркеры риска потери беременности – это
варианты 4G\4G гена PAI-1, Leu\Leu гена F13, 4а\4а гена eNOS, Т\Т гена MTHFR.
Поскольку в формировании генетической предрасположенности к невынашиванию бере-
менности имеет значение носительство не только отдельных аллельных вариантов генов, но
и их комбинаций, проанализирована частота носительства сочетаний факторов риска. Пока-
зано, что чаще всего у пациенток встречаются комбинации аллелей риска следующих генов:
F13 + PAI (41,9%), eNOS ab + PAI (30,4%), eNOS ab + F13 (20,4%). Нередко встречается также
комбинация из трёх факторов риска: PAI + F13 + eNOS ab; PAI + MTHFR (С677Т + А1298С);
F13 + MTHFR (С677Т+А1298С).
Выявление носительства данных мутаций и полиморфных вариантов является актуаль-
ным и важным, поскольку коррекция эффектов выявленных неблагоприятных вариантов генов
с помощью соответствующей терапии обеспечивает нормальное протекание беременности.
Женщины, протестированные нами год назад и ранее, успешно родили детей. У многих бере-
менность на поздних сроках, что также позволяет надеяться на её благополучное завершение.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 2. Генетика человека, медицинская и спортивная генетика 63

А.А. Гусина, А.В. Зиновик, Т.С. Зимовина, Т.М. Ефимчик, Н.Б. Гусина

ТЕСТИРОВАНИЕ НА НАСЛЕДСТВЕННЫЕ ТРОМБОФИЛИИ: НА ПОЛЬЗУ


ИЛИ ВО ВРЕД?

ГУ «Республиканский научно-практический центр «Мать и дитя»


Республика Беларусь, 20053, г. Минск, ул. Орловская 53, корп. 9.
e-mail: nina_gusina@tut.by

Наследственные тромбофилии (НТ) связывают с развитием многих распространенных


социально-значимых заболеваний. В частности, не вызывает сомнений тот факт, что эти со-
стояния являются значимым фактором риска венозных тромбоэмболических осложнений
(ВТО). Высокая распространенность НТ среди жителей европейских стран, простота детек-
ции этих дефектов и относительная безопасность современной антикоагулянтной терапии
способствовали настойчивому внедрению знаний об этих нарушениях среди практикующих
врачей. Представление о том, что НТ являются факторами риска или даже причиной возник-
новения осложнений гестации и других нарушений репродуктивного здоровья (НРЗ) широко
распространено среди практикующих акушеров-гинекологов. Сформировалась явная тенденция
к переоценке значимости НТ и игнорированию других факторов риска как ВТО, так и ослож-
нений гестации. Расширение показаний для лабораторного обследования на НТ, назначение
антикоагулянтной терапии на основании лишь носительства некоторых полиморфизмов вы-
зывает тревогу, поскольку необоснованные лабораторные исследования и фармакологические
вмешательства могут нанести вред и приводят к напрасной трате ресурсов учреждений здра-
воохранения и самих пациентов.
Цель работы: провести анализ результатов тестирования на носительство Лейденской му-
тации (FVL), мутации G20210A в гене протромбина (PTG20210A) и мутации С677Т в гене ме-
тилентетрагидрофолатредуктазы (С677Т MTHFR) у пациентов, обратившихся для исключения
тромбофилии в РНПЦ «Мать и дитя».
За период с 01.2008 по 07.2016 гг. для обследования на наличие тромбофилии (антифос-
фолипидного синдрома, гипергомоцистеинемии, НТ) обратилось 3743 пациента. Подавляю-
щее большинство (90,0%) составили женщины с НРЗ и лишь 10,0% больных обследовались
по поводу тромбоза. Обследование на носительство FVL, PTG20210A и С677Т MTHFR было
рекомендовано 80% больных тромбозами и 37,1% женщин с НРЗ. Таким образом, тестирова-
ние на носительство этих мутаций было выполнено у 1550 пациентов.
Носительство FVL или PT20210A в гетерозиготом состоянии было выявлено у 18,7% паци-
ентов с тромбозами и у 4,4% женщин с НРЗ. Распространенность FVL и PT20210A у пациенток
с НРЗ не превысила популяционную частоту этих мутаций в Беларуси (4,7%). Носительство
мутации С677Т MTHFR в гетерозиготном или гомозиготном состоянии обнаружено у 53,2%
больных тромбозами, у 51% пациенток с НРЗ, что также сопоставимо с распространенностью
этой мутации в популяции Беларуси (58,2%).
НРЗ – основная причина обращений для обследования на наличие FVL, PTG20210A
и С677Т MTHFR пациентов РНПЦ «Мать и дитя». Частота выявления этих дефектов у жен-
щин с НРЗ не превышает частоту этих мутаций в популяции в целом. Рутинное тестирование
на НТ в акушерско-гинекологической практике нецелесообразно, что подчеркивают также
профессиональные экспертные объединения врачей акушеров-гинекологов и медицинских
генетиков. Следует отметить, что неэффективность обследования на НТ женщин с НРЗ спо-
собствует утрате у врачей мотивации к назначению тестирования пациентам, которым такое
обследование действительно может принести пользу.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
64 Секция 2. Генетика человека, медицинская и спортивная генетика

С.Е. Дромашко, Н.А. Балашенко, С.Н. Шевцова, О.В. Квитко, Я.И. Шейко

НЕИНВАЗИВНОЕ ПОЛУЧЕНИЕ КЛЕТОК ЧЕЛОВЕКА В ЦЕЛЯХ


РЕГЕНЕРАТИВНОЙ МЕДИЦИНЫ

Институт генетики и цитологии НАН Беларуси


Республика Беларусь, 220072, г. Минск, ул. Академическая, 27
е-mail: S.Dromashko@igc.by

Трансплантация клеток и тканей является основным инструментом современной реге-


неративной медицины. При этом важно использовать методы получения клеточных культур
из гомологичного (собственного) материала данного индивидуума, поскольку при этом обе-
спечивается иммунологическая безопасность клеточной трансплантации. В свою очередь,
для широкого внедрения гомологичной трансплантации необходимо использовать неинвазив-
ные (малотравматичные) методы получения клеточного материала, исключающие серьезное
хирургическое вмешательство.
Целью нашей работы было разработать технологию неинвазивного (нетравматичного) по-
лучения и анализа клеток человека из урины и фолликулов волос с помощью методов культи-
вирования клеток, компьютерной видеомикроскопии.
В результате исследований установлено, что первичная культура клеток из фолликулов во-
лос нуждается в добавлении митогена FGF для стимуляции пролиферации. Показано также,
что использование для модифицирования дна сосуда для культивирования клеток матригеля
обеспечивает прикрепление фолликулов и частично освобожденных клеток к поверхности
культурального сосуда. Выявлена обратная зависимость выхода жизнеспособных клеток от вре-
мени экспозиции фолликулов волос в растворе трипсина после 1 минуты обработки. При по-
лучении жизнеспособных клеток из урины человека установлено, что наиболее подходящим
материалом является урина беременных женщин. Выявлено, что наиболее эффективным спо-
собом предотвращения бактериального заражения полученных из урины клеток является ме-
тод многократной промывки биоматериала средой RPMI без антибиотиков. Показана также
эффективность использования жидкости из фолликулов яичников коров при получении пер-
вичных культур клеток и пролонгирования их роста.
Показана перспективность интенсификации исследования за счет параллельной (одновре-
менной) видеозаписи многих участков клеточной культуры с помощью созданного совмест-
но с ГНПО «Планар» компьютерного видеокомплекса «Цитомир». Это объясняется тем, что
при получении культуры клеток из малого количества исходного материала необходим их тща-
тельный мониторинг. Применение компьютерной видеомикроскопии существенно повышает
эффективность работы, поскольку при отсутствии условий культивирования, оптимизирован-
ных для нового источника клеток, критическим является обнаружение хотя бы одного неболь-
шого пролиферирующего клона, из которого можно в дальнейшем получить клеточную линию.
Нежелательным эффектом при выделении клеток является возможность их неограниченно-
го роста. Для выявления иммортальности клеточных культур в качестве одного из молекулярно-
генетических маркеров рекомендуется применение экспрессии гена белковой субъединицы
теломеразы.
Кроме трансплантационной терапии предлагаемая клеточная технология пригодна для ис-
пользования в таких важных направлениях, как создание лекарственных препаратов (включая
антираковые), а также санитарно-гигиеническое нормирование новых химических соединений,
поступающих в среду обитания человека.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 2. Генетика человека, медицинская и спортивная генетика 65

А.А. Ершова-Павлова, Г.А. Карпенко, Е.П. Ринкевич, А.А. Славщик, Р.Д. Хмель, И.В. Наумчик,


Г.И. Лазюк

СИСТЕМА МОНИТОРИНГА В ОЦЕНКЕ НАРУШЕНИЙ ЭМБРИОНАЛЬНОГО


РАЗВИТИЯ В ПОПУЛЯЦИИ БЕЛАРУСИ

ГУ «Республиканский научно-практический центр «Мать и дитя»


Республика Беларусь, 220053, г. Минск, ул. Орловская, 66
e-mail: belgenetics@yahoo.com

Высокий удельный вес врожденных пороков развития (ВПР) в структуре причин мертво-
рождаемости, младенческой и ранней детской заболеваемости и смертности, детской инвалид-
ности, повсеместный рост, а также их экозависимость послужили причиной создания регистров
ВПР, базисом которых являются системы мониторинга на основе учета случаев нарушений
эмбрионального развития в популяции. Системы мониторинга позволяют определять популя-
ционные частоты (ПЧ), динамику и структуру ВПР, осуществлять долговременный контроль
окружающей среды с возможностью изучения причин наблюдаемых колебаний частотных
трендов ВПР (Lazjuk G.I. et al., 2003), планировать объем диагностических, лечебных, реаби-
литационных и профилактических мероприятий. В Беларуси мониторинг аномалий развития
осуществляется в рамках Белорусского регистра ВПР (БР ВПР), функционирующего с 1979 г.
В системе мониторинга БР ВПР учету подлежат все случаи ВПР у живорожденных, мертво-
рожденных и плодов, абортированных по генетическим показаниям, в масштабах республики.
Анализ базы данных БР ВПР показал, что за период 2005–2014 гг. по республике в целом
ПЧ всех форм ВПР (32,4 ± 0,54‰), как и частоты ВПР строгого учета (СУ) (13,8 ± 0,35‰), легко
диагностируемых пороков, сохранялись примерно на одном уровне, за исключением г. Минска
и Гомельской области, где отмечена положительная динамика роста частот ВПР. Наименьшие
ПЧ, как всех форм ВПР, так и ВПР СУ, как и в предыдущие годы (Lazjuk G.I. et al., 2002–2006),
характерны для Витебской области. За анализируемый период в Гомельской области ПЧ всех
форм ВПР и ВПР СУ остаются статистически значимо выше по сравнению c аналогичными
данными по Витебской области (для всех форм ВПР 34,1 ± 1,41‰ и 28,0 ± 1,49‰ соответствен-
но, t = 2,95, P < 0,05; для ВПР СУ 14,5 ± 0,93‰ и 11,6 ± 0,96‰, t = 2,17, P < 0,05). В г. Минске
ПЧ всех форм ВПР и ВПР СУ статистически значимо превышают аналогичные показатели не
только по Витебской области, но и по республике в целом. Так, в г. Минске и республике для
всех форм ВПР ПЧ составили 41,2 ± 1,37‰ и 32,4 ± 0,54‰ соответственно (t = 5,97, P < 0,05);
для ВПР СУ – 18,9 ± 0,94‰ и 13,8 ± 0,35‰ соответственно (t = 5,12, P < 0,05). Причины вы-
соких ПЧ ВПР в отдельных регионах республики требуют изучения и на основе полученных
результатов принятия управленческих решений по улучшению экологической ситуации и со-
вершенствованию мер профилактики.
Необходимо отметить эффективность пренатальной диагностики и предупреждения рож-
дения детей с некурабельными, инвалидизирующими формами ВПР. Так по данным БР ВПР,
в республике только в 2014 г. с пороками было 15 мертворожденных, умерло 137 детей (из
них 30 – до 6 суток, 107 – до года). Прервано по поводу ВПР и хромосомных болезней у пло-
да 943 беременности, что внесло существенный вклад в показатели детской заболеваемости,
инвалидности и смертности.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
66 Секция 2. Генетика человека, медицинская и спортивная генетика

А.В. Зураев, В.А. Будевич, Л.В. Кухтинская, И.Б. Моссэ

ИЗУЧЕНИЕ ПОЛИМОРФНЫХ ВАРИАНТОВ ГЕНА SLC6A4 В КАЧЕСТВЕ МАРКЕРОВ


ПСИХОЭМОЦИОНАЛЬНОЙ АДАПТАЦИИ ЧЕЛОВЕКА

Институт генетики и цитологии НАН Беларуси


Республика Беларусь, 220072, г. Минск, ул. Академическая, 27
e-mail: alex.zuraev@gmail.com

Учет индивидуальных личностных особенностей (тип темперамента, характер протека-


ния нервных процессов, акцентуации характера, уровень тревожности и психоэмоциональ-
ной устойчивости и др.) весьма важен для качественного отбора специалистов и оптимизации
их профессиональной деятельности. Однако, из всех видов профессиональной деятельности
особое место занимают экстремальные профессии, которые требуют от человека стрессоу-
стойчивости и психоэмоциональной уравновешенности. Эти качества особенно необходимы
сотрудникам сил специального назначения, которым приходится выполнять задания государ-
ственного значения в сложных психологических условиях.
Целью данной работы является оценка информативности полиморфизмов 5-HTTLPR
и 5-HTTVNTR-17 гена SLC6A4, который кодирует транспортер серотонина, в качестве марке-
ров психоэмоциональной устойчивости.
Определение аллелей полиморфных вариантов 5-HTTLPR и 5-HTTVNTR-17 проводилось
методом аллель-специфичной полимеразной цепной реакции по разработанной нами методике.
В результате проделанной экспериментальной работы был проведен сравнительный ана-
лиз полученных частот распределения генотипов и аллельных вариантов полиморфизмов
5-HTTLPR и 5-HTTVNTR-17 гена SLC6A4, кодирующего транспортер серотонина, как в груп-
пе сотрудников спецподразделений по борьбе с терроризмом, так и в группе общепопуляци-
онного контроля.
Было установлено, что сумма частот генотипов LL и LS полиморфного локуса 5-HTTLPR
гена SLC6A4 в 4,3 раза выше в группе сотрудников спецподразделения по борьбе с террориз-
мом в сравнении с группой общепопуляционного контроля.
Также установлено, что частота генотипов, содержащих аллель 9R полиморфного локу-
са 5-HTTVNTR-17 гена SLC6A4, в 2,3 раза выше в группе сотрудников спецподразделения
по борьбе с терроризмом в сравнении с группой общепопуляционного контроля.
Полученные результаты позволяют сделать вывод о том, что полиморфные варианты
5-HTTLPR и 5-HTTVNTR-17 гена SLC6A4, кодирующего транспортер серотонина, могут
считаться информативными генетическими маркерами психоэмоциональной устойчивости
человека.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 2. Генетика человека, медицинская и спортивная генетика 67

И.Н. Ильюшёнок1, O. Heidenreich2, В.В. Гринев1

РЕКОНСТРУКЦИЯ ВЗВЕШЕННОГО ЭКЗОННОГО ГРАФА ГИБРИДНОГО ОНКОГЕНА


RUNX1-RUNX1T1 НА ОСНОВЕ ДАННЫХ RNA-Seq

Белорусский государственный университет


1

Республика Беларусь, 220030, г. Минск, пр. Независимости, 4


e-mail: nov.ilyushonok@gmail.com
2
Paediatric Oncology & Haematology Group, the Northern Institute for Cancer Research Paul O’Gorman
Building, Medical School, Framlington Place
Newcastle upon Tyne, NE2 4HH, UK

Сбалансированная транслокация t(8;21)(q22;q22) является одной из наиболее часто встре-


чающихся генетических аномалий у больных острым миелоидным лейкозом. В результате
транслокации образуется гибридный онкоген RUNX1-RUNX1T1, последовательность которого
кодирует белок, состоящий из ДНК-связывающего домена RHD транскрипционного регуля-
тора RUNX1 на N-конце и фактически полноразмерного репрессора транскрипции RUNX1-
RUNX1T1 на C-конце. Данный онкоген вовлечён в функционирование регуляторных сетей,
обеспечивающих процессы малигнизации, однако детально его роль в лейкозогенезе не изучена.
Онкоген RUNX1-RUNX1T1 имеет большое количество альтернативных изоформ мРНК.
Ранее нами был реконструирован ациклический ориентированный экзонный граф на осно-
ве 135 альтернативных транскриптов онкогена. Однако такая модель имеет некоторые недо-
статки. Во-первых, информация о разнообразии альтернативных изоформ была получена как
от модельных клеточных линий, так и образцов пациентов. Во-вторых, данный граф является
невзвешенным и не предоставляет информации об относительной доле конкретных экзонов
и транскриптов в общем пуле. В то же время, воспользовавшись данными RNA-Seq, можно
провести качественный и количественный анализ пула полноразмерных альтернативных изо-
форм мРНК онкогена в конкретном образце в конкретный момент времени. Построение такого
графа с использованием данных RNA-Seq и являлось целью данной работы.
Для получения первичных данных было проведено секвенирование транскриптома клеток
линии Kasumi-1 острого миелоидного лейкоза по технологии парного RNA-Seq. RNA-Seq риды
были картированы по последовательности деривата 8-й хромосомы человека, где локализован
онкоген RUNX1-RUNX1T1. Из полученных BAM-файлов были отобраны RNA-Seq риды, кар-
тированные по области онкогена RUNX1-RUNX1T1 и относящиеся к минус-цепи.
Сборка полноразмерных транскриптов осуществлялась с помощью пайплайна Cufflinks.
Фильтрация артефактов сборки производилась с помощью оригинального кода на языке R,
а также путём оценки количества ридов, подтверждающих то или иное сплайсинговое собы-
тие, с помощью геномного обозревателя IGV. Количественная оценка альтернативных изоформ
осуществлялась с помощью инструментов Cuffdiff, StringTie, MISO, реконструкция экзонного
графа – с помощью R/Bioconductor пакета SplicingGraphs.
С помощью данного подхода нами было идентифицировано 13 полноразмерных изоформ
мРНК онкогена RUNX1-RUNX1T1, коэкспрессирующихся в клетках линии Kasumi-1, а также
осуществлена идентификация некоторых неканонических экзонов и их сочетаний, неизвест-
ных ранее. Таким образом, эта методика является перспективной для поиска новых альтерна-
тивных изоформ мРНК и изучения комбинаторики экзонов.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
68 Секция 2. Генетика человека, медицинская и спортивная генетика

Е.А. Климов1,2, А.В. Малахова1, Е.А. Наумова1,2, З.Г. Кокаева1, А.А. Анучина1, Ю.Э. Азимова3,
Н.М. Фокина4, Г.Р. Табеева3,5, О.И. Рудько1

ПОИСК МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИХ МАРКЁРОВ ПАНИЧЕСКИХ


РАССТРОЙСТВ

1
Московский государственный университет имени М.В.Ломоносова
Россия, 119234, г. Москва, Ленинские горы, 1, стр. 12
2
Университетская диагностическая лаборатория
Россия, 119331, г. Москва, пр. Вернадского, 29, пом. I
3
Университетская клиника головной боли
Россия, 121467, г. Москва, ул. Молодогвардейская, 2, к.1
4
Московский государственный медико-стоматологический университет им. А.И. Евдокимова
Россия, 127473, г. Москва, ул. Делегатская, 20, стр. 1
5
Отдел неврологии НИЦ Первого Московского государственного медицинского университета им.
И.М. Сеченова
Россия, 119435, г. Москва, ул. Россолимо, 11
e-mail: klimov_eugeney@mail.ru

Паническое расстройство (ПР), F41.0 (МКБ-10) – это заболевание, характеризующееся


внезапными и рецидивными атаками страха и тревоги, а также часто сопровождаемое физи-
ческими симптомами: головокружение, потливость, учащенное сердцебиение и боль в груди.
Панические атаки (ПА) можно считать основным симптомом ПР. Обнаружены свидетельства
прямой передачи ПР из поколения в поколение: заболеванием страдает 15–17% родственников
больных, конкордантность у однояйцевых близнецов достигает 85–90%. Однако молекулярно-
генетическая основа заболевания, ввиду его сложной многофакторной природы, изучена мало.
А спектр генов, участвующих в патогенезе ПР, до сих пор не определен.
Целью нашей работы было выявление ассоциированных с паническим расстройством мар-
кёров в генах: MAOA (VNTR), CCK (STR, rs11571842), HTR1A (rs6295), COMT (rs4680), SLC6A4
(rs3813034), TPH1 (rs1800532), PDE4B (rs1040716, rs502958, rs10454453), CCK2R (rs1805000,
rs1805002), CCK1R (rs1800857, rs1799723, rs1800908), BDNF (rs6265, rs2049046), DBH (I/D).
В исследование включены проживающие в Москве и Московской области: 1) пациенты (n =
124) с диагнозом ПР (по DSM-V) и ПА не реже 1 раза в месяц и 2) популяционная выборка
(n = 373). Анализ SNV проводили методами ПЦР-ПДРФ и ПЦР в режиме реального времени
со специфичными зондами, STR и VNTR – фрагментный анализ. Статистический анализ про-
веден с использованием программы WinPepi (тесты Фишера и Пирсона).
По результатам генотипирования и статистической обработки полученных данных выяв-
лены ассоциации и определены модели наследования для следующих маркёров:
rs6295 в гене HTR1A (CC, p = 1,0E-7, OR = 5,34, рецессивная модель);
rs3813034 в гене SLC6A4 (CC, p = 5,0E-9, OR = 2,65, рецессивная модель);
rs1040716 в гене PDE4B (AA, p = 0,03, OR = 1,66, рецессивная модель);
rs2049046 в гене BDNF (AA, p = 0,002, OR = 2.19, рецессивная модель);
rs1800908 в гене CCK1R (GT+TT, p = 2,0E-9, OR = 5,04, доминантная модель).
Данные гены кодируют белки, относящиеся к разным нейромедиаторным системам: серото-
нинергической (HTR1A, SLC6A4), холецистокининергической (CCK1R), роста нервов (BDNF),
а ген PDE4B кодирует фермент, продукт которого участвует во многих клеточных процессах,
так как ответственен за синтез цАМФ. Таким образом, наши данные свидетельствуют о том,
что ПР обусловлено нарушением нескольких сигнальных систем мозга, как межклеточных,
так и внутриклеточных. Это может объяснять как гетерогенность самого заболевания, так
и сложность его терапии. Между тем, исследование молекулярных механизмов ПР требует
дальнейших исследований.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 2. Генетика человека, медицинская и спортивная генетика 69

О.Л. Коломиец1, А.А. Кашинцова1, В.Е. Спангенберг1, Е.Е. Брагина2

КОМПЛЕКСНОЕ ИССЛЕДОВАНИЕ МЕЙОЗА И СПЕРМАТОГЕНЕЗА У ПАЦИЕНТОВ


С АЗООСПЕРМИЕЙ

Институт общей генетики им. Н.И. Вавилова РАН


1

Россия, 119991, г. Москва, ул. Губкина, 3


2
Институт физико-химической биологии им. Белозерского
Россия, 119992, г. Москва, Ленинские горы, 1, стр. 40
e-mail: olkolomiets@mail.ru

Бесплодие фиксируется в 10–20% семей. Около 50% случаев обусловлено мужским бес-
плодием. Основным методом решения проблемы бесплодия для пациентов с азооспермией
является метод интрацитоплазматической инъекции сперматозоидов (ИКСИ). Нами иссле-
дованы микробиоптаты яичек, полученные от пациентов с секреторной азооспермией, в том
числе, от пациентов с микроделециями локуса AZF Y-хромосомы и пациенты с азоосперми-
ей, у которых делеции локуса AZF не выявлены. Биоптаты получены и исследованы с инфор-
мированного согласия пациентов. У всех пациентов проведен анализ суспензии клеток био-
птата яичка, что позволяет оценить шансы получения сперматозоидов с помощью процедуры
тестикуляной экстракции сперматозоидов (ТЕSE) и шансы получения тотальных препаратов
распластанных синаптонемных комплексов (СК) из клеток конкретного образца. Проведен
сравнительный анализ результатов исследования клеточного состава и иммуноцитохимиче-
ского исследования белков в распластанных ядрах сперматоцитов, полученных из «свежих»
и криоконсервированных биоптатов. Полученные результаты свидетельствуют об идентич-
ности результатов исследования препаратов, полученных этими двумя способами, что дает
дополнительные диагностические возможности в тех случаях, когда первая попытка ИКСИ
не удалась, а исследование СК не проводилось.
Для выявления нарушений сперматогенеза проведено электронно-микроскопическое ис-
следование ультратонких срезов ткани яичек. Использован разработанный в нашей лаборато-
рии метод многораундового иммуноцитохимического окрашивания одного и того же препарата,
позволяющий в одном ядре сперматоцита последовательно выявлять особенности синапсиса
и десинапсиса гомологичных хромосом, особенности распределения узелков ранней и поздней
рекомбинации DSBs; белков, участвующих в сайленсинге хроматина. Сопоставление результатов
комплексного исследования сперматогенеза позволяет заключить, что у пациентов с микроделе-
циями субрегиона AZFb происходит нарушение архитектоники ядер, отмечается фрагментация
хромосом, мейоз блокируется на ранних стадиях профазы I мейоза. У двух пациентов с азоо-
спермией выявлена так называемая gr/gr-делеция субрегиона AZFb, которую идентифицируют
по отсутствию маркера SY1291. По данным литературы, отсутствие маркера SY1291 встречается
и у пациентов с нормозооспермией. При анализе СК у двух пациентов с этой делецией выявлены
нарушения рекомбинации и синапсиса хромосом, превышение количества ядер сперматоцитов
с признаками пахитенного ареста. При электронно-микроскопическом исследовании срезов яи-
чек у 7 из 9 исследованных пациентов с разными микроделециями, захватывающими субрегионы
AZFb, AZFb+с или AZFc, выявлены нарушения структуры базальной мембраны (БМ) семенных
канальцев: утолщение, многослойность и формирование завитков. Такие нарушения структуры
БМ у пациентов без делеций AZF локуса встречаются крайне редко. Возможно, описанные нару-
шения структуры БМ обусловлены неизвестной мутацией или, возможно, являются проявлением
усиления гемато-тестикулярного барьера (ГТБ) в условиях накопления в яичке специфических
только для клеток сперматогенного ряда аутоантигенов, которые появляются в яичке с первой
волной сперматогенеза и проникновение которых через ГТБ за пределы семенных канальцев
может индуцировать развитие аутоиммунного процесса в яичке.
Исследование поддержано грантами РФФИ № 16-04-01447 и РНФ № 14-50-00029.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
70 Секция 2. Генетика человека, медицинская и спортивная генетика

В.А. Кордюм

ОСНОВЫ СИГНАЛЬНО-КЛЕТОЧНОЙ ТЕРАПИИ

Институт молекулярной биологии и генетики НАН Украины


Украина, 03143, г. Киев, ул. Академика Заболотного, 150
e-mail: v.kordium@gmail.com

В последние годы интенсивно развивается новое направление в медицине – предупре-


ждение лечения и восстановление от поражений различной этиологии, путем использования
того, что имеется в самом организме человека и обеспечивает его самоизлечивание и само-
восстановление. Это сигнальные молекулы, стволовые клетки и их производные. Сигналинг
настолько сложен, что пока далек от полного разрешения. Но в нем имеется одно ключевое
звено, с которого он начинается. Это система лиганд–рецептор.
Мы синтезировали ряд минигенов одних лигандов, клонировали кДНК других, получи-
ли продуценты соответствующих белков и сами белки в чистом виде, и на примере одного
из них – второго фактора роста фибробластов (FGF2) продемонстрировали его использование
для предупреждения развития поражений почки при начинающейся ишемии. Эти эксперименты
проводились нами совместно с Институтом урологии НАМН Украины. Ишемия почки вызы-
валась наложением лигатуры. После начала развития ишемии, в уже частично поврежденную
почку кроля вводили FGF2. У контрольных животных через некоторое время начинались на-
рушения кровотока, которые нарастали, и к 8 месяцу почка сморщивалась, а при гистологи-
ческом анализе в ней обнаруживались обширные дистрофические зоны и атрофия почечной
паренхимы. У опытных животных, которым вводили FGF2, почка через 8 месяцев, несмотря
на лигатуру, оставалась сохранной.
Терапевтическое применение стволовых клеток и их производных уже широко исполь-
зуется в медицине. В подавляющем большинстве случаев для этого берут стволовые клетки
взрослых людей. У взрослых их стволовые клетки тоже «взрослые». За время жизни человека
в них накапливаются мутации, замедляется самовоспроизводство, падает способность к вос-
становлению повреждений. Но имеется один уникальный источник, содержащий эмбриональ-
ные мезенхимальные стволовые клетки. Это вартонов студень. Нами разработана технология
получения, мультипликации и применения таких клеток. Их эффективность продемонстри-
рована на ряде патологий у модельных животных. Восстановление слизистых было показано
в совместных экспериментах с Институтом отоларингологии НАМН Украины на примере ле-
чения атрофического ринита у мышей. Введение MSC полностью восстанавливало разрушен-
ную слизистую и устраняло все клинические проявления болезни. Терапевтические эффекты
MSC и интерлейкина 10 были получены при их использовании как терапевтического средства
при аллергическом энцефаломиелите у крыс в работах, проведенных вместе с Институтом ней-
рохирургии НАМН Украины. Непосредственно в нашем институте (ИМБиГ НАН Украины)
на мышиной модели отработана первая версия восстановления организма путем применения
MSC, после системного поражения организма, вызванного хронической химической инток-
сикацией. Показано также терапевтическое действие MSC при повреждении суставов (с ис-
пользованием крыс как модельных объектов). При сходном терапевтическом положительном
действии, разные схемы применения MSC и цитокинов давали заметные различия по резуль-
татам гистологических исследований и тонким поведенческим реакциям. В настоящее время
эти работы у нас расширены и развиваются в направлении создания технологий комплексного
использования стволовых клеток и сигнальных молекул для лечения хронических и прогрес-
сирующих патологий.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 2. Генетика человека, медицинская и спортивная генетика 71

О.Л. Курбатова1, И.С. Цыбовский2, В.М. Веремейчик2, И.Г. Удина1

ГЕНЕТИКО-ДЕМОГРАФИЧЕСКИЕ ХАРАКТЕРИСТИКИ ДВУХ МЕГАПОЛИСОВ –


МОСКВЫ И МИНСКА

Институт общей генетики им. Н.И. Вавилова РАН


1

Россия, 119991, г. Москва, ул. Губкина, 3


e-mail: okurbat@list.ru
2
Государственное учреждение «Научно-практический центр Государственного комитета судебных
экспертиз Республики Беларусь»
Республика Беларусь, 220073, г. Минск, ул. Кальварийская, 43 

На основе анализа материалов демографической статистики и данных анкетирования жите-


лей Москвы и Минска рассчитаны основные параметры генетико-демографической структуры
популяций этих мегаполисов. Определены коэффициенты миграции и их динамика в поколе-
ниях, радиус миграционного притяжения города, параметры брачной структуры (доля межна-
циональных браков, уровень внутриэтнической брачной ассортативности, брачные расстоя-
ния), потоки генов между этническими группами. В Москве численность населения (12,3 млн.
чел.) намного больше, чем в Минске (1,9 млн. чел.), однако коэффициент миграции и средний
радиус миграции в двух городах отличаются не столь значительно: в Москве m = 0,49; R =
774 км; в Минске m = 0,40; R = 564 км. Большой приток мигрантов предопределяет выражен-
ную временную динамику генофонда городской популяции. Эта динамика будет иметь свою
специфику в двух городах, поскольку различны не только интенсивность миграции, но и об-
ласти миграционного притяжения двух мегаполисов: в столице России чуть больше половины
жителей родились в Москве и Московской области, 75% – на территории Центрального Феде-
рального округа. 75% жителей столицы Беларуси родились в Минске и Минской обл., 91% –
на территории Беларуси. Представительство наиболее многочисленной этнической группы
(русские в Москве и белорусы в Минске) в двух городах одинаково – 85%, при этом в Минске
доля межэтнических браков среди родителей анкетируемых лиц (31%) в три раза выше, чем
в Москве (10%). Показано, что благодаря интенсивному притоку мигрантов и широкому рас-
пространению межнациональных браков, население обоих мегаполисов представляет собой
смешанную популяцию в этническом, антропологическом и генетическом отношении. Наи-
более смешанной является самая многочисленная в городе этническая группа. Для русских
Москвы и белорусов Минска доля индивидуумов, все предки которых на глубину трех поко-
лений родились в данном городе и принадлежат к той же национальности, оказалась крайне
мала (3–5%). В Москве интенсивность потоков генов по мужской линии более высока, чем по
женской линии, поэтому в последующих поколениях ожидается более выраженная динамика
частот генов, сцепленных с Y-хромосомой. В то же время в Минске не наблюдается гендер-
ных различий в потоках генов. Эти особенности необходимо учитывать при формировании
генетических баз данных для населения мегаполисов, в том числе «референсной популяции»
для целей ДНК-идентификации.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
72 Секция 2. Генетика человека, медицинская и спортивная генетика

А.А. Лазаревич

РАСШИРЕНИЕ ТОЛЩИНЫ ВОРОТНИКОВОГО ПРОСТРАНСТВА У ПЛОДА


ПЕРВОГО ТРИМЕСТРА КАК МАРКЕР СИСТЕМНЫХ СКЕЛЕТНЫХ ДИСПЛАЗИЙ

ГУ «Республиканский научно-практический центр «Мать и дитя»


Республика Беларусь, 220053, г. Минск, ул. Орловская, 66
e-mail:lazikn@mail.ru

Актуальность проблемы. Системные скелетные дисплазии (ССД) представляют собой


генетически гетерогенную группу остеохондродисплазий, включающую, согласно Междуна-
родной номенклатуре конституциональных нарушений развития костей 2010, 400 заболева-
ний. Популяционная частота ССД (исключая редукционные пороки) в Республике Беларусь
составляет 22 случая на 100 000 новорожденных, частота по г. Минску – 33/100 000. Основным
неинвазивным методом пренатальной диагностики данной патологии остается ультразвуковое
исследование (УЗИ). В 1 триместре ведущим УЗ-маркером, позволяющим формировать груп-
пу риска по многим ССД, является расширение толщины воротникового пространства (ТВП).
По данным литературы, из выявленных пренатально в 1 триместре беременности случаев ССД,
летальными оказались около 80%, а увеличение ТВП отмечено в 70% случаев. Возможными
механизмами увеличения ТВП при ССД могут быть венозный застой в области головы и шеи,
который связан со сдавлением верхнего отдела средостения суженной грудной клеткой, сни-
жением движений плода в связи с переломами конечностей и изменением состава экстрацел-
люлярной матрицы, связанного с дефектами коллагена.
Цель исследования. Определение спектра ССД у плодов, абортированных по медико-
генетическим показаниям в 1 триместре беременности, ретроспективная оценка УЗ-маркера ТВП.
Материалы и методы. 18 плодов, абортированных по медико-генетическим показани-
ям в 1 триместре беременности путем кюретажа. Нозологический диагноз ССД установлен
на основании патологоанатомических и гистологических данных. ТВП оценивали по данным
генетических карт с протоколами УЗИ.
Результаты. На сегодняшний день в РНПЦ «Мать и дитя» в 1 триместре беременности
диагностированы 18 случаев ССД. В 40% случаев было отмечено увеличение ТВП. Наиболее
часто выявлялся несовершенный остеогенез 2 типа, составивший 33% (6/18). ТВП при этой
патологии была до 3 мм. Также были верифицированы дисплазии из группы синдромов «ко-
ротких ребер с (без) полидактилии» – 16,7% (3/18) (ТВП составила от 3 до 6 мм), ахондрогенез
2 типа (2 случая) (ТВП – 7 и более мм), диастрофическая дисплазия (2 случая) (ТВП – до 3 мм),
ателостеогенез 2 типа – 1 случай (ТВП – 3,1 мм), танатофорная дисплазия 1 типа – 1 случай
(ТВП – 3,9 мм), спондилокостальная дисплазия ((1) ТВП – 1,5 мм) и кампомелическая диспла-
зия ((1) ТВП – 2,1 мм). Не верифицированным из-за неполного сбора постабортного материала
остался один случай с ТВП 10 мм, мезомелическим укорочением конечностей, платиспонди-
лией и расщелиной мягкого неба.
Выводы:
При первом УЗ скрининге беременных возможно пренатально диагностировать тяжелые
формы ССД, многие из которых имеют аутосомно-рецессивный тип наследования.
При выявлении расширения ТВП необходимо проводить тщательный анализ скелета плода,
что позволит после исключения хромосомных нарушений диагностировать ССД уже на сроке
12–14 недель беременности.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 2. Генетика человека, медицинская и спортивная генетика 73

О.Д. Левданский1, М.С. Родькин1, Д.Е. Данилов2, В.С. Панкратов1, А. Около-Кулак1, А.В. Троян1,


И.А. Карпов2, О.Г. Давыденко1

ВЛИЯНИЕ ПОЛИМОРФИЗМА ГЕНОВ IL28B, CCL5, CCR5 И TNFα


НА ЭФФЕКТИВНОСТЬ ТЕРАПИИ ХРОНИЧЕСКОГО ГЕПАТИТА С

1
Институт генетики и цитологии НАН Беларуси
Республика Беларусь, 220072, г. Минск, ул. Академическая, 27
e-mail: 666555@tut.by
2
Белорусский государственный медицинский университет
Республика Беларусь, 220116, г. Минск, пр. Дзержинского, 83

Вирус гепатита С является одной из основных причин развития хронических заболеваний


печени. Около 2% населения мира страдает от хронического гепатита С, что обуславливает
высокую значимость исследований факторов, влияющих на вероятность спонтанной элими-
нации вируса, а также на эффективность терапии данного заболевания. В настоящее время
препараты интерферона в сочетании с рибавирином являются наиболее распространенными
при лечении хронического гепатита С, и было показано, что полиморфизм гена IL28B является
мощным предиктором эффективности такой терапии. Однако поиск дополнительных генети-
ческих маркеров, которые бы позволили увеличить точность прогноза, остается по-прежнему
актуальным.
В данное исследование были включены 130 пациентов с хроническим гепатитом С, кото-
рые прошли полный курс терапии интерфероном в сочетании с рибавирином. Пациенты бы-
ли разбиты на 2 группы в зависимости от того, удалось ли достичь у них непосредственного
вирусологического ответа (НВО). Генотипирование по локусам IL28B, CCL5, CCR5 и TNFα
проводилось методом ПЦР-ПДРФ. Для поиска наиболее оптимальной многофакторной моде-
ли прогнозирования эффективности терапии использовалась программа MDR версии 3.0.2.
Было показано достоверное влияние полиморфизма гена IL28B на вероятность достиже-
ния НВО. Исходя из полученных данных, вероятность неудачного исхода терапии при гено-
типе С/С в 8 раз ниже таковой при наличии другого генотипа (OR = 0,12, 95% CI = 0,03–0,43).
При генотипе Т/Т вероятность не достичь НВО у пациента в 2 раза выше, чем при наличии
хотя бы одного аллеля С (OR = 2,01, 95% CI = 0,8–5,37).
С помощью программы MDR, как и ожидалось, было выявлено, что лучшей однофактор-
ной моделью прогнозирования эффективности терапии является модель, учитывающая поли-
морфизм гена IL28B (точность – 0,69, постоянство CV – 10/10, p = 0,01). Однако наилучшая
точность прогнозирования была продемонстрирована двухфакторной моделью, основанной
на полиморфизме локусов IL28B и ССL5 (точность = 0,76, постоянство CV – 10/10, p = 0,001).
Распределение генотипов гена CCL5 незначительно различалось между группами с разными
исходами терапии, однако включение данного локуса в расчет позволило значительно улуч-
шить точность предикции. Согласно полученной модели, сочетания генотипов CC/GG, CC/
GA, CT/GA и CT/AA делают наиболее вероятным успешный исход терапии.
Трех- и четырехфакторные модели оказались менее информативными.
Таким образом, была подтверждена высокая значимость полиморфизма гена IL28B при
прогнозе эффективности комплексной терапии хронического гепатита С препаратами интер-
ферона и рибавирина. Наиболее точной многофакторной моделью оказалась модель, учиты-
вающая генотип по двум локусам – IL28B и CCL5, исходя из которой, прогноз успешного ле-
чения наиболее вероятен при генотипах CC/GG, CC/GA, CT/GA и CT/AA.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
74 Секция 2. Генетика человека, медицинская и спортивная генетика

И.Б. Моссэ, П.М. Морозик, М.Д. Амельянович, К.В. Жур, Е.В. Нестеренко, П.В. Евлеев

АНАЛИЗ ГЕНЕТИЧЕСКИХ МАРКЕРОВ ПАТОЛОГИИ КОСТНО-МЫШЕЧНОЙ


СИСТЕМЫ У СПОРТСМЕНОВ

Институт генетики и цитологии НАН Беларуси


Республика Беларусь, 220072, г. Минск, ул. Академическая, 27
e-mail: P.Marozik@igc.by

Чрезмерная физическая нагрузка отрицательно влияет на организм и может быть причи-


ной развития различных патологических изменений, приводящих к летальным или инвали-
дизирующим событиям. Выявление генетических маркеров (генов предрасположенности),
обуславливающих развитие и проявление этих патологических изменений, позволит прово-
дить своевременную профилактику травм, что сохранит здоровье спортсменов и повысит их
результативность.
Нами разработаны и апробированы методики молекулярно-генетического определения
полиморфизмов генов, ассоциированных с ломкостью костей и повышенным риском разры-
вов или растяжений связок и сухожилий. Проанализированы 76 образцов ДНК высококвали-
фицированных представителей пожарно-спасательного спорта и художественной гимнасти-
ки. Для анализа данных генотипирования спортсменов разделили на группы в зависимости
от наличия или отсутствия травм в анамнезе (костных переломов или разрывов/растяжений
связок и сухожилий).
По результатам сравнения частот встречаемости аллелей и генотипов исследуемых ге-
нов в сформированных группах определены наиболее информативные генетические маркеры
ломкости костей (полиморфизмы генов VDR, COL1A1, COL1A2, повышающие риск костных
переломов в 1,5–3,0 раза), а также маркеры повреждения связок и сухожилий (полиморфизмы
генов COL1A1, COL5A1, MMP3, MIR608).
На основании полученных результатов разработана технология оценки индивидуального
генетического риска костных переломов и разрывов/растяжений связок и сухожилий, с помо-
щью которой выявлен высокий генетический риск костных переломов у 7 представительниц
художественной гимнастики и 13 спортсменов пожарно-спасательного спорта. Для 13 гимна-
сток и 17 представителей пожарно-спасательного спорта установлен высокий генетический
риск разрывов и растяжений связок и сухожилий. При этом стоит отметить, что в группе лиц
с костными переломами частота неблагоприятных аллелей среди гимнасток статистически до-
стоверно ниже по сравнению с представителями пожарно-спасательного спорта. Это может
свидетельствовать о том, что у представительниц художественной гимнастики на риск пере-
ломов в большей степени влияют средовые факторы (сниженная масса тела, слабый мышеч-
ный каркас, и др.).
Результаты исследования были переданы врачам и тренерам команд для профилактики
травм, связанных с экстремальными физическими нагрузками, путём оптимизации и коррек-
ции тренировочного процесса и медико-биологического обеспечения.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 2. Генетика человека, медицинская и спортивная генетика 75

И.В. Наумчик

РОЛЬ МЕДИЦИНСКОЙ ГЕНЕТИКИ В ПРОФИЛАКТИКЕ ВРОЖДЕННЫХ


И НАСЛЕДСТВЕННЫХ ЗАБОЛЕВАНИЙ

ГУ «Республиканский научно-практический центр «Мать и дитя»


Республика Беларусь, 220053, г. Минск, ул. Орловская, 66
e-mail: belgenetics@yahoo.com

Медицинская генетика во всем мире является одной из наиболее интенсивно развиваю-


щихся медицинских дисциплин. Для нее характерен высокий уровень капиталовложений и вы-
сокий уровень отдачи, поскольку основная задача медицинской генетики – профилактика на-
следственных и врожденных заболеваний (НВЗ).
В Республике Беларусь создана система медико-генетической помощи населению, соот-
ветствующая мировым стандартам. Её оказывают областные медико-генетические центры
и медико-генетическая служба РНПЦ «Мать и дитя», которые проводят медико-генетическое
консультирование, лабораторную диагностику; пренатальную диагностику пороков развития
(ВПР) и хромосомных болезней (ХБ) плода; неонатальный биохимический скрининг; мони-
торинг ВПР.
Основные этапы программы профилактики НВЗ в республике: витаминопрофилактика при
подготовке к беременности; пренатальный скрининг – использование ультразвуковых исследо-
ваний, биохимических маркеров и цитогенетических исследований; пренатальная диагностика
наследственных заболеваний в семьях высокого риска – уточнение диагноза лабораторными
методами с использованием цитогенетических, молекулярно-цитогенетических, биохимиче-
ских и молекулярно-генетических методов, выявление гетерозиготных носителей, проведение
пренатальной диагностики выявленного заболевания; раннее выявление врожденных заболе-
ваний и начало лечения до клинических проявлений.
Ежегодно более 60 000 пациентов обращаются за медико-генетической консультацией;
цитогенетические исследования выполняются для 6000 пациентов и более 5000 беременных;
2500 пациентов разного возраста обследуются для уточнения диагноза наследственных болез-
ней обмена веществ, для 3000 пациентов выполняется молекулярно-генетическая диагностика
с целью уточнения диагноза или выявления носительства мутаций. Возможности пре- и пост-
натального уточнения диагноза постоянно расширяются благодаря внедрению современных
высокотехнологичных лабораторных и визуализирующих методов исследования.
Благодаря действующей системе профилактики и пренатальной диагностики частота рож-
дения детей с синдромом Дауна снизилась с 1,2‰ в 90-е годы до 0,45‰ в 2015 г., такие хромо-
сомные синдромы как трисомия 13, трисомия 18, триплоидия практически полностью выяв-
ляются в пренатальном периоде, частота множественных ВПР уменьшилась с 2,9‰ до 1,6‰,
пороков развития нервной трубки – с 2,7‰ до 0,13‰.
Система мониторинга ВПР, которая функционирует в Беларуси с 1979 года, включает веде-
ние областных и республиканского регистров, ежегодно регистрирует около 3500 случаев ВПР
у детей и плодов. Анализ данных мониторинга свидетельствует об относительной стабильности
частот ВПР – средняя частота ВПР и ХБ составляет 30‰ с некоторыми колебаниями в различ-
ных регионах республики. Эффективность предупреждения рождения детей с некурабельными
ВПР и ХБ составляет от 40% до 96% в зависимости от нозологической формы заболевания.
Таким образом, система оказания медико-генетической помощи в Беларуси охватывает все
основные направления диагностики и профилактики НВЗ, вносит вклад в снижение младен-
ческой смертности и детской инвалидности.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
76 Секция 2. Генетика человека, медицинская и спортивная генетика

И.В. Новикова, А.А. Лазаревич, Н.А. Венчикова, О.А. Тарлецкая, И.В. Соловьева,


Э.И. Мараховская, С.И. Ковалев

ПОРОКИ РАЗВИТИЯ ДЫХАТЕЛЬНОЙ СИСТЕМЫ У ПЛОДОВ,


АБОРТИРОВАННЫХ ПО ГЕНЕТИЧЕСКИМ ПОКАЗАНИЯМ ВО ВТОРОМ
ТРИМЕСТРЕ БЕРЕМЕННОСТИ

ГУ «Республиканский научно-практический центр «Мать и дитя»


Республика Беларусь, 220053, г. Минск ул. Орловская, 66
e-mail: i.novikova@mail.ru

На сегодняшний день основным методом профилактики рождения детей с некурабель-


ными, инвалидизирующими пороками развития (ПР) является пренатальная ультразвуковая
(УЗ) диагностика и прерывание беременности в случае аномалии плода. Целью настоящего
исследования было изучить морфологический спектр и сопутствующие аномалии у плодов
с ПР дыхательной системы.
Материалом послужили 77 плодов с ПР дыхательной системы, абортированных по гене-
тическим показаниям во II триместре беременности в рамках программы ультразвукового по-
пуляционного пренатального скрининга (1993–2016 гг.). Плоды с гипоплазией легких были
исключены из анализа. УЗ исследование выполнялось на аппарате Voluson 730 Expert транс-
абдоминальным (4–8 МГц) и трансвагинальным (4–9 МГц) датчиками. После прерывания бе-
ременности проводилось патологоанатомическое исследование плода с целью верификации
диагноза.
Спектр ПР дыхательной системы составили атрезия гортани (2 случая), атрезия главно-
го бронха (1), агенезия правого легкого (1), кистозно-аденоматозный порок развития легкого
(КАПРЛ) (50) и легочный секвестр (ЛС) (23). При патологоанатомическом исследовании у 24
из 50 плодов был диагностирован КАПРЛ 2 типа, у 26 – КАПРЛ 3 типа. В большинстве случаев
(41/50) КАПРЛ был изолированным ПР, в 8-ми случаях – входил в состав неклассифицирован-
ных комплексов множественных ПР, в 1-ом – был компонентом хромосомной болезни. КАПРЛ
одинаково часто встречался среди плодов мужского и женского пола (25♂:25♀). 29 из 50 слу-
чаев КАПРЛ были левосторонние, 20 – правосторонние, в 1 – процесс носил двусторонний
характер. Среди случаев ЛС 69,6% (16/23) были левосторонние. Кроме случаев типичного оди-
ночного экcтралобарного (n = 12) и интралобарного (n = 5) ЛС с торакальным расположением,
в 6-ти – были другие анатомические варианты. В 3-х случаях наблюдалась переходная форма
от интра- к экстралобарному ЛС, в 2-х – секвестрация легких была множественной – интра-
торакальной и интраабдоминальной (1) и интра- и экстралобарной (1), еще в 1-ом случае –
сочеталась с бронхогенной кистой, переходящей в облитерированный остаток коммуникации
с желудочно-кишечным трактом. В 36,4% (8/23) случаев ЛС был ассоциирован с кистозно-
аденоматозным пороком развития легкого II типа, в 50,0% (11/22) – с другими внелегочными
аномалиями. ЛС сочетался с диафрагмальной грыжей (4), дупликацией желудка (2), тетрадой
Фалло (1), незавершенным поворотом кишечника (2), сопутствовал синдрому гетеротаксии
(1) и комплексу множественных пороков: правосторонняя дуга аорты, тетрада Фалло, удвое-
ние толстого кишечника, подковообразная почка. В 15-ти из 19-ти случаев установленного
системного кровоснабжения ЛС питание осуществлялось аберрантным сосудом, отходящим
от грудной аорты, в 3-х случаях – от брюшной аорты и в 1-ом случае – было двойственным.
Таким образом, патоморфологическая верификация пренатально установленных УЗ диа-
гнозов ПР дыхательной системы позволила уточнить особенности выявленных пороков и под-
твердить обоснованность элиминации плодов с пороками развития.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 2. Генетика человека, медицинская и спортивная генетика 77

В.Ю. Нугис, Е.Э. Западинская, М.Г. Козлова, О.А. Тихонова

РЕЗУЛЬТАТЫ ЦИТОГЕНЕТИЧЕСКИХ ИССЛЕДОВАНИЙ ЛИКВИДАТОРОВ


И ЖИТЕЛЕЙ ЗАГРЯЗНЕННЫХ ТЕРРИТОРИЙ СПУСТЯ 28–29 ЛЕТ ПОСЛЕ 
АВАРИИ НА ЧЕРНОБЫЛЬСКОЙ АЭС

ФГБУ «Государственный научный центр Российской Федерации – Федеральный медицинский


биофизический центр им. А.И. Бурназяна» ФМБА России
Россия, 123182, г. Москва, ул. Живописная, 46, корп. 21.
e-mail: nugisvju@list.ru

Непосредственно после аварии на Чернобыльской АЭС индикация дозы по аберрациям


хромосом (дицентрикам) в культурах лимфоцитов периферической крови с помощью класси-
ческого метода окраски была практически единственным доступным источником информации
о дозах, полученных пострадавшими лицами. Так как с течением времени уровни аберраций
хромосом нестабильного типа, к которым относятся и дицентрики (основной индикатор ра-
диационного поражения в ближайшие сроки после облучения), имеют тенденцию к сниже-
нию своей частоты, то для более адекватной оценки полученных доз в отдалённый период
или при хроническом облучении (на загрязнённых территориях), в соответствии с методиче-
скими рекомендациями МАГАТЭ, разные исследователи применяли FISH-методику окраши-
вания хромосом.
Цель. Цитогенетическое обследование спустя почти 30 лет после аварии на Чернобыльской
АЭС ликвидаторов, работавших в различные годы, и жителей разных загрязнённых территорий.
Материалы и методы. Цитогенетические исследования были выполнены в культурах
лимфоцитов периферической крови. Большинство индивидуумов обследовалось с использо-
ванием FISH- и классического методов окраски хромосом параллельно.
Результаты. В целом частоты FISH-регистрируемых транслокаций превышали фоновые
уровни у 15 (из 58) человек: у 12 (из 41) ликвидаторов и у 3 (из 17) жителей загрязнённых тер-
риторий (оцененные дозы варьировали от 18 до 48 и от 20 до 24 сЗв соответственно). При FISH-
анализе у 9 обследованных индивидуумов были обнаружены единичные клетки с множествен-
ными аберрациями, содержавшие в основном нестабильные аберрации хромосом. Присутствие
или отсутствие таких клеток не было связано с наличием цитогенетически оцененной дозы.
Анализ данных, полученных с помощью классического метода, показал, что индивидуально
у всех обследованных лиц, как общая частота перестроек хромосом, так и частота аберраций
хромосом – индикаторов радиационного воздействия – не превышали фоновых значений.
Выводы. Через почти 30 лет после аварии на Чернобыльской АЭС возможна оценка до-
зы на всё тело у людей, вовлечённых в данную ситуацию, с помощью FISH-метода окраски
хромосом. У того же контингента с помощью классического метода окраски хромосом не уда-
лось выявить существенного отличия частот аберраций хромосом от их фоновых значений.
Для ликвидаторов аварии на Чернобыльской АЭС и жителей загрязнённых территорий харак-
терно обнаружение в культурах лимфоцитов периферической крови единичных клеток с мно-
жественными аберрациями, по-видимому, связанных с действием α-излучающих радионукли-
дов, дозиметрическая трактовка которых остаётся неясной.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
78 Секция 2. Генетика человека, медицинская и спортивная генетика

Г.М. Порубова, С.Н. Сиренко, И.В. Демянцева

ГЕНЕТИЧЕСКИЙ СКРИНИНГ ЗАБОЛЕВАЕМОСТИ РАКОМ МОЛОЧНОЙ ЖЕЛЕЗЫ


И ЯИЧНИКОВ ЖЕНСКОГО НАСЕЛЕНИЯ Г. МИНСКА

Минский городской клинический онкологический диспансер МЗ РБ


Беларусь, 220013, г. Минск, пр-т Независимости, 64

Cреди женского населения г. Минска стандартизированные показатели заболеваемости


раком молочной железы (РМЖ) составили в 2015 году 61,0 случаев, а раком яичников (РЯ) –
14,3 случаев на 100 тыс. женщин. Семейное накопление как РМЖ, так и опухолей женской
репродуктивной системы наблюдается у 25% заболевших женщин.
Одним из основных факторов риска развития рака данных локализаций является гене-
тическая предрасположенность. Доля наследственно-обусловленного РМЖ варьирует от 5
до 10%, наследственного рака яичников – 10–17%. Наследственные РМЖ и РЯ характеризу-
ются аутосомно-доминантным типом наследования с высокой пенетрантностью, ранним воз-
растом манифестации и выраженной генотипической и фенотипической гетерогенностью.
Установлено, что 20–50% наследственного рака молочной железы и 90–95% наследственного
рака яичников у женщин, а также от 4 до 40% РМЖ у мужчин детерминированы герминаль-
ными мутациями в генах BRCA1 и BRCA2.
Мутации в генах BRCA1 и BRCA2 значительно увеличивают индивидуальный риск разви-
тия РМЖ и РЯ. При отягощенном семейном анамнезе индивидуальный риск РМЖ еще возрас-
тает и составляет: у носителей мутаций в гене BRCA1 для РМЖ – до 87%, и до 44% – для РЯ.
У носителей мутаций в гене BRCA2 – до 84% и 27% в отношении развития РМЖ и РЯ, соот-
ветственно.
Онкологически отягощенный семейный анамнез является самым важным показанием
к молекулярно-генетическому тестированию. Выявление носителей мутаций и формирование
групп наследственного онкориска дает возможность как ранней диагностики заболевания, так
и выбора индивидуальных методов терапии онкологических пациентов.
Генетическое консультирование семей, отягощенных РМЖ и РЯ, проживающих в г. Мин-
ске, и молекулярно-генетическое тестирование на выявление носителей герминальных мута-
ций в генах BRCA1 и BRCA2 (метод Пронто) проводится в консультативно-поликлиническом
отделении Минского городского клинического онкологического диспансера МЗ РБ (КПО
МГКОД МЗ РБ).
Для включения в группы наследственного онкориска используются следующие крите-
рии: 1) онкологически отягощенный семейный анамнез: два и более случаев РМЖ/РЯ в семье
у родственников I‑II степени родства, РЯ в любом возрасте, двусторонний РМЖ, первичном-
ножественные злокачественные новообразования, РМЖ у мужчин, накопление в семье слу-
чаев злокачественных новообразований других локализаций (рак предстательной железы,
рак поджелудочной железы, опухоли головы и шеи и др.), наследственные онкологические
синдромы; 2) личный анамнез: РМЖ в возрасте до 50 лет; двусторонний (синхронный, ме-
тахронный) РМЖ; первично-множественные злокачественные новообразования, в том числе
сочетание РМЖ и РЯ.
К настоящему времени молекулярно генетическое тестирование прошли 1205 жителей
г. Минска (1188 женщин, 17 мужчин). Выявлено 295 носителей герминальных мутаций (286 –
у женщин, 9 – у мужчин). Мутации 5382insC в гене BRCA диагностированы у 86% пациен-
тов. Женщины-носители мутаций направляются на диспансеризацию в КПО МГКОД МЗ РБ.
Мужчины – под наблюдение врачей в поликлиники по месту жительства.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 2. Генетика человека, медицинская и спортивная генетика 79

О.В. Прибушеня¹, Е.И. Головатая¹, С.А. Котова², Е.А. Шило2, И.С. Цыбовский2

ТЕТРАГАМЕТИЧЕСКИЙ ХИМЕРИЗМ У ПАЦИЕНТА С ПЕРВИЧНЫМ БЕСПЛОДИЕМ

ГУ «Республиканский научно-практический центр «Мать и дитя»


1

Республика Беларусь, 220053, г. Минск, ул.Орловская, 66, e-mail: pribushenya@yandex.ru


2
ГУ «Научно-практический центр Государственного комитета
судебных экспертиз Республики Беларусь»
Республика Беларусь, 220073, г. Минск, ул. Кальварийская, 43

В настоящей работе описано редкое клиническое наблюдение тетрагаметического химе-


ризма у внешне здорового пациента с азооспермией, обследованного в связи с бесплодием.
Цитогенетические и молекулярно-цитогенетические исследования (метод интерфазной FISH)
выполнялись на клетах буккального эпителия и образце спермы в генетической лаборатории
РНПЦ «Мать и дитя». Молекулярно-генетическое исследование выполнялось соисполнителя-
ми и заключалось в генотипировании ДНК, выделенной из лейкоцитов периферической крови,
с помощью STR-маркеров. Пациент П., белорус, 28 лет, образование высшее, в связи с азоо-
спермией направлен в РНПЦ «Мать и дитя» для обследования. Экстрагенитальные заболева-
ния, в том числе факт пересадки костного мозга, других органов и тканей, стволовых клеток
пациент отрицает. При осмотре: телосложение нормостеническое, рост 168 см, вес 76 кг, индекс
массы тела 26,9. Оволосение по мужскому типу, наружные половые органы без особенностей,
при ультразвуковом исследовании: размеры правого яичка – 25×18×15 мм, объем 6,8 см³, раз-
меры левого яичка – 25×17×14 мм, объем 6,0 см³. Выполнено цитогенетическое исследова-
ние лимфоцитов периферической крови, установлен кариотип 46,ХХ[34]/46,ХY[66], и клеток
буккального эпителия – кариотип nuc XX[31]/XY[69]. Полученные результаты косвенно сви-
детельствовали о наличии химеризма. У пациента, сибса мужского пола и их родителей были
взяты образцы крови для ДНК-анализа. Четыре аллеля были обнаружены в генотипе пробан-
да для 2 аутосомных маркеров (SE33 и Penta E) из 23 исследованных. Еще для 4 аутосомных
маркеров (D3S1358, D7S820, D10S1248 и D22S1045) в генотипе пациента было обнаружено
3 аллеля. В генотипе сибса мужского пола генетические изменения по микросателлитным ау-
тосомным STR-маркерам не были обнаружены: в каждом локусе выявляли по 1 материнскому
и 1 отцовскому аллелю. Во всех локусах Y-хромосомы генотипы пробанда и его сибса совпа-
дают с генотипом их биологического отца. Для исключения истинного гермафродитизма про-
банду выполнена магнитно-резонансная томография (МРТ) органов малого таза. По задней
стенке мочевого пузыря позади предстательной железы определяется объемное образование
размером 67×45×22 мм, разделяющееся на две равные части в виде «ласточкиного хвоста»,
с четкими ровными контурами. По МРТ характеристикам и локализации вышеописанное об-
разование сходно с яичниками. Пациент направлен для консультации и оперативного лече-
ния к онкологам. При исследовании спермограммы в нативной сперме сперматозоиды не об-
наружены (объем 5 мл). После обработки (центрифугирование 15 мин при 3000 g) в осадке
обнаружены единичные подвижные сперматозоиды с нормальной морфологией и большое
количество лейкоцитов. Учитывая воспалительный характер спермограммы, было назначено
лечение, по завершению которого проведен контрольный анализ спермы, показавший возмож-
ность проведения ЭКО ИКСИ с собственными сперматозоидами. Супруга пациента направ-
лена к врачу-репродуктологу, проведена процедура ЭКО ИКСИ. На 14-е сутки эмбриотранс-
фера по уровню β-хориогонина в крови 185,2 mlU/ml диагностирована беременность раннего
срока. Беременность завершилась рождением здорового доношенного мальчика, весом 2840 г.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
80 Секция 2. Генетика человека, медицинская и спортивная генетика

О.В. Прибушеня1, Е.И. Головатая1, А.Л. Маркевич1, И.И. Прибушеня2

СТРУКТУРА ХРОМОСОМНЫХ АНОМАЛИЙ У ПАЦИЕНТОВ С ТЯЖЕЛЫМ


НАРУШЕНИЕМ СПЕРМАТОГЕНЕЗА

1
ГУ «Республиканский научно-практический центр «Мать и дитя»
Республика Беларусь, 220053, г. Минск, ул. Орловская, 66
e-mail: pribushenya@yandex.ru
2
ГУ «Республиканский клинический медицинский центр»
Управление делами Президента Республики Беларусь
Республика Беларусь, 220030, г. Минск, ул. Красноармейская, 10

Среди пациентов с азооспермией и тяжелой олигоспермией около 20% нуждаются в гене-


тическом обследовании и в 15% случаях при необструктивной азооспермии выявляются хро-
мосомные аномалии. Целью исследования стала оценка частоты и структуры хромосомных
аномалий у мужчин при тяжелых формах нарушения сперматогенеза.
Группу исследования составили 527 пациентов, направленных для кариотипирования,
с аспермией, азооспермией, тяжелой олигоспермией, тератоспермией, астеноспермией, бес-
плодием, гипоплазией testis. Кариотипирование проводили с помощью стандартной методики
GTG-banding. Из 527 пациентов патологический кариотип установлен у 96 (18,2%). Частота
синдрома Кляйнфельтера в этой группе составила 13,1%, или 1:8. Синдром Кляйнфельтера со-
ставил 71,9%, мозаичный кариотип с клоном клеток 45,Х – 8,3%, инверсия пола – 6,3%. При мо-
заичном варианте кариотипа с клоном 45,Х все пациенты имели мужской фенотип. При вы-
соком проценте мозаицизма 45,X может наблюдаться интерсексуальное развитие (до 47%)
и женский фенотип с признаками дисгенезии гонад. Причинами появления кариотипа 46,XX
у фенотипически здоровых мужчин может быть скрытый мозаицизм ХХY/ХХ или наруше-
ние активности гена SRY. Три четверти таких пациентов имеют ген SRY как следствие обмена
между Х- и Y-хромосомами в процессе мейоза I при гаметогенезе у отца. Фенотип таких паци-
ентов подобен клиническим проявлениям синдрома Кляйнфельтера, интеллект нормальный,
тестикулы атрофированы, бесплодие вызвано азооспермией. Структурные аномалии хромо-
сом отличались большим разнообразием и их частота составила 12,5 %. В половине случаев
(6 наблюдений) кариотип был сбалансированный. При робертсоновских транслокациях (РТ)
сбалансированным считается кариотип при наличии 45 хромосом. РТ встречаются с частотой
1:1000 и могут приводить к азоо- или олигоспермии. Этот тип транслокаций является наибо-
лее частой структурной перестройкой у мужчин с бесплодием. В нашей группе были РТ 13;14
и в сочетании с 14;21. Наиболее частым типом структурных аномалий Y-хромосомы являются
изодицентрические хромосомы, возникающие в случае образования симметричной хромосом-
ной структуры, несущей 2 и более центромер. В нашем исследовании было одно наблюдение
псевдоизодицентрика Y-хромосомы, диагностирован один случай кольцевой Y-хромосомы.
В группе структурных перестроек 17% составили реципрокные трнслокации.
Таким образом, в группе бесплодных мужчин с тяжелым нарушением сперматогенеза
частота патологических кариотипов оказалась ожидаемо высокой и составила 18,2%, что
не противоречит данным литературы. Из них 71,9% приходится на полную форму синдрома
Кляйнфельтера, 8,3% – на мозаичный кариотип с клоном клеток 45,Х. Частота инверсии по-
ла оказалась высокой и составила 6,3%. Группа структурных аномалий была гетерогенной
и в ней был представлен весь спектр ожидаемой патологии, включающий РТ, реципрокные
транслокации, различные варианты перестроек Y-хромосомы и другие сбалансированные
перестройки аутосом.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 2. Генетика человека, медицинская и спортивная генетика 81

О.В. Прибушеня, Г.И. Лазюк

ЧАСТОТА И СТРУКТУРА ВРОЖДЕННЫХ ПОРОКОВ РАЗВИТИЯ


ПРИ МНОГОПЛОДНОЙ БЕРЕМЕННОСТИ

ГУ «Республиканский научно-практический центр «Мать и дитя»


Республика Беларусь, 220053, г. Минск, ул Орловская, 66
e-mail: pribushenya@yandex.ru

Увеличение среднего возраста беременных женщин и применение вспомогательных ре-


продуктивных технологий, как во всем мире, так и в Беларуси привело к росту многоплодия.
По мнению многих авторов, многоплодие ассоциируется с более высокой частотой рождения
детей с врожденными пороками развития (ВПР). Целью нашего исследования была оценка ча-
стоты и структуры врожденной и наследственной патологии при многоплодной беременности
и сравнение полученных результатов с аналогичными данными при одноплодной беременности.
Всего за 2008–2011 гг., ультразвуковой (УЗ) пренатальный скрининг прошли 82 678 бере-
менных женщин, проживающих в г. Минске и завершивших беременность. Для анализа ото-
браны 851 пациентка с многоплодной беременностью, у которых в медицинской документации
имелись сведения о количестве хорионов и амнионов, установленные в ходе УЗ исследования
в 1 триместре, из них дихориальные двойни (ДХ) составили 76,0%, монохориальные (МХ) –
24,0%, моноамниотические – 1,9%. В группе беременностей двойней в 10,7% (91 случай)
наблюдались неблагоприятные пренатальные исходы, в том числе ВПР у плода и особые со-
стояния (фето-фетальный трансфузионный синдром (ФФТС), синдром обратной артериаль-
ной перфузии (СОАП), неразделившаяся двойня), составившие 10,1% (86 случаев). В группе
одноплодных беременностей зарегистрировано 3916 случаев ВПР у плода, с учетом неуточ-
ненных дефектов межпредсердной перегородки, что составляет 4,8% и достоверно ниже, чем
при многоплодной беременности (p > 0,05). В нашей работе СОАП в 1 триместре беременно-
сти диагностирован с частотой 1:200 (0,5%), в группе МХ-двоен ФФТС был диагностирован
в 13 случаях (6,3%). В нашем исследовании частота врожденной и наследственной патологии
при многоплодии оказалась выше общепопуляционной и составила 20,0% при МХ- и 7,7%
при ДХ-двойнях. При МХ-двойнях частота неблагоприятных перинатальных исходов также
выше, но уже за счет особых состояний, связанных с МХ – неразделившаяся двойня, ФФТС
и др. (p > 0,05). Зависимость частот изолированных форм ВПР и внутриутробной гибели обо-
их плодов во 2 триместре от хориальности не установлена (p > 0,05) и не превышала анало-
гичные показатели при одноплодной беременности (p > 0,05). Вместе с тем, множественные
ВПР наблюдались чаще при многоплодии по сравнению с одноплодной беременностью и ча-
ще при МХ-двойнях, чем при ДХ- (p > 0,05). Исход беременности был известен в 86 случаях.
Прерывание беременности по медико-генетическим показаниям проведено в 28 случаях, се-
лективная редукция плода в 1 триместре – в 5, саморедукция плода с ВПР во 2 триместре –
в 3, самопроизвольный аборт во 2 триместре – в 3, роды – у 47 пациенток. Среди прерываний
беременности аборт в 1 триместре был выполнен в 11 случаях (39,3%). Среди прерванных
беременностей преобладали МХ-двойни – 75,0%, из них МХ моноамниотические – 21,4%.
Родами двойней закончились 54,7% беременностей. В 5 наблюдениях дети с ВПР были мерт-
ворожденными, в4 – умерли в младенческом возрасте.
Таким образом, частота врожденной и наследственной патологии при многоплодии оказа-
лась значительно выше общепопуляционной и зависела от хориальности.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
82 Секция 2. Генетика человека, медицинская и спортивная генетика

Н.И. Рябоконь1, Н.В. Никитченко1, Т.Д. Кужир1, О.В. Прибушеня2, А.А. Ершова-Павлова2,


И.В. Наумчик2

Метод ДНК-комет в диагностике генетически обусловленных форм


мужского бесплодия

Институт генетики и цитологии НАН Беларуси


1

Республика Беларусь, 220072, г. Минск, ул. Академическая, 27


e-mail: U-Secretar@igc.by;
2
РНПЦ «Мать и дитя»
Республика Беларусь, 220053, г. Минск, ул. Орловская, 66

В соответствии с имеющимися международными данными, бесплодием страдают не ме-


нее 15% супружеских пар, из них чуть менее половины случаев связаны с мужским фактором.
При этом особая роль отводится генетически обусловленным причинам мужского бесплодия.
Показано, что повреждения (фрагментация) ДНК являются наиболее частой причиной по-
ниженной фертильности у мужчин. Количество повреждений ДНК в спермиях коррелирует
с их оплодотворяющей способностью, а именно, с концентрацией и подвижностью спермиев,
а также с уровнем оплодотворения и имплантации, частотой спонтанных абортов и даже забо-
леваемости рожденных детей. В случае, когда количество спермиев с поврежденной ядерной
ДНК достигает 30%, число успешных естественных оплодотворений приближается к нулю.
При искусственном оплодотворении фрагментация ДНК спермиев является одной из основ-
ных причин репродуктивных потерь. При этом, если количество спермиев с поврежденной
ДНК достигает 12–30%, то беременность не наступает. Установлено, что у пациентов с идио-
патическим бесплодием количество повреждений ДНК приблизительно в 2 раза выше, чем
в контрольной группе.
Все большую научную и практическую ценность приобретают методы оценки фрагмента-
ции ДНК в мужских спермиях. Среди тестов, используемых для оценки фрагментации ДНК
спермиев в т.ч. в клинической медицине, особое место занимает метод ДНК-комет. Щелочная
версия этого метода отличается высокой чувствительностью, воспроизводимостью результа-
тов, низкими временными и финансовыми затратами. Метод позволяет учитывать широкий
спектр повреждений ДНК: одно- и двунитевые разрывы ДНК, апурин-апиримидиновые сай-
ты, частично ДНК-ДНК и ДНК-белок сшивки − в каждой отдельно взятой клетке. При этом
количество клеток может быть ограничено, что актуально при нарушениях сперматогенеза.
Помимо этого, метод ДНК-комет дает возможность оценить состояние (целостность) всего
клеточного генома, а не отдельных его локусов.
Нами в рамках выполнения задания ОНТП «Здоровая мать – здоровое дитя – сильное го-
сударство» (2013–2015 гг.) разработан протокол исследования повреждений ДНК в спермиях
мужчин методом ДНК-комет. Изучены уровни повреждений ДНК в группах мужчин, прожи-
вающих на территории Беларуси и различающихся по степени фертильности. Установлены
нормальные, патологические и условно пограничные уровни повреждений ДНК. В целом, по-
казано, что анализ ДНК-комет может быть использован как один из методов диагностики гене-
тически обусловленных причин пониженной мужской фертильности. Разработана и утверждена
в Министерстве здравоохранения Инструкция по применению «Метод диагностики генетиче-
ски обусловленных форм мужского бесплодия». Проводятся работы по внедрению результатов
исследования, носящих импортозамещающий характер: по заказам физических лиц осущест-
вляется анализ повреждений ДНК в спермиях методом ДНК-комет.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 2. Генетика человека, медицинская и спортивная генетика 83

Л.Н. Сивицкая1, Н.Г. Даниленко1, Т.Г. Вайханская2, Т.В. Курушко2, А.М. Шимкевич1, О.Г. Давыденко1

МУТАЦИИ В ГЕНЕ ЛАМИНА А/С (LMNA) У БЕЛОРУССКИХ ПАЦИЕНТОВ


С ЛАМИНОПАТИЯМИ

1
Институт генетики и цитологии НАН Беларуси
Республика Беларусь, 220072, г. Минск, ул. Академическая, 27
e-mail: cytoplasmic@mail.ru
2
Республиканский научно-практический центр «Кардиология»
Республика Беларусь, 220036, г. Минск, ул. Р. Люксембург, 110

Ген LMNA (MIM 150330) кодирует белки ядерной ламины – ламин А и С. Ядерная лами-
на определяет прочность ядерной оболочки, организацию ядерных пор, защищает хроматин
от физических повреждений, вовлечена в контроль репликации ДНК, организацию хроматина,
экспрессию генов, процессинг и апоптоз. Мутации в гене LMNA проявляются как минимум
десятью разными клинически тяжелыми фенотипами, названными ламинопатиями.
Представлены три случая ламинопатий в Беларуси, связанные с носительством мутаций
в гене LMNA: дилатационной кардиомиопатии 1А (ДКМП, OMIM 115200), конечностно-
поясной мышечной дистрофии 1В (КПМД1В, OMIM 159001) и мышечной дистрофии Эймери-
Дрейфуса типа 2 (ЭДМД2, OMIM 181350). Диагнозы были верифицированы у трех нерод-
ственных пациентов по результатам комплексного клинического исследования (ЭКГ, ЭхоКГ,
ядерно-магнитный резонанс, вирусологический ПЦР-скрининг, коронарная ангиография, ней-
ромышечные и лабораторные исследования). Методом прямого секвенирования был осущест-
влен поиск мутаций в экзонах гена LMNA на ДНК-образцах пациентов.
У пациентки 23-х лет первые симптомы ДКМП1А (частое сердцебиение, атриовентрику-
лярная (АВ) блокада 1–2 ст.) предшествовали развитию дилатационного фенотипа и сердечной
недостаточности (СН). Фибрилляция предсердий с полной АВ-блокадой и обмороки появи-
лись на стадии дилатации всех камер сердца. У пациентки выявлена гетерозиготная мутация
p.R190P (c.569G>C), приходящаяся на α-спиральный rod-домен ламина А/С. Этот домен не-
обходим для димеризации и дальнейшей сборки белка в единую сеть. Замена p.R190P нару-
шает регулярную структуру α-спирали, тем самым препятствует правильной сборке ядерной
ламины и выполнению ею функций.
У 27-летней женщины первично была обнаружена патология сердца: полная АВ-блокада,
расширение левых отделов сердца, обмороки. Проявления КПМД1В обнаружены в возрасте
30 лет. Прогрессирующая слабость и боли в скелетных мышцах, гипотрофия мышц нижних
конечностей развивались одновременно с симптомами СН. У пациентки выявлена мутация
p.W520R (c.1558T>C), приводящая к замене высококонсервативного аминокислотного остатка
в коре Ig-домена ламина. Она изменяет внутримолекулярные силы и приводит к нарушению
фолдинга этого домена.
У пациента с диагнозом ЭДМД2 первые признаки слабости в мышцах верхних и нижних
конечностей появились в 5-летнем возрасте и усиливались с возрастом. К третьей декаде жиз-
ни у него развились множественные сухожильные контрактуры и выраженный тетрапарез.
До момента манифестации сердечной патологии (в 40 лет) пациенту был выставлен диагноз
миодистрофии Дюшенна. Молекулярно-генетический анализ гена LMNA позволил верифи-
цировать диагноз ЭДМД2. Пациент оказался гетерозиготным носителем мутации p.T528R
(с.1583С>G) в Ig-домене ламина.
Исследование родственников пациентов определило возникновение мутаций de novo во всех
трех случаях. Анализ родословных выявил связь мутаций с появлением в семьях заболевания,
ранее нехарактерного для их членов.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
84 Секция 2. Генетика человека, медицинская и спортивная генетика

И.Г. Удина1, П.Р. Бутовская1, О.Е. Лазебный2, В.А. Васильев3, Д.В. Шибалев3, Е.В. Веселовская4,
М.Л. Бутовская4

ИЗУЧЕНИЕ МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКОГО ПОЛИМОРФИЗМА ДОПАМИНОВОЙ,


СЕРОТОНИНОВОЙ И АНДРОГЕННОЙ СИСТЕМ И АНТРОПОЛОГИЧЕСКИХ
И ПСИХОЛОГИЧЕСКИХ ХАРАКТЕРИСТИК
У БОРЦОВ ВЫСШЕЙ КАТЕГОРИИ

Институт общей генетики им. Н.И. Вавилова РАН


1

Россия, 119991, г. Москва, ул. Губкина, 3


e-mail: irina_udina@mail.ru
2
Институт биологии развития им. Н.К. Кольцова РАН
Россия, 119334, г. Москва, ул. Вавилова, 26
3
Институт биологии гена РАН
Россия, 119334, Москва, ул. Вавилова, 34/5
4
Институт этнологии и антропологии им. Н.Н. Миклухо-Маклая РАН
Россия, 119991, Москва, Ленинский пр., 32а

В современных исследованиях по спортивной генетике для установления спектра гене-


тических маркеров успешности в спорте изучают не только полиморфизм генов, которые от-
вечают за метаболизм и строение тела и ассоциируются с мышечной силой, выносливостью,
спринтерскими качествами и другими физическими характеристиками спортсменов, но также
и генов, определяющих эмоциональное поведение спортсменов.
Психологические особенности человека являются комплексным результатом активности мно-
гих генов. Так, например, согласно современным представлениям, серотонинергическая система
является одной из важнейших нейромедиаторных систем организма, участвующих в регуляции
нейроэндокринных ритмов, сосудистого тонуса, эмоционального состояния и поведенческих ре-
акций. В нашем исследовании мы изучили полиморфизм генов-кандидатов (в качестве маркеров
успешности в борьбе дзюдо), которые ассоциированы со стресс-устойчивостью и агрессивно-
стью, так как спортсменам-дзюдоистам необходим четкий контроль агрессивности поведения, как
на тренировках, так и в процессе соревнований. Исследование проведено у 16-ти спортсменов-
дзюдоистов мирового уровня, а также у 40 молодых людей, которые служили контрольной группой
(все представители контрольной группы были европейцами, как и изу-ченная группа спортсменов).
Изучены 10 полиморфизмов для 9-ти кандидатных генов (AR, DRD4, DRD2, DAT1, COMT, 5-HTTL,
MAOA, HTR1A и HTR2A), которые связаны с функционированием серотониновой, допаминовой
и андрогенной систем. Показано, что спортсмены-дзюдоисты значимо отличались от контроль-
ной группы по распределению отдельных маркеров и генотипов. У спортсменов-дзюдоистов
отмечены более высокие частоты аллелей гена AR c низким числом САG-повторов, генотипов
V/V гена COMT и G/G гена HTR1A, что позволяет рассматривать установленные маркеры как
маркеры успешности в борьбе дзюдо. Особенности распределения параметра гетерозиготности
по изученным маркерам у спортсменов-дзюдоистов и в контрольной группе предполагают, что
для достижения успеха в борьбе дзюдо необходим четкий контроль собственной агрессивности.
Дополнительно изучены антропологические параметры и проведено комплексное психологиче-
ское тестирование для определения черт личности спортсменов-дзюдоистов, аналогично изуче-
ны женщины-самбистки. Показаны достоверные различия по ряду параметров между группами
спортсменов-борцов и контролем, что предполагает существование комплекса признаков, спо-
собствующего адаптации к сверхвысоким нагрузкам современного спорта.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 2. Генетика человека, медицинская и спортивная генетика 85

Н.Н. Чакова1, Н.О. Воловик1, С.С. Ниязова1, А.Н. Щаюк1, Л.М. Беляева2, Н.В. Микульчик2, Д.В. Буза2

ОЦЕНКА ЗНАЧИМОСТИ ПОЛИМОРФНЫХ ЛОКУСОВ ГЕНА БЕТА-2


АДРЕНОРЕЦЕПТОРА В ПАТОГЕНЕЗЕ АТОПИЧЕСКИХ ЗАБОЛЕВАНИЙ
У ДЕТЕЙ БЕЛАРУСИ

1
Институт генетики и цитологии НАН Беларуси
Республика Беларусь, 220072, г. Минск, ул. Академическая, 27
e-mail: N.Chakova@igc.by
2
Белорусская медицинская академия последипломного образования
Республика Беларусь, 220013, г. Минск, ул. П. Бровки, 3, корп. 3

По данным эпидемиологических исследований до 15% детского населения страдают ато-


пическими заболеваниями (АЗ), причем цифра эта растет с каждым годом. Среди АЗ у детей
наиболее часто встречаются атопическая бронхиальная астма (БА) и атопический дерматит
(АтД). АЗ относятся к многофакторным заболеваниям, ведущая роль в развитии которых при-
надлежит патологическому взаимодействию определенных наследственных и средовых фак-
торов, приводящему к клинической манифестации болезни с последующим «аллергическим
маршем», т.е. формированием «атопической триады» (дерматит, астма, ринит). Первые про-
явления заболевания у детей часто сводятся к «пищевой аллергии» и повышенному уровню
IgE (атопии), что в дальнейшем реализуется в АтД. При тяжелом течении АтД через 4–5 лет
у 35–40% пациентов развивается БА. Важную роль в контрактильности дыхательных путей
играет бета-2 адренорецептор. Именно он является мишенью для бета-2 агонистов, широко
применяемых для бронходилатации при БА. Полиморфизм гена ADRB2, кодирующего бета-2
адренорецептор, может оказывать влияние на реализацию клинических проявлений АЗ и фор-
мирование неблагоприятного течения данной патологии. В ряде исследований установлена
значимость полиморфных локусов Arg16Gly, Gln27Glu гена ADRB2 в патогенезе БА и форми-
ровании ответа пациентов на терапию ,бета-2-агонистами.
Цель работы. Выявление связи полиморфизма гена ADRB2 с патогенезом и прогнозом
развития АЗ у детей из Беларуси.
Материалы и методы. Методом ПЦР-ПДРФ-анализа исследовали полиморфные локусы
rs1042713 (Arg16Gly) и rs1042714 (Gln27Glu) гена ADRB2 у 387 детей с АЗ (276 человек – БА,
111 человек – АтД) и 214 здоровых индивидов, проживающих на территории Беларуси. Про-
водили сравнительный анализ распределения генотипов между группами детей с различной
атопической патологией, а также с контрольной группой.
Результаты. Частота встречаемости генотипов полиморфного локуса Arg16Gly гена ADRB2
в группе пациентов с АЗ достоверно отличалась от контрольной группы (р = 0,013), при этом
аллель Gly16 достоверно чаще встречалась у детей с атопической патологией (р = 0,04), что
указывает на ее рисковую значимость. Такая закономерность наблюдалась и при сравнении
с контролем каждой из групп пациентов с БА и АтД в отдельности. Анализ ассоциации по-
лиморфного локуса Gln27Glu гена ADRB2 с повышенным риском развития АЗ показал, что
частота носителей генотипа Glu27Glu в группе пациентов с АтД была достоверно в 1,6 раз
выше по сравнению с контрольной группой (р = 0,02) и в 1,8 раз выше, чем в группе пациен-
тов с БА (р = 0,005).
Заключение. Риск возникновения атопической патологии, в целом, выше у носителей
аллели Gly16, при этом у пациентов с генотипом Glu27Glu, по сравнению с обладателями
других генотипов, повышен риск развития АтД, но снижена вероятность присоединения БА.
Полученные результаты могут быть использованы в качестве дополнительных молекулярно-
генетических критериев прогноза течения АЗ.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
86 Секция 2. Генетика человека, медицинская и спортивная генетика

А.А. Яцкив1, Н.В. Никитченко1, Т.А. Глушкова2, Е.В. Сечко2, А.М. Чичко2, А.В. Сукало2, Р.И. Гончарова1

АЛЛЕЛЬНЫЙ СТАТУС ПОЛИМОРФНЫХ ЛОКУСОВ G/T RS7574865 ГЕНА STAT4


И C/T RS5742909 ГЕНА CTLA4 У БЕЛОРУССКИХ ПАЦИЕНТОВ С ЮВЕНИЛЬНЫМ
ИДИОПАТИЧЕСКИМ АРТРИТОМ

Институт генетики и цитологии НАН Беларуси


1

Республика Беларусь, 220072, г. Минск, ул. Академическая, 27


e-mail: R.Goncharova@igc.by
2
УО «Белорусский государственный медицинский университет»
Республика Беларусь, 220116, г. Минск, пр. Дзержинского, 83
e-mail: childill1@bsmu.by

Аутоиммунные заболевания широко распространены в современном мире и являются


одной из основных причин инвалидизации и смертности населения. Многочисленными иссле-
дованиями показана важная роль генетических факторов в развитии таких патологий. Одним
из подобных заболеваний, характерных для детского возраста, является ювенильный идио-
патический артрит (ЮИА) – тяжелое хроническое мультифакторное заболевание, начало ма-
нифестации которого происходит до достижения 16-летнего возраста. В связи с клинической
гетерогенностью ЮИА, по классификации ILAR в нем выделяют семь подтипов.
Для выявления возможных факторов предрасположенности к ЮИА нами были изучены
полиморфные локусы генов, имеющих непосредственное отношение к формированию иммун-
ного ответа: полиморфизм G/T rs7574865 гена STAT4 (преобразователь сигнала и активатор
транскрипции 4) и rs5742909 гена CTLA4 (антиген 4 цитотоксических Т-лимфоцитов).
Для исследования были сформированы две группы детей: группа пациентов, страдаю-
щих ЮИА (n = 80), и группа детей без аутоиммунных и воспалительных заболеваний (n = 80),
у которых был установлен аллельный статус полиморфных локусов. ДНК выделяли фенол-
хлороформным методом, молекулярно-генетическую диагностику проводили методом ПЦР-
ПДРФ, для статистической обработки данных применяли точный критерий Фишера и критерий χ2.
Показано, что среди белорусских пациентов с ЮИА преобладают девочки (66,25%), а наи-
более распространенным подтипом заболевания является олигоартрит (57,5%). Распределение
частот аллелей и генотипов по обоим изучаемым полиморфным локусам в общей группе паци-
ентов не отличалось от такового в группе контроля (р > 0,05). У девочек, страдающих ЮИА,
обнаружена тенденция большей частоты встречаемости (в 1,5–1,7 раза) гетерозиготных гено-
типов и мутантных аллелей обоих полиморфизмов, чем в группе мальчиков с диагнозом ЮИА.
Частота мутантного аллеля Т по полиморфизму rs7574865 гена STAT4 в группе пациентов
с полиартикулярным подтипом ЮИА статистически значимо отличалась от таковой в группе
контроля (р = 0,04) и превышала ее в 1,8 раза. Также обнаружена тенденция большей частоты
встречаемости гетерозигот СТ и мутантного аллеля Т по полиморфизму rs5742909 гена CTLA4
в контрольной группе.
Генотипирование по полиморфным вариантам генов предрасположенности к ЮИА имеет
практическое значение для выявления лиц с неблагоприятными вариантами аллелей и своев-
ременного проведения профилактических мероприятий.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 3

Генетика, селекция и биотехнология


88 Секция 3. Генетика, селекция и биотехнология

А.А. Адамбаева1, Р.Б. Ахмедов2, М.С. Кобозева2, В.В. Заякин2, А.А. Султанов1, И.Я. Нам2

АЛЛЕЛЬНЫЙ ПОЛИМОРФИЗМ ГЕНА BoLA-DRB3 У БОЛЬНЫХ БРУЦЕЛЛЕЗОМ


КОРОВ КАЗАХСТАНА

1
Казахский научно-исследовательский ветеринарный институт
Республика Казахстан, 050016, г. Алматы, пр-т Райымбека, 223
2
Брянский государственный университет им. акад. И.Г. Петровского
Россия, 241036, г. Брянск, ул. Бежицкая, 14
e-mail: iyanam1@yandex.ru

Бруцеллез крупного рогатого скота является одной из важнейших проблем ветеринарии


во всем мире, это хронически протекающая инфекционная болезнь всех видов сельскохозяй-
ственных и диких млекопитающих. Бруцеллез характеризуется поражением ретикулоэндоте-
лиальной системы, абортами с задержанием последа, эндометритами, орхитами, артритами,
расстройством воспроизводительной способности животных. Ежегодно в Казахстане реги-
стрируется более 1,5 тысяч случаев впервые диагностированного бруцеллеза среди людей.
По данным ФАО/ВОЗ, летальность у зараженных бруцеллезом людей может достигать 2–5%.
Бруцеллезная инфекция наносит огромный экономический ущерб животноводству республи-
ки и тормозит развитие племенного скотоводства.
В последние десятилетия разработка ДНК-маркеров хозяйственно-ценных признаков по-
зволила проводить экспресс-оценку поголовья на устойчивость к инфекционным заболеваниям.
В России активно изучались ДНК-маркеры устойчивости КРС к лейкозу на основе полимор-
физма аллелей гена BoLA-DRB3 (Сулимова, 1993; Эрнст, 2003; Удина и др., 2009; Смазнова
и др., 2014). Генетическая устойчивость коров к бруцеллезу с использованием гена BoLA-DRB3
ранее не изучалась.
Целью настоящей работы является оценка аллелотипов коров, пораженных бруцеллезом
по гену BoLA-DRB3, методом ПЦР-ПДРФ.
Исследование 2 групп больных бруцеллезом коров черно-пестрой и голштинской пород
(всего 74 коровы) выявило нетипичное распределение аллелей гена BoLA-DRB3: уровень наи-
более часто встречающихся аллелей *8, *22 и *24 – от 0 до 3,57%, лишь аллель *16 выявлен
с частотой 7,8–13,1%. В норме у коров, не пораженных бруцеллезом, частота этих аллелей в со-
вокупности составляет не менее 40–45%. В то же время выявлено существенное обогащение
аллелем *7 (15,5–32%), а также наличие очень редких аллелей *18, *29, *36.
При подтверждении полученных результатов возможно выявление аллелей гена BoLA-
DRB3, связанных с генетической устойчивостью и/или восприимчивостью разных пород КРС
к бруцеллезу, что будет использовано для формирования генетически устойчивого к бруцел-
лезу поголовья КРС и снижения заболеваемости животных.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 3. Генетика, селекция и биотехнология 89

А.В. Амосова1, С.А. Зощук1, Н.Л. Большева1, М.О. Твардовская2, И.О. Андреев2, О.Ю. Юркевич1,
Т.Е. Саматадзе1, В.А. Кунах2, О.В. Муравенко1

СРАВНИТЕЛЬНЫЙ МОЛЕКУЛЯРНО-ЦИТОГЕНЕТИЧЕСКИЙ АНАЛИЗ DESCHAMPSIA


ANTARCTICA DESV. (ПРИБРЕЖНАЯ АНТАРКТИКА) И РОДСТВЕННЫХ ВИДОВ

Институт молекулярной биологии им. В.А. Энгельгардта РАН


1

Российская Федерация, 119991, г. Москва, ул. Вавилова, 32


e-mail: amomar@mail.ru
2
Институт молекулярной биологии и генетики Национальной академии наук Украины
Украина, 03680, г. Киев, ул. Заболотного, 150

Род Deschampsia P. Beauv (Poaceae) представлен большой группой широко распростра-


нённых полиморфных видов, отличающихся морфологическим разнообразием, что затруд-
няет таксономию рода. Кариотипы видов Deschampsia изучены недостаточно. D. antarctica
Desv. (2n = 26) – одно из двух цветковых растений, адаптированных к экстремальным кли-
матическим условиям Антарктики – является важной моделью для изучения толерантности
растений к суровым условиям среды обитания, а также источником полезных для селекции
генов. В данной работе методами C/DAPI-бэндинга и FISH-анализа с пробами 45S и 5S рДНК
(pTa71, pTa794) было впервые проведено сравнительное исследование кариотипов 6 видов рода
Deschampsia, включая D. antarctica (мыс Расмуссен, Прибрежная Антарктика) (2n = 26) и род-
ственных видов из других мест произрастания: D. cespitosa P. Beauv. (2n = 26) (Великобрита-
ния, Россия, Норвегия), D. danthonioides Munro ex Benth. (2n = 26) (США), D. elongata Munro
(2n = 26) (США), D. sukatschewii (Popl.) Roshev (2n = 26) (Россия) и D. flexuosa Trin (2n = 28)
(Норвегия, Франция). На основе картины C/DAPI-бэндинга и распределения 45S и 5S рДНК
локусов были идентифицированы отдельные хромосомы в кариотипах изученных видов и по-
строены видовые идиограммы. Обнаружена межвидовая вариабельность и внутривидовой по-
лиморфизм по хромосомному составу и распределению 45S и 5S рДНК. В кариотипах неко-
торых растений D. antarctica, D. cespitosa, D. danthonioides, D. elongata и D. sukatschewii были
выявлены различные хромосомные перестройки. Помимо типичных диплоидных образцов,
у D. cespitosa (Великобритания) выявлено тетраплоидное (2n = 4x = 52) растение. В кариоти-
пах D. antarctica, D. cespitosa, D. danthonioides и D. elongata наблюдали 1–3 дополнительные
хромосомы (B-хромосомы), на которых методом C/DAPI-бэндинга выявлялись четкие блоки
гетерохроматина. Выявленные различия по распределению локусов рДНК, а также вариабель-
ность кариотипов видов Deschampsia указывают на то, что реорганизация геномов в процессе
дивергенции этих видов происходила не только путем гибридизации с последующей полипло-
идией, но и благодаря хромосомным перестройкам, затрагивающим различные хромосомы.
Проведенный в данной работе молекулярно-цитогенетический анализ видов Deschampsia
способствует прояснению взаимоотношений внутри рода, а полученные результаты могут по-
служить основой для дальнейших генетических и биотехнологических исследований, а также
для селекции растений, толерантных к экстремальным климатическим условиям.
Работа поддержана грантами РФФИ (№ 15-04-05574; 14-08-01167), а также Програм-
мой РАН «Динамика генофондов растений, животных и человека» (грант № 0103-2015-0117).

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
90 Секция 3. Генетика, селекция и биотехнология

В.С. Анохина, И.Б. Саук, И.Ю. Романчук

генетическая детерминация алкалоидности отдельных


коллекционных образцов люпина желтого и узколистного

Белорусский государственный университет


Республика Беларусь, 220030, г. Минск, пр. Независимости, 4
e-mail: anokhina@tut.by

Актуальность изучения культуры люпина связана с возрастающей потребностью мирового


сельского хозяйства в дешевых источниках высококачественного белка. Возделываемые виды
люпина отвечают этим требованиям по содержанию протеина, а также в связи с происходящей
при возделывании их биологизацией почв, связанной с биологическими особенностями: высо-
кая азотфиксация, мощная корневая система, способность произрастать в северных широтах.
В настоящее время использование многих сортов люпина на корм скоту и тем более в пищу
человека ограничено либо совсем невозможно из-за высокого содержания в них токсичных
алкалоидов, биосинтез которых восстанавливается при скрещивании сортов, являющихся не-
аллельными мутантами по генам алкалоидности. В связи с вышесказанным нами проведена
серия скрещиваний кормовых сортов (с содержанием алкалоидов до 0,1%), и изучены потомства
этих межсортовых гибридов по качественной реакции на алкалоидочувствительной бумаге.
Согласно данным литературы и результатам проведенного нами гибридологического ана-
лиза, установлено, что ген низкой алкалоидности iucundus присутствует у образцов Ашчадны,
Миртан, Немчиновский 846, Брянский 1272, Illyarrie, Tanjil, Yorrel, Wonga. Данный вывод был
сделан, поскольку в первом поколении у всех изученных гибридных растений от скрещивания
этих сортов между собой не происходило восстановления биосинтеза алкалоидов. Результаты
анализа F1 от скрещивания сортов показали, что биосинтез алкалоидов восстанавливается, ес-
ли одним из родительских компонентов были сорта Frost либо Брянский 1121, независимо от
направления скрещивания. Потомство от скрещивания между собой этих сортов (Frost и Брян-
ский 1121) было безалкалоидным, что указывает на аллельность их по признаку «низкое со-
держание алкалоидов». Нами сделан был вывод о присутствии у этих образцов вместо гена
iucundus иного гена низкой алкалоидности, по которому они между собой являются аллель-
ными мутантами. Также интересны гибриды при скрещивании сортов Frost и Брянский 1121
с образцом Першацвет-1. Такие растения выявляли реакцию на малоалкалоидность, что связано
с частичным восстановлением уровня алкалоидов. Данный факт, видимо, связан с наличием
мутантов по нескольким генам, отвечающим за биосинтез этих высокотоксичных вторичных
метаболитов.
При анализе растений первого поколения от межсортового скрещивания безалкалоидных
образцов люпина желтого было отмечено изменение алкалоидности при гибридизации со-
ртообразцов Престиж и МЛ. Так, потомство гибрида Престиж × МЛ было безалкалоидным,
в то время как у обратного гибрида МЛ × Престиж отмечено восстановление биосинтеза ал-
калоидов. Это, возможно, связано с эффектом влияния цитоплазмы на экспрессию генов алка-
лоидности. Восстановления биосинтеза алкалоидов не происходило при скрещивании образца
Надежный с сортами Престиж и Демидовский, МЛ – с сортами БСХА-13, БСХА-19, Фотон,
сортообразца БСХА-13 – с образцами Фотон, Престиж, Демидовский. В таких комбинациях
исходные сортообразцы между собой являются аллельными мутантами. В потомстве F2 люпина
желтого проведенных ранее скрещиваний гибридного образца ДК2733 × МЛ с сортом Надеж-
ный растения были высокоалкалоидными уже при качественном анализе вегетативной массы,
что указывает на неаллельность этого сорта и гибридной формы по признаку алкалоидности.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 3. Генетика, селекция и биотехнология 91

Р.Б. Ахмедов, М.С. Кобозева, В.В. Заякин, И.Я. Нам

ГЕНЕТИЧЕСКИЙ ПОЛИМОРФИЗМ BoLA-DRB3 У КОРОВ ПРИ ПЕРСИСТЕНТНОМ


ЛИМФОЦИТОЗЕ

Брянский государственный университет им. акад. И.Г. Петровского


Российская Федерация, 241036, г. Брянск, ул. Бежицкая, 14
E-mail: roma.akhmedov.91@mail.ru

Для установления взаимосвязи между заболеваемостью коров персистентным лимфоцито-


зом (лейкозом) и определенными аллелями гена BoLA-DRB3, участвующего в формировании
защитной реакции на возбудителей разных заболеваний, были исследованы образцы ДНК коров
черно-пестрой породы, показавших положительную реакцию при гематологическом обследо-
вании на лейкоз. Работа проведена на образцах из ООО «Снежка-Новоселки» и ОАО «Агро-
городок Гетманобудский», в стадах КРС которых было выявлено до 90% вирусоносителей
и больных животных. Для проведения исследований из этих хозяйств поступило 8 и 18 об-
разцов крови больных (гем-положительных) коров, соответственно.
Результаты свидетельствуют о низком аллельном полиморфизме изученных групп коров
по гену BoLA-DRB3: в совокупности 8 больных коров ООО «Снежка-Новоселки» имеют 7 раз-
ных аллелей, 18 коров из «Гетманобудский» имеют 15 разных аллелей, при этом с аллелями
устойчивости в гетерозиготном состоянии (УН и УЧ) выявлено всего 1 и 2 животных, соответ-
ственно. Коров с аллелями устойчивости в гомозиготном состоянии (УУ) не выявлено. Часто-
та встречаемости аллелей чувствительности составляет 43,75% в ООО «Снежка-Новоселки»
и 44,7% в ОАО «Агрогородок «Гетманобудский», а генотипов с аллелями чувствительности
(ЧХ) – 62,5% и 61,1% исследованных коров соответственно В благополучных по лейкозу хо-
зяйствах генотипы с аллелями устойчивости составляют 21–34%, а чувствительности – 29–
54%. Полученные данные подтверждают имеющиеся ранее сведения о взаимосвязи аллелей
устойчивости к лейкозу гена BoLA-DRB3 и заболеваемостью лейкозом.
Поскольку аллель устойчивости является доминантным, то несущая его в гетерозиготном
состоянии особь должна быть фенотипически устойчивой к лейкозу. Повторный гематологи-
ческий анализ больных животных с аллелями устойчивости, как правило, показывает наличие
не персистентного лимфоцитоза, а временного лейкоцитоза, вызванного другими инфекцион-
ными агентами.
Полученные результаты подтверждают перспективность обогащения стад КРС аллелями
устойчивости в условиях значительного заражения поголовья вирусом лейкоза КРС.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
92 Секция 3. Генетика, селекция и биотехнология

С.Х. Бабаева1, Х.И. Бободжанова1, Н.В. Кухарчик2

ВЛИЯНИЕ КОНЦЕНТРАЦИИ 6-БА НА РАЗВИТИЕ МИКРОПОБЕГОВ ВИНОГРАДА

Центр биотехнологии Таджикского национального университета


1

Таджикистан, 734025, г. Душанбе, проспект Рудаки, 17


e-mail: bobojankh_7@bk.ru
2
РУП «Институт плодоводства»
Республика Беларусь, 223013, Минский р-н, а/г Самохваловичи, ул. Ковалева 2,
e-mail: nkykhartchyk@gmail.com

Современные методы биотехнологии успешно используются для сохранения и воспроиз-


водства представителей многих видов растений, в том числе ценного генофонда винограда.
Виноград в культуре in vitro характеризуется высокой видовой специфичностью, и разрабо-
танная методика не может быть эффективной для всех сортов.
В качестве объектов исследований использовали сорта винограда Чиляки белый, Гиссар-
ский ранний и Ризамат.
Чиляки белый (синонимы: Чиляки сафет, Акчиляки) – таджикский столовый сорт вино-
града раннего периода созревания. Относится к эколого-географической группе восточных со-
ртов винограда. Вызревание побегов хорошее. Кусты сильнорослые. Урожайность – 76–140 ц/
га. Слабо повреждается грибными болезнями и вредителями. Виноград используется для по-
требления в свежем виде и приготовления изюма.
Гиссарский ранний – столовый сорт очень раннего периода созревания, выведен в Тад-
жикском НИИ земледелия скрещиванием сортов Чауш черный и Чиляки розовый. По срав-
нению с местными сортами винограда восточной группы Гиссарский ранний более чувстви-
телен к оидиуму, слабее поражается антракнозом, неморозостойкий. Урожайность 150 ц/га.
Используется для потребления в свежем виде.
Ризамат – столово-изюмный сорт винограда раннесреднего периода созревания. Получен
скрещиванием сортов Катта-Курган и Паркент. Морозостойкость Ризамата слабая, устойчи-
вость к оидиуму невысокая. Урожайность – 200–250 ц/га. Изюм из сорта винограда Ризамат
отличается нарядным внешним видом и хорошим вкусом.
На этапе микроразмножения in vitro в питательную среду (MS) добавлялся 6-бензиладе-
нин (6-БА) в концентрации 1,1; 0,7 и 0,5 мг/л. При использовании концентрации 6-БА 1,1 мг/л
отмечалось избыточное побегообразование, в том числе из каллусных тканей, образующихся
у основания черенка, микрочеренки имели параметры, недостаточные для пересадки, черен-
кование сопровождалось механическими повреждениями.
Коэффициент размножения для сорта Чиляки белый при концентрации 6-БА в составе
питательной среды, равной 0,7 и 0,5 мг/л, составил 3,8 и 4,5 соответственно. Для сорта Гис-
сарский ранний при этих же концентрациях цитокинина коэффициент размножения составил
2,5 и 2,1 соответственно. У винограда сорта Ризамат коэффициент размножения составил 2,9
и 3,1 при концентрациях 6-БА 0,7 и 0,5 мг/л соответственно.
Таким образом, непригодной для культивирования сортов винограда Чиляки белый, Гис-
сарский ранний и Ризамат оказалась концентрация 6-БА 1,1 мг/л, при добавлении в питатель-
ные среды 0,7 и 0,5 мг/л 6-БА, коэффициент размножения сортов составил 2,1–4,5.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 3. Генетика, селекция и биотехнология 93

О.Г. Бабак1, С.В. Кубрак1, Г.В. Шпаковский2, А.В. Кильчевский1

ОСОБЕННОСТИ РОСТА И РАЗВИТИЯ ТРАНСГЕННЫХ РАСТЕНИЙ ТОМАТА


(Solanum lycopersicum L.), ЭКСПРЕССИРУЮЩИХ кДНК CYP11А1
ЦИТОХРОМА Р450 ЖИВОТНОГО ПРОИСХОЖДЕНИЯ.

Институт генетики и цитологии НАН Беларуси


1

Республика Беларусь, 220072, г. Минск, ул. Академическая, 27


e-mail: babak_olga@mail.ru
2
Институт биоорганической химии РАН
Россия, 117997, г. Москва, ул. Миклухо-Маклая, 16/10
e-mail: gvs@ibch.ru

Стерины и стероидные гормоны принимают участие в регуляции физиологических процес-


сов как у животных, так и у растений. Отдельные наиболее консервативные этапы метаболизма
стероидов в клетках животных имеют значительное сходство с биосинтезом брассиностерои-
дов растений. Однако у растений отсутствует ключевой фермент стероидогенеза животных –
цитохром Р450scc, отщепляющий боковую цепь холестерина, превращая его в прегненолон.
Перенос элемента стероидогенной системы животных в растения позволил бы видоизменить
синтез растительных стероидов, что способно повлечь биохимические и физиологические из-
менения трансформантов. На созданных ранее трансгенных растениях табака было показано,
что белковый продукт кДНК CYP11A1 животного происхождения способен интегрироваться
в стероидогенную систему растений, оказывая росторегулирующую активность и повышая
устойчивость к различным видам стресса. В предыдущих наших исследованиях были полу-
чены независимые первичные линии трансгенных растений томата, изучены особенности их
роста и развития, выделены семена линий № 4 и № 7.
Целью данного исследования являлось изучение семенного поколения Т1 растений томата
(Solanum lycopersicum L.), содержащих полноразмерную кДНК гена СYP11A1, кодирующего
цитохром P450SCC из тканей коры надпочечников быка.
Линии № 4 и № 7, трансгенная природа которых подтверждена методом ПЦР, выращива-
лись в условиях защищенного грунта. На всех стадиях развития наблюдались фенотипиче-
ские различия между линиями трансформантов по интенсивности окраски листьев, размеру
и форме листовой пластины, толщине и высоте побегов. Разница в продолжительности веге-
тационного периода позволила выделить линию № 4 с сокращенным периодом вегетации и
линию № 7 с более продолжительным периодом развития. Важными особенностями растений
линии № 7 были большие, по сравнению с контролем (сорт Рекордсмен), значения высоты
стебля, интенсивности окраски листьев, а также устойчивости к болезням. Общей особенно-
стью линий трансформантов являлась частичная или полная стерильность, что выражалось
в опадении бутонов после цветения, пониженной завязываемости плодов, невыполненности
семян. Накопление каротиноидов в плодах было на уровне лучших форм коллекции Инсти-
тута генетики и цитологии.
В дальнейших экспериментах в поколении T2 планируется изучить в ряде лабораторных
экспериментов устойчивость к абиотическим и биотическим стрессам.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
94 Секция 3. Генетика, селекция и биотехнология

Д.М. Бекенов1, А.А. Спанов1, А.И. Сембаева1, И.Я. Нам2, А.М. Омбаев1

ИСПОЛЬЗОВАНИЕ КЛЕТОЧНЫХ БИОТЕХНОЛОГИЙ ДЛЯ УСКОРЕННОГО


ВОСПРОИЗВОДСТВА КРУПНОГО РОГАТОГО СКОТА

1
ТОО «Казахский НИИ животноводства и кормопроизводства»
Республика Казахстан, 050035, г. Алматы, ул. Жандосова, 51
e-mail: ironlan-1983@inbox.ru
2
Брянский государственный университет им. акад. И.Г. Петровского
Россия, 241036, г. Брянск, ул. Бежицкая, 14
e-mail: iyanam1@yandex.ru

Для повышения воспроизводства племенного поголовья КРС применяли метод транс-


плантации эмбрионов, при этом для осеменения коров-доноров использовали сексированную
сперму (Канада) с целью увеличения выхода телок. Объектом исследований служили коровы
голштинской породы молочного комплекса ТОО «Байсерке-Агро» Талгарского района, Алма-
тинской области.
Гормональную стимуляцию суперовуляции проводили по классической 4-х-дневной схе-
ме с использованием 2,5%-ного масляного раствора гормона прогестерон, фолликулости-
мулирующего препарата «Плюсет» и препарата группы PG F2α «Эстрофан» в следующей
последовательности: без учета фазы полового цикла внутриматочно вводили 2,5%-ный рас-
твор прогестерона в общей дозе 0,5 г, с 7-го по 11-ый день проводили совместную инъекцию
ФСГ и раствора прогестерона, на 12-ый день двукратно инъецировали «Эстрофан» по 3 мл,
и на 13–14-ый день двукратно искусственно осеменяли в рог матки, используя по 3 соломинки
семени, разделенного по полу.
Вымывание эмбрионов проводили на 7-й день после первого искусственного осеменения
раствором Дюльбекко по 500 мл на каждый рог. Обнаруженные эмбрионы собирали в отдель-
ную четырех-луночную чашку с раствором «Hold Solution» и проводили морфологическую
оценку полученных эмбрионов.
В опытах показано, что при гормональной обработке коров-доноров препаратом CIDR
в сочетании с ФСГ число овуляций на 32% выше по сравнению с обработкой прогестамагом
в сочетании с ФСГ. Количество вымытых эмбрионов на донора составило 5,0 и 7,0 у живот-
ных в 1-ой и во 2-ой группах, соответственно. Выход полноценных эмбрионов одинаковый
в двух группах – по 3,5 на донора, что связано с увеличением количества дегенерированных
эмбрионов и яйцеклеток в первом варианте (3,5 по сравнению с 1,5). Большое количество
неоплодотворенных яйцеклеток и дегенерированных эмбрионов свидетельствует о снижении
оплодотворяющей способности сексированного семени по сравнению с обычной спермой.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 3. Генетика, селекция и биотехнология 95

П.А. Борозан

Кремнистая зародышевая плазма в селекции раннеспелых


гибридов кукурузы

Институт растениеводства «Порумбень»


Республика Молдова, 4834, Криуленский р-н, с. Пашкань
e-mail: pantelimon.borozan@yahoo.com

Селекционная программа по созданию раннеспелых гибридов кукурузы основанa на ис-


пользовании линий из европейской кремнистой гетерозисной группы. Кремнистые формы
характеризуются высокой устойчивостью к низким температурам и являются неотъемлемой
частью при синтезе гибридов северного типа. Зубовидная зародышевая плазма менее приспо-
соблена к низким температурам, однако, обладает высокой комбинационной способностью.
Для получения продуктивных гибридов, устойчивых к пониженным температурам, в скре-
щиваниях используются зубовидные линии с высокой общей комбинационной способностью
по урожаю зерна и кремнистые формы, приспособленные к тепловому режиму северных зон
возделывания кукурузы.
Исследования по созданию кремнистых линий были начаты в 90-е годы прошлого столе-
тия. Исходный материал в виде родственных, простых, тройных, сестринских, беккроссных
скрещиваний и синтетических популяций с широкой и узкой генетической основой, был создан
из лучших оригинальных константных линий и линий иностранной селекции. Использование
позднеспелых элитных линий, как доноров для улучшения комбинационной способности, яв-
ляется важным элементом в синтезе исходного материала. Анализ родословной современных
линий показывает, что наиболее ценными для селекционного улучшения кремнистой зароды-
шевой плазмы являются линии F2, F564, FCS1727, FCS1728, Со255, TA105, SUM901, CM7,
ИК169, Lo3 и Pi187. На первых этапах селекции широко использовались синтетические по-
пуляции, содержащие более 50% генотипа элитных линий. На протяжении 2–3 циклов про-
водился фенотипический рекуррентный отбор в целях выделения раннеспелых генотипов
cо специфическими признаками позднеспелых доноров.
В последние годы, для улучшения комбинационной способности лучших кремнистых ли-
ний в качестве доноров, вовлечена зубовидная зародышевая плазма, обеспечивающая в скре-
щиваниях с гетерозисной группой Айодент высокую зерновую продуктивность, в частности
среднепоздние линии из группы Ланкастер. Исходным материалом служат беккроссные скре-
щивания с 75% генотипа кремнистого рекуррентного компонента. Фенотипический отбор
внутри и среди индивидуальных потомств S2–S3 проводится на стрессовых фонах при повы-
шенной густоте растений. Загущение обеспечивает более высокую степень дифференциации
селекционного материала по устойчивости к полеганию, поражению пыльной и пузырча-
той головней, зерновой продуктивности и синхроности цветения репродуктивных органов.
На этом этапе отбираются лучшие родоначальники линий и дальнейшие работы включают
определение комбинационной способности и реакции на С- и М- типы ЦМС в топкроссных
схемах с 3–5 тестерами из альтернативных гетерозисных групп. Линии с высокой комбина-
ционной способностью переводятся в коллекцию для размножения и дальнейшего изучения
по холодостойкости в лабораторных условиях и сверхранних посевах, а также по толерантно-
сти к головневым заболеваниям на инфекционных фонах. Важным элементом является узкая
классификация новых линий на основе родословной, данных урожая зерна в скрещиваниях
между собой и распределения в группах F2 (Лакон), SUM901 (Гелбер Ланд Маис) и смешан-
ная кремнистая плазма. Кремнистые линии служат родительскими формами простых и моди-
фицированных простых гибридов, созданных на основе гетерозисных моделей Еврофлинт ×
Ранняя Зубовидная (ФАО 150-170) и Айодент × Еврофлинт (ФАО 180-220).

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
96 Секция 3. Генетика, селекция и биотехнология

А.А. Булойчик, Т.В. Долматович

ИДЕНТИФИКАЦИЯ ГЕНОВ УСТОЙЧИВОСТИ К ГРИБНЫМ БОЛЕЗНЯМ У ОЗИМЫХ


СОРТОВ МЯГКОЙ ПШЕНИЦЫ

Институт генетики и цитологии НАН Беларуси


Республика Беларусь, 220072, г. Минск, ул. Академическая, 27
e-mail: A.Buloichik@igc.by

В условиях Беларуси одними из вредоносных и распространенных заболеваний озимой


пшеницы являются мучнистая роса и бурая ржавчина (возбудители – биотрофные грибные
патогены Blumeria graminis DC. f. sp. tritici Marchal. и Puccinia triticina Erikss., соответствен-
но). В связи с изменением климата в последние годы регистрируется появление стеблевой
(P. graminis f. tritici Erikss. and Henning) и желтой (P. striiformis f. tritici Erikss.) ржавчины. При-
менение молекулярных маркеров для идентификации генов устойчивости к патогенам в ис-
ходном материале позволит оптимизировать селекционный процесс на этот признак.
С помощью 50 пар праймеров проанализированы 56 сортов озимой мягкой пшеницы, вне-
сенных в Государственный реестр Республики Беларусь 2014–2015 гг., на наличие генов устой-
чивости к бурой ржавчине, стеблевой и желтой ржавчине и мучнистой росе: Lr1, Lr9, Lr10,
Lr19/Sr25, Lr20/Sr15/Pm1, Lr21, Lr22a, Lr24/Sr24, Lr25/Pm7, Lr26/Sr31/Yr9/Pm8, Lr28, Lr29,
Lr34/Yr18/Pm38, Lr35/Sr39, Lr37/Sr38/Yr17, Lr42, Lr47, Sr2, Sr22, Sr26, Sr1RSAmigo, Sr36, Sr40,
Sr44, Sr45, Yr5, Yr10, Yr26, Pm3 (Pm3а, Pm3b, Pm3c, Pm3d, Pm3e, Pm3f, Pm3g), Pm4 и Pm17.
Ген устойчивости Lr1 выявлен у озимых сортов: Саната, Уздым, Ядвiся, Элегiя, Сакрэт,
Балада, Мроя, Akteur, Finezja, Dоrota, Muza, Turnia. Ген Lr10 выявлен у сортов Arctis, Skagen,
Finezja, Dorota, Olivin, Bogemia. Гены устойчивости Lr26, Sr31, Yr9, Pm8 идентифицирова-
ны у сортов Фантазiя, Капэла, Городничанка, Markiza. Гены устойчивости Lr34, Yr18, Pm38
выявлены у сортов Фантазiя, Дар Зернограда, Дон-93, Acteur. Гены устойчивости Lr37, Sr38,
Yr17 обнаружены у сортов Sailor, Skagen. Ген устойчивости Yr5 идентифицирован в сортах
Капылянка, Былина, Легенда, Щара, Саната, Гродненская 7, Спектр, Узлет, Фантазiя, Зари-
ца, Сюiта, Канвеер, Уздым, Ядвiся, Ода, Элегiя, Кредо, Капэла, Мроя, Zentos, Cubus, Acteur,
Skagen, Bockris, Dromos, Lucius, Tonacja, Sukces, Bogatka, Finezja, Nutka, Turnia, Figura, Sailor,
Dоrota, Olivin, Льговская 4, Eurofit, Bogemia. Ген устойчивости к мучнистой росе Pm4 иден-
тифицирован у сортов Саната, Гродненская 7, Веда, Фантазiя, Зарица, Мроя, Muza, Natula,
Lucius, Bockris, Skagen.
Сорт белорусской селекции Фантазiя был носителем комплекса генов устойчивости: к муч-
нистой росе, бурой, стеблевой и желтой ржавчине – Lr26/Sr31/Yr9/Pm8, Lr34/Yr18/Pm38, Yr5
и Pm4. Сорт белорусской селекции Капэла являлся носителем двух генов устойчивости к жел-
той ржавчине Yr9 и Yr5 и генов устойчивости: Lr26, Sr31, Pm8. У сортов немецкой селекции
Skagen и Acteur также идентифицирован комплекс генов устойчивости к мучнистой росе, бу-
рой, стеблевой и желтой ржавчине: Skagen – Lr10, Lr37/Sr38/Yr17, Yr5 и Pm4, а у Acteur – Lr1,
Lr34/Yr18/Pm38 и Yr5.
В исследованных сортах не выявлены локусы, сцепленные с генами устойчивости Lr9,
Lr19/Sr25, Lr20/Sr15/Pm1, Lr21, Lr22a, Lr24/Sr24, Lr25/Pm7, Lr28, Lr29, Lr35/Sr39, Lr42, Lr47,
Sr22, Sr26, Sr1RSAmigo, Sr36, Sr40, Sr44, Sr45, Yr10, Yr26, Pm3 (Pm3а, Pm3b, Pm3c, Pm3d, Pm3e,
Pm3f, Pm3g) и Pm17.
Выделенные сорта могут служить источниками эффективных генов резистентности к воз-
будителям мучнистой росы, бурой, стеблевой и желтой ржавчины.
Работа выполнена при финансовой поддержке Фонда фундаментальных исследований
Республики Беларусь (грант Б13-018).

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 3. Генетика, селекция и биотехнология 97

П.П. Васько

ПРОДУКТИВНОСТЬ ФЕСТУЛОЛИУМА МОРФОТИПОВ РАЙГРАСА И ОВСЯНИЦЫ

РУП «Научно-практический центр НАН Беларуси по земледелию»


Республика Беларусь, 222160 г. Жодино, ул. Тимирязева, 1
e-mail: vaskopp@mail.ru

Фестулолиум – это новый вид многолетней злаковой травы, полученный путем межродово-
го скрещивания райграса пастбищного или многоукосного и овсяницы луговой или овсяницы
тростниковой. Фестулолиум приобретает от овсяниц такие качества, как холодостойкость, за-
сухоустойчивость и выносливость к болезням, а от райграсов – способность к быстрому отрас-
танию, повышенному содержанию белка, сахаров и переваримостью органических веществ.
В зависимости от подбора родительских форм и их морфотипов гибриды наследуют опре-
деленное сочетание признаков. Фестулолиум морфотипа райграса многоукосного характери-
зуется быстрыми темпами роста в первый год жизни и формированием травостоев в после-
дующие годы использования, высоким качеством корма и относительной выносливостью к
неблагоприятным погодным условиям.
Сорт фестулолиума райграсового морфотипа Удзячны белорусской селекции включен в Го-
сударственный реестр сортов с 2015 года, характеризуется интенсивным отрастанием и форми-
рованием пастбищных травостоев с 6–7 циклами стравливания и урожайностью зеленой массы
от 385 ц/га на супесчаных и до 646 ц/га – на суглинистых почвах. Фестулолиум сорта Удзяч-
ны хорошо сочетается с райграсом пастбищным и клевером ползучим в многокомпонентной
пастбищной травосмеси. Включение в состав многокомпонентных пастбищных травосмесей
фестулолиума повышает их урожайность и качество корма, что отмечают как отечественные,
так и зарубежные исследователи.
Создан межродовый гибрид райграса пастбищного (Lolium perenne) и овсяницы луговой
(Festuca pretense) – сорт Метеор, формирующий на супесчаной почве 6–7 циклов стравлива-
ния при пастбищном использовании, или 4 укосные травостои при сенокосном использовании.
Зимостойкость на уровне 4,5 балла, содержание сырого протеина 22–24%, общей обменной
энергии 11,7 МДж/кг СВ при пастбищной спелости травостоя и 18–19% и 10,5 МДж/кг СВ
соответственно – при сенокосной спелости травостоя.
Сорт Метеор находится с 2016 года в государственном сортоиспытании. Сорт фестулоли-
ума Метеор сформировал в конкурсном сортоиспытании при неустойчивом водном режиме
413,8 ц/га зеленой массы, что выше контрольного сорта на 28%. При достаточном увлажне-
нии за вегетационный период накоплено свыше 670 ц/га зеленой массы, что превышает кон-
трольный сорт на 20%.
Создание фестулолиума овсяничного морфотипа, характеризующегося высокой зимостой-
костью, адаптивностью к климатическим условиям Беларуси, формирующего 6–7 циклов страв-
ливания при пастбищном использовании с содержанием обменной энергии 10,5–11,0 МДж/кг
СВ и сырого протеина на уровне 17–18% позволит повысить продуктивность луговых угодий,
качество кормов и сбор белка, а также оптимизировать сортовую структуру травостоев по
срокам созревания с целью расширения оптимальных сроков уборки травостоев и снижения
напряженности уборочных работ.
В результате оценки растений межродового гибрида овсяницы тростниковой и райграса
многоцветкового выявлены источники хозяйственно-полезных признаков: по скороспелости,
интенсивности отрастания, кормовой и семенной продуктивности, показателям качества кор-
мов, зимостойкости, мягкости листьев, облиственности.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
98 Секция 3. Генетика, селекция и биотехнология

Т.А. Воейкова1, О.А. Журавлева1,2, Н.В. Булушова1, Т.С. Кубасова1, Т.Т. Исмагулова3, В.П. Вейко4,


К.В. Шайтан3,5, В.Г. Дебабов1

«ЗЕЛЕНЫЙ СИНТЕЗ» НАНОЧАСТИЦ СУЛЬФИДА СЕРЕБРА МИКРООРГАНИЗМАМИ


И АНАЛИЗ БЕЛКОВОГО ПОКРЫТИЯ ЧАСТИЦ

1
Государственный научно-исследовательский институт генетики и селекции
промышленных микроорганизмов
Россия, 117545, г. Москва, 1 Дорожный проезд, 1
e-mail: voeikova.tatyana@yandex.ru
2
Институт биохимической технологии и нанотехнологии РУДН
Россия, 117198, г. Москва, ул. Миклухо-Маклая, 10, корп. 2
3
Московский государственный университет имени М.В. Ломоносова
Россия, 119991, г. Москва, Ленинские горы, 1
4
Институт биохимии им. А.Н. Баха РАН
Россия, 119071, г. Москва, Ленинский пр., 33
5
|Институт химической физики им. Н.Н. Семенова РАН
Россия, 119334, г. Москва, ул. Косыгина, 4

Получение, исследование и использование наноматериалов обеспечивает прогресс в обла-


сти нанотехнологий. Значительный интерес представляет получение наночастиц халькогенидов
металлов и наиболее доступных среди них сульфидов, которые обладают полупроводниковыми
свойствами и используются при создании солнечных батарей, биосенсоров, аккумуляторов,
в медицине для прижизненной визуализации органов и тканей. Сульфиды металлов получа-
ют химическими методами. Однако биологический метод с использованием микроорганиз-
мов имеет ряд преимуществ, экологически безопасен, осуществляется при нормальной тем-
пературе и давлении, не требует дорогих и токсичных химических веществ. Особый интерес
для медицины и биологии представляют наночастицы, которые могут стабильно существовать
в водной среде. В случае биогенного получения наночастицы покрыты гидрофильными моле-
кулами – белками, полисахаридами и другими биополимерами, определяющими стабильность
и биосовместимость наночастиц. Однако в литературе практически нет работ, посвященных
количественному и качественному изучению этих поверхностно сорбированных молекул.
Цель нашей работы – получение наночастиц сульфида серебра (нч Ag2S) с помощью бакте-
рий различных таксономических групп и анализ состава макромолекул на их поверхности. Нч
Ag2S получали в растворе солей азотнокислого серебра и тиосульфата натрия в присутствии
металл-восстанавливающей бактерии Shewanella oneidensis MR-1, Escherichia coli K-12 и Ba-
cillus subtilis 168, геномы которых полностью аннотированы. Размеры наночастиц варьировали
от 5 до 40 нм в зависимости от штамма. Наночастицы не агломерировали и были стабильны
в водных суспензиях. Белки с поверхности нч Ag2S были экстрагированы в денатурирующих
условиях, разделены методом белкового электрофореза в полиакриламидном геле и проана-
лизированы методом MALDI–TOF/TOF масс-спектрометрии. Установлена специфичность со-
става белкового покрытия наночастиц в зависимости от вида микроорганизма, применяемого
для их получения. Наибольшее разнообразие белков на поверхности наночастиц наблюдали
при использовании S. oneidensis MR-1. Тогда как на поверхности наночастиц, полученных с по-
мощью B. subtilis 168, обнаружен в основном один белок – флагеллин. Установлено, что белки,
сорбированные на поверхности наночастиц, являются белками внешних мембран микроорга-
низмов, использованных для биосинтеза наночастиц, и представлены семействами поринов,
белков-рецепторов TonB, TolC, FadL, флагеллинами.
Работа выполнена при финансовой поддержке Российского фонда фундаментальных ис-
следований (грант № 16-04-00471), Программы Президиума PАН (№ 24) и Министерства
образования и науки PФ.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 3. Генетика, селекция и биотехнология 99

Е.А. Волуевич

ИСПОЛЬЗОВАНИЕ ГЕНОВ С ПЛЕЙОТРОПНЫМИ ЭФФЕКТАМИ ДЛЯ ПОВЫШЕНИЯ


УСТОЙЧИВОСТИ ПШЕНИЦЫ К ГРИБНЫМ ПАТОГЕНАМ

Институт генетики и цитологии НАН Беларуси


Республика Беларусь, 220072, г. Минск, ул. Академическая, 27
e-mail: Voluevitch@yandex.ru

Грибные патогены вызывают распространенные и вредоносные болезни пшеницы. Эко-


логически безопасной и экономически выгодной считается генетическая защита сортов, в том
числе использование в селекции генов с плейотропными эффектами. Эти гены могли сфор-
мироваться в процессе эволюции Triticum aestivum L. и обусловливают базальный (неспеци-
фический) уровень устойчивости, необходимый для нормального роста и развития растений.
К настоящему времени хорошо изучены четыре таких гена.
Ген Lr34/Yr18/Sr57/Pm38/Bdv1/Ltn1 контролирует длительную возрастную устойчивость к ли-
стовой и желтой ржавчине с начала ХХ века, медленное развитие мучнистой росы, расоспецифи-
ческую устойчивость к стеблевой ржавчине, является основным локусом устойчивости к темно-
бурой пятнистости (Bipolaris sorokiniana) у линии мягкой пшеницы Saar селекции CIMMYT.
Ген Lr46/Yr29/Sr58/Pm39/Ltn2 обеспечивает возрастную частичную устойчивость к ли-
стовой, желтой, стеблевой ржавчине и мучнистой росе, а у линии Saar ассоциирован с малым
QTL устойчивости к B. sorokiniana. Ген повышает число колосьев на растении, но оказывает
значительный негативный эффект на массу 1000 зерен.
Ген Lr67/Yr46/Sr55/Pm46/Ltn3 обусловливает полевую устойчивость к листовой, желтой
ржавчине, мучнистой росе и в присутствии других генов – к стеблевой ржавчине (но пока
не определено, является ли она расоспецифической). Морфологический маркер трех этих ге-
нов – некроз кончиков листьев – проявляется после цветения растений и может быть исполь-
зован при отборе по фенотипу.
Ген Sr2/Yr30/Lr27/Pbc1 медленного развития стеблевой и желтой ржавчины широко ис-
пользуется в селекционных программах всего мира. Он обусловливает также возрастную ча-
стичную устойчивость к мучнистой росе. Расоспецифическая устойчивость к листовой ржав-
чине проявляется только в присутствии комплементарного гена Lr31. Ген Sr2/Yr30/Lr27/Pbc1
способствует значительному увеличению числа зерен в колосе и имеет морфологический мар-
кер – псевдочерную пигментацию стеблей и/или колосковых чешуй.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
100 Секция 3. Генетика, селекция и биотехнология

Е.В. Воронкова, В.И. Лукша, О.Н. Гукасян, А.В. Левый, А.П. Ермишин

НОВЫЙ ЛОКУС, АССОЦИИРОВАННЫЙ С УСТОЙЧИВОСТЬЮ К PVY У КАРТОФЕЛЯ,


ЛОКАЛИЗОВАН НА ХРОМОСОМЕ V

Институт генетики и цитологии НАН Беларуси


Республика Беларусь, 220072, г. Минск, ул. Академическая, 27
e-mail: e.voronkova@igc.by

На основе диплоидных межвидовых гибридов, созданных при опылении аллотетрплоид-


ного вида Solanum stoloniferum фертильным дигаплоидом S. tuberosum получены расщепляю-
щиеся по признаку «экстремальная устойчивость» (ER – extra resistance) к Potato virus Y (PVY)
диплоидные популяции гибридов. Уровень устойчивости гибридов F1 и беккроссных поколе-
ний расщепляющихся популяций определяли методом ELISA после искусственного зараже-
ния растений инфекторами штаммов PVYO или PVYN у клубневого поколения заражавшихся
гибридов. Оценка исходных экстремально устойчивых к PVY F1 межвидовых гибридов с по-
мощью ПЦР-анализа выявила отсутствие у них известных R-генов устойчивости к Y-вирусу,
ранее картированных на хромосоме XII. Однако расщепление в популяциях достоверно сви-
детельствовало о детерминации признака наличием одного R-гена. Посредством RAPD PCR
с праймером OPA18 был выявлен полиморфизм между экстремально устойчивыми и чувстви-
тельными к вирусу гибридами популяции IGC 08/13.n (заражалась штаммом PVYО) по нали-
чию локуса 600 п.н. Наличие этого локуса высокодостоверно коррелировало с устойчивостью
к вирусу (rs = 0,68**).
Секвенирование фрагмента OPA18-600 и анализ результатов сиквенса с помощью баз дан-
ных FASTA и BLAST, а также анализ его рекомбинации с известными микросателлитными
маркерами и ПЦР-маркерами к известным RFLP-локусам серии TG, позволили локализовать
фрагмент на хромосоме V в регионе 52 сМ между RFLP-локусами TG60 и TG185, (соответ-
ствующие коэффициенты рекомбинации (rf) 0,35 и 0,0).
Был выявлен высокий уровень гомологии 3’-концевого фрагмента секвенированной об-
ласти локуса размером порядка 200 нуклеотидов (от 30 до 40%) c транскрибируемыми после-
довательностями нуклеотидов, кодирующих аминокислотную последовательность медного
шаперона (CCH или ATX1-белок транспорта меди) нескольких видов растений рода Solanum
(идентичность с разными прототипами – от 91 до 93%) и полная ее идентичность с последова-
тельностью пероксидазы пятого типа (NCBI XM 006345938.1). Это свидетельствует в пользу
связи секвенированного фрагмента с последовательностями, характерными для генов устойчи-
вости. Область секвенирования захватила лишь часть локуса, ассоциированного с устойчиво-
стью, который, судя по данным рекомбинационного анализа, расположен ближе к SSR-маркеру
STM1031, чем к TG185 (соответствующие показатели rf = 0,15 и 0,60). В связи с этим нам пока
не удалось создать на основе секвенированного фрагмента STS-маркер для выявления нового
локуса устойчивости к PVY в селекционном материале S. stoloniferum. Однако для этой цели
может быть предложен SSR-маркер STM1031 273+275 (двойной пик), идентифицированный
исключительно у генотипов с экстремальной устойчивостью к PVY гибридной популяции IGC
08/13.n, а также у нескольких высокоустойчивых к PVY диплоидных межвидовых гибридов
другого происхождения, полученных на основе S. stoloniferum.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 3. Генетика, селекция и биотехнология 101

И.А. Гордей, О.М. Люсиков, И.С. Гордей, В.Е. Шимко

ПРОБЛЕМЫ И МЕТОДЫ ЦИТОГЕНОМИКИ ХЛЕБНЫХ ЗЛАКОВ

Институт генетики и цитологии НАН Беларуси


Республика Беларусь, 220072, г. Минск, ул. Академическая, 27
e-mail: I.Gordej@igc.by

Наши исследования в области цитогеномики хлебных злаков (1994–2016 гг.) являются раз-


витием экспериментальных работ классика генетики академика А.Р. Жебрака по целенаправ-
ленному синтезу новых видов пшеницы и пшенично-ржаных гибридов. Его работы послужили
основой современной цитогеномики растений – раздела геномики, занимающегося изучением
структурной организации, функционирования и изменчивости геномов на клеточном и хро-
мосомном уровнях, роли дупликаций, межвидовых интрогрессий, перестроек геномов и хро-
мосом в эволюции, формо- и видообразовании с целью выяснения механизмов и способов
целенаправленного преобразования геномов растений, теоретического и экспериментального
обоснования геномных биотехнологий в селекции.
В докладе представлены оригинальные методы и результаты исследований лаборатории
цитогеномики растений Института генетики и цитологии НАН Беларуси по созданию тетра-
плоидных форм ржи, ржано-пшеничных амфидиплоидов с цитоплазмой ржи – секалотритикум,
рекомбинантных форм тетраплоидной ржи. Зиготические полиплоиды ржи (RRRR, 2n = 28)
получали с применением метода дупликации генома в период первого деления зиготы с ис-
пользованием закиси азота (N2O) под давлением, секалотритикум и рекомбинантные формы
тетраплоидной ржи – на основе ржано-тритикальных пентаплоидных гибридов F1 (S/RRABR,
5x = 35) путем беккросса на тритикале и рожь соответственно, самофертильные линии ржи –
с использованием источников самофертильности (sf).
Установлено, что дупликация генома ржи включает комплекс молекулярно-генетических
процессов геномных перестроек, вызывающих изменение экспрессии генов и структурные
изменения ДНК. Предложены молекулярно-генетические механизмы прогамной несовмести-
мости и самонесовместимости ржи. У ржано-тритикальных гибридов F1 в условиях ржаного
типа цитоплазмы и базового генома ржи (RR) формируются функциональные гаметы раз-
личного хромосомного состава, происходит нормализация мейоза и образование частично
нередуцированных полногеномных гамет RAB и RR, что приводит к формированию генома
секалотритикум. Нами исследованы механизмы цитогенетической стабилизации и обоснова-
на целесообразность подвидового уровня в классификации гетероплазматических тритикале.
Ключевым фактором цитогенетических механизмов формирования и стабилизации геномов
межвидовых гибридов является структурно-функциональная организация центромер исходных
видов в клеточном цикле гибридов. В сотрудничестве с Институтом молекулярной биологии
СО РАН начаты молекулярно-цитогенетические исследования видовой специфичности функ-
ционирования центромер и структуры центромерного гистона H3/CENH3 у ржи, пшеницы
и их межродовых гетероплазматических гибридов.
Таким образом, межвидовые интрогрессии, полиплоидия, дупликации, инбредные
перестройки и рекомбинации геномов, гетероплазмия с использованием молекулярно-
цитогенетических методов для идентификации и анализа экспериментального материала яв-
ляются современной методологической основой целенаправленной реорганизации геномов
хлебных злаков в области прикладной цитогеномики растений.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
102 Секция 3. Генетика, селекция и биотехнология

И.С. Гордей

СТРУКТУРНО-ФУНКЦИОНАЛЬНЫЕ ИЗМЕНЕНИЯ ГЕНОМА РЖИ


(SECALE CEREALE L.) ПРИ ЗИГОТИЧЕСКОЙ ПОЛИПЛОИДИЗАЦИИ

Институт генетики и цитологии НАН Беларуси


Республика Беларусь, 220072, г. Минск, ул. Академическая, 27
e-mail: I_Gordej777@mail.ru

Проведены исследования по разработке и использованию метода зиготической поли-


плоидизации генома ржи, позволяющего повысить в 10 раз выход тетраплоидов, выявлению
структурных изменений ДНК и полиморфизма запасных белков, обусловленных дупликацией
генома ржи.
С использованием данного метода получены новые тетраплоидные формы озимой ржи:
Алькора, Зарница, Юбилейная, Плиса, Валдай × Каупо, ЗС-2, СФ 200. Выход тетраплоидов
при указанных параметрах был достаточно высок и составил в среднем 43,4% (при колхици-
нировании – до 4%) при относительно низком уровне анеуплоидии (8%).
Выявлены структурные изменения ДНК локусов запасных белков секалинов Sec-1, Sec-2,
а также локуса короткостебельности Hl (Ddw1) при дупликации генома ржи в зиготе. Уста-
новлено, что дупликация генома в зиготе приводит к появлению или элиминации отдельных
фрагментов ДНК у тетраплоидов по сравнению с исходными диплоидами.
Показано, что дупликация генома у ржи может приводить к элиминации отдельных ком-
понентов секалина, появлению новых компонентов, а также к увеличению сортового поли-
морфизма секалина у тетраплоидов. Установлено, что у тетраплоидных форм внутрисортовой
полиморфизм значительно шире и достигает 10–19, у исходных диплоидных сортов – от 7
до 10 типов спектра. Полученные данные свидетельствуют о функциональных изменениях,
обусловленных дупликацией генома ржи.
С использованием метода фотоцитометрии ядер установлено, что количество элимини-
рованной ДНК у полученных тетраплоидов ржи в 4–7 поколениях после дупликации генома
варьировало от 10 до 28% и составляло в среднем 20,2%. Выявлена зависимость количества
элиминированной ДНК от поколения тетраплоида после дупликации генома. В 4–6-ом по-
колении количество элиминированной ДНК составило 10–19%, в 7-м поколении – 25–28%.
Таким образом, зиготическая полиплоидизация генома ржи приводит к следующим
стуктурно-функциональным изменениям:
• структурным изменениям ДНК у тетраплоидов;
• изменению полиморфизма запасных белков секалинов у тетраплоидов;
• более высокой частоте нарушений мейоза у тетраплоидов;
• элиминации части ядерной ДНК у тетраплоидов в F4–7 поколениях;
• повышению продуктивности растений за счет увеличения массы 1000 зерен на 25–30%.
Урожайность с 1 м2 у созданных тетраплоидов на 10–15% выше по сравнению с исходны-
ми диплоидами.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 3. Генетика, селекция и биотехнология 103

С.И. Гордей, Е.Н. Кулинкович

Создание новых форм яровой пшеницы с использованием


внутривидовой, отдаленной гибридизации, эмбриокультуры
in vitro и экспериментального мутагенеза для селекции
на урожайность, болезнеустойчивость и качество продукции

РУП «Научно-практический центр НАН Беларуси по земледелию»


Республика Беларусь, 222160, г. Жодино, ул. Тимирязева, 1
e-mail: S_Gordej@mail.ru

В России В.А. Зыкиным были созданы перспективные формы мягкой пшеницы, характери-
зующиеся достаточно высокой урожайностью и высоким качеством зерна, причем эти ценные
признаки сцеплены с таким маркерным признаком, как фиолетовая окраска зерна. Сцепление
с таким маркерным признаком делает довольно простой задачу гибридизации и последующих
отборов высокопродуктивных и одновременно высокобелковых и высоколизиновых форм,
на основе визуального отбора продуктивных форм с фиолетовой окраской зерна, с дальней-
шей оценкой их качества и наследования по потомству. Данные формы мягкой пшеницы мы
использовали в этой работе, включая их в гибридизацию с другими формами и видами (Triti-
cum durum; T. turgidum) с последующим использованием эмбриокультуры in vitro, обработкой
УФ-лучами и отбором селекционно-ценных генотипов. Новые формы пшеницы с геномом В
от тетраплоидных пшениц могут служить также исходным материалом при создании сортов
тритикале, т.к. геному В принадлежит ведущая роль в диплоидизации мейоза, что важно в слу-
чае присутствия генома R ржи. Установлено, что локус Ph (pairing homeology), ответственный
за бивалентную коньюгацию, расположен на длинном плече 5В-хромосомы.
Проведена гибридизация по 18 комбинациям мягкой пшеницы с фиолетовой окраской зерна
(♀) с образцами твердой и тургидной пшеницы (♂). В среднем по всем комбинациям завязы-
ваемость гибридных зерновок составила 5,7% при варьировании от 0,0% до 13,6%.
Для преодоления постгамной несовместимости использовали эмбриокультуру in vitro.
С целью усиления рекомбиногенеза проводилась обработка гибридов F1 УФ-лучами с пред-
варительной сенсибилизацией. После облучения растения пересаживались в искусственную
почву Биона 112. В процессе акклиматизации в искусственной почве отмечена гибель 29,6%
растений, что, скорее всего, связано со значительными хромосомными перестройками после
облучения УФ-лучами.
В результате получено 87 растений-регенерантов межвидовых гибридов F1 яровой пше-
ницы. Полученные гибридные растения по фенотипу сходны с материнской формой мягкой
пшеницы. Фиолетовая окраска зерна ярко выражена у всех гибридных растений без исклю-
чения. По высоте растения первого поколения имели промежуточные показатели. Изучение
колоса показало, что гибриды F1 значительно превосходили обоих родителей по длине, числу
колосков и числу зерен с колоса.
На последующих этапах исследований будет проведено изучение расщепления по раз-
личным признакам в поколениях и выделение селекционно-ценных генотипов (урожайность,
болезнеустойчивость, качество).

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
104 Секция 3. Генетика, селекция и биотехнология

Т.Е. Денискова1, А.В. Доцев1, М.И. Селионова2, Г. Брем1,3, К. Виммерс4, Х. Рейер4, Е.А. Гладырь 1,
А.-М.М. Айбазов2, Н.А. Зиновьева1

ИЗУЧЕНИЕ ГЕНЕТИЧЕСКОГО РАЗНООБРАЗИЯ ПОРОД ОВЕЦ ДАГЕСТАНА


НА ОСНОВЕ полногеномного SNP-СКРИНИНГА

Всероссийский научно-исследовательский институт животноводства имени академика Л.К. Эрнста


1

Россия, 142132, Московская обл., Подольский р-н, пос. Дубровицы, 60


2
Всероссийский научно-исследовательский институт овцеводства и козоводства
Россия, 355017, г. Ставрополь, пер. Зоотехнический, 15
3
Институт животноводства и генетики ветеринарно-медицинского университета
Австрия, г. Вена, Ветеринарплац, A-1210
4
Лейбницкий институт биологии сельскохозяйственных животных, Институт геномной биологии
Германия, 18196, г. Думмерсторф, Wilhelm-Stahl-Allee 2
e-mail: horarka@yandex.ru

Республика Дагестан является крупнейшим овцеводческим центром России. Здесь разводят


более 5 млн. овец, что обусловлено целым комплексом благоприятных природно-климатических
и культурных особенностей данного региона. Методами как народной селекции в XIV–XVI ве-
ках, так и позднее путем улучшения местных беспородных овец заводскими породами были
выведены уникальные породы, идеально приспособленные к разнообразным условиям оби-
тания – от степей Прикаспийской низменности до субальпийских и альпийских пастбищ. Из-
учение генетического разнообразия является важным этапом сохранения ценного генофонда
пород. Однако генетические исследования уникальных пород Дагестана до настоящего вре-
мени не проводились. В связи с этим было осуществлено полногеномное изучение андийской
(AND, n = 16), дагестанской горной (DAG, n = 19), лезгинской (LEZ, n = 15), тушинской (TSH,
n = 12) пород и овец карачаевской породы (KAR, n = 17) Карачаево-Черкеской Республики,
разводимых в прилегающей к Дагестану территории Кавказских гор, с использованием Ovine
SNP50k BeadChip. Контроль качества генотипирования и вычисление основных статистиче-
ских показателей проводились в программе Plink 1.07. Количество полиморфных SNP было
максимальным в DAG (43 810) и минимальным в AND (41 413). Частота минорного аллеля
варьировала от 0,289 в AND до 0,301 – в DAG. Уровень наблюдаемой гетерозиготности со-
ставил 0,393, 0,394, 0,397, 0,406 и 0,401 для AND, DAG, KAR, LEZ и TSH, соответственно.
Все изучаемые породы характеризовались незначительным избытком гетерозигот – от 0,4%
в DAG до 2,6% – в LEZ, при этом значения FIS составили -0,01 и -0,05 для данных пород, со-
ответственно. MDS-анализ показал максимальную удаленность DAG от остальных пород, что
также подтверждалось значениями FST = 0,036 и 0,068 между DAG и TSH, DAG и AND, со-
ответственно. Кроме того, следует отметить высокую консолидацию животных дагестанской
горной породы, что, вероятно, объясняется ее заводским происхождением. В свою очередь,
порода AND также была расположена на значительном генетическом расстоянии от TSH, KAR
и LEZ (FST = 0,033; 0,037; 0,041, соответственно). Наименьшие значения FST были отмечены
между LEZ и TSH, KAR и TSH, KAR и LEZ: 0,014, 0,016 и 0,023, соответственно. Данная ра-
бота представляет собой часть масштабного проекта по изучению биоразнообразия пород овец
России с использованием метода полногеномного генотипирования SNP.
Исследования выполнены при финансовой поддержке Российского научного фонда, про-
ект № 14-36-00039.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 3. Генетика, селекция и биотехнология 105

Т.В. Долматович1, А.А. Булойчик1, С.И. Гриб2

Молекулярный анализ сортов мягкой яровой пшеницы на наличие


генов устойчивости к бурой ржавчине

Институт генетики и цитологии НАН Беларуси


1

Республика Беларусь, 220072, г. Минск, ул. Академическая, 27


2
Научно-практический центр НАН Беларуси по земледелию,
Республика Беларусь, 220072, г. Жодино, ул. Тимирязева, 1
e-mail: T.Dolmatovich@igc.by

Бурая ржавчина, вызываемая грибом Puccinia triticina Erikss. – одна из наиболее распро-
страненных и вредоносных болезней пшеницы. Ежегодные потери урожая от этого заболева-
ния составляют 5–15%, а в годы эпифитотий – до 70%. Создание сортов, сочетающих высокий
потенциал урожайности с генетической защитой его от болезней, является одним из ключевых
направлений современной селекции пшеницы.
В каталоге генных символов McIntosh с соавт. по состоянию на 2016 год зарегистрирова-
но около 80 генов устойчивости к бурой ржавчине, из которых 66 присвоен соответствующий
Lr-символ.
Проведен анализ на наличие генов устойчивости Lr1, Lr9, Lr10 и локусов сцепленных
генов: Lr19/Sr25, Lr24/Sr24, Lr26/Sr31/Yr9/Pm8, Lr34/Yr18/Pm38, Lr35/Sr39 и Lr37/Sr38/Yr17
среди 36 сортов и линий мягкой яровой пшеницы различного географического происхожде-
ния и 23 сортов мягкой яровой пшеницы, внесенных в Государственный реестр Республики
Беларусь по состоянию на 2016 г.
В результате проведенного маркерного анализа 59 сортов и линий яровой пшеницы вы-
явлены фрагменты амплификации, указывающие на присутствие генов устойчивости к бурой
ржавчине: Lr1, Lr10, Lr19, Lr24, Lr26, Lr34 и Lr37.
Ген устойчивости Lr1 идентифицирован в сортах пшеницы: Ульяновская 101 и Каменка
(Россия), Sorbas, Munk, Fasan, Marin (Германия), KWS Torridon, линии СЕ  22 (Великобрита-
ния), Koksa, Verbena, Nawra (Польша), Venera (Сербия), Ласка, Весточка (Беларусь), Septima
(Чехия), Elissavet (Греция), Vittorio (Италия), Ruble (США). Ген устойчивости Lr10 выявлен
у сортов: Агата, Ульяновская 101, Ульяновская 106, Воронежская 18, Тулайковская надежда,
Эстер (Россия), линии ShTRU 1122, 30.2 (Германия), KWS Torridon (Великобритания), Пода-
рунок, Улюблена (Украина), Venera (Сербия), Elissavet (Греция). Ген Lr19 идентифицирован
в сортах российской селекции Ульяновская 106 и Тулайковская надежда. Ген Lr24 – в сортах
KWS Akvilon, Kvintus (Германия) и линии KWS В-274 (Великобритания). Наличие транслока-
ции 1BL.1RS с генами устойчивости Lr26/Sr31/Yr9/Pm8 выявлено у сорта российской селекции
Тулайковская надежда, а транслокации 1AL.1RS с генами устойчивости Lr24/Sr24/Pm17/Gb2
у сорта Етюд (Украина). У сорта Sorbas (Германия) идентифицирован комплекс сцепленных
генов устойчивости Lr34/Yr18/Pm38, а у сорта Septima (Чехия) – Lr37/Sr38/Yr17.
Носителями нескольких генов устойчивости к бурой ржавчине являются сорта: Ульянов-
ская 101 (Lr10, Lr19), KWS Torridon, Elissavet и Venera (Lr1, Lr10), Sorbas (Lr1, Lr34), Septima
(Lr1, Lr37), Тулайковская надежда (Lr10, Lr19, Lr26).
Выделенные сорта служат источниками генов устойчивости к бурой ржавчине и исполь-
зуются в селекционном процессе яровой пшеницы в Республике Беларусь.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
106 Секция 3. Генетика, селекция и биотехнология

Н.И. Дробот, Е.А. Сычева, Е.Б. Бондаревич, Л.А. Соловей, Н.И. Дубовец

АНАЛИЗ АЛЛЕЛЬНОГО СОСТОЯНИЯ ГЕНОВ ХОЗЯЙСТВЕННО-ЦЕННЫХ


ПРИЗНАКОВ У РЕКОМБИНАНТНЫХ ЛИНИЙ ТРИТИКАЛЕ

Институт генетики и цитологии НАН Беларуси,


Республика Беларусь, 220072, г. Минск, ул. Академическая, 27
e-mail: N.I.Dubovets@igc.by

В настоящее время тритикале (Triticosecale, Wittmack) является важнейшей зерновой куль-


турой, сочетающей высокие показатели урожайности и кормовой ценности зерна с устойчи-
востью к неблагоприятным почвенно-климатическим факторам. Однако склонность культуры
к предуборочному прорастанию зерна и полеганию растений обуславливает необходимость
дальнейшей селекционной работы, в том числе с использованием хромосомно-инженерных
технологий и ДНК-маркирования.
Целью настоящей работы являлось изучение аллельного состава генов, контролирующих
короткостебельность (Rht-B1, Rht8) и устойчивость к предуборочному прорастанию (Vp1B),
у вторичных рекомбинантных линий тритикале, а также их родительских форм для оценки
селекционного потенциала.
Материалом для исследования послужили 33 вторичные рекомбинантные линии тритикале
(ВРЛ), полученные путем гибридизации яровых сортов тритикале – Лана, Карго и Мешко –
с 8 первичными рекомбинантными линиями тритикале (ПРЛ), содержащими различные типы
D(А)- и D(В)-замещений хромосом, и их родительские формы.
При определении аллельного состава гена Rht-B1 было установлено, что сорта Лана, Кар-
го и Мешко, а также практически все рекомбинантные линии (23 ВРЛ) содержат мутантный
аллель Rht-B1b в гомозиготном состоянии, обеспечивающий достоверное снижение высоты
растений. В то же время в выборке образцов ПРЛ было показано присутствие дикого алле-
ля Rht-B1а. Таким образом, проведенная гибридизация первичных рекомбинантных линий
с сортами-носителями гена короткостебельности Rht-B1 обеспечила перенос целевого алле-
ля в исходный материал. Анализ аллельного статуса гена Rht8 у первичных рекомбинантных
форм показал наличие у всех образцов выборки дикого аллеля Rht8а, поэтому анализ аллель-
ного состава данного гена у ВРЛ не проводился.
Для подавляющего большинства образцов (21 ВРЛ и 7 ПРЛ) и сорта Мешко было выяв-
лено наличие в гомозиготном состоянии аллеля Vp-1Bc гена Viviparous, ассоциированного
с устойчивостью к предуборочному прорастанию зерна. В то же время 7 ВРЛ, а также сорт
Kargo были неоднородны по аллельному составу – содержали аллели Vp-1Ba и Vp-1Bc в го-
мозиготном состоянии, а три образца (ВРЛ-24, ВРЛ-27и ВРЛ-28) обладали гетерозиготным
генотипом Vp-1Ba/ Vp-1Bc.
По результатам проведенного анализа выделены 10 ВРЛ, сочетающих в генотипах мутант-
ные аллели генов Rht-B1 и Vp-1B. Линии будут использованы для дальнейшего насыщения их
генотипов селекционно-ценными аллелями генов, локализованных в хромосомах D-генома
пшеницы, с целью обогащения генофонда тритикале.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 3. Генетика, селекция и биотехнология 107

М. Дука, С. Клапко, О. Табэрэ, Л. Цапу

РАСПРОСТРАНЕНИЕ ЗАРАЗИХИ (OROBANCHE CUMANA WALLR.) НА ПОЛЯХ


ПОДСОЛНЕЧНИКА В РЕСПУБЛИКЕ МОЛДОВА

Университет Академии Наук Молдовы


Республика Молдова, MD-2028, г. Кишинев, ул. Академическая, 3/2
e-mail: stela.clapco@gmail.com

Заразиха (Orobanche cumana Wallr.) является одним из основных факторов, лимитирующих


рост и продуктивность подсолнечника. Так, при заражении заразихой урожайность культуры
снижается в 2–3 раза, резко ухудшается качество семян и содержание масла. Интенсификация
возделывания подсолнечника, несоблюдение севооборота, в частности, возвращение культу-
ры на прежнее поле через 1–3 года, а не через 6–8 лет согласно рекомендациям, увеличивают
риск поражения и формирования высоковирулентных биотипов.
Таким образом, исследования по выявлению заразихи на полях Молдовы и идентификации
рас паразита являются актуальными и важными для своевременных мер борьбы с ней и селек-
ции устойчивых гибридов подсолнечника.
В течение 2014 года на предмет инфицирования заразихой были обследованы поля, за-
нятые подсолнечником в 90 хозяйствах, в 27 районах Молдовы. Анализ результатов показал,
что заразиха встречается в основном в центральной и южной части страны и, в меньшей ме-
ре, в северных районах. Также было выявлено, что биотипы паразита, встречающиеся в юж-
ной части, более агрессивны, частота поражения в большинстве случаев составляла 60–100%.
В хозяйствах проводился социологический опрос на предмет соблюдения севооборота
(культура предшественник, интервал культивирования подсолнечника на тех же полях) и типа
культивируемого гибрида подсолнечника. Исходя из результатов опроса, на полях Молдовы
культивируются в основном импортируемые гибриды, созданные компаниями Pioneer, Syn-
genta, SAATEN UNION, Донская опытная станция имени Л.А. Жданова ВНИИМК, Институтом
полеводства и овощеводства Нови Сад, Сербия. Данные гибриды отличаются разной степенью
устойчивости к заразихе. Самой высокой устойчивостью к паразиту обладает гидбрид ARENA
PR компании Syngenta.
Также было выявлено, что севооборот соблюдается приблизительно в 30% изученных хо-
зяйств, что приводит к возрастанию риска инфицирования. Таким образом, встречаются слу-
чаи культивирования подсолнечника два года подряд на тех же полях. Число инфицированных
растений на таких полях составляет в среднем 35–40%, тогда как на участках с правильной
поочередностью культур число инфицированных растений варьирует между 3 и 15%.
Эффективными мерами снижения развития и распространения заразихи являются соблю-
дение севооборота, получение и внедрение гибридов подсолнечника, устойчивых к заразихе,
а также ряд агротехнических мероприятий, направленных на создание благоприятных усло-
вий культивирования. 

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
108 Секция 3. Генетика, селекция и биотехнология

Р.С. Ержебаева, А.М. Абекова, А. Васим

ПОЛУЧЕНИЕ ДИГАПЛОИДНЫХ ЛИНИЙ ПШЕНИЦЫ И ТРИТИКАЛЕ МЕТОДОМ


КУЛЬТУРЫ ПЫЛЬНИКОВ

Казахский научно-исследовательский институт земледелия и растениеводства


Республика Казахстан, Карасайский р-н, п. Алмалыбак, ул.Ерлепесова, 1
e-mail: raushan_2008@mail.ru

Дигаплоидия – самый быстрый путь к гомозиготности у растений. Дигаплоидные линии


необходимы как для научных исследований в области генетики, так и в селекционном про-
цессе для отбора в гибридной селекции, при которой можно зафиксировать признаки в жела-
тельных комбинациях у линий. Селекционеры могут оценить дигаплоидные линии с большей
скоростью, точностью и уверенностью, особенно относительно количественно унаследован-
ных признаков, таких как урожай и качество.
В настоящее время в лаборатории биотехнологии КазНИИЗиР отработаны протоколы
по двум современным методам андрогенной технологии – культуры пыльников и культуры
изолированных микроспор тритикале и пшеницы. За период 2013–2016 гг. изучена индукция
эмбриогенеза 122 образцов, из них 50 образцов пшеницы, 64 образца перспективных линий,
полученных путем отдаленной гибридизации и 8 образцов тритикале.
Изучение индукции эмбриогенеза показало, что наиболее отзывчивыми на технологию куль-
туры пыльников и изолированных микроспор являются образцы тритикале (110 эмбриоидных
структур/чашка Петри). У генотипов тритикале (озимого и ярового) зафиксирована равномер-
ная отзывчивость. Образование эмбриоидных структур (ЭС) пшеницы в среднем составляет
94 ЭС/чашка Петри, при этом отмечен высокий выход ЭС у отдельных сортов (300–400 ЭС
с одной чашки Петри), и более низкий у гибридных поколений F1 и F2, где число ЭС на одну
чашку Петри составляет в среднем 40–50 шт.
У линий, полученных методом отдаленной гибридизации, индукция составляет 68 ЭС/
чашка Петри. Отмечена зависимость индукции эмбриогенеза от генотипов.
Среди изученных образцов пшеницы и тритикале выделены наиболее отзывчивые гено-
типы, у которых зафиксировано образование эмбриоподобных структур 400 и более с одной
чашки Петри (100–150 пыльников): пшеница – Самгау, Кайыр, тритикале – Т-968, Зернокор-
мовое 5, ЯТХ-13, 6625 × T. timopheevii. Данные генотипы могут быть использованы как мо-
дельные для исследований андрогенеза.
Исследования по регенерации растений показало, что регенерация происходит в среднем
у 52,3% высаженных эмбриоидных структур и каллусов, из них зафиксирован высокий процент
(41,8%) регенерации альбиносных растений (бесхлорофильных проростков). Выход зеленых
растений составил 10,5%. В настоящее время ведутся исследовательские работы по увеличе-
нию выхода зеленых растений. В общей сложности получено 610 зеленых растений, из них
320 пшеницы, 130 пшеницы-синтетиков и 160 тритикале.
Полученные зеленые растения (610) были подвергнуты определению плоидности мето-
дом давленых препаратов корешков. Определение плоидности у полученных 610 растений-
регенерантов показало, что спонтанное удвоение зафиксировано у 158 растений, что составляет
26%. 452 зеленых растений оказались гаплоидными. Хорошо развитые гаплоидные растения
были подвергнуты колхицинированию.
По итогам работ по андрогенной технологии за период 2013–2016 годы получено 244 ди-
гаплоидных линий пшеницы и тритикале.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 3. Генетика, селекция и биотехнология 109

О.И. Зайцева1, А.Т. Бабкенов2, Е.К. Каиржанов2, С.А. Бабкенова2, В.А. Лемеш1

АЛЛЕЛЬНОЕ РАЗНООБРАЗИЕ ГЕНОВ ВЫСОКОМОЛЕКУЛЯРНЫХ ГЛЮТЕНИНОВ


У МЯГКОЙ ПШЕНИЦЫ

Институт генетики и цитологии НАН Беларуси


1

Республика Беларусь, 220072, г. Минск, ул. Академическая, 27


e-mail: O.Zaitseva@igc.by
2
ТОО «Научно-производственный центр зернового хозяйства им. А.И. Бараева»
Республика Казахстан, 021601 Акмолинская область, Шортандинский р-н,
п. Шортанды-1, ул. Бараева 15

Мягкая пшеница (Triticum aestivum L.) – одна из наиболее важных продовольственных


культур со средним ежегодным глобальным производством около 680 млн. тонн. Качество хле-
бопекарной продукции из пшеницы главным образом обусловлено запасными белками эндо-
сперма, так как они отвечают за эластичность и растяжимость теста. Клейковинный полимер
(глютен) образован в основном высокомолекулярными и низкомолекулярными субъединица-
ми глютенина, а также мономерными белками глиадинами. Показано, что высокомолекуляр-
ные субъединицы глютенина на 47–60% определяют качество клейковины пшеницы. У мяг-
кой пшеницы субъединицы кодируются локусами Glu-A1, Glu-B1 и Glu-D1, расположенными
на длинных плечах хромосом первой гомеологичной группы. Каждый локус включает два
тесно сцепленных гена, кодирующих субъединицы различной молекулярной массы, которые
относятся к х- и у-типам. Для генов, кодирующих высокомолекулярные субъединицы глюте-
нинов, установлен высокий уровень аллельного полиморфизма, при этом аллели оказывают
различное влияние на хлебопекарные качества муки.
В связи с этим, целью исследования являлось установление аллельного состава генов вы-
сокомолекулярных субъединиц глютенинов у сортов и константных форм мягкой пшеницы
различного происхождения.
Материалом для исследований служили 102 сорта и линии мягкой яровой пшеницы, вклю-
чая генотипы из Казахстана (32), России (24), Канады (12), США (11), Франции (2), Италии
(1) и СИММИТ, Мексика (20). Идентификацию генов высокомолекулярных субъединиц глю-
тенинов проводили при помощи 14 пар праймеров к наиболее распространенным аллелям
локусов Glu-A1, Glu-B1, Glu-D1.
По локусу Glu-A1 выявлены три аллеля – а, b и с. По локусу Glu-B1 выявлены аллели al,
ak, b, c, d, e, i и u. Для локуса Glu-D1 показаны аллели d и a. Для 22 сортов установлен вну-
трилинейный полиморфизм по локусам Glu-1, наиболее часто (у 17 сортов) встречалась гете-
розиготность по генам Glu-D1.
При анализе сочетаний аллелей Glu-A1, Glu-B1 и Glu-D1 выявлено 18 гаплотипов у моно-
морфных сортов и линий пшеницы и 11 – у полиморфных. Оценка качества субъединиц глю-
тенинов, кодируемых выявленными аллелями, колебалась в пределах 6–11 баллов. Наиболее
высокий балл (11) определен для 4 сортов, балл 10 – для 16 сортов, 36 сортов содержат ал-
лели, соответствующие 9 баллам. Установлено, что для сортов казахстанского и российского
происхождения характерен невысокий аллельный полиморфизм генов выскомолекулярных
субъединиц глютенинов с максимальной оценкой в 9 баллов. По данным литературы, сходная
ситуация наблюдается для сортов белорусского происхождения.
Таким образом, оценка аллельного состава глютенин-кодирующих локусов в коллекции
линий и сортов мягкой пшеницы позволила выделить генотипы, характеризующиеся благо-
приятным сочетанием аллелей локусов Glu-1.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
110 Секция 3. Генетика, селекция и биотехнология

С.Т. Захидов1, Н.М. Муджири1,2, В.М. Рудой3, О.В. Дементьева3, И.А. Зеленина1, Т.Л. Маршак2

ПРЯМЫЕ И КОМБИНИРОВАННЫЕ ДЕЙСТВИЯ НАНОЧАСТИЦ ЗОЛОТА


НА ГЕНЕТИЧЕСКИЕ СТРУКТУРЫ МУЖСКИХ ПОЛОВЫХ КЛЕТОК МЫШЕЙ

1
Московский государственный университет им. М.В. Ломоносова
Россия, 119991, г. Москва, Ленинские горы, 1, стр. 12
2
Институт биологии развития им. Н.К. Кольцова РАН
Россия, 117334, г. Москва, ул. Вавилова, 26
3
Институт физической химии и электрохимии им. А.Н. Фрумкина РАН
Россия, 119071, г. Москва, Ленинский пр., 31
e-mail: 4361.idb@bk.ru

Наночастицы золота (НЧЗ) обладают уникальными физико-химическими свойствами и вы-


сокой проникающей способностью, что делает их весьма привлекательными для решения ряда
медико-биологических задач. Например, предполагается, что НЧЗ могут быть использованы
в нанотерапии злокачественных опухолей, а также как эффективное средство для адресной
доставки лекарственных препаратов к местам повреждения. Однако вопрос о том, влияют ли
НЧЗ на структуру аппарата наследственности, пока еще остается открытым.
Задача настоящей работы состояла в изучении генетической активности ультрамалых
наночастиц золота на модели развивающихся сперматогенных клеток мышей-гибридов
CBA×C57BL/6.
Подопытным половозрелым мышам однократно или многократно (ежедневно в течение
4-х сут) внутрибрюшинно вводили по 0,2 мл НЧЗ размером 2–3 нм в концентрации 1 × 1015 ч/мл.
Через 1 ч после последних инъекций НЧЗ части животных вводили мутаген дипин в дозе 30 мг/
кг. Позитивным контролем служили самцы, подвергшиеся однократному воздействию дипина
в той же дозе, а отрицательным – мыши, которым в течение 4-х сут. вводили по 0,2 мл физио-
логического раствора. Регистрация аберрантных сперматогониев (СГ) и округлых сперматид
(ОС) проводилась с помощью метода учета микроядер на 14 сут. после начала эксперимента.
Подсчеты показали, что в положительном и отрицательном контролях частота встречаемо-
сти СГ с микроядрами составила 2,1 ± 0,5‰ и 1,2 ± 0,4‰ соответственно. После однократного
введения НЧЗ выход генетически аномальных СГ составил 5,4 ± 2,5‰, при многократном –
1,2 ± 0,6‰, а при совместном с дипином – 2,9 ± 1,1‰ и 4,5 ± 1,2‰ соответственно.
Что касается популяции ОС, то в положительном контроле частота встречаемости этих кле-
ток с микроядрами составила 3,9 ± 1,1‰, а в отрицательном – 1,0 ± 0,3‰. После однократного
или многократного введения мышам НЧЗ число ОС со следами хромосомных поломок достигло
6,3 ± 2,4‰ и 1,2 ± 0,4‰, а в сочетании с дипином – 1,9 ± 0,8‰ и 7,0 ± 1,2‰ соответственно.
Полученные нами результаты указывают на способность НЧЗ, в зависимости от условий
эксперимента, действовать как мутаген, антимутаген и комутаген. Особенно ярко и значимо
эти эффекты проявились при цитогенетическом анализе популяции ОС, клеток, которые в мо-
мент воздействий находились преимущественно на стадии премейотического синтеза ДНК –
одной из самых генетически чувствительных стадий сперматогенеза.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 3. Генетика, селекция и биотехнология 111

С.И. Ивановская, В.Е. Падутов, Д.И. Каган

УРОВЕНЬ ГЕНЕТИЧЕСКОЙ ИЗМЕНЧИВОСТИ СОСНЫ ОБЫКНОВЕННОЙ


В ДРЕВОСТОЯХ РАЗЛИЧНОГО КЛАССА ВОЗРАСТА

Институт леса НАН Беларуси


Республика Беларусь, 246001, г. Гомель, ул. Пролетарская, 71
e-mail: isozyme@mail.ru

Уровень генетической изменчивости в популяциях зависит от различных факторов, одним


из которых может являться возраст особей, однако до настоящего времени наличие такого
влияния остается предметом дискуссии. Для сравнения генетического разнообразия сосны
обыкновенной (Pinus sylvestris) в древостоях различного класса возраста нами были иссле-
дованы 10 сосновых насаждений лесов хозяйственного использования (от 3-го до 6-го класса
возраста) и 9 плюсовых насаждений (от 4-го до 8-го класса возраста), в которых лесохозяй-
ственная деятельность ограничена. Все исследованные древостои относились к одному типу
леса – соснякам мшистым, что позволило исключить влияние условий местопроизрастания
на уровень генетической изменчивости.
В качестве экспериментального материала использовались диплоидные ткани почек. Ис-
следования проводились на основе метода изоферментного анализа, с использованием 20 алло-
зимных генов. Для определения уровня генетической изменчивости использовали показатель
наблюдаемой гетерозиготности (Ho).
При проведении популяционно-генетического анализа лесов хозяйственного использования
нами было установлено отсутствие положительной корреляции между возрастом древостоя
и величиной показателя наблюдаемой гетерозиготности. Наибольшие значения Ho отмечены
в сосняках 55, 90 и 110 лет, наименьшие – в сосняках 90 и 100 лет. При вычислении средней
наблюдаемой гетерозиготности для каждого класса возраста в отдельности в лесах хозяй-
ственного использования наблюдается снижение данного показателя от 3 к 5 классу возрас-
та, в 6 классе возраста отмечено его увеличение (III – 0,253, IV – 0,248, V – 0,234, VI – 0,265).
Проведенный корреляционный анализ показал, что между величиной наблюдаемой гетерози-
готности и возрастом древостоя в сосняках лесов хозяйственного использования взаимосвязь
недостоверна, коэффициент корреляции для отдельных насаждений составил -0,269, для клас-
сов возраста – 0,221.
В то же время, анализ показателей наблюдаемой гетерозиготности в плюсовых насажде-
ниях сосны обыкновенной выявил иную ситуацию. В большинстве случаев, с увеличением
возраста плюсовых насаждений происходит рост значений средней гетерозиготности. Исклю-
чение составило плюсовое насаждение 21/88 (Городокский лесхоз), возраст которого 110 лет.
При группировке исследованных плюсовых насаждений по классам возраста выявленная
тенденция роста показателя Ho с увеличением возраста сохраняется и становится ярко вы-
раженной (IV – 0,240, V – 0,263, VI – 0,257, VII – 0,279, VIII – 0,289). Рассчитанные коэффи-
циенты корреляции свидетельствуют о наличии достоверной прямой связи между величиной
наблюдаемой гетерозиготности и возрастом древостоя, как в случае отдельных насаждений
(r = 0,849), так и по классам возраста (r = 0,942).
Таким образом, на основании полученных результатов можно сделать заключение, что
отсутствие положительной корреляции между показателями наблюдаемой гетерозиготности
и возрастом древостоев сосны обыкновенной в лесах хозяйственного использования связано
с проведением различных лесохозяйственных мероприятий, в результате которых нарушается
естественный ход лесообразовательного процесса.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
112 Секция 3. Генетика, селекция и биотехнология

Д.И. Каган1, В.Е. Падутов1, В.М. Арнольбик2, С.И. Ивановская1, Т.С. Маркевич1

ГЕНЕТИЧЕСКИЙ АНАЛИЗ ЛОКУСА MT15-D02 PICEA ABIES (L.) KARST.


НА ТЕРРИТОРИИ НАЦИОНАЛЬНОГО ПАРКА «БЕЛОВЕЖСКАЯ ПУЩА»

Институт леса НАН Беларуси»


1

Республика Беларусь, 246001, г. Гомель, ул. Пролетарская, 71


e-mail: quercus-belarus@mail.ru
2
ГПУ «Национальный парк «Беловежская пуща»
Республика Беларусь, 225063, Брестская область, Каменецкий район, аг. Каменюки
e-mail: npbpby@mail.ru

Еловая формация НП «Беловежская пуща» представляет собой сложную систему, харак-


теризующуюся высоким типологическим разнообразием и сложной возрастной структурой.
Ее уникальность обусловлена миграционными особенностями становления современного
ареала ели европейской (Picea abies (L.) Karst.) и незначительным воздействием в пуще антро-
погенных факторов на протяжении сотен лет. Генетический анализ древостоев P. abies, с ис-
пользованием ДНК-методов, к западу от пущи выявил их значительную разнородность по про-
исхождению вследствие распространения вида из разных рефугиумов ледникового периода.
Следует отметить, что до настоящего времени изучение популяционного генофонда P. abies
в НП «Беловежская пуща» с использованием ДНК-маркеров практически не проводилось.
На территории девяти лесничеств (Белянское, Бровское, Королево-Мостовское, Никорское,
Пашуковское, Свислочское, Хвойникское, Язвинское, Ясеньское) были выделены модельные
деревья P. abies (121 шт.), отличающиеся более развитой кроной и высокой энергией роста,
по сравнению с рядом произрастающими, и проведен сбор экспериментального материала
для изучения генетико-географической структурированности еловых насаждений по локусу
митохондриальной ДНК mt15-D02.
Для всей совокупности проанализированных деревьев P. abies были обнаружены два раз-
мерных варианта амплифицируемых ПЦР-продуктов по локусу mt15-D02 (1249 и 753 пар ну-
клеотидов), являющиеся маркерами различных исторических происхождений исследуемого
вида – соответственно карпатского и бореального. Выявленный полиморфизм митохондриаль-
ной ДНК P. abies свидетельствует о существовании на территории НП «Беловежская пуща»
зоны перекрытия миграционных потоков данного вида.
В южной части пущи (Белянское лесничество) все проанализированные деревья пред-
ставлены карпатским митотипом. На территории остальных лесничеств наряду с карпатским
был обнаружен бореальный митотип. При этом установлена клинальная изменчивость частот
встречаемости выявленных митотипов. Так, представленность деревьев карпатского проис-
хождения в составе еловых насаждений пущи в направлении юг → север снижается (от 100%
в Белянском лесничестве до 56% в Свислочском), бореального – увеличивается (с 0 до 44%).
В южной части НП «Беловежская пуща» лишь в Пашуковском лесничестве выявлен более
высокий уровень встречаемости бореального митотипа (27%). Наибольшей удельной долей
встречаемости бореального митотипа характеризуются еловые насаждения Бровского и Свис-
лочского лесничеств, расположенных к северу на территории Гродненской области. В целом
в составе еловой формации пущи 76,9% модельных деревьев были представлены карпатским
происхождением, 23,1% – бореальным.
На основании полученных результатов разработаны геногеографические карты еловых на-
саждений НП «Беловежская пуща» по локусу mt15-D02, которые в дальнейшем будут исполь-
зованы для разработки мероприятий по территориально дифференцированному сохранению
и использованию генетических ресурсов P. abies.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 3. Генетика, селекция и биотехнология 113

В.Н. Кипень1, А.О. Рябцева1, С.А. Котова1, Н.В. Журина2, А.И. Ганджа2, И.С. Цыбовский1

КЛАССИФИКАЦИЯ КОММЕРЧЕСКИХ ПОРОД ДОМАШНИХ СВИНЕЙ C УЧЕТОМ


ПОЛИМОРФНЫХ ВАРИАНТОВ В ГЕНЕ МЕЛАНОКОРТИНА MC1R

1
ГУ «НПЦ Государственного комитета судебных экспертиз Республики Беларусь»
Республика Беларусь, 220073, г. Минск, ул. Кальварийская, 43
e-mail: slavakipen@rambler.ru
2
РУП «Научно-практический центр НАН Беларуси по животноводству»
Республика Беларусь, 222160, г. Жодино, ул. Фрунзе, 11

Дифференциация биологических образцов европейского дикого кабана от домашних сви-


ней актуальна в криминалистике (незаконная охота) и в производстве мясопродуктов (про-
верка подлинности). Для этой цели предложена методика на основе генотипирования двух
полиморфных сайтов в гене MC1R (NCBI-Gene ID494018) – c.367G>A и c.729G>A (Fajardo V.
et al. 2007). Fontanesi L. et al. в 2014 г. предложили включить в эту схему еще один полимор-
физм – c.727G>A, для увеличения точности всей схемы. Для домашних свиней эксперимен-
тально показано наличие двух типов полиморфизма «А» и «В». Нами проведено определение
типовой принадлежности (по Fajardo V. et al. 2007) основных разводимых в Республике Бела-
русь пород домашних свиней в сравнении с мировой популяцией свиней (на основе данных
генетических банков секвенированных последовательностей).
Для сравнительного анализа были использованы результаты секвенирования гена MC1R
(как по Сенгеру – NCBI-Nucleotide, так и проектов NGS – NCBI-SRA) для 100 животных сле-
дующих пород: крупная белая (21 жив.), дюрок (28), ландрас (21), пьетрен (7), йоркшир (11),
мейшань (12). Типу «А» должен соответствовать следующий генетический профиль по гену
MC1R: c.367-[АА]/c.727-[GG]/c.729-[GG]; типу «В» – с.367-[GG]/c.727-[AA]/c.729-[AA], причем
возможны любые сочетания для имеющихся полиморфных сайтов в интервале 726–729 кДНК,
приводящие к утрате сайта рестрикции «CGCG» для эндонуклеазы рестрикции BstUI. Биоин-
формационный анализ показал наличие следующих закономерностей: 1) все животные пород
крупная белая, ландрас, пьетрен и йоркшир относятся к типу «А»; 2) все 28 животных породы
дюрок – к типу «В»; 3) 3 из 12 животных породы мейшань – к типу «А», 9 из 12 – к типу «В».
Экспериментальные исследования по определению принадлежности к типу «А» и «В» были
проведены среди следующих пород: белорусская крупная белая (24 жив.), белорусская мясная
(21), дюрок (52), ландрас (16), йоркшир (23) и пьетрен (2), предоставленных РУП «НПЦ НАН
Беларуси по животноводству» (г. Жодино). Получены следующие результаты: 1) все исследо-
ванные животные пород белорусская крупная белая, белорусская мясная, ландрас, пьетрен и
йоркшир относятся к типу «A»; 2) 11 из 52 животных породы дюрок – к типу «А», остальные
(41/52) – к типу «В».
Таким образом, на территории Республики Беларусь в промышленном разведении преоб-
ладают породы домашних свиней типа «А», что согласуется с результатами других исследо-
ваний. Для породы дюрок показано наличие обоих вариантов («А» и «В»), что может являть-
ся указанием на необходимость более тщательной генетической оценки племенного стада
на предмет выявления эффекта основателя в приобретенной для селекционных целей партии
животных этой породы.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
114 Секция 3. Генетика, селекция и биотехнология

М.С. Кобозева, Р.Б. Ахмедов, В.В. Заякин, И.Я. Нам

ИНФОРМАТИВНОСТЬ МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКОГО АНАЛИЗА БИОТИПОВ


ВОЗБУДИТЕЛЯ АНТРАКНОЗА ЛЮПИНА

Брянский государственный университет им. акад. И.Г. Петровского


Российская Федерация, 241036, г. Брянск, ул. Бежицкая, 14
e-mail: bobunovamarina@mail.ru

Антракноз – заболевание растений, вызываемое несовершенными грибами разных видов


из различных родов. Масштабное поражение антракнозом люпина привело к резкому сниже-
нию посевных площадей этой важнейшей зернобобовой культуры. Однако до сих пор суще-
ствуют разногласия во мнениях относительно таксономической принадлежности возбудителей
антракноза люпина.
Целью нашей работы являлась идентификация возбудителя и подбор ISSR-праймеров
для молекулярной диагностики возбудителя антракноза, а также для характеристики биоти-
пов фитопатогена.
Для работы использовали полевой растительный материал культурных видов люпина
(желтого, белого и узколистного) с полей ВНИИ люпина с видимыми признаками развития
антракноза (2015 г.) и образец возбудителя антракноза узколистного люпина, любезно пре-
доставленный профессором Анохиной В.Ф. (Белорусский государственный университет).
Для молекулярно-генетического анализа использовали по две моноспоровые культуры из трех
видов люпина и белорусский образец.
ПЦР-анализ с праймерами на участок ITS-области кластера генов рибосомальной РНК по-
казал, что все изоляты могут быть отнесены к кластеру (кладе) видов Colletotrichum acutatum
и виду Colletotrichum lupine, при этом они не дают реакции с праймерами на Colletotrichum
gloeosporoides.
Подобранные ISSR-праймеры позволили установить, что все изоляты из желтого и бело-
го люпина практически идентичны, и к ним близок один из изолятов люпина узколистного.
Коэффициенты сходства, рассчитанные по формуле Сёренсена-Чекановского, составляли
от 0,92 до 1. Другой изолят из узколистного люпина резко отличается – коэффициенты сход-
ства с остальными брянскими изолятами – 0,14–0,17. Белорусский изолят из узколистного
люпина значительно различается от обоих брянских изолятов, с коэффициентами 0,23 и 0,24.
Таким образом, метод молекулярно-генетического анализа имеет высокий потенциал для изу-
чения и идентификации возбудителей антракноза люпина. При этом он является более надеж-
ным и объективным по сравнению с морфофизиологическим, поскольку показатели послед-
него значительно варьируют в зависимости от условий культивирования: среды, освещения,
температуры, количества пассажей и даже сезона.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 3. Генетика, селекция и биотехнология 115

З.А. Козловская

ИСПОЛЬЗОВАНИЕ ВИДОВОГО РАЗНООБРАЗИЯ ГЕНЕТИЧЕСКИХ РЕСУРСОВ


РАСТЕНИЙ В СОЗДАНИИ СОРТОВ ПЛОДОВЫХ КУЛЬТУР

Институт плодоводства
Республика Беларусь, 223013, Минская обл., пос. Самохваловичи, ул. Ковалева, 2
e-mail: zoya-kozlovskaya@tut.by

Важное место в решении задач современного сельского хозяйства, связанных с интенсифи-


кацией плодоводства, занимает создание и широкое использование сортов и гибридов нового
поколения. Возрастающие требования к современным сортам в отношении их устойчивости
к стрессовым факторам определяют все большую адаптивную и экологическую направлен-
ность селекции. Основой успешной селекции следует считать рациональное использование
генетического разнообразия растений.
Изучение эколого-адаптивных возможностей межвидовых гибридных форм и выделение
лучших из них увеличивает генетическое разнообразие плодовых культур, прежде всего, рас-
ширяет базу для создания нового поколения сортов в будущем. Впервые в Беларуси на осно-
ве базовых коллекций яблони (1348 генотипов 24 видов), груши (769 генотипов производные
11 видов), сливы (325 генотипов 9 видов), абрикоса (134 генотипа 2 видов), вишни и черешни
(531 генотип 7 видов), ореха грецкого (72 генотипа 3 разновидностей) в 2011–2014 гг. сформи-
рованы целевые признаковые коллекции источников устойчивости к экономически значимым
болезням: парше и мучнистой росе яблони, источников устойчивости к септориозу и парше
груши, клястероспориозу и монилиозу рода Prunus L., источников устойчивости к коккоми-
козу и монилиозу вишни и черешни, марсониозу ореха грецкого.
С применением молекулярных маркеров выявлены крупноплодные доноры – носители
2–3 олигогенов устойчивости к парше в одном геноме яблони, мелкоплодные доноры – носи-
тели 1–3 олигогенов устойчивости к мучнистой росе яблони. Объединение в одном генотипе
нескольких генов, определяющих устойчивость к конкретным болезням, позволяет получать
новые гибридные формы с более стойким иммунитетом. Развитие направления по использо-
ванию современных методов ДНК-технологий в селекции плодовых культур стало возмож-
ным благодаря сотрудничеству с Институтом генетики и цитологии НАН Беларуси. Переход
на международные принципы формирования различных типов коллекций конкретизирует объ-
екты селекционных программ по наиболее актуальным направлениям, тем самым сокращая
затраты на первоначальном этапе селекционного процесса в 2–3 раза.
В результате селекционной работы в РУП «Институт плодоводства», используя видовое раз-
нообразие плодовых растений, за 2000–2014 гг. созданы более 50 сортов различных плодовых
культур, несомненным достоинством которых является их высокая адаптивность к холодовым
стрессам зимнего периода и устойчивость к болезням, сочетающиеся с высоким качеством
плодов. Внедрение таких сортов в промышленное садоводство – это наиболее безопасный
метод защиты плодовых культур и эффективный способ получения продуктов с улучшенны-
ми экологическими характеристиками, что способствует снижению антропогенной нагрузки
на садовый биоценоз.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
116 Секция 3. Генетика, селекция и биотехнология

Е.В.Колбанова

Определение устойчивости смородины чёрной к почковому клещу


с использованием молекулярного маркера гена Се

РУП «Институт плодоводства»


Республика Беларусь, 223013, Минский район, пос. Самохваловичи, ул. Ковалева, 2
e-mail: kolbanova@tut.by

Вирус реверсии смородины чёрной переносится почковым клещом Cecidophyopsis ribis.


Кроме растений смородины черной (Ribes nigrum L.) вирус может поражать смородину крас-
ную (R. rubrum). Также имеются сообщения об обнаружении вируса в растениях смородины
альпийской (R. alpinum) и смородины колосистой (R. spicatum). Крыжовник (R. uva-crispa) яв-
ляется иммунным к данному вирусу. Снизить потери промышленных плантаций смородины
чёрной от реверсии возможно только путём проведения комплекса мероприятий, таких как
внедрение системы производства оздоровленного посадочного материала, обработка расте-
ний от почкового клеща при его миграции из почек в период цветения-начала формирования
ягод и создание сортов смородины, устойчивых к вектору переноса заболевания – почковому
клещу. Сейчас выявлено два гена устойчивости к почковому клещу: ген Р у потомков сибир-
ского подвида смородины чёрной и ген Се, который передан смородине от крыжовника. Рас-
тения смородины, обладающие геном Се, не поражаются реверсией. В Шотландском научно-
исследовательском институте сельскохозяйственных культур был разработан и протестирован
на ряде образцов собственной селекции SCAR-маркер, связанный с геном Се. Целью данного
исследования было протестировать SCAR-маркер гена Се устойчивости смородины чёрной
к почковому клещу на образцах из коллекции отдела ягодных культур РУП «Институт плодо-
водства» для включения выявленных устойчивых сортов в селекционный процесс.
Протестировано 48 сортообразцов, включая 6 сортов крыжовника, 3 сорта смородинно-
крыжовникового гибрида, 39 сортов смородины чёрной. Растительную ДНК выделяли из ли-
стьев с использованием коммерческого набора DNeasy Plant Mini Kit (QIAGEN). В начале
исследований на двух сортообразцах (крыжовник сорта Крыжачок (ген Се присутствует)
и смородина чёрная Добрыня (ген Се отсутствует)) была опробована различная температура
отжига (55; 55,6; 56,5; 57,8; 59,5; 60,8; 61,7; 62 °С). В качестве оптимальной была выбрана
температура 57 °С. Реакционная смесь для проведения ПЦР имела следующий состав: 1×Taq-
буфер c КСl (Thermo Scientific); 1,5 мМ MgCl2 (Thermo Scientific), 0,2 мМ смеси dNTP (Thermo
Scientific), 0,2 мкМ для каждого праймера (GMresaF 5’ TTACCGCAGATACAAGGTGAAG 3’ /
GMresaR 5’ GGACTAGGCCTTCTTATGAC 3’), 0,6 ед. Taq Polymerase (Thermo Scientific), 25 нг
ДНК-матрицы. Общий объём реакционной смеси составлял 12,5 мкл. Режим амплификации:
1 цикл: 95 ºС – 4 мин; 35 циклов: 95 ºС – 30 с, 57 ºС – 30 с, 72 ºС – 30 с; 1 цикл: 72 ºС – 7 мин.
Продукты амплификации разделяли электрофорезом в 2%-ном агарозном геле и 1,0×ТАЕ-
буфере (BioRad).
В результате амплификации 6 сортов крыжовника (Крыжачок, Куршу Дзинтарс, Машека,
Раволт, Северный капитан, Малахит), 3 – смородинно-крыжовникового гибрида (Josta, Эли-
забет Кип, Кант) и 2 сорта смородины чёрной (Кипиана, Грация) амплифицировали фрагмент
ожидаемого размера (130 п.н.), что говорит о присутствии гена Се. В то время как остальные
37 сортов смородины черной не амплифицировали данный фрагмент и показали отсутствие
гена Се. Таким образом, сорта смородины чёрной Кипиана и Грация селекции ВНИИСПК
(г. Орел), имеющие в своей родословной смородину клейкую и крыжовник отклонённый, мо-
гут являться донорами устойчивости к почковому клещу.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 3. Генетика, селекция и биотехнология 117

Е.В. Колбанова

ОПТИМИЗАЦИЯ ДИАГНОСТИКИ ВИРУСА РЕВЕРСИИ СМОРОДИНЫ ЧЁРНОЙ


(BLACKCURRANT REVERSION VIRUS, BRV)

РУП «Институт плодоводства»


Республика Беларусь, 223013, Минский район, пос. Самохваловичи, ул. Ковалева, 2
e-mail: kolbanova@tut.by

Самым вредоносным заболеванием смородины чёрной, которое встречается во всех странах,


где возделывается эта культура, является реверсия. На ранних стадиях реверсию трудно диагно-
стировать из-за неравномерного распределения данного вируса в тканях растения и медленного
процесса заражения, так как проходит несколько лет, пока инфекция распространится на все
ветви куста. До недавнего времени основным методом обследования насаждений смородины
чёрной в нашей республике был визуальный анализ. Диагностика BRV методом полимеразной
цепной реакции с обратной транскрипцией и связыванием вируса специфичными антителами
(Immunocapture Reverse Transcription-Polymerase Chain Reaction, IC-RT-PCR) позволяет гораздо
точнее определить наличие вирусной инфекции. Целью данного исследования было оценить
эффективность диагностики вируса в разное время года (в периоды полного покоя и активного
роста растений), определить распределение вируса в тканях растения.
Материалом для исследования служили растения смородины чёрной сорта Память Вави-
лова, поражённые вирусом реверсии. Для диагностики методом IC-RT-PCR в период активно-
го роста (май) использовали цветки, листья, древесину однолетнего и многолетнего побегов,
в период полного покоя (декабрь) вместо цветков использовали галловые почки.
IC-RT-PCR анализ вируса BRV проводили по методике, разработанной A.  Lemmetty et al.
(1998) и дополненной T. Malinowski et al. (2000). Для иммобилизации использовали покровные
антитела (IgG) в разведении 1:1000. Растительную ткань гомогенизировали путем растирания
в РВS-TРО-буфере в соотношении 1:10. Амплификацию проводили с использованием набора
One Step RT-PCR Kit (QIAGEN). Реакционная смесь для проведения RT-PCR имела следующий
состав: 6,3 мкл деионизированной H2O; 2 мкл 5×RT-PCR буфера; 0,4 мкл каждого (прямого и
обратного) праймера (10 µM); 0,2 мкл смеси dNTP (10 mM); 0,5 мкл DTT (100 mM); 0,2 мкл
смеси ферментов. Общий объем реакционной смеси составлял 10 мкл. Температурные усло-
вия для RT-PCR были следующие: на этапе обратной транскрипции 50 ºС – 30 мин; начальной
денатурации 95 ºС – 15 мин; амплификация 10 циклов: 94 ºС – 10 с, 60 ºС – 30 с, 72 ºС – 45 с;
амплификация 25 циклов с увеличением времени каждого последующего цикла на 5 с: 94 ºС –
10 с, 60 ºС – 30 с, 72 ºС – 45 с; финальная элонгация 72 ºС – 7 мин. Для анализа использовали
праймеры BRAV5/BRAV6 производства «ПраймТех» (Беларусь).
Установлена возможность диагностики вируса реверсии смородины чёрной в разных тканях
в период полного покоя растений смородины чёрной методом IC-RT-PCR, что позволяет прод-
лить сроки тестирования и осуществлять отбор неинфицированных растений во внесезонное
время. Вирус определялся в вегетативных и галловых почках, и в средней части однолетних
побегов, в то время как в верхней и нижней частях однолетних побегах вирусспецифические
ампликоны синтезировались не во всех случаях. Вирус не поддавался определению в древесине
многолетних побегов. В период активного роста (май) вирус реверсии хорошо диагностировал-
ся как в цветках, так и в вегетативных почках, древесине однолетнего и многолетнего побегов.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
118 Секция 3. Генетика, селекция и биотехнология

О.О. Коломиец, С.В. Глушен

ОЦЕНКА ПРОЛИФЕРАТИВНОЙ АКТИВНОСТИ КЛЕТОК МЕТОДОМ


ДИНАМИЧЕСКОЙ ДНК-ЦИТОМЕТРИИ

Белорусский государственный университет


Республика Беларусь, 220030, г. Минск, пр. Независимости, 4
e-mail: sglush@mail.ru

Анализ пролиферации растительных клеток является одним из фундаментальных подходов


к оценке жизнеспособности растений, их ростового потенциала и ответа на стресс. Исторически
первым методом оценки пролиферативной активности было измерение уровня синтеза ДНК
с помощью меченного тритием тимидина. Позднее радиоактивный тимидин был заменен
его аналогом – 5-бромдезоксиуридином, включение которого в ДНК определяют с помощью
специфических к нему антител. Недавно был разработан метод идентификации синтезирующих
ДНК клеток, также основанный на аналоге тимидина – 5-этинил-2`-дезоксиуридине, включение
которого в ДНК проявляют ковалентным связыванием флуоресцентной метки. В большинстве
случаев, однако, при анализе пролиферации ограничиваются менее точным, но более
доступным цитометрическим методом, основанным на измерении относительного содержания
ДНК в клеточных ядрах. Он позволяет определить плоидность растения, а также долю клеток
в G1-, S- и G2-фазах клеточного цикла путем компьютерного анализа ДНК-гистограмм.
Цель данного исследования заключалась в разработке новой методики получения ДНК-
цитограмм для более точной оценки пролиферативной активности популяций растительных
клеток. В качестве модельного объекта использовалась культура клеток Althaea officinalis
в экспоненциальной фазе роста. Проверочные эксперименты проводились на выращиваемых
в лабораторных условиях растениях томата и сладкого перца, плоидность которых определялась
подсчетом числа хромосом. Выделенные клеточные ядра окрашивали бромидом этидия
в концентрации 20 мкг/мл и фотографировали с помощью микроскопа AxioImager (Цейсс),
оборудованного телекамерой DS-5Mc (Никон). Измерения интенсивности флуоресценции
выполняли в программе ImageJ.
Принцип методики заключается в получении двух и более ДНК-цитограмм в динамике
роста культуры клеток или растения, что позволяет при дальнейшей компьютерной обработке
определить плоидность, величину пролиферативного пула и распределение клеток по фазам
клеточного цикла благодаря разделению пролиферирующей и непролиферирующей
субпопуляций.
Согласно полученным по новой методике результатам, пролиферативный пул активно
растущей культуры клеток составляет 39,5%. У томатов и перца его величина варьирует
в пределах от 36,4% до 53,7%, демонстрируя зависимость от мощности растения. Следует
отметить сужение G1-пика в гистограммах, что должно обеспечить более надежное определение
плоидности и повышение точности измерений относительного и абсолютного содержания ДНК.
В дальнейшем планируется изучение особенностей новой методики с помощью компь-
ютерного моделирования, а также путем параллельного выполнения альтернативных методов
анализа клеточного цикла.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
Секция 3. Генетика, селекция и биотехнология 119

О.Ю. Конева1, Е.А. Ровба1, А.М. Слуквин1, Н.Б. Кульжанов2

ПРИМЕНЕНИЕ МЕТОДОВ SSR-PCR В ИССЛЕДОВАНИЯХ У СТЕРЛЯДИ


(ACIPENSER RUTHENUS L.)

Институт генетики и цитологии НАН Беларуси


1

Республика Беларусь, 220072, г. Минск, ул. Академическая, 27


e-mail: A.Slukvin@igc.by
2
ООО «ТерраФиш»
Республика Беларусь, 211162, г. Новолукомль, Лукомльское шоссе, 5, оф.3
e-mail: nkulzhanov@mail.ru

На садковой линии, установленной на сбросном канале Новолукомльской ГРЭС (собствен-


ность ООО «ТерраФиш»), выращивается одно из крупнейших в республике репродуктивных
стад стерляди, однако видовая и популяционная принадлежность особей в стаде до настояще-
го времени оставалась неизвестной. По имеющимся в хозяйстве данным, стерлядь в начале
2000 годов была завезена из Конаковского завода по осетроводству (Тверская область, Россия,
бассейн реки Волга).
Цель исследований – проведение ревизии маточного стада стерляди на наличие межвидовых
гибридов (оценка генетической чистоты вида) и определение популяционной принадлежности
маточного стада стерляди с помощью микросателлитных маркеров, для оценки возможностей
интродукции молоди стерляди в водотоки бассейна р. Днепр.
Отбор биологического материала для выделения ДНК был произведён в 2014 г. у произво-
дителей стерляди, чипированных PIT-метками. Выделение ДНК производили методом фенол-
хлороформной экстракции. Для уточнения видовой принадлежности и обнаружения в стаде
стерляди межвидовых гибридов были использованы методы анализа D-петли мтДНК и ядерной
ДНК по пяти стандартным микросателлитным локусам, характерным для осетровых видов рыб:
An-20, AoxD161, AoxD165, AfuG41, AfuG51 (Мюге, 2008; Тимошкина, 2010). При изучении
популяционной принадлежности особей использованы, известные в литературе, молекулярные
маркеры, характерные для 5-ти популяций стерляди из рек Днепр, Дунай, Днестр, Кама (LS-19
(Afu-19), LS-39 (Afu-39) и LS-68 (Afu-68) (D. Fopp-Bayat, et al., 2008). По результатам исследо-
ваний было установлено, что межвидовых гибридов среди меченых производителей стерляди
не обнаружено, что свидетельствовало о видовой чистоте маточного стада с генетической точ-
ки зрения. При проведении фрагментарного анализа ДНК с использованием специфических
микросателлитных маркеров получены данные свидетельствующие о том, что чипированное
маточное стадо, размещенное на садковой линии Новолукомльской ГРЭС, относится к попу-
ляции стерляди из реки Кама, крупного притока р. Волга. Следовательно, рыбопосадочный
материал стерляди, выращиваемый в ООО «ТерраФиш», нельзя использовать для зарыбления
водотоков бассейна реки Днепр, так как по международным соглашениям о сохранении био-
разнообразия запрещено вселение в водотоки особей, относящихся к одному и тому же виду,
но принадлежащим к разным популяциям. Молодь стерляди, в данном случае, следует исполь-
зовать на товарное выращивание, а производителей – на получение молоди и пищевой черной
икры. Результаты выполненных молекулярно-генетических исследований у стерляди важны
для эффективного ведения осетроводства, а также необходимы хозяйствам при:
1. оформлении генетических паспортов меченых производителей осетровых;
2. ведении селекционно-племенной работы с осетровыми видами рыб;
3. оформлении генетических сертификатов в соответствии с требованиями СМ РБ и СИ-
ТЕС при реализации пищевой черной икры и товарной продукции осетровых видов рыб.

III Международная научная конференция «Генетика и биотехнология XXI века: проблемы, достижения, перспективы»
120 Секция 3. Генетика, селекция и биотехнология

В.Н. Кузнецова, А.И. Будевич

НЕКОТОРЫЕ ФАКТОРЫ, ВЛИЯЮЩИЕ НА ЭФФЕКТИВНОСТЬ ПОЛУЧЕНИЯ


И СОХРАННОСТЬ ГЕННЫХ КОНСТРУКЦИЙ

РУП «Научно-практический центр Национальной академии наук Беларуси по животноводству»


Республика Беларусь, 222160, г. Жодино, ул. Фрунзе, 11
e-mail: belniig@tut.by

Создание генных конструкций, отвечающих за синтез целевых белков различными систе-


мами организма, является одним из основных и важнейших этапов в биотехнологии трансге-
неза животных. Поиск оптимальных кодирующих последовательностей генов человека и ре-
гуляторных элементов для дизайна генно-инженерных вставок определяется рядом факторов,
способствующих в конечном итоге повышению стабильности переноса генов и получению
экономически значимого количества «белка интереса» в молоке животных-продуцентов.
Вместе с тем, конструирование гибридных молекул ДНК in vitro, способных кодировать
проявление определённых признаков в организме, наработка необходимого количества целе-
вых участков ДНК, оптимизация полученных конструкций и их очистка требует проведения
дальнейших исследований, направленных на разработку режимов и условий молекулярных
ман