WRITING REQUIREMENTS OF ORIGINAL ARTICLES

1 TITLE

Title should be less than 12 words.

2 RUNNING TITLE

A short running title of less than 6 words should be provided.

3 AUTHORSHIP

Authorship credit should be in accordance with the standard proposed by International

Committee of Medical Journal Editors, based on (1) substantial contributions to

conception and design, acquisition of data, or analysis and interpretation of data; (2)

drafting the article or revising it critically for important intellectual content; and (3) final

approval of the version to be published. Authors should meet conditions 1, 2, and 3.

4 RECEIVED

Fill out by S-editor; Revised: Fill out by S-editor; Accepted: Fill out by S-editor; Published

online: Fill out by E-editor.

5 ABSTRACT

An informative, structured abstracts of no more than 480 words should accompany each

manuscript. Abstracts for original contributions should be structured into the following

sections. AIM (no more than 20 words): Only the purpose should be included. Please

write the aim as the form of “To investigate/study/…; MATERIALS AND METHODS (no

more than 140 words); RESULTS(no more than 294 words): You should present P value

where necessary and must provide relevant data to illustrate how it is obtained, e.g. 6.92

± 3.86 vs 3.61 ± 1.67, P < 0.001; CONCLUSION(no more than 26 words). Available from:

http://www.wjgnet.com/1007-9327/links/Abstract.doc

6 KEYWORDS

Please list 5-10 key words for each manuscript, selected mainly from Index Medicus,

which reflect the content of the study. Each key word is separated by a semicolon.

7 PEER REVIEWER

Fill out by S-editor.

1
8 TABLES AND ILLUSTRATIONS

Each table or illustration should be made on a separate sheet and should be “self-

explanatory” (sufficient to be intelligible without reference to the text). Avoid repetitions

of data in the text, tables, and illustration. Explain tersely the symbols, letters, or

number used. Indicate the number and character of observations and subjects. Identify

statistical significance by superscripts in front of the probabilities (P), e.g. aP<0.05,

b
P<0.01 vs A; cP<0.05, dP<0.01 vs B; etc.

8.1 Figures

You should provide decomposable figures with a size of 5 : 7 (height : width) in general.

The curves or straight lines should be clear. Freehand or typewritten lettering is

unacceptable. Units can not be omitted. Combine related curves in a single figure when

possible. A composite of curves will save space and convey more information. Standard

symbols (e.g. ○, ●, ×, □, ■, △, ▲) should be used when there are multiple curves.

8.2 Photographs, Images and Legends

8.2.1 The photographs supplied should be no smaller than 85 mm in height and 126 mm

in width, and at a resolution of 300 dpi as TIFF format. The colour photos should be

saved in TIFF format at a resolution of 300 dpi; each photo in a separate file, and no

smaller than 86 mm × 50mm.

8.2.2 Images submitted should be those which uniquely display the data. Figures are not

limited, but must be thoroughly justified. For figures that have multiple panels, the labels

should be set in uppercase Helvetica or Arial letters and should not contain periods or

parentheses. Please be sure to embed all fonts. Micrographs should be provided with a

scale bar, if appropriate, instead of magnification. Figures should be should be either

Photoshop or Illustrator files (in tiff, psd, eps, ai, pdf, or JPEG formats) at 300 dpi

resolution (for a figure no smaller than 50 mm in height and 86 mm in width). Our

professional in-house illustrator will work with authors to ensure the highest quality and

clarity of published figures. Please provide only one legend for each photo or figure that

contains all the pertinent information. Figures or photos should be grouped according to

their themes. For example, Figure 1 Pathological changes of atrophic gastritis tissue

2
before and after treatment. A: …; B: …; C: …; D: …; E: …; F: …. Explain the

symbols, arrows, numbers, or letters in the illustrations. Identify the method of staining

and magnification of the photomicrographs (eg, HE stain, ×900). For those including

methodology, the legend should be no more than 100 words (no more than 500 words in

total). For those not including methodology, the legend should be no more than 300

words (no more than 800 words in total). Letters in photos or figures should be

lowercased while the first one be capitalized. An interval should be inserted between

numbers and units. Photos or figures that are obtained at different time or places must

not be grouped into one, unless those photos or figures are arranged in a time order.

There are intervals between photos or figures of the same group. Photographs or figures

should be put in an independent file.

8.2.3 Authors should list the names of tools they use to obtain and edit the image file.

Images must be edited equally and contrast must be reasonable. Editing that is far

beyond the contents is forbidden. It is not allowed to over-emphasize the difference

between experiment data and control data, or over-emphasize a certain part of the

photos by ignoring some other parts. (A) Electrophoresis and blotting images: must

include negative, positive controls and molecular Marker; provide the reference of the

identified antibodies; explain the specificity and active spectrum of the agents not

identified; band should be clear; important bands must not be deleted; leave six-band

space around the blotting bands; we suggest not use high-contrast blotting, for over-

display may conceal the other bands. Authors should try to exhibit the bands on the gray

background. Black frame may be used if the background is weak. (B) Microscopic or

endoscopic images: cells from different field must not be put in the same field; images

should be adjusted at a whole; avoid pseudo-color and nonlinear adjustment (e.g. γ

transformation), and give an explanation in the legend if necessary.

8.3 Tables: A decomposable table is required. Each table should be put in an

independent page, with a bold title no more than a row long. Tables should be put at the

end of the article.

9 REFERENCES

3
Pleased provide PubMed citation numbers to the reference list, e.g. PMID and DOI, which

can be found at http://www.ncbi.nlm.nih.gov/sites/entrez?db=pubmed and

http://www.crossref.org/SimpleTextQuery/, respectively. The numbers will be used in E-

version of this journal. Thanks very much for your co-operation.

10 THE PURPOSE AND WRITING REQUIREMENTS AND EXAMPLES IN

THE“COMMENTS”ATTACHED AFTER THE PUBLISHED ARTICLE IN WJG

The“COMMENTS”attached after each published article in WJG aims to help the readers,

including scientists and mass media, outside the fields of the article to better understand

the content of the research so as to achieve the best effect of dissemination and benefit

more readers of the journal. To avoid misrepresentation or overstatement, it is important

to understand the content of the article correctly and try to use simple terms to describe

the technical parts in the preparation of the “COMMENTS”. While writing the

“COMMENTS”, please provide the information about background, research frontiers,

related publications, innovations and breakthroughs, significance of application,

terminology and comments from peer reviewers. The specific requirements in the writing

are suggested as follows:

10.1 Writing requirements

(1) Background

To concisely and accurately summarize the related background of the articleso as to

enable the readers to gain some basic knowledge relevant to the article and better

understand the significance of the article.

(2) Research frontiers

To briefly introduce the hotspots or important areas in the research field related to the

article.

(3) Related publications

To provide the sources or hyperlinks of any published articles related to the article so

that readers may obtain a broad and extensive knowledge so as to better understand the

article.

(4) Innovations and breakthroughs

4
To summarize and emphasize the differences, particularly the advances, achievements,

innovations and breakthroughs, from other related or similar studies so as to allow the

readers to catch up the major points of the article.

(5 )Applications

To summarize the actual application values, the implications for further application and

modification, or the perspectives of future application of the outcome of the study.

(6) Terminology

To concisely and accurately describe, define or explain the specific, unique terms that

are not familiar to majority of the readers, but are essential for the readers to

understand the article.

(7 )Peer review

To provide the comments from peer reviewers that most represent the characteristics,

values and significance of the article, and allow the readers to have an objective point of

view toward the article.

10.2 Writing examples

COMMENTS

(1) Background

Peritoneal adhesion can cause intestinal obstruction and other severe clinical disorders,

so it is very important to prevent peritoneal adhesion in abdominal surgical operations.

But up to now, there are still no ideal methods to prevent peritoneal adhesion in clinical

practices. Chitosan is a deacetylated derivate from chitin. Many studies reported that

chitosan was applied to prevent tissue adhesions, such as peritoneal adhesion, tendon

adhesion and synarthrophysis, but the effect was not satisfactory.

(2) Research frontiers

Chitosan is a sort of natural biological material and it has been processed into many

forms for medical use. In the area of prevention of peritoneal adhesion with chitosan, the

research hotspot is how to modify the chitosan by chemical and physical methods to

improve its effectiveness on preventing the adhesion, and simultaneously reduce its

adverse reactions.

5
(3 )Related publications

(4) Innovations and breakthroughs

In the previous application of chitosan gels to the prevention of peritoneal adhesion, it

was found that the gel was much fluid and was difficult to stay in the target places for

sufficient time, and moreover, the gel degraded so fast that it could only maintain the

effectiveness for a short duration. In order to delay the degradation and decrease the

fluidity of the gel, we processed pure chitosan into films, but the film degraded too

slowly and the residual film was encapsulated by surrounding tissue and the peritoneal

adhesion was worsened. In order to overcome these disadvantages, we mixed chitosan

with gelatin and produced blending films. The blending film degraded much faster than

the previous pure chitosan film, but it also created foreign body reaction and formed

severe foreign body granuloma around the blending film. In the present study we

chemically modified the chitosan in gelatinization to develop a new sort of chitosan film,

and showed that the film is remarkably effective on preventing peritoneal adhesions

induced by wound, ischemia and infection except the foreign body-induced adhesion.

(5) Applications

The study results suggest that the gelatinizedly-chitosan film is a potential therapeutic

material that could be used in preventing peritoneal adhesions induced by wound,

ischemia and infection.

(6) Terminology

Peritoneal adhesion: Peritoneal adhesion is a sort of defensive reaction to the peritoneal

injury mainly including wound, infection, ischemia and foreign body, but it can also

develop intestinal obstruction and cause severe clinical disorders; chitosan: Chitosan is a

deacetylated derivate from chitin, and chitin is the second most abundant natural

biopolymer derived from exoskeletons of crustaceans and also from cell walls of fungi

and insects.

(7) Peer review

This is a good descriptive study in which authors analyze the preventive effect of

gelatinizedly-modified chitosan on peritoneal adhesions induced by different factors in

rats. The results are interesting and suggest that gelatinizedly-chitosan is a potential

6
therapeutic substance that could be used in preventing peritoneal adhesions induced by

wound, ischemia and infection.

11 S- EDITOR, L- EDITOR AND E- EDITOR

Fill out by responsible person.

7
Format for ORIGINAL ARTICLES

Ms. wjg/2009/000000 ORIGINAL ARTICLES

Overexpression of Slug is associated with

malignant progression of esophageal

adenocarcinoma

Jethwa P et al. Slug and esophageal cancer

Paras Jethwa, Mushal Naqvi, Robert G Hardy, Neil A Hotchin, Sally Roberts,
Robert Spychal, Chris Tselepis

Paras Jethwa, Mushal Naqvi, Sally Roberts, Chris Tselepis, CRUK

Institute for Cancer Studies, University of Birmingham, Vincent Drive,
Birmingham B15 2TH,
United Kingdom

Robert G Hardy, Department of Clinical and Surgical Sciences, Royal

Infirmary of Edinburgh, Crewe Road South, Edinburgh EH4 2XU, United
Kingdom

8
Neil A Hotchin, School of Biosciences, University of Birmingham, Vincent
Drive, Birmingham B15 2TH, United Kingdom

Robert Spychal, Sandwell and West Birmingham Hopsitals NHS Trust,

Birmingham, Vincent Drive, Birmingham B15 2TH, United Kingdom

Author contributions: Jethwa P and Naqvi M performed the majority of

experiments; Hardy RG, Hotchin NA, and Roberts S provided vital reagents
and analytical tools and were also involved in editing the manuscript; Spychal
R co-ordinated and provided the collection of all the human material in
addition to providing financial support for this work; Tselepis C designed the
study and wrote the manuscript.
Supported by City Hospital Trust Fund and the University of Birmingham
Scientific Project Grant
Correspondence to: Dr. Chris Tselepis, CRUK Institute for Cancer Studies,
University of Birmingham, Vincent Drive, Birmingham B15 2TH,
United Kingdom. c.tselepis@bham.ac.uk

Telephone: +44-121-4142972 Fax: +44-121-6272384

Received: Revised: Accepted:
Published online:

9
Abstract
AIM: To characterise expression of known E-cadherin repressors; Snail, Slug
and Twist in the development of esophageal adenocarcinoma.

METHODS: E-cadherin, Slug, Snail and Twist mRNA expression in Barrett's

metaplasia and esophageal adenocarcinoma specimens was examined by
real-time reverse transcription-polymerase chain reaction (RT-PCR). Semi-
quantitative immunohistochemistry was used to examine cellular localisation
and protein levels. The effect of Slug on epithelial mesenchymal transition
(EMT) markers was examined by transfection of Slug into an adenocarcinoma
line OE33.

RESULTS: Cellular localisation of Slug in Barrett's metaplasia was largely

cytoplasmic whilst in adenocarcinoma it was nuclear. Semi-quantitative
analysis indicated that Slug was more abundant in adenocarcinoma compared
to matched Barrett's metaplastic specimens. Snail and Twist were expressed
in adenocarcinoma but were cytoplasmic in location and not induced
compared to Barrett's mucosa. These observations were supported by mRNA
studies where only Slug mRNA was shown to be over-expressed in
adenocarcinoma and inversely correlated to E-cadherin expression.
Overexpression of Slug in OE33 mediated E-cadherin repression and induced
the mesenchymal markers vimentin and fibronectin.

CONCLUSION: Progression to adenocarcinoma is associated with increased

Slug expression and this may represent a mechanism of E-cadherin silencing.

© 2008 The WJG Press. All rights reserved.

Key words: Slug; Oesophagus; Cancer; Barrett’s metaplasia; Epithelial-

10
mesenchymal transition

Peer reviewer:

Jethwa P, Naqvi M, Hardy RG, Hotchin NA, Roberts S, Spychal R, Tselepis C.

Overexpression of Slug is associated with malignant progression of
esophageal adenocarcinoma. World J Gastroenterol 2008; 14(7): 1044-1052
Available from: URL: http://www.wjgnet.com/1007-9327/14/0000.asp
DOI: http://dx.doi.org/10.3748/wjg.14.0000

11
INTRODUCTION
The incidence of esophageal adenocarcinoma is currently rising faster than
any other cancer in the Western world. Alarmingly the cause of this increase
is largely unknown[1]. The strongest known risk factor for esophageal
adenocarcinoma is the condition Barrett’s metaplasia which is characterised
by a replacement of the native squamous lined esophagus with a columnar
epithelium: a possible consequence of prolonged reflux of gastric contents
into the lower esophagus[1,2].
To date, numerous proteins have been implicated in the malignant
progression of Barrett’s metaplasia to adenocarcinoma including E-cadherin[3-
. E-cadherin is a calcium dependent cell adhesion molecule which is
6]

essential in the establishment of homotypic adhesion junctions[7]. In nearly all

epithelial cancers E-cadherin has been reported to be repressed: an essential
step for increased invasiveness and metastasis[8-10], thus this event commonly
occurs during late tumourigenesis. In particular in the development of
esophageal adenocarcinoma, E-cadherin repression has been reported to be a
late event associated with high grade dysplastic Barrett’s metaplasia and
adenocarcinoma[4-6].
However, it remains unclear what directs repression of E-cadherin
expression in esophageal adenocarcinoma. Unlike in hereditary diffuse gastric
cancer E-cadherin is not subject to mutation and neither is there evidence of
E-cadherin promoter methylation as is common in colorectal cancers [11,12]. A
possible mechanism of E-cadherin silencing, which to date has not been
addressed, is transcriptional repression by proteins involved in epithelial
mesenchymal transition (EMT) including proteins in the Snail family: Snail and

12
Slug and the transcription factor Twist[13-15].
Several studies have elegantly demonstrated in a variety of cell types that
overexpression of Snail and Slug causes an EMT and this is associated with E-
cadherin repression[16,17]. Furthermore, it has been demonstrated that these
effects are mediated through interaction with specific E-pal elements of the
E-cadherin proximal promoter[16,17]. In support of a role for these EMT
regulators in E-cadherin repression and carcinogenesis, several studies have
shown overexpression in several epithelial cancers including overexpression
of Slug in gastric carcinomas[18], Snail in colorectal cancers[19] and Twist in
pancreatic cancers[20].
The primary aim of this study was to determine the expression profile of
Snail, Slug and Twist in the development of esophageal adenocarcinoma and
determine if overexpression of these proteins in an esophageal background is
able to mediate a repression in E-cadherin.

MATERIALS AND METHODS

Ethics
This work has been carried out in accordance with the Declaration of Helsinki
(2000) of the World Medical Association. This study was approved ethically by
University Hospital Birmingham Trust (LREC 2002/166). All patients provided
informed written consent.

Patient tissue
Esophageal adenocarcinoma resection specimens: Samples of normal
squamous esophagus (n = 40) and esophageal adenocarcinoma (n = 40)
were collected during surgery. Half of the esophageal adenocarcinoma
resection specimens (n = 20) collected also had associated intestinal
Barrett’s metaplasia. In addition, samples(n = 20) of long segment (≥ 3 cm)
Barrett’s metaplasia, defined as columnar mucosa with intestinal type goblet

13
cells were also collected during endoscopy. All specimens were divided in two,
half for RNA extraction and half for immunohistochemistry.
Immunohistochemistry: Immunohistochemistry for E-cadherin was
performed using microwave antigen retrieval as previously described with an
E-cadherin monoclonal antibody (clone 36, BD Biosciences, Oxford, UK) used
at a concentration of 1:300[21]. Immunohistochemistry for Snail, Slug and Twist
was performed as follows: Slides were immersed in W-cap buffer (Bio-Optica,
Milan, Italy) and cycled in a Pixel antigen retriever (CellPath, Newtown, UK) for
60 min, washed in running water and placed in methanol:hydrogen peroxide
(10:1) for 5 min. Sections were then incubated in a primary antibody to either
Snail, 1:10, (SNAI1 clone E18, Autogen Bioclear, Wiltshire, UK), Slug, 1:20
(SNAI2 clone G18 Autogen Bioclear, UK) or Twist, 1:50 (clone C17 Autogen
Bioclear, UK) in TBS 7.5 × buffer (Bios Europe Ltd, Skelmersdale, UK) at 4℃
overnight, washed with TBS and reacted with peroxidase-linked rabbit anti-
sheep antibody (Dako, Ely, UK) at a 1:100 dilution in TBS for 1 h. The
immunoreactivity was then revealed as above using DAB. Slides were then
dipped in hematoxylin, dehydrated and mounted. The slides were scored by a
previously described method for (1) intensity of staining(0 = negative, 1 =
weak, 2 = moderate, 3 = intense) and (2) percentage of epithelial cells
staining (0 = 0%-5%; 1 = 6%-25%; 2 = 26%-50%; 3 = 51%-75%; 4 = 76%-
100%); these two scores were multiplied to yield a final staining score [22]. In
addition, cellular localisation (nuclear, cytoplasmic, cell surface) was
assessed. All sections were scored independently by two observers (PJ and
CT).
In the series of immunofluorescent experiments following primary antibody
incubations, sections were washed extensively and then incubated with either
FITC goat anti-mouse or goat anti-rabbit (Jackson Immunoresearch, USA,
1:500) for 1 h. Sections were then washed and incubated in 4’, 6-Diamidino-3-
phenylindole dihydrochloride hydrate (DAPI) (1:10 000) for 1 min prior to

14
visualisation. Omission of primary antibody was employed as a negative
control. Images were visualised using an Olympus BX40 microscope and
digital images taken using a Sensys Photometrics camera (Middlesex, UK).
Desksoft SmartCapture 2 software was used for image acquisition (Desksoft,
USA).

Real time RT-PCR

Real time RT-PCR reactions were performed as previously described using 18S
ribosomal RNA as an internal standard (PE Biosystems, Roche, USA)[21]. Each
reaction was performed in triplicate and contained one of the following sets of
probes and primers: (1) E-cadherin (probe 5'FAM
AAATTCACTCTGCCCAGGACGCGGTAMRA3'), forward primer (5'-
GGCGCCACCTCGAG-AGA-3') and reverse primer (5'-
TGTCGACCGGTGCAATCTT3'); (2) Slug (probe 5'FAM'CACATACAGTGATTATTTCCC
CGTATC-TCTATGAGAGTTAMRA3'), forward primer (5'-
AAAAGCCAAACTACAGCGAACTG-3') and reverse primer (5'-AGAATCTCTG-
CTTGTGGT ATG ACA-3'); (3) Snail (probe 5'FAMTGCAGGACTCTA
ATCCAGAGTTTACCTTCCAGCTAMRA3'), forward primer (5'-
CCCAATCGGAAGCCTAACTACAG-3') and reverse primer (5'-
CAGGTGGGCCTGGTCGTA-3'), or (4) Twist (probe 5'-FAMACAATG-ACATCTAGG
TCTC-3'), forward primer (5'-GCTCCAGAGTCTCTA GACTGTCCATT-3') and
reverse primer(5'-GGGGCCTGG-TCCATGTC-3').

Western blotting
Western blotting was performed as previously described[21] with antibodies
to (1) E-cadherin (1:2 000, clone 36, Autogen Bioclear UK); (2) Fibronectin
(1:1000, Clone P1F11 Autogen Bioclear, UK); (3) Vimentin (1:1000, clone C-
20, Autogen Bioclear, UK); (4) Cytokeratin 19 (CK-19) (1:2000; Oncogene
Research Products USA) and (5) GFP (1:2000, Clone AB290 Abcam, UK).

15
Immunoreactive bands were then subject to densitometry using NIH Image
1.62 software.

Cell culture
Cell lines derived from esophageal adenocarcinoma (OE33[23], SEG-1[24] and
oesophageal squamous carcinoma TE-7[25]) were all routinely cultured in
Dulbecco’s modified Eagles medium (Gibco, USA) with 10% fetal calf serum
supplemented with 1 × 105 Units/L penicillin and 1 g/L streptomycin. Upon
reaching 70% confluence cells were lysed into Trizol reagent (Gibco, UK) for
mRNA extraction and evaluation of Slug mRNA expression by Real Time PCR.

Transfection studies
Cell line OE33 was transiently transfected with either control empty vector,
pMSCV-GFP or full-length human Slug-GFP tagged construct, pMSCV-Slug-
GFP[26] or beta-galactosidase plasmid (beta-GAL) using Lipofectamine Plus
according to manufacturers instruction. 48 h post transfection cells were
either assayed for transfection efficiency using beta-galactosidase assay to
determine transfection efficiency, lysed into RIPA buffer for Western blotting
or lysed in Trizol for real time RT-PCR studies. Data analysis was only
performed in experiments where a minimum of 40% transfection efficiency
was achieved as determined by beta-galactosidase assay.

To determine the effect of Slug on the human E-cadherin promoter, an E-

cadherin promoter assay was performed as previously described[21]. Briefly,
OE33 cells were transiently transfected with full length human slug (pCDNA3-
Slug[25]), Renilla luciferase plasmid pRL TK and the wild-type human E-
cadherin promoter cloned into the pGL3basic luciferase reporter plasmid
(EproWT) a kind gift from Professor Frans van Roy). Controls included empty
pCDNA3 and empty pGL3basic vectors. 48 h post transfection cells were

16
assayed for firefly and Renilla luciferase activities using the dual-reporter
assay kit Stop ‘N’ Glow (Promega) according to manufacturer’s instruction.
Firefly luciferase activity was normalised to Renilla luciferase activity as a
transfection control. Promoter activity was expressed as a fold change in
relative luciferase units (RLU) compared to that obtained in pGL3basic control
transfected cells. Results shown represent the means ± SE of three
independent experiments.

Statistical analysis
All data are presented as means ± SE. Statistical significance was calculated
using unpaired Student’s t test. To assess the association between Slug and
E-cadherin, linear regression analysis was performed on log-transformed
mRNA fold change values using log Slug expression as the independent
variable and log E-cadherin expression as the dependent variable. The R2
value was determined to demonstrate the extent to which expression of Slug
was correlated to E-cadherin. A Bonferroni adjustment was applied to P values
attained from multiple comparisons during the analysis of prognostic factors.
In univariate analyses significance was accepted at P ≤ 0.05, following
Bonferroni adjustment, P ≤ 0.0125 was considered significant. All analyses
were performed using SPSS version 10.0 (SPSS Inc, USA).

RESULTS
Immunolocalisation of Snail, Slug and Twist in esophageal
adenocarcinoma
In normal stratified squamous esophagus, there was no detectable expression
of Snail and only weak diffuse cytoplasmic immunoreactivity for Twist, while
there was strong nuclear immunoreactivity for Slug in basal and supra-basal
layers (Figure 1). In Barrett’s metaplasia, Snail and Slug were generally
localised to the cytoplasm with staining being patchy and diffuse in nature. In

17
contrast, Twist was largely nuclear in localisation (Figure 1). In esophageal
adenocarcinoma, all three proteins were abundantly expressed with Snail and
Twist being mostly localised in the cytoplasm whilst Slug was almost
exclusively nuclear in all adenocarcinoma specimens (n = 20) (Figure 1).
In addition, all slides were scored and data are shown in Table 1. To
determine if Snail, Slug and Twist were over-expressed in adenocarcinoma
specimens relative to non-matched Barrett’s metaplastic specimens (BM-ve),
statistical analysis was performed and results showed that both Slug and
Snail were significantly over-expressed (P ＜ 0.05) in esophageal
adenocarcinoma. Twist, however, was not significantly induced. To validate
this data, we further performed immunohistochemistry on a further 20
sections of adenocarcinoma with matched Barrett’s metaplastic tissue
(BM+ve). When comparing the staining scores of matched Barrett’s
metaplastic specimens with adenocarcinoma, only Slug was significantly over-
expressed (P＜0.05).
Since there is a growing body of evidence implicating Slug as a repressor of
E-cadherin, we further sought to address if Slug overexpression was
associated with depressed E-cadherin expression in sections of both Barrett’s
metaplasia and adenocarcinoma using dual immunofluorescence with anti-
Slug (FITC) and E-cadherin antibodies (Texas Red) (Figure 2). Sections of
Barrett’s metaplasia mostly demonstrated preserved cell border E-cadherin
immunoreactivity consistent with its role in cell-cell adhesion whilst there was
little detectable expression of Slug. Conversely in sections of adenocarcinoma
in areas of abundant Slug immunoreactivity, there was almost a complete
loss of E-cadherin immunoreactivity with the expression mostly localised to
the cytoplasm.

mRNA expression of E-cadherin, Slug, Snail and Twist in Barrett’s

metaplasia and esophageal adenocarcinoma specimens
To determine if Slug, Snail, Twist and E-cadherin were modulated at the

18
transcriptional level in esophageal adenocarcinoma, 10 specimens of
esophageal adenocarcinoma each with matched intestinal Barrett’s
metaplasia were analysed by real-time PCR (Figure 3).
E-cadherin mRNA was repressed in 70% of adenocarcinoma specimens
whilst Slug, Snail and Twist was over-expressed in 70%, 40% and 50%,
respectively. The mean fold decrease for E-cadherin in the ten specimens
examined was 0.73 whilst Slug, Snail and Twist had mean fold increases of
2.07, 1.47 and 1.50 respectively. We then sought to determine if the mean
fold changes for Slug, Snail and Twist across the ten specimens were
significantly different from E-cadherin values. This revealed that only Slug
was significantly elevated compared to E-cadherin expression (P ＜ 0.005).
Additionally we assessed the association between E-cadherin and these EMT
regulators using linear regression analysis. Results of this showed that again
only Slug was negatively correlated with E-cadherin expression (R2 0.677, P＜
0.03) (Figure 4).

Exogenous overexpression of Slug in the cell line OE33 induces an

EMT phenotype
Slug mRNA expression was examined in a panel of three esophageal cell lines
OE33, SEG1 and TE-7 by real-time PCR and results showed that the cell line
OE33 had the lowest expression of Slug mRNA whilst the highest Slug
expressing cell line was TE-7. In this regard, the cell line OE33 was chosen for
Slug overexpression studies.
The cell line OE33 was transiently transfected with either full length human
Slug-GFP vector or the control empty GFP vector. Forty-eight h after
transfection, cells were either lysed and processed for mRNA and protein
analysis or fixed for immunofluorescence.
mRNA analysis revealed an approximate 6.5 × induction in Slug mRNA in
cells transfected with full length human Slug-GFP compared to cells

19
transfected with empty-GFP vector (P ＜ 0.05) (Figure 5A). Exogenous Slug
expression was further verified indirectly (due to a lack of a commercially
available Slug antibody suitable for Western blotting) by Western blotting for
GFP (Figure 5B).
To ascertain whether overexpression of Slug in OE33 cells mediated an EMT
phenotype, Western blotting was performed to examine protein expression of
three EMT markers E-cadherin, vimentin and fibronectin (Figure 6).
Densitometric analysis of Western blots (n = 6) revealed Slug overexpression
was associated with a repression in E-cadherin (mean fold decrease of 53% ±
15%, P＜0.05) and increased vimentin (41% ± 11%, P＜0.05) and fibronectin
expression (32% ± 12%, P＜0.05). In addition, the cell adhesion and signalling
molecule beta-catenin was also examined and shown to be significantly
repressed (57% ± 19%, P＜0.05).
To address whether Slug mediated E-cadherin protein repression was
through a direct effect at the level of the E-cadherin promoter and
consequently a transcriptional effect, a luciferase E-cadherin promoter assay
and real-time PCR was employed respectively as previously described[21,25].
Overexpression of Slug in OE33 resulted in a significant reduction (35% ±
10%, P＜0.05) in E-cadherin promoter activity (Figure 7A) which was mirrored
by decreased E-cadherin mRNA expression (20% ± 5%, P＜0.05) (Figure 7B).

DISCUSSION
Recent reports have highlighted the importance of epithelial mesenchymal
regulators including Snail, Slug and Twist in gastrointestinal
carcinogenesis[18,19,27-29]. We have demonstrated for the first time a modulation
in the expression and localisation of these proteins in the malignant
progression of normal squamous esophagus to adenocarcinoma.
Twist was only weakly expressed in squamous esophagus consistent with
the results of Yuen et al[29]. Their studies reported over 95% of non-neoplastic

20
squamous esophageal samples were either negative or weak for Twist
immunoreactivity as assessed by immunohistochemistry. However, in our
studies we did observe nuclear Twist staining in Barrett’s metaplasia which in
adenocarcinoma had become cytoplasmic in localisation. This pattern of
cytoplasmic expression for Twist in cancer has also been observed in
squamous cell cancers of the esophagus[29]. We were unable to show a
difference in Twist expression between matched Barrett’s and
adenocarcinoma specimens at both the mRNA and protein level, and neither
was its expression associated with prognostic end points such as stage and
modal involvement.
In the case of Snail, this was comparably either very weak or nondetectable
in stratified squamous oesophagus whilst in both Barrett’s metaplastic tissue
and adenocarcinoma Snail was detectable in the cell cytoplasm. Despite
moderate expression of Snail in adenocarcinoma specimens, there was no
difference in expression between matched adenocarcinoma and Barrett’s
specimens at both the protein and mRNA level. A recent study has also
reported Snail immunoreactivity in adenocarcinomas of the upper
gastrointestinal tract including the esophagus[30]. In their study Snail
expression was reported in 11% of esophageal adenocarcinomas examined
and no correlation was found between the expression of Snail and tumor
grade and stage.
Why both Snail and Twist are localised to the cytoplasm in esophageal
adenocarcinoma is unclear though a recent study has suggested that Snail’s
localisation could in part be determined by post-translational phosphorylation
with proteins such as p21-activated kinase 1 (Pak1)[31]. Interestingly, when
Pak1 mediated phosphorylation of Snail was inhibited, this not only caused a
nuclear to cytoplasmic accumulation but also attenuated its repressor
activity[31].
Immunolocalisation studies for the transcription factor Slug showed that it

21
was strongly expressed in nuclei of basal and suprabasal esophageal
keratinocytes of the stratified squamous epithelium consistent with previous
reports in murine studies[32] and other human stratified epithelia including
epidermis[25]. Whilst Slug nuclear expression was lost in Barrett’s metaplasia,
it was retained in adenocarcinoma and furthermore there appeared to be an
overexpression of this protein in adenocarcinoma compared to matched
Barrett’s metaplasia at both the mRNA and protein level.
Interestingly Uchikado et al have reported that Slug is also over-expressed
in esophageal squamous cell carcinomas (SCC)[27]. Their study showed that
the presence of Slug was associated with depth of tumor invasion, lymph
node metastasis, stage and lymphatic invasion. Consistent with our study,
Slug expression in SCC was significantly correlated with reduced E-cadherin
expression.
Thus our data would suggest that of the three EMT regulators examined,
Slug was the only transcription factor to show a significant increase at both
the mRNA and protein level in the progression from Barrett’s metaplasia to
adenocarcinoma. This coupled with nuclear expression in adenocarcinoma
and an association with E-cadherin repression suggests functionality in
oesophageal tumourigenesis.
The consequence of overexpression of Slug in adenocarcinoma is likely to be
complex, as exemplified by the ever-growing list of direct and indirect
downstream target genes attributed to be modulated as a consequence of its
expression[25,33,34]. As anticipated, many of these targets appear to be involved
in cellular survival, proliferation and mesenchymal transition. The latter was
exemplified by E-cadherin, a protein commonly silenced in epithelial cancers
including esophageal adenocarcinoma[4-6,8-10,17].
To support our hypothesis that Slug might be responsible for the observed
repression of E-cadherin in adenocarcinoma, Slug was exogenously over-
expressed in an oesophageal cell line OE33. Our results demonstrate that

22
Slug could repress E-cadherin transcription at the level of the E-cadherin
promoter. Slug mediated E-cadherin promoter repression has been previously
demonstrated in other lineages and this is likely to be mediated through one
or more of the E-box elements present within the promoter[17].
To verify the extent of EMT, we further examined the expression of the
mesenchymal proteins vimentin and fibronectin[35]. Indeed both proteins were
induced as a consequence of Slug expression and consistent with other
studies Slug also mediated a repression in beta-catenin, a protein involved in
both cell-cell adhesion and Wnt signalling[36].
Abrogating Slug induction may thus represent a potential therapeutic
strategy since it appears central to the EMT phenotype observed in
esophageal adenocarcinoma. A potential approach might be to silence or
block known inducers of Slug. In this regard, the extracellular signals FGF,
TGF-beta, and Wnt, which have been reported to be over-expressed and
implicated in the pathogenesis of esophageal adenocarcinoma, have been
found to induce Slug expression[13,14,37-39]. Thus abrogating the expression of
these extracellular signals might represent a mechanism of repressing Slug
and potentially mediating a mesenchymal to epithelial transition which is
likely to impact on development of disease and ultimately patient survival.
In summary of the EMT regulators examined, Slug appears to be the only
transcription factor over-expressed in esophageal carcinogenesis. A
downstream consequence of Slug overexpression is likely to be silencing of E-
cadherin and ultimately in concert with other signalling molecules induction
of invasion and metastasis.

COMMENTS

23
Background
The incidence of esophageal adenocarcinoma is currently rising faster than
any other cancer in the Western world though the cause of this increase is
largely unknown. Progression of this disease is associated with a repression in
the cell adhesion molecule E-cadherin; a crucial event in invasion and
metastasis.

Research frontiers
E-cadherin silencing is a common event in nearly all epithelial malignancies
and in several cancers this is either due to mutation, gene deletion or
promoter methylation. However, how E-cadherin is silenced in esophageal
adenocarcinoma has not been unequivocally addressed. In this study, the
authors demonstrate that the overexpression of Slug could be a potential
mechanism for mediating E-cadherin repression.

Innovations and breakthroughs

Recent reports have highlighted the importance of epithelial mesenchymal
regulators including Snail, Slug and Twist in gastrointestinal carcinogenesis. In
particular in esophageal squamous cell cancers, Slug is over-expressed. This
is the first study to report that Slug is also over-expressed in esophageal
adenocarcinomas. Furthermore, our in vitro studies would suggest that this
protein may be the cause of the repression in E-cadherin observed in this
cancer.

Applications
By understanding how Slug is induced and by blocking its expression, this
study may represent a future strategy for therapeutic intervention in the
treatment of patients with esophageal adenocarcinoma.

24
Terminology
Slug, Snail and Twist are all proteins involved in the process called epithelial
mesenchymal transition. This is when epithelial cells lose cell-cell adhesion
and behave more like fibroblasts. Such a mechanism is thought to be crucial
in invasion and metastasis of cancer. Non-surprisingly, the cell adhesion
molecule E-cadherin is repressed during this process.

Peer review
The authors examined the expression of E-cadherin and its repressors; Snail,
Slug and Twist in squamous esophagus, Barrett’s metaplasia and esophageal
adenocarcinoma. It revealed that Slug was increased in adenocarcinoma and
in OE33 cells, the increase of Slug expression was inversely correlated to E-
cadherin expression (mRNA and promoter activity) and induced EMT. The
results are interesting and may represent a molecular mechanism of
esophageal carcinogenesis.

25
REFERENCES
1 Lagergren J. Adenocarcinoma of oesophagus: what exactly is the size of the problem
and who is at risk? Gut 2005; 54 Suppl 1: i1-i5 doi:10.1136/gut.2004.041517
PMID:15711002
2 Jankowski JA, Harrison RF, Perry I, Balkwill F, Tselepis C. Barrett's metaplasia. Lancet
2000; 356: 2079-2085 doi:10.1016/S0140-6736(00)03411-5
3 Koppert LB, Wijnhoven BP, van Dekken H, Tilanus HW, Dinjens WN. The molecular
biology of esophageal adenocarcinoma. J Surg Oncol 2005; 92: 169-190
doi:10.1002/jso.20359 PMID:16299787
4 Bongiorno PF, al-Kasspooles M, Lee SW, Rachwal WJ, Moore JH, Whyte RI, Orringer MB,
Beer DG. E-cadherin expression in primary and metastatic thoracic neoplasms and in
Barrett's oesophagus. Br J Cancer 1995; 71: 166-172
5 Swami S, Kumble S, Triadafilopoulos G. E-cadherin expression in gastroesophageal
reflux disease, Barrett's esophagus, and esophageal adenocarcinoma: an
immunohistochemical and immunoblot study. Am J Gastroenterol 1995; 90: 1808-
1813
6 Bailey T, Biddlestone L, Shepherd N, Barr H, Warner P, Jankowski J. Altered cadherin
and catenin complexes in the Barrett's esophagus-dysplasia-adenocarcinoma
sequence: correlation with disease progression and dedifferentiation. Am J Pathol
1998; 152: 135-144
7 Takeichi M. Cadherin cell adhesion receptors as a morphogenetic regulator. Science
1991; 251: 1451-1455 doi:10.1126/science.2006419 PMID:2006419
8 Takeichi M. Cadherins in cancer: implications for invasion and metastasis. Curr Opin
Cell Biol 1993; 5: 806-811 doi:10.1016/0955-0674(93)90029-P PMID:8240824
9 Birchmeier W, Behrens J. Cadherin expression in carcinomas: role in the formation of
cell junctions and the prevention of invasiveness. Biochim Biophys Acta 1994; 1198:
11-26
10 Behrens J. Cadherins and catenins: role in signal transduction and tumor progression.
Cancer Metastasis Rev 1999; 18: 15-30 doi:10.1023/A:1006200102166
PMID:10505543
11 Wijnhoven BP, de Both NJ, van Dekken H, Tilanus HW, Dinjens WN. E-cadherin gene
mutations are rare in adenocarcinomas of the oesophagus. Br J Cancer 1999; 80:
1652-1657 doi:10.1038/sj.bjc.6690577 PMID:10408414
12 Eads CA, Lord RV, Kurumboor SK, Wickramasinghe K, Skinner ML, Long TI, Peters JH,
DeMeester TR, Danenberg KD, Danenberg PV, Laird PW, Skinner KA. Fields of aberrant
CpG island hypermethylation in Barrett's esophagus and associated adenocarcinoma.
Cancer Res 2000; 60: 5021-5026
13 De Craene B, van Roy F, Berx G. Unraveling signalling cascades for the Snail family of

26
 transcription factors. Cell Signal 2005; 17: 535-547 doi:10.1016/j.cellsig.2004.10.011
PMID:15683729
14 Barrallo-Gimeno A, Nieto MA. The Snail genes as inducers of cell movement and
survival: implications in development and cancer. Development 2005; 132: 3151-3161
doi:10.1242/dev.01907 PMID:15983400
15 Kang Y, Massague J. Epithelial-mesenchymal transitions: twist in development and
metastasis. Cell 2004; 118: 277-279 doi:10.1016/j.cell.2004.07.011 PMID:15294153
16 Batlle E, Sancho E, Franci C, Dominguez D, Monfar M, Baulida J, Garcia De Herreros A.
The transcription factor snail is a repressor of E-cadherin gene expression in epithelial
tumour cells. Nat Cell Biol 2000; 2: 84-89 doi:10.1038/35000034 PMID:10655587
17 Bolos V, Peinado H, Perez-Moreno MA, Fraga MF, Esteller M, Cano A The transcription
factor Slug represses E-cadherin expression and inducesepithelial to mesenchymal
transitions: a comparison with Snail and E47repressors. J Cell Sci 2003; 116: 499-511
doi:10.1242/jcs.00224 PMID:12508111
18 Castro Alves C, Rosivatz E, Schott C, Hollweck R, Becker I, Sarbia M, Carneiro F,
Becker KF. Slug is overexpressed in gastric carcinomas and may act synergistically
with SIP1 and Snail in the down-regulation of E-cadherin. J Pathol 2007; 211: 507-515
doi:10.1002/path.2138 PMID:17299729
19 Shioiri M, Shida T, Koda K, Oda K, Seike K, Nishimura M, Takano S, Miyazaki M. Slug
expression is an independent prognostic parameter for poor survival in colorectal
carcinoma patients. Br J Cancer 2006; 94: 1816-1822 doi:10.1038/sj.bjc.6603193
PMID:16773075
20 Ohuchida K, Mizumoto K, Ohhashi S, Yamaguchi H, Konomi H, Nagai E, Yamaguchi K,
Tsuneyoshi M, Tanaka M. Twist, a novel oncogene, is upregulated in pancreatic cancer:
clinical implication of Twist expression in pancreatic juice. Int J Cancer 2007; 120:
1634-1640 doi:10.1002/ijc.22295
21 Brookes MJ, Hughes S, Turner FE, Reynolds G, Sharma N, Ismail T, Berx G, McKie AT,
Hotchin N, Anderson GJ, Iqbal T, Tselepis C. Modulation of iron transport proteins in
human colorectal carcinogenesis. Gut 2006; 55: 1449-1460
doi:10.1136/gut.2006.094060 PMID:16641131
22 Di Martino E, Wild CP, Rotimi O, Darnton JS, Olliver RJ, Hardie LJ. IGFBP-3 and IGFBP-10
(CYR61) up-regulation during the development of Barrett's oesophagus and
associated oesophageal adenocarcinoma: potential biomarkers of disease risk.
Biomarkers 2006; 11: 547-561 doi:10.1080/13547500600896791 PMID:17056474
23 Rockett JC, Larkin K, Darnton SJ, Morris AG, Matthews HR. Five newly established
oesophageal carcinoma cell lines: phenotypic and immunological characterization. Br
J Cancer 1997; 75: 258-263
24 Hughes SJ, Nambu Y, Soldes OS, Hamstra D, Rehemtulla A, Iannettoni MD, Orringer
MB, Beer DG. Fas/APO-1 (CD95) is not translocated to the cell membrane in
esophageal adenocarcinoma. Cancer Res 1997; 57: 5571-5578
25 Boonstra JJ, van der Velden AW, Beerens EC, van Marion R, Morita-Fujimura Y, Matsui
Y, Nishihira T, Tselepis C, Hainaut P, Lowe AW, Beverloo BH, van Dekken H, Tilanus
HW, Dinjens WN. Mistaken identity of widely used esophageal adenocarcinoma cell
line TE-7. Cancer Res 2007; 67: 7996-8001 doi:10.1158/0008-5472.CAN-07-2064

27
 PMID:17804709
26 Turner FE, Broad S, Khanim FL, Jeanes A, Talma S, Hughes S, Tselepis C, Hotchin NA.
Slug regulates integrin expression and cell proliferation in human epidermal
keratinocytes. J Biol Chem 2006; 281: 21321-21331 doi:10.1074/jbc.M509731200
PMID:16707493
27 Rosivatz E, Becker I, Specht K, Fricke E, Luber B, Busch R, Hofler H, Becker KF.
Differential expression of the epithelial-mesenchymal transition regulators snail, SIP1,
and twist in gastric cancer. Am J Pathol 2002; 161: 1881-1891
28 Uchikado Y, Natsugoe S, Okumura H, Setoyama T, Matsumoto M, Ishigami S, Aikou T.
Slug Expression in the E-cadherin preserved tumors is related to prognosis in patients
with esophageal squamous cell carcinoma. Clin Cancer Res 2005; 11: 1174-1180
29 Yuen HF, Chan YP, Wong ML, Kwok WK, Chan KK, Lee PY, Srivastava G, Law SY, Wong
YC, Wang X, Chan KW. Upregulation of Twist in oesophageal squamous cell carcinoma
is associated with neoplastic transformation and distant metastasis. J Clin Pathol
2007; 60: 510-514 doi:10.1136/jcp.2006.039099 PMID:16822877
30 Rosivatz E, Becker KF, Kremmer E, Schott C, Blechschmidt K, Hofler H,Sarbia M.
Expression and nuclear localization of Snail, an E-cadherin repressor, in
adenocarcinomas of the upper gastrointestinal tract. Virchows Arch 2006; 448: 277-
287 doi:10.1007/s00428-005-0118-9 PMID:16328348
31 Yang Z, Rayala S, Nguyen D, Vadlamudi RK, Chen S, Kumar R. Pak1 phosphorylation of
snail, a master regulator of epithelial-to-mesenchyme transition, modulates snail's
subcellular localization and functions. Cancer Res 2005; 65: 3179-3184
32 Parent AE, Choi C, Caudy K, Gridley T, Kusewitt DF. The developmental transcription
factor slug is widely expressed in tissues of adult mice. J Histochem Cytochem 2004;
52: 959-965 doi:10.1369/jhc.4A6277.2004 PMID:15208362
33 Bermejo-Rodriguez C, Perez-Caro M, Perez-Mancera PA, Sanchez-Beato M, Piris MA,
Sanchez-Garcia I. Mouse cDNA microarray analysis uncovers Slug targets in mouse
embryonic fibroblasts. Genomics 2006; 87: 113-118 doi:10.1016/j.ygeno.2005.09.014
PMID:16311016
34 Kajita M, McClinic KN, Wade PA. Aberrant expression of the transcription factors snail
and slug alters the response to genotoxic stress. Mol Cell Biol 2004; 24: 7559-7566
doi:10.1128/MCB.24.17.7559-7566.2004 PMID:15314165
35 Thiery JP, Sleeman JP. Complex networks orchestrate epithelial-mesenchymal
transitions. Nat Rev Mol Cell Biol 2006; 7: 131-142 doi:10.1038/nrm1835
PMID:16493418
36 Bienz M. beta-Catenin: a pivot between cell adhesion and Wnt signalling. Curr Biol
2005; 15: R64-R67 doi:10.1016/j.cub.2004.12.058 PMID:15668160
37 Soslow RA, Petersen CG, Remotti H, Altorki N. Acidic fibroblast growth factor is
expressed sequentially in the progression from Barrett's esophagus to esophageal
adenocarcinoma. Dis Esophagus 2001; 14: 23-27 doi:10.1111/j.1442-
2050.2001.00146.x PMID:11422301
38 von Rahden BH, Stein HJ, Feith M, Puhringer F, Theisen J, Siewert JR, Sarbia M.
Overexpression of TGF-beta1 in esophageal (Barrett’s) adenocarcinoma is associated
with advanced stage of disease and poor prognosis. Mol Carcinog 2006; 45: 786-794

28
 doi:10.1002/mc.20259 PMID:16921482
39 Clement G, Braunschweig R, Pasquier N, Bosman FT, Benhattar J Alterations of the
Wnt signaling pathway during the neoplastic progression of Barrett’s esophagus.
Oncogene 2006; 25: 3084-3092 doi:10.1038/sj.onc.1209338 PMID:16407829

S-Editor L-Editor E-Editor

Figure 1 Immunolocalisation of Slug, Snail and Twist in normal

esophagus, intestinal type Barrett’s metaplasia and oesophageal
adenocarcinoma. Normal squamous esophagus (S), intestinal type
Barrett’s metaplasia (BM) and esophageal adenocarcinoma (ADC)
were subjected to immunohistochemistry using antibodies to Slug,
Snail and Twist. Arrows denote areas of positivity (x 20, x 40).

Figure 2 Co-immunofluoresence of Slug and E-cadherin in Barrett’s

metaplasia and esophageal adenocarcinoma. Sections of Barrett’s
metaplasia (BM) mostly demonstrate preserved cell border E-
cadherin (Texas Red) immunoreactivity consistent with its role in
cell-cell adhesion. Slug (FITC) immunoreactivity in BM however was
minimal and appeared non specific. Conversely in sections of
adenocarcinoma (ADC) in areas of abundant Slug immunoreactivity,
there was negligible E-cadherin immunoreactivity. DAPI staining was

29
used to highlight nuclei in sections (x 40).

Figure 3 mRNA expression of E-cadherin, Slug, Snail and Twist in

esophageal adenocarcinoma. Real time RT-PCR was employed to
examine the expression of E-cadherin, Slug, Snail and Twist in ten
esophageal adenocarcinoma specimens (ADC1-ADC10) each
compared to Barrett’s metaplastic tissue collected from the same
resection specimen. Barrett’s metaplastic tissue control (BM),
normalised to 1.0.

Figure 4 Correlation of E-cadherin and Slug mRNA expression in

esophageal adenocarcinoma specimens. Using linear regression
analysis, Slug mRNA expression was demonstrated to be negatively
correlated with E-cadherin expression in the ten adenocarcinoma
specimens examined (ADC1-10) (R2 0.677, P＜ 0.03).

Figure 5 Overexpression of Slug in the esophageal adenocarcinoma

derived cell line OE33. Cell line OE33 was transiently transfected
with either full length human Slug-GFP vector (OE33 Slug-GFP) or
with the control empty GFP vector (OE33 Empty). 24 h post
transfection. A: Slug mRNA; B: GFP protein expression was determined. CK-
19 was used as an epithelial control. aP＜0.05 using Student’s t test.

Figure 6 The effect of Slug overexpression on proteins implicated in

EMT. Expression of E-cadherin, beta-catenin, fibronectin and
vimentin were all examined in Slug over-expressing (OE33 Slug-GFP)
and control cells (OE33 empty-GFP). Lysates were normalised using
GFP expression.

30
Figure 7 Slug expression causes a decrease in E-cadherin promoter
activity and mRNA expression. A: OE33 cells transfected with full length
human Slug (Slug) showed decreased E-cadherin promoter activity compared
to sham transfected control cells. Promoter activity was expressed as a fold
change in relative luciferase units (RLU) compared to control cells. Results
represent the means  SE of three independent experiments. aP＜0.05 using
Student’s t test; B: Expression of E-cadherin mRNA in Slug over-expressing
cells (Slug) was also repressed in comparison to control cells (control).
Relative gene expression was normalised to 1.0 (100%) of controls. Error bars
= 2 mean ± SE. cP <0.05 using Student’s t test. These data are the mean of
three independent experiments.

Table 1 Semi-quantitative analysis of Snail, Slug and Twist in

malignant progression of Barrett’s metaplasia to adenocarcinoma
(Immunoreactivity score)

S BM (-ve) BM (+ve) ADC

Snail 2.4 2.5 2.9 8.7a
Slug 6.7 2.6 3.5 10.5a,c
Twist 4.5 4.7 5.2 7.1

31
Semi-quantitative analysis of immunoreactivity for Snail, Slug and Twist in
specimens of squamous esophagus (S); Intestinal type Barrett’s metaplasia
without associated adenocarcinoma BM (-ve), intestinal Barrett’s metaplasia
with associated adenocarcinoma BM (+ve) and esophageal adenocarcinoma
(ADC). The mean staining scores were calculated for each type of mucosa and
the mean fold change in protein expression was calculated. adenotes
significant (aP＜0.05) differences between adenocarcinoma and intestinal type
Barrett’s metaplasia without associated adenocarcinoma. cdenotes significant
(c
P ＜ 0.05) differences between adenocarcinoma and intestinal type Barrett’s
metaplasia with associated adenocarcinoma.

32