BIOLOGY AND HEALTH SCIENCES EXERCISES FOR S6 PCB & BCG (ALL) S/Y 2020

Q1. Nowadays, the world generally and our country particularly is facing the negative effects of a
pandemic disease which is taking away the lives of many people worldwide. WHO and ministry of health
in our country have suggested different ways to prevent the contamination of this disease.
a. Write the name of this pandemic disease
b. What is its causing agent?
c. Outline all healthy practices that you are required to carry out in order to prevent this
disease

Q2. A.Define the term biodiversity

b. If the ecosystem A has greater Simpson’ s diversity index than that of the ecosystem B, what does
this tell us about their diversity and stability?

Q3. A. After explaining how the enzymes concentration affect the rate off enzyme catalyzed reaction,
draw the curve that illustrate it and precise the limiting factor
b. Explain the end product inhibition of an enzyme

Q4. Complete the following paragraph by filling in the blank spaces.Note: Don’ t copy the text. Write
the number and corresponding word only. The text will not be marked. /4marks

Blood is ………1………in the lungs where the partial pressure of Oxygen rises. The red pigment called
………2………has a high affinity for oxygen. The pumping action of the………3……creates pressure which
pushes the blood around the body. In the tissues the partial pressure of……4……….is low. This causes the
………5………of the oxyhaemoglobin. In the tissues, the oxygen is used in the process of…………6………….
For production of ………7……. To be used in ……8……..reactions.

Q5. Copy and complete the table given below which compares the structure of a typical plant, animal and
prokaryotic cell. Use a tick (ⱱ) if the feature is present and a cross (X) if it is absent.

Features Plant cell Animal cell Prokaryotic cell

Nucleolus

Plasmid

Mitochondria
Cellulose wall

Q6. In a healthy adult human, the amount of haemoglobin in 1 dm3 of blood is about 150 g. Given that 1
g of pure haemoglobin can combine with 1.3 cm3 of oxygen at body temperature, how much oxygen can
be carried in 1 dm3 of blood?

Q7. The diagram summarizes how glucose can be used to produce ATP, without the use of oxygen

Which compounds are represented by the letters X, Y and Z?

Q8. Complete the table below for cellular respiration in mammals:
Input(s) Output(s) Location in
cell/organelle
Glycolysis
Fermentation
Transitional stage
Citric acid cycle
Respiratory chain

Q9. Suggest a reason for each of the following:

a) The right atrium is larger than the left atrium.

b) The left ventricle has a thicker more muscular wall than the right ventricle.
Q10. Explain any two advantages of closed double circulatory system and two disadvantages of open
circulatory system.
Q11. Observe the figure and answer the following questions:

a) What does it represent?

b) Give the names of the parts denoted by the letters A, B and C.
 c) What might happen to living organisms if the above molecules are not present?
Q12.Using the following equation of an organic compound:

2C18H34O2 + 51O2 36CO2 + 34H2O.

a) Calculate the RQ for the complete aerobic respiration.

b) Based on your findings, state which substrate is being respired.

Q13. Complete the tables below to differentiate close and open circulations, and single and double
circulations:

a)

Closed circulation Open circulation

b)

Single circulation Double circulation

Q14. Observe the illustration below and answer to the following questions:

a) Describe the shape of the electrocardiogram trace above.

b) Explain why the QRS complex has a larger peak than the P wave.

Q15. The table below shows the cell composition of three samples of blood.

Sample from
Cells number per mm3 Peter John Joseph
Red blood cells 6.000.000 5.000.000 2.000.000
White blood cells 500 6.000 5.000
Platelets 200.000 220.000 500

a) Identify a person who is most likely to have lived at high altitude recently. Explain your answer.
 b) Which person would be the most likely to become ill if exposed to pathogens? Justify your
answer.

c) Which person’ s blood is least likely to clot efficiently if injured? Justify your answer.

Q16. a) Mount Everest is nearly 9000 m high. The partial pressure of oxygen in the alveoli at this height
is only about 2.5 kPa. Explain what effect this would have on the supply of oxygen to body cells if a
person climbed to the top of Mount Everest without a supplementary oxygen supply.

b) Explain how an increase in the number of red blood cells can help to compensate for the lack of
oxygen in the air at high altitude.

Q17. Complete the table below to differentiate between photosynthesis and cellular respiration:

Photosynthesis Cellular Respiration

Overall reaction
Reactants
Products
Waste products

Q18. Copy and complete the table below to show how much ATP is used and produced for each
molecule of glucose respired in the various stages of respiration.

ATP used ATP produced Net gain in ATP

Glycolysis
Link reaction
Krebs cycle
Oxidative
phosphorylation
Total

Q19. Observe the figure below and respond to the following questions.
 a) Identify the organs W, X, Y, Z shown on this figure.
b) Describe the functions of the organs W, X, Y, Z.
Q20. Choose and write ONLY the letter that best answers the question or completes the statement.

1) Before the Krebs cycle can proceed, pyruvic acid must be converted into
a) Citric acid, b) Glucose, C) Acetyl-CoA, d) Glucose, e) NADH.
2) The net number of ATP made directly by glycolysis is
a) 2, b) 6, c) 32, d) 38

3) Cellular respiration is similar to photosynthesis in that they both

a) Produce ATP, b) Involve chemiosmosis, c) Make phosphoglyceraldehyde (PGAL), d) All of the above
4) By accepting electrons and protons, the oxygen used in aerobic respiration turns into
a) CO2, b) H2O, c) C6H12O6, d) ATP

5) The Krebs cycle occurs in the

a) Cytosol, b) Outer mitochondrial membrane, c) Mitochondrial matrix d) Space between the inner and
outer mitochondrial membrane.
6) During each turn of the Krebs cycle,
a) Two CO2 molecules are produced, b) Two ATP molecules are consumed
c) Pyruvic acid combines with oxaloacetic acid, d) Glucose combines with a four-carbon molecule.

7) Most of the ATP synthesized in aerobic respiration is made

a) During glycolysis, b) Through fermentation, c) In the cytosol, d) Through chemiosmosis.
8) Most CO2 from catabolism is released during.

a) Glycolysis, b) Electron transport.

9) Blood returning to the mammalian heart in a pulmonary vein drains first into the:
a) Vena cava, b) Left ventricle, c) right ventricle, d) Left atrium.
10) The illustration below represents what stage of meiosis?
a) Metaphase I, b) prophase I, c) metaphase, d) metaphase II

11) The ribosome contains 4 binding sites such as: the A site, P site,E site and:
a) tRNA-binding site, b) mRNA-binding site, c) Peptidyl-tRNA binding site.
Provided with the sequence of mRNA: AUGUAUGCAAAACAUGGCCCACCUGCGAAGUGA, and
the genetic code, answer to the questions below:

12) The sequence of template DNA copied to make that mRNA is:
a) TACATACGTTTTGTACCGGGTGGACGCTACACT.
b) TACATACGTTTTGTACCGGGTGGACGCTTCACT.
c) TACATACCTTTTGTACCGGGTGGACGCTTCACT

13) The sequence of amino acids specified by that mRNA is:

a) Met-Tyr-Ala-Lys-His-Pro-Gly-Pro-Ala-Lys-stop
b) Met-Tyr-Ala-Lys-His-Pro-Gly-Ala-Pro-Lys-stop
c) Met-Tyr-Ala-Lys-His-Gly-Pro-Pro-Ala-Lys-stop.

14) How many Types of tRNA molecules that are involved to make the polypeptide from that mRNA?
a) 11, b) 10, c) 9, d) 7.

15) How many tRNA molecules that are involved to make the polypeptide from that mRNA?
a) 11, b) 10, c) 9, d) 7.
Q21. The figure below shows the process of formation of a polypeptide:

b) Name the structure represented by:

i) X= ………………………ii) Y= ……………………… iii) Z= …………………….……….

b) In which direction (From X to Z or from Z to X) are the ribosomes moving?

c) Explain how you were able to decide on their direction of movement

Q22. a) Copy and complete the table to distinguish between the process of transcription and translation:
The factors transcription Translation

Site of the process in cell

Molecule used as template in the process

Molecule produced by the process

Components molecules (monomers) used in the

process

Q23. You have a solution which you are told that it contains sugar but you do not know whether it is a
Reducing sugar, non-reducing sugar or a mixture of both. How can you find out the précised type of
sugar?

Q24. a) Define the term mutation.

b) Describe briefly the types of mutations
c) Red-green colour blindness is sex-linked recessive condition. The gene for colour
blindness is canied on the X-chromosome. The figure below shows afamily tree. Work
out the genotypes of the individuals labeled A----E

Q25. The table below shows some information about energy transfer in three ecosystems

a) Calculate the figures for respiration by plants in alfalfa field, and the net primary
productivity of the young pine forest.
b) How much energy is available to the primary consumers, in the rain forest?
c) Suggest why the gross primary productivity of the rain forest is greater than that of
the pine forest.
d) Suggest why the net primary productivity of the alfalfa field is greater than that of the

rain forest.

Q26. Mendel crossed peas with round, green seeds to ones with wrinkled, yellow seeds. All Fl
plants had seeds that were round and yellow. Predict the results of test-crossing these Fl
Plants

Q27. Pure-breeding Drosophila with straight wings and grey bodies were crossed with pure-breeding
curled-wing, ebony-bodied flies. All the off spring were straight-winged and grey-bodied.
Female off spring were then test crossed with curled-wing, ebony-bodied males, giving the following
results:
straight wing, grey body 113
straight wing, ebony body 30
curled wing, grey body 29
curled wing, ebony body 115
a. State the ratio of phenotypes expected in a dihybrid test cross such as this.
b.Use Chi-square test to explain the discrepancy (difference) between the expected result and the results
given. ( See the attached chi-square distribution table and consider 99% confidence for your decisions)
c. Calculate the cross over value.
d . suggest the cause of this difference

MUGIRE AMAHORO KANDI MUKOMERE

 Chi-square Distribution Table

d.f. .995 .99 .975 .95 .9 .1 .05 .025 .01

1 0.00 0.00 0.00 0.00 0.02 2.71 3.84 5.02 6.63
2 0.01 0.02 0.05 0.10 0.21 4.61 5.99 7.38 9.21
3 0.07 0.11 0.22 0.35 0.58 6.25 7.81 9.35 11.34
4 0.21 0.30 0.48 0.71 1.06 7.78 9.49 11.14 13.28
5 0.41 0.55 0.83 1.15 1.61 9.24 11.07 12.83 15.09
6 0.68 0.87 1.24 1.64 2.20 10.64 12.59 14.45 16.81
7 0.99 1.24 1.69 2.17 2.83 12.02 14.07 16.01 18.48
8 1.34 1.65 2.18 2.73 3.49 13.36 15.51 17.53 20.09
9 1.73 2.09 2.70 3.33 4.17 14.68 16.92 19.02 21.67
10 2.16 2.56 3.25 3.94 4.87 15.99 18.31 20.48 23.21
11 2.60 3.05 3.82 4.57 5.58 17.28 19.68 21.92 24.72
12 3.07 3.57 4.40 5.23 6.30 18.55 21.03 23.34 26.22
13 3.57 4.11 5.01 5.89 7.04 19.81 22.36 24.74 27.69
14 4.07 4.66 5.63 6.57 7.79 21.06 23.68 26.12 29.14
15 4.60 5.23 6.26 7.26 8.55 22.31 25.00 27.49 30.58
16 5.14 5.81 6.91 7.96 9.31 23.54 26.30 28.85 32.00
17 5.70 6.41 7.56 8.67 10.09 24.77 27.59 30.19 33.41
18 6.26 7.01 8.23 9.39 10.86 25.99 28.87 31.53 34.81
19 6.84 7.63 8.91 10.12 11.65 27.20 30.14 32.85 36.19
20 7.43 8.26 9.59 10.85 12.44 28.41 31.41 34.17 37.57
22 8.64 9.54 10.98 12.34 14.04 30.81 33.92 36.78 40.29
24 9.89 10.86 12.40 13.85 15.66 33.20 36.42 39.36 42.98
26 11.16 12.20 13.84 15.38 17.29 35.56 38.89 41.92 45.64
28 12.46 13.56 15.31 16.93 18.94 37.92 41.34 44.46 48.28
30 13.79 14.95 16.79 18.49 20.60 40.26 43.77 46.98 50.89
32 15.13 16.36 18.29 20.07 22.27 42.58 46.19 49.48 53.49
34 16.50 17.79 19.81 21.66 23.95 44.90 48.60 51.97 56.06
38 19.29 20.69 22.88 24.88 27.34 49.51 53.38 56.90 61.16
42 22.14 23.65 26.00 28.14 30.77 54.09 58.12 61.78 66.21
46 25.04 26.66 29.16 31.44 34.22 58.64 62.83 66.62 71.20
50 27.99 29.71 32.36 34.76 37.69 63.17 67.50 71.42 76.15
55 31.73 33.57 36.40 38.96 42.06 68.80 73.31 77.38 82.29
60 35.53 37.48 40.48 43.19 46.46 74.40 79.08 83.30 88.38
65 39.38 41.44 44.60 47.45 50.88 79.97 84.82 89.18 94.42
70 43.28 45.44 48.76 51.74 55.33 85.53 90.53 95.02 100.43
75 47.21 49.48 52.94 56.05 59.79 91.06 96.22 100.84 106.39
80 51.17 53.54 57.15 60.39 64.28 96.58 101.88 106.63 112.33
85 55.17 57.63 61.39 64.75 68.78 102.08 107.52 112.39 118.24
90 59.20 61.75 65.65 69.13 73.29 107.57 113.15 118.14 124.12
95 63.25 65.90 69.92 73.52 77.82 113.04 118.75 123.86 129.97
100 67.33 70.06 74.22 77.93 82.36 118.50 124.34 129.56 135.81