Вы находитесь на странице: 1из 1

Проблемы медицинской микологии, 2020, Т.

22, №3

ным документам, с использованием масс-спектрометра Microflex «Bruker». Анти- TEINS


биотикорезистентность оценивали по клиническим рекомендациям EUCAST
(2015). Taraskina A.E.1, Boyko I.R.1, Sekretareva J.V.1, Shadrivova O.V.1, Borisova D.S.1,
Результаты. Изучено 34 штамма S. agalactiae, выделенных из влагалища Uspenskaya O.S.2, Schneider T.V.2, Frolova E.V.1, Vasilyeva N.V.1
и/или цервикального канала пациенток. Монокультура S. agalactiae обнаружена у 1North-Western State Medical University named after I.I. Mechnikov; 2Leningrad Re-

23,5% женщин; у 76,5% – микст-культура с Staphylococcus aureus, S. epidermidis, gional Clinical Hospital, St. Petersburg, Russia
Enterococcus faecium и Е. faecalis наблюдали у 17,6% обследованных; совместно с
грамотрицательной микробиотой (Klebsiella pneumoniae, Escherichia coli) – у 20,5%. Цель исследования – оценка вклада генетических вариантов, ассоцииро-
Колонизация с грибами рода Candida выявлена у 23,5% женщин. Высокоэффек- ванных с нарушениями Тх1, Тх17 адаптивного иммунного ответа, в риск развития
тивны в отношении S. agalactiae – β-лактамные антибиотики (от 95 % до 90,8% к инвазивного аспергиллеза легких (ИАЛ) у онкогематологических пациентов.
разным АМП), нитрофурантоин (85,29%). Чувствительность к хлорамфениколу Материалы и методы. В исследование было включено 211 иммунокомпро-
отмечали в 60%. Доля полирезистентных S. agalactiae – 8,82% изолятов. метированных онкогематологических пациентов на фоне цитостатической поли-
Выводы. Терапия носительства S. agalactiae – важный этап при подготовке к химиотерапии с подозрением на инвазивный аспергиллез легких (ИАЛ). У 92 лиц
ЭКО как эффективному методу лечения повторяющихся абортов. Согласно полу- диагноз «вероятный ИАЛ» был доказан в соответствии с критериями EORTC/MSG
ченным нами данным, β-лактамные АМП остаются препаратами выбора для про- 2008 г. Возраст пациентов с ИАЛ составил 47±17 [9-75] лет, распределение по
ведения терапии, так как обладают наибольшей активностью в отношении S. полу − 52,7% и 47,3%, мужчин и женщин соответственно. 109 больных с не под-
agalactiae. Однако монокультура S. agalactiae обнаружена только у 23,5% пациен- твержденным диагнозом ИАЛ составили группу контроля сопоставимую по воз-
ток, следовательно, носительство S. agalactiae не может быть рассмотрено в расту (48±15, [3-76]) и полу. Генотипирование генетических вариантов CXCL10 -
качестве единственного инфекционного фактора, провоцирующего повторяющиеся 1447 A/G (rs4508917), TNFA -308(-488) G/A (rs1800629), IL23R 1142 G/A
аборты и неонатальные инфекции. Необходим комплексный анализ генитального (Arg381Gln) (rs11209026), IL17F 11139 G/C (rs612242), TLR4 1363 (1196) C/T
микробиоценоза для выявления дополнительных этиологических факторов. (Thr399IIe) (rs4986791) проводили методом ПЦР в реальном времени с использо-
________________________________________ ванием аллель специфичных флуоресцентных зондов. Статистическую обработку
МЕТОДИКИ АНАЛИЗА КАЧЕСТВА ЖИЗНИ ЖЕНЩИН В ПОСЛЕРОДОВОМ ПЕ- данных осуществляли с использованием пакета программы SPSS версии 21 (IBM,
РИОДЕ ПРИ ЕСТЕСТВЕННОМ РОДОРАЗРЕШЕНИИ. СОСТОЯНИЕ ВОПРОСА USA): анализ распределения генотипов и аллелей между исследуемой группой с
ИАЛ и контролем выполняли при помощи критерия χ2.
Тараненко И.В., Любимова А.В. Результаты. Статистически значимых различий между контрольной группой
Северо-Западный государственный медицинский университет им. И.И. Мечнико- и пациентами с ИАЛ в распределении генотипов и аллелей для rs4508917,
ва, Санкт-Петербург, Россия rs11209026, rs612242 и rs4986791 достигнуто не было (р<0,05). Гетерозиготный
генотип GA генетического варианта TNFA rs1800629, расположенного в промо-
METHODS FOR ANALYZING THE QUALITY OF LIFE OF WOMEN IN THE POST- торной области гена и ассоциированного с продукцией цитокина (G аллель –
PARTUM PERIOD DURING NATURAL DELIVERY. STATUS OF THE ISSUE низкая продукция ФНО-α, А – высокая продукция), превалировал у пациентов с
ИАЛ (χ2=6,145, р=0,046). Частоты минорных аллелей практически совпадали для
Taranenko I.V., Lubimova A.V. всех изученных генетических вариантов с глобальными данными (источник
North-Western State Medical University named after I.I. Mechnikov, St. Petersburg, GMAF). Исключение составил rs1800629, фактор риска развития ИАЛ: частота
Russia минорной аллели А в изучаемых группах была выше, чем данные для глобальной
популяции (0,09): для лиц контрольной группы составила 0,12, пациентов с ИАЛ –
Цель исследования – определение оптимальной методики оценки качества 0,15.
жизни женщин в послеродовом периоде после акушерских пособий или травм Заключение. Генетический вариант TNFA rs1800629 оказывает вклад в раз-
мягких тканей родовых путей при естественном родоразрешении. витие ИАЛ. Дальнейшее расширение выборок анализируемых пациентов позво-
Материалы и методы. Проанализированы публикации и клинические реко- лит стратифицировать риск развития ИАЛ с большей достоверностью.
мендации, посвященные оценке качества жизни женщин в послеродовом перио- ________________________________________
де, в базах данных PUBMED, E-Library, Google Scholar и др. за 2015-2019 гг. МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЙ АНАЛИЗ ГЕНА ERG11, МУЛЬТИРЕЗИСТЕНТ-
Результаты. Исследований, направленных на изучение особенностей тече- НОГО К АЗОЛАМ ИЗОЛЯТА CANDIDA ALBICANS, − ВОЗБУДИТЕЛЯ ОСТРОГО
ния послеродового периода у женщин с акушерскими травмами и после малых ДИССЕМИНИРОВАННОГО КАНДИДОЗА
акушерских операций, крайне мало. Оценку состояния родильниц в послеродовом
периоде проводят по результатам лабораторных и инструментальных данных, что Тараскина А.Е.1, Сташук А.А.1, Пчелин И.М.1, Выборнова И.В.1, Богомолова
позволяет оценить только физическую составляющую. Методология оценки каче- Т.С.1, Добродеева В.С.2, Насырова Р.Ф.2, Шагдилеева Е.В.1, Васильева Н.В.1
ства жизни предполагает использование стандартизированных опросников, осве- 1Северо-Западный государственный медицинский университет им.
щающих как физиологическую, так и психо-эмоциональную сторону. Наиболее И.И. Мечникова; 2Национальный медицинский исследовательский центр психиат-
часто для оценки качества жизни женщин в послеродовом периоде используют рии и неврологии им. В.М. Бехтерева, Санкт-Петербург, Россия
Эдинбургская шкалу послеродовой депрессии (EPDS), опросник «Индекс женской
сексуальной функции» (FSFI), стандартный опросник SF-36, содержащий 8 (шкал): MOLECULAR GENETIC ANALYSIS OF THE ERG11 GENE IN PAN-AZOLE RE-
физическое здоровье, ролевая деятельность, телесная боль, общее здоровье, SISTANT CANDIDA ALBICANS CAUSING ACUTE DISSEMINATED CANDIDIASIS
жизнеспособность, социальная активность, эмоциональное состояние и психиче-
ское здоровье. Для формирования единого представления о психо- Taraskina A.E.1, Stashuk A.A.1, Pchelin I.M.1, Vybornova I.V.1, Bogomolova T.S.1,
эмоциональном здоровье родильницы, ее субъективном восприятии себя, оценки Dobrodeeva V.S.2, Nasyrova R.F.2, Shagdileeva E.V.1, Vasilyeva N.V.1
половой функции, наличии осложнений в послеродовом периоде необходимо 1North-Western State Medical University named after I.I. Mechnikov; 2V.M. Bekhterev
проводить анкетирование с помощью нескольких опросников одновременно. National Medical Research Center Psychiatry & Neurology, St. Petersburg, Russia
Многие из них содержат более 30 вопросов, а иногда и несколько разделов, что
может вызвать у пациентки негативную реакцию на длительный опрос и отказ от Препараты азольного ряда – противогрибковые средства терапии первой ли-
участия в исследовании. Использование нескольких методик одновременно сни- нии против инфекционных патологий, вызванных представителями рода Candida.
жает качество и достоверность анализируемой информации, так как единых Механизм действия азолов состоит в конкурентном связывании с ферментом
критериев и шкалы оценки для применяемых видов опросников не существует. семейства цитохромов P450 ланостерол 14 альфа-деметилазой (cyp51А), катали-
Выводы. Необходима разработка специальных опросников, специфичных зирующим биосинтез эргостерола (ключевого компонента клеточной стенки гри-
для отдельных состояний женщин в послеродовом периоде после акушерских ба). Несинонимичные нуклеотидные замены гена ERG11, кодирующем cyp51А,
пособий или травм мягких тканей родовых путей при естественном родоразреше- приводят к нарушению аффинитета фермента к азолам и приобретению микро-
нии. мицетом устойчивости к противогрибковым препаратам.
________________________________________ Цель – изучение нуклеотидного полиморфизма ERG11 мультирезистентного
МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЕ МАРКЕРЫ РИСКА РАЗВИТИЯ ИНВАЗИВНО- к азолам клинического изолята C. albicans − возбудителя острого диссеминиро-
ГО АСПЕРГИЛЛЕЗА ЛЕГКИХ: ФОКУС НА БЕЛКИ ИММУННОЙ СИСТЕМЫ ванного кандидоза.
Материалы и методы. В исследование включен клинический изолят
Тараскина А.Е.1, Бойко И.Р.1, Секретарева О.В.1, Шадривова О.В.1, Борисова C. albicans, выделенный из крови и ран новорожденного с низкой массой тела −
Д.С.1, Успенская О.С.2, Шнейдер Т.В.2, Фролова Е.В.1, Васильева Н.В.1 пациента ОРИТ. Видовая принадлежность подтверждена секвенирования региона
1Северо-Западный государственный медицинский университет им. И.И. Мечнико-
ITS. Чувствительность к противогрибковым препаратам определена с помощью
ва; 2Ленинградская областная клиническая больница, Санкт-Петербург, Россия коммерческой тест-системы SensititreTM YeastOne YO10 (Thermo Fisher Scientific,
США). Для амплификации гена ERG11 использованы оригинальные праймеры
MOLECULAR GENETIC MARKERS OF RISK FOR THE DEVELOPMENT OF INVA- CaERG11orf_F AGACAAAGAAAGGGAATTCAATCGT, CaERG11orf_R
SIVE PULMONARY ASPERGILLOSIS: FOCUS ON THE IMMUNE SYSTEM PRO- TGAATCGAAAGAAAGTTGCCGT. Секвенирование осуществлено с использовани-

134

Оценить