Вы находитесь на странице: 1из 62

СП Е Ц В ЫП У С К

Tом 37
МОСКВА Vol. 37
ISSN 0208-0613
Институт молекулярной генетики РАН https://doi.org/10.17116/molgen2019s-tez

Молекулярная генетика, микробиология


и вирусология — научно-теоретический журнал
Выходит 4 раза в год

2019
Основан в январе 1983 года

Статьи, публикуемые в журнале, полностью


переводятся на английский язык и публикуются
в США издательством ALLERTON PRESS, INC. Том 37
Сведения о статьях, публикуемых в журнале, раз- Спецвыпуск
мещаются в следующих российских и международ-
ных базах данных и информационно-справочных
изданиях: Academic OneFile, BIOSIS, Biological Н А У Ч Н О-Т Е О Р Е Т И Ч Е С К И Й Ж У Р Н А Л
Abstracts, CSA, EMBASE, Expanded Academic,
Google Scholar, Health Reference Center Academic,
Journal Citation Reports/Science Edition (интегри-
рован в поисковую платформу Web of Science),
РЕДАКЦИОННАЯ КОЛЛЕГИЯ
OCLC, SCImago, SCOPUS, Science Citation Index
Expanded (SciSearch), Summon by ProQuest, РИНЦ.
Главный редактор С.В. КОСТРОВ
Издательство «Медиа Сфера»: Зам. гл. редактора Ю.М. РОМАНОВА
127238 Москва,
Дмитровское ш., д. 46, корп. 2, этаж 4 Ответственный секретарь Т.С. ИЛЬИНА
Тел.: (495) 482-4329
Факс: (495) 482-4312
E-mail: info@mediasphera.ru
www.mediasphera.ru В.И. АГОЛ, А.Д. АЛЬТШТЕЙН, А.П. АНИСИМОВ ,
Адрес для корреспонденции: В.А. ГВОЗДЕВ, В.Н. ГЕРШАНОВИЧ, А.Л. ГИНЦБУРГ,
127238 Москва, а/я 54, «Медиа Сфера»
Отдел рекламы: (495) 482-0604
И.В. ДЕМИДЮК, В.В. ДЕМКИН,
E-mail: reklama@mediasphera.ru A.V. KARLYSHEV (UK), С.А. ЛИМБОРСКАЯ,
Отдел подписки: (495) 482-5336
E-mail: zakaz@mediasphera.ru С.А. ЛУКЬЯНОВ, V.L. MOTIN (USA),
Н.Ф. МЯСОЕДОВ, С.В. НЕТЕСОВ, Е.Д. СВЕРДЛОВ,
Редакция не несет ответственности за содержание ре-
кламных материалов. Точка зрения авторов может не
Г.Б. СМИРНОВ, Н.И. СМИРНОВА,
совпадать с мнением редакции. К публикации при- В.З. ТАРАНТУЛ, М.М. ШМАРОВ
нимаются только статьи, подготовленные в соответ-
ствии с правилами для авторов. Направляя статью в
редакцию, авторы принимают условия договора пу-
бличной оферты. С правилами для авторов и догово-
ром публичной оферты можно ознакомиться на сай- РЕДАКЦИОННЫЙ СОВЕТ
те: www.mediasphera.ru. Полное или частичное вос-
произведение материалов, опубликованных в
журнале, допускается только с письменного разре- А.М. БОРОНИН (Пущино-на-Оке),
шения издателя — издательства «Медиа Сфера».
А.А. ПРОЗОРОВ (Москва),
Адрес редакции: С.В. ШЕСТАКОВ (Москва)
127238 Москва, а/я 54, «Медиа Сфера», редакция
журнала «Молекулярная генетика, микробиоло-
гия и вирусология»
Тел.: +7 (905) 739-3435
e-mail: molgenetika@yandex.ru
Зав. редакцией И.Х. Измайлова

Оригинал-макет изготовлен
издательством «Медиа Сфера»
Компьютерный набор и верстка:
О.В. Ненашева, Е.Л. Коган

Решением Высшей аттестационной комиссии (ВАК) Министерства образования и науки РФ


журнал «Молекулярная генетика, микробиологии и вирусология» включен в Перечень веду-
Индекс по каталогу агентства «Роспечать» 71452 щих рецензируемых научных журналов и изданий, выпускаемых в Российской Федерации,
Подписано в печать
в которых рекомен­дована публикация основных результатов диссертационных исследований
Формат 60×90 1/8. Тираж 1500 экз. на соискание ученых степеней доктора и кандидата наук.
Усл. печ. л. 6. Заказ 5356
Отпечатано в ООО «ПКФ СОЮЗ-ПРЕСС» Издательство МЕДИА СФЕРА Москва • MEDIA SPHERA Publishing GROUP Moscow
VIII МЕЖДУНАРОДНАЯ ШКОЛА
МОЛОДЫХ УЧЕНЫХ ПО МОЛЕКУЛЯРНОЙ ГЕНЕТИКЕ
«ГЕНЕТИЧЕСКАЯ ОРГАНИЗАЦИЯ
И МОЛЕКУЛЯРНЫЕ МЕХАНИЗМЫ
ФУНКЦИОНИРОВАНИЯ ЖИВЫХ СИСТЕМ»

Тезисы докладов

НАЦИОНАЛЬНЫЙ МИНИСТЕРСТВО
ИССЛЕДОВАТЕЛЬСКИЙ ЦЕНТР НАУКИ И ВЫСШЕГО
«КУРЧАТОВСКИЙ ИНСТИТУТ» ОБРАЗОВАНИЯ ИНСТИТУТ
МОЛЕКУЛЯРНОЙ ГЕНЕТИКИ РАН

При финансовой поддержке

БЛАГОТВОРИТЕЛЬНОГО ФОНДА
«БУДУЩЕЕ МОЛЕКУЛЯРНОЙ ГЕНЕТИКИ»
РОССИЙСКОГО ФОНДА ФУНДАМЕНТАЛЬНЫХ ИССЛЕДОВАНИЙ
ООО «ДИАЭМ»

19—23 ноября 2018 г.

МОСКВА — ЗВЕНИГОРОД
ОРГАНИЗАЦИОННЫЙ КОМИТЕТ

Сопредседатели Оргкомитета:
М.В. Ковальчук, член-корреспондент РАН
Е.Д. Свердлов, академик РАН
Заместители председателей Оргкомитета:
С.В. Костров, член-корреспондент РАН

С.А. Лимборская, доктор биологических наук, профессор


В.А. Гвоздев, академик РАН
В.Г. Дебабов, академик РАН
Н.Ф. Мясоедов, академик РАН
В.О. Попов, член-корреспондент РАН
Л.Е. Андреева
И.В. Бойцова
Р.Г. Василов
Л.В. Дергунова
Т.А. Коломин
А.Л. Коневега
А.В. Кульбачинский
Ю.А. Пухова
Р.А. Санду
П.А. Сломинский
И.В. Спорыхина
В.В. Ставчанский
Т.В. Тупицына
И.Б. Филиппенков
А.В. Хрунин
Г.В. Хворых
А.С. Яненко
Содержание
ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

Агапов А.А., Есюнина Д.М., Кульбачинский А.В.


Регуляция работы РНК-полимеразы радиоустойчивой бактерии Deinococcus radiodurans
на поврежденных ДНК-матрицах....................................................................................................................................... 11

Адашев В.Е., Котов А.А., Годнеева Б.К., Оленкина О.М., Оленина Л.В.
Изучение роли РНК-хеликазы Belle в сперматогенезе Drosophila melanogaster................................................................. 11

Акимов В.Э., Дмитриева В.Г., Дергунова Л.В., Хрунин А.В.


Геномный и транскриптомный анализ потенциальных маркеров болезни Альцгеймера................................................ 11

Алексеева Л.М., Узун М.М., Козяева В.В., Сухачева М.В., Патутина Е.О., Слободова Н.В., Груздев Д.С.
Использование маркерного гена mamK для изучение разнообразия магнитотактических бактерий.............................. 12

Аликина О.В., Глазунова О.А., Сырочева А.О., Шавкунов К.С., Озолинь О.Н.
Модельный перенос генов в геном кишечной палочки вызвал адаптивный ответ на уровне экспрессии
перенесенных генов и ускоренный локальный мутагенез................................................................................................. 12

Андреева А.А., Барадиева Э.Ц., Шрам С.И.


Фенотипирование дифференцированных клеток кардиомиобластов крысы H9c2
с использованием морфологических и иммуноцитохимических критериев.................................................................... 12

Андреюшкова Д.А., Лисачев А.П., Трифонов В.А.


Получение хромосомспецифичных библиотек быстрой ящурки,
Eremias velox (семейство Настоящие ящерицы).................................................................................................................. 13

Анучина А.А., Лавров А.В., Смирнихина С.А.


Исследование механизмов активации направленной гомологичной репарации
через Tudor-взаимодействующий регулятор TIRR............................................................................................................. 13

Артыков А.А., Яголович А.В., Гаспарян М.Э.


Новый способ получения белка DR5-B V114C на основе противоопухолевого цитокина TRAIL.................................. 14

Астапенко А.В., Аммур Ю.И., Файзулоев Е.Б.


Разработка метода количественного определения штамма «Москва» реовируса на основе ПЦР с детекцией
в режиме реального времени............................................................................................................................................... 14

Ахмедзянова М.
Сравнение этиологии возникновения рака молочной железы и рака прямой кишки..................................................... 14

Базылев С.С., Адашев В.Е., Годнеева Б.К., Котов А.А., Аравин А.А., Оленина Л.В.
Участие piРНК-сайленсинга в межвидовой репродуктивной изоляции у Drosophila....................................................... 15

Бахчеван Е.Л., Борисова О.В.


Генетические формы тромбофилии — возможный маркер осложнений при заместительной
гормональной терапии у женщин в климактерическом периоде...................................................................................... 15

Бахшиев А.Г.
Влияние метеорологических условий на распространение фитоплазмы у томатов......................................................... 15

Башинская В.В., Коляда А.К., Мурланова Е.В., Борисович Ю.Г., Загородняя О.А., Дарвишов Н.Р., Мосейко В.В.,
Осичанская Д.П., Вайсерман А.М.
Поиск генетических факторов риска аддиктивного поведения на примере курения...................................................... 16

Бебякова Н.А., Куба А.А., Хромова А.В.


Ассоциация полиморфизма -786 T>C гена NOS3 с артериальной гипертензией у пожилых мужчин............................ 16

Бейлин А.К., Чермных Э.С., Щепетов Д.М., Воротеляк Е.А.


Выявление причины мутантного фенотипа мышей wellhaarig (we)................................................................................... 16

Бибиков Н.М., Семенова М.В., Рубцова Е.А., Короткова О.Г.


Создание химерной эндоглюканазы II, содержащей целлюлозосвязывающий домен,
в штамме Penicillium canescens, и изучение свойств продукта............................................................................................. 17

4 © Медиа Сфера, 2019


Бобохужаев Ш.У., Абдукаримов Ш.С., Макамов А.Х., Санамьян М.Ф.
Идентификация анеуплоидных гибридов с замещениями отдельных хромосом или их плеч с помощью
цитогенетического и молекулярно-генетического анализа............................................................................................... 17

Богданова М.В., Буракова А.А., Царь А.И., Хоружий Н.Е., Сакович В.И., Лемеш В.А.
Сравнительный анализ уровней генетического разнообразия культурных сортов
и дикорастущих популяций Brassica napus.......................................................................................................................... 17

Болдинова Е.О., Макарова А.В.


Белок PolDIP2 стимулирует днк-полимеразную активность PrimPol человека............................................................... 18

Бондаренко К.А., Макарова А.В.


Получение аптамеров к PrimPol.......................................................................................................................................... 18

Борисова О.В., Бахчеван Е.Л.


Полиморфизм генов фолатного цикла: частота и ассоциация с биохимическими показателями
у детей с расстройствами аутистического спектра............................................................................................................. 18

Бочарова Е.С.
Эволюционная динамика популяционно-генетической структуры у частично клональных видов актиний................. 19

Брулер Е.С., Сергина С.Н., Антонова Е.П., Морозов А.В.


Роль пинеальной железы и мелатонина в механизмах фотопериодического ответа у млекопитающих......................... 19

Валуйских О.Е., Тетерюк Л.В., Пылина Я.И., Сушенцов О.Е., Шадрин Д.М.
Молекулярно-генетический анализ прострелов Pulsatilla в Республике Коми................................................................. 19

Василева Е.А., Леонова Т.С., Мамонтова В.А., Старшова П.А., Федорова О.А., Дакс А.А.,
Шувалов О.Ю., Петухов А.В., Барлев Н.А.
Роль метилтрансферазы Set7/9 в Sam68-опосредованной регуляции клеточного цикла................................................. 20

Велегжанинов И.О., Пылина Я.И., Шадрин Д.М., Белых Е.С., Рыбак А.В.
Регуляция радиоустойчивости клеток с помощью технологии CRISPRa......................................................................... 20

Волков А.А., Румянцев А.М.


Изучение взаимосвязи транспорта аминокислот и метаболизма метанола у дрожжей Pichia pastoris............................. 20

Волков П.В., Денисенко Ю.А., Рожкова А.М., Синицын А.П.


Экспрессия химерной полисахаридмонооксигеназы с присоединенным
целлюлозосвязывающим модулем в штамме-реципиенте Penicillium verruculosum........................................................... 21

Гагаринская Д.И., Болдинова Е.О., Макарова А.В.


Выделение полноразмерного репликативного регуляторного фактора PolDIP2............................................................. 21

Гармаш Е.В., Велегжанинов И.О., Силина Е.В., Кузиванова О.А., Ермолина К.В., Головко Т.К.
Экспрессия генов и активность ферментов аскорбат-глутатионового цикла в зеленеющем листе пшеницы................ 21

Гейдаров Р.Н., Титов С.В., Попов А.Ю., Михайлович В.М.


Определение частот встречаемости аллельных вариантов генов UGTA1, DPYD, GSTP1 и ABCB1 в популяции
восточных славян................................................................................................................................................................. 22

Герасимова Е.М., Качкин Д.В., Зелинский А., Рубель А.А., Чернов Ю.О.
Изучение амилоидогенного белка PHC3 на клеточной культуре млекопитающих HEK293........................................... 22

Гималова Г.Ф., Абдуллин З.С., Сакаева Д.Д., Хуснутдинова Э.К.


Поиск мутаций в хромосомной области 17p13 у больных мелкоклеточным раком легкого
из Республики Башкортостан.............................................................................................................................................. 22

Гирнык А.Е., Доценко И.Б., Вергун А.А.


Биологические и генетические характеристики партеногенетических ящериц Darevskia armeniaca,
ассимилированных в новых условиях обитания................................................................................................................. 23

Громов К.Б.
Филогенетический анализ гена nef ВИЧ-1 суб-субтипа А6 в сравнении с суб-субтипом А1 и субтипом В.................... 23

Денисенко Ю.А., Волков П.В., Осипов Д.О., Семенова М.В., Рожкова А.М., Короткова О.Г., Синицын А.П.
Экспрессия гомологичной полисахаридмонооксигеназы в штамме-реципиенте Penicillium verruculosum B1-537.......... 23

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 5


Денисова А.Е., Филиппенков И.Б., Ставчанский В.В., Дергунова Л.В., Губский Л.В.
Применение магнитно-резонансной томографии в анализе нейропротективного эффекта пептидного препарата
семакс в условиях модели обратимой фокальной ишемии мозга у крыс.......................................................................... 24

Дмитриева Т.М., Кузмицкая П.В., Урбанович О.Ю.


Оценка полиморфизма генов дегидринов мягкой пшеницы (Triticum aestivum L.).......................................................... 24

Доронин С.А., Ульянов С.В., Храмеева Е.Е., Разин С.В. , Шевелев Ю.Я.
Ядерная ламина обеспечивает правильную пространственную организацию хроматина в интерфазном ядре............. 25

Дюдеева Е.С., Курусь Н.Н., Дульцев Ф.Н., Ломзов А.А., Шевелев Г.Ю., Пышный Д.В.
Исследование кинетики гибридизации олигонуклеотидов ДНК методом VFDM........................................................... 25

Евстигнеева С.С., Федоненко Ю.П.


Структурные особенности экстраклеточных и мембранных гликанов флокулирующих
культур бактерий Р. Azospirillum........................................................................................................................................... 25

Екомасова Н.В., Литвинов С.С., Джаубермезов М.А., Габидуллина Л.Р., Хусаинова Р.И., Хуснутдинова Э.К.
Изучение генетической структуры популяций башкир, татар и чувашей по данным
об изменчивости Y-хромосомы........................................................................................................................................... 26

Елизарова В.С., Астрейко М.О., Бебякова Н.А.


Влияние левзеи сафлоровидной (Rhaponticum carthamoides) на поведенческие характеристики крыс в условиях
иммобилизационного стресса............................................................................................................................................. 26

Еникеева Р.Ф., Казанцева А.В., Хуснутдинова Э.К.


Анализ ассоциаций полиморфных локусов rs6277 и rs2283265 гена DRD2 c фенотипическими вариациями
в уровне математической тревожности............................................................................................................................... 26

Заварухина А.Н., Золотаренко А.Д.


Изучение роли отдельных генов семейства AP-1 в регуляции важных для псориаза характеристик кератиноцитов..... 27

Зайцев С.С., Салтыков Ю.В., Субботина И.А., Филонова Н.Н., Федорова В.А.
Молекулярно-генетическое типирование штаммов Chlamydia trachomatis...................................................................... 27

Зайцев С.С., Салтыков Ю.В., Яковлев С.И., Ларионова О.С., Евстифеев В.В., Федорова В.А.
Результаты пилотного секвенирования штамма хламидий зоонозного происхождения
на платформе Illumina HiSeq 2500....................................................................................................................................... 27

Зачепило Т.Г., Лопатина Н.Г.


Диметилирование гистона H3K4 участвует в формировании памяти у медоносной пчелы............................................ 28

Земская Н.В., Соловьев И.А., Коваль Л.А., Щеголева Е.В., Москалев А.А.
Влияние витаферина-А на качество и продолжительность жизни особей Drosophilame lanogaster................................ 28

Иванова А.В., Румянцев А.М.


Исследование регуляции генов полиаминоксидаз у дрожжей Pichia pastoris.................................................................... 28

Иванова Е.В., Кипень В.Н.


Оценка частоты распространенности полиморфизма rs80981028 в гене гефестина для вида Sus scrofa........................... 29

Иванова Ю.С., Фомина М.Н., Пай О.А.


Морфологические особенности и геометрическая характеристика зерна голозерных образцов овса............................ 29

Каныгина А.В., Котова Е.С.


Анализ дифференциальной экспрессии ретротранспозонов в раковой и нормальной ткани предстательной
железы с использованием транскриптомных данных........................................................................................................ 30

Карапетьян О.Ш., Бибов М.Ю., Добаева Н.М.


Роль VDAC1 в поиске эффективных фотосенсибилизаторов при фотодинамической терапии рака............................. 30

Климентова Е.А., Гилязова И.Р., Бермишева М.А., Измайлов А.А., Павлов В.Н., Хуснутдинова Э.К.
Исследование профилей экспрессии генов микроРНК у пациентов с метастатическим раком почки.......................... 30

Коваль Л.А., Земская Н.В., Шапошников М.В., Москалев А.А.


Изучение стрессоустойчивости у долгоживущих особей Drosophila melanogaster, мутантных по гену E(Z)................... 31

6 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


Козарь Е.В., Домблидес Е.А., Солдатенко А.В., Домблидес А.С.
Оценка уровня плоидности удвоенных гаплоидов редиса, полученных в культуре изолированных микроспор in vitro........ 31

Кондратьева Е.В., Лавров А.В., Вареников Г.Г., Скоблов М.Ю.


Целенаправленное однонуклеотидное редактирование позволяет корректировать сотни патогенных вариантов
наследственных заболеваний.............................................................................................................................................. 31

Коновалова М.В., Царегородцева Д.С., Свирщевская Е.В.


Анализ врожденного иммунитета у мышей разных линий................................................................................................ 32

Копытова А.Э., Николаев М.А., Рычков Г.Н., Сенкевич К.А., Байдакова Г.В., Захарова Е.Ю., Емельянов А.К. Пчелина С.Н.
Разработка подходов к терапии болезни Гоше и болезни Паркинсона............................................................................. 32

Кордюкова М.Ю., Побегуц О.В., Бутенко И.О., Абрамов Ю.А., Оленкина О.М., Калмыкова А.И.
Теломерные рибонуклеопротеиновые комплексы нарушают биогенез компонентов митотического аппарата
при дисфункции теломер в процессе раннего развития Drosophila.................................................................................... 32

Кропочева Е.В., Есюнина Д.М., Аравин А.А., Кульбачинский А.В.


Выделение белка-аргонавта из Runella slithyformis и исследование его каталитической активности............................... 33

Кузмицкая П.В., Урбанович О.Ю.


Идентификация стресс-ассоциированных белков, содержащих домены цинковых
пальцев A20/AN1 в геноме яблони...................................................................................................................................... 33

Кулабухова Д.Г., Гараева Л.А., Штам Т.А., Камышинский Р.А., Варфоломеева Е.Ю., Верлов Н.А., Волницкий А.В.,
Ланда С.Б., Сенкевич К.А., Милиюхина И.В., Гаврилов Г.В., Емельянов А.К., Пчелина С.Н.
Влияние экзосом CV: и плазмы крови пациентов с болезнью Паркинсона
на выживаемость нейрональных культур............................................................................................................................ 33

Кулак М.М., Комиссаров А.С., Демин А.Г., Фийон В., Сайфитдинова А.Ф., Павлова О.А., Гагинская Е.Р., Галкина С.А.
Новые тандемные повторы, идентифицированные в геноме японского перепела.......................................................... 34

Лага В.Ю.
Анализ мутаций лекарственной устойчивости ВИЧ у пациентов,
заразившихся за пределами Российской Федерации......................................................................................................... 34

Лашкул В.В., Качкин Д.В., Чернов Ю.О., Рубель А.А.


Разработка дрожжевой модели для фенотипического анализа
конформационного перехода прионного белка PrP........................................................................................................... 34

Лемеш В.А., Богданова М.В., Буракова А.А., Добыш О.И., Кипень В.Н., Виноградов А.А.
Разработка MS-SnuPE праймеров для определения статуса метилирования генов человека ELOVL2, F5 и ZYG11A.......... 35

Лисицкая Л.А., Комар А.А., Есюнина Д.М.


Выделение нуклеазы, ассоциированной с белком-Аргонавтом бактерии Rhodobacter sphaeroides................................... 36

Лужин А.В., Величко А.К., Петрова Н.В., Кантидзе О.Л.


Роль фосфатидилинозитол 3-киназа подобных киназ (PIKK)
в индуцированном гипертермией репликативном стрессе................................................................................................ 36

Мамонтова В.А., Петухов А.В., Шувалов О.Ю., Федорова О.А., Барлев Н.A., Дакс А.А.
Нокаут метилтрансферазы Set7/9 повышает чувствительность клеток рака легкого к генотоксическим препаратам.......... 36

Мензоров А.Г., Беклемишева В.Р.


Эффективная трансдукция фибробластов ластоногих с помощью неинтегративных векторов...................................... 37

Мешалкина Д.А., Казалов М.А., Кисель Э.В., Мизгирев И.В., Федорова Я.В., Козлова А.Н., Малашичев Е.Б.
Создание рыб зебраданио (Danio rerio) с нокаутами по генам транспортеров серотонина (slc6a4a и slc6a4b)
как модели аффективных расстройств................................................................................................................................ 37

Мосейко В.В., Коляда А.К., Сизенко А.К., Будовская Л.А., Пучков К.С., Гавалко Ю.В. , Романенко М.С., Вайсерман А.М.
Связь между индексом массы тела и соотношением Firmicutes и Bactemidetes в микробиоме кишечника в
зрослого населения Украины.............................................................................................................................................. 37

Некрасов Д.В., Курусь Н.Н., Дульцев Ф.Н., Ломзов А.А., Шевелев Г.Ю., Пышный Д.В.
Использование кварцевого резонатора для определения термодинамических параметров
механической денатурации двойной спирали ДНК........................................................................................................... 38

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 7


Никитин М.В., Простова М.А., Есюнина Д.М., Комар А.А., Кульбачинский А.В.
Выделение специализированных днк-полимераз экстремофильной бактерии Deinococcus gobiensis.............................. 38

Новосадова Е.В., Арсеньева Е.Л., Ванюшина Ю.Н., Малова Т.В.,


Антонов С.А., Тарантул В.З., Гривенников И.А.
Получение астроцитов из индуцированных плюрипотентных стволовых клеток человека............................................ 38

Носова А.Ю., Царь А.И., Буракова А.А., Добыш О.И.


Видовая идентификация пищевой продукции из лососевых рыб (salmonidae)................................................................ 39

Носова Е.В., Дмитриева В.Г., Рожкова А.В., Дергунов А.Д., Литвинов Д.Ю., Дергунова Л.В.
Особенности экспрессии генов, функционирующих в клетках крови человека и вовлеченных в атерогенез
при различном содержании холестерина липопротеинов высокой плотности................................................................ 39

Олина А.В., Агапов А.А., Есюнина Д.М., Кульбачинский А.В.


Система для поиска белков-партнеров рнк-полимеразы в клетках Deinococcus radiodurans............................................ 40

Орехова М.М., Якунина М.В.


Механизм узнавания промотора невирионной РНК-полимеразой бактериофага phiKZ................................................ 40

Орлов М.А., Гаранина И.А., Фисунов Г.Ю., Сорокин А.А.


Связь физико-химических и функциональных свойств промоторов Mycoplasma gallisetpicum........................................ 40

Орлова С.Ю., Орлов А.М.


Особенности микроэволюции антимор (Antimora spp., Moridae, Gadiformes)
по данным митохондриальных маркеров............................................................................................................................ 41

Павлова Л.Е., Тимина М.Ф., Шмалий А.В., Янус Г.А., Имянитов Е.Н.
Генотипирование макак резус (Macaca mulatta) адлерского приматологического центра
по полиморфизму гена OPRM1........................................................................................................................................... 41

Пай О.А., Фомина М.Н., Иванова Ю.С.


Оценка коллекционных образцов ярового овса на устойчивость к распространенным заболеваниям
в зоне Северного Зауралья................................................................................................................................................... 41

Петрова Д.В., Кошлань Н.А., Говорун Р.Д., Блага П., Богданова Ю.В., Кошлань И.В.
Цитогенетический анализ хромосомных нарушений в клетках китайского хомячка в разные
сроки после гамма-облучения60cо....................................................................................................................................... 42

Плюта В.А., Мелькина О.Е., Сидорова Д.Е., Завильгельский Г.Б., Хмель И.А.
Действие летучих органических соединений, синтезируемых микроорганизмами, на экспрессию
генов copA, arsR и zntA, индуцируемых в ответ на присутствие в среде ионов тяжелых металлов и мышьяка................ 42

Побединцева М.А., Макунин А.И., Кичигин И.Г., Сердюкова Н.А., Интересова Е.А.,
Заделенов В.А., Юрченко А.А., Щербаков Д.Ю., Графодатский А.С., Трифонов В.А.
Популяционная генетика осетровых в реках Сибири........................................................................................................ 43

Полтораченко В.А., Юдкина А.В., Жарков Д.О., Макарова А.В.


Выделение ДНК-гликозилазы человека MUTYH.............................................................................................................. 43

Полуконова А.В., Дидыч Д.А., Свердлов Е.Д.


Характеристика опухолей трех аллографтных моделей мыши по экспрессии потенциальных
строма-специфичных генов................................................................................................................................................. 43

Пономарева Е.В., Ведяйкин А.Д., Вишняков И.Е., Ходорковский М.А.


Белок-белковые взаимодействия с участием ftsZ в клетках микоплазм............................................................................ 44

Прописцова Е.А., Галинская Т.В.


Применение молекулярных маркеров COI и 12S для уточнения филогении группы видов Pardosa lugubris................... 44

Пурвиньш Я.В., Грищенко И.В.


Исследование влияния активной транскрипции на экспансию повторов в модельных линиях клеток......................... 44

Пылина Я.И., Шадрин Д.М., Белых Е.С., Велегжанинов И.О., Старцева О.М., Белых Д.В.
Поиск новых ФС для ФДТ онкологических заболеваний среди димерных производных хлорофилла А....................... 45

8 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


Радион Е.И., Рязанский С.С., Глухов С.И., Абрамов Ю.А., Калмыкова А.И.
Влияние инсуляторного комплекса gypsy на функционирование piРНК кластеров
в герминальных тканях Drosophila....................................................................................................................................... 45

Родионова Д.А., Чанышев М.Д., Благодатских К.А., Коваль А.П., Щербо Д.С.
Избирательное повышение представленности фрагментов гена EGFR,
содержащих клинически значимые мутации, на фоне избытка ДНК «дикого типа»....................................................... 45

Романишко Е.Л.
Исследование свиньи домашней с помощью расширенной панели микросателлитных локусов
для анализа достоверности происхождения....................................................................................................................... 46

Селина П.И., Рощина М.П., Сафина Д.Р.


Функционирование генетических конструкций различной структуры в эукариотических системах............................. 46

Сидорин А.В., Румянцев А.М.


Изучение механизмов передачи регуляторных сигналов от Tor-киназы к генам метаболизма
метанола у дрожжей Pichia pastoris....................................................................................................................................... 46

Снытков Е.В., Смирнова Е.Г., Кипень В.Н., Мельнов С.Б.


Точность кластеризации при использовании метода HRM (High resolution melting)
в зависимости от разницы температуры плавления альтернативных аллелей.................................................................. 47

Ставчанский В.В., Филиппенков И.Б., Денисова А.Е., Дергунова Л.В.


Анализ экспрессии генов нейротрансмиттерных систем в клетках подкорковых структур
и лобно-теменной коры головного мозга крыс в условиях церебральной ишемии.......................................................... 47

Степаненко Е.А., Вовк А.Д., Рекунова М.В., Побережный Д.Ю., Макарова И.В., Щербатова Н.А.,
Андреева Л.Е., Марков Д.Д., Ненашева В.В., Тарантул В.З.
Исследование влияния гена TRIM14 на поведение трансгенных мышей и транскрипцию генов,
кодирующих нейротрофины............................................................................................................................................... 48

Тимашева Я.Р., Эрдман В.В., Насибуллин Т.Р., Туктарова И.А., Мустафина О.Е.
Анализ профилей экспрессии генов медиаторов воспаления у пациентов с эссенциальной гипертензией................... 48

Тимина М.Ф., Шмалий А.В., Павлова Л.Е., Агумава А.А.


Разработка и оптимизация тест-системы ПЦР с гибридизационно-флуоресцентным
методом детекции для обнаружения парвовируса в лабораторной диагностике.............................................................. 48

Узун М., Алексеева Л.М., Круткина М.С., Козяева В.В., Груздев Д.С.
Расширение знаний о разнообразии магнитотактических бактерий посредством анализа
метагеномных данных.......................................................................................................................................................... 49

Филиппенков И.Б., Ставчанский В.В., Денисова А.Е., Ионов Н.С., Дергунова Л.В.
Роль циклоРНК-микрорнк-мРНК взаимодействий в клетках головного мозга крысы
в условиях церебральной ишемии....................................................................................................................................... 49

Фомина Е.А.
Изучение коллекции сортов и линий пшеницы (triticum aestivum l.)
по аллельному составу генов hmw глютенинов.................................................................................................................. 49

Хлебаева Д.А.-А., Зачепило Т.Г., Дюжикова Н.А.


Определение первичной последовательности экзонов и CpG-островков в гене Bdnf
у крыс с генетически различным уровнем возбудимости нервной системы..................................................................... 50

Цаплина О.А., Хайтлина С.Ю., Артамонова Т.О., Байтин Д.М., Бахланова И.В.
Регуляция SOS-ответа бактерий протеализином............................................................................................................... 50

Царь А.И., Носова А.Ю.


Видовая идентификация осетровых рыб (Acipenseridae)................................................................................................... 50

Чапров К.Д., Тетерина Е.В.


Анализ прогрессии МФТП-индуцированного Паркинсонического синдрома................................................................ 51

Шараев Н.И., Румянцев А.М.


Изучение роли сенсоров аминокислот в регуляции генов метаболизма метанола у дрожжей Pichia pastoris.................. 51

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 9


Шейнов А.А., Татарский Е.В., Георгиева С.Г., Сошникова Н.В.
Phf10 — субъединица ремоделирующего хроматин pbaf комплекса регулируется
киназами pi3k/Akt-сигнального пути.................................................................................................................................. 51

Шелякин М.А., Захожий И.Г., Силина Е.В., Пылина Я.И., Шадрин Д.М., Чадин И.Ф., Головко Т.К.
Структурно-функциональная организация и генетическая дифференциация популяции растений
Plantago media l. На Южном Тимане................................................................................................................................... 52

Шилкин Е.С., Макарова А.В.


5’-дезоксирибофосфат-лиазная активность полиморфных вариантов Pol iota человека................................................. 52

Шишлова-Соколовская А.М., Кузмицкая П.В., Кветко Е.П., Урбанович О.Ю.


Создание генетической конструкции, несущей ген дегидрина TaDHN19 triticum aestivum............................................... 53

Шмитко А.О., Оленкина О.М., Комаров П.А., Кордюкова М.Ю., Радион Е.И., Калмыкова А.И.
Вклад системы piРНК в регуляцию теломерного ретроэлемента TART
в герминальных тканях Drosophila...................................................................................................................................... 53

Ялаев Б.И., Хусаинова Р.И.


Поиск ассоциаций полиморфных вариантов сайтов связывания микроРНК
с первичным остеопорозом у мужчин и женщин............................................................................................................... 53

ТЕЗИСЫ СТЕНДОВЫХ СООБЩЕНИЙ

Андрющенко С.В., Здвижкова И.А., Бекпергенова А.В., Семеновых Т.А., Рахматуллина О.И.
Проблемы определения механизмов антилизоцимной активности и лизоцимрезистентности энтеробактерий........... 54

Васильева О.Ю., Васильев С.А., Зарубин А.А., Скрябин Н.А.


Детекция мутаций при несовершенном остеогенезе с помощью таргетного
массового параллельного секвенирования......................................................................................................................... 54

Григоров А.С., Салина Е.Г., Быченко О.С., Капрельянц А.С., Ажикина Т.Л.
Роль DrrS, малой некодирующей РНК Mycobacterium tuberculosis, в адаптации к макрофагальному стрессу................. 55

Дьяконов Е.Е., Артамонова Т.О., Ходорковский М.А., Цимоха А.С.


Масс-спектрометрический анализ посттрансляционных модификаций клеточных и внеклеточных протеасом.......... 55

Игнатов Д., Каллиполитис Б., Фрейтаг Н., Йоханссон Й.


Анализ вторичной структуры РНК у патогенной бактерии Listeria monocytogenes............................................................ 55

Макаревич А.Е., Панкратов В.С., Синявская М.Г., Луханина Н.В., Шимкевич А.М.,
Голоенко И.М., Даниленко Н.Г., Давыденко О.Г.
Секвенирование геномов хлоропластов и митохондрий как метод изучения филогении ячменя.................................. 56

Портная Я.А., Злобин В.И., Джиоев Ю.П.


Биоинформационный анализ CRISPR/Cas-системы вида Y. similis штамм 228............................................................... 56

Прокопов Д.Ю., Билтуева Л.С., Трифонов В.А.


Идентификация и аннотация повторяющейся ДНК в геноме стерляди (Acipenser ruthenus)............................................ 56

Салтыков Ю.В., Зайцев С.С., Субботина И.А., Федорова В.А.


Полиморфизм гена omp1 Chlamydia trachomatis................................................................................................................... 57

Устьянцев И.Г., Татосян К.А., Стасенко Д.В.


Полиаденилирование транскриптов SINE, синтезируемых РНК-полимеразой III, значительно увеличивает
их время жизни в клетке...................................................................................................................................................... 57

Черезов Р.О., Воронцова Ю.Е., Симонова О.Б.


Сравнительный анализ экспрессии AHR, ARNT и их генов-мишеней в клеточных культурах
опухолевого и неопухолевого происхождения................................................................................................................... 57

Авторский указатель тезисов устных докладов................................................................................................................... 59


Авторский указатель тезисов стендовых сообщений......................................................................................................... 61

10 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

Тезисы устных докладов

РЕГУЛЯЦИЯ РАБОТЫ РНК-ПОЛИМЕРАЗЫ тактов между соматическими и герминальными клетками,


РАДИОУСТОЙЧИВОЙ БАКТЕРИИ в норме формирующими цисты, функциональные едини-
DEINOCOCCUS RADIODURANS НА цы сперматогенеза. Мы показали, что эктопическая экс-
ПОВРЕЖДЕННЫХ ДНК-МАТРИЦАХ прессия в семенниках белка клеточной адгезии бета-инте-
грина на фоне RNAi-нокдауна Belle приводит к значитель-
А.А. Агапов, Д.М. Есюнина, А.В. Кульбачинский ному восстановлению ранних стадий сперматогенеза. Для
идентификации мишеней трансляционной регуляции, осу-
ФГБУН Институт молекулярной генетики Российской академии
наук, Москва, Россия, 123182; e-mail: al.a.agapov@gmail.com ществляемой Belle в семенниках, мы получили и просекве-
нировали CLIP-Seq библиотеки. В процессе анализа и кар-
Повреждения ДНК могут значительно влиять на точ- тирования полученных библиотек с использованием ге-
ность и эффективность транскрипции. В то же время номной сборки D. melanogaster dm6 (браузер UCSC) нами
РНК-полимераза (РНКП) является одним из главных сен- были предсказаны около 60 РНК-мишеней Belle. На осно-
соров повреждений ДНК в клетке. У Escherichia coli ключе- ве полученных данных нами была построена сеть взаимо-
вую роль в сопряжении транскрипции и репарации играет действий (GO анализ), вследствие чего мы полагаем, что
транслоказа Mfd: она удаляет РНКП с поврежденного Belle участвует в таких процессах, как деаденилирование
участка ДНК и привлекает факторы репарации. Мы иссле- мРНК, протеолиз белков, ядерный транспорт и других. В
довали транскрипцию поврежденной ДНК РНК-полиме- ближайшее время мы планируем подтвердить найденные
разой стрессоустойчивой бактерии Deinococcus radiodurans мишени независимыми методами.
(Dra) на матрицах, содержащих повреждения 8-оксогуа- Работа поддержана грантом РФФИ №18-04-00546 А.
нин, 6-О-метилгуанин, тиминовый димер, тимин-гликоль,
АП-сайт и этеноаденин. Мы показали, что эти поврежде- ***
ния значительно снижают эффективность и точность син-
теза РНК. Мы обнаружили, что филум-специфичные
ГЕНОМНЫЙ И ТРАНСКРИПТОМНЫЙ АНАЛИЗ
Mn2+-зависимые транскрипционные факторы Gfh Dra уси-
ливают транскрипционные паузы, возникающие на повре-
ПОТЕНЦИАЛЬНЫХ МАРКЕРОВ БОЛЕЗНИ
жденной ДНК. Согласно нашим данным, транслоказа Mfd АЛЬЦГЕЙМЕРА
Dra приводит к диссоциации остановленных в поврежден- В.Э. Акимов1, 2, В.Г. Дмитриева1, Л.В. Дергунова1,
ных участках элонгационных комплексов РНКП, причем
А.В. Хрунин1
этот эффект усиливается в присутствии Gfh-факторов. Мы
предполагаем важную роль белков Gfh и Mfd в координа- 1
ФГБУН Институт молекулярной генетики РАН, Москва,
ции процессов транскрипции и репарации ДНК в клетках 123182, Россия;
Dra в стрессовых условиях. 2
Институт биологии и химии ФГБОУВО МПГУ, Москва, Россия;
e-mail: vaso-akim@yandex.ru
*** Болезнь Альцгеймера (БА) — это нейродегенератив-
ное заболевание, сопровождающееся массовой гибелью
ИЗУЧЕНИЕ РОЛИ РНК-ХЕЛИКАЗЫ BELLE В нейронов и постепенным снижением когнитивных функ-
СПЕРМАТОГЕНЕЗЕ DROSOPHILA MELANOGASTER ций, со временем приводящее к деменции. Хотя БА мож-
но выявить прижизненно по содержанию в цереброспи-
В.Е. Адашев, А.А. Котов, Б.К. Годнеева, нальной жидкости бета-амилоида и тау-белка, диагности-
О.М. Оленкина, Л.В. Оленина ка болезни на ранних стадиях остается проблематичной,
Федеральное государственное бюджетное учреждение науки поскольку клинические проявления возникают только че-
Институт молекулярной генетики Российской академии наук, рез несколько лет после начала необратимых патологиче-
Москва, 123182, Россия; e-mail: adashev.vladimir@gmail.com ских изменений в мозге. Основное внимание исследовате-
Мы изучали роль DEAD-box содержащей РНК хели- лей направлено на поиск генетических маркеров БА. В пол-
казы Belle (DDX3) в сперматогенезе D. melanogaster. DEAD- ногеномных ассоциативных исследованиях (GWAS) было
box содержащие РНК хеликазы участвуют во всех аспектах выявлено более 20 локусов, полиморфизм которых был ас-
метаболизма клеточных РНК. DDX3 участвует в широком социирован с риском развития БА. Однако функциональ-
круге онкологических процессов у различных организмов, ный вклад многих из них в патогенез заболевания остает-
включая человека. Мы обнаружили, что на фоне RNAi- ся неясным ввиду их соотнесенности с богатыми генами
нокдауна Belle в соматических клетках семенников D. mela- регионами и сцепленности с большим количеством других
nogaster в последних образуются тумороподобные класте- полиморфных локусов, а также с отсутствием оценки из-
ры из мелких герминальных клеток, не вступающих в даль- менения функций белков, кодируемых ассоциированны-
нейшую дифференцировку и экспрессирующих маркеры ми с этими полиморфизмами генами. Основываясь на дан-
стволовых клеток. Также герминальные клетки в составе ных GWAS, нами выявлен пул из 198 генов, потенциально
кластеров имеют спектросомы — структуры, характерные ассоциированных с процессами, сопровождающими раз-
для герминальных стволовых клеток. Формирование таких витие БА. Помимо генов, для которых ассоциация с ри-
кластеров сопровождается нарушением адгезионных кон- ском развития БА уже является установленной, в него во-

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 11


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

шли гены, расположенные вблизи полиморфизмов, сце- МОДЕЛЬНЫЙ ПЕРЕНОС ГЕНОВ В ГЕНОМ
пленных (r2≥0,2) с «каноническими» 21 полиморфными КИШЕЧНОЙ ПАЛОЧКИ ВЫЗВАЛ АДАПТИВНЫЙ
локусами. Для выяснения их функциональной значимости ОТВЕТ НА УРОВНЕ ЭКСПРЕССИИ
в патогенезе БА из этого пула генов с помощью базы дан- ПЕРЕНЕСЕННЫХ ГЕНОВ И УСКОРЕННЫЙ
ных DAVID были отобраны 62 гена, демонстрировавшие
ЛОКАЛЬНЫЙ МУТАГЕНЕЗ
ассоциации с неврологическими, метаболическими и им-
мунными заболеваниями. Мы предполагаем, что прижиз- О.В. Аликина1, О.А. Глазунова1, А.О. Сырочева1, 2,
ненное исследование изменения функции отобранных ге- К.С. Шавкунов1, О.Н. Озолинь1, 2
нов с помощью сравнительного анализа уровня экспрес-
сии мРНК в клетках крови пациентов с БА и контрольной
1
ФГБУН Институт биофизики клетки Российской академии
наук, Пущино, 142290, Россия;
группы позволит не только установить патогенетическую
значимость отдельных полиморфизмов, но и в перспекти-
2
Пущинский естественно-научный институт, Пущино, 142290,
Россия; e-mail: alikina.olga@mail.ru
ве рассматривать их диагностическое применение в каче-
стве маркеров БА. Для изучения процесса адаптивной эволюции бактери-
альных геномов в ответ на интеграцию чужеродного генети-
*** ческого материала, более 3 лет назад был осуществлен мо-
дельный перенос генов в геном кишечной палочки (Esche-
ИСПОЛЬЗОВАНИЕ МАРКЕРНОГО ГЕНА MAMK richia coli MG1655) и начат эволюционный эксперимент. Для
ДЛЯ ИЗУЧЕНИЕ РАЗНООБРАЗИЯ переноса были использованы гены sfmA и fumD Salmonella
enterica Typhimurium 14028S, кодирующие адгезин и фума-
МАГНИТОТАКТИЧЕСКИХ БАКТЕРИЙ
разу 6, соответственно. Они были интегрированы в геном
Л.М. Алексеева1, 2, М.М. Узун1, 2, В.В. Козяева1, кишечной палочки вместо ранее ассимилированных генов,
М.В. Сухачева1, Е.О. Патутина1, предположительно полученных ею от сальмонелл. Ожида-
Н.В. Слободова1, Д.С. Груздев1 лось, что повторное введение предковых форм в то же гене-
тическое окружение запустит такой же процесс адаптивной
1
ФИЦ биотехнологии РАН, Москва, Россия, 119071; эволюции, который ранее привел к подавлению транскрип-
2
МГУ им. М.В. Ломоносова, Москва, Россия, 119991; ционной активности модельных генов. Вместо этого мы об-
e-mail: al.lolita96@gmail.com наружили медленные волнообразные изменения в экспрес-
Магнитотактические бактерии (МТБ) — группа про- сии перенесенных генов, которые в случае мутанта с заме-
кариот, которая была обнаружена среди филумов ной sfmA имеют тенденцию к затуханию, а у мутанта с
Proteobacteria, Nitrospirae, Omnitrophica, Planctomycetes, заменой fumD на рубеже ~7000 генераций возникла первая
Latescibacteria. Общим для них свойством является способ- фиксированная мутация, которая, по-видимому, стала при-
ность синтезировать внутриклеточные кристаллы магне- чиной резкого усиления экспрессии и опережающего роста
тита или грейгита, окруженные липопротеиновой мембра- этого мутанта в условиях совместного культивирования с
ной. Такие органеллы получили название магнетосомы. родительским штаммом. Так как расчетное время ее появ-
Однако синтез магнетосом не является таксономическим ления в результате случайного мутагенеза должно было быть
дескриптором, в связи с чем существуют трудности в обна- гораздо более продолжительным, это может свидетельство-
ружении МТБ по последовательностям генов 16s рРНК. В вать об ускоренном локальном мутагенезе. Как и ожидалось,
данной работе впервые была разработана праймерная си- у обоих мутантов в рекомбинантной области наблюдается
стема для идентификации МТБ в природных сообществах. повышенная частота спонтанных замен GC-пар на АТ-па-
В качестве универсального маркера был выбран ген, коди- ры, которые на популяционном уровне приближают их ну-
рующий актиноподобный белок MamK, отвечающий за клеотидные последовательности к А/Т-богатому контексту
упорядоченное расположение магнетосомной цепи в клет- ранее ассимилированных генов.
ке. Было сконструировано 8 праймерных систем, из кото- Работа поддержана грантом РФФИ 16-04-01570 и РФ-
рых после оптимизации условий ПЦР было выбрано 2 ФИ мол_а 18-34 01006.
праймерные системы для проведения Nested-PCR, пока-
завшие достоверные результаты на чистых культурах рода ***
Magnetospirillum. Кроме того, был проведен анализ биораз-
нообразия пресноводного озера Белое Бордуковское. Бы- ФЕНОТИПИРОВАНИЕ
ли проанализированы 576 клонов 16S рРНК и mamK. Фи- ДИФФЕРЕНЦИРОВАННЫХ КЛЕТОК
логенетический анализ последовательностей генов mamK КАРДИОМИОБЛАСТОВ КРЫСЫ H9C2 С
выявил 6 ОТЕ, относящихся к МТБ. Они принадлежали к ИСПОЛЬЗОВАНИЕМ МОРФОЛОГИЧЕСКИХ И
филуму Nitrospirae, классу Alphaproteobacteria, семействам
ИММУНОЦИТОХИМИЧЕСКИХ КРИТЕРИЕВ
Magnetococcaceae и Syntrophaceae. Анализ последователь-
ностей генов 16S рРНК показал схожие результаты. А.А. Андреева, Э.Ц. Барадиева, С.И. Шрам
Работа выполнена при частичной поддержке РФФИ
Институт молекулярной генетики РАН, Москва, Россия, 123098;
(грант № 18-34-01005).
e-mail: a.andreeva@img.ras.ru
Линия кардиомиобластов крысы H9c2 широко исполь-
*** зуется при моделировании различных кардиопатологий в
культуре клеток. Известно, что клетки Н9с2 в процессе диф-
ференцировки, в зависимости от целого ряда факторов, мо-
гут приобретать признаки не только кардиомиоцитов, но и
миоцитов скелетных мышц. Цель данной работы — предло-

12 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

жить четкие критерии для фенотипирования клеток Н9с2 ИССЛЕДОВАНИЕ МЕХАНИЗМОВ АКТИВАЦИИ
по признакам, характеризующим степень и направленность НАПРАВЛЕННОЙ ГОМОЛОГИЧНОЙ
дифференцировки в сердечные/скелетные миоциты. В ка- РЕПАРАЦИИ ЧЕРЕЗ TUDOR-
честве таких признаков предложено использовать: а) содер- ВЗАИМОДЕЙСТВУЮЩИЙ РЕГУЛЯТОР TIRR
жание маркерных белков — тропонинов T сердца (cTnT) и
скелетных мышц (sTnT); и б) число ядер в клетке. Было про- А.А. Анучина1, А.В. Лавров1, 2, С.А. Смирнихина1
ведено сравнение нескольких штаммов H9c2, полученных 1
ФГБНУ «Медико-генетический научный центр», Москва,
из разных пулов клеток, хранящихся в криобанке. Морфо- Россия;
логический анализ, проведенный через 10 сут культивиро-
ФГБОУ ВО РНИМУ им. Н.И. Пирогова Минздрава России,
2
вания в среде с 1% FBS (условие для стимуляции дифферен- Москва, Россия; e-mail: arinate@mail.ru
цировки), показал, что число многоядерных клеток (мио-
трубок) варьировало в пределах 20—40%. С использованием В 2017 г. были открыты уникальные свойства ранее
дифференциального анализа cTnT/sTnT (иммунофлуорес- не охарактеризованного белка TIRR (Tudor-interacting re-
центная микроскопия) было обнаружено, что в культурах pair regulator), кодируемого геном NUDT16L. Был показан
преобладают cTnT(+)/sTnT(+) клетки (50—60%). Доля отри- не только значительный вклад TIRR в выбор пути репа-
цательных по обоим TnT клеток составляла 30—40%, число рации двунитевых разрывов, но и ранее неизвестный ме-
cTnT(+)/sTnT(–) клеток было незначительным, а cTnT(–)/ ханизм взаимодействия с ключевым игроком негомоло-
sTnT(+) клетки были обнаружены только в одном из проа- гичного соединения концов — белком 53BP1. TIRR явля-
нализированных штаммов, где их содержание не превыша- ется первым и пока единственным белком, способным
ло 10%. При этом структурированное распределение мар- маскироваться под гистоновую метку и вступать в прямую
керных белков, характерное для цитоскелетных и сократи- конкуренцию с хроматином за связывание с Tu-
тельных белков, наблюдали только в культурах cTnT(–)/ dor-доменом белка 53BP1. Образование подобного ком-
sTnT(+) клеток. Предложенный подход будет использован плекса удерживает 53BP1 от связывания с местами дву-
нами для подбора оптимальных условий дифференцировки нитевых разрывов, содержащими специфический гисто-
клеток H9c2 в миоциты сердечного типа. новый мотив H4K20me2. Кроме того, независимые
Работа выполнена при поддержке РФФИ (проект №16- эксперименты установили взаимосвязь эффективности
04-01870). гомологичной репарации с изменением экспрессии TIRR-
транскрипта гена NUDT16L, что примечательно, как в по-
*** ложительную, так и в отрицательную сторону. Существу-
ет гипотеза о существовании некого конститутивного
уровня белка, любое изменение которого оказывает на не-
ПОЛУЧЕНИЕ ХРОМОСОМСПЕЦИФИЧНЫХ
гомологичное соединение концов ингибирующий эффект.
БИБЛИОТЕК БЫСТРОЙ ЯЩУРКИ, EREMIAS VELOX
Предполагается, что TIRR может быть использован для
(СЕМЕЙСТВО НАСТОЯЩИЕ ЯЩЕРИЦЫ) повышения эффективности направленной гомологичной
Д.А. Андреюшкова1, А.П. Лисачев2, репарации при геномном редактировании с использова-
В.А. Трифонов1, 3 нием CRISPR-Cas9-системы. Однако подобных экспери-
ментов до настоящего времени не проводилось. Исследо-
Институт молекулярной и клеточной биологии СО РАН,
1
вание направлено на разработку и оптимизацию методи-
Новосибирск, Россия, 630090; ки повышения эффективности гомологичной репарации
2
Федеральный исследовательский центр Институт цитологии и путем влияния на экспрессию гена NUDT16L с помощью
генетики СО РАН, Новосибирск, Россия, 630090; ряда механизмов. Первым является нокдаун гена
3
Новосибирский государственный университет, Новосибирск, NUDT16L с помощью малых интерферирующих РНК в
Россия, 630090; e-mail: ada@mcb.nsc.ru клеточной культуре HEK293T. Вместе с siRNA в клетки
Представители современных рептилий имеют различ- трансфицируют плазмиду с мутантным геном GFP, плаз-
ные системы определения пола, как правило, возникшие в миду, содержащую ген Cas9-нуклеазы и соответствующую
эволюции независимо друг от друга. В связи с этим иссле- sgRNA к целевому гену и одноцепочечный олигодезокси-
дование половых хромосом внутри разных групп рептилий нуклеотид как матрицу для репарации. Вторым подходом
является важным для изучения возникновения и эволюции является оверэкспрессия TIRR-транскрипта гена
механизмов, лежащих в основе детерминации пола. Семей- NUDT16L путем конструирования и введения в клетки
ство Настоящие ящерицы (Lacertidae) имеет ZZ/ZW-систе- экспрессирующей плазмиды с кодирующей последова-
му определения пола, однако происхождение половых хро- тельностью, соответствующей изучаемому белку.
мосом данной группы в настоящее время не выяснено окон-
чательно. В рамках данной работы с помощью
микродиссекции метафазных хромосом был получен набор ***
хромосомспецифичных библиотек быстрой ящурки (Eremias
velox), в том числе, W-хромосомы. Флуоресцентные зонды,
созданные на основе данных библиотек, будут использова-
ны в дальнейших исследованиях кариотипа данного вида, в
частности, в изучении его половых хромосом. Впоследствии
полученные библиотеки будут секвенированы на платфор-
ме MiSeq Illumina и исследованы биоинформатически.
Поддержано грантом РФФИ 18-34-00182.

***

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 13


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

НОВЫЙ СПОСОБ ПОЛУЧЕНИЯ БЕЛКА DR5-B 104 инкубировали с серийными разведениями исследуемых
V114C НА ОСНОВЕ ПРОТИВООПУХОЛЕВОГО вируссодержащих образцов в присутствии трипсина, необхо-
ЦИТОКИНА TRAIL димого для активации вируса, или контрольным препаратом
с известным титром в течение 24 ч, после чего культуру кле-
А.А. Артыков1, 2, А.В. Яголович1, 2, М.Э. Гаспарян1 ток лизировали и выделяли вирусную РНК. Титр вируса в об-
1
Институт биоорганической химии им. академиков разцах оценивали по отношению к контрольному образцу. С
М.М. Шемякина и Ю.А. Овчинникова РАН, Москва, 117997, Россия; целью достижения максимальной чувствительности теста, ус-
2
Московский государственный университет им. М.В.
ловия проведения ПЦР-РВ были оптимизированы по кон-
Ломоносова, биологический факультет, 117992, Москва, центрации праймеров в реакционной смеси и температуре
Россия; e-mail: art.al.artykov@gmail.com отжига. В сравнении с реакцией цитопатического действия
данный подход позволял количественно оценить вирус в ко-
Ранее были созданы рецептор-селективный вариант
роткий срок, а также был менее трудоемок в работе, в то вре-
TRAIL DR5-B, который селективно связывается с рецепто-
мя как полученные средние значения и отклонения были со-
ром смерти DR5, не проявляя аффинности к другим рецеп-
поставимы.
торам цитокина (DR4, DcR1, DcR2, OPG), а также мутант-
ный вариант TRAIL DR5-B V114C с мутацией V114С на
***
N-конце полипептидной цепи для ковалентной конъюга-
ции белка с малеимидными группами различных соедине-
ний. Также ранее был описан способ получения вариантов СРАВНЕНИЕ ЭТИОЛОГИИ ВОЗНИКНОВЕНИЯ
цитокина TRAIL путем экспрессии в штамме E. coli РАКА МОЛОЧНОЙ ЖЕЛЕЗЫ И РАКА ПРЯМОЙ
BL21(DE3) в виде гибридного белка с тиоредоксином. Этот КИШКИ
способ позволял получить препаративные количества рас-
М. Ахмедзянова
творимого белка, однако качество очистки не удовлетворя-
ло требованиям, предъявляемым к лекарственным препара- Иркутский государственный медицинский университет ,
там. В данной работе был получен новый плазмидный век- Иркутск, Россия; e-mail: margarita.axmedzyanova@mail.ru
тор pET-32a/dr5-b-v114c, который не содержит Trx-, His- и Основной задачей работы являлось изучение этиологии
S-тагов и служит для прямой экспрессии целевого белка возникновения рака прямой кишки и рака молочной желе-
DR5-B V114C. Вектор pET-32a/dr5-b-v114c был трансфор- зы и выявление наличия общих закономерностей. BRCA1 и
мирован в высокопроизводительный штамм E. coli SHuffle BRCA2 — гены-супрессоры опухолевого роста, относятся к
B. Целевой белок DR5-B V114C был очищен из раствори- так называемой группе генов «общего контроля» (ОК). При
мой фракции цитоплазматических белков. Благодаря ком- наличии мутации гена BRCA1 повышается риск возникно-
бинированию аффинной хроматографии на сорбентах Ni- вения рака молочной железы, при мутации гена BRCA2 —
NTA и Pierce High Capacity Endotoxin Removal Resin и ионо- рака яичников. Наличие клинически значимых мутаций в
обменной хроматографии на сорбенте SP Sepharose удалось генах BRCA1 или BRCA2 вызывает потерю функции бел-
повысить степень очистки от низкомолекулярных белковых ков, кодируемых этими генами, в результате чего нарушает-
примесей и бактериальных эндотоксинов, а также сократить ся основной механизм репарации двунитевых разрывов
количество стадий очистки. Препарат DR5-B V114C, полу- ДНК. Альтернативные пути репарации (BER, NHEJ) не спо-
ченный новым способом, эффективно индуцировал апоп- собны полностью исключить накопление большого числа
тоз в линиях опухолевых клеток Т-клеточной лейкемии Jur- ошибок в первичной структуре ДНК (геномная нестабиль-
kat и колоректальной карциномы HCT116. ность). Мутации гена-супрессора аденоматозного полипо-
Работа поддержана грантом РФФИ №18-34-00812. за толстой кишки (adenomatous polyposis coli, АРС) ведут к
разрастанию полипов толстой кишки в раннем возрасте. Со-
*** матическая мутация ведет к активации онкогена ras и уско-
рению роста полипа, который, тем не менее, еще остается
РАЗРАБОТКА МЕТОДА КОЛИЧЕСТВЕННОГО доброкачественным. Однако с годами полип может приоб-
ОПРЕДЕЛЕНИЯ ШТАММА «МОСКВА» рести мутации генов-супрессоров DCC и ТР53, которые ве-
РЕОВИРУСА НА ОСНОВЕ ПЦР С ДЕТЕКЦИЕЙ дут к автономному неконтролируемому росту злокачествен-
В РЕЖИМЕ РЕАЛЬНОГО ВРЕМЕНИ ных клеток рака толстой кишки. Мини-опрос, проведенный
в группе из 30 человек, показал, что каждый из респонден-
А.В. Астапенко, Ю.И. Аммур, Е.Б. Файзулоев тов знает о таких заболеваниях, как рак молочной железы и
НИИ вакцин и сывороток им. И.И. Мечникова, 115088, Россия,
рак прямой кишки; 85% не знают о том, что именно мута-
Москва; e-mail: ekzis666@mail.ru ция генов способна привести к таким последствиям, и лишь
15% респондентов ответили, что слышали ранее об этом. Од-
В настоящем исследовании был разработан чувствитель-
нако результаты исследований американских ученых, в ко-
ный и воспроизводимый метод количественного определе-
торых принимали участие 7015 женщин, показали, что жен-
ния специфической активности реовируса штамма «Москва»
щины, имеющие мутации генов RCBA1 и RCBA2, кроме вы-
на основе ПЦР с флуоресцентной детекцией в режиме реаль-
сокого риска развития рака молочной железы и яичников,
ного времени (ПЦР-РВ), как альтернатива классическим ме-
имеют высокий риск развития других типов рака, к приме-
тодам. Разработанный подход станет ценным инструментом
ру, рака прямой кишки. Таким образом, огромную роль в
в целях количественного определения инфекционной актив-
возникновении рака молочной железы (рака яичников) и
ности реовирусов, применяемых в качестве онколитических
рака прямой кишки играет генетический фактор. А именно
агентов. К консервативному участку генома реовируса штам-
наличие мутации определенных генов.
ма «Москва» были подобраны праймеры и зонд, специфич-
ность которых была показана в ПЦР-РВ и подтверждена ме- ***
тодом электрофореза в агарозном геле. Культуру клеток МА-

14 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

УЧАСТИЕ PIРНК-САЙЛЕНСИНГА морфизма гена FV Leiden в украинской популяции являет-


В МЕЖВИДОВОЙ РЕПРОДУКТИВНОЙ ся актуальной задачей для разработки алгоритма обследо-
ИЗОЛЯЦИИ У DROSOPHILA вания пациенток при отборе для ЗГТ. Цель нашей работы
— изучение частоты полиморфизма G1691A (Arg506Gln)
С.С. Базылев1, В.Е. Адашев1, Б.К. Годнеева1, гена FV (Leiden). ДНК выделяли из проб буккального эпи-
А.А. Котов1, А.А. Аравин1, 2, Л.В. Оленина1 телия по методу Делапорта. В группу вошли образцы ДНК
250 женщин, имеющих семейную историю тромботических
Институт молекулярной генетики Российской академии наук,
1

Москва, 123182, Россия; осложнений и/или репродуктивные проблемы (бесплодие,


невынашивание беременности в анамнезе). Согласно ре-
2
Калифорнийский технологический институт, Пасадена, США;
e-mail: bazylevser@gmail.com
зультатам исследования, частота варианта G/G составила
58,6%, G/A 39,8%, A/A 1,6%. Таким образом, высокая
piРНК путь — эволюционно консервативный меха- встречаемость полиморфного варианта гена FV, его дока-
низм, обеспечивающий поддержание стабильности гено- занная роль в повышении риска тромботических осложне-
ма за счет подавления активности транспозонов. Актив- ний и простота анализа делают его удобным маркером для
ность piРНК системы также направлена на репрессию не- включения в обследование пациенток перед ЗГТ.
которых белок-кодирующих генов. В герминальных
клетках самцов D. melanogaster piРНК, образующиеся с ло- ***
куса Su(Ste), участвуют в подавлении экспрессии генов Stel-
late, что необходимо для нормального сперматогенеза и
ВЛИЯНИЕ МЕТЕОРОЛОГИЧЕСКИХ УСЛОВИЙ НА
поддержания фертильности. Мы обнаружили 26
РАСПРОСТРАНЕНИЕ ФИТОПЛАЗМЫ У
X-сцепленных геномных повторов, специфичных только
для D. melanogaster, имеющих высокое сходство с последо- ТОМАТОВ
вательностью гена vasa и названных нами Varel (vasa relat- А.Г. Бахшиев
ed) повторами. С помощью FISH обнаружено, что экспрес-
сия Varel ограничена стадией ранних сперматоцитов. Ана- Институт генетики, физиологии и защиты растений, Кишинев,
Республика Молдова; e-mail: aighiuni93@mail.ru
лиз библиотек малых РНК показал, что в герминальных
клетках самцов с локуса Varel образуется большое количе- Фитоплазма является широко распространенным ми-
ство piРНК, антисмысловых по отношению к мРНК гена кроорганизмом, который поражает более 700 видов расте-
vasa, то есть повторы Varel, также как и Su(Ste), являются ний. Среди них много экономически важных культур, та-
мощными piРНК кластерами. Однако, в отличие от пода- ких как томат, кукуруза, картофель, виноград и др. Поте-
вления экспрессии Stellate, экспрессия гена vasa у D. mela- ри от фитоплазмоза могут составлять до 70—80% от
nogaster не подавляется в гонадах из-за недостаточной ком- урожайности. Основными переносчиками фитоплазмы яв-
плементарности Varel piРНК. Varel piРНК могут супресси- ляются цикадки. Отсутствие клеточной стенки делает не-
ровать vasa D. mauritiana в семенниках межвидовых возможным культивирование фитоплазмы in vitro, что су-
гибридов за счет более высокой комплементарности. От- щественно затрудняет идентификацию патогена. Однако,
сутствие локуса Su(Ste) в семенниках гибридов с полноцен- благодаря развитию молекулярных методов, точная диа-
ным герминальным контентом приводит к дерепрессии гностика данного фитопатогена стала возможной. Основ-
Stellate и стерильности. Таким образом, piРНК путь вносит ную цель данной работы составляло определение влияния
вклад в репродуктивную изоляцию D. melanogaster с помо- метеорологических условий на распространение фитоплаз-
щью нарушения регуляции двух различных белок-кодиру- мы на томатном поле. Молекулярная диагностика прово-
ющих генов. дилась на томатах сортов Elvira и Cerasus в периоды веге-
Работа поддержана грантом министерства образова- тации 2016 и 2017 г. ДНК была выделена из плодоножек
ния и науки Российской Федерации №14.W03.31.0007. томатов с помощью щелочного экспресс-метода, разрабо-
танного Guo и др. (2003). Для вложенного ПЦР-анализа
*** использовались специфичные праймеры cpn421 F/R и
cpn200 F/R, созданные на основе нуклеотидной последо-
ГЕНЕТИЧЕСКИЕ ФОРМЫ ТРОМБОФИЛИИ — вательности гена chaperonin Candidatus phytoplasma solani.
ВОЗМОЖНЫЙ МАРКЕР ОСЛОЖНЕНИЙ ПРИ Погодные условия 2016 и 2017 г. существенно отличались.
Летом 2016 г. были зарегистрированы высокие температур-
ЗАМЕСТИТЕЛЬНОЙ ГОРМОНАЛЬНОЙ ТЕРАПИИ
ные показатели и сравнительно мало осадков. При анали-
У ЖЕНЩИН В КЛИМАКТЕРИЧЕСКОМ ПЕРИОДЕ зе сводных данных на присутствие фитопатогена было
Е.Л. Бахчеван, О.В. Борисова определенно заражение в 92% проанализированных образ-
цов. Летом 2017 г. были отмечены сравнительно низкие
Одесский национальный университет им. И.И. Мечникова,
температурные показатели и более высокий уровень осад-
Одесса, 119121, Украина; e-mail: oljachum@gmail.com
ков. Процент зараженных томатов был значительно ниже,
В рандомизированных исследованиях было выявлено всего около 42%. Эти результаты показывают, что большое
увеличение риска венозных тромбозов в 2—4 раза при при- количество осадков повлияло отрицательно на распростра-
менении заместительной гормональной терапии (ЗГТ). Од- нение и размножение цикадок, а более низкие температу-
ной из наиболее изученных генетических форм тромбофи- ры снижали их активность, вследствие чего процент зара-
лии является полиморфизм фактора V G1691A (Лейден- женных растений (томатов) понизился.
ская мутация). В результате этой мутации образуется
вариант фактора V (FV Leiden), устойчивый к расщепле- ***
нию под действием АПС и сохраняющий, таким образом,
свою активность. Таким образом, изучение частоты поли-

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 15


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

ПОИСК ГЕНЕТИЧЕСКИХ ФАКТОРОВ РИСКА постоянно проживающих в условиях Арктической зоны


АДДИКТИВНОГО ПОВЕДЕНИЯ НА ПРИМЕРЕ РФ, из них 83 — с артериальной гипертензией (АГ) и 73 —
КУРЕНИЯ без данного диагноза. Методом ПЦР определялись гено-
типы по полиморфизму -786T>C гена NOS3. Метод логи-
В.В. Башинская1, 2, А.К. Коляда1, 2, Е.В. Мурланова1, 2, стической регрессии использовался для выявления ассо-
Ю.Г. Борисович3, О.А. Загородняя3, циации гипертензии с генотипом по изучаемому
Н.Р. Дарвишов3, В.В. Мосейко1, 2, Д.П. Осичанская4, полиморфизму. Обнаружены преобладание аллеля С и ге-
А.М. Вайсерман1 нотипа С/С и более редкая встречаемость аллеля Т среди
пожилых мужчин с АГ по сравнению с контрольной груп-
1
ГУ «Институт геронтологии им. Д.Ф. Чеботарева НАМН пой без АГ. Поиск генетической модели показал, что наи-
Украины», Киев, Украина;
более правдоподобно описывает результаты генотипиро-
2
Генетическая лаборатория, ООО «Diagen», Киев, Украина; вания полиморфного варианта -786Т>С гена NOS3 адди-
3
КНУ им. Тараса Шевченко, Киев, Украина; тивная модель (ТТ-ТС-СС, OR 0,54 (95% ДИ: 0,85—2,8),
4
Реабилитационный центр «Медлюкс», Киев, Украина; e-mail: р=0,012, согласно которой, каждая копия аллеля С повы-
vitalina.bashinskaya@gmail.com шает риск развития АГ у пожилых мужчин. Таким обра-
Аддиктивное поведение часто проявляется в виде не- зом, у пожилых мужчин вклад в формирование гипертен-
преодолимого влечения к употреблению психоактивных зии вносит не только генотип СС, но и аллель С полимор-
веществ, включая табак. Выявление генетических факто- фного варианта -786T>C гена NOS3.
ров риска курения и предрасполагающих к аддикции пси-
хологических черт необходимо для развития персонализи-
рованных подходов к терапии. 167 добровольцев (средний ***
возраст 32,6±9,6 года) заполнили опросники, включающие
шкалу импульсивности Баррата и краткую шкалу зависи- ВЫЯВЛЕНИЕ ПРИЧИНЫ МУТАНТНОГО
мости от сигарет (CDS-5), и сдали образцы буккального ФЕНОТИПА МЫШЕЙ WELLHAARIG (WE)
эпителия для выделения ДНК. Генотипирование по SNP в
генах DRD2, HTR2A, CYP2A6, COMT, GABRA2 и CHRNA5 А.К. Бейлин1, 2, Э.С. Чермных1, 2, Д.М. Щепетов1,
проводилось методами ПЦР. Частоты носительства алле- Е.А. Воротеляк1, 2, 3
лей/генотипов/аллельных комбинаций в группах курящих ФГБУН Институт биологии развития им. Н.К. Кольцова РАН,
1

и некурящих, а также людей с высокими (>75 баллов) и Москва, Россия;


нормальными (до 70 баллов) показателями импульсивно- 2
Российский национальный исследовательский медицинский
сти сравнивали с помощью ПО APSampler, использующе- университет им. Н.И. Пирогова, Москва, Россия;
го MCMC метод и Байесовскую непараметрическую ста- 3
Московский государственный университет
тистику. Не выявлено индивидуальных аллелей/геноти- им. М.В. Ломоносова, Москва, Россия;
пов, ассоциированных с исследуемыми фенотипами, e-mail: arkadii.beilin@gmail.com
однако выявлены сочетания, включающие аллели иссле- Фенотипически рецессивная мутация wellhaarig (we) у
дуемых SNP генов HTR2A, COMT и GABRA2, значимо ча- мышей проявляется волнистым шерстяным покровом и
ще наблюдаемые в группах курильщиков и людей с высо- волнистыми и короткими вибриссами. Ген we был карти-
кой импульсивностью. Набор исследуемых продолжается. рован на хромосоме 2, его положение известно до локуса
Полученные данные свидетельствуют о вовлечении поли- сцепления размером один миллион п.н. Из всех генов, кар-
морфизма генов HTR2A, COMT и GABRA2 в формирование тированных на этом участке, только эпидермальная
аддиктивного поведения. трансглютаминаза 3 (Tgm3) экспрессируется в коже и во-
лосяных фолликулах, поэтому и была предложена в каче-
стве кандидата на роль нормального аллеля мутантного ге-
*** на we. В ходе настоящей работы мы обнаружили и устано-
вили тип мутации гена Tgm3 у наших мутантных мышей we.
АССОЦИАЦИЯ ПОЛИМОРФИЗМА -786 T>C Для этого мы провели секвенирование экзонов гена Tgm3.
ГЕНА NOS3 С АРТЕРИАЛЬНОЙ ГИПЕРТЕНЗИЕЙ Ген Tgm3 содержит 13 экзонов, мы проверили 5 экзонов, в
У ПОЖИЛЫХ МУЖЧИН которых ожидали обнаружить мутацию, исходя из данных
литературы. Секвенирование экзонов позволило обнару-
Н.А. Бебякова, А.А. Куба, А.В. Хромова жить нонсенс-мутацию ДНК в 13 экзоне у мутантной мы-
ФГБОУ ВО «Северный государственный медицинский ши we; замена цитозина на тимин приводит к появлению
университет» Минздрава РФ, Архангельск, Россия; e-mail: преждевременного стоп-кодона ТГА (вместо аргининово-
nbebyakova@mail.ru го кодона ЦГА) и укорачивает белковый продукт Tgm3 на
В ранее проведенных исследованиях была выявлена 36 аминокислот. Мутантные мыши wellhaarig (we), которые
ассоциация генотипа СС полиморфизма -786T>C гена несут мутацию в гене Tgm3, могут послужить ценной мо-
NOS3 с факторами риска развития гипертензии у юношей, делью для исследования роли Tgm3 в развитии и функци-
проживающих в условиях Арктической зоны РФ. У юно- онировании эпидермиса и волосяных фолликулов, и заслу-
шей с генотипом СС чаще наблюдалась гипертоническая живают дальнейших исследований.
реакция на физическую нагрузку (р<0,05), выявлен более Исследование выполнено при финансовой поддержке РФ-
высокий периферический тонус сосудов (р<0,05) и в 2 раза ФИ в рамках научного проекта №18-34-01022.
более высокий уровень эндотелина-1, чем у юношей с ге-
нотипом СТ и ТТ. В данное исследование были включены
156 мужчин (средний возраст 71,4 года, 95% ДИ 68,6—74,1) ***

16 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

СОЗДАНИЕ ХИМЕРНОЙ ЭНДОГЛЮКАНАЗЫ II, (Gallagher и соавт., 2017). При скрещивании моносомных
СОДЕРЖАЩЕЙ ЦЕЛЛЮЛОЗОСВЯЗЫВАЮЩИЙ и монотелодисомных линий Цитогенетической коллекции
ДОМЕН, В ШТАММЕ PENICILLIUM CANESCENS, И НУУз, созданных на основе линии Л-458, с линией Pima
ИЗУЧЕНИЕ СВОЙСТВ ПРОДУКТА 3-79 вида G. barbadense L. были получены анеуплоидные
гибриды с замещениями отдельных хромосом или их плеч.
Н.М. Бибиков, М.В. Семенова, Е.А. Рубцова, Цитогенетический анализ гибридных растений F1 выявил
О.Г. Короткова присутствие семи моносомных растений в двух семьях
(Мо34х3-79 и Мо95х3-79) с унивалентом крупного разме-
ФИЦ Биотехнологии РАН, Москва, 119071, Россия;
ра. В одной комбинации скрещиваний (Telo-12х3-79) бы-
e-mail: bibik0808@mail.ru
ло обнаружено два монотелодисомика с формированием
Целюллозосвязывающий домен (ЦСД) присутствует у 25 нормальных и одного гетероморфного бивалента. Для
многих целлюлолитических ферментов и обеспечивает их идентификации и нумерации моносом проводили скрещи-
адсорбцию на нерастворимом субстрате. Одним из таких вания анеуплоидных линий с транслокационными лини-
ферментов является целлобиогидролаза I (ЦБГ I) Penicilli- ями с пронумерованными хромосомами. При анализе ги-
um verruculosum, имеющая высокую способность к адсорб- бридов с участием моносомной линии Мо95 была установ-
ции на поверхности субстрата. ЦБГ I осуществляет расще- лена гомологичность унивалента этой линии с одной из
пление волокон целлюлозы с образованием димера — цел- транслоцированных хромосом, поскольку у моносомных
лобиозы. К ферментам, не имеющим ЦСД, относится гибридов в метафазе I мейоза наблюдалось 24 бивалента
эндоглюканаза II (ЭГ II) P. verruculosum. Этот фермент осу- плюс один тривалент. Поскольку у транслокационной ли-
ществляет статистическое расщепление волокон аморф- нии в транслокацию была вовлечена хромосома 6, предпо-
ной целлюлозы по 1,4-β-связям с образованием олигоса- ложили, что унивалентная хромосома линии Мо95 являет-
харидов. Таким образом, целью данной работы стало по- ся хромосомой 6 At-субгенома хлопчатника. Анализ меж-
лучение химерной конструкции: эндоглюканазы II, видовых гибридов F 1 (Мо34×3-79, Мо95×3-79 и
содержащей целлюлозосвязывающий домен, и изучение Telo-12х3-79) выявил присутствие только аллелей G.
свойств продукта. В ходе работы была получена генетиче- barbadense, тогда как аллели линии Л-458 отсутствовали,
ская конструкция, состоящая из гена ЭГ II P. verruculosum что продемонстрировало локализацию 8 маркеров
(eglII) и участка гена ЦБГ I P. verruculosum В1, кодирующе- (BNL1064, BNL2884, GH39, GH82, TMB1538, TBM0154,
го ЦСД (cbhIcbd). Оба гена были амплифицированы, а затем TBM1538, TBM1484) на изучаемых моносомных и моно-
соединены с использованием линкерных праймеров. Кон- телодисомном гибридах. Поскольку ранее эти маркеры бы-
струкция была клонирована в компетентных клетках E. co- ли картированы на хромосоме 6 At-субгенома хлопчатни-
li MACHI и трансформирована в штамм-реципиент Peni- ка, можно утверждать, что линии цитогенетической кол-
cillium canescens RN3-11-7, подходящий для исследования лекции — Мо34, Мо95 и Telo-12 являются дубликатами с
гетерогенных целлюлаз. Клоны, содержащие химерную отсутствием хромосомы 6 At-субгенома.
конструкцию, были использованы для получения сухого Работа выполнена при финансовой поддержке Комитета
ферментного препарата, из которого хроматографически- по науке и технологиям и Министерства инноваций Республи-
ми методами был выделен чистый химерный белок. Свой- ки Узбекистан (гранты Ф-5-31 и ОТ-А-КХ-2018-379).
ства химерного белка были исследованы в сравнении с чи-
стой ЭГ II. По сравнению с чистой ЭГ II, химерный белок ***
имеет адсорбцию на 60% выше, а также в 14 раз более вы-
сокую гидролитическую активность по отношению к не- СРАВНИТЕЛЬНЫЙ АНАЛИЗ УРОВНЕЙ
растворимому субстрату. Кроме того, изменился качествен-
ГЕНЕТИЧЕСКОГО РАЗНООБРАЗИЯ КУЛЬТУРНЫХ
ный состав продуктов гидролиза в пользу целлобиозы с 12
до 45% продуктов.
СОРТОВ И ДИКОРАСТУЩИХ ПОПУЛЯЦИЙ
BRASSICA NAPUS
*** М.В. Богданова, А.А. Буракова, А.И. Царь,
Н.Е. Хоружий, В.И. Сакович, В.А. Лемеш
ИДЕНТИФИКАЦИЯ АНЕУПЛОИДНЫХ
ГИБРИДОВ С ЗАМЕЩЕНИЯМИ ОТДЕЛЬНЫХ Государственное научное учреждение «Институт генетики
и цитологии НАН Беларуси», Минск, Беларусь; e-mail:
ХРОМОСОМ ИЛИ ИХ ПЛЕЧ С ПОМОЩЬЮ m.bogdanova@igc.by
ЦИТОГЕНЕТИЧЕСКОГО И МОЛЕКУЛЯРНО-
При оценке рисков воздействия генетически модифи-
ГЕНЕТИЧЕСКОГО АНАЛИЗА цированных организмов на окружающую среду большое
Ш.У. Бобохужаев1, Ш.С. Абдукаримов2, внимание уделяется сохранению биологического разноо-
А.Х. Макамов2, М.Ф. Санамьян1 бразия, в частности дикорастущих популяций сельскохо-
зяйственных культур. Известны многочисленные дикора-
1
Национальный университет Узбекистана, Ташкент, Республика стущие популяции масличного рапса (Brassica napus), од-
Узбекистан; нако генетически они малоизучены. Для исследования
2
Центр геномики и биоинформатики АН РУз, Ташкент, генетического разнообразия и происхождения дикорасту-
Республика Узбекистан; e-mail: bobohujayev@mail.ru щих популяций рапса в Беларуси мы сравнили показатели
Хлопчатник (Gossypium hirsutum L., 2n=52) является полиморфизма 14 микросателлитных локусов у 11 диких
наиболее широко культивируемым видом среди пяти ра- популяций и 30 коммерческих сортов.
нее изученных тетраплоидных видов. В последние годы бы- В целом коммерческие сорта и дикорастущие популя-
ли описаны два новых вида тетраплоидного хлопчатника: ции продемонстрировали сходные уровни генетического по-
G. ekmanianum Wittm. (Grover и соавт., 2015) и G.stephensii лиморфизма. Рассчитанные значения ожидаемой и наблю-

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 17


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

даемой гетерозиготности были несколько выше (значения Исследование поддержано грантом РНФ 18-14-00354 (по
статистически не достоверны) среди дикорастущих популя- PrimPol) и РФФИ-комфи 17-00-00264 (по остальным ДНКП).
ций по сравнению с культурными сортами, однако две груп-
пы имели менее 50% общих аллелей. По результатам ***
AMOVA, доля изменчивости, которая приходится на разли-
чия между группами (коммерческие сорта: дикорастущие ПОЛУЧЕНИЕ АПТАМЕРОВ К PRIMPOL
популяции), составляла почти 16% (FST=0,159). При попар-
ном сравнении сортов и дикорастущих популяций уровни К.А. Бондаренко, А.В. Макарова
генетической дифференциации варьировали от умеренных ФГБУН Институт молекулярной генетики РАН, Москва, 123182,
до очень высоких (FST=0,234—0,750). Программное обеспе- Россия; e-mail: amakarova-img@yandex.ru
чение STRUCTURE также продемонстрировало четкое раз- Действие многих современных химиотерапевтических
деление между коммерческими сортами и дикорастущими препаратов основано на блокировании репликации быстро
популяциями: из 25 идентифицированных генетических кла- делящихся опухолевых клеток с помощью повреждения
стеров только один включал растения как коммерческого ДНК. ДНК-праймаза и ДНК-полимераза человека Prim-
сорта, так и дикорастущей популяции. Результаты свиде- Pol осуществляют реинициацию репликации после повреж-
тельствуют о том, что генетически рапс способен поддержи- дений ДНК, в том числе после цисплатиновых сшивок, и
вать стойкие дикорастущие популяции. Дикорастущие по- являются перспективной мишенью для создания препара-
пуляции могли образоваться из более старых сортов, кото- тов для борьбы с химиотерапевтической резистентностью.
рые не были включены в наш анализ или, возможно, Аптамеры представляют собой небольшие олигонуклео-
являются результатом гибридизации с дикими родственны- тидные молекулы, отобранные из библиотек случайных по-
ми видами. В связи с этим дикорастущие популяции долж- следовательностей ДНК и РНК и образующие прочные
ны учитываться при оценке экологического риска при выс- комплексы с молекулами-мишенями. Связываясь в функ-
вобождении трансгенного рапса в окружающую среду. ционально важных участках молекулы, аптамеры эффек-
тивно ингибируют активности многих белков-мишеней.
*** По специфичности и аффинности аптамеры не уступают
антителам, но обладают низкой иммуногенностью. С по-
БЕЛОК POLDIP2 СТИМУЛИРУЕТ ДНК- мощью систематической эволюции лигандов экспоненци-
ПОЛИМЕРАЗНУЮ АКТИВНОСТЬ PRIMPOL альным обогащением (SELEX — «Systematic Evolution of
ЧЕЛОВЕКА Ligands by Exponential Enrichment») были получены
ДНК-аптамеры к PrimPol человека. После 13 циклов отбо-
Е.О. Болдинова, А.В. Макарова ра ДНК-аптамеры были клонированы, и для 24 клонов бы-
ла определена нуклеотидная последовательность. По ну-
ФГБУН Институт молекулярной генетики РАН, Москва, 123182,
Россия; e-mail: lizaboldinova@yandex.ru клеотидному составу вариативной области полученные ап-
тамеры можно разделить на несколько групп, содержащих
PrimPol — это открытая в 2013 г. ДНК-праймаза/по- 4 основных типа консервативных мотивов. Для всех полу-
лимераза человека, играющая важную роль в преодолении ченных аптамеров характерна структура G-квадруплекса,
нерепарированных повреждений ДНК в процессе репли- что может быть связано как с более высокой стабильно-
кации. PrimPol может осуществлять реинициацию синте- стью этой структуры in vitro, так и с высокой аффинностью
за ДНК после поврежденного участка, используя PrimPol к G-квадруплексам.
ДНК-праймазную активность, а также может напрямую Работа поддержана грантом РФФИ 18-04-00777.
включать нуклеотиды напротив повреждений ДНК благо-
даря ДНК-полимеразной активности. PrimPol не взаимо- ***
действует с PCNA, и механизмы регуляции ее активности
еще недостаточно изучены. Одним из главных направле-
ПОЛИМОРФИЗМ ГЕНОВ ФОЛАТНОГО ЦИКЛА:
ний исследования PrimPol является поиск вспомогатель-
ных белков, регулирующих ее работу. Было показано, что
ЧАСТОТА И АССОЦИАЦИЯ С
ядерная изоформа белка PolDIP2 (белок 2, взаимодейству- БИОХИМИЧЕСКИМИ ПОКАЗАТЕЛЯМИ У ДЕТЕЙ
ющий с ДНК-полимеразой δ) значительно стимулирует С РАССТРОЙСТВАМИ АУТИСТИЧЕСКОГО
ДНК-полимеразную активность PrimPol. Наибольший сти- СПЕКТРА
мулирующий эффект наблюдается при воздействии
PolDIP2 с рекомбинантной PrimPol, содержащей GST-таг.
О.В. Борисова, Е.Л. Бахчеван
ДНК-полимеразная активность препаратов PrimPol с от- Одесский национальный университет им. И.И. Мечникова,
резанным GST-тагом стимулируется белком PolDIP2 в Одесса, 119121, Украина; e-mail: oljachum@gmail.com
меньшей степени. Можно предположить, что регуляция Цель нашей работы — определение частот полимор-
активности PrimPol происходит путем димеризации фер- физмов генов MTHFR (677C>T, 1298A>C), MTR (2756A>G),
мента на ДНК-матрице, при этом белок PolDIP2 оказыва- MTRR (c.66A>G) в группе детей (51 человек) с расстрой-
ет стимулирующее действие, а рекомбинантный GST-таг ствами аутистического спектра, а также оценить влияние
может способствовать димеризации PrimPol. Взаимодей- данных полиморфизмов на уровень витаминов В9, В12 и го-
ствие PrimPol с белком PolDIP2 также было подтверждено моцистеина в плазме крови. Частоты полиморфизмов по
успешным выделением комплекса PrimPol-PolDIP2 при указанным генам составили: MTHFR (677C>T): AA 51%, Aa
экспрессии обоих белков в клетках E. сoli. Также было об- 45%, aa 3,9%; MTHFR (1298A>C): AA 45%, Aa 33%, aa 22%;
наружено, что помимо PrimPol белок PolDIP2 оказывает MTR (2756A>G): AA 0,59, Aa 33%, aa 8%; MTRR (c.66A>G):
стимулирующее действие на другие ДНК-полимеразы Y- AA 40%, Aa 49%, aa 11%. Частоты аллелей по данным ге-
и X-семейств. нам: MTHFR (677C>T): p(A)=0,74, q(a)=0,26; MTHFR

18 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

(1298A>C): p(A)=0,62, q(a)=0,38, MTR (2756A>G): РОЛЬ ПИНЕАЛЬНОЙ ЖЕЛЕЗЫ И МЕЛАТОНИНА


p(A)=0,76, q(a)=0,24; MTRR (c.66A>G): p(A)=0,65, В МЕХАНИЗМАХ ФОТОПЕРИОДИЧЕСКОГО
q(a)=0,35. Частоты полиморфизмов данных генов в груп- ОТВЕТА У МЛЕКОПИТАЮЩИХ
пе детей с расстройствами аутистического спектра не от-
личались от частот полиморфизмов в европейской попу- Е.С. Брулер1, С.Н. Сергина2, Е.П. Антонова2,
ляции. Была выявлена ассоциация носительства двух не- А.В. Морозов2
благоприятных аллелей гена MTRR (c.66A>G) с уровнем
ФГБОУ ВО «Петрозаводский государственный университет»,
1
В12 плазмы крови. У детей с расстройствами аутистическо- Петрозаводск, 185000, Россия;
го спектра, имеющих аа форму гена MTRR (c.66A>G), на- 2
Институт биологии КарНЦ РАН, ФИЦ «Карельский научный
блюдалось достоверное снижение уровня В12 по сравнению центр РАН», Петрозаводск, 185910, Россия; e-mail: bruler.
с АА или Аа варианта гена (OR=4,2, р<0,05). Достоверной ekaterina@mail.ru
ассоциации аллельных вариантов генов фолатного цикла
Реакция организма на изменение световых условий
и уровня гомоцистеина плазмы крови у группы детей с рас-
окружающей среды реализуется посредством изменения
стройствами аутистического спектра не было выявлено.
функционирования нейроэндокринного органа — пине-
*** альной железы (ПЖ), которая осуществляет многочислен-
ные модулирующие влияния на физиологические системы
организма посредством своих гормонов, важнейшим из ко-
ЭВОЛЮЦИОННАЯ ДИНАМИКА
торых является мелатонин. В докладе собран материал об
ПОПУЛЯЦИОННО-ГЕНЕТИЧЕСКОЙ СТРУКТУРЫ участии ПЖ и мелатонина в молекулярных и физиоло-
У ЧАСТИЧНО КЛОНАЛЬНЫХ ВИДОВ АКТИНИЙ го-биохимических механизмах фотопериодической регу-
Е.С. Бочарова1, 2 ляции физиологических функций у млекопитающих. Осо-
бое внимание уделяется вопросам, касающимся минераль-
ФГБУН Институт биологии развития им. Н.К. Кольцова РАН,
1
ного состава, причин и механизмов формирования
Москва, 119334, Россия; кальцинированных конкреций (сorpora arenacea) в ПЖ.
2
ФГБНУ Всероссийский научно-исследовательский институт Исследования выполнены на научном оборудовании
рыбного хозяйства и океанографии, Москва, 107140, Россия; Центра коллективного пользования Федерального иссле-
e-mail: bocharova.ekaterina@gmail.com
довательского центра «Карельский научный центр Россий-
Поскольку клонирование очень распространено сре- ской академии наук».
ди разных видов актиний, образуется достаточно много Финансовое обеспечение исследований осуществлялось из
клональных или частично клональных популяций актиний средств федерального бюджета на выполнение государственно-
на краю ареала или в условиях, кардинально отличающих- го задания карнц РАН (0221-2017-0052), а также при финансо-
ся от условий вероятного рефугиума вида. Наши исследо- вой поддержке гранта РФФИ (проект №18-34-00035 мол_а).
вания касаются популяций нескольких видов актиний, для
двух из которых характерно циркумполярное распределе- ***
ние (Aulactinia stella, Stomphia coccinea), в то время как аре-
ал других ограничен только Атлантикой (Urticina crassicornis, МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЙ АНАЛИЗ
U. felina, Cribrinopsis similis) или только Пацификой (C. olegi, ПРОСТРЕЛОВ PULSATILLA В РЕСПУБЛИКЕ КОМИ
C. albopunctata). По последовательностям митохондриаль-
ной ДНК виды из родов Urticina и Cribrinopsis идентичны О.Е. Валуйских1, Л.В. Тетерюк1, Я.И. Пылина1,
либо отличаются на одну замену, у циркумполярных видов О.Е. Сушенцов2, Д.М. Шадрин1
в одной популяции могут существовать от 1 до 5 гаплоти- 1
Институт биологии Коми научного центра Уральского
пов. Анализ последовательностей ядерных рибосомальных отделения Российской академии наук, ул. Коммунистическая,
генов (18S и 28S рРНК) показал, что наибольшее генети- 28, Сыктывкар, Республика Коми, 167982, Россия;
ческое разнообразие наблюдается у вида U. felina, который 2
Ботанический сад Уральского отделения Российской академии
в своем жизненном цикле имеет внешнее оплодотворение наук, Екатеринбург, Свердловская область, 620002, Россия;
и плавающую личинку. Наименьшее разнообразие по ядер- e-mail: valuyskikh@ib.komisc.ru
ным маркерам демонстрировали особи A. stella, которые в
На европейском северо-востоке России в пределах Ре-
зоне наибольшего гаплотипического разнообразия по ми-
спублики Коми проходит зона перекрытия ареалов Pulsatilla
тохондриальным генам (5 гаплотипов) были представлены
patens (L.) Mill. и P. flavescens (Zucc.) Juz. (или P. uralensis (Zam.)
всего тремя ядерными генотипами. Это может свидетель-
Tzvel.). Наличие переходных форм (по окраске цветков, струк-
ствовать о том, что помимо нормального полового размно-
туре листа), неоднородность популяций в регионе требуют
жения в данной популяции Тихого океана стало происхо-
ревизии рода Pulsatilla , в том числе молекулярно-генетиче-
дить частичное клонирование, к которому этот вид полно-
скими методами. В качестве основного диагностического при-
стью перешел в условиях Атлантики.
знака, используемого при разделении этих видов в уральских
Красных книгах, является окраска лепестков: сине-фиолето-
***
вая у P. patens и светло-желтая у P. flavescens. Отметим, что P.
patens s.l. включен в Красную книгу Республики Коми (2009).
Для определения таксономического положения прострелов
привлечен 31 образец растений из разных по составу популя-
ций с территории Республики Коми, а также однородных по-
пуляций P. patens (Оренбургская область) и P. flavescens (Сверд-
ловская область). Молекулярно-филогенетический анализ
проводился с использованием последовательностей хлоро-

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 19


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

пластных генов matK и rbcL, а также последовательностей коплением знаний о функциях генов и их взаимодействи-
ITS1-5.8s-ITS2 рДНК. Установлено, что все исследованные ях открывает новые возможности для управления свойства-
популяции представляют собой сложные гибридогенные ком- ми клеток и организмов. В частности, для управления
плексы двух видов рода Pulsatilla, которые разделились на устойчивостью к генотоксическому стрессу. Фундамен-
группы по генам rbcL и matK. тальные знания о регуляции клеточной стрессоустойчиво-
Работа выполнена при поддержке Комплексной программы сти могут лечь в основу подходов к снижению рисков воз-
фундаментальных исследований Уральского отделения Россий- никновения онкологических заболеваний и увеличению
ской академии наук на 2018 г., проект №АААА-А17-117121270031-2 эффективности их лечения. Кроме того, такие знания нуж-
(18-4-4-23) «Генетическое разнообразие редких видов Европей- ны для создания более долговечных клеток-продуцентов
ского Северо-Востока России: инвентаризация и прогноз устой- рекомбинантных белков, новых сортов растений и пород
чивости к глобальным изменениям климата». животных. С помощью белка dCas9, связанного с актива-
тором транскрипции VPR, мы выполнили раздельную и
*** одновременную сверхэкспрессию генов XPC и HR23B в
клетках HEK293T. Продукты данных генов образуют ос-
РОЛЬ МЕТИЛТРАНСФЕРАЗЫ SET7/9 В SAM68- нову комплекса распознавания повреждений ДНК. Кроме
ОПОСРЕДОВАННОЙ РЕГУЛЯЦИИ КЛЕТОЧНОГО того, мы осуществили сверхэкспрессию гена репликации
ЦИКЛА и репарации RPA1 отдельно и одновременно с XPC и
HR23B. Трансфецированные клетки тестировали на пред-
Е.А. Василева, Т.С. Леонова, В.А. Мамонтова, мет устойчивости к гамма-излучению. Сверхэкспрессия
П.А. Старшова, О.А. Федорова, А.А. Дакс, XPC или HR23B отдельно не приводила к изменению ра-
О.Ю. Шувалов, А.В. Петухов, Н.А. Барлев диоустойчивости. В то же время одновременная сверхэкс-
Институт цитологии Российской Академии наук, Санкт- прессия данных функционально взаимозависимых генов
Петербург, 194064, Россия; e-mail: slkd-k@mail.ru приводила к увеличению выживаемости клеток после об-
Белок Sam68 (SRC associated in mitosis of 68 kDa) отно- лучения. Сверхэкспрессия RPA1, как отдельно, так и од-
сится к STAR-семейству РНК-связывающих белков. Показа- новременно с XPC и HR23B приводила к увеличению ра-
на роль Sam68 при раке толстой кишки, простаты, карцино- диоустойчивости. Наши результаты демонстрируют высо-
мах почки и пищевода, раке мочевого пузыря, раке шейки кий потенциал мультиплексной сверхэкспрессии генов
матки и груди. Известно, что Sam68 является регулятором стресс-ответа в функционально обоснованных комбина-
клеточного цикла и апоптоза. В частности, нокаут Sam68 при- циях для увеличения радиоустойчивости клеток.
водит к удлинению G2-M фазы клеточного цикла. Несмотря Работа выполнена при поддержке гранта Президента
на важную роль Sam68 в канцерогенезе, посттрансляционная РФ: МК-2929.2017.4
регуляция этого белка еще недостаточно хорошо изучена. На-
ми было показано, что лизиновая метилтрансфераза Set7/9 ***
специфично метилирует РНК-связывающий белок Sam68.
Методом проточной цитофлуометрии мы показали, что ме- ИЗУЧЕНИЕ ВЗАИМОСВЯЗИ ТРАНСПОРТА
тилтрансфераза Set7/9 вовлечена в Sam68-опосредованную АМИНОКИСЛОТ И МЕТАБОЛИЗМА МЕТАНОЛА
регуляцию клеточного цикла. Сверхэкспрессия Sam68 в клет- У ДРОЖЖЕЙ PICHIA PASTORIS
ках рака толстой кишки HCT116 приводила к существенно-
му укорочению G2-M фазы клеточного цикла, в то время как А.А. Волков, А.М. Румянцев
в отсутствии Set7/9 в раковых клетках HCT116 Sam68 не ока- Санкт-Петербургский государственный университет, кафедра
зывал влияния на продолжительность G2-M. В частности, генетики и биотехнологии, Санкт-Петербург, Россия;
наличие метилтрансферазы Set7/9 необходимо для Sam68-о- e-mail: volkov.art.andr@gmail.com
посредованной репрессии циклинов D1 и Е. Полученные на- Метилотрофные дрожжи Pichia pastoris широко исполь-
ми данные позволяют рассматривать низкий уровень экспрес- зуются в современной биотехнологии для синтеза реком-
сии метилтрансферазы Set7/9 как негативный прогностиче- бинантных белков. При этом применяются промоторы ге-
ский маркер для пациентов с раком толстой кишки и высоким нов метаболизма метанола, в частности гена алкогольок-
уровнем экспрессии Sam68. сидазы 1 (АОХ1). В связи с этим большой практический
Работа была выполнена при поддержке гранта РФФИ интерес вызывает изучение механизмов регуляции этих ге-
18-315-00408 мол_а. нов. Было показано, что помимо регуляции активности ге-
на АОХ1 источником углерода (например глицерином и ме-
*** танолом), существует отдельный механизм его репрессии
при наличии пролина в среде. Цель данной работы — кон-
РЕГУЛЯЦИЯ РАДИОУСТОЙЧИВОСТИ КЛЕТОК струирование репортерной системы, которая позволит ис-
С ПОМОЩЬЮ ТЕХНОЛОГИИ CRISPRA следовать влияние транспорта пролина на регуляцию экс-
И.О. Велегжанинов1, 2, Я.И. Пылина1, прессии генов метаболизма метанола у P. pastoris. На пер-
вом этапе с помощью биоинформатического анализа в
Д.М. Шадрин1, Е.С. Белых1, А.В. Рыбак1
геноме P. Pastoris были выявлены 2 гена, предположитель-
1
Институт биологии Коми научного центра Уральского но кодирующие специфические пермеазы пролина. Далее
отделения РАН, Сыктывкар, 167982, Россия; кодирующую последовательность одного из них — PpPUT4
2
Политехнический институт, Вятский государственный встроили в состав плазмиды pPIC9-Pcup1 под контроль ре-
университет, Киров, 610000, Россия; e-mail: vellio@yandex.ru гулируемого промотора гена CUP1. Этой плазмидой транс-
Развитие технологий мультиплексной регуляции экс- формировали штамм GS115 дрожжей P. pastoris. На втором
прессией генов CRISPRa и CRISPRi в совокупности с на- этапе работы полученные штаммы трансформировали

20 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

плазмидой, содержащей репортерный ген кислой фосфа- ВЫДЕЛЕНИЕ ПОЛНОРАЗМЕРНОГО


тазы РНО5 под контролем промотора гена АОХ1. Получен- РЕПЛИКАТИВНОГО РЕГУЛЯТОРНОГО
ный таким образом штамм позволяет измерять активность ФАКТОРА POLDIP2
промотора гена АОХ1 на фоне сверхэкспресии гена, коди-
рующего специфическую пермеазу пролина PpPUT4. Д.И. Гагаринская, Е.О. Болдинова, А.В. Макарова
Работа выполнена при поддержке гранта РФФИ №18- ФГБУН Институт молекулярной генетики РАН, Москва, 123182,
34-00750 мол-а. Россия; e-mail: deanaw@yandex.ru

*** Полноразмерная форма многофункционального регу-


ляторного белка PolDIP2 (42 кДа) стимулирует активность
ряда ДНК-полимераз (PrimPol, Pol λ, Pol η), увеличивая их
ЭКСПРЕССИЯ ХИМЕРНОЙ сродство к ДНК. Функциональное взаимодействие
ПОЛИСАХАРИДМОНООКСИГЕНАЗЫ ДНК-полимераз с PolDIP2 повышает эффективность и точ-
С ПРИСОЕДИНЕННЫМ ность синтеза на ДНК-матрицах со многими типами по-
ЦЕЛЛЮЛОЗОСВЯЗЫВАЮЩИМ МОДУЛЕМ вреждений ДНК. Изучение PolDIP2 осложнено низкой ста-
В ШТАММЕ-РЕЦИПИЕНТЕ PENICILLIUM бильностью белка и сложностью его выделения. На осно-
VERRUCULOSUM ве штамма E. coli Rosetta2 были получены продуценты
белка PolDIP2, слитого на N-конце с 6xHIS и GST-тагом.
П.В. Волков1, Ю.А. Денисенко1, А.М. Рожкова1,2, Клетки растили в 6 л среды LB при 30 °С до достижения
А.П. Синицын1,2 OD=0,4, наработку белка осуществляли при 16 °С в тече-
1
Федеральный исследовательский центр «Фундаментальные ние 12—14 ч. Выделение PolDIP2 с N-концевым 6xHIS-та-
основы биотехнологии», Институт биохимии им. А.Н. РАН, гом проводили с помощью металл-хелатной хроматогра-
Москва, 119071, Россия; фии на сорбенте Ni-NTA, а с N-концевым GST-тагом — с
2
Химический факультет МГУ им. М.В. Ломоносова, Москва, помощью аффинной хроматографии на сорбенте глутати-
119991, Россия; e-mail: pvvolkov@mail.ru он-сефароза. Выход белка и чистота препарата PolDIP2 с
Известно, что классическая схема ферментативного ги- GST-тагом были намного выше по сравнению с препара-
дролиза целлюлозы предполагает участие трех ключевых цел- том PolDIP2, слитым с HIS-тагом. С помощью масс-спек-
люлаз: целлобиогидролазы (ЦБГ), эндоглюканазы (ЭГ) и трометрии было показано, что препараты PolDIP2 содер-
β-глюкозидазы (БГ). Однако 10 лет назад были открыты но- жат протеолизованный фрагмент фермента, доля которо-
вые белки негидролитической природы — полисахаридмо- го была выше в препарате PolDIP2, слитого с HIS-тагом.
нооксигеназы (ПМО), осуществляющие окислительный раз- Исследование поддержано грантом РНФ 18-14-00354.
рыв полимерной цепи целлюлозы, разрыхляя тем самым ее
связи и облегчая доступ гидролитического комплекса к по-
***
лимеру. В лаборатории биотехнологии ферментов активно
ведутся работы с реципиентным штаммом В1-537 аскомице-
та P.verruculosum, способного секретировать до 50 г/л белка на ЭКСПРЕССИЯ ГЕНОВ И АКТИВНОСТЬ
стандартной среде культивирования с целлюлозой. В гДНК ФЕРМЕНТОВ АСКОРБАТ-ГЛУТАТИОНОВОГО
P.verruculosum удалось обнаружить ген pmo, кодирующий го- ЦИКЛА В ЗЕЛЕНЕЮЩЕМ ЛИСТЕ ПШЕНИЦЫ
мологичную ПМО. В последовательности белка обнаружен
консервативный домен, характерный для известных грибных
Е.В. Гармаш, И.О. Велегжанинов, Е.В. Силина,
ПМО, относящихся к 61-й семье гликозид-гилролаз. Одна- О.А. Кузиванова, К.В. Ермолина, Т.К. Головко
ко в структуре белка отсутствует целлюлозосвязывающий до- Институт биологии Коми НЦ УрО РAH, Сыктывкар, 167982,
мен (ЦСМ), необходимый для адсорбции ПМО на целлюло- Россия, ул. Коммунистическая, д. 28; e-mail: garmash@ib.komisc.ru
зе, что должно приводить к увеличению гидролитической спо- Аскорбат-глутатионовый цикл (АГЦ) — метаболиче-
собности ферментных препаратов и, как следствие, ский путь детоксификации H2O2 в растениях. В работе ис-
повышению эффективности гидролиза целлюлозы. Метода- следовано функционирование АГЦ в процессе деэтиоля-
ми генной инженерии ген pmo был состыкован с полинукле- ции листа яровой пшеницы (Triticum aestivum L., с. Ирги-
отидной последовательностью, кодирующей ЦСМ целлобио- на) на непрерывном свету (190 μмоль м–2 с–1) в течение 48 ч.
гидролазы I P. verruculosum. Таким образом, была получена Выявлен дифференциальный характер экспрессии генов,
плазмидная конструкция, содержащая химерную конструк- в основном совпадающий с активностью ферментов АГЦ,
цию pmo+cbd под контролем сильного сbhI промотора. Кон- направленный на поддержание уровня восстановленного
струкция pmo-cbd будет экспрессирована в штамме-реципи- аскорбата (Asc) и глутатиона (GSH). Усиление экспрессии
енте P.veruculosum B1-537. Полученный химерный белок гена аскорбатпероксидазы (t-APX) и активности APX, вос-
ПМО-ЦСМ будет использован для получения высокоэффек- станавливающей Н2О2 с использованием Asc, сопровожда-
тивных оптимизированных ферментных комплексов для кон- лось увеличением количества Asc. После 24 ч деэтиоляции
версии целлюлозосодержащего сырья. уровень экспрессии гена и активность APX снизились, а
Работа выполнена при поддержке программы фундамен- содержание Asc продолжало увеличиваться. Этому способ-
тальных исследований Президиума РАН №33 «Углеродная ствовало усиление экспрессии гена и активности дегидро-
энергетика: химические аспекты». аскорбатредуктазы (DHAR), регенерирующей Asc из его
окисленной формы. Экспрессия гена и активность глута-
*** тионредуктазы, восстанавливающей окисленный глутати-
он (GSSG), снижались после 24 ч, а концентрация GSSG
— увеличилась. Следовательно, можно полагать, что реге-

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 21


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

нерация Asc в АГЦ — не единственный путь пополнения ИЗУЧЕНИЕ АМИЛОИДОГЕННОГО БЕЛКА PHC3
его пула, как и окисление глутатиона дегидроаскорбатре- НА КЛЕТОЧНОЙ КУЛЬТУРЕ МЛЕКОПИТАЮЩИХ
дуктазой. Вероятно, что транзиторное усиление экспрес- HEK293
сии гена монодегидроаскорбатредуктазы (MDAR) обуслов-
лено повышенным образованием MDA-радикала при пе- Е.М. Герасимова1, Д.В. Качкин1, А. Зелинский1,
реносе этиолированных проростков на свет. Благодаря А.А. Рубель1, Ю.О. Чернов1, 2
эффективному функционированию АГЦ поддерживается
Санкт-Петербургский государственный университет,
1
стабильный уровень H2O2 в зеленеющем листе, что способ- Санкт-Петербург, Россия;
ствует оптимизации условий для становления фотосинте- 2
Georgia Institute of Technology, Atlanta, USA;
тического аппарата. e-mail: kantellis@mail.ru
Работа выполнена при финансовой поддержке РФФИ в
рамках научного проекта № 19-04-0076 А и темы НИР, но- Ряд нейродегенеративных заболеваний, таких как бо-
мер ГР ААА-А-А17-117033010038-7. лезнь Альцгеймера, болезнь Паркинсона, хорея Гентинг-
тона и другие, которые объединяются под общим терми-
*** ном «амилоидозы», обусловлены нарушением белкового
обмена, сопровождающимся образованием и отложением
в тканях специфического комплекса — амилоида. Амило-
ОПРЕДЕЛЕНИЕ ЧАСТОТ ВСТРЕЧАЕМОСТИ
иды — это белковые агрегаты фибриллярной природы,
АЛЛЕЛЬНЫХ ВАРИАНТОВ ГЕНОВ UGTA1, DPYD,
формирующие межмолекулярные кросс-β-структуры и
GSTP1 И ABCB1 В ПОПУЛЯЦИИ ВОСТОЧНЫХ способные катализировать присоединение к себе мономер-
СЛАВЯН ных молекул того же белка с изменением их нормальной
Р.Н. Гейдаров 1, С.В. Титов 1, А.Ю. Попов 2, конформации. На сегодняшний день наблюдается повы-
шенный интерес к амилоидам, которые могут выполнять
В.М. Михайлович 1
определенные функции в организме. В ходе ранее прове-
1
ФГБУН Институт молекулярной биологии денных работ в лаборатории Биологии Амилоидов благо-
им. В.А. Энгельгардта Российской академии наук, Москва, даря биоинформатическим методам и дрожжевой модели
Россия; 2Городская клиническая больница имени Д.Д. Плетнева был идентифицирован новый амилоидный белок млеко-
Департамента здравоохранения Москвы, 105077, Москва,
питающих — PHC3. PHC3 является одним из белков по-
Россия; e-mail: rustam.heydarov@gmail.com
ликомбгруппы (PcG) — комплекса белков, необходимых
Продукты генов UGTA1, DPYD, GSTP1 отвечают за ме- для поддержания репрессивного состояния многих генов,
таболизм различных субстратов как эндогенного происхож- включая Hox-гены, функционирующие во время развития
дения, так и ксенобиотиков, в том числе, противоопухоле- организма. Данная работа направлена на изучение амило-
вых препаратов. Уридиндифосфат-глюкуронилтрансфера- идных свойств белка PHC3 в системе клеточных культур
за (UGTA1) участвует в дезактивации метаболитов человека HEK293, а также изучение влияния агрегации это-
иринотекана, дигидропиримидин-дегидрогеназа (DPYD) — го белка на паттерн экспрессии генов в изучаемой культу-
фторурацила, глутатион S-трансфераза P1 (GSTP1) — про- ре клеток.
изводных платины. Ген ABCB1 кодирует P-гликопротеин из Работа выполнена при поддержке СПбГУ и грантов РНФ
группы ATP-связывающих транспортных белков и участву- №14-50-00069 и РФФИ №15-04-08159.
ет в модуляции фармакокинетики ряда лекарственных
средств. Известны полиморфизмы этих генов, влияющие на ***
активность их продуктов. Наиболее значимыми считаются
rs8175347 (UGTA1)-вставка двух нуклеотидов TA, препят- ПОИСК МУТАЦИЙ В ХРОМОСОМНОЙ
ствующая связыванию с промотером фактора транскрип-
ОБЛАСТИ 17P13 У БОЛЬНЫХ
ции TFIID, снижает экспрессию гена до 70%; rs3918290
(DPYD) — однонуклеотидная замена (G->A) в донорном
МЕЛКОКЛЕТОЧНЫМ РАКОМ ЛЕГКОГО
сайте сплайсинга, приводящая к полной потере фермента- ИЗ РЕСПУБЛИКИ БАШКОРТОСТАН
тивной активности; rs1695 (GSTP1) — замена (A>G), сни- Г.Ф. Гималова1, З.С. Абдуллин2, Д.Д. Сакаева2,
жающая активность фермента; rs1045642 (ABCB1) — замена
Э.К. Хуснутдинова1
(С>T), снижающая экспрессию гена. На разработанном ра-
нее биочипе мы провели анализ 149 образцов ДНК резиден- 1
Институт биохимии и генетики — обособленное
тов европейской части РФ. Частоты минорных аллелей по- структурное подразделение Федерального государственного
бюджетного научного учреждения Уфимского федерального
лиморфизмов rs8175347, rs3918290, rs1695 и rs1045642 соста-
исследовательского центра Российской академии наук, 450054,
вили 0,37; 0; 0,38 и 0,56, соответственно. Уфа, Россия;
Работа выполнена за счет средств Российского научно- 2
Республиканский клинический онкологический диспансер,
го фонда (проект №16-15-00257).
450054, Уфа, Россия; e-mail: galiyagimalova@gmail.com
Рак легкого (РЛ) является одним из наиболее распростра-
*** ненных онкологических заболеваний и основной причиной
смертности от них во всем мире. Мелкоклеточный рак легко-
го (МРЛ) составляет 15—20% всех случаев РЛ и характеризу-
ется коротким анамнезом, быстрым течением, имеет тенден-
цию к раннему метастазированию. Полногеномные исследо-
вания МРЛ показали практически 100% частоту мутирования
гена TP53. Нами проведен поиск мутаций в данном гене и

22 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

всей хромосомной области 17p13.1 у больных МРЛ из Респу- Исследование выполнено при поддержке гранта РФФИ
блики Башкортостан. Материалами для исследования послу- №№17-04-00396, 17-00-00430 (17-00-00426).
жили 72 образца тканей, фиксированных в формалине и за-
литых в парафин. Поиск мутаций осуществлялся методом ***
мультиплексной лигазозависимой амплификации (MLPA).
В результате исследования у 11 образцов выявлены гетерози-
готные дупликации в первом экзоне гена TP53 и у одного — ФИЛОГЕНЕТИЧЕСКИЙ АНАЛИЗ ГЕНА NEF
во втором, четвертом, седьмом и десятом экзонах. Большин- ВИЧ-1 СУБ-СУБТИПА А6 В СРАВНЕНИИ
ство же образцов имели делеции в локусе 17p13: пять — в седь- С СУБ-СУБТИПОМ А1 И СУБТИПОМ В
мом экзоне гена MPUD1 и первом экзоне гена ATP1B2,
К.Б. Громов
четыре — в четвертом—шестом экзонах гена TP53, три — во
втором экзоне гена TP53 и седьмом гена ATP1B2 и один — в ФГБУ «НИЦЭМ им. Н.Ф. Гамалеи» Минздрава России, 123098
13-м экзоне гена CHEK2. Кроме того, обнаружено 4 образца Москва; e-mail: konstantinhiv@bk.ru
с мутацией c.1100delC гена CHEK2, ассоциированной с раз- Цель настоящего исследования — филогенетический
витием рака молочной железы, яичников и простаты. Полу- анализ гена nef ВИЧ-1 суб-субтипа А6 в сравнении с дру-
ченные результаты в целом согласуются с литературными дан- гими генетическими вариантами ВИЧ-1 — близкородствен-
ными, свидетельствующими о высокой частоте мутирования ным суб-субтипом A1 и широко распространенным в ми-
гена TP53 у больных МРЛ. ре субтипом В. Ранее было показано, что эти варианты раз-
Работа частично поддержана грантом РФФИ №17- личаются по последовательностям других генов, однако
020115. данных, касающихся гена nef, в литературе нет.
Материал и методы. Для анализа были получены 47
*** полногеномных последовательностей вирусов А6 с приме-
нением технологии секвенирования MiSeq («Illumina»,
БИОЛОГИЧЕСКИЕ И ГЕНЕТИЧЕСКИЕ США) и наборов MiSeq reagent kits V2. Также для анализа
ХАРАКТЕРИСТИКИ ПАРТЕНОГЕНЕТИЧЕСКИХ использовали 53 полногеномные последовательности ви-
ЯЩЕРИЦ DAREVSKIA ARMENIACA, русов суб-субтипа А6 ВИЧ-1, полученные из GenBank. Для
АССИМИЛИРОВАННЫХ В НОВЫХ УСЛОВИЯХ проведения сравнительного филогенетического анализа
было включено также по 100 последовательностей суб-суб-
ОБИТАНИЯ
типа А1 и субтипа В из GenBank. Для выравнивания после-
А.Е. Гирнык1, И.Б. Доценко2, А.А. Вергун1, 3 довательностей использовалась программа MEGA6.0
(https://www.megasoftware.net). Для филогенетического ана-
1
ФГБУН Институт биологии гена РАН, 119334, Москва, Россия;
лиза была использована программа iqtree (http://www.iqtree.
2
Национальный Научно-природоведческий музей НАН Украины, org)
01601, Киев, Украина;
Результаты. Проведенный нами филогенетический
3
ФГБOУ ВО «Московский педагогический государственный анализ последовательностей показал, что ген nef суб-суб-
университет» (МПГУ), 119991, Москва, Россия;
типа А6 имеет существенные различия с геном nef суб-суб-
e-mail: nasstenochka@mail.ru
типа А1 и образует отдельный субкластер в составе класте-
Эксперимент по искусственной интродукции скаль- ра субтипа А. Последовательности субтипа B образуют от-
ных ящериц D. armeniaca из Закавказья в Житомирскую об- дельный кластер от последовательностей субтипов A.
ласть Украины был начат И.С. Даревским и Н.Н. Щерба- Вывод. На основании проведенного сравнительного
ком в 1963 г. За более чем 50 лет акклиматизации переме- молекулярно-генетического и филогенетического анали-
щенная популяция D. armeniaca стала обладать более за исследования было показано, что геномы ВИЧ-1
высокой численностью и плотностью, чем в местах есте- суб-субтипа А6, суб-субтипа А1 и субтипа B различаются
ственного обитания в Армении, а также приобрела неко- по последовательности гена, кодирующего белок Nef.
торые биологические различия. Отмечено, что плодови-
тость самок украинской популяции выше, а размножение ***
начинается на 2 недели раньше, чем в исходной армянской
популяции. В этой связи особый интерес связан c генети- ЭКСПРЕССИЯ ГОМОЛОГИЧНОЙ
ческими исследованиями интродуцированной популяции. ПОЛИСАХАРИДМОНООКСИГЕНАЗЫ
В настоящей работе было проведено микросателлитное ге-
В ШТАММЕ-РЕЦИПИЕНТЕ PENICILLIUM
нотипирование 40 особей украинской популяции. Были
выявлены и секвенированы 12 аллельных вариантов четы- VERRUCULOSUM B1-537
рех локусов, отличающихся по структуре микросателлит- Ю.А. Денисенко1, П.В. Волков1, Д.О. Осипов1,
ного кластера и однонуклеотидным вариациям в прилежа- М.В. Семенова1, А.М. Рожкова1,2, О.Г. Короткова1,
щих к микросателлиту областях. По сочетанию аллелей че-
А.П. Синицын1,2
тырех локусов установлены индивидуальные генотипы для
всех особей. Всего было детектировано 7 генотипов, в том 1
Федеральный исследовательский центр «Фундаментальные
числе относительно мажорные и редкие. Некоторые гено- основы биотехнологии» РАН, Москва, 119071, Россия;
типы не были обнаружены в исходной и других армянских 2
Химический факультет МГУ им. М.В. Ломоносова, Москва,
популяциях D. armeniaca. Однако говорить о появлении но- Россия, 119991; e-mail: denisenkoyura@mail.ru
вых генотипов в украинской популяции пока рано, по- Полисахаридмонооксигеназа (ПМО) — фермент, ко-
скольку необходимо провести сравнение с исходной ар- торый не обладает гидролитической активностью, однако
мянской популяцией, используя равные по количеству осо- окисляет в произвольных местах кристаллические участки
бей выборки. целлюлозы, образует свободные концы, которые являют-

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 23


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

ся субстратом для действия целлобиогидролаз (ЦБГ), и уве- га со стороны окклюзии или распространялась на кору.
личивает аморфность целлюлозы. Штамм мицелиального Наиболее заметное увеличение объема ишемического по-
гриба Penicillium verruculosum является основным объектом вреждения было выявлено спустя сутки после tMCAO: из
систематического исследования в Лаборатории биотехно- 29 животных, получавших физиологический раствор (ФР),
логии ферментов ФИЦ Биотехнологии РАН. В геноме 11 крыс имели очаг, значительно распространившийся в
штамма гриба P. verruculosum был обнаружен набор поли- область коры. При введении семакса у крыс с зоной ише-
нуклеотидных последовательностей, при трансляции ко- мии, включавшей кору, отмечалось значительно меньшее
торых выявляется высокая степень гомологии с ПМО из увеличение ее размеров по сравнению с животными, полу-
других грибных штаммов: Penicillium occitanis (95%) и Ta- чавшими ФР. Так, через 24 ч после tMCAO по данным DWI
laromyces celluloliticus (91%). Таким образом, ген pmo, раз- и T2 WI у животных, получавших ФР, размер зоны повреж-
мером 1043 п.н., кодирующий ПМО из P. Verruculosum, был дения (мм3) составил 178,2 [119; 201,7] и 142,5 [91,7; 173,1]
клонирован и секвенирован по методу Сэнгера. ПЦР-про- соответственно, тогда как при введении семакса — 66,1
дукт, соответствующий гомологичному гену pmo, был ли- [57,3; 92,9] и 56,8 [53,6; 74,6]. Результаты указывают на воз-
гирован в шаттл-вектор pUC-CBHI под контролем силь- можную активацию защитных механизмов клеток мозга
ного индуцибельного cbhI промотора. В результате транс- при ишемии, обусловленных нейропротективным действи-
формации в штамм-реципиент P. verruculosum B1-537 и ем семакса.
культивировании полученных рекомбинантных штам- Работа выполнена при поддержке гранта Российского
мов-продуцентов гомологичного белка ПМО, на электро- научного фонда №16-14-00077.
фореграммах наблюдалась полоса с видимой молекуляр-
ной массой 33 кДа, что приблизительно соответствовало
теоретически рассчитанной молекулярной массе нового ***
белка. Проведение масс-спектрометрического анализа по-
зволило подтвердить экспрессию ПМО. ПМО P.verruculosum ОЦЕНКА ПОЛИМОРФИЗМА ГЕНОВ
состоит из 328 а.к. и содержит консервативную область раз- ДЕГИДРИНОВ МЯГКОЙ ПШЕНИЦЫ
мером 217 а.к., наличие которой позволяет отнести новую (TRITICUM AESTIVUM L.)
ПМО к 61-й семье гликозидгидролаз, к которой относят
ПМО из других грибных источников. Т.М. Дмитриева, П.В. Кузмицкая, О.Ю. Урбанович
Работа выполнена при поддержке программы фундамен- Институт генетики и цитологии НАН Беларуси, Минск, 220072,
тальных исследований Президиума РАН №33 «Углеродная Республика Беларусь; e-mail: t.dmitrieva@igc.by
энергетика: химические аспекты».
Дегидрины представляют собой белки позднего эмбри-
*** огенеза второй группы (LEA II), для которых характерен
консервативный домен (К-сегмент). Абиотический стресс
(засоление, засуха, холод) вызывает повышение уровня экс-
ПРИМЕНЕНИЕ МАГНИТНО-РЕЗОНАНСНОЙ прессии генов, кодирующих эти протеины. Была показана
ТОМОГРАФИИ В АНАЛИЗЕ положительная связь между накоплением некоторых деги-
НЕЙРОПРОТЕКТИВНОГО ЭФФЕКТА дринов и устойчивостью растений к низким температурам.
ПЕПТИДНОГО ПРЕПАРАТА СЕМАКС Цель работы — изучение полиморфизма генов дегидринов
В УСЛОВИЯХ МОДЕЛИ ОБРАТИМОЙ среди сортов и линий яровой и озимой пшеницы различ-
ФОКАЛЬНОЙ ИШЕМИИ МОЗГА У КРЫС ного генетического происхождения. Нами было изучено
аллельное разнообразие локусов TaDHN2, TaDHN18,
А.Е. Денисова1, И.Б. Филиппенков2, TaDHN19 и TaDHN20 (по классификации Wang и соавт.) в
В.В. Ставчанский2, Л.В. Дергунова1, 2, Л.В. Губский1 коллекции из 41 сорта и линии яровой и озимой пшеницы,
ФГБОУ ВО «Российский национальный исследовательский
1 характеризующихся разной устойчивостью к холоду. В хо-
медицинский университет им. Н.И. Пирогова» Минздрава РФ, де исследования полиморфизм на уровне длин амплифи-
Москва, 117997, Россия; цированных фрагментов не был выявлен ни для одного из
2
ФГБУН Институт молекулярной генетики РАН, Москва, описанных локусов. Были секвенированы последователь-
123182, Россия; e-mail: dalina543@gmail.com ности гена TaDHN19.3 из геномов 6 сортов пшеницы: Ка-
Проблема сосудистых заболеваний головного мозга, в пылянка, Каравай, Сукцесс, Фантазия (удалось выделить
том числе ишемического инсульта, сохраняет медицин- два аллельных варианта гена) — озимые, Бонпэйн и Ро-
скую и социальную значимость вследствие высоких пока- стань — яровые. Анализ секвенированных последователь-
зателей заболеваемости, инвалидизации и смертности на- ностей показал высокую степень их идентичности (98,23—
селения. Семакс является одним из первых пептидных пре- 100%). Были обнаружены точечные мутации в виде одно-
паратов, успешно используемых для лечения инсульта, нуклеотидных замен. Результаты in silico трансляции
однако механизмы его действия остаются недостаточно из- секвенированных локусов свидетельствовали об идентич-
ученными. В данной работе с помощью магнитно-резо- ности гипотетических белков у сортов Каравай, Капылян-
нансной томографии (МРТ) было изучено влияние семак- ка, Сукцесс и одного из аллельных вариантов сорта Фан-
са на локализацию и объем ишемического повреждения в тазия.
условиях модели обратимой ишемии мозга крыс (tMCAO). Работа выполнена при финансовой поддержке гранта
Анализ проводили с помощью диффузионно- и T2-взве- БРФФИ Б17РМ-054 и Б18Р-166.
шенных изображений (DWI и T2 WI) спустя 3 и 24 ч после
***
внутрисосудистой окклюзии (90 мин) правой средней моз-
говой артерии. По данным МРТ, после tMCAO зона ише-
мии локализовалась в области подкорковых структур моз-

24 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

ЯДЕРНАЯ ЛАМИНА ОБЕСПЕЧИВАЕТ Метод атомно-силовой спектроскопии (АСС) широко


ПРАВИЛЬНУЮ ПРОСТРАНСТВЕННУЮ применяется для исследования стабильности двойных спи-
ОРГАНИЗАЦИЮ ХРОМАТИНА ралей ДНК. Особенность экспериментов заключается в ма-
В ИНТЕРФАЗНОМ ЯДРЕ лом количестве информативных силовых кривых, вслед-
ствие чего необходимо проводить порядка нескольких со-
С.А. Доронин1*, С.В. Ульянов2*, Е.Е. Храмеева3*, тен измерений. Одна из причин может заключаться в том,
С.В. Разин2, Ю.Я. Шевелев1 что для образования двойной спирали ДНК требуется более
продолжительное время, чем время контакта зонда АСС с
1
Институт молекулярной генетики РАН, Москва, Россия;
подложкой, составляющее около 0,1—2 с. В данной работе
2
Институт биологии гена РАН, Москва, Россия; мы экспериментально определили время гибридизации, ис-
Сколковский институт науки и технологий, Сколково, Россия;
3
пользуя метод измерения вольт-частотной зависимости на
равный вклад; e-mail: semdornot@gmail.com
*
кварцевом резонаторе (VFDM). Исследования проводили
У многоклеточных организмов участки хромосом, на- на модельных дуплексах ДНК, содержащих по 20 пар осно-
ходящиеся в ламина-ассоциированных доменах (ЛАДах), ваний. Дуплекс ON1/ON2 сформирован полностью компле-
прикреплены к ядерной ламине — белковой сети, состоя- ментарными олигонуклеотидами, а ON1/ON3 содержит од-
щей из ламинов и ламин-ассоциированных белков. Одна- нонуклеотидное несоответствие. На поверхности кварцево-
ко вклад ядерной ламины в компактизацию ЛАДов и в под- го резонатора ковалентно иммобилизовали олигонуклеотид
держание глобальной архитектуры хромосом до сих пор ON1, а буферный раствор, содержащий один из олигону-
остается неясен. Мы обнаружили, что деплеция ламина клеотидов ON2 или ON3, вводили в жидкостную ячейку с
Dm0 методом РНКи в клетках S2 дрозофилы вызывает уда- размещенным в ней резонатором. Измерения проводили
ление хроматина от ядерной оболочки, которое приводит при постоянной амплитуде переменного напряжения, рав-
к общему увеличению его плотности в ядре. Однако в от- ной 0,2 В. При данном напряжении амплитуда колебаний
личие от клеток млекопитающих, при деплеции ла- кварцевого кристалла мало влияет на процесс гибридиза-
мин-B-рецептора при одновременном отсутствии ламина ции, а анализ интенсивности шумов на резонансной кри-
C в клетках S2 заметного смещения хроматина внутрь ядра вой позволяет изучить кинетику образования ДНК-дуплек-
не наблюдалось. Методом Hi-C были проанализированы сов. Полученные кривые зависимости степени превраще-
изменения плотности хроматина в топологически-ассоци- ния от времени реакции свидетельствуют о том, что для
ированных доменах (ТАДах) после деплеции ламина Dm0 полной гибридизации необходимо время около 300 с в слу-
в клетках S2. Оказалось, что плотность хроматина в ТАДах, чае дуплекса ON1/ON2 и около 400 с в случае ON1/ON3. Та-
состоящих преимущественно из неактивного хроматина, ким образом, продолжительность процесса гибридизации
уменьшается, в то время как в ТАДах с высокой долей ак- действительно может являться одним из факторов, обуслов-
тивного хроматина, а также в меж-ТАДах плотность хро- ливающих малую информативность силовых измерений,
матина, наоборот, увеличивается. Декомпактизация хро- проводимых методом АСС.
матина в неактивных ТАДах была подтверждена методом Работа выполнена при финансовой поддержке РФФИ в
двуцветной FISH с использованием зондов к противопо- рамках научного проекта №18-34-00320.
ложным концам одного из ТАДов. ChIP-seq анализ с анти-
телами к H3-пан-ацетилированнным гистонам и RNA-seq ***
анализ транскрипции в клетках S2 на фоне деплеции ла-
мина Dm0 показали повышение уровня ацетилирования СТРУКТУРНЫЕ ОСОБЕННОСТИ
гистонов и усиление фоновой транскрипции генов в ЛА- ЭКСТРАКЛЕТОЧНЫХ И МЕМБРАННЫХ
Дах. Полученные результаты свидетельствуют о двоякой ГЛИКАНОВ ФЛОКУЛИРУЮЩИХ КУЛЬТУР
функции ядерной ламины в поддержании геномной архи- БАКТЕРИЙ Р. AZOSPIRILLUM
тектуры. Связывание ТАДов с ядерной ламиной делает их
более компактными, подавляя фоновую транскрипцию. В С.С. Евстигнеева, Ю.П. Федоненко
то же время связывание с ламиной приводит к уменьше-
Институт биохимии и физиологии растений и микроорганизмов
нию общей плотности хроматина в ядре из-за растягива- Российской академии наук, Саратов, 410049, Россия;
ния интерфазных хромосом на ядерной оболочке. e-mail: Stels20295@yandex.ru
Работа выполнена при поддержке гранта РНФ 16-14-
Диазотрофные бактерии p. Azospirillum обитают в ри-
10081.
зосфере многих важных сельскохозяйственных культур. К
адаптационным реакциям, которые помогают азоспирил-
***
лам выживать при варьировании условий среды, относит-
ся образование флокул. Феномен флокуляции заключает-
ИССЛЕДОВАНИЕ КИНЕТИКИ ГИБРИДИЗАЦИИ ся в том, что данная форма организации помимо своей за-
ОЛИГОНУКЛЕОТИДОВ ДНК МЕТОДОМ VFDM щитной функции является наиболее перспективной для
Е.С. Дюдеева1, Н.Н. Курусь2, Ф.Н. Дульцев2, 3, инокуляции растений. Исследование формирования фло-
кул имеет первостепенное значение для оптимизации при-
А.А. Ломзов1, 3, Г.Ю. Шевелев1, 3, Д.В. Пышный1
менения данных ризобактерий в составе биопрепаратов.
ФГБУН Институт химической биологии и фундаментальной
1
При этом важно уделить внимание структурным особен-
медицины СО РАН, Россия; ностям экзополисахаридов (ЭПС), полисахаридов капсу-
ФГБУН Институт физики полупроводников им. А.В. Ржанова
2
лы (КПС) и липополисахаридов внешней мембраны
СО РАН Россия; (ЛПС), которые участвуют в растительно-микробном вза-
3
Новосибирский государственный университет, Новосибирск, имодействии на молекулярном уровне. Нами проводилось
Россия, e-mail: jenyadudeeva@gmail.com изучение структуры и свойств ЭПС, КПС и ЛПС флоку-

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 25


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

лирующих культур азоспирилл, полученных при измене- адаптогенной активностью. Цель работы — выявить влия-
нии состава питательной среды и фазы роста. Показано, ние левзеи сафлоровидной на поведенческие характери-
что в составе данных гликанов при переходе бактерий от стики крыс в условиях иммобилизационного стресса. В те-
планктонных культур к образованию флокул происходят чение двух недель контрольную группу животных поили
модификации моносахаридного состава, профиля жирных водой, опытную — отваром листьев левзеи сафлоровидной.
кислот и макромолекулярной организации. Такие резуль- Особенности поведения оценивали в тесте «Открытое по-
таты помогут выявить необходимый симбиотический фе- ле», иммобилизационный стресс без жесткой фиксации
нотип Azospirillum для повышения эффективности исполь- проводили в течение 1 ч. До запаивания обе группы харак-
зования биоудобрений на их основе. теризовались одинаковыми депрессивными поведенчески-
Работа выполнена при финансовой поддержке РФФИ ми реакциями на стресс, которые проявлялись в снижении
(грант 18-34-00089). индекса поведенческой активности (ИПА), увеличении пе-
риодов короткого груминга. После запаивания у крыс кон-
*** трольной группы ИПА до и после стресса не менялся, од-
нако уровень тревожности повышался. Крысы опытной се-
ИЗУЧЕНИЕ ГЕНЕТИЧЕСКОЙ СТРУКТУРЫ рии в тесте вели себе более спокойно. После действия
ПОПУЛЯЦИЙ БАШКИР, ТАТАР И ЧУВАШЕЙ ПО стресса наблюдалась активация поведения: большинство
ДАННЫМ ОБ ИЗМЕНЧИВОСТИ Y-ХРОМОСОМЫ крыс доходило до центра поля, периоды короткого грумин-
га были незначительны, уровень тревожности невысокий.
Н.В. Екомасова1, 2, С.С. Литвинов1, Выводы: было установлено влияние левзеи сафлоровидной
М.А. Джаубермезов2, Л.Р. Габидуллина2, на стресс-обусловленные изменения поведения крыс. Дей-
Р.И. Хусаинова1, Э.К. Хуснутдинова1, 2 ствие левзеи приводит к адаптации животных к условиям
стресса. Они легче и спокойно его воспринимают. И в ито-
1
Институт биохимии и генетики — обособленное
ге стресс оказывает возбуждающее влияние на их актив-
структурное подразделение Федерального государственного
бюджетного научного учреждения Уфимского федерального ность.
исследовательского центра РАН, Уфа, 450054, Россия;
2
ФГБОУ ВО «Башкирский государственный университет», Уфа,
450076, Россия; e-mail: trofimova_nata_@mail.ru ***
Материалом для исследования служили образцы ДНК
АНАЛИЗ АССОЦИАЦИЙ ПОЛИМОРФНЫХ
чувашей (n =43), 2 субпопуляций татар (n=103) и 8 субпопу-
ляций башкир (n =483). Было выявлено, что доминирующей ЛОКУСОВ RS6277 И RS2283265 ГЕНА DRD2
линией гаплогруппы R1a-M198 Y-хромосомы в субпопуля- C ФЕНОТИПИЧЕСКИМИ ВАРИАЦИЯМИ
циях абзелиловских башкир (16,5%), башкир Западного В УРОВНЕ МАТЕМАТИЧЕСКОЙ ТРЕВОЖНОСТИ
Оренбуржья (36,4%), башкир Самарской и Саратовской об-
Р.Ф. Еникеева, А.В. Казанцева, Э.К. Хуснутдинова
ластей (44%), Бурзянского (27,5%) и Баймакского (6,1%)
районов Башкирии является гаплогруппа R1a-Z2123. Необ- Институт биохимии и генетики — обособленное
ходимо отметить, что в других изученных популяциях — чу- структурное подразделение Федерального государственного
вашей и татар — эта гаплогруппа встречается в единичных бюджетного научного учреждения Уфимского федерального
исследовательского центра Российской академии наук, Уфа,
случаях, 2,3 и 2% соответственно. В субпопуляциях баймак-
450054, Россия; e-mail: enikeevarf@gmail.com
ских башкир (77,3%), бурзянских башкир (32,5%), башкир
Западного Оренбуржья (22,7%), башкир Саратовской и Са- Трудности в обучении математике могут быть обуслов-
марской областей (18%) гаплогруппа R1b-Z2105 является лены наличием математической тревожности (МТ), харак-
доминирующей линией R1b-M269. При этом R1b-М412 с теризуемой чувством тревоги и страха при решении мате-
максимально высокой частотой наблюдается в субпопуля- матических задач. На сегодняшний день существует боль-
ции пермских башкир — 77,8%. Во всех других изученных шое количество литературных данных подтверждающих
популяциях R1b-М412 обнаружена в единичных случаях. ассоциацию гена рецептора дофамина 2-го типа (DRD2)
Работа выполнена при финансовой поддержке гранта как с познавательными способностями [Kellendonk и со-
РФФИ №17-44-020748 р_а. авт., 2006], так и с тревожными состояниями [Hayden и со-
авт., 2010], что делает ген DRD2 интересным с точки зре-
*** ния изучения его в контексте МТ. Ген DRD2 включает в се-
бя большое количество однонуклетидных полиморфизмов,
ВЛИЯНИЕ ЛЕВЗЕИ САФЛОРОВИДНОЙ в данной работе были проанализированы два из них —
rs6277 и rs2283265. В исследовании приняли участие 530
(RHAPONTICUM CARTHAMOIDES)
психически здоровых индивидов (русских, татар, башкир,
НА ПОВЕДЕНЧЕСКИЕ ХАРАКТЕРИСТИКИ КРЫС удмуртов) (75% женщин) — студентов ВУЗов Уфы (сред-
В УСЛОВИЯХ ИММОБИЛИЗАЦИОННОГО ний возраст 21,5±3,87 года), прошедшие оценку МТ с по-
СТРЕССА мощью опросника MARS-E. Генотипирование проводили
с помощью ПЦР-ПДРФ. Статистический анализ был осу-
В.С. Елизарова, М.О. Астрейко, Н.А. Бебякова
ществлен с использованием программы Plink v.1.07. В ре-
ФГБОУ ВО «Северный государственный медицинский зультате линейного регрессионного анализа не было выяв-
университет» Минздрава РФ, Архангельск, 163000, Россия; лено ассоциации полиморфных локусов гена DRD2 (rs6277
e-mail: nika-elizarova@yandex.ru
и rs2283265) c МТ. Однако последующий стратификацион-
Левзея сафлоровидная (Rhaponticum carthamoides) — ный анализ, проведенный среди мужчин, женщин, инди-
травянистое растение, обладающее антистрессовой и видов татарской, русской, башкирской, удмуртской и сме-

26 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

шанной этнической принадлежности, показал ассоциацию hfiX, gitA, enoA, hemN и fumC). При постановке ПЦР исполь-
локуса rs2283265 в гене DRD2 с МТ у мужчин (p=0,03, зовали праймеры, ранее предложенные Y. Pannekoek
r2=0,04). (Pannekoek и соавт., 2008). В результате исследования кли-
Работа выполнена при поддержке грантов Российского нических образцов были выявлены следующие сиквенс-ти-
гуманитарного научного фонда 17-16-02009 а(р). пы СТ: ST4, ST6, ST9, ST10, ST38, ST94. На следующем эта-
пе работы было проведено генотипирование региона VD2
*** гена ompA. В ПЦР использовали праймеры, указанные D.
Dean (Dean и соавт., 1995). Нами было выявлено 7 генова-
ИЗУЧЕНИЕ РОЛИ ОТДЕЛЬНЫХ ГЕНОВ ров СТ: D, E, F, G, H, J, K. Таким образом, найдены следу-
СЕМЕЙСТВА AP-1 В РЕГУЛЯЦИИ ВАЖНЫХ ДЛЯ ющие геновары и сиквенс-типы СТ: D — ST4, E — ST4 и
ПСОРИАЗА ХАРАКТЕРИСТИК КЕРАТИНОЦИТОВ ST94, F — ST38, G — ST9, H — ST10, J — ST9, K — ST6.
Исследование выполнено при поддержке РНФ (проект
А.Н. Заварухина1, 2, А.Д. Золотаренко2 №17-16-01099).
1
Лаборатория функциональной гномики, Институт общей
генетики им. Н.И. Вавилова, Москва, 119991, Россия; ***
2
Кафедра генетики биологического факультета МГУ
им. М.В. Ломоносова, Москва, 119234, Россия; РЕЗУЛЬТАТЫ ПИЛОТНОГО СЕКВЕНИРОВАНИЯ
e-mail: zavaruhinal@mail.ru ШТАММА ХЛАМИДИЙ ЗООНОЗНОГО
Семейство AP-1 является одним из основных регуля- ПРОИСХОЖДЕНИЯ НА ПЛАТФОРМЕ ILLUMINA
торов сигнальных каскадов, связанных с развитием псори- HISEQ 2500
аза. Белки семейства участвуют в дифференцировке эпи-
дермиса, в процессах заживления ран. Цель нашего иссле- С.С. Зайцев1, Ю.В. Салтыков1, С.И. Яковлев2,
дования — изучение вклада разных членов семейства в О.С. Ларионова1, 3, В.В. Евстифеев2, В.А. Федорова1
развитие болезни. Нами была создана линия кератиноци- 1
Федеральный исследовательский центр вирусологии
тов со сверхэкспрессией FRA1. Мы показали, что сверхэкс- и микробиологии — филиал в Саратове, Саратов, Россия;
прессия данного белка в кератиноцитах приводит к изме- 2
Федеральный центр токсикологической, радиационной
нению фенотипа клеток на мезенхимально-подобный. Кро- и биологической безопасности, Казань, Россия;
ме того, она запускает петлю аутоамплификации 3
Саратовский государственный аграрный университет
воспаления, поскольку под воздействием FRA1 наблюда- им. Н.И. Вавилова, Саратов, Россия;
ется повышенный синтез ключевых для псориаза провос- e-mail: zaytsev-sergey@inbox.ru
палительных цитокинов и хемокинов (например, TNFa и Cеквенирование геномов возбудителей хламидиоза от-
CXCL8), что, в свою очередь, влияет на активацию FRA1. крывает дорогу к пониманию эволюции, филогенетическо-
Следующим этапом исследования стала проверка того, го родства, клонального доминирования конкретных гене-
специфичны ли такие свойства для всего семейства или ха- тических линий и иммунобиологических свойств этих па-
рактерны только для Fra1. Для этого были созданы кон- тогенов. Это особенно актуально в свете высокой
струкции с генами JunB, cJun и cFos. Полученные кон- распространенности штаммов семейства Chlamydiaceae, в
струкции будут использованы для сборки лентивирусных том числе, на территории Российской Федерации. Цель на-
частиц и получением стабильных клеточных линий с ин- стоящего исследования — пилотное секвенирование ДНК
дуцибельной сверхэкспрессией отдельных членов семей- штамма хламидий зоонозного происхождения (лиофилизи-
ства. рованный музейный образец). На первом этапе в предвари-
тельных экспериментах выявляли наличие хламидийной
*** ДНК в испытуемом образце с использованием панели прай-
меров к специфическим участкам генома Chlamydia psittaci,
МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКОЕ ТИПИРОВАНИЕ Chlamydia abortus, Chlamydia pneumonia, Chlamydia felis, Chla-
ШТАММОВ CHLAMYDIA TRACHOMATIS mydia trachomatis и т.д. В ПЦР данный штамм показал поло-
жительный результат на присутствие генетического матери-
С.С. Зайцев, Ю.В. Салтыков, И.А. Субботина, ала C. psittaci и C. abortus. Далее секвенировали геном на
Н.Н. Филонова, В.А. Федорова секвенаторе Illumina HiSeq 2500 с последующей первичной
Федеральный исследовательский центр вирусологии обработкой полученных данных с помощью программного
и микробиологии — филиал в Саратове, Россия; обеспечения Assembler SPAdes. В результате получено 2 млн
e-mail: nadejda.filonova@yandex.ru ридов, которые затем были собраны в контиги с различной
Chlamydia trachomatis (СТ) является возбудителем одно- длиной и величиной покрытия. Контиги с величиной по-
го из наиболее часто встречающихся венерических заболе- крытия более 10 тыс. единиц сравнивали с референтными
ваний — хламидиоза, преимущественно у молодых мужчин штаммами, депонированными ранее в NCBI GenBank, го-
и женщин. Выявление сходства и различия между штамма- мология составила 99% со штаммами C. psittaci и 94% с C.
ми хламидий, выделенных от различных пациентов, осу- abortus. Далее планируется проведение аннотации данного
ществляется с помощью молекулярного типирования. Цель генома с целью выявления уникальных точечных мутаций.
работы — провести ompA и MLST-типирование 61 изолята Исследование выполнено при поддержке РНФ (проект
СТ. Материалом для исследований служили цервикальные №17-16-01099).
и уретральные смывы от людей, с подтвержденным диагно-
зом урогенитальный хламидиоз. Для определения ***
сиквенс-типа изолятов СТ использовали MLST-
типирование на семь генов домашнего хозяйства (gatA, oppA,

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 27


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

ДИМЕТИЛИРОВАНИЕ ГИСТОНА H3K4 ние витаферина-А на продолжительность жизни и харак-


УЧАСТВУЕТ В ФОРМИРОВАНИИ ПАМЯТИ теристики жизнеспособности (стрессоустойчивость, пло-
У МЕДОНОСНОЙ ПЧЕЛЫ довитость, циркадные ритмы, локомоторная активность,
проницаемость кишечника) особей Drosophila melanogaster.
Т.Г. Зачепило, Н.Г. Лопатина Витаферин-А — небольшая молекула, стероидный лактон,
Институт физиологии им. И.П. Павлова РАН, Санкт-Петербург, представляет собой метаболит растения Withania somnifera
Россия; e-mail: polosataya2@mail.ru (L.) Dunal (Витания снотворная), которое широко исполь-
зуется в народной медицине и известно под названием Аш-
Известно, что формирование памяти сопровождается
ваганда. Также как и другие представители группы витано-
активацией экспрессии генов и ремоделированием хрома-
лидов, витаферин-А обладает широким спектром биоло-
тина. Последнее зависит от эпигенетических модифика-
гических активностей; он характеризуется выраженным
ций ДНК и гистонов. Диметилирование гистона Н3 по ли-
противораковым действием, которое включает повышение
зину 4 (H3K4me2) ассоциировано с активацией транскрип-
эффективности работы систем клеточной антиоксидант-
ции и локализовано в промоторной части гена. Роль
ной защиты и/или дезоксидации, подавление воспалитель-
H3K4me2 в формировании памяти изучена недостаточно.
ных сигнальных путей, избирательное ингибирование про-
Исследование выполнено на медоносной пчеле — уникаль-
лиферации опухолевых клеток и индукцию их апоптоза,
ном модельном объекте для изучения памяти. Использо-
подавление ангиогенеза в опухолях, предотвращение ин-
ваны методы: условно-рефлекторный, иммуногистохими-
вазии опухолей и метастазов, изменение метаболизма опу-
ческий и ОТ-ПЦР. Пчел обучали, далее извлекали мозг,
холевых клеток, иммуномодуляция, уничтожение раковых
фиксировали, готовили срезы, окрашивали с антителами
стволовых клеток (Lee, Choi, 2016). По крайней мере часть
к H3K4me2/гомогенизировали, выделяли РНК, проводи-
из описанных свойств указывает на его большой потенци-
ли ОТ-ПЦР. Нами впервые показано, что у медоносной
ал в качестве геропротектора.
пчелы в процесс формирования ольфакторной ассоциа-
Исследование выполнено при финансовой поддержке РФ-
тивной памяти вовлекается H3K4me2. Диметилирование
ФИ в рамках научного проекта №18-315-00086.
H3K4 усиливается в нейронах каликсов грибовидных тел
— структур, отвечающих за обучение и память у насекомых
— через 1 ч после обучения. В это же время повышается
экспрессия генов гистоновых метилтрансфераз. Отметим, ***
что в это же время наблюдается первая волна транскрип-
ции (Lefer и соавт., 2013). Полученные данные вносят вклад ИССЛЕДОВАНИЕ РЕГУЛЯЦИИ ГЕНОВ
в понимание эпигенетических механизмов памяти. ПОЛИАМИНОКСИДАЗ У ДРОЖЖЕЙ PICHIA
Работа выполнена на животных из ЦКП «Биоколлекция PASTORIS
ИФ РАН» на оборудовании ЦКП «Конфокальная микроско-
пия» Института физиологии им. И.П. Павлова РАН при фи- А.В. Иванова, А.М. Румянцев
нансовой поддержке Программы фундаментальных научных Санкт-Петербургский государственный университет, кафедра
исследований государственных академий на 2013—2020 гг. генетики и биотехнологии, Санкт-Петербург, Россия;
(ГП-14, тема 63.1). e-mail: st055295@student.spbu.ru
Для разных видов дрожжей характерно наличие не-
больших генных семейств, кодирующих белки с одинако-
***
вой функцией. Их подробное изучение необходимо для по-
нимания эволюции геномов и регуляторных систем микро-
ВЛИЯНИЕ ВИТАФЕРИНА-А НА КАЧЕСТВО И организмов. Цель данной работы — изучение регуляции
ПРОДОЛЖИТЕЛЬНОСТЬ ЖИЗНИ ОСОБЕЙ генов полиаминоксидаз у дрожжей P. pastoris. Для достиже-
DROSOPHILA MELANOGASTER ния этой цели были сконструированы репортерные систе-
мы, позволяющие исследовать активность промоторов этих
Н.В. Земская, И.А. Соловьев, Л.А. Коваль,
генов. В ходе работы у P. pastoris были выявлены два гена
Е.В. Щеголева, А.А. Москалев полиаминоксидаз (PpFMS1 и PpFMS2). Было обнаружено,
Институт биологии Коми НЦ УрО РАН — обособленное что ген PpFMS2 расположен рядом с геном алкогольокси-
подразделение ФГБУН ФИЦ «Коми НЦ УрО РАН», Сыктывкар, дазы АОХ1, и что их промоторные области могут перекры-
167982, Россия; e-mail: zemnadezhd@gmail.com ваться. Далее получили плазмиды, в которых под контроль
C возрастом происходит снижение жизненно важных данных промоторов были встроены последовательности
функций организма человека. Возрастные изменения сни- репортерного гена кислой фосфатазы (КФ) PHO5 дрожжей
жают адаптационные возможности организма, в результа- S. cerevisiae. Данными плазмидами трансформировали
те повышается вероятность возникновения хронических штамм 4-GS115 his4 phox, лишенный активности собствен-
заболеваний. Одной из актуальных проблем современной ной КФ. У полученных трансформантов активность репор-
биологии является поиск веществ, способных эффектив- терной КФ на поверхности клеток пропорциональна ак-
но увеличивать устойчивость к различным стрессовым фак- тивности исследуемых промоторов полиаминоксидаз.
торам и способствующих активному долголетию. В насто- Штаммы, содержащие репортерные системы, выращива-
ящее время активно изучаются эффекты действия расти- ли в средах с различными источниками азота и углерода.
тельных экстрактов с целью изготовления на их основе Показано, что регуляция генов PpFMS1 и PpFMS2 разли-
фармакологических препаратов, способных продлевать чается в зависимости от условий. Активность промотора
жизнь модельным животным. Природные соединения так- гена PpFMS2 отсутствовала в средах с глицерином и сме-
же могут позиционироваться как адаптогены и средства сью глицерина с метанолом, но проявлялась в среде с ме-
против старения. В нашей работе впервые изучено влия- танолом в качестве источника углерода. Полученные ре-

28 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

зультаты схожи с регуляцией гена АОХ1, который репрес- ких кабанов и 210 домашних свиньях семи наиболее рас-
сируется глицерином и индуцируется метанолом. пространенных пород в Республике Беларусь (БКБ, БМ,
Работа выполнена при поддержке гранта РФФИ №18- БЧП, Дюрок, Ландрас, Йоркшир и Пьетрен) впервые на
34-00750 мол_а. практическом материале доказан высокий дифференци-
рующий потенциал полиморфизма rs80981028 для разли-
чения особей дикого кабана (Sus scrofa scrofa) и его до-
*** машней разновидности (Sus scrofa domesticus) — сбалан-
сированная точность предсказания составила не менее
ОЦЕНКА ЧАСТОТЫ РАСПРОСТРАНЕННОСТИ 98,6% (при 100% специфичности).
ПОЛИМОРФИЗМА RS80981028 В ГЕНЕ ***
ГЕФЕСТИНА ДЛЯ ВИДА SUS SCROFA
Е.В. Иванова1, В.Н. Кипень2
1
Белорусский государственный университет, Минск, Республика
Беларусь; МОРФОЛОГИЧЕСКИЕ ОСОБЕННОСТИ
2
ГНУ «Институт генетики и цитологии НАН Беларуси», Минск, И ГЕОМЕТРИЧЕСКАЯ ХАРАКТЕРИСТИКА
Республика Беларусь; e-mail: slavakipen@rambler.ru ЗЕРНА ГОЛОЗЕРНЫХ ОБРАЗЦОВ ОВСА
На начало 2018 г. официальной статистической ин- Ю.С. Иванова, М.Н. Фомина, О.А. Пай
формации о численности дикого кабана на территории
Республики Беларусь не представлено, однако охотове- Научно-исследовательский институт сельского
хозяйства Северного Зауралья — филиал Федерального
ды отмечают постепенное восстановление численности
государственного бюджетного учреждения науки Федерального
особей данного вида после резкого сокращения его чис- исследовательского центра Тюменского научного центра
ленности по причине массовой депопуляризации из-за Сибирского отделения Российской академии наук, пос.
угрозы африканской чумы свиней. Ранее была показана Московский, Тюменской обл., 625501, Россия;
возможность использования данных NGS-проектов для e-mail: averyasova-uliy@mail.ru
поиска ОНП (однонуклеотидный полиморфизм), обла- Одним из морфологических признаков зерна явля-
дающих высоким дифференцирующим потенциалом для ется его форма. Сорта с игольчатой формой зерновки
различения дикого кабана и домашней свиньи [Кипень составили 41,0%, с овальной — 53,8% и грушевидной —
В.Н. Использование полногеномных данных проектов 5,1%. Также одной из важных характеристик зерна явля-
NGS для поиска решения криминалистической задачи ются глубина и ширина брюшной бороздки. В изучаемой
по дифференциации диких кабанов и домашних свиней коллекции были образцы с глубокой бороздкой, которые
на основе анализа SNP / Молекулярная диагностика. М.. составили 25,4% из всего набора образцов. Среднюю глу-
2017. Т.2. с.305]. На данный момент задача по диффе- бину брюшной бороздки имели 50,2% и мелкую — 24,4%.
ренциации может быть решена с использованием анали- Из общего количества изученных образцов с широкой
за двух ОНП — c.367G>A (ген MC1R) и g.299084751C>T бороздкой были 29,6% образцов, с узкой — 70,4%. Од-
(ген NR6A1), — сбалансированная точность предсказания ним из важных морфологических признаков зерна го-
составляет не менее 98,5% [Кипень В.Н. и др. Использо- лозерных сортов овса является его опушенность. В про-
вание двухлокусных SNP-систем для дифференциации в цессе изучения коллекционных образцов было выделено
семействе Свиные при проведении судебно-экспертных 4 степени опушения: сильное — 7,5%, среднее — 38,5%,
исследований / Генетика популяций: прогресс и перспек- слабое — 49,3%, без опушения — 4,7%. При оценке зер-
тивы. М.,2017. с.130]. Однако для повышения точности на, особенно для производства муки, необходима геоме-
дифференцирования могут быть использованы выявлен- трическая характеристика (линейные размеры, форма,
ные нами полиморфные варианты в гене гефестина — объем, площадь внешней поверхности). Геометрическая
HEPH. Нашей целью было оценить частоту распростра- характеристика зерна голозерных сортов овса позволила
ненности полиморфизма rs80981028 среди особей дикого рассчитать у них содержание эндосперма. Установлено,
кабана и домашней свиньи, как обладающего потенци- что содержание эндосперма у крупнозерных сортов вы-
ально высоким дифференцирующим потенциалом для ше, чем у мелкозерных. Доля эндосперма у крупнозер-
их различения. Определение генотипа по rs80981028 осу- ных образцов оставляла 82,20—83,98%. Изучение голо-
ществляли с использованием метода ПЦР-ПДРФ (эндо- зерных образцов овса по морфологическим признакам,
нуклеаза рестрикции NdeI, NEB, США). ПЦР проводили линейным размерам и геометрическим показателям зер-
в объеме 15 мкл в термоциклире CFX96 Touch (Bio-Rad, новки показало, что они в большой степени зависели от
США). Сбалансированную точность предсказания оце- генотипа. Выделены источники хозяйственно ценных
нивали с использованием ROC-анализа (в SPSS v.20.0) признаков, которые могут быть рекомендованы для ис-
и MDR v.3.0.2. В исследование были включены следую- пользования в селекции овса голозерного на продоволь-
щие группы: выборка образцов биологического матери- ственные цели: без опушения зерновки; с низким содер-
ала дикого кабана (n=150) и домашней свиньи (n=210). жанием пленчатых зерен; крупнозерные с высоким со-
В результате проведенного нами исследования показа- держанием эндосперма.
но, что генотип С/С был выявлен для всех 210 особей
домашней свиньи, вне зависимости от породной при-
надлежности. Для выборки дикого кабана распределе-
ние оказалось следующим: генотип С/С был выявлен в
3,3% (5/150) случаев, T/C — 12,7% (19/150), Т/Т — 84,0% ***
(126/150). Таким образом, нами на выборке из 150 ди-

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 29


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

АНАЛИЗ ДИФФЕРЕНЦИАЛЬНОЙ ЭКСПРЕССИИ ции образуется большой канал, через который проходят
РЕТРОТРАНСПОЗОНОВ В РАКОВОЙ И цитохром С и протеаза AIF (Apoptosis Inducing Factor), так-
НОРМАЛЬНОЙ ТКАНИ ПРЕДСТАТЕЛЬНОЙ же VDAC1 регулирует апоптоз через взаимодействие с гек-
ЖЕЛЕЗЫ С ИСПОЛЬЗОВАНИЕМ сокиназой, белками Bcl-2 и Bcl-xL. Показано, что факто-
ры, индуцирующие митохондриальный путь апоптоза че-
ТРАНСКРИПТОМНЫХ ДАННЫХ
рез VDAC1, эффективны при терапевтическом лечении
А.В. Каныгина, Е.С. Котова рака. Подобным фактором является фотодинамическое
воздействие с применением фотосенсибилизаторов пор-
ФБГУ Федеральный научно-клинический центр физико-
фиринового ряда, обладающих сродством к мембранам ми-
химической медицины Федерального медико-биологического
агентства, 119435, Москва, Россия; e-mail: kanygina@rcpcm.org тохондрий. При фотодинамическом воздействии идет ге-
нерация свободных радикалов, повреждающих липиды в
Транскрипционная активность ретротранспозонов, мембране митохондрий, в результате чего происходит пер-
способных к перемещению, является возможной причи- воначальное падение мембранного потенциала. Измене-
ной геномной нестабильности. Кодируемые ими белки спо- ние потенциала увеличивает вероятность открытия пор ка-
собны расщеплять ДНК, что может приводить к хромосо- нала VDAC1, через которые выходят проапоптические бел-
мным перестройкам. Встраивание новых копий ретроэле- ки, инициируя каскад реакций апоптоза. Актуальным
ментов в геном ведет к дерегуляции экспрессии генов и представляется поиск фотосенсибилизаторов, способных
может способствовать хромосомным перестройкам за счет индуцировать апоптоз в раковых клетках путем модуляции
рекомбинации. Существуют свидетельства того, что обра- VDAC1, что в дальнейшем позволит улучшить эффектив-
зование хромосомных перестроек, характерных для рака ность фотодинамической терапии рака.
предстательной железы, связано с активацией ретротранс-
позонов. Ретротранспозоны человека, сохранившие спо-
собность к перемещению, относятся к L1-элементам под- ***
семейства L1Hs, а также к эндогенным ретровирусам под-
семейства HERVK. Цель данной работы — выявление групп
ИССЛЕДОВАНИЕ ПРОФИЛЕЙ ЭКСПРЕССИИ
ретротранспозонов, дифференциально экспрессирующих-
ся в раковой и нормальной ткани предстательной железы,
ГЕНОВ МИКРОРНК У ПАЦИЕНТОВ
с использованием транскриптомных данных, предоставля- С МЕТАСТАТИЧЕСКИМ РАКОМ ПОЧКИ
емых ресурсом TCGA (The Cancer Genome Atlas). С исполь- Е.А. Климентова1, И.Р. Гилязова1,
зованием программных пакетов TEtranscript и SalmonTE
М.А. Бермишева1, А.А. Измайлов2,
был проведен анализ поли-А-транскриптомов опухолевой
и нормальной ткани 52 пациентов. Обоими алгоритмами
В.Н. Павлов2, Э.К. Хуснутдинова1
было показано повышение экспрессии эндогенных ретро- 1
Институт биохимии и генетики — обособленное
вирусов HERVK11 и HERVK11D. Данные ретроэлементы структурное подразделение Федерального государственного
относятся к подсемейству HERVK, для которого, в целом, бюджетного научного учреждения Уфимского федерального
исследовательского центра РАН, 450054, Уфа, Россия;
обе программы также показали повышенное содержание
РНК в опухолевой ткани по сравнению с нормальной. Для
2
ГБОУ ВПО Башкирский государственный медицинский
ретроэлементов L1HS не было обнаружено статистически университет Министерства здравоохранения Российской
Федерации, 450008, Уфа, Россия; e-mail: lissa987@yandex.ru
значимого изменения уровня экспрессии в опухолевой тка-
ни по сравнению с нормальной. В дальнейшем будет про- Исследование профиля экспрессии микроРНК при ме-
веден анализ взаимосвязи экспрессии групп ретроэлемен- тастатическом светлоклеточном раке почки (СРП) было
тов HERVK11 и HERVK11D с наличием хромосомных пе- проведено в 18 образцах первичной опухоли, 6 образцах
рестроек, характерных для рака предстательной железы. метастатической опухоли и 6 образцах нормальной ткани
Исследование выполнено при финансовой поддержке РФ- почек пациентов с СРП с использованием технологии
ФИ в рамках научного проекта №18-315-00363. OpenArray в QuantStudio 12K Flex Real-Time PCR System.
В настоящем исследовании было обнаружено значитель-
ное снижение экспрессии микроРНК-199b (FDR
*** p-value=0,0001) и микроРНК-582 (FDR p-value=0,0001) при
метастатическом СРП, чем таковая в прилежащей ткани и
РОЛЬ VDAC1 В ПОИСКЕ ЭФФЕКТИВНЫХ первичной опухоли. Выявленные микроРНК ранее не бы-
ФОТОСЕНСИБИЛИЗАТОРОВ ПРИ ли описаны при раке почки, но, учитывая данные литера-
туры о генах-мишенях этих микроРНК и процессах, в ко-
ФОТОДИНАМИЧЕСКОЙ ТЕРАПИИ РАКА
торых они участвуют, можно предположить их участие в
О.Ш. Карапетьян, М.Ю. Бибов, Н.М. Добаева инвазии и миграции опухолевых клеток и, следовательно,
в процессах метастазирования.
ФГБОУ ВО «Ростовский государственный медицинский
Работа выполнена при финансовой поддержке грантов
университет» Минздрава РФ, 344022, Ростов-на-Дону;
e-mail: biobooks@bk.ru РФФИ №17-44-020050 и №17-44-020498.
Потенциал-зависимый анионный канал 1 (Voltage-De-
pendent Anion Channel, VDAC1) внешней мембраны мито-
хондрий — многофункциональный канал, который кон- ***
тролирует поток метаболитов между митохондрией и ци-
топлазмой, участвует в транспорте ионов, энергетическом
и липидном обмене. VDAC1 — участник митохондриаль-
ного пути апоптоза клетки, так как при его олигомериза-

30 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

ИЗУЧЕНИЕ СТРЕССОУСТОЙЧИВОСТИ ных ядер, были не способны завязать семена при самоопы-
У ДОЛГОЖИВУЩИХ ОСОБЕЙ DROSOPHILA лении. Все потомство R1, полученное при самоопылении
MELANOGASTER, МУТАНТНЫХ ПО ГЕНУ E(Z) удвоенных гаплоидов, было диплоидным (определение
производилось как проточной цитометрией, так и прямым
Л.А. Коваль1, 2,, Н.В. Земская1, 2, М.В. Шапошников1, подсчетом хромосом) и визуально выровнено по всем хо-
А.А. Москалев1, 2, 3, 4 зяйственно-важным признакам, что представляет ценность
для дальнейшей селекционной работы.
1
Институт биологии Коми научного центра Уральского
отделения РАН, 167982, Сыктывкар, Россия;
ФГБОУ ВО «СГУ им. Питирима Сорокина», 167001,
2
***
Сыктывкар, Россия;
3
Московский физико-технический институт (государственный
университет), Московская обл., Долгопрудный, 141701, Россия; ЦЕЛЕНАПРАВЛЕННОЕ ОДНОНУКЛЕОТИДНОЕ
4
ФГБУН Институт молекулярной биологии им. В.А. Энгельгардта
РЕДАКТИРОВАНИЕ ПОЗВОЛЯЕТ
РАН, Москва, 119991, Россия; e-mail: lyubov.schilova@yandex.ru КОРРЕКТИРОВАТЬ СОТНИ ПАТОГЕННЫХ
Метилтрансфераза E(Z) метилирует H3K27 в Н3К4me3. ВАРИАНТОВ НАСЛЕДСТВЕННЫХ ЗАБОЛЕВАНИЙ
Данная метка необходима для работы ингибиторного ком- Е.В. Кондратьева1, А.В. Лавров1, 2, Г.Г. Вареников3,
плекса 2 (PRC2), который участвует в пролиферации и диф-
М.Ю. Скоблов1, 3
ференцировке клеток, а также в паттернах индивидуально-
го развития. В 2010 г. Сиболд и соавт. показали, что мутация ФГБНУ «Медико-генетический научный центр», Москва, Россия;
1

гена E(z) способна продлить жизнь Drosophila melanogaster на ФГБОУ ВО РНИМУ им. Н.И. Пирогова Минздрава России,
2

76%. В данной работе мы изучили возрастную устойчивость Москва, Россия;


особей Drosophila melanogaster, мутантных по гену E(z) к 3
Московский физико-технический институт, Долгопрудный,
стрессу эндоплазматической сети, окислительному стрессу Россия; e-mail: ekaterina.kondratyeva@gmail.com
и тепловому шоку. Полученные данные свидетельствуют о Недавно были разработаны новые инструменты на ос-
роли данной метилтрансферазы в формировании устойчи- нове CRISPR/Cas9, которые называются редакторами ос-
вости особей Drosophila melanogaster к стрессорам. нований (base editors, BE). Они представляют собой нукле-
Работа выполнена при поддержке гранта РФФИ N 14- отидные дезаминазы, слитые с Cas9 или его аналогом, и де-
50-00060. лают возможным направленную конверсию C(G) в T(A) и
A(T) в G(C) без введения двухцепочечных разрывов ДНК.
Это означает, что при наследственных заболеваниях может
*** быть исправлено 4 типа мутаций: T>C, A>G, C>T, G>A.
Однако BE активны в определенном «окне», состоящем из
ОЦЕНКА УРОВНЯ ПЛОИДНОСТИ УДВОЕННЫХ нескольких нуклеотидов, что ограничивает их потенциаль-
ГАПЛОИДОВ РЕДИСА, ПОЛУЧЕННЫХ ное использование. Для поиска оптимальных мишеней для
В КУЛЬТУРЕ ИЗОЛИРОВАННЫХ МИКРОСПОР применения BE в клинической практике был проведен био-
IN VITRO информатический и экспертный анализ известных мута-
ций. Все известные патогенные мутации из базы ClinVar
Е.В. Козарь, Е.А. Домблидес, А.В. Солдатенко, мы проанализировали на наличие PAM-последовательнос-
А.С. Домблидес тей вблизи и на отсутствие других потенциальных мише-
ФГБУН «Федеральный научный центр овощеводства», 143080,
ней для BE. В результате были созданы 4 базы данных му-
М.O., Одинцовский район, п. ВНИИССОК, Россия; e-mail: koz. таций, которые потенциально можно отредактировать с
leno4ek@gmail.com помощью наиболее изученных BE: BE3, Target-AID, dCpf1-
BE и ABE7.10, и обнаружили 344, 537, 148 и 1959 мишеней,
Получение удвоенных гаплоидов (DH-растений) в
соответственно. В итоге теоретически можно отредактиро-
культуре микроспор in vitro — один из биотехнологических
вать 13,8% всех патогенных мутаций T>C (A>G) и 10,5%
методов, сокращающий время создания гомозиготных ли-
мутаций C>T (G>A). Далее базу данных для системы Target-
ний до 1 года. DH-растения редиса европейского (Raphanus
AID мы оценили вручную: проанализировали ссылки на
sativus var. sativus) были получены из сорта РБК при исполь-
мутации в базах ClinVar, OMIM и HGMD и первичные
зовании сред: NLN-13 (Lichter, 1982) и модифицирован-
источники, оценивая доказанность патогенности и часто-
ной MS (Murashige and Skoog, 1962) с 13% сахарозой — для
ту встречаемости мутаций. В итоге были найдены 3 мута-
индукции эмбриогенеза; МS с 0,1 мг/л бензиламинопури-
ции: гомозиготная мутация 740A>G в гене KERA (причина
на (БАП) и 2% сахарозой — для регенерации; и безгормо-
плоской роговицы, распространена в Финляндии); мута-
нальной среды B5 — для укоренения. Максимальный вы-
ция 332A>G в гене KCNQ1 (синдром удлиненного QT,
ход составил 7 эмбриоидов на чашку Петри (микроспоры
Швеция); и мутация в некодирующей части (-26+2T>C)
из 5 бутонов), а потери на этапах регенерации и укорене-
гена SLC26A2 (дистрофическая дисплазия, Финляндия).
ния не превышали 30%. Анализ плоидности растений Ro
Обнаруженные мутации являются хорошими кандидатами
при прямом подсчете хромосом в меристемных клетках с
для разработки генной терапии с помощью модификации
использованием DAPI и пропионо-лакмоидного методов
CRISPR/Cas9.
окраски показал, что 81,8% растений — удвоенные гапло-
иды (2n=2x=18), а 18,2% — гаплоиды. Некоторые расте-
ния, содержащие двойной набор хромосом в меристемных
***
тканях и определенные миксоплоидами при оценке пло-
идности с использованием проточной цитометрии клеточ-

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 31


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

АНАЛИЗ ВРОЖДЕННОГО ИММУНИТЕТА тивной активности GCase при использовании ФШ, явля-
У МЫШЕЙ РАЗНЫХ ЛИНИЙ ющихся ингибиторами GCase (изофагомин, амброксол), в
макрофагах в исследуемых групп пациентов. Оценка фер-
М.В. Коновалова, Д.С. Царегородцева, ментативной активности GCase проводилась методом тан-
Е.В. Свирщевская демной масс-спектрометрии (ВЖХ-МСМС) в сухом пят-
ФГБУН Институт биоорганической химии им. академиков М.М. не клеток. Методом компьютерного моделирования была
Шемякина и Ю.А. Овчинникова РАН, 117997, Москва, Россия; создана гликозилированная модель мутантной GCase и
e-mail: mariya.v.konovalova@gmail.com описан механизм действия аллостерических ФШ GCase.
Генетические факторы определяют предрасположен- Исследование поддержано грантом РНФ №17-75-20159.
ность к различным заболеваниям. Цель данной работы —
***
оценка факторов врожденного иммунитета, к которым от-
носятся белки фибринолиза tPA и PAI-1, тканевые цито-
кины TSLP, ИЛ-25 и 33, и антимикробные пептиды ТЕЛОМЕРНЫЕ РИБОНУКЛЕОПРОТЕИНОВЫЕ
криптидин 4 (К4) и дефенсин 3 (Д3), у интактных мышей КОМПЛЕКСЫ НАРУШАЮТ БИОГЕНЕЗ
линий BALB/c (A), СBA (C) и C57BL/6 (L). Известно, что КОМПОНЕНТОВ МИТОТИЧЕСКОГО АППАРАТА
мыши линий А и L противоположны по реакциям адаптив- ПРИ ДИСФУНКЦИИ ТЕЛОМЕР В ПРОЦЕССЕ
ной иммунной системы. Для них характерно формирова- РАННЕГО РАЗВИТИЯ DROSOPHILA
ние Т-хелперов 2 (Тх2) и Т-хелперов 1-го типа ответов со-
ответственно. Для мышей линии С данных нет. Анализ ак- М.Ю. Кордюкова1, О.В. Побегуц2, И.О. Бутенко2,
тивации врожденной иммунной системы оценивали Ю.А. Абрамов1, О.М. Оленкина1, А.И. Калмыкова1
методом ПЦР в реальном времени с нормированием на 1
ФГБУН Институт молекулярной генетики РАН, Москва, Россия;
контрольный ген GAPDH. Показали, что у линии А в 5—20 2
ФГБУ ФНКЦ ФХМ ФМБА России, Москва, Россия; e-mail:
раз выше продукция tPA, PAI-1 и их отношение, а также kordyukova.maria@yahoo.com
Д3 в барьерных тканях — мышцах, легких, кишечнике и
коже. У мышей линии L в 1,5—2 раза был повышен К4, Ранее было показано, что механизмы поддержания це-
PAI-1 и TSLP в некоторых тканях. Не было значительных лостности концов хромосом дрозофилы тесно связаны с
различий по экспрессии генов ИЛ-25 и 33. Профиль экс- сайленсингом теломер. При дисфункции теломер Drosoph-
прессии факторов врожденного иммунитета у мышей ли- ila многочисленные теломерные РНК — транскрипты те-
ний С был близким к линии L (корреляция данных r=0,87, ломерного ретротранспозона HeT-A, а также белок HeT-A
p<0,001) и отличался от линии А (r=0,33, p>0,05). В целом Gag, накапливаются в ооците, транспортируются в эмбри-
по реактивности врожденной системы линии располага- он и формируют скопления рибонуклеопротеиновых
лись в ряду А>C>L. Таким образом, склонность к Тх2-от- (РНП) частиц у митотических полюсов, что сопровожда-
вету может быть связана с большей реактивностью факто- ется высоким уровнем эмбриональной смертности. Пред-
ров врожденного иммунитета. полагается, что теломерные РНП участвуют в теломерном
сигналинге при дисфункции теломер. Основной целью дан-
*** ного исследования было понять, как гиперэкспрессия
НеТ-А может влиять на процесс раннего развития Drosoph-
ila. На первом этапе было показано, что оверэкспрессия
РАЗРАБОТКА ПОДХОДОВ К ТЕРАПИИ БОЛЕЗНИ
HeT-A сама по себе в отсутствии каких-либо мутаций при-
ГОШЕ И БОЛЕЗНИ ПАРКИНСОНА водит к гибели эмбрионов. Действительно, когда трансген-
А.Э. Копытова1, М.А. Николаев1, 2, Г.Н. Рычков2, ный HeT-A гиперэкспрессировали в эмбрионах дрозофи-
К.А. Сенкевич1, 2, Г.В. Байдакова3, Е.Ю. Захарова3, лы, смертность 0—5-часовых эмбрионов увеличивалась в
3,5 раза (до 50%) по сравнению с контрольными. Следова-
А.К. Емельянов1, 2, С.Н. Пчелина1, 2
тельно, избыточные HeT-A РНП токсичны для эмбрионов.
1
Первый Санкт-Петербургский государственный медицинский Второй задачей является исследование самого механизма,
университет им. акад. И.П. Павлова, Санкт-Петербург; с помощью которого HeT-A РНП при оверэкспрессии мо-
2
Петербургский Институт Ядерной Физики гут нарушать развитие эмбрионов дрозофилы. Для этого
им. Б.П. Константинова НИЦ «Курчатовский институт», Гатчина; мы выделили белковый комплекс, ассоциированный с
3
Медико-генетический научный центр, Москва; e-mail: HeT-A Gag, из лизата эмбрионов дрозофилы и исследова-
kopytova_ae@pnpi.nrcki.ru ли его состав методом масс-спектрометрии. В составе ком-
Мутации в гене лизосомного фермента глюкоцеребро- плекса были обнаружены белки Polo и Сdk1-киназы, регу-
зидазы (GBA), приводящие к дисфункции фермента глю- лирующие митоз. Гиперэкспрессия HeT-A сопровождалась
коцереброзидазы (GCase), в гомозиготном состоянии вы- значительным увеличением содержания этих белков на
зывают болезнь Гоше (БГ), а в гетерозиготном состоянии поздних этапах оогенеза и в ранних эмбрионах, что может
повышают риск развития болезни Паркинсона (БП) в 6—7 быть причиной митотических нарушений. Таким образом,
раз?. Обсуждается использование фармакологических ша- нарушение биогенеза митотических киназ за счет их взаи-
перонов (ФШ) GСase для терапии как БГ, так и GBA- модействия с избыточными теломерными РНП, которые
ассоциированной БП (GBA-БП). Цель данного исследо- образуются при дисфункции теломер, может приводить к
вания — оценить эффективность восстановления активно- гибели эмбрионов.
сти GCase, воздействуя ФШ на макрофаги пациентов с БГ Работа поддержана Программой президиума РАН «Мо-
и GBA-БП. Нами было проведено культивирование макро- лекулярная и клеточная биология» и темой НИР 01201355491.
фагов пациентов с БГ (n=6), GBA-БП (n=3) и лиц кон-
трольной группы (n=3). Показано увеличение фермента- ***

32 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

ВЫДЕЛЕНИЕ БЕЛКА-АРГОНАВТА ИЗ RUNELLA 9,66. Результаты оценки клеточной локализации in silico


SLITHYFORMIS И ИССЛЕДОВАНИЕ ЕГО показывают, что 12 SAP находятся в цитоплазме, 9 — секре-
КАТАЛИТИЧЕСКОЙ АКТИВНОСТИ тируются. Анализ последовательностей, расположенных не-
посредственно перед первым кодоном генов, кодирующих
Е.В. Кропочева1, Д.М. Есюнина1, А.А. Аравин2, SAP, показал, что на регуляцию их экспрессии могут влиять
А.В. Кульбачинский1 растительные гормоны, кальмодулин, изменение уровня ос-
вещенности, а также стрессовые воздействия.
1
ФГБУН Институт молекулярной генетики Российской академии
наук, Москва 123182, Россия;
***
2
Отделение Биологии и Биологической Инженерии,
Калифорнийский технологический университет, Пасадена,
CA 91125, США;-e-mail: katerinakropocheva@ya.ru ВЛИЯНИЕ ЭКЗОСОМ СМЖ И ПЛАЗМЫ КРОВИ
Белки-аргонавты эукариот активно исследуются как ПАЦИЕНТОВ С БОЛЕЗНЬЮ ПАРКИНСОНА
основные действующие факторы РНК-интерференции и НА ВЫЖИВАЕМОСТЬ НЕЙРОНАЛЬНЫХ КУЛЬТУР
эпигенетической регуляции. Большое количество видов
архей и бактерий также имеет гены, кодирующие белки Д.Г. Кулабухова1, 2, Л.А. Гараева1, Т.А. Штам1,
этой группы. Однако функции белков-аргонавтов в бакте- Р.А. Камышинский1, 3, Е.Ю. Варфоломеева1,
риальной клетке до сих пор остаются невыясненными. Для Н.А. Верлов1, А.В. Волницкий1, С.Б. Ланда1,
исследования мы выбрали аргонавт из штамма DSM-19594 К.А. Сенкевич1, 2, И.В. Милиюхина1, 2, 5,
Runella slithyformis и экспрессировали его в клетках Г.В. Гаврилов4, А.К. Емельянов1, 2, С.Н. Пчелина1, 2
Escherichia coli. Очистку белка производили с использова- 1
ФБГУ «Петербругский Институт Ядерной Физики
нием металл-аффинной и катионообменной хроматогра-
им. Б.П. Константинова Национального Исследовательского
фии. В реакциях in vitro было показано, что аргонавт R. Центра «Курчатовский Институт», 188300, Ленинградская
slithyformis способен специфично разрезать одноцепочеч- область, Гатчина, Россия;
ную ДНК с использованием коротких (18 нт) 5’-фосфори- 2
Первый Санкт-Петербургский государственный медицинский
лированных гидовых ДНК в присутствии ионов Mn2+, но университет им. акад. И.П. Павлова, 197022, Санкт-Петербург,
не Mg2+. При этом скорость реакции расщепления зависит Россия;
от 5’-концевого нуклеотида. С РНК-гидами разрезания 3
Национальный исследовательский центр «Курчатовский
ДНК-мишени не происходит. Таким образом, аргонавт R. институт», 123182, Москва, Россия;
slithyformis является ДНК-зависимой ДНК-нуклеазой. 4
Военно-медицинская академия им. С.М. Кирова МО РФ,
194044, Санкт-Петербург, Россия;
*** 5
Федеральное государственное бюджетное научное учреждение
«Институт экспериментальной медицины», 197376,
ИДЕНТИФИКАЦИЯ СТРЕСС- Санкт-Петербург, Россия; e-mail: kulabuhova_dg@pnpi.nrcki.ru
АССОЦИИРОВАННЫХ БЕЛКОВ, СОДЕРЖАЩИХ Считается, что перенос патогенных форм альфа-сину-
ДОМЕНЫ ЦИНКОВЫХ ПАЛЬЦЕВ A20/AN1 клеина экстраклеточными везикулами, в частности экзо-
В ГЕНОМЕ ЯБЛОНИ сомами (80—100 нм), может являться ключевым моментом
патогенеза при болезни Паркинсона (БП). Цель настояще-
П.В. Кузмицкая, О.Ю. Урбанович го исследования — оценка влияния экзосом спинномозго-
Институт генетики и цитологии НАН Беларуси, 220072, Минск, вой жидкости (СМЖ) и плазмы крови пациентов с БП на
Республика Беларусь; e-mail: p.kuzmitskaya@igc.by выживаемость нейрональных клеточных линий. Экстра-
клеточные везикулы были выделены методом последова-
Стресс-ассоциированные белки (SAP, stress-associated
тельного ультрацентрифугирования из СМЖ 12 пациентов
proteins) представляют собой транскрипционные факторы
с БП и 2 пациентов с синдромом Хакима—Адамса и плаз-
с цинковыми пальцами, содержащие домены A20 и(или)
мы периферической крови 12 пациентов с БП, 4 пациен-
AN1. Уровни экспрессии кодирующих их генов изменяют-
тов с болезнью Гоше (БГ) и 5 представителей контрольной
ся под воздействием стресса у животных и растений. Цель
группы, и охарактеризованы с использованием анализа тра-
данной работы — идентификация генов, кодирующих SAP,
екторий наночастиц (NTA), метода динамического свето-
в геноме яблони домашней сорта Golden Delicious, анализ
рассеяния, цитометрического анализа, просвечивающей и
структурной организации гипотетических SAP из генома
криоэлектронной микроскопии. Оценка выживаемости
яблони и оценка их промоторных областей Поиск генов, ко-
нейрональных клеточных линий (нейробластома IMR32,
дирующих SAP, проведен с помощью ПО hmmer3. Под-
нейроглиома) при со-культивации с экзосомами СМЖ и
тверждение принадлежности генов-кандидатов к семейству
плазмы крови с использованием МТS теста, метода импе-
SAP выполнено с помощью SMART. Мы обнаружили 21 ген,
дансометрии и проточной цитометрии не выявила разли-
каждый из которых кодирует белок, содержащий как мини-
чий между исследуемыми группами. В составе микровези-
мум один домен цинковых пальцев AN1. Из их числа у 12
кул плазмы крови пациентов с БГ методом динамическо-
гипотетических белков N-конец содержит домен цинковых
го светорассеяния и цитометрией показано превалирование
пальцев A20, С-конец — домен AN1, что является наиболее
CD9 положительных микровезикул размером 80—100 нм
характерной структурой для SAP растений. Два белка име-
по сравнению с контрольной группой. Впервые была про-
ют комбинацию AN1-AN1, и столько же — AN1-С2Н2. У
ведена криоэлектронная микроскопия экзосом СМЖ.
пяти белков имеется только по одному домену AN1. Гипо-
Исследование поддержано грантом РФФИ №18-015-
тетические SAP яблони являются щелочными и имеют дли-
00262 А.
ну 109—293 а.к. (молекулярный вес 11,5—32 кДа). Расчет-
ные изоэлектрические точки колеблются в пределах 6,51—
***

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 33


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

НОВЫЕ ТАНДЕМНЫЕ ПОВТОРЫ, в увеличение разнообразия генетических вариантов вносят


ИДЕНТИФИЦИРОВАННЫЕ В ГЕНОМЕ и пациенты, инфицированные за пределами страны, воз-
ЯПОНСКОГО ПЕРЕПЕЛА можно, нетипичными для России вариантами ВИЧ.
Цель нашей работы — анализ мутаций лекарственной
М.М. Кулак1, А.С. Комиссаров1, А.Г. Демин2, устойчивости ВИЧ у пациентов, заразившихся за предела-
В. Фийон3, А.Ф. Сайфитдинова1, О.А. Павлова1, ми Российской Федерации.
Е.Р. Гагинская1, С.А. Галкина1 Материал и методы. Мы проанализировали 2690 по-
1 следовательностей, имеющихся в лабораторной базе дан-
Санкт-Петербургский государственный университет, 199034,
ных, а также те российские последовательности из базы
Санкт-Петербург, Россия;
данных GenBank, для которых имелись следующая инфор-
2
Саратовский государственный медицинский университет
мация: путь заражения, подтип, установленное наличие/
им. В.И. Разумовского Минздрава РФ, 410012, Саратов, Россия;
отсутствие терапии. Анализ наличия мутаций лекарствен-
3
Национальный институт с.-х. исследований, 31326 Кастане- ной устойчивости проводился с помощью он-лайн про-
Толозан, Франция; e-mail: ontica@mail.ru
граммы CPR (http://cpr.stanford.edu/cpr.cgi) и HIVdb
Многокопийные тандемно расположенные последова- Program (https://hivdb.stanford.edu/hivdb/by-mutations/).
тельности (тандемные повторы, ТП) являются неотъемлемой Результаты. Из всех проанализированных пациентов
частью геномов эукариот. Протяженные блоки ТП образуют для 14 предполагаемое место инфицирования находилось
центромерные, перицентромерные, а иногда и теломерные за пределами Российской Федерации. Трое из 14 пациен-
области хромосом. Для более коротких массивов ТП показа- тов на момент забора крови для исследования получали
на роль в регуляции экспрессии генов, в том числе генов ко- АРТ. Мутации ЛУ были обнаружены у одного из них. Ин-
личественных признаков, они могут быть причиной параму- тересен тот факт, что была обнаружена мутация ЛУ K103N
таций. Многокопийность, полиморфность, зачастую обога- к ННИОТ, при этом в известной схеме терапии препара-
щенность ГЦ-нуклеотидами, отсутствие совершенных тов данной группы не было.
методов их сборки и аннотирования при секвенировании це- Вывод. На основе анализа известных данных можно
лых геномов, — основные причины недостаточной изучен- сделать предположение о том, что в настоящее время вклад
ности ТП даже в геномах модельных и сельскохозяйственных заносов вариантов ВИЧ, имеющих мутации ЛУ, из других
видов. Японский перепел Coturnix japonica — один из самых стран в эпидемию ВИЧ-инфекции в Российской Федера-
высокопродуктивных с.-х. видов птиц, а также модельный ции небольшой, тем не менее отдельные случаи обнаруже-
объект биомедицины, биологии развития и физиологии по- ния вариантов с лекарственной устойчивостью требуют
ведения. Геном перепела был одним из первых, исследован- пристального внимания и слежения.
ных на присутствие сателлитной ДНК. В нашей работе мы Работа выполнена благодаря финансовой поддержке про-
выполнили анализ баз сырых данных секвенирования и иден- екта РНФ № 15-15-00050П (2018-2019).
тифицировали 23 новых ТП, составляющих по меньшей ме-
ре 4,8% генома перепела. С помощью флуоресцентной гибри- ***
дизации in situ мы показали, что выявленные нами ТП входят
в состав гетерохроматина коротких плеч субметацентриче- РАЗРАБОТКА ДРОЖЖЕВОЙ МОДЕЛИ
ских микро- и акроцентрических макрохромосом CJA3 и ДЛЯ ФЕНОТИПИЧЕСКОГО АНАЛИЗА
CJA4. ТП CjapSAT с базовой повторяющейся единицей ~1180
КОНФОРМАЦИОННОГО ПЕРЕХОДА
п.н. входит в состав перицентромерных районов CJA 1—6 и
по крайней мере трех пар микрохромосом, а также в состав ПРИОННОГО БЕЛКА PRP
p- и q-плеч CJAW. Полученные данные дополняют имеющи- В.В. Лашкул1, Д.В. Качкин1, Ю.О. Чернов1, 2,
еся данные об организации и эволюции геномов птиц. А.А. Рубель1
Техническая и финансовая поддержка: Центр геномной
биоинформатики им. Ф.Г. Добржанского, РЦ ЦКП «Хромас»,
1
Санкт-Петербургский государственный университет, Научная
РЦ «РМиКТ» Научного парка СПбГУ, мероприятие 4 СПбГУ лаборатория биологии амилоидов, Санкт-Петербург, Россия;
(проект №1.40.1625.2017).
2
Технологический институт Джорджии, Атланта, США;
e-mail: lashkulvv@mail.ru
*** Болезни неправильной укладки являются весьма рас-
пространенными заболеваниями, характеризующимися не-
АНАЛИЗ МУТАЦИЙ ЛЕКАРСТВЕННОЙ правильной укладкой определенных белков организма. К
УСТОЙЧИВОСТИ ВИЧ У ПАЦИЕНТОВ, таким заболеваниям относятся болезнь Альцгеймера и при-
ЗАРАЗИВШИХСЯ ЗА ПРЕДЕЛАМИ РОССИЙСКОЙ онные заболевания, так как они ассоциированы с агрегаци-
ей амилоидных белков Aβ и PrP, что является характерной
ФЕДЕРАЦИИ
чертой этих расстройств. На сегодняшний день все они яв-
В.Ю. Лага ляются неизлечимыми. Удобным модельным объектом для
изучения амилоидов млекопитающих in vivo являются дрож-
ФГБУ «НИЦЭМ им. Н.Ф. Гамалеи» Минздрава России, 123098,
Москва, Россия. e-mail vita.laga@mail.ru
жи Saccharomyces cerevisiae, так как формируемые в дрожжах
агрегаты не токсичны и вместе с этим сходны с агрегатами,
ВИЧ-инфекция — проблема, актуальная для всех стран, выявляемыми у млекопитающих. На данный момент фено-
в том числе и для России. Повсеместное распространение типическая детекция агрегации белков в дрожжах невозмож-
антиретровирусной терапии, с одной стороны, и отсутствие на. В нашей лаборатории разрабатывается дрожжевая мо-
приверженности у пациентов и перебои с терапией, с дру- дель, позволяющая по фенотипу оценивать амилоидоген-
гой стороны, приводят к постепенному увеличению часто- ный статус белков и проводить масштабный поиск факторов,
ты встречаемости лекарственной устойчивости ВИЧ. Вклад влияющих на процессы амилоидогенеза. В качестве репор-

34 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

тера мы используем C-терминальную последовательность рующих возраст. На сегодняшний день основная часть дан-
дрожжевого фактора терминации трансляции — Sup35. В ных, описывающих взаимосвязь профилей метилирования
штаммах, маркированных нонсенс-мутацией ade1-14 и не- с возрастом, получена с использованием технологии
сущих делецию хромосомной копии SUP35, гибридный бе- ДНК-чипов Illumina Methlylation BeadChip450k. Однако
лок, включающий последовательность изучаемого амилои- данный метод не практичен для применения в обычных су-
догенного белка и репортерную последовательность, дол- дебных лабораториях, которые обычно имеют дело с огра-
жен эффективно выполнять функции терминатора ниченным количеством ДНК. Поэтому необходима разра-
трансляции, что можно детектировать по отсутствию роста ботка панелей, состоящих из небольшого числа CpG мар-
дрожжей на селективной среде без аденина. Агрегация ами- керов, обеспечивающих высокую точность прогнози-
лоидогенного белка будет приводить к росту штаммов на се- рования на различных платформах, например, пиросекве-
лективной среде. В настоящее время нами разрабатывают- нирование, MassArray и MS-SnuPE. Для разработки прай-
ся дрожжевые модели для фенотипического анализа агрега- меров для MS-SnuPE анализа нами были выбраны СрG ло-
ции мышиного белка PrP и пептида Aβ человека. кусы, которые находятся в составе последовательности ге-
Работа выполнена при поддержке грантов РНФ №14- нов ELOVL2, F5 и ZYG11A, поскольку для данных CpG
50-00069 и РФФИ №18-04-00799. Для выполнения иссле- была показана зависимость уровня метилирования от воз-
дований использовалась приборная база РЦ «ЦКП ХРО- раста во многих независимых исследованиях. Для ампли-
МАС» и «РМиКТ» научного парка СПбГУ. фикации геномной ДНК, обработанной бисульфитом на-
трия, были использованы ПЦР-праймеры, разработанные
*** J. Naue и соавт. (2017), а внутренние праймеры для целе-
вых CpG в ПЦР-продуктах были разработаны нами с ис-
РАЗРАБОТКА MS-SNUPE ПРАЙМЕРОВ ДЛЯ пользованием программы BatchPrimer3 v1.0. Последова-
ОПРЕДЕЛЕНИЯ СТАТУСА МЕТИЛИРОВАНИЯ тельности праймеров указаны в таблице.
Созданные праймеры будут использованы для разра-
ГЕНОВ ЧЕЛОВЕКА ELOVL2, F5 И ZYG11A
ботки методики определения вероятного возраста неиз-
В.А. Лемеш, М.В. Богданова, А.А. Буракова, вестного индивида по образцу его ДНК.
О.И. Добыш, В. Н. Кипень, А.А. Виноградов
***
Государственное научное учреждение «Институт генетики
и цитологии НАН Беларуси», Минск, Беларусь; e-mail:
m.bogdanova@igc.by
В настоящее время метилирование ДНК является од-
ним из наиболее перспективных биомаркеров, прогнози-

Последовательности праймеров к генам человека для анализа метилирования ДНК


№ Название Illumina ID Последовательность праймеров, 5’-3’ Размер Размер
гена для CpG фрагмента, п.н. MS-SnuPE
1 ELOVL2 cg16867657 F GGYGATTTGTAGGTTTAGT 156 21
R ACCCAACTATAAACAAAACCAAC
MS-SnuPE CTCCRTAAACRTTAAACCRCC
2 F5 cg16054275 F GGAGTTATTTGTTTAAGGTGGTT 146 24
R AACTATATCCCTCCATTTCCAC
MS-SnuPE CCTACCAACACCACAAAAACAATC
3 ZYG11A cg06784991 F AGGTATTTGTTGGGGAGTGT 170 26
R CTCAAAACRCAAATTCCAC
MS-SnuPE CCTAAAAAAAACTCRACATCTAAACC

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 35


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

ВЫДЕЛЕНИЕ НУКЛЕАЗЫ, АССОЦИИРОВАННОЙ репарации ошибочно спаренных оснований. Кроме того,


С БЕЛКОМ-АРГОНАВТОМ БАКТЕРИИ гипертермия сама является повреждающим ДНК факто-
RHODOBACTER SPHAEROIDES ром. Ранее нами было показано, что гипертермия может
приводить к образованию как одноцепочечных, так и дву-
Л.А. Лисицкая1, А.А. Комар2, Д.М. Есюнина1 цепочечных разрывов ДНК в клетках человека. Интерес-
ФГБУН Институт молекулярной генетики РАН, 123182,
1 но, что образование двуцепочечных разрывов ДНК вслед-
Москва, Россия; ствие гипертермии происходит только в клетках, находя-
2
Center for Gene Regulation in Health and Disease and Department
щихся в G1- и G2-фазах клеточного цикла, в то время как
of Biological, Geological and Environmental Sciences, Cleveland в S-фазе гипертермия приводит к замедлению/аресту ре-
State University, Cleveland, OH, 44115, USA; пликации ДНК и образованию только одноцепочечных
e-mail: lisitskaya@img.ras.ru разрывов ДНК. Тем не менее, в S-фазе гипертермия инду-
Белки-Аргонавты являются центральным компонен- цирует PIKK-зависимый ответ на повреждения ДНК, в
том систем РНК-интерференции эукариот. Cпецифичность частности, фосфорилирование гистона H2AX по сери-
действия этих белков обеспечивается связыванием корот- ну-139 (gammaH2AX). Нами было продемонстрировано,
ких «гидовых» молекул нуклеиновых кислот, которые слу- что предотвращение такого фосфорилирования приводит
жат для распознавания и расщепления комплементарных к образованию двуцепочечных разрывов ДНК в клетках,
мишеней. Белок-Аргонавт альфапротеобактерии Rhodo- находящихся в S-фазе клеточного цикла, и последующей
bacter sphaeroides (RsAgo) использует гидовые РНК для уз- гибели этих клеток. Более того, был охарактеризован мо-
навания ДНК-мишеней, но не обладает нуклеазной актив- лекулярный механизм восстановления репликации после
ностью из-за замен аминокислотных остатков в активном индуцированного гипертермией ареста. Была детально ис-
центре. Однако RsAgo может вызывать расщепление плаз- следована роль PIKK-киназ в предотвращении образова-
мидной ДНК in vivo за счет действия дополнительных ну- ния сложнорепарируемых повреждений ДНК вследствие
клеаз. Известно, что гены, кодирующие неактивные про- индуцированного гипертермией ареста репликации. В част-
кариотические белки-Аргонавты, часто расположены ря- ности, мы показали, что для предотвращения образования
дом с генами, кодирующими предполагаемые нуклеазы. сложнорепарируемых повреждений ДНК необходима ак-
Рядом с белком RsAgo тоже закодирована предполагаемая тивность PIKK-киназы ATR, для привлечения в вилку ре-
нуклеаза — белок из семейства PD-(E/D)xK-нуклеаз, ген пликации белка BRCA1, который необходим для «защиты»
которого имеет перекрывающуюся рамку считывания с ге- остановленной вилки репликации. Методом солевых экс-
ном RsAgo. Цель нашей работы — выделение этой нукле- тракций было показано, что тепловой стресс приводит к
азы и исследование ее свойств in vivo. Многочисленные по- инактивации белка BRCA1. Кроме того, мы показали, что
пытки экспрессировать природный ген нуклеазы в клетках в случае теплового стресса функции белка BRCA1 (на фо-
E. coli не привели к успеху из-за низкого уровня экспрес- не его инактивации) выполняет белок PARP, который мар-
сии и низкой растворимости рекомбинантного белка. Для кирует остановленные вилки репликации поли(АДФ-ри-
обеспечения эффективной суперпродукции нуклеазы в бозой).
E.coli была создана кодон-оптимизированная последова- Работа проводится при поддержке Российского научно-
тельность гена нуклеазы, что позволило достичь высокого го фонда (грант №17-74-20030).
уровня ее экспрессии. Очистку белка осуществляли с по-
мощью металл-хелатной аффинной хроматографии, чи-
стота полученного образца составляла не менее 98%. Даль- ***
нейшее изучение каталитических свойств полученной ну-
клеазы и ее взаимодействий с белком RsAgo поможет НОКАУТ МЕТИЛТРАНСФЕРАЗЫ SET7/9
установить механизмы процессинга нуклеиновых кислот ПОВЫШАЕТ ЧУВСТВИТЕЛЬНОСТЬ КЛЕТОК РАКА
и функции этого белка в клетках бактерий. ЛЕГКОГО К ГЕНОТОКСИЧЕСКИМ ПРЕПАРАТАМ
Работа выполнена при поддержке гранта Правитель-
ства Российской Федерации (договор 14.W03.31.0007). В.А. Мамонтова1, А.В. Петухов1, 2, О.Ю. Шувалов1,
О.А. Федорова1, Н.A. Барлев1, А.А. Дакс1
Институт цитологии Российской академии наук,
1

Санкт-Петербург, 194064, Россия;


*** 2
Медицинский исследовательский центр им. В.А. Алмазова, Санкт-
Петербург, 197341, Россия; e-mail: victoria.shubina@icloud.com
РОЛЬ ФОСФАТИДИЛИНОЗИТОЛ 3-КИНАЗА
ПОДОБНЫХ КИНАЗ (PIKK) В Известно, что метилтрансфераза Set7/9 осуществля-
ИНДУЦИРОВАННОМ ГИПЕРТЕРМИЕЙ ет эпигенетическую регуляцию путем метилирования ги-
стона Н3. Также в список ее мишеней входят транскрип-
РЕПЛИКАТИВНОМ СТРЕССЕ
ционные факторы: р53, E2F1, YAP и др. Эти мишени игра-
А.В. Лужин, А.К. Величко, Н.В. Петрова, ют ключевые роли в регуляции клеточного цикла,
О.Л. Кантидзе апоптоза, стрессового ответа, а взаимодействие с p53 мо-
жет указывать на участие Set7/9 в подавлении развития
ФГБУН Институт биологии гена РАН, Москва, 119334, Россия; опухоли. Таким образом, регуляция активности Set7/9 мо-
e-mail: artyom.luzhin@gmail.com
жет влиять на чувствительность клеток к ДНК-поврежда-
Известно, что гипертермия может ингибировать неко- ющим препаратам. Используя ранее полученную линию
торые белковые факторы-участники различных систем ре- клеток немелкоклеточной карциномы легкого человека
парации, включая системы репарации двуцепочечных раз- А549 с нокаутом Set7/9, нами было показано, что отсут-
рывов ДНК, системы эксцизионной репарации и систему ствие функционального белка Set7/9 увеличивает чувстви-

36 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

тельность раковых клеток к генотоксическим препаратам: СОЗДАНИЕ РЫБ ЗЕБРАДАНИО (DANIO RERIO)
доксорубицину и цисплатину. Более того, было проде- С НОКАУТАМИ ПО ГЕНАМ ТРАНСПОРТЕРОВ
монстрировано, что нокаут Set7/9 приводит к увеличению СЕРОТОНИНА (SLC6A4A И SLC6A4B) КАК
количества апоптотических клеток в ответ на действие МОДЕЛИ АФФЕКТИВНЫХ РАССТРОЙСТВ
этопозида. Мы также исследовали чувствительность к пре-
паратам и апоптотический индекс у клеток А549, подвер- Д.А. Мешалкина1, М.А. Казалов2, Э.В. Кисель1,
гавшихся воздействию (R)-PFI-2 — селективного инги- И.В. Мизгирев3, Я.В. Федорова4, А.Н. Козлова1,
битора Set7/9. Е.Б. Малашичев1
Работа поддержана грантом РНФ №17-75-10198.
1
Санкт-Петербургский государственный университет (СПбГУ),
199034, Санкт-Петербург, Россия;
***
2
Санкт-Петербургский политехнический университет Петра
Великого (СПбПУ), 195251, Санкт-Петербург, Россия;
ЭФФЕКТИВНАЯ ТРАНСДУКЦИЯ
3
ФГБУ «НМИЦ онкологии им. Н.Н. Петрова» Минздрава
России, 197758, Санкт-Петербург, Россия;
ФИБРОБЛАСТОВ ЛАСТОНОГИХ С ПОМОЩЬЮ 4
Сколковский Институт науки и технологии, 121205, Москва,
НЕИНТЕГРАТИВНЫХ ВЕКТОРОВ Россия; e-mail: postoronniiW@yandex.ru
А.Г. Мензоров1, 2, В.Р. Беклемишева3 Рыбы D. rerio с нокаутом по генам транспортеров серо-
1
ФГБНУ Федеральный исследовательский центр Институт
тонина будут являться ценными для моделирования аффек-
цитологии и генетики Сибирского отделения Российской тивных расстройств. Для создания таких рыб было выбрано
академии наук, 630090, Новосибирск, Россия; редактирование генома при помощи системы CRISPR/Cas в
2
ФГАОУВО Новосибирский национальный исследовательский двух вариантах рибонуклеопротеидных комплексов — sgR-
государственный университет, 630090, Новосибирск, Россия; NAс SpCas9 и crRNA c LbCpf1. Помимо slc6a4a и slc6a4b в ка-
ФГБУН Институт молекулярной и клеточной биологии
3 честве мишени-маркера также был использован ген slc45a2,
Сибирского отделения Российской академии наук, 630090, нокаут которого приводит к нарушению пигментации. Сфор-
Новосибирск, Россия; e-mail: menzorov@bionet.nsc.ru мированные комплексы вводили в зиготу микроинъекцией
Одно из ключевых событий в биологии развития — по- перед прохождением первого деления. На 3-й день развития
лучение индуцированных плюрипотентных стволовых кле- часть эмбрионов из каждой группы забирали для анализа на
ток (ИПСК). Цель исследования — поиск условий репро- наличие мутаций в целевых генах с помощью Т7 эндонукле-
граммирования фибробластов ластоногих, представителей азы I и секвенирования по Сэнгеру. Обнаружено, что оба ва-
каноидной ветви Хищных. Мы сравнили две системы до- рианта комплексов вызывают появление мутаций в целевых
ставки репрограммирующих транскрипционных факторов: локусах, хотя эффективность варьировала в пределах от 5,9%
лентивирусные векторы и вектор на основе вируса Сендай, для slc6a4b-2-Cpf1 до 90,2% для slc45a2-3-Cpf1 (согласно ал-
преимущество которого — отсутствие встройки в геном. горитму TIDE (Brinkman и соавт., 2014)). При этом даже для
Флуоресцентный белок экспрессировали в фибробластах эмбрионов с высокой эффективностью редактирования бы-
семи видов ластоногих: северного морского котика ла характерна мозаичность — при полной утрате аллеля ди-
(Callorhinus ursinus), северного морского льва (Eumetopias кого типа мы обнаруживали широкий спектр делеций. Поэ-
jubatus), моржа (Odobenus rosmarus), морского зайца тому для выбора основателей мутантных линий будет прове-
(Erignathus barbatus), байкальской нерпы (Pusa sibirica), дено генотипирование потомков особей, несущих мутации.
кольчатой нерпы (Phoca hispida) и пестрой нерпы (Phoca Исследование выполнено при поддержке гранта РФФИ
largha). Мы показали, что система трансдукции на основе мол_а18-315-00375 и ресурсного центра Развитие молекуляр-
вируса Сендай обеспечивает стабильный уровень экспрес- ных и клеточных технологий Научного парка СПбГУ.
сии трансгена на 1—2 порядка выше, чем лентивирусы. По-
***
лученные данные позволяют предположить, что трансдук-
ция фибробластов ластоногих с помощью вируса Сендай СВЯЗЬ МЕЖДУ ИНДЕКСОМ МАССЫ ТЕЛА
предпочтительна для получения ИПСК ластоногих.
И СООТНОШЕНИЕМ FIRMICUTES
Исследование поддержано грантом РФФИ №17-04-00644
и бюджетным проектом №0324-2018-0016. Часть работы И BACTEMIDETES В МИКРОБИОМЕ КИШЕЧНИКА
проведена на базе ЦКП «Коллекция плюрипотентных куль- ВЗРОСЛОГО НАСЕЛЕНИЯ УКРАИНЫ
тур клеток человека и млекопитающих общебиологического В.В. Мосейко1, 2, А.К. Коляда1, 2, А.К. Сизенко3,
и биомедицинского направления» ФИЦ ИЦиГ СО РАН (http://
Л.А. Будовская3, К.С. Пучков3, Ю.В. Гавалко1,
ckp.icgen.ru/cells/; http://www.biores.cytogen.ru/brc_cells/
collections/ICG_SB_RAS_CELL). Использованы первичные М.С. Романенко1, 4, А.М. Вайсерман1
культуры фибробластов ластоногих из Коллекции культур 1
ГУ «Институт геронтологии им. Д.Ф. Чеботарева НАМН
клеток общебиологического назначения (№0310-2016-0002) Украины», Киев, Украина;
отдела разнообразия и эволюции геномов ИМКБ СО РАН. 2
Генетическая лаборатория, ООО «Diagen», Киев, Украина;
3
Национальный медицинский университет
им. А.А. Богомольца, Киев, Украина;
4
Национальная медицинская академия последипломного
***
образования им. П.Л. Шупика, Киев, Украина;
e-mail: moseykovlad@gmail.com
Исследовались отличия в составе основных типов ми-
кробиоты кишечника у взрослого населения Украины и их

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 37


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

связь с индексом массы тела (ИМТ). Обследован 61 взрос- чением скорости сканирования наблюдается увеличение си-
лый в возрасте от 19 до 76 лет (средний возраст 44,3±1,6 го- лы, что обусловлено уменьшением вклада тепловых колеба-
да). Пациентов распределили на четыре группы по вели- ний в разрыв дуплекса. На основе результатов измерений,
чине ИМТ: со сниженной массой тела — ИМТ <18,5 кг/м2; проведенных при разных температурах, можно оценить зна-
с нормальной массой тела — ИМТ 18,5—24,9 кг/м2; с из- чение энтальпии активации диссоциации комплекса.
быточной массой тела — ИМТ 25,0—29,9 кг/м2, с ожире- Работа выполнена при финансовой поддержке РФФИ в
нием — ИМТ >30,0 кг/м2. Проанализировано содержание рамках научного проекта №18-34-00320.
Actinobacteria, Firmicutes, Bacteroidetes и отношение Firmic-
utes/Bacteroidetes (F/B) в фекалиях. Количество Firmicutes ***
постепенно повышалось, а Bacteroidetes уменьшалось с уве-
личением ИМТ и, соответственно, возрастало отношение ВЫДЕЛЕНИЕ СПЕЦИАЛИЗИРОВАННЫХ ДНК-
F/B. В некорректированной модели логистической регрес- ПОЛИМЕРАЗ ЭКСТРЕМОФИЛЬНОЙ БАКТЕРИИ
сии установлена корреляция величины отношения F/B с DEINOCOCCUS GOBIENSIS
ИМТ (отношение шансов 1,23, 95% доверительный интер-
вал 1,09—1,38), которая оставалась значимой при коррек- М.В. Никитин1, М.А. Простова1, Д.М. Есюнина1,
тировке таких факторов, как возраст, пол, физическая ак- А.А. Комар2, А.В. Кульбачинский1
тивность и курение (отношение шансов 1,33, 95% довери- 1
ФГБУН Институт молекулярной генетики РАН, Москва 123182,
тельный интервал 1,11—1,60). Полученные данные Россия;
соответствуют результатам исследований в других популя- 2
Center for Gene Regulation in Health and Disease and Department of
циях. Biological, Geological and Environmental Sciences, Cleveland State
University, Cleveland, OH, 44115, USA; e-mail: nikitin.mv@bk.ru

*** Экстремофильные бактерии рода Deinococcus облада-


ют высокой устойчивостью к воздействию радиации, что
делает их очень интересной моделью для изучения меха-
ИСПОЛЬЗОВАНИЕ КВАРЦЕВОГО РЕЗОНАТОРА
низмов репарации ДНК и систем защиты генома от по-
ДЛЯ ОПРЕДЕЛЕНИЯ ТЕРМОДИНАМИЧЕСКИХ вреждений. Одной из таких систем могут быть почти не из-
ПАРАМЕТРОВ МЕХАНИЧЕСКОЙ ДЕНАТУРАЦИИ ученные специализированные ДНК-полимеразы X- и Y-се-
ДВОЙНОЙ СПИРАЛИ ДНК мейств, закодированные в геномах этих бактерий. Цель
данной работы — исследование функциональных свойств
Д.В. Некрасов1, 2, Н.Н. Курусь1, Ф.Н. Дульцев1, 2,
этих ДНК-полимераз, в частности, их способности к про-
А.А. Ломзов2, 3, Г.Ю. Шевелев2, 3, Д.В. Пышный3 хождению поврежденных участков ДНК, на примере по-
ФГБУН Институт физики полупроводников им. А.В. Ржанова
1
лимераз X и Y D. gobiensis. Гены этих полимераз были оп-
СО РАН, Новосибирск, Россия 630090; тимизированы для успешной экспрессии белков в E. coli в
2
Новосибирский государственный университет, Новосибирск, растворимой форме и клонированы в экспрессионный век-
630090, Россия; тор. Подобраны условия экспрессии, позволяющие полу-
3
ФГБУН Институт химической биологии и фундаментальной чить достаточное количество растворимого целевого бел-
медицины СО РАН, Новосибирск, 630090, Россия; e-mail: ка. Две последовательные хроматографические очистки на
nekrrus@gmail.com аффинных носителях — Ni-сефарозе и гепарин-сефарозе
Для исследования механической денатурации ДНК был — позволили выделить полимеразы с высокой степенью
использован кварцевый резонатор (QCM) в активной моде. чистоты (>95%). В настоящее время проводятся экспери-
В отличие от атомно-силовой спектроскопии (ACС), в дан- менты по измерению полимеразной и экзонуклеазной ак-
ной методике за одно измерение получается результат, тивности данных белков, что позволит в дальнейшем опре-
усредненный по ансамблю частиц. Кроме того, отсутствует делить точность их работы и способность к репликации по-
ограничение степени свободы, как в случае АСС, где моле- врежденной ДНК.
кула зафиксирована на кантилевере. Однако, в отличие от Данная работа была выполнена при поддержке гранта
АСС, метод QCM позволяет проводить измерения только в РНФ 17-14-01393.
режиме разрыва с последовательным разделением нуклео-
тидов. Используя метод QCM, меняя скорость нарастания ***
амплитуды колебаний кварцевого кристалла, мы получили
зависимость силы разрыва дуплексов ДНК длиной 20 пар ПОЛУЧЕНИЕ АСТРОЦИТОВ ИЗ
оснований от времени сканирования t. Исследуемые дуплек- ИНДУЦИРОВАННЫХ ПЛЮРИПОТЕНТНЫХ
сы были сформированы полностью комплементарными СТВОЛОВЫХ КЛЕТОК ЧЕЛОВЕКА
(ON1/ON2) и частично некомплементарными (ON1/ON3)
модельными олигонуклеотидами. Для того чтобы оценить Е.В. Новосадова, Е.Л. Арсеньева, Ю.Н. Ванюшина,
энтальпию реакции денатурации, процесс денатурации рас- Т.В. Малова, С.А. Антонов, В.З. Тарантул,
сматривали как мономолекулярную реакцию. Это позволи- И.А. Гривенников
ло восстанавливать энергетические профили денатурации
ФГБУН Институт молекулярной генетики РАН, 123182, Москва,
из экспериментальных данных, полученных при измерени- Россия; e-mail: novek-img@mail.ru
ях силы разрыва при различных временах сканирования, в
В настоящее время большое внимание уделяется изу-
диапазоне температур от 20 до 40 °С. С ростом температуры
чению механизмов функционирования центральной нерв-
вероятность пребывания дуплекса в связанном состоянии
ной системы человека на всех уровнях организации — от
уменьшается. Полученная зависимость силы разрыва от вре-
молекулярного, клеточного до всего организма в целом.
мени сканирования имеет два линейных участка. C увели-

38 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

При этом крайне важным является изучение нервной си- пищевой продукции из красной рыбы (семги, радужной
стемы при развитии патологических процессов, так как по- форели, горбуши, нерки, кижуча, кеты) различной обра-
добный анализ позволит получить наиболее полную ин- ботки (свежемороженая, слабосоленая, холодного и горя-
формацию о функционировании нервной системы в раз- чего копчения, икра слабосоленая пастеризованная, рыб-
личных условиях и стать основой для формирования новых ные консервы). Одной из наиболее видоспецифичных и
подходов к терапии наиболее распространенных невроло- часто используемых в баркодировании животных являет-
гических заболеваний. Развитие патологии глиальных кле- ся последовательность митохондриального гена, кодиру-
ток может предшествовать появлению симптомов болезни ющего субъединицу I оксидазы цитохрома С (COI). Ис-
Паркинсона (БП), а также других других нейродегенера- пользование специфичных маркеров к последовательно-
тивных заболеваний. Длительное нарушение астроцитар- сти COI позволяет однозначно определить видовую
ных функций может повышать уязвимость дофаминерги- принадлежность исследуемого образца. Нами были подо-
ческих нейронов черной субстанции, ускорить их дегене- браны видоспецифичные маркеры (Rasmussen и соавт.,
рацию и повлиять на способность компенсировать 2010), которые позволили в ходе ПЦР-анализа установить,
частичную дегенерацию на пресимптомных стадиях забо- а также подтвердить видовую принадлежность более 40 об-
левания. В то же время энергетическая и трофическая под- разцов продукции из красной рыбы, различающихся по
держка астроцитов является одним из существенных фак- способу обработки исследуемой ткани и типу биологиче-
торов нейрональных компенсаторных механизмов дофа- ского материала. Разработка технологии идентификации
минергической системы и может играть ведущую роль на видов лососевых в составе рыбной продукции водного про-
ранних стадиях БП. Однако в настоящее время исследова- мысла и аквакультуры позволит проводить генетическую
ния вовлеченности глиальных клеток в развитие нейроде- экспертизу для установления видовой принадлежности рыб
генеративных процессов имеют крайне ограниченный ха- семейства Лососевых и продуктов из них, в том числе крас-
рактер. В большей степени это связано с невозможностью ной икры, что позволит выявлять фальсифицированную
получения in vitro необходимого количества данного типа продукцию и защищать интересы потребителей.
клеток человека. В настоящее время разрабатываются про- Работа выполнена в рамках мероприятия 21 «Разрабо-
токолы получения различных типов глиальных клеток из тать и внедрить технологию генетической идентификации
индуцированных плюрипотентных стволовых клеток (ИП- растительноядных и лососевых видов рыб» подпрограммы 1
СК) человека. В нашей работе были получены культуры «Инновационные биотехнологии — 2020»  ГП «Наукоемкие
астроцитов из ИПСК от здоровых доноров и пациентов с технологии и техника» на 2016—2020 годы.
БП. Полученные клетки были охарактеризованы: морфо-
логически, иммуноцитохимически (окраска антителами на ***
специфические маркеры астроцитов s-100 и GFAP) и мо-
лекулярно-биологически (экспрессия необходимого пат- ОСОБЕННОСТИ ЭКСПРЕССИИ ГЕНОВ,
терна мРНК). Проведены первые эксперименты по сокуль- ФУНКЦИОНИРУЮЩИХ В КЛЕТКАХ КРОВИ
тивированию астроцитов и дифференцированных нейро- ЧЕЛОВЕКА И ВОВЛЕЧЕННЫХ В АТЕРОГЕНЕЗ ПРИ
нов. РАЗЛИЧНОМ СОДЕРЖАНИИ ХОЛЕСТЕРИНА
Данная работа была поддержана грантом программы
ЛИПОПРОТЕИНОВ ВЫСОКОЙ ПЛОТНОСТИ
Президиума РАН «Фундаментальные исследования для био-
медицинских технологий». Е.В. Носова1, В.Г. Дмитриева1, А.В. Рожкова1,
А.Д. Дергунов2, Д.Ю. Литвинов2, Л.В. Дергунова1
***
ФГБУН Институт молекулярной генетики РАН, 123182,
1

Москва;
ВИДОВАЯ ИДЕНТИФИКАЦИЯ ПИЩЕВОЙ 2
ФГБУ «НМИЦ профилактической медицины» Минздрава
ПРОДУКЦИИ ИЗ ЛОСОСЕВЫХ РЫБ России, 101990, Москва; e-mail: el.nosova94@mail.ru
(SALMONIDAE) В целях изучения молекулярных основ патогенеза ате-
А.Ю. Носова, А.И. Царь, А.А. Буракова, росклероза проведено сравнительное исследование уров-
ня мРНК 41 гена, участвующих в метаболизме липидов, де-
О.И. Добыш
грануляции тромбоцитов и развитии воспалительной ре-
Институт генетики и цитологии НАН Беларуси, 220072, Минск, акции в мононуклеарных клетках крови пациентов с
Республика Беларусь; e-mail: a.nosova@igc.by повышенным содержанием холестерина липопротеинов
Значительные различия по цене рыб разных семейств, высокой плотности (ХС-ЛВП) (n=9) и группы с его пони-
подгрупп, видов и наименований создают базу для фаль- женным содержанием (n=10). В клетках крови пациентов
сификации рыбных товаров. Наиболее часто фальсифици- с повышенным содержанием ХС-ЛВП методом ПЦР в ре-
руются рыбы семейства лососевых, так как анатомо-мор- альном времени обнаружено значимое снижение уровня
фологические признаки разных видов рыб этого семейства мРНК ITGB3, кодирующего рецептор, участвующий в ре-
имеют определенное сходство, а различия между видами акции свертывания крови и формировании атеросклеро-
могут распознать только специалисты или лица, занимаю- тической бляшки. Также выявлено снижение уровня
щиеся уловом и переработкой лососевых. Молекулярно-ге- мРНК гена TLR8, обеспечивающего индукцию провоспа-
нетические подходы видоопределения считаются одними лительных цитокинов, и гена CYBA, кодирующего ци-
из наиболее надежных и достоверных, так как даже после тохром b-245 — важный компонент НАДФН-оксидаз, уча-
различных видов обработки рыбного сырья (нагревание, ствующих в образовании реактивных форм кислорода в со-
копчение и др.) в образцах сохраняется ДНК в достаточ- судах. Содержание мРНК гена секреторного ингибитора
ном количестве для проведения ПЦР и, соответственно, протеиназы лейкоцитов (SLPI), обладающего противовос-
для генетической идентификации. Нами изучены образцы палительной активностью, напротив, возрастало. Нами об-

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 39


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

наружено снижение уровня экспрессии гена SREBF1, ко- крибирует поздние гены фага. В экспериментах с двуцепо-
дирующего транскрипционный фактор ЛНП-рецептора чечными ДНК-матрицами определено, что для транскрип-
(LDLR), что согласуется с выявленным ранее снижением ции важна каждая пара нуклеотидов в консенсусной по-
уровня мРНК LDLR. Одновременно у пациентов с повы- следовательности TATG, где G является точкой старта
шенным содержанием ХС-ЛВП обнаружено значимое по- транскрипции (ТСТ — +1). Область после ТСТ также не-
вышение содержания мРНК рецептора окисленных ЛНП обходима для транскрипции. На матрицах с неспаренны-
(OLR1), способствующего их захвату и накоплению. Полу- ми основаниями в области консенсуса была показана важ-
ченные данные об экспрессии генов ITGB3, TLR8, CYBA, ность T в (–1) положении нематричной нити промотора.
SLPI свидетельствуют об уменьшении роли воспалитель- В экспериментах с вилочковыми матрицами (область до
ного компонента атерогенеза у пациентов с повышенным ТСТ представлена в однонитевой форме) показано, что
содержанием ХС-ЛВП. Однако реципрокное изменение нвРНКП phiKZ абсолютно необходима матричная нить
экспрессии генов OLR1 и LDLR может говорить об иници- ДНК промоторной области для транскрипции. При этом
ации проатерогенных процессов у пациентов данной груп- замена консенсусных нуклеотидов с –3 по –1 на матрич-
пы через другие сигнальные пути. ной нити не оказывает значительного влияния на транс-
Работа выполнена при поддержке гранта РФФИ №17- крипцию с вилочковых матриц. Также с помощью вилоч-
04-00217 и Программы Президиума РАН «Фундаментальные ковых матриц показано, что область перед консенсусной
исследования для биомедицинских технологий». последовательностью участвует в определении ТСТ. Ком-
плексы нвРНКП с промоторами менее устойчивы к воз-
*** действию неспецифического конкурента гепарина, чем
комплексы бактериальной РНКП-сигма70. Комплексы
СИСТЕМА ДЛЯ ПОИСКА БЕЛКОВ-ПАРТНЕРОВ бактериальной РНКП-сигма70 с ДНК стабилизируются за
РНК-ПОЛИМЕРАЗЫ В КЛЕТКАХ DEINOCOCCUS счет самопроизвольной изомеризации закрытого транс-
RADIODURANS крипционного комплекса в открытый. Вероятно, меньшая
устойчивость промотор-нвРНКП комплексов говорит об
А.В. Олина, А.А. Агапов, Д.М. Есюнина, отсутствии самопроизвольного образования стабильного
А.В. Кульбачинский открытого комплекса.
ФГБУН Институт молекулярной генетики РАН, Москва, 123182, Исследование выполнено за счет гранта Российского на-
Россия; e-mail: anya2olina2@gmail.com, mailto:tussi@list.ru учного фонда (проект №17-74-10220).
Транскрипция является ключевым этапом регуляции
экспрессии генов у бактерий. У стрессоустойчивой бакте-
***
рии Deinococcus radiodurans профиль экспрессии генов зна-
чительно изменяется в условиях стресса. Однако транскрип-
ционные факторы, ассоциированные с РНК-полимеразой СВЯЗЬ ФИЗИКО-ХИМИЧЕСКИХ И
в клетках D. radiodurans, только начинают исследоваться. ФУНКЦИОНАЛЬНЫХ СВОЙСТВ ПРОМОТОРОВ
Для поиска потенциальных белков-партнеров РНК-поли- MYCOPLASMA GALLISETPICUM
меразы D. radiodurans нами разработана система выделения
РНК-полимеразы в комплексе с ассоциированными факто- М.А. Орлов1, И.А. Гаранина2, Г.Ю. Фисунов2,
рами из клеток D. radiodurans. Для этого получен штамм D. А.А. Сорокин1
radiodurans, кодирующий бета’-субъединицу РНК-полиме- 1
Институт биофизики клетки РАН, Пущино,
разы с гистидиновым тагом на С-конце. Выделение РНК-по- Московская область;
лимеразы из клеток данного штамма осуществляется в одну Федеральный Научно-клинический Центр физико-химической
2

стадию путем аффинной хроматографии. Мы выделяем медицины ФМБА, Москва; e-mail: orlovmikhailanat@gmail.com
РНК-полимеразу из клеток D. radiodurans, выращенных как Mycoplasma gallisepticum является внутриклеточным па-
в оптимальных условиях, так и при воздействии стрессовых разитом, вызывающим заболевания дыхательной системы
факторов (перекиси водорода, ультрафиолетового и гам- птиц. Для этой бактерии характерна динамичная регуля-
ма-излучения). Это позволит проанализировать белки, со- ция транскрипции на фоне редукции большинства факто-
выделяющиеся с РНК-полимеразой в разных условиях, при ров транскрипции (TFs). В избегании M. gallisepticum бак-
помощи масс-спектрометрии. терией иммунного ответа хозяина участвует семейство ге-
Работа была выполнена при поддержке гранта РФФИ нов вариабельного липопротеина-гемагглютинина (variable
№18-34-00905. lipoprotein hemagglutinin, vlhA). Промоторы этих генов со-
держат в upstream-области участок тринуклеотидных по-
*** второв GAA на расстоянии примерно 40 пар оснований от
точки старта транскрипции (ТСТ). Показано, что такие
МЕХАНИЗМ УЗНАВАНИЯ ПРОМОТОРА
промоторы активны в присутствии ровно 12 повторов три-
НЕВИРИОННОЙ РНК-ПОЛИМЕРАЗОЙ нуклеотида GAA. Можно предположить, что лежащий в
БАКТЕРИОФАГА PHIKZ основе этого механизм определяют физико-химические
М.М. Орехова, М.В. Якунина свойства промоторных областей ДНК. В данной работе при
анализе нуклеотидной последовательности промоторов
Санкт-Петербургский политехнический университет Петра vlhA помимо области GAA-повторов выявлены консерва-
Великого, Санкт-Петербург, Россия; тивные последовательности, фланкирующие эту область с
e-mail: m.m.orekhova@gmail.com
обоих концов. Рассмотрение физико-химических свойств
Неканоническая многосубъединичная невирионная дуплекса показало, что не относящиеся к генам семейства
РНК-полимераза (нвРНКП) бактериофага phiKZ транс- vlhA промоторы имеют максимумы профилей SIDD в

40 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

upstream-области, в то время как промоторы vlhA демон- ГЕНОТИПИРОВАНИЕ МАКАК РЕЗУС


стрируют несущественную дестабилизацию. Профили ди- (MACACA MULATTA) АДЛЕРСКОГО
намических характеристик открытых состояний и электро- ПРИМАТОЛОГИЧЕСКОГО ЦЕНТРА
статического потенциала промоторов vlhA, в отличие от ПО ПОЛИМОРФИЗМУ ГЕНА OPRM1
группы сравнения, содержат характерные паттерны. Таким
образом, удалось показать сложный характер связи нукле- Л.Е. Павлова1, М.Ф. Тимина1, А.В. Шмалий1,
отидной последовательности промоторов M. gallispeticum с Г.А. Янус2, Е.Н. Имянитов2
их функционированием и предполагаемую роль физико-хи- 1
ФГБНУ «НИИ медицинской приматологии», Сочи, 354376,
мических характеристик ДНК в этом явлении.
Россия;
ФГБНУ «НМИЦ онкологии им. Н.Н. Петрова», Санкт-
2

Петербург, 197758, Россия; e-mail: pavlova_laura@mail.ru


***
Согласно результатам семейных и близнецовых иссле-
ОСОБЕННОСТИ МИКРОЭВОЛЮЦИИ АНТИМОР дований, общий вклад наследственных факторов в разви-
тие алкогольной зависимости достигает 50—60%. При этом
(ANTIMORA SPP., MORIDAE, GADIFORMES)
данные литературы о вкладе каждого отдельного гена в раз-
ПО ДАННЫМ МИТОХОНДРИАЛЬНЫХ
витие алкоголизма остаются противоречивыми. Благода-
МАРКЕРОВ ря генетическому сходству с людьми приматы могут быть
С.Ю. Орлова1, А.М. Орлов1, 2, 3, 4, 5 успешно использованы для систематизации молекуляр-
но-генетических предикторов алкогольной зависимости.
1
Всероссийский научно-исследовательский институт рыбного У макак резус известен однонуклеотидный полиморфизм
хозяйства и океанографии, 107140, Москва, Россия;
(SNP) гена OPRM1 (rs195917455) C77G, функционально
2
Институт проблем экологии и эволюции им. А.Н. Северцова идентичный SNP А118G µ-опиоидного рецептора челове-
РАН, 119071, Москва, Россия;
ка (rs1799971). Считается, что рецептор, кодируемый G ал-
3
Дагестанский государственный университет, Махачкала, лелью, обладает в 3 раза большей аффинностью к бета-эн-
367000, Россия; дорфину и, возможно, влияет на эффективность терапии
4
Томский государственный университет, Томск, 634050, Россия; при алкоголизме антагонистами опиоидных рецепторов.
5
Прикаспийский институт биологических ресурсов Цель исследования — проведение генотипирования макак
Дагестанского научного центра РАН, Махачкала, 367000, резус по полиморфному варианту гена OPRM1. Забор ве-
Россия; e-mail: kordicheva@rambler.ru нозной крови произведен у 10 клинически здоровых сам-
Род Antimora (Moridae) представлен двумя видами — мел- цов макак резус (Macaca mulatta) в возрасте 6—9 лет, содер-
кочешуйной A. microlepis и клюворылой A. rostrata антимора- жащихся в питомнике ФГБНУ «НИИ медицинской при-
ми. Географическое распространение первой охватывает толь- матологии». Экстракция нуклеиновых кислот проведена
ко северную часть Тихого океана, последний вид встречает- стандартным сорбентным методом. Для создания тест-си-
ся практически повсеместно за исключением Северной стемы ПЦР выполнен подбор аллель-специфичных прай-
Пацифики. До сих пор генетические исследования антимор меров к геномной ДНК макак резус. Подобран оптималь-
касались только клюворылой и ограничивались отдельными ный температурный профиль для лучшей дискриминации
районами ее ареала (Oyarzun и соавт., 1995; Roa-Varóna, Orti, аллелей по гену OPRM1. Секвенирование продуктов ам-
2009; Smith и соавт., 2011; White и соавт., 2011). Данное сооб- плификации подтвердило специфичность тестируемого в
щение основано на анализе 7 выборок A. microlepis (186 образ- ПЦР фрагмента ДНК. В результате генотипирования ме-
цов) и 11 выборок A. rostrata (270 образцов) по гену CO1. В вы- тодом аллель-специфической ПЦР у 5 животных иденти-
борках первого вида обнаружен 41 гаплотип, в том числе 28 фицирован полиморфизм µ-опиоидного рецептора по G
уникальных (отмеченных только у одной особи), в выборах аллели гена OPRM1, что указывает на наличие данного по-
второго — 102 гаплотипа, включая 74 уникальных. Для обо- лиморфизма в популяции питомника. Таким образом, ото-
их видов общими оказались 3 гаплотипа: гаплотип H2 обна- бранная популяция приматов-носителей данного полимор-
ружен в выборке A. microlepis из вод Императорского хребта и физма может быть использована в доклинической оценке
Гаваев и в большинстве выборок A. rostrata, гаплотип H3 — в средств лечения алкогольной зависимости.
большинстве выборок A. microlepis и выборках A. rostrata из
вод Австралии и Новой Зеландии, гаплотип H37 — в выбор- ***
ке A. microlepis из вод Императорского хребта и Гаваев и в вы-
борках A. rostrata из моря Скоша и вод Фолклендских о-вов. ОЦЕНКА КОЛЛЕКЦИОННЫХ ОБРАЗЦОВ
Полученные данные позволяют сформулировать гипотезу ЯРОВОГО ОВСА НА УСТОЙЧИВОСТЬ К
расселения антимор в Мировом океане. РАСПРОСТРАНЕННЫМ ЗАБОЛЕВАНИЯМ В ЗОНЕ
Работа выполнена при финансовой поддержке гранта СЕВЕРНОГО ЗАУРАЛЬЯ
РФФИ №16-04-00516.
О.А. Пай, М.Н. Фомина, Ю.С. Иванова
Научно-исследовательский институт сельского
хозяйства Северного Зауралья — филиал Федерального
*** государственного бюджетного учреждения науки Федерального
исследовательского центра Тюменского научного центра
Сибирского отделения Российской академии наук, Тюмень;
e-mail: ola92ola@mail.ru
Проведена оценка исходного материала ярового овса
в условиях северной лесостепи Тюменской области, по по-

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 41


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

левой устойчивости к распространенным заболеваниям в ДЕЙСТВИЕ ЛЕТУЧИХ ОРГАНИЧЕСКИХ


зоне Северного Зауралья: пыльной головне (Ustilago avenae СОЕДИНЕНИЙ, СИНТЕЗИРУЕМЫХ
(Pers.) Jеns), корончатой ржавчине (Puccinia coronifera МИКРООРГАНИЗМАМИ, НА ЭКСПРЕССИЮ
Kleb.), красно-бурой пятнистости (Drechslera avenae Ito). ГЕНОВ COPA, ARSR И ZNTA, ИНДУЦИРУЕМЫХ
Объектами исследования послужили 73 коллекционных
В ОТВЕТ НА ПРИСУТСТВИЕ В СРЕДЕ ИОНОВ
образца овса различного эколого-географического проис-
хождения, полученных из ФГБНУ «Федеральный исследо- ТЯЖЕЛЫХ МЕТАЛЛОВ И МЫШЬЯКА
вательский центр Всероссийский институт генетических В.А. Плюта1, О.Е. Мелькина2, Д.Е. Сидорова1,
ресурсов растений им. Н.И. Вавилова» (ВИР) и 30 перспек- Г.Б. Завильгельский2, И.А. Хмель1
тивных селекционных линий, созданных в НИИСХ Север-
ного Зауралья. В качестве стандарта использовали возде- ФГБУН Институт молекулярной генетики РАН, 123182,
1

лываемый в регионе сорт Талисман. Анализ устойчивости Москва, Россия;


108 образцов овса в 3-кратной повторности позволил вы- 2
ФГБУ «ГосНИИгенетика» НИЦ «Курчатовский институт»,
делить более 90 (94,6%) сортов, устойчивых к пыльной го- 117545, Москва, Россия; e-mail: plyutaba@gmail.com
ловне. Размах варьирования по восприимчивости сортов к Многие микроорганизмы продуцируют летучие ор-
патогену был значительным (0—74%). Высокую устойчи- ганические соединения (ЛОС), выполняющие различ-
вость к возбудителю корончатой ржавчины проявили со- ные функции и играющие важную роль в межвидовой
рта Российской Федерации, зарубежной селекции и пер- коммуникации организмов. Было показано, что ЛОС
спективные линии Северного Зауралья. Размах варьирова- могут проявлять антимикробную активность и служить
ния составил от 0 (К-14572, К-14887, ТМ 04-36-18, ТМ одним из факторов межвидовой борьбы. О механизмах
08-179-9 и др.) до 35,0% (К-14755, К-14758). Интенсивность действия многих летучих веществ в настоящий момент
поражения листьев красно-бурой пятнистостью (Drechslera известно мало. В данной работе исследовано действие
avenae Ito) в среднем на растении овса варьировала от 0 ЛОС на экспрессию генов copA, arsR и zntA, индуциру-
(К-6529, ТМ 08-140-2) до 37% (К-14292, К-14755). емых в клетках Escherichia coli в ответ на присутствие в
среде ионов тяжелых металлов (Cu2+, Zn2+) и мышьяка
(As3+) (продукты указанных генов участвуют в защите
*** клеток от токсичных концентраций этих соединений).
Для оценки влияния ЛОС на экспрессию генов были ис-
ЦИТОГЕНЕТИЧЕСКИЙ АНАЛИЗ пользованы специфические lux-биосенсоры — клетки
ХРОМОСОМНЫХ НАРУШЕНИЙ В КЛЕТКАХ E. coli MG1655, несущие плазмиды с репортером lux-опе-
КИТАЙСКОГО ХОМЯЧКА В РАЗНЫЕ СРОКИ роном и клонированными промоторами генов copA, arsR
и zntA. Степень экспрессии с соответствующих промо-
ПОСЛЕ ГАММА-ОБЛУЧЕНИЯ60CО
торов определялась по интенсивности биолюминесцен-
Д.В. Петрова1, Н.А. Кошлань1, Р.Д. Говорун1, ции сенсора. Показано, что исследуемые ЛОС (диметил-
П. Блага1, 2, Ю.В. Богданова1, И.В. Кошлань1, 3 дисульфид и кетоны 2-ундеканон, 2-нонанон, 2-гепта-
нон, ацетон) не активируют экспрессию генов copA, arsR
Объединенный Институт ядерных исследований, Дубна,
1
и zntA. Только действие 2-пентанона приводит к акти-
Московская область;
вации экспрессии люциферазных генов, находящихся
2
Чешский технический университет в Праге, Прага, Чехия;
под контролем индуцируемого промотора гена zntA. На-
3
Государственный университет «Дубна», Дубна, Московская блюдается уменьшение степени экспрессии генов copA,
область; e-mail: edv-@mail.ru arsR и zntA при совместном действии ЛОС с водными рас-
В Лаборатории радиационной биологии ОИЯИ иссле- творами солей Cu2+, Zn2+, As3+ по сравнению с контро-
довано действие γ-излучения 60Co (2 и 5 Гр) на клетки ки- лем (действие CuSO4, ZnSO4 или NaAsO2 без ЛОС). Об-
тайского хомячка линии V79. Цитогенетический анализ суждаются возможные механизмы влияния ЛОС на ре-
хромосомных аберраций проводили в разные сроки после гуляторные белки и проницаемость клеточных мембран
облучения (от 3 ч до 40 сут). Показано, что максимальный для ионов тяжелых металлов и мышьяка.
выход клеток с хромосомными аберрациями наблюдается Работа частично финансировалась грантами РФФИ
в первые часы после облучения и достигает 60%. В отда- № 18-34-00396-мол_а, 18-04-00375-а и 19-04-00495-а.
ленные сроки выявлено снижение этого показателя до кон-
трольного значения (7% клеток с аберрациями).

***

***

42 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

ПОПУЛЯЦИОННАЯ ГЕНЕТИКА ОСЕТРОВЫХ ние репарационной активности MUTYH связано с развити-


В РЕКАХ СИБИРИ ем наследственного рака прямой кишки (MUTYH-ассоци-
ированный семейный аденоматозный полипоз). Исследо-
М.А. Побединцева1, А.И. Макунин1, И.Г. Кичигин1, вания MUTYH человека затруднены сложностью получения
Н.А. Сердюкова1, Е.А. Интересова2, 3, очищенных препаратов фермента (опубликованы лишь ча-
В.А. Заделенов4, А.А. Юрченко5, Д.Ю. Щербаков6, стично очищенные препараты MUTYH человека с низкой
А.С. Графодатский1, В.А. Трифонов1 концентрацией белка). Для получения продуцента MUTYH
человека был использован штамм E. coli Rosetta2. Клетки
Институт молекулярной и клеточной биологии СО РАН,
1
выращивали в 6 литрах среды YT, после индукции экспрес-
Новосибирск, Россия;
сии продукцию белка проводили при 18 ºС. Выделение бел-
2
Новосибирское отделение государственного научно-
ка MUTYH, слитого на N-конце с GST-тагом, осуществля-
производственного центра рыбного хозяйства ФГБНУ
Госрыбцентр, Новосибирск, Россия;
ли с помощью аффинной хроматографии на сорбенте глу-
татитон-сефароза. Был получен высококонцентрированный
3
Томский государственный университет, Томск, Россия;
препарат MUTYH высокой степени чистоты. Однако зна-
4
ФГБНУ «Научно-исследовательский институт экологии
рыбохозяйственных водоемов», Красноярск, Россия; чительная часть белка (около 40%) была протеолизована. С
помощью масс-спектрометрии сайт протеолиза был лока-
Центр Геномной Биоинформатики им. Ф.Г. Добржанского
5

Санкт-Петербургского государственного университета, лизован в области остатка Thr338. Показано, что препарат,
Санкт-Петербург, Россия; содержащий смесь полноразмерного и укороченного бел-
6
Лимнологический институт СО РАН, Иркутск, Россия;
ков MUTYH, обладает специфической репарационной ак-
e-mail: mapob@mcb.nsc.ru тивностью по отщеплению аденина из пары 8-oxo-G:A, но
не отщепляет аденин из пары G:A.
Популяционная генетика позволяет ответить на вопро-
Работа поддержана грантом РФФИ-комфи 17-00-00265
сы, связанные с эволюцией и демографической историей ви-
(K) (17-00-00264 А.В.М. и 17-00-00261. Д.О.Ж.).
дов. Осетрообразные (Acipenseriformes) — древнейший отряд
класса Лучеперых рыб, в реках Сибири представлен стерля- ***
дью (Acipenser ruthenus) и сибирским осетром (A. baerii). Осе-
тровые чрезвычайно уязвимы к воздействию разнообразных ХАРАКТЕРИСТИКА ОПУХОЛЕЙ ТРЕХ
факторов, препятствующих их естественному воспроизвод- АЛЛОГРАФТНЫХ МОДЕЛЕЙ МЫШИ ПО
ству. В настоящее время филогения осетровых остается про- ЭКСПРЕССИИ ПОТЕНЦИАЛЬНЫХ СТРОМА-
тиворечивой, существуют проблемы с идентификацией от- СПЕЦИФИЧНЫХ ГЕНОВ
дельных видов, а также поднимаются вопросы о выделении
подвидов внутри вида. Цель работы — оценка генетического А.В. Полуконова, Д.А. Дидыч, Е.Д. Свердлов
разнообразия осетровых в реках Сибири по последователь- ФГБУН Институт биоорганической химии им. акад.
ности контрольного района митохондриальной ДНК, а так- М.М. Шемякина и Ю.А. Овчинникова Российской академии
же выяснение филогенетических отношений между основ- наук, 117997, Москва, Россия; e-mail: polukonova.av@gmail.com
ными гаплогруппами обоих видов, основанное на анализе Опухоль-ассоциированные фибробласты (ОАФ) пред-
полных митохондриальных геномов. В ходе работы собрана ставляют собой один из основных компонентов микроо-
коллекция материала представителей двух видов осетровых, кружения большинства солидных опухолей и принимают
обитающих в Сибири. Оценено генетическое разнообразие участие в процессах, связанных с прогрессией опухоли.
обоих видов в бассейнах рек Сибири. Показана изоляция по- ОАФ обладают высокой гетерогенностью, поэтому для ха-
пуляций обоих видов в разных речных бассейнах. Оценено рактеристики их отдельных популяций актуален поиск
время расхождения основных гаплогрупп внутри обоих ви- ОАФ-специфичных генов. В данной работе на основе дан-
дов. Сравнение популяционных характеристик двух видов ных литературы мы выбрали группу строма-ассоцииро-
показало более уязвимый статус вида A. baerii. Впервые уста- ванных генов, содержащую, наряду со стандартными, не-
новлены филогенетические взаимоотношения между основ- сколько потенциальных ОАФ-специфичных генов, и про-
ными гаплогруппами стерляди и сибирского осетра по после- вели анализ их экспрессии в опухолевых образцах трех
довательностям полных митохондриальных геномов. аллографтных моделей мыши с помощью ОТ-ПЦР в ре-
Работа поддержана грантом РНФ №18-44-04007. альном времени. В работе были использованы образцы
тотальной мРНК, выделенные из подкожно привитых
*** опухолей мыши, полученных с использованием раковых
линий CT26 (карцинома толстой кишки), С26 (карцино-
ВЫДЕЛЕНИЕ ДНК-ГЛИКОЗИЛАЗЫ ЧЕЛОВЕКА ма толстой кишки) и Pan02/Panc02 (протоковая адено-
MUTYH карцинома поджелудочной железы). В качестве контроль-
ных использовали образцы мРНК, выделенные из соот-
В.А. Полтораченко1, А.В. Юдкина2, Д.О. Жарков2,
ветствующих линий раковых клеток, культивируемых in
А.В. Макарова1 vitro. В данной работе мы выявили гены, экспрессия ко-
ФГБУН Институт молекулярной генетики РАН, 123182,
1 торых отсутствует или незначительна в раковых клетках
Москва, Россия; in vitro, но при этом хорошо детектируется в опухолях in
1
Институт химической биологии и фундаментальной медицины vivo. Результаты работы подтверждают стромальную спец-
СО РАН, 630090, Новосибирск, Россия; ифичность экспрессии большинства рассмотренных ге-
e-mail: amakarova-img@yandex.ru нов. Полученные данные об экспрессии исследованных
Мисматч-специфическая ДНК-гликозилаза MUTYH генов позволяют предположить, что опухоль Pan02 обла-
узнает аденин в паре с 8-oxo-G и удаляет неповрежденное дает более выраженным стромальным компонентом, по
основание, предотвращая закрепление мутаций. Наруше- сравнению с опухолями CT26 и С26. В дальнейшем экс-

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 43


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

прессия рассмотренных генов будет проанализирована на новании различий в окраске ног и карапакса, брачного пове-
отдельных популяциях ОАФ, выделенных из опухолей. дения самцов, различии в строении эпигин самок (Töpfer-
Исследование выполнено при финансовой поддержке РФ- Hofmann и соавт., 2000). На данный момент группа P. lugubris
ФИ в рамках научного проекта №17-00-00190. включает 7 видов: P. alacris (C.L. Koch, 1833), P. baehrorum
(Kronestedt, 1999), P. caucasica (Ovtsharenko, 1979), P. lugubris
*** (Walckenaer, 1802), P. pertinax (Helversen, 2000), P. koponeni
(Nadolny и соавт., 2016) и P. saltans (Töpfer-Hofmann, 2000).
БЕЛОК-БЕЛКОВЫЕ ВЗАИМОДЕЙСТВИЯ С Предполагается, что 5 видов обитает в Европе, P. koponeni в
УЧАСТИЕМ FTSZ В КЛЕТКАХ МИКОПЛАЗМ Восточной Азии и только P. lugubris распространена по всей
транспалеарктике (Platnick, 2014; World Spider Catalog, 2015;
Е.В. Пономарева1, 2, А.Д. Ведяйкин1, 2, Nadolny и соавт., 2016). Морфологически самки группы ви-
И.Е. Вишняков2, М.А. Ходорковский1 дов P. lugubris (Walckenaer, 1802) практически неразличимы
1
Санкт-Петербургский политехнический университет Петра между собой, в то время как самцы различаются по брачно-
Великого, Санкт-Петербург, 195251; му поведению (Vlček, 1995), строению медиального апофиза
2
Институт цитологии РАН, Санкт-Петербург, 194064;
и цвету цимбиума (Roberts, 1998; Kronestedt, 1999; Töp-
e-mail: 39_smooth@mail.ru fer-Hofmann и соавт., 2000). Генетические исследования этой
группы показывают монофилетичность рода, но разные ви-
Микоплазмы являются важными патогенами растений,
ды часто формируют одну кладу, результаты анализов часто
животных и человека, поэтому их изучение имеет большой
неоднозначны (Murphy и соавт., 2006; Nadolny и соавт., 2016).
практический интерес. Известно, что многие микоплазмы
Показана эффективность использования гена COI для иден-
имеют ген ftsZ, кодирующий ключевой белок бактериально-
тификации пауков до вида (Barrett, R.D.H. & Hebert, P.D.N.,
го деления. Подавляющее большинство знаний о структуре
2005), в связи с чем мы решили применить его как один из
и функции белков FtsZ получено при исследовании Esche-
маркеров для уточнения филогении групп видов данного ро-
richia coli и нескольких других модельных микроорганизмов.
да. ДНК выделяли методом кипячения (Galinskaya и соавт.,
Основной ролью FtsZ в E. coli считают привлечение в сайт
2016) из ноги паука, затем проводили ПЦР, используя прай-
деления других белков, участвующих в цитокинезе, в осо-
меры для двух генов: 12S, праймеры 12S-bi, 12St-L (Murphy и
бенности ферментов, связанных с ремоделированием кле-
соавт., 2006) и COI, праймеры C1-J-2123, C1-N-2776 (Vidergar
точной стенки. Предполагается, что белок FtsZ участвует и
и соавт., 2014), а также впервые подобранные нами прайме-
в процессе деления микоплазм, хотя с учетом того, что в ми-
ры COX1-F, COX1-R. Очистка ПЦР-продукта производилась
коплазмах отсутствует клеточная стенка, не вполне ясен ме-
переосаждением, секвенирование на ABI Prism 3500 (Applied
ханизм вовлечения FtsZ в этот процесс. Принимая во вни-
Biosystems, the United States). Для сравнения взяли пауков из
мание, что FtsZ считается перспективной мишенью для но-
группы Pardosa pullata (P.riparia, P.sphagnicola), в качестве аут-
вых антибиотиков, блокирующих процесс деления бактерий,
группы использовали пауков рода Alopecosa. Мы доказали эф-
представляется важным разобраться в роли белка FtsZ в ми-
фективность использования метода кипячения для выделе-
коплазмах. В данной работе использовали методы ко-имму-
ния ДНК у пауков, синтезировали новую пару праймеров для
нопреципитации и со-осаждения (pull-down анализ). Уда-
амплификации COI гена у пауков. ПЦР с подобранными на-
лось установить, что FtsZ в клетках микоплазм взаимодей-
ми праймерами дает стабильные успешные результаты. В хо-
ствует с рядом белков, среди которых идентифицированы
де отработки методик выделения ДНК у пауков рода Pardosa
фактор элонгации трансляции EFTu, молекулярный шапе-
мы пришли к выводу, что наиболее эффективным методом
рон DnaK, а также другие белки. Среди белков-партнеров
является выделение кипячением (Galinskaya и соавт., 2016),
FtsZ микоплазм не удалось обнаружить других известных
поскольку при выделении набором ДНК Diatom prep 100 фир-
гомологов белков деления, что может говорить об отличии
мы Изоген или методом CCDB DNA Extraction, после ПЦР
роли белка FtsZ в клетках микоплазм от хорошо изученных
было мало продукта, что свидетельствует о маленькой кон-
микроорганизмов. Планируется исследование межбелковых
центрации матричной ДНК. Синтезированная нами пара
взаимодействий с участием FtsZ микоплазм с использова-
праймеров показала свою эффективность, используя полу-
нием других методов.
ченные сиквенсы, удалось построить филогенетическое де-
Работа поддержана Российским научным фондом, про-
рево.
ект 17-74-20065.
***
***
ИССЛЕДОВАНИЕ ВЛИЯНИЯ АКТИВНОЙ
ПРИМЕНЕНИЕ МОЛЕКУЛЯРНЫХ МАРКЕРОВ COI ТРАНСКРИПЦИИ НА ЭКСПАНСИЮ ПОВТОРОВ
И 12S ДЛЯ УТОЧНЕНИЯ ФИЛОГЕНИИ ГРУППЫ В МОДЕЛЬНЫХ ЛИНИЯХ КЛЕТОК
ВИДОВ PARDOSA LUGUBRIS Я.В. Пурвиньш, И.В. Грищенко
Е.А. Прописцова, Т.В. Галинская ФБУН ГНЦ ВБ «Вектор» Роспотребнадзора;
Кафедра энтомологии, Биологический факультет МГУ им. e-mail: purvinsh_yav@vector.nsc.ru
М.В. Ломоносова, Ленинские горы, Москва 119234 Россия; Экспансия тринуклеотидных повторов — резкое уве-
e-mail: evgenya.jeny@yandex.ru, nuha1313@gmail.com личение числа копий внутригенных последовательностей
Род пауков Pardosa C.L. Koch, 1847 является самым боль- ДНК, является одной из форм нестабильности генома.
шим родом семейства Lycosidae (Araneae). Он включает 533 Синдром ломкой Х-хромосомы — одно из распространен-
вида (Platnick, 2014), голарктические пауки делятся на 30 ных заболеваний, развитие которого вызывает данная му-
групп видов (Zyuzin, 1979; Dondale & Redner, 1990). В 2000 г. тация. Экспансия (ЦГГ)n повторов в 5’-UTR гена FMR1
группа P. lugubris была выделена из группы P. amentata на ос- приводит к гиперметилированию промотора и прекраще-

44 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

нию экспрессии данного гена. Вследствие этого перестает прессии генов SOD2 и GSR системы антиоксидантной защи-
нарабатываться белок FMRP — РНК-связывающий поли- ты, активирующихся при окислительных стрессах.
пептид, ответственный за нормальную дифференцировку Исследование выполнено при финансовой поддержке РФ-
и функционирование нейронов. Механизм экспансии по- ФИ в рамках научного проекта №18-34-00002.
второв остается неизвестным, а заболевания, связанные с
экспансией повторов, неизлечимыми. Экспансия повто- ***
ров во время репарации ДНК является одной из гипотез
возникновения данной мутации. Для аллелей гена FMR1 ВЛИЯНИЕ ИНСУЛЯТОРНОГО КОМПЛЕКСА
было показано, что уровень транскрипции значительно вы- GYPSY НА ФУНКЦИОНИРОВАНИЕ PIРНК
ше в аллелях с увеличенным повтором. Эти данные указы- КЛАСТЕРОВ В ГЕРМИНАЛЬНЫХ ТКАНЯХ
вают на то, что репарация, ассоциированная с транскрип- DROSOPHILA
цией, вероятно, является одной из причин экспансии. Цель
нашей работы — создание молекулярной модели повтора Е.И. Радион, С.С. Рязанский, С.И. Глухов,
(ЦГГ)n нормальной длины и исследование его экспансии Ю.А. Абрамов, А.И. Калмыкова
при активной транскрипции в иммортализованных В-лим-
ФГБУН Институт молекулярной генетики Российской академии
фоцитах пациентов с синдромом ломкой Х-хромосомы с
наук, 123182 Москва, Россия; e-mail: radion-radion.90@mail.ru
помощью вектора, несущего соответствующую конструк-
цию. В ходе работы был сконструирован ДНК-вектор, со- piРНК (Piwi interacting RNAs), участвующие в подавле-
держащий встройку ЦГГ-повторов, была проверена его ра- нии экспрессии ретротранспозонов в герминальных тканях,
ботоспособность и проведена трансфекция клеточных ли- образуются из длинных однонитевых предшественников,
ний иммортализованных В-лимфоцитов пациентов с считывающихся с особых локусов генома — кластеров
синдромом ломкой Х-хромосомы и здорового контроля, а piРНК. piРНК кластеры обогащены фрагментами мобиль-
также исследовано изменение длины ЦГГ-повтора в век- ных элементов и располагаются преимущественно в гете-
торе при активной транскрипции с течением времени. рохроматиновых областях генома. В герминальных тканях
Работа поддержана грантом РФФИ 18-34-00336. Drosophila активными являются двунитевые piРНК класте-
ры, в которых транскрибируются обе геномные цепи. Для
*** продукции piРНК важна целостная структура хроматина
piРНК кластеров. Хроматин таких локусов обогащен гете-
рохроматиновыми факторами HP1 и H3K9me3, а также гер-
ПОИСК НОВЫХ ФС ДЛЯ ФДТ
минально-специфичным гомологом HP1 — белком Rhino.
ОНКОЛОГИЧЕСКИХ ЗАБОЛЕВАНИЙ СРЕДИ Мобильные элементы, входящие в состав кластеров, содер-
ДИМЕРНЫХ ПРОИЗВОДНЫХ ХЛОРОФИЛЛА A жат различные регуляторные элементы, в том числе инсу-
Я.И. Пылина1, Д.М. Шадрин1, Е.С. Белых1, ляторные последовательности, которые являются платфор-
мами для сборки мультибелковых комплексов, способных
И.О. Велегжанинов1, О.М. Старцева2, Д.В. Белых2
блокировать распространение окружающего гетерохрома-
1
Институт биологии Коми научного центра Уральского тина. Однако неизвестно, каково влияние инсуляторного
отделения Российской академии наук, Сыктывкар, 167982, комплекса на функционирование двунитевых piРНК кла-
Республика Коми, Россия; стеров. С помощью трансгенной системы, содержащей сай-
2
Институт химии Коми научного центра Уральского отделения ты связывания инсуляторного белка gypsy SuHw, мы пока-
Российской академии наук, Сыктывкар, 167000. Республика зали, что сборка инсуляторного комплекса внутри piРНК
Коми, Россия; e-mail: yanapylina@yandex.ru
кластера негативно влияет на транскрипцию piРНК-
Известно, что некоторые производные хлорофилла а предшественников, биогенез piРНК и ассоциацию с хрома-
применяют в медицине в качестве фотосенсибилизаторов тином кластеров белков Rhino, HP1 и H3K9me3. Эти дан-
(ФС) для фотодинамической терапии (ФДТ) онкологиче- ные показывают, что формирование инсуляторных комплек-
ских заболеваний. Цель работы — поиск и изучение моле- сов опережает сборку хроматина, характерного для piРНК
кулярно-клеточных механизмов действия перспективных кластеров, и нарушает их функциональную целостность.
агентов для ФДТ онкологических заболеваний среди новых Работа поддержана грантом РФФИ 16-04-01107 А.
димерных производных хлорофилла а с фрагментами оли-
гоэтиленгликолей в качестве спейсеров между макроцикла- ***
ми. Проведенный анализ темновой и фотоиндуцированной
цитотоксической активности 15 новых димерных произво- ИЗБИРАТЕЛЬНОЕ ПОВЫШЕНИЕ
дных хлорофилла а на линиях раковых клеток HeLa, A549 и ПРЕДСТАВЛЕННОСТИ ФРАГМЕНТОВ ГЕНА EGFR,
нормальных фибробластах легких эмбриона человека
СОДЕРЖАЩИХ КЛИНИЧЕСКИ ЗНАЧИМЫЕ
ФЛЭЧ-104 позволил выявить наиболее перспективные со-
единения. На примере форбин-хлоринового димера с три-
МУТАЦИИ, НА ФОНЕ ИЗБЫТКА ДНК «ДИКОГО
этиленгликолем в качестве спейсера между макроциклами ТИПА»
показано, что под воздействием света данное соединение не Д.А. Родионова, М.Д. Чанышев, К.А. Благодатских,
оказывает генотоксического эффекта на опухолевые клет-
А.П. Коваль, Д.С. Щербо
ки, что свидетельствует о том, что клеточное ядро не явля-
ется мишенью его воздействия. Анализ экспрессии генов в ФГБОУ ВО РНИМУ им. Н.И. Пирогова Минздрава России,
ответ на фотоиндуцированное воздействие данного агента 117997, Москва, Россия; e-mail: alekseevna.dari@gmail.com
на опухолевые клетки показал повышение экспрессии гена При онкологических заболеваниях в крови содержится
проапоптозного лиганда TNFSF10, а также повышение экс- свободная внеклеточная ДНК, часть которой попадает в кро-
воток из опухолевых клеток (цоДНК). В ряде работ проде-

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 45


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

монстрирована возможность определения наличия сомати- генофонда свиней с помощью микросателитных локусов
ческих опухолевых мутаций во фракции цоДНК. Одним из была разработана тест-система включающая основную па-
актуальных применений такого подхода, получившего на- нель: состоящие из следующих микросателлитных локусов:
звание «жидкостная биопсия», на сегодняшний день явля- SW24, SО155, SО002, SW951, IGF-1, SW240, SW857, S0225,
ется выявление активирующих соматических мутаций в ге- SW0101, SW936, SO228 и дополнительную панель, состоя-
не EGFR, служащих важным предиктивным маркером при щую из следующих локусов: SO005, S0355, S0228, SО227,
назначении таргетной терапии немелкоклеточного рака лег- SW632, SW911, SO226. Были получены данные по ранее не
ких. При этом фракция молекул, содержащих исследуемые исследованным локусам SO005, SО002, SО227, SO226,
мутации, может быть незначительна на фоне ДНК «дикого SW632, IGF-1. В исследованной выборке число аллелей ва-
типа», что повышает требования к чувствительности мето- рьировало в пределах — от 4 до 9 аллелей на локус. Cреднее
да детекции. Поэтому актуальны подходы, позволяющие вы- число аллелей на локус 5,22±0,3. Ожидаемая гетерозигот-
являть в образце даже низкопредставленные мутации. Бла- ность варьировала от 0,3871 до 0,7393. Проведена оценка по-
годаря свойству дуплекс-специфической нуклеазы (ДСН) родной принадлежности животных по критерию Q.
избирательно гидролизовать полностью комплементарные
ДНК-дуплексы становится возможным значительно сни- ***
зить содержание ДНК «дикого типа» в пробе, сохраняя фраг-
менты ДНК, несущие мутации. Возможность такого приме- ФУНКЦИОНИРОВАНИЕ ГЕНЕТИЧЕСКИХ
нения ДСН проверяли на модельных образцах ДНК, выде- КОНСТРУКЦИЙ РАЗЛИЧНОЙ СТРУКТУРЫ
ленной из клеточной линии, и на образцах цоДНК из
В ЭУКАРИОТИЧЕСКИХ СИСТЕМАХ
плазмы крови. Были исследованы фрагменты гена EGFR в
районе «горячих точек» в экзонах 19 и 21. После обработки П.И. Селина, М.П. Рощина, Д.Р. Сафина
ДСН в присутствии зондов, комплементарных ДНК «дико-
ФГБУН Институт молекулярной генетики РАН, 123182, Москва,
го типа», детекцию мутаций проводили с помощью ПЦР и Россия; e-mail: greenapple_35@mail.ru, mailto:tussi@list.ru
секвенирования по Сэнгеру. В результате в пробах, обрабо-
танных ДСН, представленность мутантных фрагментов ДНК В настоящее время активно развивается направление,
повышалась, что во многих случаях делало возможным их связанное с созданием минимизированных генетических кон-
определение с помощью секвенирования по Сэнгеру. В пер- струкций с оптимальными показателями функционирования
спективе такой подход может быть использован для выяв- для работы в эукариотических системах. Но на сегодняшний
ления низкопредставленных мутаций с помощью общепри- день эффективность функционирования минимизирован-
нятых лабораторных методов. ных экспрессионных векторов оценена недостаточно. Нами
Работа выполнена в рамках государственного задания проведен анализ эффективности функционирования различ-
ФГБОУ ВО РНИМУ им. Н.И. Пирогова. ных генетических конструкций, которые содержали кольце-
вой плазмидный вектор и линейные векторы, в том числе век-
*** тор на основе ПЦР-амплификата. Исследования проводили
на моделях разных уровней: культуре клеток НЕК293 и эм-
брионах рыбы Danio rerio. В качестве целевого гена использо-
ИССЛЕДОВАНИЕ СВИНЬИ ДОМАШНЕЙ С вали маркерный ген модифицированного зеленого флуорес-
ПОМОЩЬЮ РАСШИРЕННОЙ ПАНЕЛИ центного белка (EGFP) под контролем промотора ранних ге-
МИКРОСАТЕЛЛИТНЫХ ЛОКУСОВ ДЛЯ АНАЛИЗА нов цитомегаловируса человека. Введение ДНК в клетки
ДОСТОВЕРНОСТИ ПРОИСХОЖДЕНИЯ HEK293 проводили при использовании коммерческого транс-
фицирующего агента TurboFect. Инъекцию генетического
Е.Л. Романишко материала в эмбрионы Danio rerio осуществляли на стадии
ГНУ «Институт генетики и цитологии НАН Беларуси, 220072, первого деления дробления в желточную область. Биоимид-
Минск, Республика Беларусь; e-mail: LenaRamanishko@mail.ru жинг инъецированных объектов осуществляли в течение двух
Во многих странах для идентификации и контроля про- недель. Показана высокая функциональная эффективность
исхождения сельскохозяйственных животных применяют минимизированной экспрессионной генетической конструк-
микросателлитные локусы, рекомендованные Международ- ции на основе ПЦР-амплификата как на клеточном, так и на
ным обществом генетики животных (ISAG). Согласно За- организменном уровне.
кону «О племенном деле в животноводстве», в Республике Работа выполнена при финансовой поддержке гранта
Беларусь племенная продукция подлежит обязательной ге- РФФИ №18-04-00319, №17-00-00189, Программ Президиу-
нетической экспертизе. По результатам проведения генети- ма РАН: «Молекулярная и клеточная биология» и «Фундамен-
ческой экспертизы выдается генетический сертификат. Цель тальные исследования для биомедицинских технологий».
работы — исследование свиньи домашней, с помощью рас-
ширенной панели микросателлитных локусов для анализа ***
достоверности происхождения животных. В качестве объ-
екта исследования мы использовали животных породы лан- ИЗУЧЕНИЕ МЕХАНИЗМОВ ПЕРЕДАЧИ
драс, йоркшир и белорусская крупная белая. Выделение РЕГУЛЯТОРНЫХ СИГНАЛОВ ОТ TOR-КИНАЗЫ
ДНК проводили с помощью набора реагенов «Нуклеосорб» К ГЕНАМ МЕТАБОЛИЗМА МЕТАНОЛА
(«Праймтех», Беларусь). Количество ДНК было нормализо- У ДРОЖЖЕЙ PICHIA PASTORIS
вано с помощью QFX Fluorometer («DeNovix», США) с ис-
пользованием набора реагентов DeNovix dsDNA Broad Range А.В. Сидорин, А.М. Румянцев
kit. Анализ микросателлитов проводили на генетическом Санкт-Петербургский государственный университет, кафедра
анализаторе 3500 («Applied Biosystems», США) относитель- генетики и биотехнологии, 199034, Санкт-Петербург, Россия;
но стандарта S 450 («Синтол», Россия). Для исследования e-mail: antonsidorin@list.ru

46 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

Дрожжи Pichia pastoris являются широко применяемой в женную тенденцию — при возрастании Tm diff результаты кла-
биотехнологии системой гетерологичной экспрессии генов. стеризации для обоих наборов для HRM-анализа приобрета-
Одно из преимуществ этих дрожжей заключается в наличии ли одинаковое распределение: для rs2273500 совпадение бы-
сильных промоторов генов метаболизма метанола (MUT- ло отмечено лишь в 21,4% случаев (15/70), для rs7590720 — в
генов), в частности гена АОХ1. В связи с практической зна- 83,9% (58/70), для rs4356203 — в 100% (70/70). Средний уро-
чимостью этих генов их регуляция активно изучается. Было вень RFU не отличался в зависимости от набора. Точность
показано, что регуляция промотора гена АОХ1 зависит от ак- кластеризации была не ниже 99,0%. Таким образом, получен-
тивности Tor-киназы. Цель данной работы — изучение меха- ные нами результаты свидетельствуют о том, что исследова-
низмов передачи сигнала от Tor-киназы, которые обеспечи- тель, использующий в своей практике HRM-анализ, должен
вают координированную регуляцию MUT-генов. Белок Mxr1, исходить из тех соображений, чтобы, во-первых, в процессе
который является ключевым активатором промотора гена моделирования праймеров сделать вклад исследуемого поли-
АОХ1, регулируется другим белком из семейства 14-3-3 за счет морфизма в общий уровень Tm наиболее существенным, и,
фосфорилирования. В ходе работы была получена плазмида, во-вторых, подтверждать результаты кластеризации допол-
содержащая последовательность гена MXR1, в которую с по- нительной проверкой с использованием альтернативных ме-
мощью сайт-направленного мутагенеза была внесена заме- тодов, например, ПЦР-ПДРФ.
на, приводящая к нарушению сайта фосфорилирования. Дан-
ной конструкцией был трансформирован штамм P. pastoris, ***
что приводило к замене последовательности MXR1 дикого ти-
па на последовательность, кодирующую белок с нарушенным АНАЛИЗ ЭКСПРЕССИИ ГЕНОВ
сайтом фосфорилирования. Далее полученные штаммы НЕЙРОТРАНСМИТТЕРНЫХ СИСТЕМ В КЛЕТКАХ
трансформировали плазмидой, содержащей репортерный ген ПОДКОРКОВЫХ СТРУКТУР И ЛОБНО-
кислой фосфатазы РНО5 под контролем промотора гена ТЕМЕННОЙ КОРЫ ГОЛОВНОГО МОЗГА КРЫС
АОХ1. Полученная репортерная система позволяет оценить
В УСЛОВИЯХ ЦЕРЕБРАЛЬНОЙ ИШЕМИИ
участие белков Mxr1 и 14-3-3 в передаче сигнала от Tor-
киназы за счет измерения активности промотора гена АОХ1 В.В. Ставчанский1, И.Б. Филиппенков1,
в различных условиях. А.Е. Денисова2, Л.В. Дергунова1, 2
Работа выполнена при поддержке гранта РФФИ №18-
34-00750 мол_а. ФГБУН Институт молекулярной генетики РАН, 123182,
1

Москва, Россия;
2
ФГБОУ ВО «Российский национальный исследовательский
*** медицинский университет им. Н.И. Пирогова» Минздрава РФ,
117997, Москва, Россия; e-mail: bacbac@yandex.ru
ТОЧНОСТЬ КЛАСТЕРИЗАЦИИ ПРИ Церебральная ишемия относится к числу наиболее рас-
ИСПОЛЬЗОВАНИИ МЕТОДА HRM (HIGH пространенных причин нарушения функции мозга. Анализ
RESOLUTION MELTING) В ЗАВИСИМОСТИ транскриптома является одним из новых подходов к изуче-
ОТ РАЗНИЦЫ ТЕМПЕРАТУРЫ ПЛАВЛЕНИЯ нию функционирования мозга в норме и при ишемии, а так-
АЛЬТЕРНАТИВНЫХ АЛЛЕЛЕЙ же применяется для разработки новых стратегий лечения
ишемического инсульта. Мы использовали модель обрати-
Е.В. Снытков1, Е.Г. Смирнова1, В.Н. Кипень2, мой церебральной ишемии у крыс (tMCAO), которая наибо-
С.Б. Мельнов1 лее часто используется при изучении нейропротекции. Мо-
1
УО «Международный государственный экологический институт дель основана на внутрисосудистой окклюзии правой сред-
им. А.Д. Сахарова» БГУ, 220070, Минск, Республика Беларусь, ней мозговой артерии в течение 90 мин с последующей
e-mail: evsnytkov@gmail.com реперфузией. RNA-Seq анализ экспрессии генов показал, что
ГНУ «Институт генетики и цитологии НАН Беларуси», 220072,
2 спустя сутки после tMCAO в подкорковых структурах мозга
Минск, Республика Беларусь, e-mail: slavakipen@rambler.ru крыс, содержащих очаг повреждения, ишемия преимуще-
Метод высокоразрешающего плавления ДНК (High ственно подавляет экспрессию генов, участвующих в функ-
resolution melting, HRM) широко используется в молекуляр- ционировании систем нейросигнализации. Среди них гены
ной генетике ввиду его относительной простоты реализации. белка синаптического везикулярного транспорта (Cplx2), ре-
Цель данного исследования — оценить дифференцирующий цепторов дофамина (Drd1), серотонина (Htr6), глутамата
потенциал двух наборов для генотипирования методом HRM (Grm3, Grm5), ацетилхолина (Chrm1, Chrm4) и другие. Исполь-
— qPCR GreenMaster («Jena Bioscience», Германия) и Precision зование ПЦР в реальном времени позволило выявить схожие
Melt Supermix («Bio-Rad», США) — в зависимости от разни- изменения экспрессии генов спустя сутки после tMCAO в
цы температуры плавления альтернативных аллелей (в диа- лобно-теменной коре, взятой со стороны повреждения, но
пазоне рассчитанных Tm 0,25—0,89 °C). Генотипирование по вместе с тем было зафиксировано значительное подавление
трем полиморфным вариантам rs7590720, rs2273500, rs4356203 экспрессии генов Drd1, Chrm1, Grm3 и Cplx2 в аналогичных
проводилось с использованием наборов qPCR GreenMaster и участках мозга крыс после ложной операции. Таким образом,
Precision Melt Supermix согласно рекомендациям производи- в лобно-теменной коре генетические ответы, связанные с ней-
телей на приборе CFX96 Touch. Валидация генотипов была росигнализацией, вызваны не только развитием ишемиче-
проведена с использованием ПЦР-ПДРФ. Разница в Тm для ского повреждения, но, вероятно, являются сложной комби-
rs2273500 в среднем на 1,7 °C оказалась меньше при исполь- нацией эффектов, включая реакцию на стресс.
зовании Precision Melt Supermix, для rs7590720 — на 1,9 °C, Работа выполнена при поддержке гранта Российского
для rs4356203 — 2,0 °C, чем при использовании qPCR научного фонда №16-14-00077.
GreenMaster. Результаты кластеризации также имели выра-
***

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 47


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

ИССЛЕДОВАНИЕ ВЛИЯНИЯ ГЕНА TRIM14 Артериальная гипертензия является основным факто-


НА ПОВЕДЕНИЕ ТРАНСГЕННЫХ МЫШЕЙ ром риска сердечно-сосудистых заболеваний, патогенез
И ТРАНСКРИПЦИЮ ГЕНОВ, КОДИРУЮЩИХ которого связан с воспалением и дисфункцией эндотелия.
НЕЙРОТРОФИНЫ Наша цель состояла в изучении роли медиаторов воспале-
ния в развитии эссенциальной гипертензии (ЭГ) и опреде-
Е.А. Степаненко1, А.Д. Вовк1, М.В. Рекунова1, лении особенностей экспрессии генов у лиц с повышен-
Д.Ю. Побережный1, И.В. Макарова2, ной выживаемостью (80 лет и старше). Мы провели анализ
Н.А. Щербатова2, Л.Е. Андреева2, Д.Д. Марков2, профилей экспрессии генов в лейкоцитах периферической
В.В. Ненашева2, В.З. Тарантул2 крови 30 пациентов с ЭГ и 32 здоровых лиц в возрасте от
30 до 60 лет, а также 12 человек в возрасте от 82 до 113 лет
1
Российский химико-технологический университет (6 пациентов с ЭГ, 6 лиц группы контроля) с использова-
им. Д.И. Менделеева, 125047, Москва, Россия; нием RT² Profiler PCR Array (Qiagen, США). В группе па-
2
ФГБУН Институт молекулярной генетики Российской академии циентов с ЭГ среднего возраста мы обнаружили изменен-
наук, 123182, Москва, Россия; e-mail: katishsha@mail.ru ную транскрипционную активность 21 гена. Проведение
Белок TRIM14 относится к семейству TRIM белков, ко- количественного анализа позволило подтвердить значи-
торые участвуют во многих важных физиологических про- тельные различия в уровнях экспрессии генов CX3CR1 (FC,
цессах в клетке, включая нейрогенез и иммунитет. Ранее на- fold change, 29.2), CXCL13 (FC=13,8), IL1F6 (FC=12,9),
ми было установлено, что повышенная экспрессия гена CD40LG (FC=8), CXCL1 (FC=7,2). У пожилых пациентов с
TRIM14 человека подавляет нейрональную дифференциров- ЭГ повышена экспрессия генов NFKB1 (FC=3,21) и IL18R1
ку эмбриональных стволовых клеток мыши, а ингибирова- (FC=2,41), и снижена экспрессия генов CCL5, CFS1,2,3,
ние экспрессии эндогенного Trim14 приводит к усилению CD4, RPLP0, BCL2, SRC, IL15, CD40LG, CDKN1A, MYC.
этой дифференцировки (Novosadova и соавт., 2012). Также Анализ ассоциаций с ЭГ полиморфных вариантов иссле-
мы показали, что количество мРНК и белка TRIM14 пони- дуемых генов в группе пациентов с ЭГ и практически здо-
жается при дифференцировке индуцированных плюрипо- ровых лиц в возрасте от 30 до 108 лет позволил выявить ас-
тентных стволовых клеток человека в терминально диффе- социацию с ЭГ аллеля rs355689*C гена CXCL13 (OR=0,61,
ренцированные нейроны (Nenasheva и соавт., 2017). Мы пред- PBonf=5*10–4). Результаты исследования свидетельствуют о
полагаем, что белок TRIM14, как и некоторые другие белки дифференциальной экспрессии генов медиаторов воспа-
TRIM семейства, может участвовать в процессах централь- ления у пациентов с ЭГ различных возрастных групп.
ной нервной системы (ЦНС). Для определения роли TRIM14
в функционировании ЦНС мы использовали трансгенных ***
мышей, экспрессирующих ген TRIM14 человека, которые бы-
ли получены в нашей лаборатории (две линии). Поведенче- РАЗРАБОТКА И ОПТИМИЗАЦИЯ ТЕСТ-СИСТЕМЫ
скую активность животных оценивали в тесте Порсолта (при- ПЦР С ГИБРИДИЗАЦИОННО-
нудительное плавание), который показал, что у мышей ФЛУОРЕСЦЕНТНЫМ МЕТОДОМ ДЕТЕКЦИИ
трансгенной линии с более высокой экспрессией трансгена
ДЛЯ ОБНАРУЖЕНИЯ ПАРВОВИРУСА В
выше уровень тревожности и эмоциональной реактивности,
ЛАБОРАТОРНОЙ ДИАГНОСТИКЕ
а также ниже способность к адаптации в стрессогенных усло-
виях по сравнению с животными дикого типа. В гиппокампе М.Ф. Тимина, А.В. Шмалий, Л.Е. Павлова,
трансгенных мышей уровень мРНК Ngf, Nt3, Gdnf резко cни- А.А. Агумава
жен у животных обеих линий по сравнению с контрольными
животными. После теста Порсолта происходило резкое уве- ФГБНУ «НИИ медицинской приматологии», 354376, Сочи,
Россия; e-mail: free_marshmallows@mail.ru
личение транскрипции этих факторов в гиппокампе мышей
обеих трансгенных линий при ее уменьшении у контрольных Парвовирус распространен среди домашних и производ-
животных. Таким образом, в своей работе на модели трансген- ственных плотоядных животных, и заболевание инфекцией
ных мышей мы показали, что ген TRIM14, по-видимому, ак- может привести к летальному исходу для неиммунизирован-
тивно участвует в функционировании ЦНС. ных животных. Поэтому важна своевременная и достоверная
Работа поддержана грантом РФФИ 18-04-00733, НИР диагностика парвовирусных инфекций. Полимеразная цеп-
№01201355481. ная реакция (ПЦР) является методом диагностики широко-
го использования, но не лишена недостатков. Цель исследо-
вания — разработка и оптимизация тест-системы ПЦР для
*** диагностики парвовируса плотоядных. В ходе работы для
улучшения экстракции нуклеиновых кислот был модифици-
АНАЛИЗ ПРОФИЛЕЙ ЭКСПРЕССИИ ГЕНОВ рован стандартный сорбентный метод. При создании тест-си-
МЕДИАТОРОВ ВОСПАЛЕНИЯ У ПАЦИЕНТОВ стемы проведено множественное выравнивание полногеном-
ных сиквенсов ста штаммов парвовирусов плотоядных для
С ЭССЕНЦИАЛЬНОЙ ГИПЕРТЕНЗИЕЙ
поиска консенсусных участков геномов. К выбранным участ-
Я.Р. Тимашева1, 2, В.В. Эрдман2, Т.Р. Насибуллин2, кам в дальнейшем подбирали праймеры и зонд, строго гомо-
И.А. Туктарова2, О.Е. Мустафина2 логичные исключительно с геномом парвовирусов плотояд-
ных, что обеспечило высокую специфичность ПЦР. Опти-
1
Башкирский государственный медицинский университет,
мизированы концентрация реагентов (праймеры, зонд,
450000, Уфа, Россия;
дезоксирибонуклеотид, полимераза, ионы магния и т.д.) и
2
Институт биохимии и генетики Уфимского федерального температурный профиль реакции амплификации. Проведе-
исследовательского центра Российской академии наук, 450054,
но сравнение разработанной тест-системы с коммерческой
Уфа, Россия; e-mail: ianina_t@mail.ru
тест-системой фирмы Вектор-Бест. В результате исследова-

48 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

ния оптимизирован метод экстракции, позволяющий без по- РОЛЬ ЦИКЛОРНК-МИКРОРНК-МРНК


тери качества сократить время пробоподготовки на 20%. Раз- ВЗАИМОДЕЙСТВИЙ В КЛЕТКАХ ГОЛОВНОГО
работана собственная тест-система ПЦР с технологией МОЗГА КРЫСЫ В УСЛОВИЯХ ЦЕРЕБРАЛЬНОЙ
TaqMan для детекции парвовируса плотоядных, в два раза ИШЕМИИ
превосходящая коммерческую тест-систему фирмы Век-
тор-Бест по чувствительности (значение порогового цикла И.Б. Филиппенков1, В.В. Ставчанский1,
ниже на 1,3 единицы) и соотношению уровня сигнал/шум. А.Е. Денисова2, Н.С. Ионов2, Л.В. Дергунова1, 2
*** ФГБУН Институт молекулярной генетики РАН, 123182,
1

Москва, Россия;
2
ФГБОУ ВО «Российский национальный исследовательский
РАСШИРЕНИЕ ЗНАНИЙ О РАЗНООБРАЗИИ медицинский университет им. Н.И. Пирогова» Минздрава РФ,
МАГНИТОТАКТИЧЕСКИХ БАКТЕРИЙ 117997, Москва, Россия; e-mail: filippenkov@img.ras.ru
ПОСРЕДСТВОМ АНАЛИЗА МЕТАГЕНОМНЫХ Ишемический инсульт мозга относится к числу наибо-
ДАННЫХ лее тяжелых и социально значимых заболеваний. На сегод-
М. Узун1, 2, Л.М. Алексеева1, 2, М.С. Круткина1, няшний день в патогенезе и терапии ишемического инсуль-
та большое внимание уделяется изучению роли РНК. В реак-
В.В. Козяева1, Д.С. Груздев1
ции транскриптома на ишемию участвуют не только
1
ФИЦ биотехнологии РАН, 119071, Москва, Россия; информационные мРНК, но и различные типы некодирую-
2
МГУ им. М.В. Ломоносова, Ленинские горы, 119991, Москва, щих РНК. В частности, циклические РНК (циклоРНК) мо-
Россия; e-mail: uzunmasha@gmail.com гут взаимодействовать с микроРНК, негативно влияющими
Магнитотактические бактерии (МТБ) — группа бакте- на экспрессию многих мРНК, и нивелировать их активность.
рий, отличительной особенностью которых является спо- ЦиклоРНК имеют замкнутую структуру, устойчивую к воз-
собность к синтезу наноразмерных кристаллов магнетита действию экзонуклеаз, и демонстрируют преимущественный
(Fe3O4) или грейгита (Fe3S4), покрытых липопротеиновой мозгоспецифический характер экспрессии у млекопитающих.
мембраной. Такие органеллы получили название магнето- В данной работе нами применена модель обратимой ишемии
сомы, а их синтез в клетках МТБ контролируется генетиче- мозга у крыс (tMCAO), основанная на окклюзии правой сред-
ски совокупностью оперонов, получившей название ней мозговой артерии монофиламентом в течение 90 мин с
«Mагнетосомный Геномный Остров» (МГО). Он кодирует последующей реперфузией. Через 24 ч после tMCAO мы про-
синтез Mam-белков, не присутствующих в других клеточ- анализировали изменение уровня мРНК, микроРНК и ци-
ных органеллах. Несмотря на 50-летнее изучение МТБ, зна- клоРНК в мозге ишемизированных крыс относительно лож-
ния о процессе биоминерализации магнетосом до сих пор нооперированных животных с помощью полногеномного
остаются неполными в силу небольшого количества модель- RNA-Seq-анализа. Нами были выявлены 713 мРНК, 407 ми-
ных организмов. Так, известно всего около 60 геномов МТБ, кроРНК и 72 циклоРНК, дифференциально представленных
филогенетически принадлежащих к Proteobacteria, Nitrospi- в зоне повреждения в условиях tMCAO. Биоинформатиче-
rae, Omnitrophica, Planctomycetes и Latescibacteria. В настоя- ский анализ выявил значительное количество сайтов связы-
щем исследовании было проанализировано 61410 бактери- вания микроРНК в последовательностях циклоРНК и мР-
альных геномов и 10587 метагеномных данных из водных, НК, изменивших свою экспрессию при ишемии. В результа-
наземных, симбионтных и антропогенных экосистем из ба- те проделанной работы были выявлены гены и РНК,
зы данных IMG для обнаружения МТБ. В качестве маркер- являющиеся потенциальными маркерами в диагностике и
ного белка для BLAST-анализа использовали MamK. В ре- мишенями в терапии ишемического инсульта. Дальнейший
зультате был найден 301 MamK из 139 метагеномов. Бин- анализ циклоРНК-микроРНК-мРНК взаимодействий мо-
нинг обнаруженных метагеномов осуществлялся при жет заложить основу для выяснения механизмов поврежде-
помощи программы DAS Tool. Для бинов, содержащих ния и восстановления при церебральной ишемии.
MamK, определялась филогенетическая принадлежность, и Работа выполнена при поддержке гранта Российского
были собраны их МГО. В результате были найдены новые научного фонда №17-74-10189.
МТБ различных таксономических рангов, что существенно
***
увеличило базу организмов для дальнейшей реконструкции
эволюционных путей МГО и расширения знаний о процес-
ИЗУЧЕНИЕ КОЛЛЕКЦИИ СОРТОВ И ЛИНИЙ
сах биоминерализации магнетосом.
Работа выполнена при поддержке программы РАН «На-
ПШЕНИЦЫ (TRITICUM AESTIVUM L.)
ноструктуры: физика, химия, «Основы биологии, техноло- ПО АЛЛЕЛЬНОМУ СОСТАВУ ГЕНОВ HMW
гии» и Министерства науки и высшего образования Россий- ГЛЮТЕНИНОВ
ской Федерации.
Е.А. Фомина
*** Институт генетики и цитологии НАН Беларуси, 220072, Минск,
Республика Беларусь; e-mail: e.fomina@igc.by
Качество хлеба, производимого из гексаплоидных со-
ртов пшеницы, — это сложный признак, который зависит
от многих факторов. Однако гидрофобные белки глютени-
ны вносят значительный вклад в эластичность и вязкость
теста. Нами исследован аллельный состав генов, кодиру-
ющих глютенины, в коллекции, состоящей из 236 образ-
цов озимой и 98 образцов яровой пшеницы белорусской и

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 49


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

зарубежной селекции. Выявлено 13 аллелей среди образ- РЕГУЛЯЦИЯ SOS-ОТВЕТА БАКТЕРИЙ


цов озимой пшеницы и 11 — среди образцов яровой пше- ПРОТЕАЛИЗИНОМ
ницы. Среди исследованных образцов выявлено 36 различ-
ных генотипов. Наиболее часто среди образцов озимой О.А. Цаплина1, С.Ю. Хайтлина1, Т.О. Артамонова2,
пшеницы встречаются сорта и линии, обладающие гено- Д.М. Байтин3, И.В. Бахланова3
типами Glu-A1с, Glu-B1с, Glu-D1d (16,2% от общего коли- 1
Институт цитологии РАН, 194064, Санкт-Петербург, Россия;
чества исследованных образцов), Glu-A1a, Glu-B1с, Glu-D1d 2
Санкт-Петербургский политехнический университет Петра
(13,7%), Glu-A1b, Glu-B1с, Glu-D1d (12,7%), а среди образ- Великого, 195251, Санкт-Петербург, Россия;
цов яровой пшеницы — генотипами Glu-A1a, Glu-B1с, Glu- 3
НИЦ «Курчатовский институт» — Петербургский институт
D1d (22,5%), Glu-A1a, Glu-B1с, Glu-D1a (16,4%), Glu-A1с, ядерной физики, 188300, Гатчина, Россия; e-mail: olga566@mail.ru
Glu-B1f, Glu-D1d (13,3%). В геноме линии яровой пшени-
цы КП-406/11 обнаружен аллель гена, кодирующего пер- В ответ на серьезные повреждения ДНК бактерии запу-
вичную структуру Bx-субъединицы, максимальная степень скают каскад защитных реакций — SOS-ответ. SOS-ответ мо-
идентичности которого относительно представленных в жет запускаться в ответ на контакт бактерий с эпителиальны-
базе данных GenBank нуклеотидных последовательностей ми клетками, продуцирующими повреждающие ДНК аген-
Bx-субъединиц составила 99%. Он содержит открытую рам- ты для защиты от бактериальной инфекции.
ку считывания длиной 2367 п.н. и имеет наибольшую сте- Условно-патогенные бактерии Serratia proteamaculans способ-
пень идентичности с нуклеотидной последовательностью ны проникать в цитоплазму клеток эукариот, что коррелиру-
субъединицы Вх14. Аминокислотная последовательность ет с активностью актин-специфической протеазы протеали-
длиной 789, кодируемая данным аллелем, отличается от зин. Задачей настоящей работы было оценить возможную
Вх14 заменами аминокислотных остатков в трех позициях роль регуляции SOS-ответа протеализином во время инва-
— 662, 780 и 788. Он получил название Вх14.1 (номер до- зии. Мы показали, что трансформация бактерий E. coli плаз-
ступа в Genbank MH108092). мидой, несущей ген протеализина, приводит к уменьшению
выживаемости бактерий при облучении ультрафиолетом, что
*** может указывать на снижении уровня SOS-ответа. По дан-
ным масс-спектрометрии, протеализин расщепляет стрессо-
вые белки: шаперон GroEL и очищенный белок SOS-ответа
ОПРЕДЕЛЕНИЕ ПЕРВИЧНОЙ
RecA, что приводит к потере способности RecA образовывать
ПОСЛЕДОВАТЕЛЬНОСТИ ЭКЗОНОВ полимеры. Мы показали, что S. proteamaculans экспрессиру-
И CPG-ОСТРОВКОВ В ГЕНЕ BDNF У КРЫС ют RecA и шаперон GroEL конститутивно, и контакт с клет-
С ГЕНЕТИЧЕСКИ РАЗЛИЧНЫМ УРОВНЕМ кой-хозяином не влияет на уровень их экспрессии, как это
ВОЗБУДИМОСТИ НЕРВНОЙ СИСТЕМЫ было, например, показано для бактерий Listeria, которые экс-
прессируют RecA только в ответ на контакт с клеткой-хозя-
Д.А.-А. Хлебаева, Т.Г. Зачепило, Н.А. Дюжикова
ином. Таким образом, протеализин может регулировать ко-
Институт физиологии им. И.П. Павлова РАН, Санкт-Петербург, личество белков SOS ответа RecA и GroEL, и способствовать
Россия; e-mail: dibair@yandex.ru инвазии, ускоряя прохождение репликативной вилки.
Нейротрофический фактор мозга (Brain-derived neuro- Работа поддержана грантом РФФИ 17-04-00558.
trophic factor — BDNF) — один из наиболее изученных ней-
ротрофинов. Изменения экспрессии гена Bdnf и нарушения ***
его эпигенетической регуляции в разных структурах мозга
показаны при стресс-зависимых патологических состояни- ВИДОВАЯ ИДЕНТИФИКАЦИЯ ОСЕТРОВЫХ РЫБ
ях. Влияние наследственно обусловленных различий в уров- (ACIPENSERIDAE)
не возбудимости нервной системы (НС) на эти процессы не
исследовалось. Цель исследования — определить первич- А.И. Царь, А.Ю. Носова
ную последовательность экзонов и CpG-островков в гене 1
Институт генетики и цитологии НАН Беларуси, 220072, Минск,
Bdnf у крыс с генетически детерминированным различным Республика Беларусь; e-mail: A.Tsar@igc.by
уровнем возбудимости НС (ВП — высокий порог возбуди- Осетровые — реликтовая группа рыб с длительной эво-
мости, НП — низкий). Из гиппокампа крыс выделяли ДНК люционной историей, которая подпадает под Конвенцию о
протеиназным методом. Проводили ПЦР, ПЦР-продукты международной торговле видами дикой фауны и флоры, на-
секвенировали по Сэнгеру (Евроген). В последовательно- ходящимися под угрозой исчезновения (CITES). Установ-
сти (Gene ID: 24225) были определены 24 CpG-богатых ре- ление легальности происхождения продукции из осетровых
гиона (от 50 п.н.) в гене и промоторной области (1280 п.н. невозможно без точной идентификации вида на всех стади-
до начала гена) (EMBOSS Cpgplot). Для секвенирования ис- ях развития особей — от икры до взрослого организма, а так-
пользовали 3 фрагмента ДНК в положениях — 1280—3560 же продуктов питания из них (мясо, балык, пищевая икра и
п.н, 18150—20381 п.н., 46923—50574 п.н. от точки начала т.п.). Существенное различие в цене разных представителей
транскрипции (включающие 20 CpG-регионов, 7 5’-нетранс- осетровых и их гибридов делает генетические исследования
лируемых экзонов и 1 3’-кодирующий экзон). Полученные видовой принадлежности продуктов питания актуальными
данные способствуют пониманию структурных особенно- для защиты интересов потребителя. Кроме того, для адек-
стей гена Bdnf у крыс линий с контрастной возбудимостью ватной селекционной работы в условиях аквакультуры не-
НС для дальнейшего исследования изменений его экспрес- обходимо знать чистоту (гибридность) разводимой рыбы. В
сии и эпигенетической регуляции под влиянием психоэмо- настоящее время наиболее достоверно позволяют иденти-
ционального стресса. фицировать продукцию из осетровых молекулярно-генети-
ческие методы анализа ядерной и митохондриальной ДНК
***

50 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

(мтДНК). Нами изучены образцы пищевой продукции и кого типа контрольной группы и группы МФТП, что может
биоматериал стерляди (Acipenser ruthenus), белуги (Huso huso), отражать скрытые признаки и динамику прогрессии хрони-
бестера (Huso huso × Acipenser ruthenus), стероса (Acipenser ческой досимптомной стадии БП. В результате работы отра-
ruthenus × Acipenser gueldenstaedtii) и стербела (Acipenser ботан протокол анализа данных для исследования прогрес-
ruthenus × Huso huso). В качестве негативного контроля бы- сии нарушения двигательной функции у мышей в токсиче-
ли использованы образцы сибирского и ленского осетров, ской модели МФТП-индуцированного паркинсонического
а также их гибрида. Исследование с использованием спец- синдрома. Выявлено 50 параметров, показатели которых до-
ифичных маркеров 247_Arp/247_uni, 247_ARn/247_uni, 153_ стоверно отражают нарушения двигательной функции у жи-
HHp/153_uni, 153_HHn/153_uni к ядерной последователь- вотных.
ности, обнаруженной в референсном контиге №140238 для Исследование поддержано грантом РНФ 19-14-00064.
стерляди и референсном контиге №216845 для белуги
(Havelka и соавт., 2017), позволяет однозначно определить ***
видовую принадлежность исследуемого образца. ПЦР-ана-
лиз подтвердил, что два образца относятся к белуге, два — к ИЗУЧЕНИЕ РОЛИ СЕНСОРОВ АМИНОКИСЛОТ В
стерляди, один к бестеру и один к стербелу. Было также РЕГУЛЯЦИИ ГЕНОВ МЕТАБОЛИЗМА МЕТАНОЛА
определено, что один образец, заявленный как белуга, ока-
У ДРОЖЖЕЙ PICHIA PASTORIS
зался бестером. Таким образом, данное исследование по-
зволяет отделить «чистых» представителей стерляди и белу- Н.И. Шараев, А.М. Румянцев
ги от их комерческих гибридов и продуктов из них, что не-
Санкт-Петербургский государственный университет, кафедра
возможно при анализе специфичных участков мтДНК, генетики и биотехнологии, Санкт-Петербург, Россия; e-mail:
которые наследуются только по материнской линии. nikita_51s@mail.ru
Промоторы генов метаболизма метанола используются
***
для гетерологичной экспрессии в дрожжах Pichia pastoris и по-
этому механизмы их регуляции активно изучаются. Было по-
АНАЛИЗ ПРОГРЕССИИ МФТП- казано, что регуляция промотора гена алкогольоксидазы 1
ИНДУЦИРОВАННОГО ПАРКИНСОНИЧЕСКОГО (АОХ1) зависит от наличия ряда аминокислот в среде, в част-
СИНДРОМА ности пролина и глутамата. У дрожжей Saccharomyces cerevisi-
ae сенсинг аминокислот опосредуется SPS-системой, основу
К.Д. Чапров1, Е.В. Тетерина1, 2 которой составляют белки, кодируемые генами SSY1, PTR3 и
1
Институт физиологически активных веществ Российской SSY5. Целями данной работы являлись поиск у P. pastoris ге-
академии наук, 142432, Черноголовка, Россия; нов SPS-комплекса и конструирование репортерной систе-
2
Сибирский государственный медицинский университет мы, которая позволит исследовать влияние сенсинга амино-
Министерства здравоохранения Российской Федерации, кислот на регуляцию экспрессии генов метаболизма метано-
634050, Томск, Россия; e-mail: chapkir@gmail.com ла у этих дрожжей. В начале был проведен анализ генома P.
Болезнь Паркинсона (БП) — распространенное нейро- pastoris, в ходе которого были выявлены гены РрSSY1, РрPTR3
дегенеративное заболевание, характеризующееся поражени- и РрSSY5, гомологичные соответствующим генам S. cerevisi-
ем структур экстрапирамидной системы, преимущественно ae. Далее последовательность гена РрSSY1, кодирующего бе-
черной субстанции (ЧС), потерей дофаминергических (ДА) лок, непосредственно осуществляющий сенсорную функ-
нейронов и наличием в них телец Леви. Одним из наиболее цию, была встроена в состав плазмиды pPIC9-PCUP таким об-
распространенных методов индукции симптомов БП являет- разом, что она оказалась под контролем регулируемого
ся введение нейротоксина 1-метил-4-фенил-1,2,3,6-тетраги- промотора гена CUP1. Данной плазмидой был трансформи-
дропиридина (МФТП), который обладает селективной ток- рован штамм GS115 дрожжей P. pastoris. После этого в геном
сичностью по отношению к ДА нейронам ЧС. Истощение трансформантов была встроена конструкция PAOX1-PHO5
пула ДА нейронов ведет к нарушению кортикального кон- на основе репортерного гена кислой фосфатазы. Получен-
троля сложных движений, и развитию симптомов БП: бра- ный штамм позволяет измерять активность промотора гена
дикинезии, семенящей походки, тремору. Нашей целью бы- АОХ1 на фоне сверхэкспресии гена, кодирующего специфи-
ло отработать анализ нарушений двигательной функции в ческий сенсор аминокислот РрSSY1.
установке CatWalk у мышей линии С57BL при моделирова- Работа выполнена при поддержке гранта РФФИ №18-34-
нии МФТП-индуцированного паркинсонического синдро- 00750 мол_а.
ма. Внутрибрюшинное введение МФТП осуществлялось в
течение 5 дней в дозе 30 мг/кг МФТП в сутки. Исследование ***
двигательной функции животных проводили с помощью тех-
нологии Illuminated Footprints™ на установке CatWalk (Nol- PHF10 — СУБЪЕДИНИЦА РЕМОДЕЛИРУЮЩЕГО
dus, Нидерланды) через 21 день после завершения введения ХРОМАТИН PBAF КОМПЛЕКСА РЕГУЛИРУЕТСЯ
МФТП. Данная технология анализа походки позволяет реги- КИНАЗАМИ PI3K/AKT-СИГНАЛЬНОГО ПУТИ
стрировать разницу в распределении давления и веса тела жи-
А.А. Шейнов1, Е.В. Татарский1, С.Г. Георгиева1, 2,
вотного на четыре конечности во время ходьбы. Статистиче-
скую обработку полученных данных проводили с помощью Н.В. Сошникова1
T-теста для зависимых наблюдений и критерия Манна—Уит- 1
ФГБУН Институт биологии гена РАН, Москва, 119334, Россия;
ни в программных пакетах GraphPad Prism 6 («GraphPad 2
Институт молекулярной биологии РАН, Москва, 119991,
Software, Inc.», США). Анализ 200 детектируемых установкой Россия; e-mail: asheinov@gmail.com
CatWalk параметров показал наличие 50 статистически досто- Ремоделирующие комплексы играют важную роль в ре-
верных различий между показателями походки животных ди- гуляции экспрессии генов при развитии организма. Ремо-

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 51


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

делирующие комплексы PBAF, семейства SWI/SNF, изме- го цикла и ферментов антиоксидантной системы. Судя по
няют структуру хроматина, обеспечивая доступ транскрип- морфологическим и функциональным показателям, рас-
ционным факторам к регуляторным последовательностям тения на склоне адаптировались к действию избыточной
генов. Регуляция работы комплексов осуществляется во инсоляции и водного дефицита. Величина нефотохими-
многом за счет изменения субъединичного состава. Также ческого тушения, отражающая диссипацию поглощенной
субъединицы комплекса PBAF подвергаются посттрансля- световой энергии, в полуденные часы достигала предель-
ционным модификациям, которые влияют на функции все- ных значений. Листья затененных растений реализовали
го комплекса. Одной из важных субъединиц PBAF комплек- большую часть поглощенной энергии в фотохимических
са является белок PHF10, определяющий взаимодействие процессах и отличались превалированием цитохромного
PBAF комплекса с хроматином. PHF10 представлен в клет- над альтернативным путем митохондриального дыхания.
ке четырьмя изоформами. Изоформы альтернативно вклю- Популяционный генетический анализ P. media с исполь-
чаются в PBAF комплекс и по-разному влияют на ремоде- зованием межмикросателлитных маркеров (Intersimple
лируемые комплексом гены. Мы показали, что все изофор- sequence repeats — ISSR) позволил выявить два кластера,
мы PHF10 значительно фосфорилированы. Каждая границы которых совпадают с границами между расте-
изоформа имеет уникальный паттерн фосфорилирования, ниями из разных местообитаний. В отсутствие барьеров,
зависящий от доменной структуры. В данной работе мы из- препятствующих обмену генетической информацией, это
учили паттерн фосфорилирования Y, характерный для изо- можно объяснить отбором генотипа с преимуществами
форм PHF10, имеющих длинный N-концевой домен. Было для выживания и размножения в конкретных условиях.
показано, что множественное фосфорилирование Y-класте- Работа выполнена в рамках темы НИР, номер ГР ААА-
ра определяется двумя ключевыми серинами и является три- А-А17-117033010038-7.
ггерным. Данные серины входят в состав мотивов, узнаю-
щихся Akt и ERK1/2 киназами FGF/EGF сигнального каска-
да. При мутации этих серинов происходит полное ***
элиминирование множественного фосфорилирования
Y-кластера. Нами была выявлена минимальная последова- 5’-ДЕЗОКСИРИБОФОСФАТ-ЛИАЗНАЯ
тельность PHF10, подвергающаяся фосфорилированию, и АКТИВНОСТЬ ПОЛИМОРФНЫХ ВАРИАНТОВ
показано, что в состав комплекса PBAF включаются макси-
POL IOTA ЧЕЛОВЕКА
мально фосфорилированные изоформы PHF10. Таким об-
разом, можно предположить, что фосфорилирование Y-кла- Е.С. Шилкин, А.В. Макарова
стера длинных изоформ PHF10 киназами Akt и ERK1/2 вли-
ФГБУН Институт молекулярной генетики РАН, 123182, Москва,
яет на функционирование комплекса PBAF и регулирует его Россия; e-mail: shilkinevgeniy.chem@gmail.com
участие в активации генов в ответ на действие белков FGF/
EGF сигнального каскада. ДНК-полимераза йота (Pol ι) Y-семейства ДНК-по-
Данная работа поддержана грантом РФФИ 18-04-00885 лимераз относится к специализированным ДНК-полиме-
А «Влияние фосфорилирования на регуляцию PHF10/BAF45a — разам, осуществляющим синтез ДНК напротив повре-
субъединицы ремоделирующего хроматин комплекса PBAF жденных матричных оснований. Pol ι обладает дополни-
млекопитающих». тельной 5’-дезоксирибофосфат(5’-дРФ)-лиазной
активностью, необходимой на некоторых этапах эксци-
зионной репарации оснований (ЭРО). Предполагается,
*** что Pol ι может принимать участие в ЭРО повреждений
ДНК, возникающих при окислительном стрессе. Мы про-
анализировали влияние распространенных аминокислот-
СТРУКТУРНО-ФУНКЦИОНАЛЬНАЯ
ных полиморфизмов, затрагивающих активный центр
ОРГАНИЗАЦИЯ И ГЕНЕТИЧЕСКАЯ фермента, на 5’-дРФ-лиазную активность Pol ι человека:
ДИФФЕРЕНЦИАЦИЯ ПОПУЛЯЦИИ РАСТЕНИЙ R71G, E251K и I236M. Белок дикого типа и полиморф-
PLANTAGO MEDIA L. НА ЮЖНОМ ТИМАНЕ ный вариант I236M продемонстрировали одинаковый уро-
М.А. Шелякин, И.Г. Захожий, Е.В. Силина, вень 5’-дРФ-лиазной активности. Для полиморфного ва-
рианта E251K наблюдали умеренное увеличение
Я.И. Пылина, Д.М. Шадрин, И.Ф. Чадин,
5’-дРФ-лиазной активности. Однако было показано, что
Т.К. Головко способность к отщеплению 5’-дРФ-группы у формы R71G
Институт биологии Коми научного центра Уральского отделения значительно снижена по сравнению с Pol ι дикого типа.
РAH, Сыктывкар, 167982, Россия; e-mail: shelyakin@ib.komisc.ru Падение 5’-дРФ-лиазной активности коррелировало со
Растения рода Plantago известны своей уникальной снижением ДНК-полимеразной активности варианта
пластичностью, что позволяет им адаптироваться к ши- R71G Pol ι, но не было вызвано снижением стабильности
рокому спектру внешних условий. Однако вопрос, в какой фермента. Полученные результаты позволяют предполо-
мере долговременная структурно-функциональная адап- жить, что полиморфный вариант Pol ι с заменой R71G об-
тация к условиям среды связана с генетическими моди- ладает сниженной репарационной активностью in vivo.
фикациями, остается до конца не выясненным. Результа- Работа поддержана грантом РФФИ-комфи 17-00-00264
ты изучения подорожника среднего (Plantago media L.) из и РФФИ-Бел-а 18-54-00024.
двух местообитаний (открытый склон и густой травостой)
выявили существенные различия растений по габитусу,
соотношению надземной и подземной части, площади и ***
плотности листьев, содержанию в них зеленых пигмен-
тов, фенольных соединений, активности ксантофилово-

52 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


ТЕЗИСЫ УСТНЫХ ДОКЛАДОВ

СОЗДАНИЕ ГЕНЕТИЧЕСКОЙ КОНСТРУКЦИИ, вклад piРНК системы в регуляцию экспрессии TART. Мы ис-
НЕСУЩЕЙ ГЕН ДЕГИДРИНА TADHN19 TRITICUM пользовали трансгенные линии мух, содержащие репортер-
AESTIVUM ный ген lacZ под контролем промотора TART в прямой и об-
ратной ориентациях. Известно, что в яичниках дрозофилы
А.М. Шишлова-Соколовская, П.В. Кузмицкая, образуются piРНК к обеим цепям TART, поэтому piРНК-
Е.П. Кветко, О.Ю. Урбанович зависимый транскрипционный сайленсинг lacZ не должен
зависеть от ориентации фрагмента TART. Однако мы показа-
Институт генетики и цитологии НАН Беларуси, Минск, 220072,
Республика Беларусь; e-mail: s_anastasia78@mail.ru ли зависимость экспрессии и структуры хроматина трансге-
на TART-lacZ от ориентации фрагмента TART. Было показа-
Растения на протяжении всего вегетационного периода но, что нарушения piРНК системы приводят к накоплению
подвергаются воздействию абиотических стрессовых факто- бета-галактозидазы и снижению связывания гетерохромати-
ров. Реакция растения на стресс приводит к функциональной новых белков НР1 и H3K9me3 с хроматином трансгенов толь-
перестройке метаболизма клетки и, как следствие, транскрип- ко при обратной ориентации TART-вставки. Данные резуль-
ции генов, вовлеченных в стрессовый ответ. Среди них гены, таты свидетельствуют о том, что в прямой ориентации про-
кодирующие дегидрины — белки группы II суперсемейства мотор TART защищен от воздействия piРНК, возможно, с
LEA. Дегидрины главным образом локализуются в цитоплаз- помощью пограничных элементов, природу которых и роль
ме, ядрах клеток, митохондриях, хлоропластах, при этом ме- в функционировании теломер предстоит исследовать.
сто локализации данных белков не всегда известно. С целью Работа поддержана грантом РФФИ 18-34-00415 мол_а.
изучения функции и локализации на разных стадиях онтоге-
неза при действии низких температур белка, кодируемого ге-
ном TaDHN19 (по классификации Wang и соавт., 2014), была ***
создана генетическая конструкция pBI121_TaDHN19/EGFP.
Данная конструкция содержит два отдельных гена TaDhn19 и ПОИСК АССОЦИАЦИЙ ПОЛИМОРФНЫХ
EGFP в одной транскрипционной рамке. В качестве источ- ВАРИАНТОВ САЙТОВ СВЯЗЫВАНИЯ МИКРОРНК
ника для клонирования нативного гена TaDHN19 был исполь- С ПЕРВИЧНЫМ ОСТЕОПОРОЗОМ У МУЖЧИН
зован устойчивый к холоду сорт озимой пшеницы белорус- И ЖЕНЩИН
ской селекции Каравай. Соответствие гена ожидаемой после-
довательности подтверждено секвенированием. Ген TaDhn19 Б.И. Ялаев1, Р.И. Хусаинова1, 2
был слит в единую рамку считывания с геном EGFP под кон- 1
Институт биохимии и генетики УФИЦ РАН, Уфа, 450054,
тролем 35S-промотора и nos-терминатора. При этом между Россия;
генами введена дополнительная последовательность из 7 ами- 2
ГБУЗ Республиканский медико-генетический центр, Уфа,
нокислотных остатков — «pro-gly-thr-gly-arg-pro-thr», 450076, Россия; e-mail: yalaev.bulat@yandex.ru
стоп-кодон гена TaDHN19 удален. Получен химерный ген,
Остеопороз — одно из распространенных заболеваний,
далее клонирован в бинарный вектор pBI121. Вставка данно-
характеризующееся увеличением риска переломов костей,
го гена подтверждена методом ПЦР. В дальнейшем планиру-
высокой долей смертности и инвалидизации, что представ-
ется получить трансгенные растения табака, как модельный
ляет серьезный социально-экономический вызов совре-
объект для изучения функции и локализации гена TaDhn19
менному обществу. Предполагается, что изменение срод-
при гипотермии.
ства микроРНК к целевым генам может значительно вли-
ять на регуляцию экспрессии последних, и, вероятно,
*** играет роль в патогенезе остеопороза.
Цель исследования — поиск ассоциаций полиморфных
ВКЛАД СИСТЕМЫ PIРНК В РЕГУЛЯЦИЮ локусов rs11540149, rs1061947, rs6854081, rs10793442,
ТЕЛОМЕРНОГО РЕТРОЭЛЕМЕНТА TART rs10098470, rs1712, rs1042673 и rs1054204 с наличием пере-
В ГЕРМИНАЛЬНЫХ ТКАНЯХ DROSOPHILA ломов и низким уровнем минеральной плотности костной
ткани (МПКТ) в выборке мужчин (510 человек) и женщин
А.О. Шмитко, О.М. Оленкина, П.А. Комаров, в постменопаузе (740 человек).
М.Ю. Кордюкова, Е.И. Радион, А.И. Калмыкова Результаты. Аллель *А локуса rs11540149 оказался ассо-
циирован с переломами и низким уровнем МПКТ у мужчин,
ФГБУН Институт молекулярной генетики РАН, 123182, Москва,
Россия; e-mail: annashmi97@gmail.com генотип *G*G локуса rs6854081 также оказался связан с пе-
реломами в общей выборке женщин и женщин татарского
Теломеры Drosophila поддерживаются с помощью транс-
происхождения, аллель *T локуса rs10098470 ассоциирован с
позиций особой группы теломерных ретротранспозонов —
переломами в общей выборке женщин, аллель *А локуса
HeT-A, TAHRE и TART. Изучение регуляции экспрессии те-
rs10793442 с остеопорозом и остеопенией в общей выборке
ломерных элементов необходимо для понимания механиз-
женщин и генотип *G*G локуса rs1054204 с переломами и
мов поддержания длины теломер. В герминальных тканях
низким уровнем МПКТ в общей выборке мужчин. Аллели
Drosophila экспрессия теломерных элементов HeT-A, TAHRE
полиморфного локуса могут иметь сродство к разным ми-
и TART регулируется с помощью piРНК сайленсинга, пода-
кроРНК и их количеству, что может значительно отразиться
вляющего активность мобильных элементов на уровне транс-
на регуляции экспрессии гена. Наши результаты показыва-
крипции. Нарушения работы данной системы приводят к ги-
ют, что такой эффект может различаться в зависимости от по-
перэкспрессии теломерных элементов, при этом наибольшая
ла, и согласуются с гипотезой, согласной которой переломы
активация наблюдается для HeT-A и TAHRE, а экспрессия
и низкий уровень МПКТ представляют собой два независи-
TART изменяется незначительно. Мы предполагаем, что, по-
мых эндофенотипа.
мимо системы piРНК сайленсинга, активность TART регули-
руется другими механизмами. В данной работе мы изучали ***

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 53


ТЕЗИСЫ СТЕНДОВЫХ СООБЩЕНИЙ

Тезисы стендовых сообщений

ПРОБЛЕМЫ ОПРЕДЕЛЕНИЯ МЕХАНИЗМОВ ДЕТЕКЦИЯ МУТАЦИЙ ПРИ НЕСОВЕРШЕННОМ


АНТИЛИЗОЦИМНОЙ АКТИВНОСТИ ОСТЕОГЕНЕЗЕ С ПОМОЩЬЮ ТАРГЕТНОГО
И ЛИЗОЦИМРЕЗИСТЕНТНОСТИ МАССОВОГО ПАРАЛЛЕЛЬНОГО
ЭНТЕРОБАКТЕРИЙ СЕКВЕНИРОВАНИЯ
С.В. Андрющенко, И.А. Здвижкова, О.Ю. Васильева, С.А. Васильев, А.А. Зарубин,
А.В. Бекпергенова, Т.А. Семеновых, Н.А. Скрябин
О.И. Рахматуллина НИИ медицинской генетики, Томский национальный
ФГБУН Институт клеточного и внутриклеточного симбиоза исследовательский медицинский центр, Томск, Россия,
Уральского отделения Российской академии наук, 634050; e-mail: vasilyeva.o.yu@gmail.com
Оренбург, 460000, Россия; Несовершенный остеогенез в 85% случаев вызывает-
email: rattus000@gmail.com ся мутациями с аутосомно-доминантным типом наследо-
Целостность наружной мембраны грамотрицатель- вания в одном из двух генов, кодирующих коллаген I ти-
ных бактерий обеспечивает полную устойчивость бакте- па (COL1A1, COL1A2). При этом частых мутаций не обна-
риальных клеток к бактерицидному действию лизоцима, руживается, в связи с чем при молекулярной диагностике
вместе с тем, у энтеробактерий и ряда других протеобакте- этого заболевания требуется секвенирование всех экзо-
рий выявляются как фенотипическая способность к дис- нов генов COL1A1, COL1A2. Для диагностики изучаемого
тантной инактивации лизоцима, так и генетические де- заболевания был разработан метод таргетного массового
терминанты двух независимых семейств специфических параллельного секвенирования. В основе предлагаемого
секретируемых ингибиторов лизоцима, а также лизоци- подхода лежит обогащение образцов с помощью ПЦР
мингибирующий эффект энтеротоксина. Вопрос о роли длинных фрагментов с последующим приготовлением
ингибиторов лизоцима в обеспечении устойчивости самих ДНК-библиотек с использованием набора Nextera XT
клеток-продуцентов дополняется вопросом об их эффек- (Illumina), массовым параллельным секвенированием на
те для непосредственного микросимбиотического окруже- секвенаторе MiSeq (Illumina) и дальнейшей биоинформа-
ния энтеробактерий в условиях кишечного биотопа. Кро- ционной обработкой данных. Для данного подхода отсут-
ме того, различные методики фенотипического определе- ствие частых мутаций не является ограничением, посколь-
ния как лизоцимрезистентности, так и антилизоцимной ку анализируется вся последовательность экзонов и ин-
активности грамотрицательных бактерий демонстрируют тронов генов COL1A1 и COL1A2. Метод применили для
трудносопоставимые результаты. В данной работе прове- поиска мутаций в генах COL1A1 и COL1A2 у пациентов с
дена оценка влияния ряда компонентов питательных сред диагнозом несовершенный остеогенез. В результате про-
и условий культивирования для максимизации разрешаю- веденного анализа были обнаружены патогенные вариан-
щей способности фотометрического метода определения ты у четырех обследуемых в гене COL1A2: замена G1000A
антилизоцимной активности энтеробактерий. На штам- у троих пациентов, de novo мутация G856A у одного боль-
мах-носителях как плазмидного, так и хромосомного го- ного. У троих обследуемых выявлены de novo мутации в
мологов гена периплазматического ингибитора лизоци- гене COL1A1: замена 4274C>T, мутация 2172delT (приво-
ма pliC, принадлежащих к видам Klebsiella pneumoniae и дящая к сдвигу рамки считывания), мутация в сайте
Salmonella enterica соответственно, показано, что наиболь- сплайсинга 48 экзона c.3532-2A>C. Разработанный метод
шая эффективность ингибирования лизоцима культураль- таргетного массового параллельного секвенирования по-
ной средой достигается при культивировании энтеробак- зволяет идентифицировать мутации в генах COL1A1 и
терий в бульонах с содержанием глюкозы до 15 г/л в тече- COL1A2 и является эффективным инструментом молеку-
ние 48 ч с последующей 1-часовой инкубацией во взвеси лярно-генетической диагностики несовершенного осте-
с хлороформом в объемном соотношении 9:1. огенеза.
Работа выполнена при грантовой поддержке фундамен-
тальных исследований по Программе УрО РАН «Фундамен-
тальные науки – медицине», проект № 18-7-8-34 и Россий-
ского Фонда Фундаментальных Исследований по программе ***
поддержки фундаментальных научных исследований, выпол-
няемых молодыми учеными, проект №18-34-00853 мол_а.

***

54 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


ТЕЗИСЫ СТЕНДОВЫХ СООБЩЕНИЙ

РОЛЬ DRRS, МАЛОЙ НЕКОДИРУЮЩЕЙ РНК (ПТМ) и их функциональной значимости в экспорте про-
MYCOBACTERIUM TUBERCULOSIS, В теасом не проводился. В данной работе с помощью МАЛ-
АДАПТАЦИИ К МАКРОФАГАЛЬНОМУ СТРЕССУ ДИ масс-спектрометрического анализа с преобразовани-
ем Фурье были впервые обнаружены фосфосайты S216
А.С. Григоров1, Е.Г. Салина2, О.С. Быченко1, α4-субъединицы, S181 — β3, Y125 — β5, которые потенци-
А.С. Капрельянц2, Т.Л. Ажикина1 ально могут быть специфичны для внеклеточных протеа-
сом. Также внеклеточные протеасомы могут иметь специ-
ФГБУ НИИ биоорганической химии им. академиков М.М.
1

Шемякина и Ю.А. Овчинникова РАН, Москва, 117997, Россия; фические сайты ацетилирования на сайтах K237, 238 субъ-
единицы β2 и K192 — β3. Всего было найдено 95 ПТМ у
2
ФГБУ НИИ биохимии им. А.Н. Баха РАН, Москва, 119071,
Россия; e-mail: artgrigorov@gmail.com
внеклеточных, и 75 — у клеточных протеасом, среди кото-
рых также убиквитинирование и сукцинилирование. Мы
Малые некодирующие РНК бактерий принимают уча- предполагаем, что специфические для внеклеточных про-
стие в регуляции широкого спектра процессов, влияя на теасом ПТМ могут регулировать их активность или уча-
процессы транскрипции и трансляции. Предполагается, ствовать в транспорте комплексов во внеклеточное про-
что межгенные малые РНК играют одну из центральных странство, поэтому полученные данные могут быть суще-
ролей в регуляции адаптивных механизмов Mycobacterium ственны для определения функциональной значимости
tuberculosis, возбудителя туберкулеза. Целью работы было протеасом во внеклеточном пространстве.
исследование роли малой некодирующей РНК DrrS в ме- Работа выполнена при финансовой поддержке Россий-
таболизме M. tuberculosis. Экспрессия этой малой РНК ха- ского Научного Фонда (проект 16-14-10343).
рактерна для стационарной фазы роста, а также в услови-
ях перехода микобактерий в состояние покоя. Также ***
DrrS характеризуется высокой консервативностью, что
указывает на ее роль в регуляции развития инфекции.
АНАЛИЗ ВТОРИЧНОЙ СТРУКТУРЫ РНК
Искусственное повышение экспрессии DrrS в клетке
У ПАТОГЕННОЙ БАКТЕРИИ LISTERIA
M. tuberculosis привело к появлению в транскрипционном
профиле изменений, характерных для микобактериаль- MONOCYTOGENES
ного ответа на макрофагальный стресс. Повышается экс- Д.В. Игнатов1, Б. Каллиполитис2, Н. Фрейтаг3,
прессия ряда регуляторов; генов, участвующих в защите Й. Йоханссон1
от окислительного стресса; генов, связанных с метаболиз-
мом азота и кластера PE/PPE белков. При этом наблюда-
1
Университет Умео;
ется угнетение экспрессии генов биосинтеза аминокис- 2
Университет Южной Дании;
лот; генов, связанных с дыханием, и нескольких транс- 3
Университет Иллинойса в Чикаго, США;
крипционных факторов. На основе изменений e-mail: dima.ignatov@gmail.com
транскрипционного профиля можно предположить, что Некодирующие РНК играют важную роль в регуля-
DrrS является активатором молекулярных механизмов, ции экспрессии генов бактерий. Их механизм действия
необходимых для выживания внутри макрофага. Анализ часто основывается на изменении пространственной
динамики экспрессии DrrS ex vivo показал, что экспрес- структуры, взаимодействии с другими РНК или белками.
сия этой малой РНК возрастает только в условиях иммун- Мы использовали метод Structure-seq для поиска молекул
ного ответа, а главным триггером экспрессии является РНК, которые изменяют свою структуру в ответ на раз-
NO. личные стимулы. Исследования проводились на модель-
Работа выполнена при поддержке гранта РНФ  18-15- ной грамположительной бактерии L. monocytogenes. Так
00332. как регуляторные РНК часто располагаются в 5’-нетранс-
лируемых областях молекул РНК (5’-НТО), мы модифи-
*** цировали метод Structure-seq для увеличения глубины
секвенирования этих регионов. 1) Сравнение структуры
МАСС-СПЕКТРОМЕТРИЧЕСКИЙ АНАЛИЗ 5’-НТО при различных температурах позволило обнару-
ПОСТТРАНСЛЯЦИОННЫХ МОДИФИКАЦИЙ жить новый РНК термометр, расположенный в 5’-НТО
КЛЕТОЧНЫХ И ВНЕКЛЕТОЧНЫХ ПРОТЕАСОМ мРНК гена cspA. 2) Был проведен поиск молекул РНК, из-
меняющих свою структуру при делеции РНК шаперона
Е.Е. Дьяконов1, Т.О. Артамонова2, Hfq. У некоторых видов бактерий Hfq играет ключевую
М.А. Ходорковский2, А.С. Цимоха1 роль при регуляции с помощью малых РНК, однако у
1
Институт цитологии РАН, Санкт-Петербург, 194064, Россия; L. monocytogenes его роль ограничена. Действительно, ста-
2
Санкт-Петербургский политехнический университет тистически значимые изменения структуры РНК были
Петра Великого, Санкт-Петербург, 195251, Россия; e-mail: обнаружены только в Hfq-связывающей малой РНК LhrA
diakonov2007@mail.ru и в мРНК гена lmo0850, с которой эта малая РНК взаимо-
26S-протеасома — мультисубъединичный эукариоти- действует. 3) Изучение структуры РНК при активации
ческий белковый комплекс, отвечающий за регулируемую программы вирулентности у L. monocytogenes выявило из-
убиквитин-зависимую деградацию белков. Повышенный менения в 5’-НТО нескольких мРНК. Дальнейший ана-
уровень экспорта протеасом во внеклеточное пространство лиз показал, что у мРНК гена prsA2 эти изменения вызва-
был выявлен при опухолевой трансформации клеток чело- ны взаимодействием с мРНК гена hly, кодирующей клю-
века, однако функция внеклеточных протеасом остается чевой фактор вирулентности листериолизин О. PrsA2
неизвестной. Анализ внеклеточных протеасом по присут- служит шапероном при секреции листериолизина О, и
ствию специфических посттрансляционных модификаций выявленное мРНК-мРНК взаимодействие увеличивает

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 55


ТЕЗИСЫ СТЕНДОВЫХ СООБЩЕНИЙ

экспрессию PrsA2, позволяя секретировать большие ко- ния процессов приобретения и функционирования CRIS-
личества листериолизина О во время инфекции. PR/Cas-системы, для отбора специфических методов ге-
нотипирования вида иерсиний, а также для
*** «персонализации» штаммов в специфической терапии.
Цель работы — проанализировать особенности CRISPR/
СЕКВЕНИРОВАНИЕ ГЕНОМОВ ХЛОРОПЛАСТОВ Cas-системы штамма Yersinia similis 228 и оценить биоин-
И МИТОХОНДРИЙ КАК МЕТОД ИЗУЧЕНИЯ формационный скрининг фагов и плазмид через декоди-
ФИЛОГЕНИИ ЯЧМЕНЯ рованные спейсеры. Анализ особенностей CRISPR/Cas-си-
стемы вида Y. similis штамма 228 помог оценить возмож-
А.Е. Макаревич, В.С. Панкратов, М.Г. Синявская, ность изменения последовательности нуклеиновых кислот
Н.В. Луханина, А.М. Шимкевич, И.М. Голоенко, (CRISPRone, CRISPRFinder and CRISPRDetect), с целью
Н.Г. Даниленко, О.Г. Давыденко внедрения необходимой для нас цепочки. Использование
компьютерных программ показало эволюцию различных
Лаборатория нехромосомной наследственности Института
видов. Биоинформационный скрининг фагов и плазмид
генетики и цитологии Национальной академии наук Беларуси,
Минск, 220072, Республика Беларусь; (PHASTER) через декодированные спейсеры позволил оце-
e-mail: bio.makarevich@gmail.com нить схожесть как внутри-, так и межвидовую. Такие ме-
тодики помогают сравнивать, как образом штаммы изме-
Цель данной работы — изучение филогении ячменя
нялись со временем, и согласно этим изменениям позво-
(Hordeum sp.) путем анализа последовательностей хло-
ляют внедрять уже модифицированный штамм в
ропластных (хп) и митохондриальных (мт) геномов его
практическую медицину, например, использовать при мо-
диких и культурных форм. В рамках исследования бы-
ногенных заболеваниях, таких как фенилкетонурия, гемо-
ло проведено NGS хп и мт геномов диких (W3, W4, W8)
филия. Использование онлайн-программ CRISPROne,
и одомашненных (Вежа, Роланд и Визит) форм ячменя.
CRISPRFinder позволило найти 2-кассеты у Y. similis 228.
Фракция, полученная методом дифференциального цен-
BLASTn-программа визуализировала идентичность наше-
трифугирования, содержала смесь хп и мт ДНК, что позво-
го штамма по отношению к другим штаммам из рода En-
лило изучать оба генома. Обработка сырых FASTQ-фай-
terobacteria. Результат помог предположить отсутствие па-
лов проводилась с учетом наличия областей гомологии
тологических особенностей исследуемой бактерии, а так-
внутри и между геномами. Она содержала этапы очист-
же их высокую активность у Y. pseudotuberculosis R626R с
ки прочтений (Trimmomatic-0.36), их выравнивания
идентичной нуклеотидной последовательностью. В статье
на гибридный хп-мт референс (Bowtie2-2.3.3), получе-
представлен эволюционный аспект с целью наблюдения
ния и фильтрации VCF-файлов (Samtools-1.5, VCFlib).
территориальной распространенности рода. Представлен-
Отработка алгоритма проводмлась на искусственных
ный анализ, направленный на скрининг с помощью раз-
FASTQ (ART). В филогенетическом анализе участвовали
личных компьютерных программ, может быть использо-
последовательности хп и мт геномов изучаемых форм, а
ван для описания процесса приобретения и функциониро-
также последовательности органельных геномов предста-
вания CRISPR/Cas-системы различных штаммов бактерий,
вителей рода Hordeum, доступные в базе NCBI. Построе-
что в дальнейшем может облегчить выбор специфичных
ние филогенетических деревьев производилось с помощью
методов генотипирования рода иерсиний, необходимых
методов максимальной парсимонии и байесовского выво-
для специфичной штаммовой терапии.
да (MrBayes). Анализ топологии филогенетических деревь-
ев для хп и мт геномов не выявил явных различий, опро-
вергающих коэволюцию данных органелл. Как в хп, так и
в мт деревьях наблюдалось разделение на две крупные кла- ***
ды, обе из которых содержали как дикие, так и одомашнен-
ные формы ячменя, что позволило сделать предположение ИДЕНТИФИКАЦИЯ И АННОТАЦИЯ
о наличии нескольких центров его доместикации. ПОВТОРЯЮЩЕЙСЯ ДНК В ГЕНОМЕ СТЕРЛЯДИ
(ACIPENSER RUTHENUS)
***
Д.Ю. Прокопов, Л.С. Билтуева, В.А. Трифонов
БИОИНФОРМАЦИОННЫЙ АНАЛИЗ Институт молекулярной и клеточной биологии СО РАН,
CRISPR/CAS-СИСТЕМЫ ВИДА Y. SIMILIS Новосибирск, 630090, Россия; email: dprokopov@mcb.nsc.ru
ШТАММ 228 Осетровые представляют интересную группу из-за их
палеополиплоидного статуса, базального положения сре-
Я.А. Портная , В.И. Злобин , Ю.П. Джиоев
1 2 2
ди Actinopterygii и медленной скорости геномной эволю-
1
Иркутский государственный медицинский университет, ции. Геном стерляди можно использовать в качестве рефе-
кафедра микробиологии, вирусологии и иммунологии, Иркутск, ренсного генома осетровых из-за самого низкого уровня
664003, Россия; плоидности в этой группе. В данном проекте мы секвени-
2
НИИ Биомедицинских технологий, Иркутск, 664003, Россия; ровали ДНК самца и самки стерляди на платформах Illu-
email: portnaya.yana.1997@yandex.ru mina и PacBio, после чего произвели сборку генома. Кро-
CRISPR/Cas-система — инновационная технология ме того, мы произвели секвенирование и сборку транс-
среди современных исследований, которая рассматрива- криптома яичников и семенников. Поиск повторяющихся
ется как подход к моделированию методов геномного ре- элементов de novo проводили на прочтениях Illumina и
дактирования клеточных культур и моделей организмов. PacBio, а также на геномной сборке с использованием раз-
Представленный скрининг посредством различных ком- личных инструментов. В результате мы получили полную
пьютерных программ может быть использован для описа- библиотеку повторяющихся элементов. Мы идентифици-

56 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


ТЕЗИСЫ СТЕНДОВЫХ СООБЩЕНИЙ

ровали тандемные повторы, в том числе те, которые отли- ПОЛИАДЕНИЛИРОВАНИЕ ТРАНСКРИПТОВ SINE,
чались по содержанию между самцом и самкой, однако СИНТЕЗИРУЕМЫХ РНК-ПОЛИМЕРАЗОЙ III,
FISH-анализ показал, что эти различия обусловлены вну- ЗНАЧИТЕЛЬНО УВЕЛИЧИВАЕТ ИХ ВРЕМЯ
тривидовым полиморфизмом. Тем не менее, мы смогли ЖИЗНИ В КЛЕТКЕ
идентифицировать хромосомоспецифичные сателлитные
последовательности, в том числе такие, которые позволя- И.Г. Устьянцев, К.А. Татосян, Д.В. Стасенко
ют различать паралоги. Анализ мобильной ДНК продемон-
ФГБУН Институт молекулярной биологии им. В.А. Энгельгардта
стрировал преобладание ретроэлементов над ДНК-транс- Российской академии наук, Москва, 119991, Россия; e-mail:
позонами. Найдены новые потенциальные случаи гори- ustian@mail.ru
зонтального переноса. Анализ транскриптов показал
До последнего времени считалось, что AAUAAA-
активность исследуемых ДНК-транспозонов. Наши резуль-
зависимому полиаденилированию (нематричный синтез
таты подчеркивают важность изучения повторяющихся
поли(А) на 3’-конце РНК) могут подвергаться только
элементов немодельных организмов и могут помочь выя-
транскрипты, синтезируемые РНК-полимеразой II (напри-
вить новые пути эволюции геномов.
мер, мРНК). Однако в нашей лаборатории было показано,
Работа была поддержана грантом Российского научно-
что РНК, транскрибируемые РНК-полимеразой III (pol III)
го фонда (РНФ) 18-44-04007.
со многих коротких ретропозонов геномов млекопитаю-
щих, подвергаются AAUAAA-зависимому полиаденилиро-
*** ванию. Короткие ретропозоны, или SINE (Short Interspersed
Elements), представляют собой один из классов мобильных
генетических элементов. Сотни тысяч копий SINE рассе-
ПОЛИМОРФИЗМ ГЕНА OMP1 CHLAMYDIA яны по геномам всех млекопитающих, а их длина лежит в
TRACHOMATIS диапазоне от 100 до 500 п.н. SINE способны транскриби-
Ю.В. Салтыков, С.С. Зайцев, И.А. Субботина, роваться pol III, благодаря наличию в их 5’-концевой по-
ловине промотора, состоящего из двух боксов — А и В.
В.А. Федорова
Многие виды SINE заканчиваются терминатором транс-
Федеральный исследовательский центр вирусологии и крипции pol III (TTTT) и содержат гексамеры AATAAA в
микробиологии — филиал в Саратове, Россия; 3’-концевой части. Оказалось, что pol III-транскрипты та-
e-mail: subbotina.irinaa@mail.ru
ких SINE способны к полиаденилированию. Известно, что
Возбудителем хламидийной инфекции у людей явля- поли(А)-хвост мРНК увеличивает время ее жизни в клет-
ется представитель семейства Chlamydiaceae — Chlamydia ке, защищая от действия экзонуклеаз. Мы предположили,
trachomatis. Это внутриклеточный облигатный паразит, вы- что поли(А)-хвост pol III-транскриптов SINE также может
зывающий одно из распространенных заболеваний, пере- препятствовать быстрому распаду этих РНК. В клетки He-
дающихся половым путем, — урогенитальный хламидиоз La вводили плазмиды, содержащие SINE из геномов мы-
(УГХ). В данной работе, для изучения разнообразия гено- ши, тушканчика, крота, собаки, лошади, летучих мышей.
вариантов C. Trachomatis мы исследовали ДНК из клини- В качестве контроля использовались те же SINE, но с за-
ческого материала от людей, направленных для уточнения меной Т на С в гексамере AATAAA. Транскрипты SINE с
лабораторного диагноза (УГХ) в диагностические лабора- такой заменой не полиаденилировались, и время их полу-
тории Саратовской области. В качестве клинического ма- жизни оказалось равным 20—30 мин. Время полужизни по-
териала использовали соскобы с генитальных сайтов муж- лиаденилированных транскриптов SINE многократно уве-
чин и женщин, преимущественно молодого возраста. Об- личивалось и измерялось часами.
наружение ДНК возбудителя хламидийной инфекции Работа финансирована грантом РФФИ №18-34-00247
проводили с помощью молекулярно-генетических мето- мол_а.
дов. Использовали метод полимеразной цепной реакции
(ПЦР) с последующей постановкой горизонтального элек- ***
трофореза в агарозном геле. После секвенирования ампли-
конов проводили типирование соответствующего участка СРАВНИТЕЛЬНЫЙ АНАЛИЗ ЭКСПРЕССИИ AHR,
генома хромосомы возбудителя хламидиоза по вариабель- ARNT И ИХ ГЕНОВ-МИШЕНЕЙ В КЛЕТОЧНЫХ
ному региону VD2 гена omp1, кодирующего MOMP (глав- КУЛЬТУРАХ ОПУХОЛЕВОГО И
ный белок наружной мембраны C. trachomatis). В результа-
НЕОПУХОЛЕВОГО ПРОИСХОЖДЕНИЯ
те проведенного исследования было обнаружено, что са-
мый распространенный геновар в Саратовской области Р.О. Черезов, Ю.Е. Воронцова, О.Б. Симонова
— G (52,6%), второй по распространенности — E (31,6%),
ФГБУН Институт биологии развития им. Н.К. Кольцова
далее идут геновары F (5,3%), D (5,3%), K (5,3%). Таким
Российской академии наук, 119334, Москва, Россия;
образом, полученные данные указывают на выраженный e-mail: vjul83@mail.ru
полиморфизм гена omp1 у штаммов C. trachomatis, детекти-
руемых на территории Саратовской области. Арил-гидрокарбоновый рецептор (AHR) — лиганд-за-
Исследование выполнено при поддержке РНФ (проект висимый транскрипционный фактор, функции которо-
№17-16-01099). го связаны с детоксикацией и поддержанием гомеостаза.
AHR играет важную роль в процессах канцерогенеза, по-
этому его рассматривают как потенциальную мишень в
*** противораковой терапии. Нашей задачей было сравнить
уровень экспрессии AHR, его партнера ARNT (AHR Nu-
clear Translocator) и генов-мишеней AHR из семейства ци-
тохрома Р450 (CYP1A1, CYP1A2, CYP1B) до и после акти-

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 57


ТЕЗИСЫ СТЕНДОВЫХ СООБЩЕНИЙ

вации AHR его лигандами в клеточных культурах неопу- воздействия лигандами экспрессия генов-мишеней по-
холевого (клетки эмбриональных почек человека HEK293; вышалась во всех линиях, кроме HEK293. Уровень экс-
мезенхимальные стволовые клетки MSC) и опухолево- прессии белка AHR не коррелировал с повышенной экс-
го (карцинома простаты PC3; глиобластома Sus/fP2, рак прессией генов CYP. Особняком оказались результаты по
молочной железы Mcf7, остеосаркома O.src25/16) проис- линии HEK293. В ней был самый высокий уровень экс-
хождения. Для активации AHR были использованы ли- прессии ARNT, но экспрессия целевых генов после добав-
ганды: индол-3-карбинол и индирубин. Уровень экспрес- ления лигандов снижалась в 2 и более раза. Мы предпо-
сии оценивали с помощью ПЦР-РВ и вестерн-блоттинга. лагаем, что регуляция экспрессии генов цитохрома Р450
В отсутствии лиганда уровень экспрессии AHR в культу- при ответе клеток на действие ксенобиотиков происхо-
рах был различный: высокий (O.src25/16, PC3), средний дит не только по AHR-зависимому сигнальному пути, но
(HEK293, MSC, Sus/fP2) и низкий (Mcf7). Уровень экс- существует и другой механизм, что требует дальнейше-
прессии ARNT во всех линиях, кроме HEK293, был очень го исследования.
низкий. Гены CYP1A1 и CYP1A2 в опухолевых культурах Работа выполнена при финансовой поддержке РФФИ
практически не детектировались, а уровень экспрессии №18-34-00162 мол-а и раздела Гос. задания ИБР РАН №0108-
CYP1B1 был повышен во всех клеточных линиях. После 2018-0001.

***

58 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


Авторский указатель тезисов устных докладов

Абдукаримов Ш.С. 17 Вергун А.А. 23 Ермолина К.В. 21


Абдуллин З.С. 22 Верлов Н.А. 33 Есюнина Д.М. 11, 33, 36, 38, 40
Абрамов Ю.А. 11,39 Виноградов А.А. 35 Жарков Д.О. 43
Агапов А.А. 11, 40 Вишняков И.Е. 44 Заварухина А.Н. 27
Агумава А.А. 48 Вовк А.Д. 48 Завильгельский Г.Б. 42
Адашев В.Е. 11, 15 Волков А.А. 20 Загородняя О.А. 16
Акимов В.Э. 11 Волков П.В. 21, 23 Заделенов В.А. 43
Алексеева Л.М. 12, 49 Волницкий А.В. 33 Зайцев С.С. 27, 57
Аликина О.В. 12 Воротеляк Е.А. 17 Захарова Е.Ю. 32
Аммур Ю.И. 14 Габидуллина Л.Р. 26 Захожий И.Г. 52
Андреева А.А. 12 Гавалко Ю.В. 37 Зачепило Т.Г. 28, 58
Андреева Л.Е. 48 Гаврилов Г.В. 33 Зелинский А. 22
Андреюшкова Д.А. 13 Гагаринская Д.И. 21 Земская Н.В. 28, 31
Антонов С.А. 38 Гагинская Е.Р. 34 Золотаренко А.Д. 27
Антонова Е.П. 19 Галинская Т.В. 44 Иванова А.В. 28
Анучина А.А. 13 Галкина С.А. 34 Иванова Е.В. 29
Аравин А.А. 15,33 Гараева Л.А. 33 Иванова Ю.С. 29, 41
Арсеньева Е.Л. 38 Гаранина И.А. 40 Измайлов А.А. 30
Артамонова Т.О. 50 Гармаш Е.В. 21 Интересова Е.А. 43
Артыков А.А. 14 Гаспарян М.Э. 14 Ионов Н.С. 49
Астапенко А.В. 14 Гейдаров Р.Н. 22 Казалов М.А. 37
Астрейко М.О. 26 Георгиева С.Г. 51 Казанцева А.В. 26
Ахмедзянова М. 14 Герасимова Е.М. 22 Калмыкова А.И. 32, 35, 53
Базылев С.С. 15 Гилязова И.Р. 30 Камышинский Р.А. 33
Байдакова Г.В. 32 Гималова Г.Ф. 22 Кантидзе О.Л. 36
Байтин Д.М. 50 Гирнык А.Е. 23 Каныгина А.В. 30
Барадиева Э.Ц. 12 Глазунова О.А. 12 Карапетьян О.Ш. 30
Барлев Н.A. 20, 36 Глухов С.И. 45 Качкин Д.В. 22, 34
Бахланова И.В. 50 Говорун Р.Д.42 Кветко Е.П. 53
Бахчеван Е.Л. 15, 18 Годнеева Б.К. 11, 15 Кипень В.Н. 29, 35, 47
Бахшиев А.Г. 15 Головко Т.К. 21, 52 Кисель Э.В. 37
Башинская В.В. 16 Графодатский А.С. 43 Кичигин И.Г. 43
Бебякова Н.А. 26 Гривенников И.А. 38 Климентова Е.А. 30
Бейлин А.К. 16 Грищенко И.В. 44 Коваль А.П. 45
Беклемишева В.Р. 37 Громов К.Б. 23 Коваль Л.А. 28, 31
Белых Д.В. 45 Груздев Д.С. 12, 49 Козарь Е.В. 31
Белых Е.С. 20, 45 Губский Л.В. 24 Козлова А.Н. 37
Бермишева М.А. 30 Дакс А.А. 20, 36 Козяева В.В. 12, 49
Бибиков Н.М. 17 Дарвишов Н.Р. 16 Коляда А.К. 16, 37
Бибов М.Ю. 30 Демин А.Г. 34 Комар А.А. 36, 38
Блага П. 42 Денисенко Ю.А. 21, 23 Комаров П.А. 53
Благодатских К.А. 45 Денисова А.Е. 24, 47, 49 Комиссаров А.С. 34
Бобохужаев Ш.У. 17 Дергунов А.Д. 39 Кондратьева Е.В. 31
Богданова М.В. 17, 35 Дергунова Л.В. 11, 24, 39, 47, 49 Коновалова М.В. 32
Богданова Ю.В. 42 Джаубермезов М.А. 36 Копытова А.Э. 32
Болдинова Е.О. 18, 21 Дидыч Д.А. 43 Кордюкова М.Ю. 32, 53
Бондаренко К.А. 18 Дмитриева В.Г. 11, 39 Короткова О.Г. 17, 23
Борисова О.В. 15, 18 Дмитриева Т.М. 24 Котов А.А. 11, 15
Борисович Ю.Г. 16 Добаева Н.М. 30 Котова Е.С. 30
Бочарова Е.С. 19 Добыш О.И. 35, 39 Кошлань И.В. 42
Брулер Е.С. 19 Домблидес А.С. 31 Кошлань Н.А. 42
Будовская Л.А. 37 Домблидес Е.А. 31 Кропочева Е.В. 33
Буракова А.А. 17, 35, 39 Доронин С.А. 25 Круткина М.С. 49
Бутенко И.О. 32 Доценко И.Б. 23 Куба А.А. 16
Вайсерман А.М. 16, 37 Дульцев Ф.Н. 25, 38 Кузиванова О.А. 21
Валуйских О.Е. 19 Дюдеева Е.С. 25 Кузмицкая П.В. 24, 33, 53
Ванюшина Ю.Н. 38 Дюжикова Н.А. 50 Кулабухова Д.Г. 33
Вареников Г.Г. 31 Евстигнеева С.С. 25 Кулак М.М. 34
Варфоломеева Е.Ю. 33 Евстифеев В.В. 27 Кульбачинский А.В. 11, 33, 38, 40
Василева Е.А. 20 Екомасова Н.В. 26 Курусь Н.Н. 25, 38
Ведяйкин А.Д. 44 Елизарова В.С. 26 Лавров А.В. 13, 31
Велегжанинов И.О. 20, 21, 45 Емельянов А.К. 32, 33 Лага В.Ю. 34
Величко А.К. 36 Еникеева Р.Ф. 26 Ланда С.Б. 33

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 59


Ларионова О.С. 27 Попов А.Ю. 22 Титов С.В. 22
Лашкул В.В. 34 Прописцова Е.А. 44 Трифонов В.А. 13, 43, 56
Лемеш В.А. 17, 35 Простова М.А. 38 Туктарова И.А. 48
Леонова Т.С. 20 Пурвиньш Я.В. 44 Узун М.М. 12, 49
Лисачев А.П. 13 Пучков К.С. 37 Ульянов С.В. 25
Лисицкая Л.А. 36 Пчелина С.Н. 32, 33 Урбанович О.Ю. 24, 33, 53
Литвинов Д.Ю. 39 Пылина Я.И. 19, 20, 45, 52 Файзулоев Е.Б. 14
Литвинов С.С. 26 Пышный Д.В. 25, 38 Федоненко Ю.П. 25
Ломзов А.А. 25, 38 Радион Е.И. 45, 53 Федорова В.А. 27, 57
Лопатина Н.Г. 28 Разин С.В. 25 Федорова О.А. 20, 36
Лужин А.В. 36 Рекунова М.В. 48 Федорова Я.В. 37
Макамов А.Х. 17 Родионова Д.А. 45 Фийон В. 34
Макарова А.В. 18, 21, 43, 52 Рожкова А.В. 39 Филиппенков И.Б. 24, 47, 49
Макарова И.В. 48 Рожкова А.М. 21, 23 Филонова Н.Н. 27
Макунин А.И. 43 Романенко М.С. 37 Фисунов Г.Ю. 40
Малашичев Е.Б. 37 Романишко Е.Л 46. Фомина Е.А. 49
Малова Т.В. 38 Рощина М.П. 46 Фомина М.Н. 29, 41
Мамонтова В.А. 20, 36 Рубель А.А. 22, 34 Хайтлина С.Ю. 50
Марков Д.Д. 48 Рубцова Е.А. 17 Хлебаева Д.А.-А. 50
Мельнов С.Б. 47 Румянцев А.М. 46, 51 Хмель И.А. 42
Мензоров А.Г. 37 Рыбак А.В. 20 Ходорковский М.А. 44, 55
Мелькина О.Е. 42 Рычков Г.Н. 32 Хоружий Н.Е. 17
Мешалкина Д.А. 37 Рязанский С.С. 45 Храмеева Е.Е. 25
Мизгирев И.В. 37 Сайфитдинова А.Ф. 34 Хромова А.В. 16
Милиюхина И.В. 33 Сакаева Д.Д. 22 Хрунин А.В. 11
Михайлович В.М. 22 Сакович В.И. 17 Хусаинова Р.И. 26, 53
Морозов А.В. 19 Салтыков Ю.В. 27, 57 Хуснутдинова Э.К. 22, 26, 30
Мосейко В.В. 16, 37 Санамьян М.Ф. 17 Цаплина О.А. 50
Москалев А.А. 28, 31 Сафина Д.Р. 46 Царегородцева Д.С. 32
Мурланова Е.В. 16 Свердлов Е.Д. 43 Царь А.И. 17, 39, 50
Мустафина О.Е. 48 Свирщевская Е.В. 32 Чадин И.Ф. 52
Насибуллин Т.Р. 48 Селина П.И. 46 Чанышев М.Д. 45
Некрасов Д.В. 38 Семенова М.В. 17, 23 Чапров К.Д. 51
Ненашева В.В. 48 Сенкевич К.А. 32, 33 Чермных Э.С. 16
Никитин М.В. 38 Сергина С.Н. 19 Чернов Ю.О. 22, 34
Николаев М.А. 32 Сердюкова Н.А. 43 Шавкунов К.С. 12
Новосадова Е.В. 38 Сидорин А.В. 46 Шадрин Д.М. 19, 20, 45, 52
Носова А.Ю. 39, 50 Сидорова Д.Е. 42 Шапошников М.В. 31
Носова Е.В. 39 Сизенко А.К. 37 Шараев Н.И. 51
Озолинь О.Н. 12 Силина Е.В. 21, 52 Шевелев Г.Ю.8, 25, 38
Оленина Л.В. 11, 15 Синицын А.П. 21, 23 Шевелев Ю.Я. 25
Оленкина О.М. 11, 32, 53 Скоблов М.Ю. 31 Шейнов А.А. 51
Олина А.В. 40 Слободова Н.В. 12 Шелякин М.А. 52
Орехова М.М. 40 Смирнихина С.А. 13 Шилкин Е.С. 52
Орлов А.М. 41 Смирнова Е.Г. 47 Шишлова-Соколовская А.М. 53
Орлов М.А. 40 Снытков Е.В. 47 Шмалий А.В. 41, 48
Орлова С.Ю. 41 Солдатенко А.В. 31 Шмитко А.О. 53
Осипов Д.О. 23 Соловьев И.А. 28 Шрам С.И. 12
Осичанская Д.П. 16 Сорокин А.А. 40 Штам Т.А. 33
Павлов В.Н. 30 Сошникова Н.В. 51 Шувалов О.Ю. 20, 36
Павлова Л.Е. 41, 48 Ставчанский В.В. 47, 49 Щеголева Е.В. 28
Павлова О.А. 34 Старцева О.М. 45 Щепетов Д.М. 16
Пай О.А. 29, 41 Старшова П.А. 20 Щербаков Д.Ю. 43
Патутина Е.О. 12 Степаненко Е.А. 48 Щербатова Н.А. 48
Петрова Д.В. 42 Субботина И.А. 27, 57 Щербо Д.С. 45
Петрова Н.В. 36 Сухачева М.В. 12 Эрдман В.В. 48
Петухов А.В. 20, 36 Сушенцов О.Е. 19 Юдкина А.В. 43
Плюта В.А. 42 Сырочева А.О. 12 Юрченко А.А. 43
Побегуц О.В. 32 Тарантул В.З. 38, 48 Яголович А.В. 14
Побединцева М.А. 43 Татарский Е.В. 51 Яковлев С.И. 27
Побережный Д.Ю. 48 Тетерина Е.В. 51 Якунина М.В. 40
Полтораченко В.А. 43 Тетерюк Л.В. 19 Ялаев Б.И. 53
Полуконова А.В. 43 Тимашева Я.Р. 48 Янус Г.А. 41
Пономарева Е.В. 44 Тимина М.Ф. 41, 48

60 МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК


Авторский указатель стендовых сообщений

Ажикина Т.Л. 55 Зарубин А.А. 54 Синявская М.Г. 56


Андрющенко С.В. 54 Здвижкова И.А. 54 Симонова О.Б. 57
Артамонова Т.О. 55 Злобин В.И. 56 Скрябин Н.А. 54
Бекпергенова А.В. 54 Игнатов Д. 55 Стасенко Д.В. 57
Билтуева Л.С. 56 Йоханссон Й. 55 Субботина И.А. 57
Быченко О.С. 55 Каллиполитис Б. 55 Татосян К.А. 57
Васильев С.А. 54 Капрельянц А.С. 55 Трифонов В.А. 56
Васильева О.Ю. 54 Луханина Н.В. 56 Устьянцев И.Г. 57
Воронцова Ю.Е. 57 Макаревич А.Е. 56 Федорова В.А. 57
Голоенко И.М. 56 Панкратов В.С. 56 Фрейтаг Н. 55
Григоров А.С. 55 Портная Я.А. 56 Ходорковский М.А. 55
Давыденко О.Г. 56 Прокопов Д.Ю. 56 Цимоха А.С. 55
Даниленко Н.Г. 56 Рахматуллина О.И. 54 Черезов Р.О. 57
Джиоев Ю.П. 56 Салина Е.Г. 55 Шимкевич А.М. 56
Дьяконов Е.Е. 55 Салтыков Ю.В. 57
Зайцев С.С. 57 Семеновых Т.А. 54

МОЛЕКУЛЯРНАЯ ГЕНЕТИКА, МИКРОБИОЛОГИЯ И ВИРУСОЛОГИЯ, 2019, СПЕЦВЫПУСК 61

Оценить