Joseph Okani Honger

University of Ghana http://ugspace.ug.edu.
gh
CHARACTERISATION OF THE CAUSAL AGENT OF MANGO ANTHRACNOSE
DISEASE IN GHANA
BY
JOSEPH OKANI HONGER
(BSc. Agric, MPhil (Crop Science) Legon.
(10121175)
THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF GHANA, LEGON IN
PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE AWARD OF PhD
CROP SCIENCE DEGREE
MAY, 2014
University of Ghana http://ugspace.ug.edu.gh
DECLARATION
I hereby declare that except for reference to other peoples work which has been duly
cited, this work is the result of my original research and that this thesis has neither in
whole nor part been presented for another degree elsewhere
…………………………………….
Joseph Okani Honger
(Student)
……………………………………
Prof. S.K.Offei
(Supervisor)
…………………………………..
Prof. K. A.Oduro
(Supervisor)
……………………………….
Prof. G.T Odamtten
(Supervisor)
DEDICATION
This work is dedicated to the Glory of God and to all members of my family.
ii
ACKNOWLEDGEMENTS
My first and foremost thanks go to the Almighty God for His mercies and love that
sustained me throughout the period of my study.
I would also like to extend my sincerest thanks to my supervisors Prof. S. K. Offei, Prof.
K.A. Oduro and Prof. G.T. Odamtten for their guidance and support as I carried out this
research work.
I am highly indebted to The Office of Research and Innovation Development ORID for
financial support for my research work. My sincerest thanks also goes to the Office of
International Students Exchange Programme for offering me the opportunity to study
abroad which enabled me acquire the skills necessary for the completion of my studies.
To Professor Frank Louws of the Plant Pathology Department of the North Carolina State
University, U.S.A., I say a big thank you for his generousity which enabled me to
sequence the genes from the DNA extracted from the isolates I used in this study. I wish
also to thank Stella Chang and Jimpin Sun, both of the Plant Pathology Laboratory of the
North Carolina State University for their tremenduous help while I carried out some
aspects of my research in their laboratory.
To many others whose names have not been mentioned but who contributed in diverse
ways towards the completion of this research work, I say may God bless you all.
iii
TABLE OF CONTENTS
Contents
DECLARATION..................................................................................................................... i
DEDICATION ....................................................................................................................... ii
ACKNOWLEDGEMENTS .................................................................................................. iii
TABLE OF CONTENTS ...................................................................................................... iv
LIST OF TABLES .............................................................................................................. viii
LIST OF FIGURES ................................................................................................................ x
ABSTRACT .......................................................................................................................... xi
CHAPTER 1 ........................................................................................................................... 1
1.0 INTRODUCTION ................................................................................................................... 1
CHAPTER 2 ........................................................................................................................... 7
2.0 LITERATURE REVIEW ........................................................................................................ 7
2.1 Origin, spread and production of mango ................................................................................. 7
2.2 Constraints to mango production ............................................................................................ 9
2.3 Mango anthracnose disease: symptoms and importance....................................................... 10
2.4 Disease cycle and epidemiology ........................................................................................... 11
2.5 Aetiology of mango anthracnose........................................................................................... 15
2.6 Description and Identification of Colletotrichum gloeosporioides ....................................... 15
2.7 The Colletotrichum gloeosporioides complex ...................................................................... 20
2.8 Effect of postharvest pathogens on nutritional and eating quality of mango. ....................... 23
2.9 Control of mango anthracnose .............................................................................................. 24
CHAPTER 3 ......................................................................................................................... 27
3.0 MATERIALS AND METHODS .......................................................................................... 27
3.1 Field survey of commercial mango farms ............................................................................. 27
3.1.1 Study area ....................................................................................................................... 27
3.1.2 Field visits....................................................................................................................... 27
3.1.3 Observation of disease symptoms .................................................................................. 27
3.1.4 Interaction with farmers.................................................................................................. 28
3.2. Evaluation of leaves, panicles and dropped fruits as important sources of inoculum ......... 28
iv
3.3 Field survey for the disease incidence and severity in Ghana............................................... 29
3.3.1 Disease incidence, severity and percentage of diseased fruits in the different
administrative regions of Ghana. ............................................................................................. 31
agro-ecological zones of Ghana .............................................................................................. 31
administrative regions of Ghana. ............................................................................................. 31
3.4 Determination of latent infections of mango anthracnose disease on mature fruits ............. 31
3.5 Determination of disease incidence, severity and yield/fruit quality loss due to the
mango anthracnose disease in a commercial farm. ..................................................................... 32
3.6. Disease aetiology: Characterisation of the causal agent ...................................................... 34
3.6.1 Isolation of causal agent ................................................................................................. 34
3.6.2 Establishment of monoconidial cultures......................................................................... 35
3.6.3 Identification of isolates ................................................................................................. 36
3.7 Pathogenicity tests ................................................................................................................. 49
3.7.1 Evaluation of methods of artificial inoculation of mango .............................................. 49
3.7.2 Evaluation of disease severity induced by isolates on mango fruits .............................. 50
3.7.3 Cross infection studies with isolates ............................................................................... 51
3.8. Studies on the secondary metabolites of isolates ................................................................. 52
3.8.1 Extraction of secondary metabolites............................................................................... 52
3.8.2Thin layer chromatography ............................................................................................. 53
3.8.3 Toxicity of secondary metabolites .................................................................................. 54
3.9. Fruit juice quality analysis ................................................................................................... 54
3.9.1 Selection of fruits and juice extraction ........................................................................... 54
3.9.2 Total Soluble Solids determination ................................................................................ 55
3.9.3 Titratable acidity determination...................................................................................... 55
3.9.4 TSS/TTA ........................................................................................................................ 56
3.10 Control of mango anthracnose disease ................................................................................ 56
3.10.1 Selection and in vitro evaluation of fungicides ............................................................ 56
3.10.2 Evaluation of efficacy of fungicides against the disease on the field ........................... 57
3.10.3 Post harvest treatments ................................................................................................. 58
3.11 Data analysis ....................................................................................................................... 59
v
CHAPTER FOUR ................................................................................................................ 60

4.0 RESULTS.............................................................................................................................. 60
4.1 Nature of mango anthracnose disease. .................................................................................. 60
4.1.1 Types of disease symptoms ............................................................................................ 60
4.1.2 Penetration of fruit pericarp by disease lesion................................................................ 60
4.1.3 Diseases with similar symptoms as mango anthracnose ................................................ 63
4.1.4 Factors promoting symptom expression on the field...................................................... 65
4.2 Evaluation of leaves, fruits and dried panicles as important sources of inoculum ............... 65
4.3 Disease control practices being implemented on mango orchards in Ghana ........................ 69
4.4 Incidence and severity of mango anthracnose disease in Ghana .......................................... 71
4.4.1 Incidence and severity of mango anthracnose disease in the Greater Accra,
Eastern, Ashanti, Volta, Brong Ahafo and the Northern regions of Ghana. ........................... 71
4.4.2 Incidence and severity of mango anthracnose disease in the coastal savanna,
semi deciduous, transitional and Guinea savanna agro-ecological zones of Ghana. .............. 74
4.4.3 Incidence and severity of mango anthracnose disease among some selected
administrative districts of Ghana ............................................................................................. 76
4.4.5. Incidence of latent (postharvest) infection on mature fruits in mango orchards ........... 80
4.5 Incidence, severity and yield/fruit quality loss in a commercial farm in Ghana ................... 82
4.5.1 Incidence, severity and yield/fruit quality loss in the minor season ............................... 82
4.5.2 Incidence, severity and yield/fruit quality loss in the major season ............................... 83
4.6 Identification of causal agent of the mango anthracnose disease.......................................... 86
4.6.1 Cultural, growth rate and morphological characteristics of isolates .............................. 86
4.6.2 Biochemical characteristics ............................................................................................ 90
4.6.3 Molecular characterization of isolates ............................................................................ 93
4.7 Pathogenic analyses............................................................................................................. 111
4.7.1 Evaluation of inoculation methods. .............................................................................. 111
4.7.2 Disease severity induced by different isolates .............................................................. 111
4.8 Cross infection potential of isolates. ................................................................................... 115
4.8.1 Mode of infection of fruits by isolates of the pathogen ................................................ 115
4.8.2 Characterisation of isolates of the pathogen from mango based on their cross-
infectivity on other fruit crops ............................................................................................... 115
4.9 Chromatographic determination and toxicity of secondary metabolites of isolates ........... 120
vi
4.9.1 Chromatographic screening of secondary metabolite. ................................................. 120

4.9.2 Toxicity of secondary metabolites of isolates .............................................................. 121
4.10 Effect of mango anthracnose disease on the juice quality of mango fruits. ...................... 123
4.10.1 Titratable acidity ......................................................................................................... 123
4.10.2 Total soluble solids ..................................................................................................... 123
4.10.3 The TSS/TTA ratio ..................................................................................................... 123
4.11. Control of mango anthracnose disease ............................................................................. 126
4.11.1 Effect of selected fungicides on the mycelia growth of Colletotrichum
gloeosporioides ...................................................................................................................... 126
4.11.2 Effect of preharvesting applications of fungicides on disease incidence and
severity of minor seasons mango production. ....................................................................... 128
4.11.3 Effect of pre and postharvest treatments on the incidence and severity index
of mango anthracnose disease on the Keitt variety of mango in the minor season. .............. 130
severity of major seasons mango production. ....................................................................... 133
4.11.5 Effect of pre and postharvest treatments on the incidence and severity index
of mango anthracnose on the Keitt variety of mango in the major season. ........................... 135
CHAPTER FIVE ................................................................................................................ 138
5.0 DISCUSSION ..................................................................................................................... 138
REFERENCES ................................................................................................................... 176
APPENDICES .................................................................................................................... 189
vii
LIST OF TABLES
Table 1. Major mango producing countries in the world and production in 2010. ............ 8
Table 2. Major mango exporting countries of the world and the amount exported in 2009
............................................................................................................................................. 9
Table 3. Disease severity rating scale used for the assessment of disease severity in
different mango farms in Ghana ....................................................................................... 30
Table 4. Universal primers used in the study. ................................................................... 43
Table 5. Isolates used in the phylogenetic study of the ITS1 region and their molecular
identification and accession numbers. .............................................................................. 48
Table 6. Isolates used in the GCPSR study for the identification of Colletotrichum species
and their GeneBank accession numbers ........................................................................... 49
Table 7. Fungicides evaluated for effect on the radial mycelial growth and incidence and
severity of mango anthracnose disease in Ghana ............................................................. 57
Table 8. occurrence of acervuli of Colletotrichum gloeosporioides in the indicated plant
parts in mango farms in Ghana ......................................................................................... 68
Table 9. Incidence of postharvest anthracnose disease in various mango growing districts
of Ghana. ........................................................................................................................... 81
Table 10. Effect of anthracnose disease on yield/fruit quality of mango fruits in a
commercial farm in the minor mango growing season of 2010 ....................................... 84
Table 11. Effect of anthracnose disease on yield/fruit quality of mango in a commercial
farm in the major season of 2011 ...................................................................................... 85
Table 12. Conidial morphology and dimensions and growth rate of Colletotrichum
species isolated from indicated fruits from different countries during the study ............. 90
Table 13. rDNA-ITS1 grouping of Colletotrichum gloeosporioides isolates used in the
study. ................................................................................................................................. 99
Table 14. Sequence variation and homology of the ITS1 region among isolates of
Colletotrichum species used in the study ........................................................................ 102
Table 15. Pairwise comparison of the entire ITS region of selected Colletotrichum
isolates used in the study................................................................................................. 103
Table 16. Similarity of isolates of Colletotrichum species obtained from mango and those
reported in the GeneBank using BLAST search ............................................................. 109
viii
Table 17. Lesion diameter induced on different cultivars of mango by isolates of

Colletotrichum gloeosporioides obtained from mango from different localities of Ghana
......................................................................................................................................... 114
Table 18. Cross infectivity of Colletotrichum gloeosporioides isolates on matured fruits
......................................................................................................................................... 117
Table 19. Effect of different severity levels of mango anthracnose disease on the
Titratable Acidity content of mango sunset, Irwin and local cultivars of mango fruit ... 124
Table 20. Effect of different severity levels of mango anthracnose disease on the Total
soluble solids content of mango sunset, Irwin and local cultivars of mango fruit.......... 124
Table 21. Effect of different severity levels of mango anthracnose disease on the ratio
Total soluble solid:Titratable acidity of sunset, Irwin and a local cultivars of mango fruit
......................................................................................................................................... 125
Table 22. Effect of different fungicides on radial growth of Colletotrichum
gloeosporioides obtained from mango on amended PDA .............................................. 127
Table 23. Effect of fungicide applications on the incidence and severity of mango
anthracnose and on the fruit quality of Keitt variety of mango during the minor mango
production season of 2010 in the Yilo Krobo district of Ghana ..................................... 129
Table 24. Effect of pre and postharvest treatments on the incidence of postharvest
anthracnose on fruits of the Keitt variety of mango in the minor season of 2010 .......... 131
Table 25. Effect of pre and postharvest treatments on the severity index of postharvest
anthracnose on fruits of the Keitt variety of mango in the minor season of 2010 .......... 132
anthracnose and on the fruit quality of Keitt variety of mango during the major mango
production season of 2011 in the Yilo Krobo district of Ghana ..................................... 134
Table 27. Effect of pre and postharvest treatments on the incidence of mango anthracnose
disease on fruits of the Keitt variety of mango in the major season ............................... 136
Table 28. Effect of pre and postharvest treatments on the severity index of mango
anthracnose on fruits of the Keitt variety of mango in the major season. ...................... 137
ix
LIST OF FIGURES
Figure 1. Anthracnose disease cycle ................................................................................. 14

Figure 2. Sequence homology of ITS1 regions of C. gloeosporioides obtained from
indicated fruit crops. ......................................................................................................... 18
Figure 3. A pie chart showing the percentage of farms practising different types of
disease control measures ................................................................................................... 70
Figure 4. A map of Ghana showing percentage of diseased fruits, incidence and severity
of mango anthracnose disease in mango farms from some selected administrative regions
of Ghana in 2010 and 2011. ...............................................Error! Bookmark not defined.
of mango anthracnose disease in mango farms from some selected agro-ecological zones
of Ghana in 2010 and 2011. .............................................................................................. 75
Figure 6. Rainfall, Temperature and Relative humidity figures from January to March
recorded in the different administrative districts of Ghana in 2010 and 2011 .................. 78
of mango anthracnose disease in farms in the indicated administrative districts of Ghana
in 2010 and 2011............................................................................................................... 79
Figure 8. Sequence alignment of intron of glutamine synthetase gene of isolates ........... 95
Figure 9. A phylogram drawn with the multiple sequence alignment generated with the
rDNA-ITS1 sequences of the 21 isolates of Colletotrichum species used in the study. . 101
Figure 10. Phylograms drawn with the multiple sequence alignment generated with the
nucleotide sequences of different gene regions. ............................................................. 107
Figure 11. Alignment of the sequences of the ITS1 region of Colletotrichum
gloeosporioides isolates from mango and other fruit crops in Ghana. ........................... 110
x
ABSTRACT
This research work was carried out to update information on the nature, the identity of the
causal agent and the importance of mango anthracnose disease in Ghana. It was also to
determine the effect of the disease on the juice quality of fruits and come up with
appropriate control measures in the country. A field survey was carried out in 12
administrative districts of Ghana in 2010 and 2011 to assess the disease incidence and
severity. The effect of the disease on yield/fruit quality was assessed in a commercial
farm by determining the percentage of fruits that dropped or could not be marketed due to
the disease. The pathogen causing the disease was isolated from the diseased lesions and
characterised using cultural, morphological, biochemical and molecular approaches. The
total soluble solids and acidity content of infected fruits were measured as means of
determining the effect of the disease on juice quality of the fruits. The susceptibility of
the different strains of the pathogen to fungicides available in Ghana was assessed using
PDA amended with the fungicides after which efficacy of fungicides was evaluated in the
field. The results show that two different symptoms, a sunken dark lesion and cracked
skins were observable in Ghana. The disease was not found in the field in 5 out of the 12
districts surveyed and the incidence ranged from 0% in the Hohoe, Berekum, Kintampo,
Savelungu/Nanton and Tolon/Kumbungu districts to 100% in the Kwaebibrem and
Kumasi metro districts in both the 2010 and 2011 major mango growing seasons. The
severity index of the disease on a scale of 0-5 ranged from 0 to 3.8 in 2010 and 0 to 3.7 in
2011. The disease was found to cause shriveling of fruit panicles and blemishes on skin
of fruits resulting in yield loss of 4.5% in the major season and 29.9% in the minor
season in a mango orchard in the Yilo Krobo district. Colletotrichum gloeosporioides
xi
sensu lato was confirmed as the causal agent of the disease. From a total of 45 isolates,
16 (35%) were identified as Colletotricum asianum while 29 (65%) were identified as
Colletotrichum species. Artificial inoculations confirmed the pathogenicity of isolates of
the pathogen on mango and induced similar disease level on Haden, Irwin, Julie, Keitt,
Kent, Palmer and Tommy Atkins cultivars of mango. Cross-infection studies showed 32
(32%) of the isolates were the mango bio-type of the pathogen while 68 (68%) were very
virulent on all the three types of fruit and were isolates that may have cross-infected
mango in the field. Analysis of the secondary metabolites of the two types of strains of
the pathogen indicated they may be producing the same kind of toxin. Analysis of the
total soluble solid and titratable acidity content of the fruit showed that the disease does
not significantly affect the juice quality of mango fruits (p>0.05). The pathogen was
found to be highly susceptible to 8 different fungicides available on the Ghanaian market.
The fungicides were able to reduce the incidence and severity of the disease significantly
(p<0.05) in the field eve. At the postharvest phase dipping of fruits in prochloraz solution
both at ambient temperature and at 53ºC were found to eradicate pathogen on harvested
fruits even if the fruits did not receive any preharvest treatment on the field. To minimize
cost, the prochloraz dip at ambient temperature is recommended for postharvest control
of the disease.
xii
CHAPTER 1
1.0 INTRODUCTION
Mango (Mangifera indica L.) is one of the most important fruit crops in the tropics, and
approximately makes up 50% of tropical fruits produced in the world (Jedele et al, 2003).
The world’s largest producer of the crop is India followed by China and Thailand. The
largest producer of the crop in Africa is Nigeria followed by Egypt (FAOSTAT, 2010).
Countries in West Africa such as Ghana and Burkina Faso produce modest amounts of the
crop (FAOSTAT, 2010).
Mango is a specialty crop in most of the international markets and hence is an important
source of foreign exchange for most developing countries including Ghana. Currently,
Mexico is the world’s largest exporter of the crop followed by India and Brazil. In Africa,
none of the producer countries is considered as one of the top ten exporting countries
(FAOSTAT, 2010) although South Africa, Kenya, Mali, Burkina Faso and Cote d’Ivoire
export modest quantities of the crop. Ghana has also been exporting the crop for the past 20
years but is still not recognized as an important exporting country in international markets
(Anon., 1996).
Ghana is made up of six major agro-ecological zones comprising of the coastal savanna, the
wet equatorial forest, semi-deciduous forest, transitional zone, Guinea savanna and Sudan
savanna. Currently, the commercial production of mango which was previously concentrated
in the coastal savanna zone is now spreading to the other agroecological zones and it is
believed that if the major problems related to the production of the crop are properly handled,
1
the mango crop has a potential of being the number one export earner of Ghana thereby
replacing cocoa (Anon., 1996).
There are many factors affecting the production of quality mango fruits in Ghana. These
range from unfavourable weather conditions to incidence of pests and diseases. Mango
anthracnose caused by Colletotrichum gloeosporioides (Oduro, 2000; Offei et al., 2008) is
one of the main diseases affecting the crop in Ghana. The disease has been reported as the
most important fungal disease of the crop in the country (Oduro, 2000). The disease causes
dark sunken lesions on leaves and immature fruits and can sometimes blight flowers (Agrios,
2005; Ploetz, 1998). One of the most significant effects of the disease is the blemishes caused
on fruit in storage or in transit which eventually reduce the marketability of the fruits.
Elsewhere, the disease is known to be favoured by high humidity or rainfall during the early
fruit maturity stage (Ploetz, 1998; Arauz, 2000) and hence it is cultivated in drier areas or
areas in where rainfall does not coincide with early fruit maturity.
Several characteristics have been associated with the mango anthracnose disease worldwide.
These include variant forms of symptoms (Nelson, 2008), latency of the infection
(Simmonds, 1941) and retention of inoculum in the tree canopy (Arauz, 2000). It has also
been reported that the disease results in fruit drop thereby causing direct loss in fruit quantity
(Ploetz, 1998; Dodd et al., 1992). The knowledge of these disease characteristics is important
designing control measure. However, limited research has been done on these aspects of the
disease in Ghana. Thus there is the need for the nature of the disease in Ghana to be
elucidated.
2
Three different species belonging to the genus Colletotrichum have been reported as the
causal agent of mango anthracnose. These are Colletotrichum gloeosporioides (Dodd et al.,
1997), Colletotrichum acutatum (Fitzell, 1979; Ploetz and Prakash, 1997) and Colletotrichum
gloeosporioides var. minor (Fitzell and Peak, 1984). C. gloeosporioides var. minor has been
described as a variant form of C. gloeosporioides and has so far been reported only in
Australia. Currently, it is no more recognized as an aetiological agent of the disease (Ploetz,
1998). C. gloeosporioides and C. acutatum are distinct species but the disease symptoms they
elicit on mango are indistinguishable. They both cause dark brown sunken lesions on mango
fruits, leaves and stems and may also cause twig die back (Ploetz, 1999). Multiple species of
the genus Colletotrichum are known to infect the same host. For example, C. gloeosporioides
and C. acutatum are known to cause disease on citrus (Brown et al, 1996), while coffee is
attacked by C. asianum, C. fructicola and C. siamense (Prihastuti et al., 2009). In Florida
both C. gloeosporioides and C. acutatum were found to be the causal agent of anthracnose on
mango (Davis, 1999). In Ghana only Colletotrichum gloeosporioides has been reported as the
causal agent of mango anthracnose as well as anthracnose on other fruit crops (Oduro, 2000;
Offei et al., 2008) and therefore it would be important to confirm this.
Colletotrichum gloeosporioides is a group species made up of different species including C.
musae, C. kahawae, C. asianum and C. gloeosporioides sensu stricto and several other
species brought together by similar spore morphology and rDNA-ITS sequences (Damm et
al., 2010). In Ghana, the identification of the causal agent of mango anthracnose as C.
gloeosporioides is not specific enough since it could refer to any of the distinct species in the
C. gloeosporioides complex. It is necessary, therefore to determine which of the distinct
species in the C. gloeosporioides complex, is the causal agent of the disease in Ghana.
3
The strain of C. gloeosporioides infecting the mango crop is generally referred to as the
mango bio-type of C. gloeosporioides and is known to be restricted to the crop and has not
been found naturally on any other crop (Alahakoon et al., 1994). Apart from being
genetically different compared to the strains of the pathogen from other fruit crops, the
mango biotype is readily distinguished from the other strains by virtue of its limited
infectivity on other fruit crops compared to its virulent nature on mango as assessed using
artificial inoculation studies (Hayden et al., 1994). In addition to the mango biotype of the
pathogen other strains have been found to infect mango implying that the crop has been
cross-infected on the field by these other strains. In Ghana, it is not known whether strains of
the pathogen on mango are the mango bio-type or whether other strains are involved in the
disease aetiology. This, together with the biochemical basis for the mode of infectivity of the
mango bio-type of the pathogen which has largely not been determined was investigated in
this study.
In guava, anthracnose caused by C. gloeosporioides was found to reduce the nutritional
quality of the fruit (Amusa et al., 2005). In the case of citrus, the black spot disease attributed
to Guinardia citricarpa has been reported as not having any effect on the juice quality of the
citrus fruit (Brentu et al., 2012). In mango, there is paucity of the information as regards the
effect of C. gloeosporioides on the juice quality of the mango fruit and this was addressed in
this thesis.
Fungicide application at regular intervals has been generally recognized as the most effective
method of controlling mango anthracnose (Ploetz, 1998). Inherent problems of the method
include emergence of resistant strains of the pathogen, harmful environmental side effects
(Dodd et al., 1989) and accumulation of fungicide residues in the final produce. It is
4
generally known that poor application methods of these fungicides will result in poor control
results. In Ghana, farmers have complained of poor results achieved with the fungicides
available in the country (Odzeyem, 1998). What is not known is whether the pathogen has
developed resistance to the fungicides or whether the ineffectiveness of the fungicides is as a
result of poor application practices. These were investigated in this current study.
The objectives of this research therefore, were to determine the nature and importance of
mango anthracnose disease in Ghana, clarify the identity of the causal agent and recommend
appropriate methods for the application of fungicides for the control of the disease in the
country.
Specific objectives were:
 Determine the types and nature of the disease symptoms, the major sources of
inoculum on the field and control practices being instituted in the field in Ghana
against the mango anthracnose disease.
 Determine the disease incidence and severity of mango anthracnose in the field and
after harvest in the different administrative regions and districts and the different
agro-ecological zones of Ghana.
 Estimate the disease incidence, severity and yield loss associated with mango
anthracnose in a selected commercial mango farm in Ghana.
 Characterize the pathogen causing mango anthracnose disease in Ghana.
 Identify the mango bio-type of the pathogen and determine whether other strains of
the pathogen from other fruit crops cross-infect mango on the field.
5
 Determine the effect of the mango anthracnose disease on the juice quality of the
mango fruit
 Develop a protocol for the control of mango anthracnose in Ghana.
6
CHAPTER 2
2.0 LITERATURE REVIEW
2.1 Origin, spread and production of mango

Mango (Mangifera indica L.) is a member of the family, Anacardiaceae which also includes
important fruit and nut species such as cashew (Anacardium occidentale), Pistachio
(Pistaciavera) and several Spondias spp. There is considerable debate about the origin of
mango. It is generally believed that the crop originated in the Indo-Burma region and has
been in cultivation for over 4000 years in the Southeastern Asia countries including
Phillipines, Indonesia, Java, Thailand, Burma (now Myanmar), Malaysia and Sri Lanka. The
crop was introduced into East and West Africa then to Brazil in the sixteenth century. It was
introduced into Mexico in the nineteenth century and Florida in 1833
(http.www.mango.tree.blogspot.com; Litz, 1998).
Mango is currently produced in most sub-tropical and tropical regions of the world and until
recently, it was an exotic specialty crop in most markets in the United States and Europe
(Galinsky and Law, 1998). India is the world largest producer of mango producing about
70% of total world production (Table 1). Other important mango producing countries include
Thailand, Mexico and Brazil. In Africa, Nigeria used to be the largest producer of the crop
with about 730, 000 metric tonnes in 2005. Currently, Kenya is the largest producer in Africa
with 553,710 MT followed by Egypt with 505,741 MT in 2010 (FAOSTAT, 2010). In West
Africa, countries that produce the crop in commercial quantities include Cote d’Ivoire and
Ghana.
Until 2005, Mexico used to be the leading exporter of mango worldwide. They were
overtaken recently by India. Total exports from Mexico amounted to 232, 643 MT as
7
compared to 286,775 MT from India in the 2009 (Table 2). Other important exporting
countries in the world include the Phillipines, Thailand and Ecuador (FAOSTAT, 2009).
Table 1. Major mango producing countries in the world and production in 2010.
Producing country Production (MT)
India 16,337,400
China 4,351,593
Thailand 2,550,600
Pakistan 1,784,300
Mexico 1,632,650
Indonesia 1,313,540
Brazil 1,188,910
Philippines 825,676
Kenya 553,710
Egypt 505,731
Mali 470,800
Peru 454,330
Dominican Republic 299,650
Colombia 243,375
Cote d’Ivoire 42,500
Ghana 7,000
(FAOSTAT, 2010a). MT=Metric tonnes
8
Table 2. Major mango exporting countries of the world and the amount exported in
2009
Producing country Amount exported (MT)
Mexico 232,643
India 175,467
Brazil 110, 355
Netherlands 81,932
Pakistan 73,575
Peru 69,191
Ecuador 47,591
Philippines 21,472
Belgium 14,614
Cote d’Ivoire 13,763
Spain 8,524
Costa Rica 7,117
Senegal 6,650
(FAOSTAT, 2010b). MT=Metric tonnes.
2.2 Constraints to mango production

Mango cultivation is constrained by many factors which include the incidence of pests and
diseases. The major pests in Ghana include the scale insects, mealy bugs and stone fruits
(Odzeyem, 1998). Worldwide diseases affecting the production of the crop include
Alternaria black rot caused by Alternaria alternata (Prusky, 1998), pink disease caused by
Erythricium salmonicolor (Lim, 1998), stem end rot caused by Lasiodiplodia theobromae or
Dothiorella dominica (Johnson, 1998) and mango anthracnose caused by Colletotrichum
gloeosporioides or Colletotrichum acutatum (Ploetz, 1998). These diseases cause both
qualitative and quantitative losses in the crop and bring added costs in the form of institution
of control measures to the farmers (Arauz, 2000). Among these diseases, mango anthracnose
has been reported as the most important fungal disease affecting the crop worldwide (Ploetz,
1998; Jeffries et al, 1990; Arauz, 2000).
9
2.3 Mango anthracnose disease: symptoms and importance

Mango anthracnose is reported to be the most important disease affecting mango worldwide
(Jeffries et al., 1990; Crane and Campbell, 1991; Nelson, 2008). It is a major pre and post-
harvest disease of the crop throughout the tropics (Jeffries et al., 1990). The disease is
believed to co-exist with mango cultivation worldwide (Fitzell, 1981) and is a major
constraint to fruit production as well as marketing (Ilag, 1992). The disease affects both
leaves, twigs, petioles, panicles and fruits (Nelson, 2008). It also causes blossom blight of
flowers and results in poor fruit set (Prior and Ryder, 1987; Estrada et al., 2000).
Anthracnose disease also causes latent infection on developing fruits which generally remain
quiescent until the fruit ripens (Simmonds, 1941; Muirhead and Grattidge, 1986; Dodd et al.,
1989; Estrada, 2000) except on young fruits (Dodd et al., 1991a). Symptoms develop on
fruits in transit or storage and reduce their marketability (Freeman et al., 1998).
Anthracnose symptoms on leaves initially occur as small angular, brown to black spots that
can coalesce to form large extensive lesions on the leaf. This is particularly common around
the edges of the leaves. On panicles, the symptoms first appear as small black or dark brown
spots which may enlarge or coalesce to kill the flowers before fruits are produced. Blighted
flowers are dry and their colour varies from brown to black (Arauz, 2000). Petioles, twigs
and stems, are also susceptible and the typical black expanding lesions found on leaves can
be found on them (Nelson, 2008).
Two types of symptoms are found on fruits. The commonest is a dark-brown lesion which is
slightly sunken with raised rims (Bailey et al., 1992; Agrios, 2005). This can be found on
very young fruits or matured fruits in storage or transit. The lesions can enlarge on the fruit
surface and eventually penetrate the fruit and infected young fruits usually drop (Nelson,
10
2008). These black necrotic lesions may or may not be accompanied by bright orange
acervuli which are the fruiting bodies of the pathogen (Bailey et al., 1992; Agrios, 2005).
The second type of symptom is commonly referred to as tear strain symptom in which are
linear necrotic regions on the fruit that may or may not be associated with superficial
cracking of the fruit epidermis causing an alligator skin effect on the fruit surface (Nelson,
2008). Anthracnose causes premature fruit drop and direct reduction in quality of ripe fruits,
shortening storage life time (Dodd et al., 1992). In areas where rain is prevalent during
flowering and fruit set, anthracnose can cause destruction of the inflorescence and infection
and drop of young fruits. Infection of the blossom or young fruits can result in total crop
failure (Estrada et al., 2000). Fruits smaller than 4 cm or of pea size usually aborts when
infected (Arauz, 2000).
Incidence of mango anthracnose has been reported between 32% in South Africa and 64.6%
in Costa Rica and can reach 100% when fruits are produced under wet or very humid
conditions. Similarly, post-harvest anthracnose incidence on mango can also reach as high as
100% on fruits produced in wet or high humid conditions (Arauz, 2000).
2.4 Disease cycle and epidemiology

Branch terminals, mummified inflorescences, flower bracts and leaves have been found to be
significant sources of primary inoculum (Dodd et al., 1991; Fitzell and Peak, 1984). The
conidia in the mango canopy are abundant and are considered the primary inoculum (Arauz,
2000). During rainfall, these conidia are splashed onto surfaces of healthy plant parts to cause
secondary infections showing a polycyclic nature of the disease on these tissues (Arauz,
2000). Under favourable conditions of free moisture or relative humidity more than 97%
(though this could also occur at 95% relative humidity), a conidium germinates on the
11
surface of the plant part and produces a bulbous appressorium which terminates in infection
pegs. The infection peg then enzymatically penetrates the cuticle and the epidermis to ramify
through the host tissues (O’Connell et al., 2009; Nelson, 2008). In young tissues the
pathogen develops and feeds on the nutrients of the host resulting in the development of
disease symptoms on the surface of the host. On matured mango fruits, the penetrated
pathogen enters into a period of dormancy and remains as sub-cuticular hyphae until the post
climacteric phase of the fruit is achieved (Arauz, 2000) and the fruit begins to ripen (Fig. 1).
The disease lesion of the postharvest stage during fruit ripening appears as dark brown to
black lesions with an indefinite border on the fruit surface (Arauz, 2000).
C. gloeosporioides has been reported as producing toxins during the infection process and it
has been suggested that such metabolites play a role in the development of anthracnose
disease symptoms on infected hosts including yam (Abang, 2003). These secondary
metabolites are released by the invading fungus to precede the advancing of the hyphae
through the cuticle to the interior portion of the host (Agrios, 2005). These toxins elicit a
variety of defense mechanisms from the host which result in varying degrees of protection of
the plant from the pathogen (Agrios, 2005).
When infection is successful the pathogen multiplies by producing numerous conidia in
bright orange acervuli on the infected fruit surfaces (Fig. 1). These conidia are released when
there is abundance of water and are dispersed by rain water which also provides the free
moisture required for the process of infection to recur (Jeffries et al., 1990). The pathogen
survives in between seasons by producing the reproductive structures on infected and
defoliated branch terminals and matured leaves (Fig 1). Ascospores have been reported as
being produced in dry leaves on the ground, but the role played by Glomerella cingulata, the
12
sexual stage of the pathogen, is not clear (Fitzell and Peak, 1984). Also larger fruits which
abort due to self thinning or other physiological reasons are mummified and such mummified
fruits are colonized by the pathogen which it sporulates abundantly (Arauz, 2000).
In vitro studies using detached fruits have shown that mango fruits can be infected with
conidia of isolates Colletotrichum species from other tree hosts such as avocado, papaya,
banana and guava (Hayden et al., 1994; Freeman and Shabi, 1996; Peres et al., 2002; Sanders
and Korsten, 2003; Lakshmi and Prasad, 2011). Though there is one instance of the pathogen
from avocado being isolated from naturally infected mango fruits (Alahakoon et al., 1994),
the epidemiological significance of these other potential sources of inoculum has not been
assessed (Arauz, 2000).
Severity of the mango anthracnose disease is related to weather and the pathogen is relatively
inactive in dry weather. When fruits are produced in such seasons, the disease incidence and
severity can be close to zero (Arauz, 2000). In general, the disease is favoured by wet, humid
warm weather (Nelson, 2008).
13
Figure 1. Anthracnose disease cycle (Arauz, 2000)
14
2.5 Aetiology of mango anthracnose

Three different species of Colletotrichum have been associated with mango anthracnose
worldwide. These are Colletotrichum gloeosporioides (Dodd et al, 1997), Colletotrichum
gloeosporioides var minor (Fitzell and Peak, 1984) and Colletotrichum acutatum (Fitzell,
1979; Ploetz and Prakash, 1997; Peres et al, 2002; Tarnowski and Ploetz, 2008).
Colletotrichum gloeosporioides var minor was regarded as a variant form of C.
gloeosporioides and was reported only in Australia. Currently, it is no more recognized as the
causal agent of the disease (Ploetz, 1998).
In tropical areas, Colletotrichum gloeosporioides has been reported as the major cause of the
disease while C. acutatum predominates in sub-tropical areas. In Florida and Brazil, both
species were found on mango (Davis, 1999; Peres et al., 2002). Though the two belong to
separate species, the symptoms they develop on mango fruits are indistinguishable. On other
crops where the two occur simultaneously, diagnosis of the disease in absence of molecular
characterization of the pathogens has been questioned (Walker et al., 1991).
2.6 Description and Identification of Colletotrichum gloeosporioides

C. gloeosporioides is ubiquitous pathogen infecting a wide range of crops including
mangoes. Colonies on potato dextrose agar are grayish white to dark grey with aerial mycelia
which ranged from a thick mass to sparse tufts associated with fructifications. The pathogen
produces short, hyaline, unicellular conidia that are either cylindrical with obtuse ends or
ellipsoidal with a rounded apex and a narrow truncated base. The conidia form on hyaline to
faintly brown conidiophores in acervuli which are irregular in shape and approximately
measure 500 µm in diameter. Setae (4-8 X 200 µm) which are found on the acervuli are one
15
to four septated, brown, slightly swollen at the base and tapered at the apex (Ploetz, 1998;
Agrios, 2005).
C. gloeosporioides infecting mango is both genetically and pathologically distinct from other
isolates of the pathogen infecting other tropical fruit crops and has been described as the
mango bio-type of the pathogen (Mills et al., 1992; Hayden et al., 1994). The mango bio-
type of the pathogen is restricted to the mango crop and unlike the other strains of the
pathogen it has not been found on any other crop naturally (Alahakoon et al., 1994; Hayden
et al., 1994). Isolates of the mango bio-type from different locations are genetically uniform
and hence is conjectured to be clonal and distributed worldwide from a single source.
Irrespective of where they were found, isolates of the mango bio-type of pathogen had been
identified based on two substitutions at the 78th and 138th position of the ITS1 nucleotide
sequences which corresponds to the 73rd and 133rd position beginning from the first
nucleotide of the region. At the 78th position, the isolate possess an ‘A’ while the strains from
the other tree crops possess a ‘C’ and at the 138th position this mango bio-type possess a ‘G’
while the others posses a ‘T’ (Fig. 2). They also posses the same mtDNA and rDNA
restriction digestion profile which is unique in comparison to the other isolates from the other
tree crops (Mills et al., 1992; Hodson et al., 1993; Alahakoon et al., 1994; Gupta et al.,
2010). These characteristics of the pathogen had been utilised in the demonstration of cross-
infection of the strains of the pathogen from other tree crops onto mango (Alahakoon et al.,
1994). Currently, it has been reported that the mango bio-type of C. gloeosporioides may be
Colletotrichum asianum, a pathogen previously found on coffee (Phoulivong et al., 2010).
Traditionally, plant-associated fungi are identified based on morphological features such as
colony colour, size and shape of conidia, optimal temperature, growth rate, presence or
16
absence of setae and the existence of the teleomorph, Glomerella (Cannon et al., 2000;
Sutton, 1980). However, due to the effect of environment on the stability of morphological
traits and the existence of intermediate forms that can be associated with storage and frequent
sub-culturing, and the overlap of morphological traits such as conidial morphology and
cultural characteristics, the use of these morphological and physiological characteristics is
limited in the identification of members of the genus (Freeman and Rodriguez, 1995; Bailey
et al., 1996; Adaskaveg and Hartin, 1997; Johnston and Jones, 1997; Cannon et al., 2000;
Freeman et al., 2000; Freeman, 2009). In certain cases, using these methods has generated
confusion as to the causal agent of a disease where both C. gloeosporioides and C. acutatum
were suspected (Bailey et al., 1996). In fact it has been reported that many disease symptoms
attributed to C. gloeosporioides before 1965 may have been caused by C. acutatum (Walker
et al., 1991). It is necessary for an accurate diagnosis of diseases suspected to be caused by
members of the genus Colletotrichum, to apply a combination of both morphological and
molecular data to identify the pathogen (Peres et al., 2002).
17
Figure 2. Sequence homology of ITS1 regions of C. gloeosporioides obtained from indicated

fruit crops. (Mills et al., 1992)
18
Several molecular methods have been employed for species delineation within the genus
Colletotrichum and this has enabled the accurate identification of C. gloeosporioides
infecting fruit crops in general. These include the use of Abitrarily primed polymerase chain
reaction (ap-PCR), Analysis of A+T-rich DNA associated with mtDNA and Nuclear DNA
polymorphisms and Ribosomal DNA analysis (Freeman et al, 1993; Freeman and Rodriguez,
1995). Ribosomal DNA (rDNA) genes appear as multiple copies in the genome and are
conserved. In contrast the non-coding internal transcribed spacer region (ITS) between the
small and large nuclear rDNA regions is suitable targets for detection of recent evolutionary
divergence within Colletotrichum (Freeman, 2009). Additionally, species specific primers
have been designed based primarily on the sequence dissimilarities of the ITS region of
representative Colletotrichum species and have been used successfully and sequences have
been used to characterize the pathogen from a wide range of fruit crops including almond,
avocado and strawberry (Sreenivasaprad et al., 1994; Correl et al., 1993). Sequence analysis
of the region has been used to accurately differentiate between and identify several species
within the Colletotrichum genus including C. gloeosporioides (Mills et al., 1992;
Sreenivasaprad et al., 1996; Johnston and Jones, 1997). Recently, the intron of the glutamine
synthetase gene was evaluated for its suitability as a rapid diagnostic tool for identification of
C. gloeosporioides and C. acutatum infecting a wide range of crops. It was found that
restriction fragment length polymorphism of the 1-kb intron and the presence or absence of
poly-T chains at the beginning of the intron nucleotide sequence could be used to accurately
distinguish between the two species (Liu et al., 2010). Other gene introns found useful for
characterizing members of the Colletotrichum genus include the beta tubulin,
19
glyceraldehyde-3-phosphate dehydrogenase gene and the beta tubulin genes (Guerber et al.,
2003; Phoulivong et al., 2010).
Multiple species of Colletotrichum are known to infect the same host. For example, C.
gloeosporioides and C. acutatum are known to cause disease on citrus (Brown et al., 1996),
while coffee is affected by C. fructicola, C. asianum and C. siamense (Prihastuti et al., 2009).
In Florida and Brazil both C. gloeosporioides and C. acutatum were found to be the causal
agent of anthracnose on mango (Davis, 1999: Peres et al., 2002). In most cases, C.
gloeosporioides and C. acutatum produce symptoms on the same host that are
indistinguishable and especially on mango where only the two have been reported as causing
mango anthracnose, accurate diagnosis of the disease relies primarily on distinguishing
between the two. This strategy has been employed in Florida (Davis, 1999) and in Brazil
(Peres et al., 2002). To accurately distinguish between the two, conidial morphology, growth
rate and susceptibility to fungicides have been combined with the use of one or more of the
several molecular methods on several crops including mango. Generally, C. gloeosporioides
produce conical spores that are rounded at both edges while C. acutatum produces fusiform
conidia with sharp edges and grows at a slower rate than the C. gloeosporioides. Also C.
acutatum is reported to be resistant to benomyl and extremely tolerant to carbendazim which
contrasts with C. gloeosporioides which is extremely susceptible to both fungicides (Brown
et al., 1996; Freeman et al., 1998; Martin and Garcia-Figueres, 1999; Peres et al., 2002).
2.7 The Colletotrichum gloeosporioides complex

C. gloeosporioides is a group species made up different genetically distinct species brought
together by similar conidial morphology and rDNA-ITS nucleotide sequences. It has been
reported that the taxa C. musae, C. kahawae, C. xanthorrhoeae, C. nupharicola, C. fragariae,
20
C. gloeosporioides sensu stricto, C. horii, C. theobromicola, C. ignotum, C. tropicale, C.
asianum, C. siamense, C. fructicola and C. hymenocallidis as well as many putative
undescribed species are all part of the C. gloeosporioides sensu lato complex (Damm et al.,
2010). In several instances, the term C. gloeosporioides has been used interchangeably to
refer to both C. gloeosporioides sensu stricto and the group species (Sreenivasaprad et al.,
1996). However, the distinction was made very clear by Phoulivong et al., (2010) who
restricted the name to C. gloeosporioides sensu stricto, the original strain obtained from
citrus which has recently been identified also on orchids. There exists some amount of
confusion in the naming of isolates of C. gloeosporioides when differences in the nucleotide
sequences of the ITS1 region were found among different isolates named as C.
gloeosporioides. To overcome this confusion, Sreenivasaprad et al, (1996) proposed up to
3.6% variations in sequence homology as the ceiling for the naming of variants as C.
gloeosporioides. The consequence of these ceiling was that other species especially, C.
kahawae which showed a percent variation of less than 3.6% with some isolates of C.
gloeosporioides had to be renamed. To solve the problem, it was proposed that C.
gloeosporioides must be defined to cater for the C. kahawae isolates. However, Phoulivong
et al, (2010) showed that some isolates which have wrongly been assumed to be variants of
C. gloeosporioides especially on tropical fruit crops are distinct Colletotrichum isolates
whose species status has not been ascertained yet. The authors also reported that the
anomalies detected in the identification of C. gloeosporioides isolates was due to the
comparison of unknowns to wrong type strains (Phoulivong et al., 2010).
Despite the usefulness of the ITS region in resolving systematic issues, the region represent a
small portion of the total genome and hence it was not possible to use the region to determine
21
the species of isolates within the C. gloeosporioides complex (Abang, 2003). To achieve this,
different gene regions were combined to obtain sufficient information to achieve such aim.
These DNA regions include the intron of the glyceraldehyde-3–phosphate dehydrogenase
gene, the intron of the beta tubulin gene and the actin gene (Liu et al., 2007; Prihastuti et al.,
2009; Phoulivong et al., 2010). Based on the results of these analyses it has been reported
that the pathogen infecting mangoes in Thailand and earlier on reported as C.
gloeosporioides is rather C. asianum (Phoulivong et al., 2010). They also suggested that the
wrong identification of the pathogen may not be restricted to Thailand alone but may be
worldwide.
One method of resolving systematic issues within species complexes is the use of the
Genealogical Concordance Phylogenetic Species Recognition (GCPSR). According to the
method, speciation point is the point at which different gene trees show concordance (Taylor
et al., 2000). The method has been used to resolve systematic issues in the Gibberella fujikori
complex (O’Donnell et al., 1998) and to identify different species of Aspergillus flavus
(Geiser et al., 1998). According to Taylor et al., (2000), among Morphological Species
Recognition (MSR), Biological Species Recognition and Phylogenetic Species Recognition
(PSR), PSR comes closer than the others to recognizing species consistent with Evolutionary
Species Concept. This according to them is because once progeny evolutionary species have
formed from an ancestor, changes in gene sequences occur and can be easily recognized
before changes have occurred in mating behavior or morphology. The method involves the
construction and analysis of several gene trees (Koufopanou et al., 1997) and this makes it
more robust in the identification of species compared to the use of a single gene (Abang,
2003).
22
2.8 Effect of postharvest pathogens on nutritional and eating quality of mango.

During pathogenesis various postharvest fungi and bacteria cause rot to a number of fruits
including mango which cause biochemical changes in the fruit and reduced food and market
value (Pawer, 2012). Fruits in general contain high concentrations of vitamins, carbohydrates
and mineral. The content of these nutrients are affected by postharvest fungi (Pawer, 2012).
In mango, Aspergillus niger infection reduces the sugar content in the fruit (Reddy and
Laxminanaraya, 1984). The fungus Pestalotia anonicola causes reduction in total sugar of
mango. A. niger is responsible for the reduction in ascorbic acid levels in mango while
reduction in vitamin C content of the mango fruit is caused by Phomopsis mangifera or
Phoma axigua (Reddy and Laxminanaraya, 1984) and Lasiodiplodia theobromae (Arya,
1993). Apart from sugar and vitamin C, the ash, phosphorus and calcium content of mango
fruits are depleted by postharvest fungi (Gadgile and Chavan, 2011; Pawer, 2012)
Total soluble solid and organic acid content are two important parameters used to determine
the juice quality of a fruit. These have also been reported as important components of the
flavour of ripe mangoes along with aroma volatiles (Padda et al., 2011). In general, the ratio
of total soluble solid (TSS)/ total titratable acidity (TTA) influences consumer’s acceptability
in fruits and vegetables (Zapata et al., 2008). Consequently, any effect of external factors
such as pathogens or age of fruit that affect either the TSS or TTA content of a fruit is likely
to affect the organoleptic quality of the fruit. In citrus, Guinardia citricarpa. responsible for
the black spot disease of the fruit was found not to influence the TSS/TTA ratio of the fruit
and hence was considered as having no effect on the juice quality of the fruit. On mango the
incidence and severity of mango anthracnose caused by Colletotrichum gloeosporioides was
found not to correlate with the TSS (Jabber et al., 2011).
23
2.9 Control of mango anthracnose

Several options exist for the control of mango anthracnose which include siting of mango
orchards in drier areas, the use of resistant cultivars, farm sanitation and the application of
fungicides (Nelson, 2008). These methods are usually applied together in an integrated pest
management programme (Nelson, 2008). Farm sanitation which involves the removal of
excess foliages and their subsequent removal from the field is aimed at reducing the
inoculum level in the field prior to the production season. However, despite the importance
of the method, it is rarely practised by farmers due to the cost and difficulty (Akem, 2006).
Choice of resistant cultivars has been described as the most important control measure after
site selection (Nelson, 2008). The resistance of mango cultivars appears to depend on the
geographical location at which the crop is cultivated and this may be linked to the identity of
the pathogen within the locality, (Nishijima, 1994; Davis, 1999; Pernezny and Ploetz, 2002).
Several mango cultivars have been found with moderate resistance to the disease, but due to
the high market cosmetic standards, no commercial cultivar is sufficiently resistant to be
produced in humid areas without fungicide application as the levels of the disease on such
cultivars are unacceptable in commercial situations (Dodd et al., 1997; Arauz, 2000).
Therefore, the most profitable production of cultivars which are very susceptible but
important in international trade would be the establishment of the orchards in arid areas
(Nelson, 2008). In recent times, the possibility of boosting the natural resistance of
susceptible fruits have been investigated by the application of salicylic acid and acibenzolar-
S-methyl (Zainuri et al., 2003)
Fungicide application to control mango anthracnose has been done both at the pre-and post-
harvest periods. On the field, application of fungicides to control mango anthracnose can
24
reach as high as 25 sprays of both contact and systemic fungicides within a production
season in environments favourable to the development of the disease (Dodd et al., 1997). In
drier areas or areas where the production season completely escapes the rains, the crop can be
grown without the application of fungicides (Arauz, 2000). Different strategies have been
developed for the application of fungicides in different locations for the management of the
disease. In Florida, a comprehensive field spray programme involving the weekly application
of fungicides from flowering to fruit set followed by weekly application of systemic or bi-
weekly application of contact fungicides has been developed (MacMillan, 1984). A similar
comprehensive programme has been developed to be used in Australia (Fitzell and Peak,
1986). In The Philippines, fungicides are applied at specific periods of the production system
and this results in a fewer application of fungicides compared to the Florida programme
(Dangan et al., 1988). The use of disease forecasting system which advises the application of
fungicides only when the model predicts the advent of infections has resulted in a fewer
applications of fungicides compared to the calendar based programme to achieve the same
level of control (Estrada et al., 1996). The models incorporate the effects of temperature and
humidity on the pathogen and hence may be specific to a locality.
Very few fungicides have been approved to be used on mango both at the pre- and
postharvest stages of production. The fungicide, prochloraz has been listed to be applied on
fruits destined for the US markets. Others include Benomyl, Prochloraz, Captan, Ferbam,
Thiabendazole and Copper fungicides. Currently, benomyl is no more permitted while
prochloraz is the only synthetic fungicide approved to be used on the fruits after harvest
(Arauz, 2000). However, there are differences in the types of fungicides approved to be used
on fruits destined for the European market or the United States markets. For example,
25
dithiocarbamate fungicides which include mancozeb are allowed in the EU but not in the US
markets (Arauz, 2000). Generally, copper fungicides are allowed in both markets and
chemical residues of these fungicides are not a problem. However, they have been reported
as being less effective under high disease pressure (Arauz, 2000) and may also be phytotoxic
to flowers (Dodd et al., 1997).
26
CHAPTER 3
3.0 MATERIALS AND METHODS
3.1 Field survey of commercial mango farms
3.1.1 Study area
The field survey was carried out in 12 selected districts of Ghana from the Greater Accra,
Eastern, Volta, Ashanti, Brong Ahafo and Northern Regions. The selected districts were
distributed among the four major agro-ecological zones of Ghana namely the coastal
savanna, the wet equatorial, transition and the Guinea savanna agro-ecological zones (Figs 4
and 5)..
3.1.2 Field visits
Field visits were made to a total of 82 farms found in the mango growing districts of Ghana
to study the nature of the mango anthracnose disease in the field, interact with farmers and
collect samples of both diseased and healthy plant parts for further studies.
3.1.3 Observation of disease symptoms
Field visits to determine the nature of the mango anthracnose disease was carried out in thirty
selected farms in the Yilo Krobo district of the Eastern region in the minor mango production
season of 2009. During the period several visits were made to each of the selected farms and
leaves, inflorescences and fruits on the trees were inspected for the presence of the mango
anthracnose disease symptoms. Some newly formed fruits were selected at random, tagged
and monitored daily and the development of the disease symptoms recorded. The nature of
the disease symptoms on the different varieties found within the period of the study was also
27
observed. Also recorded were other disease symptoms that resembled the mango anthracnose
disease symptoms and which could therefore confuse the diagnosis of the mango anthracnose
disease. Fruits of different ages showing disease symptoms were observed for the possible
cause of the expression of the symptoms. When necessary, farmers were questioned and the
reason for the symptom expression was deduced. Ripened fruits that were showing the
disease symptoms on the trees were harvested and the skins removed to determine whether
the disease lesions had penetrated the flesh of the fruits or not
3.1.4 Interaction with farmers
The farm visits with the aim of interacting with farmers were carried out in 2009 in the
Greater Accra, Eastern and Volta regions of Ghana. It was extended to farmers in the Brong
Ahafo and Northern regions in the major mango production season of 2010. Farmers and
farm managers were interviewed by being asked specific questions about the kind of
practices carried out on the farm to control the mango anthracnose disease (Appendix 1). The
responses from the different farms were converted to percentages.
3.2. Evaluation of leaves, panicles and dropped fruits as important sources of inoculum
Farm visits to collect plant samples to determine if leaves, panicles and dropped fruits were
major sources of inoculum were made to a total of 82 farms across 12 administrative districts
of Ghana in the 2010 major mango production season. During the visit to each farm, 10
leaves of all ages were collected at random from 5 trees found in the middle of each farm.
The leaves harvested from farms within the same district were bulked together and 100 of
these were sampled at random and sent to the laboratory. The leaves were placed in black
polyethene bags containing moistened tissue paper. The open end of the bags were tied and
28
incubated in a dark cupboard using the completely randomized design (CRD) at 65% RH and
27ºC. Two weeks after incubation, the leaves were retrieved and their surfaces inspected for
the presence or absence of acervuli. The number of leaves showing the signs of the pathogen
was expressed as a percentage of the total number of leaves incubated. Dry panicles and
mummified fruits from the previous season’s production which were found were also
collected and subjected to the same treatment as the leaves.
3.3 Field survey for the disease incidence and severity in Ghana
The survey to determine disease incidence and severity of mango anthracnose in the field
was carried out during the major mango growing seasons of 2010 and repeated in 2011. In
each year, the survey was carried out between February and March, 2-3 weeks after fruit set
in the selected farms. The survey was carried out in the major mango growing regions of
Ghana (Figs 4 and 5). Mango farms with sizes more than one acre were selected at random in
each of the administrative regions of Ghana and used for the survey.
On each farm, 10 trees of the Keitt variety (the only variety common to all farms selected)
were randomly sampled and disease incidence (DI) was calculated by the equation:
DI= Number of trees showing disease symptoms X 100
Total number of trees inspected
Ten10 trees were then circled at walking paces and stops were made at regular intervals and
the inflorescence found at the head level was selected. Some fruits (at least 200 in number
per farm), were picked at random and the percentage of the fruit area covered by the disease
lesion was estimated and rated on a scale of 0-5 using the criteria of All India Co-ordinate
29
Research Project on Sub-tropical fruit crops (Table 3). The disease severity index per tree
was estimated as indicated below:
DSI=∑fX, where,
∑x
DSI=Disease severity index
f=number of fruits with a particular rating
x=a particular rating based on the percentage of fruit surface area covered by disease lesion.
Also, the percentage of fruits inspected showing the disease symptom was calculated using
the equation:
%Infestation= Number of fruits showing the disease symptom X 100

Number of fruits inspected
Table 3. Disease severity rating scale used for the assessment of disease severity in
different mango farms in Ghana
Rating Meaning
0 No infection
1 Up to 5% of fruit surface area covered
2 6-10% of fruit area affected
3 between 11 and 20% of fruit area covered
4 21-50% of fruit area affected
5 more than 50% of the fruit surface area covered
Lakshmi and Prasad, (2011).
30
administrative regions of Ghana.
The results obtained from the disease incidence, severity and percentage of diseased fruits in
farms that were found in the same administrative region were bulked together and the data
among the different administrative regions in Ghana were analysed to determine differences.
3.3.2 Disease incidence, severity and percentage of diseased fruits in the different agro-
ecological zones of Ghana
The results obtained from the disease incidence, severity and percentage of diseased fruits in
farms that were found in the same agro-ecological zone were bulked together and the data
among the different administrative regions in Ghana were analysed to determine differences.
administrative regions of Ghana.
Rresults obtained from the disease incidence, severity and percentage of diseased fruits in
farms that were found in the same administrative district in Ghana were bulked together and
the data among the different administrative regions in Ghana were analysed to determine
differences. A ten year relative humidity, temperature and rainfall data for January, February
and March (the period of flowering and fruit set of the mango tree in the survey areas) was
obtained from the Ghana meteorological Agency.
3.4 Determination of latent infections of mango anthracnose disease on mature fruits
At fruit maturity periods (which ranged between 110-120 days after flowering in the mango
farms within the different districts), 50 clean and healthy fruits were harvested from each
farm and all fruits collected from farms within the same district were bulked together and
100 fruits sampled. The fruits were washed with a liquid detergent and thoroughly rinsed 3
31
times with water and divided into lots of 4 with each lot representing a replicate of each
district. Fruits were packed into plastic baskets and were then covered with a sack and left on
benches in the laboratory at 65% RH and 27°C for two weeks. The fruits were then inspected
for symptoms of mango anthracnose disease. The incidence of the disease was calculated as
stated in Section 3.3.
3.5 Determination of disease incidence, severity and yield/fruit quality loss due to the
mango anthracnose disease in a commercial farm.
The experiment was carried out in the minor mango growing season of 2010 and repeated in
the 2011 major mango growing production season in a commercial farm in Akorley a town
located in the Yilo Krobo district of the Eastern Region of Ghana. The farm was selected due
to the presence of trees of varying ages. Twelve (12) trees four each of the same age were
selected for the study and designated as plot 1, 2 and 3 where trees in plot were 8 years old,
those in plot 2 were 10 years old and plot 3 were trees of 12 years old. Prior to the
experiment ring weeding was carried out and the debris were collected. After that, potassium
nitrate at a rate of 16.6 g in 1L of water was sprayed on the trees using a knapsack sprayer to
induce uniform flowering. After fruit set, regular inspection of trees was carried out and any
fruit that had dropped was inspected for the presence of the mango anthracnose disease. If the
symptoms were found, it was decided whether the fruit was dropped solely because it was
infected by the disease or it dropped due to other factors. A fruit was considered to have been
dropped by the mango anthracnose disease when there was evidence that the fruit stalk was
heavily colonized by the pathogen and that the symptom was restricted to the stem end
portion. Inspection of the field was carried out daily for the first three weeks after fruit set
after which it was carried out at twice a week. This continued till harvesting maturity of fruits
at 118 days after fruit set. At fruit maturity, 100 fruits were selected at random from each tree
32
and the disease incidence and severity were determined as done in section 3.3. All fruits were
then harvested and separated into marketable and non marketable fruits. The data collected
were:
Number of fruits dropped solely due to the disease (Nd)
Number of fruits dropped due to other factors (No)
Number of fruits without disease symptoms after harvest (Nc)
Number of fruits that were diseased but were marketable fruits (Nm).
Number of fruits that were not marketable because they were diseased (Nu)
Number of fruits that were not marketable due to other factors (Nf)
The collected data was then used to calculate the following:
a) Total number of fruits produced per tree (Nt) = Nd + No +Nc +Nm +Nu +Nf
b) Percentage of fruits that were dropped solely due to the disease (%Nd) = Nd X 100
Nt
c) Percentage of fruits that dropped due to other factors (%No) = No X 100

Nt
d) Percentage of fruits without disease (%c) = Nc X 100

Nt
e) Percentage of diseased but marketable fruits (%Nm) = Nm X 100

Nt
f) bPercentage of fruits that were rejected due to other factors (%Nf) = Nf X 100
Nt
33
g) Percentage of fruits that were not marketable because they were infected by the
anthracnose disease (%Nu)= Nu X 100
Nt
h) Total yield/fruit quality loss due to the disease= Percentage of fruits dropped due to
the disease (%Nd) + percentage of matured fruits that were not marketable because
they were diseased (Nu).
3.6. Disease aetiology: Characterisation of the causal agent
3.6.1 Isolation of causal agent
Diseased mango fruits, leaves and panicles showing anthracnose symptoms which were
collected from the farmer fields in Ghana were sent to the Plant Pathology Laboratory of the
Crop Science Department of the University of Ghana for isolation of the causal agent. Also
sent to laboratory for the same purpose, were diseased fruits of pawpaw and avocado and
diseased leaves of citrus all showing anthracnose disease symptoms which were collected
from the mango orchards. Healthy fruits of mango from Puerto Rico, Mexico and Florida
were also collected from grocery shops in North Carolina, USA, and sent to the laboratory of
the Plant Pathology Laboratory of the North Carolina State University where they were
dipped in paraquat herbicide and incubated till the disease symptoms began to show. The
diseased fruits were used for the isolation of the causal agent. Diseased strawberry leaves and
bell pepper fruits were collected from farmer fields in North Carolina for the isolation of
Colletotrichum acutatum which were also used as reference isolates of Colletotrichum
acutatum at certain indicated parts of the work. The isolation of causal agents was first done
on water agar and then on potato dextrose agar. Water agar (WA) and potato dextrose agar
(PDA) were prepared at rates of 20g/L and 39 g/L respectively. Each mixture was autoclaved
at 121ºC for 15 minutes allowed to cool and poured into clean sterilized plates and allowed to
34
set. Pieces of the fruit tissues taken from the advancing edge of the lesion at all parts of the
fruits (stem end, middle and bottom portions) were taken, surface sterilised with sodium
hypochlorite for 15 sec., washed in sterile distilled water and blotted dry using a paper towel.
This were plated singly on water agar plates and incubated till enough growth of the
pathogen was observed. The growth were then sub-cultured on PDA and incubated till
sufficient growth was observed.
3.6.2 Establishment of monoconidial cultures
Monoconidal cultures of Colletotrichum were established to obtain pure cultures. This was
carried out on 100 isolates obtained from mango and 2 each from avocado, papaya and citrus
in Ghana. In North Carolina, U.S.A, the method was carried out on 5 isolates each of the
pathogen from mango obtained from Mexico, Florida and Puerto Rico, and 2 each from bell
pepper and strawberry. A 10 ml spore suspension of each isolates was produced by extracting
a single acervulus from cultures and crushing it in sterile distilled water to release the conidia
into the water. A sterile lop was then used to streak the spore suspension on water agar plates
after which the plates were incubated. After 24 hours plates were observed at the base to
identify a single germinating spore under the microscope at x10 magnification of the
objective lense. The position where a spore was located was marked with a marking pen at
the base of the plate and a sterile scalpel was used to cut the portion of the water agar
containing the germinating spore and transferred onto PDA plates. The plates were incubated
for 7 days after which slants of each isolate were produced and kept in the fridge for short
term storage. In situations where acervuli production by an isolate was limited, a cockborer
was used to cut portions of mycelia and the culture incubated until the acervuli began to form
35
around the edges of the wounds. The acervuli were then isolated and used for the production
of monoconidial cultures on PDA.
3.6.3 Identification of isolates
3.6.3.1 Cultural characteristics and growth rate
A plug of an 8 day old culture of each isolate was placed on PDA and incubated under
ambient temperature of 27C and relative humidity of 65% on laboratory benches. This was
done in Ghana with the isolates obtained from Ghana and repeated in North Carolina with the
isolates obtained from there. The colony colour, its margin and presence and arrangement of
acervuli in the mycelia was observed and recorded to aid in the identification of the isolates.
Using a ruler, the diameter of the mycelia of the organisms was measured daily on the
reverse side of the plate along lines ruled across the diameter of the Petri plates. Three plates
of each isolate were used for the study. For each plate, the colony diameter was measured
daily for 7 days and growth rate was calculated as 7 day average of the mean daily growth.
3.6.3.2 Morphological characteristics of conidia

A conidial suspension of each isolate was prepared by extracting and crushing few acervuli
in sterile distilled water. A drop of the suspension was fixed on a slide and observed under
the microscope. The shape of the conidia was recorded. The length and breadth of 50
randomly selected conidia were measured with the aid of an eye piece graticule and recorded
to aid in the identification of the organisms. Three plates of each isolate were used in the
study. Drops of the suspension of some selected isolates of the pathogen from mango from
Ghana, were placed in a sterilized plate, covered and incubated at 27ºC for 3 days after which
the nature of the germinating spore was recorded. These were repeated with the isolates from
mango from Mexico, Florida and Puerto Rico in North Carolina, U.S.A.
36
3.6.3.3 Biochemical characteristics

Four biochemical reactions were carried out to aid in the identification of the fungi. The
amylase production, Lipase production and Polyphenol Oxidase production (Trigiano and
Ament, 2008) and Casein hydrolysis (Martin and Garcia-Figueres, 1999) tests were used to
compare the biochemical reactions between Colletotrichum gloeosporioides and
Colletotrichum acutatum in North Carolina where both were obtained. In Ghana, the methods
were used to compare the reactions of the different strains of the pathogen obtained from
mangoes in Ghana. The methods were as follows:
Amylase production
Isolates selected for the amylase test were first sub-cultured on nutrient agar. The media for
the amylase production test was prepared by combining 8 g of nutrient broth and 20 g of agar
powder in 1L of water and autoclaving the mixture at 121ºC for 15 minutes after which they
were dispensed into Petri dishes and allowed to set. A plug of the mycelium of the pathogen
originally on PDA was taken and cultured on the nutrient agar for 7 days. The resulting
colony was then subcultured onto a starch medium. The medium was prepared by combining
2 g of soluble starch, 8 g of nutrient broth and 20 g of agar in 1L of water and the mixture
autoclaved for 15 minutes. Plates were incubated and observed daily till mycelium had
covered about 60-70% of the plate. Some of the mycelium was scrapped off and the media
flooded with an iodine reagent. The medium was inspected for presence of cleared zones
underneath or in advance of the mycelium to detect the presence of amylase activity.
Lipase production
Media for the determination of lipase production was prepared by combining 8 g of peptone,
0.1 g of calcium chloride monohydrate, and 20 g of agar powder in 990 ml of distilled water.
37
After autoclaving it was allowed to cool and 10 ml of autoclaved Tween 80 was added and
mixed thoroughly by swirling the flask. The mixture was then poured into plates and allowed
to set. Mycelial plugs of isolates were taken from the nutrient agar plates and were placed
singly on the media and incubated. The growing culture was observed periodically to detect
the presence of white flocculent inclusions underneath the mycelium or in advance of the
mycelium to detect lipase production.
Polyphenol Oxidase production
Isolates were first grown on a malt extract-yeast extract medium produce by combining 20 g
of malt extract, 1 g of yeast extract and 20 g of agar in 1L of distilled water and autoclaving
the mixture. Plugs of isolates from the medium was transferred into a Polyphenol Oxidase
test assay medium prepared by mixing autoclaved solutions A and B. Solution A was made
up of 5 g of gallic acid in 250 ml of distilled water while solution B was made up of 15 g of
malt extract and 20 g of agar powder in 750 ml of distilled water. Cultures were wrapped in
aluminum foil to prevent exposure to light. Plates were examined at daily intervals to
determine dark colouration as evidence of polyphenol activity
Casein hydrolysis
The medium was prepared by combining the following reagents: 1 g potassium hydrogen
phosphate, 0.5 g potassium chloride, 0.1 g calcium chloride dehydrate, 0.2 g magnesium
sulphate heptahydrate, 25 g 15% skim milk, 10 g of glucose and 12 g of agar. The reagents
were dissolved in 1L of water, dispensed into plates and allowed to set. Mycelial plugs of the
pathogen from mango and Colletotrichum acutatum were placed on the media and incubated
at 28ºC for 72 hours. The culture was inspected for the presence of a clear zone to indicate
the hydrolysis of the medium.
38
3.6.3.4 Molecular characteristics
3.6.3.4.1 Deoxyribonucleic acid (DNA) extraction

The extraction of DNA from isolates from Ghana was carried out in the Biotechnology
Laboratory of the College of Agriculture and Consumer Sciences of the University of Ghana.
DNA from isolates of the pathogen obtained from mango fruits from Mexico, Puerto Rico,
Florida and bell pepper and strawberry from North Carolina was carried out in the Plant
Pathology Laboratory of the North Carolina State University in the U.S.A. A total of 60
isolates of the pathogen from mango made up of 45 from Ghana and 5 each from Mexico.
Puerto Rico and Florida were used for the molecular studied. Also included in the molecular
studies were 2 isolates of Colletotrichum acutatum from strawberry and bell pepper (2 each)
and 2 each of the pathogen from citrus, avocado and papaya from Ghana.
DNA extraction was performed using the Sigma’s GenFlute Plant Genomic DNA Miniprep
Kit following the manufacturer’s instructions. Using a sterile loop, the mycelium of the
pathogen was scrapped from the surface of PDA and dried overnight in the laminar flow
hood. The dried mycelium was mashed in liquid nitrogen using mortar and pestle after which
the powdered mycelia were poured into a microcentrifuge tube. 350 µl of Lysis solution part
A and 50 µl of lysis solution B were added to the mycelium in the microcentrifuge tube after
which a pestle was used to gently mash the mycelia in the solution. The mixture was then
vortexed and incubated at 65°C for 10 minutes. After that, 130 µl of precipitation solution
was added to the mixture and mixed thoroughly and then placed on ice for 5 minutes after
which the sample was centrifuged at 12000 x g for 5 minutes. The supernatant was pipetted
onto a Genflute filtration column and centrifuged at 12000 X g for 1 minute after which the
filtration column was discarded and 70µl of binding solution added to the flow through liquid
39
in the collection tube. the mixture mixed thoroughly by inversion. A binding column was
then prepared by pipetting 500 µl of the Column preparation solution to a miniprep column
and centrifuging at 1200 x g for 30 sec after which the flow through liquid was discarded.
700µl of the flow through liquid in the collection tube obtained prior to the preparation of the
binding column was pipetted onto the column prepared and was centrifuged at 12000 x g for
1 minute after which the flow through liquid was discarded and the collection tube retained.
The column was returned to the collection tube and the rest of the lysate prepared prior to
column preparation was added and the solution was centrifuged at 1200 X g for 1 minute
after which the flow through liquid and collection tube were discarded while the column was
retained. The binding column was placed in a clean 2 ml collection tube after which 500 µl
of alcohol-diluted Wash Solution was added to the column and the solution centrifuged at
1200 x g for 1 minute after which the flow through liquid was discarded and the collection
tube retained. Another 500 µl of the diluted Wash Solution was added to the column and
centrifuged at 1200 x g for 3 minutes and the binding column was transferred into a fresh 2
ml collection tube. 100 µl of pre warmed (65°C) Elution Solution was added to the column
and centrifuged at 1200 x g for 1 minute. The elution was repeated and the eluate containing
the pure genomic DNA was collected and stored at -20°C till needed.
3.6.3.4.2 Agarose gel electrophoresis loading dye preparation and DNA ladder and
primer reconstitution.
Agaros gel (0.8% w/v) was prepared by weighing 0.912 g of hydrated Molecular Biology
agarose (BIORON, Germany) into a 114 ml 1 x TAE buffer. The mixture was weighed and
heated in a microwave oven and allowed to cool to about 50°C after which 2.5 µL of
Ethidium bromide (10 µg) was added and the flask swirled to ensure that the ethidium
bromide mixed thoroughly with the agarose solution. The resultant solution was poured into
40
a horizontal electrophoresis tray that has been mounted in a gel casting tray fitted with 10 or
20 teeth comb. The preparation was allowed to stand to allow the solution to polymerise and
the tray was removed from the gel caster and placed in an electrophoresis tank containing
1XTAE buffer. Fresh loading dye was prepared by mixing 0.5 g of 0.25% bromophenol blue,
0.5 g of 0.25% xylene FF and 6 ml of 30% glycerol to 20 ml of ultra-pure water. To aid
dissolution of the reagents in the water, few drops of 0.5 M EDTA were added and the
mixture agitated carefully after which the preparation was stored till needed. A 1.0 kb DNA
ladder was constituted by mixing 10µ l of stock solution, 20 µl of loading dye and 170 µl of
sterile distilled water and the preparation stored until needed. Primers were reconstituted into
100 picomoles by adding sterile distilled water and resuspending overnight. This was also
stored till needed. Quality of extracted DNA was assessed by loading 5µl of DNA into each
well and electrophoresis carried out at 45 volts for 30 minutes. Presence and quality of the
bands were noted. Where the DNA was found to be of poor quality, back up samples were
used for the extraction of the DNA.
3.6.3.4.3 Polymerase chain reactions
DNA extracted from isolates of the pathogen was used as templates in polymerase chain
reaction. The reactions were carried out both in the Biotechnology laboratory of the
University of Ghana and in the Plant pathology laboratory of the North Carolina State
University. To be able to carry out the reaction in the North Carolina State University, DNA
from the isolates in Ghana were extracted and taken to the U.S.A and kept frozen at -20ºC
prior to usage.
Species specific primer CgInt; (5’-GGGGAAGCCTCTCGCGG-3’) specific to
Colletotrichum gloeosporioides was combined with the universal primer ITS4 for the
41
identification of the isolates. These reactions were carried out both in Ghana and the U.S.A.
On the other hand, four degenerate primer pairs, ITS1/ITS4, GSF1/GSR1, GDF1/GDR1 and
Bt2a/Bt2b (Table 4) were used to amplify the intron of the glutamine synthetase gene, the
entire internal transcribed spacer region, the intron of the glyceraldehyde-3-phosphate
dehydrogenase (GPDH) gene and the second intron of the Beta tubulin gene respectively
(Phoulivong et al, 2010: Liu et al, 2010). These reactions were carried out only in the U.S.A.
The amplified regions were subsequently sequenced to obtain sufficient information for the
identification of isolates.
3.6.3.4.4. Polymerase chain reaction mixture and conditions.
PCR was performed in a total reaction volume of 50µl. The reaction mixture was made up of
34.25 µl of double distilled water, 5 µl of 10X PCR buffer (Invitrogen, Carlsbad, CA), 2.5 µl
of deoxynucleoside-triphosphate mix (2.5 mM each), 0.25 µl bovine serum albumin (20
mg/ml), 2 µl each of the forward and reverse primer, and 0.2 µl of taq polymerase, 1.8 µl of
magnesium chloride (50 mM) and 2 µl target DNA. The reaction was carried out in a Thermo
Hybaid PXE Thermal Cycler. The reaction cycles were; denaturing for 2 min at 94°C
followed by 35 cycles of 1min at 94°C, 1 min at 55°C, 2 min at 72°C and a final of 10 min at
72°C. Amplification products were separated by 1.5% w/v agarose gel stained with Ethidium
bromide or gel red alongside 1.0 kb marker at 100 V for about 1.5 hours. Bands were
observed under UV light and Polaroid photographs taken or viewed using the Gene Flash
Documentation System (Snygene Bio Imaging).
42
Table 4. Universal primers used in the study.
Name Nucleotide sequence (3’-5’) Target DNA region

GSF1 ATGGCCGAGTACATCTGG Glutamin synthetase gene intron
GSR1 GAACCGTCGAAGTTCCAC Glutamin synthetase gene intron
GDF1 GCCGTCAACGACCCCTTCATTGA Glyceradehyde-3-phosphate
dehydrogenese gene intron
GDR1 GGGTGGAGTCGTACTTGAGCATGT Glyceradehyde-3-phosphate
dehydrogenese gene intron
Bt2a GGTAACCAATCGGTGCTGCTTTC Beta tubulin gene intron
Bt2b ACCCTCAGTGTAGTGACCCTTGGC Beta tubulin gene intron
ITS1 TCCGTAGGTGAACCTGCGG Internal transcribed spacer region
ITS4 TCCTCCGCTTATTGATATGC Internal transcribed spacer region
3.6.3.4.5 Restriction enzyme digestion of the ITS region
This reaction was carried out in the Biotechnology laboratory of the Crop Science
Department, UG. Amplified products of the ITS region obtained from isolates of the
pathogen from mango in Ghana was digested using Hae III to determine differences among
strains of the pathogen from mango. Each reaction mixture was made up of 1 µl of
amplicons, 1 µl of buffer and 1µl of enzyme with sterile distilled water added to make a
volume of 25 µl. The mixture was incubated in a hot water bath at 37ºC for 2 hours after
which it was loaded in a well of a 2% agarose gel stained with ethidium bromide and
electrophoresis was carried out at 90 V for 1.5 hours. Bands were observed under UV light
and Polaroid photographs taken or viewed using the Gene Flash Documentation System
(Snygene Bio Imaging).
3.6.3.4.6 Purification and sequencing of amplified products
The PCR amplified product of the ITS region, the intron of the glutamine synthetase gene,
glyceraldehyde-3 phosphate dehydrogenase (GPDH) gene and beta tubulin gene from all
isolates selected from Ghana, Mexico, Florida and Puerto Rico were sent to ETON
43
Bioscience Laboratory at Raleigh in North Carolina for purification and sequencing. 10
picomole of each primer was used to sequence the product directly from both directions. In
addition, the primer pair GSRG/GSRD (GSRD; 3’- CCTGTCGGCCAGCCAGCT-5’) and
(;GSRG 3’-GAACCGTCGAAGTTCCAC-5’) (Liu et al, 2010) was also used to sequence the
amplified product of the glutamine synthetase gene. Sequences were entered into the
BIOEDIT software and edited and consensus strands generated.
3.6.3.4.7 Analysis of the glutamine synthetase gene sequence
The short stretch of the nucleotide sequence chain at the beginning of the entire sequences of
the glutamine synthetase gene intron obtained from isolates in this work were aligned and
compared to sequences of C. acuatum downloaded from the European Molecular Biological
Laboratory (EMBL) Nucleotide Sequence Database and aligned using clustalW. The
presence of the poly ‘T’ chains at the beginning of the intron was noted to aid in
characterizing the isolates.
3.6.3.4.8 Analysis of the sequences of the ITS region
The ITS sequences of the 45 isolates from mango in Ghana were first used in a multiple
sequence comparisons using clustalW and isolates were grouped based on their sequence
homology. Isolates that showed sequence homology of 100% among themselves were placed
in the same group and 1 representative isolate from each group was selected. The same
method was used to select representative isolates from Mexico, Florida and Puerto Rico. The
ITS region of these isolates were compared to ITS sequences of different Colletotrichum
species that were retrieved from European Molecular Biological Laboratory (EMBL)
Nucleotide Sequence Database. Sequence comparisons were predominantly based on the
ITS1 region. Sequences of selected isolates (Table 5) were aligned using clustalW which is
44
included in the MEGA software package and optimized manually to ensure positional
homology. Gaps were treated as missing data. The multiple sequence alignment obtained was
used in a phylogenetic analysis using MEGA4 (Tamura et al, 2007). The entire sequences of
the ITS region of some selected isolates were used in a pairwise sequence comparison to
determine whether it supports the results of the ITS1 region.
3.6.3.4.9 Comparison of ITS1 region between isolates from mango and other fruit crops
Sequences of the ITS1 region of isolates obtained from mango and those from papaya,
avocado and citrus from Ghana were aligned using the ClustalW and the type of nucleotides
found at the 73rd and 133rd position beginning from the first nucleotide position was used to
separate the mango isolates into the different types based on their original host.
3.6.3.4.10 Genealogical Concordance of Phylogenetic Species Recognition
The sequences of the internal transcribed spacer region (ITS), beta-tubulin gene intron and
the intron of the glyceraldehyde-3-phosphate dehydrogenase gene of the isolates from mango
in Ghana were subjected to multiple sequence analysis using clustalW to enable grouping of
the isolates such that isolates with same sequences across the three gene regions (100%
homology) were placed in one group. One isolate was then selected from each of the groups
and used for comparison with the sequences of the other isolates from the C. gloeosporioides
complex that have been well identified based on studies of several gene regions of those
isolates. Also included in the study were representative isolates of the pathogen from
Mexico, Florida and Puerto Rico which were also selected using the same method applied for
the selection of representative isolates from Ghana. In all, sequences of 20 isolates were used
in the study (Table 6). These were made up of the three representative isolates from Ghana,
one each from Florida, Mexico and Puerto Rico (which were obtained in this study) and
45
fourteen (14) retrieved from European Molecular Biological Laboratory (EMBL) Nucleotide
Sequence Database. The sequences of the different gene regions of the selected were aligned
separately using clustalW which is included in the MEGA software package and optimized
manually to ensure positional homology. Gaps were treated as missing data. The multiple
sequence alignments obtained were individually used in a phylogenetic analysis using
MEGA4 (Tamura et al, 2007). The points at which the different gene trees showed
concordance was identified as the speciation point and the phylogenetic species were
identified.
3.6.3.4.11 Phylogenetic analysis
The MEGA4 software was used to construct the phylograms. The Maximum Parsimony
(MP) and the Neighbor Joining (NJ) were selected to construct the phylograms (gene trees)
for each multiple sequence alignment generated. The MP tree was obtained using the Close-
Neighbor-Interchange algorithm (Nei and Kumar, 2000) with search level 3 (Felsenstein,
1985, Nei and Kumar, 2000) in which the initial trees were obtained with the random
addition of sequences (10 replicates). All positions containing gaps and missing data were
eliminated from the data set (complete deletion option). Clade stability of the tree resulting
from maximum parsimony analysis was assessed by bootstrap analysis with 1000 replicates
(Felsenstein, 1985). The Consistency Index (CI), Retention Index (RI) and Composite Index
(CI) were all generated by the software to evaluate the stability of the tree.
The Neighbor-Joining method (Saitou and Nei, 1987) was also used to infer the evolutionary
history. The percentage of replicate trees in which the associated taxa clustered together was
evaluated with a bootstrap analysis with 1000 replicates. The tree was drawn to scale, with
branch lengths in the same units as those of the evolutionary distances used to infer the
46
phylogenetic tree. The evolutionary distances were computed using the Maximum Composite
Likelihood method (Tamura et al, 2004) and are in the units of the number of base
substitutions per site. All positions containing gaps and missing data were eliminated from
the dataset (Complete deletion option).
3.6.3.4.12 Basic Local Alignment Search (BLAST)
The sequences of the entire ITS region, the beta tubulin gene intron and the glyceraldehyde-
3-phosphate dehydrogenase gene of the isolates from Ghana were used in a BLAST
(www.ncbi.nlm.nih.gov) search and the most identical isolate was recorded to further aid in
the identification of Colletotrichum isolates. The expected value (E-value) which indicates
the probability of finding a correct match by chance was recorded together with the
percentage similarity. Hits (sequences in the data base that matched the query or yet to be
identified sequence) with E values less than 10-4 is considered very significant.
47
Table 5. Isolates used in the phylogenetic study of the ITS1 region and their molecular
identification and accession numbers.
Isolate code Molecular identification EMBL accession number

MAN-GH10 C. gloeosporioides -
CBS 95397 C. gloeosporioides AF090855
SAS 4 C. gloeosporioides Z32953
IMI 319406 C. kahawae Z32983
63-1 C. fragariae Z32943
UQ C. musae Z32997
IMI 489 C. musae Z32991
102 C. graminicola Z32974
288810 C. dematium Z32938
COC-LC C. coccodes Z32931
CLD2 C. lindemuthianum Z32987
172.59 C. orbiculare Z33379
ACU-397 C. acutatum Z32915
ACU-1 C.acutatum -
ACU-2 C. acutatum -
M1/6 C. gloeosporioides Z32968
FOXYRRNA Fusarium oxysporum X94173
48
Table 6. Isolates used in the GCPSR study for the identification of Colletotrichum
species and their GeneBank accession numbers
GeneBank accession number
Isolate Strain
number Identification
Species GPDH ITS TUB2
1 BLI13 C. asianum FJ972571 FJ972605 FJ907434

2 BMLI14 C. asianum FJ972573 FJ972615 FJ907436
5 BPDI4 C. asianum FJ972576 FJ972612 FJ907439
3 BMLI15 C. siamense FJ972574 FJ972614 FJ907437
4 BPDI2 C. siamense FJ972575 FJ972613 FJ907438
6 CBS95397 C. gloeosporioides FJ972582 FJ972609 FJ907445
7 CORCG4 C. gloeosporioides HM034806 HM034808 HM034810
8 CORCG5 C. gloeosporioides HM034807 HM034809 HM034811
9 CBS217.64 C. trichellum GU228204 GU227812 GU228107
10 IMI319418 C. kahawae FJ972583 FJ972608 FJ907446
11 IMI363578 C. kahawae FJ972584 FJ972607 FJ907447
12 BPDI12 C. fructicola HM038272 HM038356 HM038302
13 BPDI18 C. fructicola HM038320 HM038357 HM038298
14 BPDI16 C. fructicola
15 MAN-GH10 C. sp. - - -
16 MAN-GH12 C. sp. - - -
17 MAN-GH-21 C. asianum - - -
18 MAN-PR1 C. sp. - - -
19 MAN-MX1 C. asianum - - -
20 MAN-FL1 C. sp. - - -
3.7 Pathogenicity tests
3.7.1 Evaluation of methods of artificial inoculation of mango
Two methods were evaluated for suitability for pathogenicity tests. The first method was the
inoculation of intact fruit surfaces using spore suspension while the second was the
inoculation of fruits through wounds using mycelia of isolates.
In the first method, spore suspension of each isolate was prepared by crushing acervuli in
sterile distilled water and the spore concentration adjusted to 1 x 107 with the aid of
haemocytometer. Clean, healthy and physiologically mature fruits of Haden cultivar were
49
inoculated with the spore suspension by placing 15 ml of the suspension on filter paper discs
placed on the fruit surface. The filter paper discs were used to prevent run-off of the spore
suspension on the fruit surface. Fruits were then placed in air tight containers lined with
paper towels and incubated at a temperature of 27ºC. Each fruit received as many isolates as
it could contain based on the fruit size and each isolates was used to inoculate at least three
fruits. Water was similarly used as a control. Seven (7) days after incubation, the fruits were
removed from incubation and inspected for the development of anthracnose symptoms.
In the second method selected physiologically mature fruits were scrubbed with soapy, rinsed
with tap water and were air dried. Using a 9 mm cockborer, a core of the fruit surface was
removed but not discarded. The hole was filled with 9 mm disc of each isolate after which
the fruit core was replaced. The wound around the core was either sealed with paraffin wax
or with a cellotape. PDA controle were also maintained. The fruits were placed in trays and
kept at ambient temperature and humidity, observed daily till the development of symptoms.
Symptom development was an indication of pathogenicity of the isolate used.
3.7.2 Evaluation of disease severity induced by isolates on mango fruits
Hundred monoconidial isolates of the fungus was used to inoculate fruits of 7 different
cultivars of the crop made up of, Haden, Irwin, Julie, Keitt, Kent, Palmer and Tommy
Atkinson,. Each isolate was used to inoculate three fruits of each cultivar and the method of
wounding fruits prior to inoculation as described above was used for the inoculation. Fruits
were incubated at 27°C and RH of 65% for 7 days after which the diameter of the disease
lesion was measured at two points and recorded as the disease severity. Disease severity
induced by isolates from the same district was bulked together and the data subjected to the
50
analysis of variance. Treatment and means were separated using Least Significant Difference
test (P=0.05)
3.7.3 Cross infection studies with isolates
3.7.3.1 Cross-infection studies using whole fruits.
One hundred isolates of the pathogen were inoculated into fruits of mango, avocado, papaya
and citrus. Depending on the size of each fruit, three or more isolates were used. Fresh plugs
of the isolates were plated on PDA for 7 days after which some acervuli were extracted and
used to produce a spore suspension of each isolate of concentration 1X107 spores/ml. Fruits
were harvested at maturity, washed and surface sterilized using 10% dilution of household
bleach and the chemical washed off with sterile distilled water. 15 ml of the spore suspension
of each isolate was placed on filter paper discs placed on the fruit surface and air dried after
which the fruits were placed in air-tight containers lined with paper towels and incubated at
27ºC. Each isolate was used to inoculate three spots of each fruit while sterile distilled water
was used as a control. 7 days after incubation, the fruits were retrieved and the filter paper
discs were removed and fruits were inspected for the development of symptoms.
3.7.3.2 Cross-infection studies using artificially wounded fruits
The experiment was repeated with a variation in the inoculation method. Fruits selected for
inoculation were wounded using a cockborer as done in section 3.6.1. Plugs of 7 day old
culture of each of the 100 isolates of the pathogen were used for the inoculation studies. To
compare the behavior of the isolates from mango to those of the isolates obtained from other
fruit crops, two isolates each collected from citrus, avocado and papaya were included in the
study. Each isolate was inoculated into 6 different fruits of each type and each fruit was
51
inoculated 3 or more isolates depending on its size. After inoculation, the fruits were placed
in cardboard boxes and incubated on benches under ambient conditions in the laboratory.
Seven days after inoculation fruits were observed for development of anthracnose symptoms.
The infectivity of isolates was designated - =Avirulent (0/6), + weakly virulent (1-3/6), ++
highly virulent (4-6/6), where numerator is number of fruits with lesion and denominator is
number of fruits inoculated (Hayden et al, 1994). The results were used to place isolates of
mango into different infectivity groups based on which the mango-biotype of the pathogen
were distinguished from the other forms of the pathogen.
To confirm wounds as necessary for infection to take place on papaya and avocado, a flame-
sterilised inoculation pin was used to punch holes on surface sterilized papaya fruits. A spore
suspension of one of the isolates from papaya and one from mango were selected and 15 ml
of their spore suspensions separately placed on the wounds created on the fruit. Sterile
distilled water was also placed on other wounds to serve as control. The fruits were air-dried
and incubated on benches in the laboratory at a temperature of 27ºC and humidity of 65%.
Inoculated fruits were observed daily till appearance of disease symptoms.
3.8. Studies on the secondary metabolites of isolates
3.8.1 Extraction of secondary metabolites
Nine refrigerated isolates of the pathogen, 4 of which were identified previously as mango
bio-type and 5 identified as strains from other fruit crops were selected at random and plugs
of the isolates sub-cultured on PDA. After 7 days, plugs of the isolates were taken from the
advancing margin of the mycelium and sub-cultured in freshly produced potato dextrose
broth. The broth was prepared by slicing 20 g of Irish potato which was boiled and squeezed
52
through cheese cloth. The volume was made up with sterile distilled water to 1L. Volumes of
100 ml of the broth were dispensed into 250 ml conical flasks and autoclaved and allowed to
cool. Three discs of mycelium (5 mm in diameter) were obtained from the advancing edge of
colonies of each isolate and placed separately into each of the 250 ml conical flask
containing the 100 ml broth. The cultures were incubated at 27ºC under in alternating 12
hour photoperiod for 14 days during which period the flasks were hand shaken twice daily.
Uninoculated broth served as control. The metabolites were extracted using ethyl acetate by
adding equal volume of the extractant (100 ml) to each culture. The mixture was allowed to
stand overnight after which the organic solvent phase was carefully pipette out ensuring that
the aqueous phase was left in the broth. The extraction process was repeated once and the
two organic solvents were pooled together and dried overnight in oven at 40ºC. The slurry
obtained was dissolved in methanol and subjected to analysis by the thin layer
chromatography (TLC) and determination of toxicity using detached leaf bio-assay. The
methods were as follows.
3.8.2Thin layer chromatography
The secondary metabolite profiles of isolates were determined using silica gel plates. Three
millilitres of the organic solvent extract was pipetted into a glass vial and dried after which
100 ml of methanol was used to reconstitute the dried extract and used for the TLC analysis.
The tank for the analysis was equilibrated with a mixture of ethyl acetate, acetonitrile and
petroleum ether in the ration 7:2:1. The silica gel (Merck, Kieselgel 60 F254) of dimensions
10 cm by 5 cm was spotted with 5 ml of each of the reconstituted methanol extract and
placed in the tank and more of the equilibrating liquid was added. After separation of
products, the gel plate was removed dried briefly and pictures taken at UV 254 nm and 365
53
nm. The dried plate was then stained with an anisaldehyde based reagent made up of ethanol
(13 ml), acetic acid (1.5 ml) and sulphuric acid (3.7 ml) after which it was dried briefly and
photographs taken at UV 365 nm.
3.8.3 Toxicity of secondary metabolites
The ability of the secondary metabolites to cause necrosis was determined using a detached
leaf bio-assay. Young and expanding leaves of the Keitt variety of mango were harvested,
washed and surface sterilized using 10% dilution of household bleach. The abaxial side of
each leaf was inoculated with a spot of the methanol reconstituted extract and a pin was used
to puncture the leaf at the point where the spot was dropped. Each leaf was inoculated at 4
points on one side while the other side was inoculated with methanol only to serve as control.
All inoculated leaves were air-dried to allow the methanol to evaporate after which they were
placed in air-tight containers lined with moistened paper towels. They were incubated at the
ambient temperature and humidity of the laboratory and inspected daily for the development
of necrotic lesions. The toxicity of the metabolites was also determined on leaves of papaya,
avocado and cassava to investigate their cross-infection potential on other crops.
3.9. Fruit juice quality analysis
3.9.1 Selection of fruits and juice extraction
One hundred physiologically matured fruits each of the sunset, Irwin and a local variety of
the mango fruits were harvested in March, 2013, washed with soap and rinsed three times
with water. The fruits were placed in a plastic basket and covered with sack. The fruits were
then incubated at 27ºC an RH of 65% for 20 days after which the fruits were retrieved and
separated into five groups based on the percentage of the mango anthracnose disease lesion
54
using the scale of 0-5 as stated in table 3. Five fruits of each group were then selected at
random and used for the assessment of the nutrient quality of the fruits.
The pericarp (skin) of each fruit was split opened using a scalpel and the whole skin was
removed and discarded. The whole pulp was detached from the seed and the juice was
squeezed out using a cheese cloth and the pulp discarded. The filtrate was then passed
through cheese cloth at two more times to obtain a fine filtrate after which the juice was
subjected to total soluble solids (TSS) and titratable acidity (TTA) content determination.
The five fruits represented five replicates of each treatment and were analysed separately.
3.9.2 Total Soluble Solids determination
Brix of the juice was determined using a hand held refractometer with a sucrose scale
calibrated at 20ºC. The procedure was repeated three times for each sample and in between
readings the refractometer was cleaned and standardized using sterile distilled water.
3.9.3 Titratable acidity determination.
Titratable acidity (TA) was determined with 10 ml aliquot of each of the fruit juice used for
the determination of the total soluble solids. The 10 ml aliquot of the juice was titrated in a
250 ml Erlemeyer flask against 0.1N sodium hydroxide solution to an end point using
phenolphthalein as an indicator. Each titration was repeated three times. The volume of 0.1N
sodium hydroxide used was recorded and used to calculate percentage TA values using the
formulae:
TA= (Volume of NaOH) x N (NaOH) x 0.064*) X 100

Volume of titrated juice
*Milliequivalent factor of citric acid
N= Normality
55
3.9.4 TSS/TTA
The ratio of total soluble solids: titratable acidity was calculated for each fruit juice sample
and used as a measure of the fruit quality.
3.10 Control of mango anthracnose disease
3.10.1 Selection and in vitro evaluation of fungicides
Seven fungicides (Table 7) made up of those which were found to be in use by farmers
during the period of the study and those being used in other mango growing countries were
obtained either from farmers or from the chemical companies and evaluated in-vitro to
determine their efficacy against isolates of Colletotrichum gloeosporioides obtained from
mango in Ghana. The required amount of each fungicide was measured and mixed
thoroughly with 100 ml of autoclaved molten PDA (39 g/L) and dispensed into three plates
and allowed to set. Plugs of each isolate was taken from a 7 day old culture and placed in the
middle of the plates with three plates containing the same fungicide-PDA mix representing
three replications of each isolate. Control plates contained PDA without a fungicide. The
Petri dishes were placed in polythene bags and incubated in the laboratory at temperature of
23-25ºC and relative humidity of 60-65%. Radial mycelial growths of the colonies were
measured daily by measuring the radius of the colonies from the reversed side of the petri
dishes with a ruler, starting from the third day when significant growth was recorded on the
control plates to the 8th day when the growth in the control had covered the entire plate.
Percent reduction in radial growth over control was calculated by the following
formula:I=((C-T)/C) x 100 where, I= percent reduction in growth of test fungi, C= radial
56
growth (mm) in control and T=radial growth (mm) in treatment. A fungicide was considered
effective when it was able to suppress the growth of the pathogen on Petri plates.
Table 7. Fungicides evaluated for effect on the radial mycelial growth and incidence
and severity of mango anthracnose disease in Ghana
Product name Active ingredient Nature Use Application
rate
Bendazim Carbendazim Systemic Preharvest 2 g/L
Funguran Copper hydroxide Contact Preharvest 2 g/L
Ivory Mancozeb Contact Preharvest 4 g/L
Agriette Mancozeb+Fosetyl-Al Contact/Systemic Preharvest 4 g/L
Sundomil Mancozeb+Metalaxyl Contact Preharvest 4 g/L
Top Cop Copper+Flowable Contact Preharvest 30 ml/L
sulphur
Prochloraz Prochloraz Systemic Postharvest 1.5 ml/L
Bendazim+Ivory Carbendazim+ Systemic/Contact Preharvest 1 g/L+2 g/L
Mancozeb
Funguran+Ivory Copper hydroxide Contact Preharvest 1 g/L+2 g/L
+Mancozeb
No Fungicide - - - -
3.10.2 Evaluation of efficacy of fungicides against the disease on the field
The field trial was carried out in a mango orchard in the Yilo Krobo district in the minor
season of 2010 and again in the major season of 2011. The trees selected for the trial were
pruned to ensure the removal of excess foliage and all plant debris were removed from the
field. This was carried out immediately the previous seasons harvest was over in both
seasons’ trials. Early pruning of trees was necessary to ensure that the trees had enough time
57
to recover from the shock before flower initiation. Flower initiation was carried out by
dissolving 16.6 g of potassium nitrate in water and spraying the mixture on the trees. This
was done at bi-weekly intervals for two consecutive times. After flower initiation, trees with
uniform flowering were selected for the trial. Nine treatments made up of the six fungicides
and two combinations of different fungicides and a non treatment control were arranged in a
randomized complete block design with four replicates. The treatments were applied with a
calibrated solo mistblower with a volume rate of application of 200L/ha. Treatments were
applied at bi-weekly intervals commencing on 15th January in the major season and 10th
September in the minor season. In each season, the applications continued until two weeks
before harvesting. In all there were a total of 8 treatments per season. Trees were protected
against insects with cypermethrin at a rate of 4 ml/L. At approximately 114 days after
flowering, fruits were harvested and 100 fruits per tree were selected at random and used for
the assessment of disease incidence and severity after which all fruits from each replicate
were graded into exportable fruits (without anthracnose lesions), non-exportable fruits (with
disease lesions) and those that cannot be utilised in any way (discarded fruits).
3.10.3 Post harvest treatments
Eighty clean and healthy fruits were selected at random from each of the nine (9) treatments
evaluated on the field and were divided into four lots of 20 fruits each and each lot was
subjected to one of the following postharvest dips: (1) prochloraz solution at ambient
temperature of 25ºC; (2) prochloraz solution at 53ºC; (3) hot water at 55ºC and water at
ambient temperature to serve as control. Fruits were dipped in treatments for 10 minutes after
which they were air-dried and packed tightly in cardboard boxes. Fruits were then stored
between 25-28C and RH of 65% using a complete randomized block design with four
58
replicates of 5 fruits per replicate. At 15 days in storage the disease incidence was assessed
by expressing the number of fruits showing disease symptoms as a percentage of the number
of fruits incubated and the percentage of the surface of fruits diseased was rated visually
using a scale of 0-5 where 0=no lesion, 1=up to 5% of fruit area affected, 2=6-10% of fruit
area affected, 3=between 11 and 20% of fruit area covered, 4=21-50% of fruit area affected
and 5=more than 50% of the fruit surface area covered.
3.11 Data analysis

Analysis of variance was performed on arcsine transformed data of disease incidence and
severity and percentage of fruits infected. Also the percentage of fruits that dropped or are
infected, clean fruits from commercial farm for assessment for yield loss assessment and
percentage inhibition of mycelial growth of the Colletotrichum species were all arcsine
transformed before before analysis. ANOVA was also performed directly on the diameter of
symptoms induced on fruits and on the total soluble solids, total titratable acidity and the
ratio. The Genstat software was used for all analyses. When significant differences were
obtained among means, they were separated using L.S.D at 5%.
59
CHAPTER FOUR
4.0 RESULTS
4.1 Nature of mango anthracnose disease.
4.1.1 Types of disease symptoms
Two types of disease symptoms were found on fruits hanging on trees. The first type
consisted of dark-brown sunken spots that ranged from pin point sizes to large chlorotic areas
on the diseased fruit surface (Plate 1A). In some instances, the dark brown spots were
accompanied by bright yellow acervuli of the causal agent of the disease. This disease
symptom was found to occur on the fruit peduncle resulting in dead and dried peduncles
which eventually break leading fruit drop. The second type of the symptom was made up of
slightly raised spots which in most cases coalesce together to make the fruit surface rough in
a characteristic ‘alligator skin’ effect (Plate 1B). Surfaces of such fruits appear cracked and
rough to touch. When incubated for some time, the characteristic anthracnose dark-brown
sunken lesions emanate from the raised spots, confirming the symptom as another form of
mango anthracnose disease symptom. Compared to the dark brown sunken lesion, this type
of symptom was restricted to the fruits and hence was not found as form of the disease that
could lead to fruit drop.
4.1.2 Penetration of fruit pericarp by disease lesion.
The development of disease lesions on ripening fruits showed that disease lesions initially
develop as a single spot which subsequently expand to cover a large portion of the fruit
surface (Plate 1C) or different spots could coalesce to cover almost the entire fruit surface.
The individual spots were found to be restricted to the fruit pericarp when they were at their
60
initial stages. As the lesions continue to expand, it penetrated the inner tissues resulting in
dark rotten patches under the pericarp (Plate 1D). In very severe cases, the lesion developed
into the inner tissues and had infected the seed as well. Some of the heavily diseased fruits
had the acervuli of the pathogen on the lesions. It was observed that the rate at which the
spots had covered the fruit surface did not depict the age of the lesion. In some cases, fruits
with the entire surface covered by the disease lesion were fit to be consumed as the inner
mesocarp tissue was not affected.
61
A B
C D
Plate 1. Symptoms of anthracnose on mango fruits in the field. A=Dark lesion

concentrated around the pedicel of a young fruit (3 weeks old) and accompanied by mycelia
and acervuli (arrowed) of the pathogen, B=slightly raised dark spots (arrowed) that are rough
to touch, C= dark sunken lesions on a ripe fruit, D=a ripe fruit with the pericarp removed to
show the penetration of the dark lesions of the anthracnose disease on the fruit pulp. (Mg X
0.7)
62
4.1.3 Diseases with similar symptoms as mango anthracnose
Two other diseases with symptoms similar to that of mango anthracnose were encountered
and these could be easily confused with the mango anthracnose disease. At early fruit
developmental stage one of these symptoms, characterized by black greasy spots that were
not sunken (Plate 2A) was found. Usually when such fruits are placed in a high humid
chamber, the spots spread rapidly, coalesce and may cover the entire fruit surface within a
day or two. The symptom was also found on leaves and was similar to what has been
associated with bacterial black spot.
The second disease was characterized by a dark brown lesion (Plate 2B) which initially was
colourless lesion. This lesion in most cases originated from the stem end portion of the
diseased fruits and could cover the whole fruit while the fruit was still hanging on the tree.
Just like the mango anthracnose disease, the symptoms developed on clean healthy fruits
while in storage. When the disease develops on the same fruit with the anthracnose lesion it
masks the anthracnose symptoms. In such cases, it can lead to wrong diagnosis of the
anthracnose disease.
63
A B
Plate 2. Symptoms of other diseases resembling the mango anthracnose disease
symptom.
A=Greasy spot similar to symptoms of Bacterial black spot caused by Xanthomonas sp.;
B=dark lesions emanating from the stem end portion similar to stem end rot symptoms
caused by Lasiodiploidia theobromae. (Mg x 0.7).
64
4.1.4 Factors promoting symptom expression on the field
Certain factors were observed to be contributing to the expression of the more common dark
brown sunken disease lesions on the developing fruits. Whole fruits without any form of
injury were found to express the disease symptoms only when fruits were between 1-3 weeks
old or were left hanging on the trees after maturity to ripen. Fruits between the ages of 22 to
120 days after fruit set were hardly found with disease symptoms when the fruits were not
bruised. On the other hand, fruits older than 22 days were found with the disease symptom
when the fruit surface had wounds. In such cases, the disease lesion was found to be
concentrated around the point of injury. In some cases, whole fruits which were matured
were found with the disease symptoms after the field was treated with a paraquat herbicide
spray to clear the field before harvesting. Injury caused by the paraquat spray which drifted
on to the fruit surface was considered a major factor in the stimulation of latent infection.
This was because such diseased fruits were found only at the portions of the farms where the
herbicide was sprayed. Secondly only the low hanging fruits, close to the weeds which were
sprayed with the paraquat were showing the disease symptom. In general, fruits of all ages
could be induced by paraquat to express the dark sunken lesion. The ‘alligator skin’ disease
lesion was found on fruits of all ages.
4.2 Evaluation of leaves, fruits and dried panicles as important sources of inoculum
Mango leaves collected from the different districts of Ghana which were without symptoms
of the mango anthracnose disease were found to develop large masses of acervuli on their
surfaceS particularly in the middle portion along the mid-rib (Plate 3A) after incubation.
Similarly, the mummified fruits (Plate 3B) and dried panicles (Plate 3C) were also found
with the signs of the pathogen developing on their surface after incubation. Since these
65
fruiting bodies contained the infective propagules of the pathogen, the leaves, panicles and
fruits were considered as important sources of inoculum in the mango orchard. There was a
significant difference (p<0.05) in percentage of leaves developing the acervuli on their
surface among the leaves from the different districts. The highest percentage of 77% was
obtained on leaves from Kumasi Metro while the lowest of 14% was obtained on leaves from
Savelungu Nanton district (Table 8). The percentage recorded on leaves from Hohoe,
Kintampo, Berekum, Savelugu Nanton and Tolon Kumbugu were not significantly different
(p>0.05). The percentage of fruits showing the acervuli after incubation also varied
significantly among the different districts (p<0.05). The highest percentage of 61% was
recorded on fruits from Kumasi Metro while the lowest of 8% was recorded on fruits from
Tolon Kumbugu (Table 8). The percentage recorded on fruits from Hohoe, Kintampo,
Berekum, Savelugu Nanton and Tolon Kumbugu were not significantly different (p>0.05)
(Table 8). The percentage of panicles developing the acervuli was highest in the Kumasi
Metro and Kwaebibrem districts while it was lowest in the Savelugu/Nanton and
Tolon/Kumbugu districts (Table 8). However, the difference was no significantly different
(p>0.05). In general, more leaves (45.2%) were found developing the acervuli of the
pathogen followed by fruit (28.6%) and the dried panicles (13.9%) from the various districts
(Table 8)..
66
A B
Plate 3. Presence of acervuli on some selected parts of the mango tree.
A= a leaf with a high concentration of the acervuli (arrowed) near the mid-rib, B=a piece of
a dried panicle showing the acervuli (arrowed), C=mummified fruits with acervuli (arrowed)
on almost the entire fruit surface. (Mg. x 0.7).
67
Table 8. occurrence of acervuli of Colletotrichum gloeosporioides in the indicated plant

parts in mango farms in Ghana. (Figures are in percentages)
Districts Plant parts
Leaves Fruits Panicles
Ga West 60.0b 37.0b 25.0a
b b
Dangbe West 61.0 33.0 18.0a
Manya Krobo 59.0b 34.0b 18.0a
b b
Yilo Krobo 65.0 36.0 15.0a
Kwaebibrem 75.0bcd 59.0c 22.0a
bcd c
Kumasi Metro 77.0 61.0 20.0a
N/Tongu 66.0b 29.0b 16.0a
a a
Hohoe 16.0 12.0 9.0a
Berekum 18.0a 11.0a 10.0a
a a
Kintampo 17.0 13.0 6.0a
S/Nanton 14.0a 10.0b 5.0a
a a
T/Kumbugu 14.0 8.0 3.0a
Mean 45.2 28.6 13.9
Means followed by the same alphabet in a column are not significantly different (p>0.05).
68
4.3 Disease control practices being implemented on mango orchards in Ghana
Different types of control practices were found to be in place in the different mango farms in
Ghana. The type of control measure practised in a particular farm depended on many factors
with the major factor being the targeted market and the common practice being applied in a
localized area. For example, farms producing mainly for the local market did not carry out
any control measure. Most of these farms were unattended to and the farmers harvest and sell
whatever fruits they obtain during the season on the local market. In contrast, farms targeting
the conventional fresh fruit market practice regular pruning with heavy fungicide
applications. Very few farms (9%) were found during the studies that were targeting the
international organic fresh fruit markets. The control practice being employed by these farms
was the regular pruning of trees with very little or no application of copper fungicides. In
other farms, due to the very short inter-seasonal period, farmers practice very little pruning
with over reliance on fungicides. In such farm, healthy fruits produced without blemishes
were sold to middle men who export them and the blemished fruits were sold on the local
market.
The responses obtained from farmers with regard to the type of control measures being
practiced on the different farms are represented in Fig. 3. Majority of farmers (70%)
practiced slight pruning and apply fungicides throughout the growing season; 14% of farmers
do not practice any control measure at all; 9% engage in heavy pruning with no or little
application of fungicides while the remaining 7% practice heavy pruning followed by
application of fungicides throughout the growing season.
69
No pruning , no fungicide
7%
14% application
Heavy pruning and

9% occasional fungicide
application
Slight pruning and heavy
fungicide application
Heavy pruning and heavy

70%
fungicide application
Figure 3. A pie chart showing the percentage of farms practising different types of
disease control measures
70
4.4 Incidence and severity of mango anthracnose disease in Ghana
4.4.1 Incidence and severity of mango anthracnose disease in the Greater Accra,
Eastern, Ashanti, Volta, Brong Ahafo and the Northern regions of Ghana.
The survey was carried out in six out of the ten administrative regions of Ghana comprising
of the Greater Accra, Eastern, Ashanti, Volta, Brong Ahafo and the Northern regions (Fig. 4).
The disease incidence in 2010 ranged from 0% in the Brong Ahafo and Northern regions to
100% in the Ashanti region. The disease incidence in the Eastern and Greater Accra regions
were lower than what was recorded in the Ashanti region and ranged between 27% in the
Volta region to 58% in the Greater Accra region. Similarly, in 2011, disease incidence was
0% in Brong Ahafo and Northern regions while it was 100% in the Ashanti region. The
lowest disease incidence of 27% was recorded in the Volta region while the Greater Accra
and Eastern regions recorded almost the same disease incidence (Fig. 4)
The percentage of fruits that showed visible disease symptoms during the 2010 survey
ranged from 0% in the Brong Ahafo and Northern regions to 100% in the Ashanti region.
The percentage of diseased fruits in Eastern region which was approximately 16% was
slightly higher than what was recorded in the Greater Accra region (12.3%) but was higher
than what was recorded in the Volta region which was approximately 5%. In 2011, the
percentage of diseased fruits ranged from 0% in Brong Ahafo and Northern regions to 100%
in the Ashanti region. The percentage of nearly 6% which was recorded in the Volta region
was slightly lower than the 13.6 and 14.7% recorded in the Greater Accra and Eastern
regions respectively (Fig. 4).
71
Disease severity index in 2010 ranged from 0 in the Brong Ahafo and Northern regions to 3.8
in the Ashanti region. The severity index in the Volta, Eastern and Greater Accra regions was
almost the same ranging from 0.2 to 0.6 with the highest being recorded in the Eastern
region. In 2011, the disease severity index ranged from 0 in the Brong Ahafo and Northern
regions to 3.8 in the Ashanti region. The severity index in the Greater Accra, Eastern and
Volta regions ranged between 0.2 and 0.6 (Fig. 4).
72
Fig. 4. A map of Ghana showing the disease incidence nd severity and percentage of
diseased fruits from some selected regions in 2010 and 2011
73
4.4.2 Incidence and severity of mango anthracnose disease in the coastal savanna, semi
deciduous, transitional and Guinea savanna agro-ecological zones of Ghana.
The mango farms surveyed were located in four agro-ecological zones. These were coastal
savanna, semi-deciduous forest, transitional and Guinea savanna agro-ecological zones (Fig.
5).
The disease incidence among the different agro-ecological zones recorded in 2010 ranged
from 0 % in the Transitional and Guinea savanna zones to 57 % in the coastal savanna zone.
The disease incidence in the semi-deciduous forest was lower than in the coastal savanna but
higher than the incidence in the transitional zone and the Guinea savanna, where the disease
incidence was 0%. A similar trend was recorded in 2011 with the highest disease incidence
being recorded in the coastal savanna followed by the semi-deciduous forest. There was no
disease recorded in both the transitional and Guinea savanna agro-ecological zones (Fig. 5).
In 2010, the percentage of number of fruits showing visible disease symptoms ranged from 0
in the Transitional zone and Interior savanna to 25% in the humid forest. The percentage of
diseased fruits in the coastal savanna which was approximately13% was lower than what was
recorded in the semi-deciduous forest but higher than what was recorded in the Transitional
zone and the Guinea savanna. The percentage of diseased fruits from the different agro-
ecological zones in 2011 was same as what was recorded in the 2010 survey (Fig. 5).
Disease severity index also ranged from 0 to 0.9 among the different agro-ecological zones in
2010 with the lowest of 0 being recorded in both the Guinea savanna and the transitional
zone while the highest of 0.9 was recorded in the semi-deciduous forest. Similar results were
obtained in 2011 with the semi-deciduous forest recording the highest disease severity with
an index of 0.9 followed by the coastal savanna with a severity index of 0.5 (Fig. 5).
74
of mango anthracnose disease in mango farms from some selected agro-ecological zones
of Ghana in 2010 and 2011.
75
4.4.3 Incidence and severity of mango anthracnose disease among some selected
administrative districts of Ghana
The farms used for the field survey were found in 12 different districts of Ghana. These were
the Ga West, Dangbe West, Yilo Krobo, Manya Krobo, North Tongu, Hohoe Municipal,
Kwaebibrem, Kumasi Metro, Berekum, Kintampo, Tolon Kumbungu and Savelungu Nanton
Districts (Fig. 7). The rainfall, humidity and temperature figures of the districts obtained
from the Ghana Meteorological Agency are indicated in Fig. 6.
Disease incidence among the districts ranged from 0 % to 100 % in 2010 (Fig. 7). The
highest incidence of 100 % was recorded in the Kwaebibrem and Kumasi while the lowest of
0 % was recorded in the Hohoe, Berekum, Kintampo, Tolon/Kumbungu and Savelugu
Nanton districts. Disease incidence in the Ga West, Dangbe West, Yilo krobo, Manya Krobo
and North Tongu ranged from 42 % to approximately 70 % (Fig. 7). Among these districts
the highest was recorded in the Dangbe West while the lowest was recorded in the Manya
Krobo district. Similarly, the disease incidence in 2011 ranged from 0 % in the Hohoe,
Berekum, Kintampo, Tolon/Kumbungu and S/Nanton districts to 100 % in the Kwaebibrem
and Kumasi Metro districts. Among the other districts, the incidence ranged from the lowest
of 54% in the Ga West to the highest of approximately 68% in the North Tongu district (Fig.
7).
The percentage of fruits showing disease symptoms in 2010 survey was 100% in
Kwaebibrem and Kumasi metro, while it ranged from 9% to 15% in Manya Krobo, North
Tongu, Yilo Krobo and Dangbe West. During the period, the disease was not found in the
Hohoe, Berekum, Kintampo, Tolon/Kumbungu and Savelugu/Nanton districts. In 2011 the
percentage of fruits showing visible disease symptoms ranged from 9% to 13% among the
76
Manya Krobo, Yilo Krobo, North Tongu and Ga West districts while the disease was not
found in theHohoe, Berekum, Kintampo, Tolon/Kumbungu and Savelugu/Nanton districts.
The highest percentage was recorded in the Kwaebibrem and Kumasi metro districts where
every fruit inspected was infected showing a percentage of 100% in 2011 (Fig. 7).
Disease severity index ranged from 0.4 % to 0.6 % in Ga West, Manya Krobo, North Tongu,
Dangbe West and Yilo Krobo while it was 3.8 in both the Kwaebibrem and Kumasi metro
districts in the 2010 survey. The disease was absent in the Hohoe, Berekum, Kintampo,
Tolon/Kumbungu and Savelungu Nanton districts. In the 2011 survey, a similar trend was
observed with a severity index ranging from 0.4 to 0.7 among Ga West, Manya Krobo, North
Tongu, Dangbe West and Yilo Krobo districts while the disease was not found in Hohoe,
Berekum, Kintampo and Savelugu/Nanton districts. The severity index in the Kumasi metro
and Kwaebibrem districts during the period was 3.7 and 3.8 respectively (Fig. 7).
77
150
Rainfall (mm)
100
50
40
Temperature (ºC)
30
20
10
90
Relative humudity (%)
80
70
60
50
40
30
20
10
0
Administrative districts
2010 2011
Figure 5. Rainfall, Temperature and Relative humidity figures from January to March
recorded in the different administrative districts of Ghana in 2010 and 2011
Source: Ghana Meteorological Agency.
78
of mango anthracnose disease in farms in the indicated administrative districts of
Ghana in 2010 and 2010
79
4.4.5. Incidence of latent (postharvest) infection on mature fruits in mango orchards
In 2010, the incidence of the postharvest symptom development on fruits ranged from 0 to 99
%. The lowest was recorded on fruits from Hohoe district followed by Savelugu/Nanton and
Tolon/Kumbungu while the highest of 99 % was recorded on fruits from Kumasi metro. The
disease incidence recorded on fruits from Ga West, Dangbe West, Berekum and Kintampo
districts were not significantly different at p>0.05 (Table 9). Similarly, the disease incidence
on fruits collected from Manya Krobo, Yilo Krobo and North Tongu were not significantly
different. In 2011, the lowest disease incidence of 2% was recorded on fruits from Hohoe
district while the highest of 93 % was recorded on fruits from Kwaebibrem district. There
was no significant difference in the disease incidence on fruits from Ga West, Dangme West
and Yilo Krobo. Also, the difference in disease incidence on fruits from Manya Krobo and
North Tongu was not significant (Table 9).
The disease incidence from the two year average shows that the latent form of the disease on
matured fruits occurred in all the mango growing districts of Ghana (Table 9).
80
Table 9. Incidence of postharvest anthracnose disease in various mango growing

districts of Ghana.
Districts Disease incidence (%)
2010 2011 Mean
Ga West 40.0bc 41.0bcd 40.5

bc
Dangme West 40.0 39.0bcd 40.5
bcd bcde
Manya Krobo 60.0 58.0 59.0
Yilo Krobo 49.0bcd 47.0bcd 48.0
bcde bcdef
Kwaebibrem 98.0 93.0 95.5
North Tongu 60.0bcd 59.0bcde 59.0
a a
Hohoe 0.0 2.0 1.0
Kumasi metro. 99.0bcde 90.0bcdef 94.5
bc bc
Berekum 25.0 24.0 24.5
Kintampo 25.0bc 27.0bc 26.0
S/Nanton 8.0b 11.0b 9.5
b a
T/Kumbungu 8.0 9.0 8.5
Means followed by the same alphabets are not significantly different at p<0.05
81
4.5 Incidence, severity and yield/fruit quality loss in a commercial farm in Ghana
4.5.1 Incidence, severity and yield/fruit quality loss in the minor season
Direct yield loss caused by the disease was recorded on all trees. Dropping of young fruits
was observed beginning from 1 week after fruit set and continued till fruit maturity.
However, the fruits that dropped solely due to the disease were collected up to 3 weeks after
fruit set. Thereafter, almost none dropped.
During the period, the percentage of fruits that dropped solely by the disease ranged from
26.6% to 32.3 % among the trees of different ages resulting in an average of 29.9% loss in
yield (Table 10). At fruit maturity, the disease symptoms was found on fruits hanging on
trees resulting in poor quality of the fruits which were rejected as unfit for marketing. The
major symptom found at this stage was dominated by the alligator skin effect. The disease
incidence recorded from the different plots ranged from 31.3% to 32.8% with an average of
31.8%, while disease severity index ranged from 3.2 to 3.3 with a total of 3.3. The percentage
of fruits that reached maturity but could not be marketed due to the disease symptom alone
was 22.9% of the total fruit produced during the season (Table 10). Overall fruit-drop during
the study that was attributable to other unknown factors was 32.7% of the total production,
making it the single largest cause of yield loss during the study (Table 10).
The total yield/fruit quality loss was 52.8% comprising of the percentage of fruits that were
formed but dropped because they were infected by the disease and those that reached
maturity but could not be marketed due to the disease.
82
4.5.2 Incidence, severity and yield/fruit quality loss in the major season
In the major season, the percentage of fruit dropped due to the disease ranged from 6.3% on
older trees to 5.7 % of the total production of the season in the youngest trees giving an
average direct loss of 6.4% of the total production of the year. Very few fruits were diseased
on all plots, consequently the fruits selected at random for the assessment of the disease
incidence and severity were mainly healthy and the disease incidence and severity recorded
were both 0% (Table 11). The percentage of fruits that could not be sold because they were
infected by the disease was less than one (1) in all trees of different ages indicating their
number was negligible. Therefore a combination of the fruits that dropped because they were
infected and those that could not be sold because they were showing the disease symptoms
resulted in a yield/quality loss of approximately 6.5% of the total fruit production for the
season.
Direct yield loss attributed to other factors ranged from 52.5% to 54.3% with an average of
53.5%, making it the largest single cause of yield loss during the season (Table 11). Fruits
that were free of the disease and were able to reach maturity ranged from 41% on younger
trees to 38.7% on the 10 year old trees giving an average of 39.7% (Table 11).
83
Table 10. Effect of anthracnose disease on yield/fruit quality of mango fruits in a

commercial farm in the minor mango growing season of 2010
Plot* Fallen fruits Fruits at harvesting maturity
no.
due to
Disease Other Clean Diseased Rejected Rejected Disease Disease
only factors but Incidence Severity
Fruits marketable due to due to
(%) (%) the (%) index
(%) (%) disease other
(%) factors
(%)
1 28.8 32.9 12.8 1.9 23.4 0.2 31.3 3.3

2 32.3 30.9 12.1 1.6 22.7 0.3 32.8 3.2
3 26.6 34.1 12.3 1.8 22.9 0.3 31.3 3.3
Mean 29.9 32.7 12.4 1.8 22.9 0.3 31.8 3.3
L.S.D 7.5 3.8 2.7 1.6 5.8 0.2 7.2 0.5
Pr>F NS NS NS NS NS NS NS NS
*Plot 1: 8 years old trees

Plot 2: 10 years old trees
84
Table 11. Effect of anthracnose disease on yield/fruit quality of mango in a commercial

farm in the major season of 2011
Plot* Fallen fruits Fruits at harvesting maturity
no.
due to
Disease Other Clean Diseased Rejected Rejected Disease Disease
only factors but Incidence Severity
Fruits marketable due to due to
(%) (%) the (%) index
(%) (%) disease other
(%) factors
(%)
1 5.7 52.5 41.3 0.2 0.1 0.2 0.0 0.0

2 7.3 53.6 38.7 0.1 0.1 0.1 0.0 0.0
3 6.3 54.3 38.9 0.0 0.1 0.3 0.0 0.0
Mean 6.4 53.5 39.7 0.1 0.05 0.2 0.0 0.0
L.S.D 1.8 6.2 8.4 0.2 5.8 0.2 0.0 0.0
Pr>F NS NS NS NS NS NS NS NS
*Plot 1: 8 years old trees

85
4.6 Identification of causal agent of the mango anthracnose disease
4.6.1 Cultural, growth rate and morphological characteristics of isolates
Different types of colony morphology were observed when 100 isolates of Colletotrichum
species from mango and 2 each from citrus, avocado and papaya in Ghana and 15 from
mango from Florida, Mexico and Puerto Rico were grown on potato dextrose agar. These
were white cottony growth without obvious sporulation, white cottony growth with grey
centre without obvious sporulation, white cottony mycelium with abundant sporulation either
scattered in the medium or arranged in concentric rings and white mycelia with dark green
middle (Plate 4). In some instances, isolates without obvious sporulation were induced to
sporulate profusely by cutting the mycelia with a cockborer. Three types of colonies were
recorded for the isolates from Ghana. These were white mycelia with or without sporulation
and white mycelia with greyish centre. The isolates with dark green centre in a white
mycelial background were those isolated from mango from Puerto Rico. Margins of mycelia
growth of all isolates was the same. Colletotrichum acutatum isolates also produced white
mycelia with abundant sporulation and could not be differentiated from the mango isolates
showing similar cultural characteristics. Isolates of the pathogen obtained from citrus, papaya
and avocado all produced white mycelia with abundant sporulation and culturally could not
be differentiated from the mango isolates from Ghana that produced white mycelia with
abundant sporulation.
Conidial morphology and size and growth rate among isolates is summarized in Table 12.
Conidial morphology showed that all isolates from mangoes in Ghana possessed cylindrical
conidia which in few cases were narrow at the middle with obtuse ends. The conidia were
produced abundantly in disc shaped bright yellow acervuli which were common on the
86
surface of the naturally infected fruits collected during the survey and in culture media.
Acervuli produced by isolates in culture possessed numerous setae which were swollen at the
base and taper toward the edge (Plate 5). Conidial size among isolates from Ghana was 15.2 -
16.8 µm in length and 4.3-6.0 µm in width. The Colletotrichum gloeosporioides isolates
from Florida, Mexico and Puerto Rico also possessed cylindrical spores which were rounded
at the edges. The conidial sizes among the isolates from elsewhere ranged from 15.6 µm to
16.9 µm in length and 4.5 µm to 5.4 µm in width. The growth rate ranged from 0.7 mm/day
to 1.3 mm/day with all isolates obtained from mango and other fruit crops in Ghana and the
reference Colletotrichum gloeosporioides isolates showing a higher growth rate than the
reference Colletotrichum acutatum isolates. On the other hand, isolates of Colletotrichum
acutatum possessed fusiform spores that were pointed at the edges (Plate 5) and which were
smaller in length and width compared to the Colletotrichum gloeosporioides isolates.
Conidia of selected isolates of the pathogen germinated when spore suspensions were
incubated at 27ºC for 3 days. Each conidium produced short hyphae which terminated in a
bulbous dark appressorium. Slight variations were found in individual conidium in terms of
length of the germ tube. However, the shape of the apppressorium was the same (Plate 6).
87
Plate 4. Cultural characteristics of Colletotrichum gloeosporioides isolates obtained

from mango growing on PDA. A=White mycelia without visible sporulation, B=white
mycelia with obvious sporulation, C=Grey mycelia without obvious sporulation, D= White
mycelia with bright orange acervuli ring, E= White mycelia with dark green colour in the
middle, F=Acervuli forming around edges of wounds on mycelia. (Mg x 0.5)
88
A B C
Plate 5. Fruiting bodies and conidia of isolates used in the study. A=acervuli showing
numerous setea (arrowed), B=conidia of Colletotrichum acutatum with at least one sharp
edge (arrowed), C=conidia of Colletotrichum gloeosporioides with rounded edges (arrowed).
(Mg x 200)
m
n n
m
A g B C
Plate 6. Germinating conidia of isolates collected from mango in Ghana showing

different lengths of germ tubes. A= germinating conidium with a short germ tube (g)
between the conidium (arowed m) and the appressorium (arrowed n): B=a germinating
conidium with a longer germ tube compared to the one in A, C=hyphae and appressorium
only after the conidium has completely germinated. (Mg. x 200)
89
Table 12. Conidial morphology and dimensions and growth rate of Colletotrichum
species isolated from indicated fruits from different countries during the study
Source Country Spore type Spore Spore Growth rate
of isolate of origin width (µm) (mm/day)
Length
(µm)
Mango Ghana Cylindrical 15.9±0.06 5.4±0.08 1.10

Mango U.S.A. Cylindrical 15.6±0.15 5.4±0.08 1.10
Mango Mexico Cylindrical 16.9±0.05 5.3±0.06 1.10
Mango Puerto Cylindrical 15.3±0.13 4.5±0.07 1.10
Rico
Avocado Ghana Cylindrical 15.9±0.3 4.87±0.22 1.13
Citrus Ghana Cylindrical 17.57±0.28 5.07±0.17 1.13
Pawpaw Ghana Cylindrical 17.35±0.05 4.83±0.23 1.13
Strawberry U.S.A Fusiform 12.7±0.06 3.7±0.04 0.70
Bell U.S.A Fusiform 11.9±0.05 3.3±0.04 0.70
pepper
4.6.2 Biochemical characteristics
Isolates of the pathogen obtained from mango in Florida, Mexico and Puerto Rico all showed
positive reactions for amylase test. Similarly, the isolates obtained from mango in Ghana also
showed same reaction. In all cases, the media immediately surrounding the mycelia of the
pathogen and at the points where the mycelia were scrapped showed clearing after the
addition of the iodine solution while the other parts of the media remained dark in colour.
Similarly, all isolates of the pathogen from mango in Florida, Mexico, Puert Rico and Ghana
were positive for lipase reaction which was detected when they produced white flocculent
substances in advance of the mycelia in the media. The isolates were also positive for
polyphenol oxidase tests, with the PPO medium inoculated with the plug of the pathogen
90
turning dark after incubation (Plate 7). The reference Colletotrichum acutatum isolates also
showed same reactions on the different media as the isolates obtained from mango.
In the initial casein hydrolysis test involving both isolates from mango in Florida, Mexico
and Puerto Rico and the Colletotrichum acutatum isolates from strawberry in U.S.A, all of
the isolates from mango showed a negative reaction with the media remaining solid after the
incubation of the plates containing the isolates. On the other hand, the Colletotrichum
acutatum isolates showed a positive reaction. When the isolates from Ghana were plated on
the casein hydrolysis medium, they also produced a negative reaction. The casein hydrolyses
test therefore shows that the mango isolates from Ghana, Florida, Mexico and Puerto Rico
could be Colletotrichum gloeosporioides and not Colletotrichum acutatum.
91
Plate 7. Reactions of the same isolate of the pathogen on different media. Note the black
background surrounding the plug of the mycelia of the pathogen on the PPO media (right)
and absence of the black background on the PDA media (left).
92
4.6.3 Molecular characterization of isolates
4.6.3.1 Polymerase chain reaction using specific primers
An approximately 480 bp product was amplified when the DNA from isolates of the
pathogen from mango and other fruit crops from Ghana were used in a PCR with species
specific primers CgInt and ITS4. On the other hand, no product was obtained when the DNA
from isolates from strawberry and bell pepper were used in the PCR with the same primer
pair (Plate 8). This effectively identified the isolates from mango and other fruit crops in
Ghana as Colletotrichum gloeosporioides.
4.6.3.2. Polymerase chain reaction using universal primers
The universal primers amplified the different target regions of the DNA from the different
isolates used in the study and the products were successfully sequenced and assembled. The
amplified intron of the glutamine synthetase gene was approximately 1000 bp, ITS region
was approximately 600 bp, the beta tubulin gene was 405 bp and the glyceraldehyde-3-
phosphate dehydrogenase gene approximately 250 bp in size. Assembled sequences used in
the study were 900 bp for the glutamine synthetase gene intron, 535 bp for ITS region, 405
bp for beta tubulin gene intron and 190 bp for the glyceraldehyde-3-phosphate
dehydrogenase gene intron.
4.6.3.3 Restriction digestion profile
The restriction digestion of the rDNA-ITS amplified product with Hae III resulted in same
RFLP bands for all isolates of the pathogen from Ghana and was the same for the
Colletotrichum gloeosporioides from Puerto Rico, Mexico and Florida The enzyme
generated three fragments of 280 bp, 170 bp and 140 base pair from the amplified ITS
product of the isolates (Plate 9).
93
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
500bp
Plate 8. A gel showing the approximately 480 bp product amplified from Colletotrichum
species used in the study. Lane 1 (from the left) is a 1kb marker, 2-3 is DNA from C.
acutatum from bell pepper and strawberry respectively; 4-16=DNA from Colletotrichum
isolates from mango and17 and 18 =DNA from Colletotrichum isolates from avocado and
papaya.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
300bp
Plate 9. A gel showing the RFLP of the ITS product digested with HaeIII enzyme. (ITS
product was obtained from DNA of C. gloeosporioides isolates from mango). 1 and 18= 1kb
Marker; 2-17 DNA of isolates of the pathogen.
94
4.6.3.4 Sequence analysis of the glutamine synthetase gene intron

The gene intron of the glutamine synthetase gene which was obtained from the selected
isolates of the pathogen from mango from Ghana showed a long chain of the nucleotide T at
the beginning of the intron nucleotide sequence (Fig 8). However, this feature was
conspicuously absent from the gene intron of the Colletotrichum acutatum isolate retrieved
from the GeneBank. A slight variation in the length of the T chain was observed among the
different isolates, but the chain was at least 5 nucleotides long in each intron. The difference
in the occurrence of the T chain in the intron of the isolates from mango and the
representative isolate of C. acutatum is another indication that the mango isolates were not C.
acutatum and would therefore be C. gloeosporioides.
MAN-GH1: GTATGTCTTTTTTCCCGATAAGCCGCGTCTCAGTCTTTTTTTTTTTTTTT
MAN-GH2: GTATGTCTTTTTTTCCCGATAAGCCGCGTCTAAGTCTTTTTTTTTTTTTT
MAN-GH3: GTATATGTCTCTTTTTTCCCGGTAAAGCGGCGCTGTTCCACGATCTTTT
MAN-GH11GTATGTCTTTTTTCCCGATAAGCCGCGTCTCAGTCTTTTTTTTTTTTTTT
MAN-GH12 GTATGTCTTTTTTTCCCGATAAAGCCGCGTCTTTTTTTTTTTTTCCATT
MAN-GH13: GTATGTCTTTTTTCCGATAAGCCGCGTCTCAGTCTTTTTTTTTTTTTTC
MAN-GH15: GTATGTCTTTTTTTCCCGATAAGCCGCGTCTCAGTCTTTTTTTTTTTTT
MAN-GH20: GTATGTCTTTTTTCCCGATAAGCCGCGTCTCAGTCTTTTTTTTTTTTTT
MAN-GH22: GTATGTCTTTTTTCCCGATAAGCCGCGTCTCAGTCTTTTTTTTTTTTTT
JA2:GTACGTTCACGACAACCACCTTGTCTTTCTTATTCTTTGCGTTGGCTTTT
Figure 7. Sequence alignment of intron of glutamine synthetase gene of isolates
(Isolates designated MAN-GH1 to MAN-GH22 were obtained from mango collected from different
locations in Ghana; isolate designated JA2 was Colletotrichum acutatum whose intron sequences was
downloaded from the EMBL GeneBank). Note the presence of multiple T chain (darkened) at the
beginning of the intron which was absent from the intron of isolate JA2.
95
4.6.3.5 Sequence analysis and phylogenetic studies of the ITS region
Out of the total of 45 isolates of the pathogen collected from Ghana, 27 belonged to group 1,
16 belonged to group 2 and 2 belonged to group 3 (Table 13). The three representative
isolates selected from Ghana were picked at random from each of the three different rDNA–
ITS groups. The ITS1 region of isolates obtained from all the isolates from mango were 171
bp long. An approximately 180 bp product of the ITS1 region from isolates collected in the
study and those retrieved from the geneBank were aligned and used in the drawing of trees
(phylograms). Both trees drawn (MP and NJ) had a similar topology. Tree number 1 out of
131 most parsimonious trees (length = 84) obtain with the multiple sequence alignment of
the ITS1 region of the rDNA of isolates using the maximum parsimony method is shown in
Fig. 8. The consistency index was 0.759259, the retention index was 0.899225, and the
composite index was 0.760059 (0.682745) for all sites and parsimony-informative sites (in
parentheses). The Bootstrap values in percentages are shown next to the branches. There
were a total of 143 positions in the final dataset, out of which 27 were parsimony
informative. In the neighbor joining method, the optimal tree obtained had a total branch
length of 0.80069298 and a total of 143 positions in the final data set.
Out of the 21 Colletotrichum species used in the study, 12 clustered together in the C.
gloeosporioides complex with a high bootstrap support of 91% (Fig. 9). Among members of
the group are the reference isolate of C. gloeosporioides (CBS. 953.97), the selected isolates
of C. fragariae, C. kahawae, and C. musae and all the isolates of the fungi obtained from
mango from Ghana, Florida, Mexico and Puerto Rico. The two isolates collected from bell
pepper and strawberry clustered with the reference C. acutatum isolate with a high bootstrap
support of 97%. The C. acutatum clade was formed far from the Colletotrichum
96
gloeosporioides complex clade, showing that the mango isolates of the pathogen were very
different from strains of C. acutatum. Similarly, the other Colletotrichum species clustered
away from the group containing the mango isolates showing that none of the mango isolates
belong to any of those groups. This shows that isolates infecting mangoes in Ghana, Florida,
Mexico and Puerto Rico used in this study were not C. acutatum and may therefore be C.
gloeosporioides.
Sequence variation was detected among the isolates grouped together within the
Colletotrichum gloeosporioides complex. Between the mango isolates and C.
gloeosporioides type strain, the sequence variation ranged from 0.6-2.9. Between them and
the other species, the sequence divergence ranged from 0.6 to 7.6 with C. musae being the
most diverged from the mango isolates. Some isolates from mango showed a higher sequence
homology with the C. kahawae isolate than the type strain of C. gloeosporioides while others
show the same homology with both C. gloeosporioides type strain (CBS 953.97) and the C.
kahawae isolate (Table 14). A pairwise comparison of nucleotide sequences of the entire ITS
region showed that all isolates from mango in Ghana and other selected isolates within the C.
gloeosporioides complex (including the type strain of C. gloeosporioides) had a high
sequence homology among them. Also between these isolates and other isolates belonging to
different species including C. acutatum, the sequence homology was lower (Table 15). This
means that none of the mango isolates belong to any of the species represented by the
different isolates. A distinct clade was formed by the Isolate MAN-GH21 from Ghanaian
mangoes, MAN-MX1 from Mexican mangoes and isolate M1/6 known as the mango bio-
type of Colletotrichum gloeosporioides from Sri Lanka, which is supported by a high
bootstrap value of 88% within the C. gloeosporioides complex clade. This shows that those
97
isolates belong to the same species which was not represented by any of the reference
isolates.
98
Table 13. rDNA-ITS1 grouping of Colletotrichum gloeosporioides isolates used in the

study.
Isolate designation Locality Cultural colour/sporulation rDNA-ITS

of collection (7 day old) group
MAN-GH1 Somanya White/intense 1
MAN-GH4 Akorley White/intense 2
MAN-GH5 Akorley White/sparse 2
MAN-GH13 Ayikuma White/intense 2
MAN-GH14 Ayikuma White/intense 2
MAN-GH15 Dodowa White/intense 1
MAN-GH18 Kpong Grey/sparse 2
MAN-GH19 Kpong Grey/Sparse 1
MAN-GH20 Kpong Grey/intense 1
MAN-GH21 Sogakope White/intense 2
MAN-GH22 Sogakope White/sparse 1
MAN-GH23 Sogakope White/intense 1
MAN-GH24 Oyibi White/intense 1
MAN-GH25 Oyibi White/sparse 2
MAN-GH26 Oyibi White/intense 1
MAN-GH27 Hohoe White/intense 1
MAN-GH28 Hohoe White/sparse 1
MAN-GH29 Hohoe White/intense 1
MAN-GH30 Kade White/intense 1
MAN-GH33 Kwadaso White/sparse 2
MAN-GH34 Kwadaso White/intense 1
MAN-GH35 Kwadaso White/intense 2
NB. Isolates placed in the same group possess the same nucleotide sequences of the ITS 1
region (100% homology). The group number was arbitrarily assigned
99
Table 13 (Cont’d). rDNA-ITS1 grouping of Colletotrichum gloeosporioides isolates

collected from different locations in Ghana and abroad used for the molecular
characterization studies.
Isolate designation Locality Cultural colour/sporulation rDNA-ITS

of collection (7 day old) group
MAN-GH40 Berekum White/intense 2
MAN-GH41 Sampa White/intense 1
MAN-GH42 Sampa White/intense 1
MAN-GH43 Tamale White/sparse 2
MAN-GH44 Tamale White/intense 1
MAN-GH45 Tamale White/intense 1
MAN-MX1 Mexico White/intense 2
MAN-MX2 Mexico White/intense 2
MAN-MX3 Mexico White/sparse 2
MAN-FLO1 Florida White/sparse 1
MAN-PRI Puerto Rico Dark green/sparse 4
MAN-PR2 Puerto Rico Dark green/sparse 4
AVO-GH1 Dome White/intense 1
AVO-GH2 Legon White/intense 1
CIT-GH1 Kade White/intense 5
CIT-GH2 Kpong White/intense 5
PAW-GH1 Kpong White/intense 6
PAW-GH2 Kpong White/intense 6
NB. Isolates placed in the same group possess the same nucleotide sequences of the ITS 1
region (100% homology). The group numbers were arbitrarily assigned.
100
C. gloeosporioides
complex
C. acutatum
Figure 8. A phylogram drawn with the multiple sequence alignment generated with the
rDNA-ITS1 sequences of the 21 isolates of Colletotrichum species used in the study.
101
Table 14. Sequence variation and homology of the ITS1 region among isolates of
Colletotrichum species used in the study
MAN MAN MAN MAN MAN MAN M1/6 SAS- CBS C. C. C. fra
- - - -FL1 -PR1 -MX1 4 953.7 kah. mus
GH10 GH12 GH21
MAN- - 98.3 97.7 98.3 98.8 97.7 97.7 99.4 97.7 98.8 93.5 94.7
GH10
MAN- 1.7 - 98.3 100 98.3 98.3 98.3 98.8 99.4 98.3 92.9 94.2
GH12
MAN- 2.3 1.7 - 98.3 97.7 100 100 98.3 97.7 97.7 92.4 93.6
GH21
MAN- 1.7 0 1.7 - 98.3 98.3 98.3 98.8 99.4 98.3 92.9 94.2
FL1
MAN- 1.2 1.7 2.3 1.7 - 97.7 97.7 98.3 97.1 97.7 92.4 92.9
PR1
MAN- 2.3 1.7 0 1.7 2.3 - 100 98.3 97.7 97.7 92.4 93.6
MX1
M1/6 2.3 1.7 0 1.7 2.3 0 - 98.3 97.7 97.7 92.4 93.6
SAS-4 0.6 1.2 1.7 1.2 1.7 1.7 1.7 - 98.3 99.4 94.1 95.3
CBS 2.3 0.6 2.3 0.6 2.9 2.3 2.3 1.7 - 97.7 92.4 94.7
953.97
C. 1.2 1.7 2.3 1.7 2.9 2.3 2.3 0.6 2.3 - 93.5 94.7
kahawae
C. 6.5 7.1 7.6 7.1 7.6 7.6 7.6 5.9 7.6 6.5 - 94.1
musae
C. fra 5.3 5.8 6.4 5.8 6.4 6.4 6.4 4.7 5.3 5.3 5.9 -
*Percent homology above diagonal and sequence variation below diagonal.
C. kah=C. kahawae
C. mus=C. musae
C. fra=C. fragariae
MAN-GH10, MAN-GH12 and MAN-GH21=representative isolates from mangoes in Ghana
MAN-FLO1=representative isolates from Florida
MAN-PR1=representative isolate from Puerto Rico
MAN-MX1=representative isolate from Mexico
M1/6, SAS-4, CBS 953.7, C. kah, C. mus, and C. fra. are isolates whose sequences were
downloaded from the EMBL database
102
Table 15. Pairwise comparison of the entire ITS region of selected Colletotrichum
isolates used in the study
MAN- MAN- MAN- PAW- AVO- C. C. C. C. C. F.

GH10 GH12 GH21 GH1 GH1 gloe dem gram. acu. musae oxy
MAN- 100.0 99.3 99.0 99.1 99.2 98.6 81.9 85.6 82.9 98.1 66.7
GH10
MAN- 100.0 99.1 99.8 100 98.9 82.3 85.6 82.6 97.8 66.7
GH12
MAN- 100.0 98.9 99.1 98.6 80.9 84.7 82.2 97.6 66.5
GH21
PAW- 100.0 99.8 99.2 82.1 85.4 82.6 97.8 66.7
GH1
AVO- 100.0 98.9 81.3 85.4 82.4 97.7 65.3
GH1
C. 100.0 80.2 85.6 82.1 98.6 61.5
gloe
C. 100.0 90.0 86.0 82.5 60.9
dem.
C. 100.0 88.6 86.6 66.5
gram.
C. 100 97.6 64.9
acu.
C. 100.0 66.9
musae
F. 100
oxy
F. oxy= Fusarium oxysporum.

C. gloe=C. gloeosporioides
C. dem.=C. dematium
C. gram=C. graminicola
C. acu=C. acutatum
103
4.6.3.6 Genealogical Concordance Phylogenetic Species Recognition.

(Sequence analysis of the entire ITS region, the beta tubulin gene and the
glyceraldehyde-3-phosphate dehydrogenase gene)
Two different trees were drawn with the multiple sequence alignment generated with the
nucleotide sequences of the ITS region. Both trees (MP and NJ) had a similar topology. Tree
number 1 out of 138 most parsimonious trees (length = 36) obtained using the maximum
parsimony method is shown in Fig. 10 (A). The consistency index is 0.909091, the retention
index is 0.966667, and the composite index is 0.939815 (0.878788) for all sites and
parsimony-informative sites (in parentheses). The Bootstrap values in percentages are shown
next to the branches. There were a total of 442 positions in the final dataset, out of which 9
were parsimony informative. In the neighbor joining method, the optimal tree obtained had a
total branch length of 0.08512981 and a total of 442 positions in the final data set.
Fig. 10 (B) shows the phylogram drawn with the nucleotide sequences of the second intron of
the beta tubulin gene. Both trees drawn (MP and NJ) with the multiple sequence alignment
generated had a similar topology. Tree number 1 out of 258 most parsimonious trees (length
= 55) obtained using the maximum parsimony method is shown. The consistency index is
0.947368, the retention index is 0.972222, and the composite index is 0.954545 (0.921053)
for all sites and parsimony-informative sites (in parentheses). The Bootstrap values in
percentages are shown next to the branches. There were a total of 301 positions in the final
dataset, out of which 16 were parsimony informative. In the neighbor joining method, the
optimal tree obtained had a total branch length of 0.21414864 and a total of 301 positions in
the final data set.
Fig. 10 (C) shows the phylogram drawn with the nucleotide sequences of the intron of the
GPDH gene. Both trees drawn (MP and NJ) with the multiple sequence alignment generated
104
had a similar topology. Tree number 1 out of 133 most parsimonious trees (length = 75)
obtained using the maximum parsimony method is shown. The consistency index is
0.9024390, the retention index is 0.935484, and the composite index is 0.885591 (0.844217)
for all sites and parsimony-informative sites (in parentheses). The Bootstrap values in
percentages are shown next to the branches. There were a total of 104 positions in the final
dataset, out of which 29 were parsimony informative. In the neighbor joining method, the
optimal tree obtained had a total branch length of 0.95851740 and a total of 104 positions in
the final data set.
The three different trees showed concordance at three major points; the C. asianum, C.
kahawae and the C. gloeosporioides clades. The expected C. siamense and C. fructicola
clades were not formed in at least one of the trees and the manner of clustering of the isolates
originally identified as C. siamense and C. fructicola was not consistent when all trees are
considered (Fig 10A, B and C). The C. gloeosporioides clade was supported by high
bootstrap values ranging from 61-97% while the C. asianum clade was also supported with
bootstrap values ranging from 76-98% among the different trees drawn. Two of the mango
isolates made up of the representative isolate, MAN-GH21 from Ghana and the MX1 from
Mexico clustered together with the C. asianum isolates in all trees drawn and were thus
identified as C. asianum isolates. The other representative isolates from mango were either
placed in different clades within the different trees or were found clustering all by themselves
(Fig. 10A, B and C). None of the representative isolates obtained from mango was placed in
the C. gloeosporioides clade in any of the trees drawn, indicating that none of those isolates
was C. gloeosporioides. Therefore, with the exception of the representative isolates MAN-
GH21 from Ghana and MAN-MX1 from Mexico, which were found to be of the same
105
phylogenetic lineage, all the other representative isolates of the pathogen obtained from
mango were of different phylogenetic species.
106
Figure 9. Phylograms drawn with the multiple sequence alignment generated with the
nucleotide sequences of different gene regions. A= entire ITS region, B=2nd intron of
the beta tubulin gene, C= glyceraldehyde-3-phosphate dehydrogenase gene.
107
4.6.3.7 BLAST search

Results obtained from the BLAST search with the nucleotide sequences of the isolates
obtained from mangoes in Ghana showed that isolates that were very similar to those
designated as MAN-GH10 or MAN-GH12 has been named variously as C. gloeosporioides,
C. siamense, C. fructicola or C. species. On the other hand, isolates similar to MAN-GH21
had been identified as C. asianum or C. species (Table 16). The E value for the hits obtained
with the ITS and Beta tubulin genes was 0 ie., the homology between the queries and the hits
was not by any chance.
4.6.3.8 ITS1 sequence comparison between isolates from mango and those from other
fruit crops in Ghana.
The alignment of the nucleotide sequence of the ITS1 region of representative isolates from
mango and other fruit crops in Ghana is shown in Fig. 11. At the 73rd position, the
representative isolate MAN-GH21 from mango possessed the nucleotide ‘A’ same as the
mango biotype (M1/6). All other representative isolates possessed the nucleotide ‘C’. Also at
the 133rd position, the isolate MAN-GH21 possessed the nucleotide ‘G’ same as the mango
biotype while the other isolates possessed ‘T’. Therefore based on the positioning of
nucleotide sequences within the ITS1 region, the isolate representative isolate MAN-GH21
from Ghana was identified as the mango bio-type of the pathogen. The other representative
isolates found on mango namely, MAN-GH10 and MAN-GH12 were therefore identified as
strains from other fruit crops. The sequence homology between the representative isolate
MAN-GH12 and AVO-GH1 was 100%. This indicates that the isolates represented by MAN-
GH12 may have infected mango from avocado. Sequence homology between the
representative isolate MAN-GH21, MAN-MX1 and M1/6 was 100%. This also shows that
the isolate from Mexico was also the mango bio-type of the pathogen.
108
Table 16. Similarity of isolates of Colletotrichum species obtained from mango and those
reported in the GeneBank using BLAST search
Gene region Query Hits E value* % Similarity

ITS MAN-GH10 C. sp. 0.0 100
C. gloeosporioides 0.0 100
MAN-GH12 C. siamense 0.0 100
MAN-GH21 C. asianum 0.0 100
Beta-Tub. MAN-GH10 C. sp. 0.0 100
C. siamense 0.0 100
C. fructicola 0.0 100
MAN-GH12 C. sp. 0.0 100
C. siamense 0.0 100
C. fructicola 0.0 100
MAN-GH21 C. asianum 0.0 100
C. sp. 0.0 100
GAPDH MAN-GH10 C. sp. 1e-92 99
MAN-GH12 C. gloeosporioides 5e-96 100
C. sp. 5e-96 100
MAN-GH21 C. asianum 5e-96 100
*E value is the probability of finding the hits by chance.
109
AVO-GH1 CTGAGTTTACGCTCTACAACCCTTTGTGAACATACCTATAACTGTTGCTTCGGCGGGTAG
MAN-GH12 CTGAGTTTACGCTCTACAACCCTTTGTGAACATACCTATAACTGTTGCTTCGGCGGGTAG
PAW-GH1 CTGAGTTTACGCTCTACAACCCTTTGTGAACATACCTATAACTGTTGCTTCGGCGGGTAG
CT-GH1 CTGAGTTTACGCTCTACAACCCTTTGTGAACATACCTACAACTGTTGCTTCGGCGGGTAG
MAN-GH10 CTGAGTTTACGCTCTATAACCCTTTGTGAACATACCTATAACTGTTGCTTCGGCGGGTAG
M1/6 CTGAGTTTACGCTCTACAACCCTTTGTGAACATACCTATAACTGTTGCTTCGGCGGGTAG
MAN-GH21 CTGAGTTTACGCTCTACAACCCTTTGTGAACATACCTATAACTGTTGCTTCGGCGGGTAG
**************** ********************* *********************
AVO-GH1 GGTCTCCGCGACCCTCCCGGCCTCCCGCCTCCGGGCGGGTCGGCGCCCGCCGGAGGATAA
MAN-GH12 GGTCTCCGCGACCCTCCCGGCCTCCCGCCTCCGGGCGGGTCGGCGCCCGCCGGAGGATAA
PAW-GH1 GGTCTCCGCGACCCTCCCGGCCTCCCGCCTCCGGGCGGGTCGGCGCCCGCCGGAGGATAA
CT-GH1 GGTCTCCGCGACCCTCCCGGCCTCCCGCCTCCGGGCGGGTCGGCGCCCGCCGGAGGATAA
MAN-GH10 GGTCTCCGTGACCCTCCCGGCCTCCCGCCCCCGGGCGGGTCGGCGCCCGCCGGAGGATAA
M1/6 GGTCTCCGCGACACTCCCGGCCTCCCGCCCCCGGGCGGGTCGGCGCCCGCCGGAGGATAA
MAN-GH21 GGTCTCCGCGACACTCCCGGCCTCCCGCCCCCGGGCGGGTCGGCGCCCGCCGGAGGATAA
******** *** **************** ******************************
AVO-GH1 CCAAACTCTGATTTAACGACGTTTCTTCTGAGTGGTACAAGCAAATAATCA
MAN-GH12 CCAAACTCTGATTTAACGACGTTTCTTCTGAGTGGTACAAGCAAATAATCA
PAW-GH1 CCAAACTCTGATTTAACGACGTTTCTTCTGAGTGGTACAAGCAAATAATCA
CT-GH1 CCAAACTCTGATTTAACGACGTTTCTTCTGAGTGGTACAAGCAAATAATCA
MAN-GH10 CCAAACTCTGATTTAACGACGTTTCTTCTGAGTGGTACAAGCAAATAATCA
M1/6 CCAAACTCTGATGTAACGACGTTTCTTCTGAGTGGTACAAGCAAATAATCA
MAN-GH21 CCAAACTCTGATGTAACGACGTTTCTTCTGAGTGGTACAAGCAAATAATCA
************ **************************************
Figure 10. Alignment of the sequences of the ITS1 region of Colletotrichum

gloeosporioides isolates from mango and other fruit crops in Ghana.
(Red highlighted nucleotides indicate the point of substitution between mango bio-type
(M1/6) and other isolates.
MAN-GH10 represents 2 isolates from mango in Ghana.
AVO-GH1 represents 2 isolates from avocado in Ghana.
CIT-GH1 represents 2 isolates from citrus in Ghana
PAW-GH1 represents 2 isolates from pawpaw in Ghana.
M1/6 represents the mango biotype of the pathogen (Mills et al, 1992).
110
4.7 Pathogenic analyses
4.7.1 Evaluation of inoculation methods.
The two methods employed for the inoculation of mango fruits in the study resulted in
symptom expression on fruits by all isolates from the mango. Disease symptomS induced
under the filter papers which were used to hold the inoculum was characterized by the dark
brown and sunken spots which were observed on naturally infected fruits in the field (Plate
10A). On the same fruits, points that were inoculated with sterile distilled water did not show
the symptoms confirming that the disease symptoms developed under the filter papers were
caused by the isolates used for the inoculation. The pathogen was re-isolated from the
diseased lesions to confirm that the fungi used for the inoculation were responsible for the
disease.
Puncturing of fruits and subsequent inoculation with mycelia mass also resulted in the
development of disease symptoms on inoculated fruits in contrast to holes that were
inoculated with PDA only. Disease symptoms were first observed three days after
inoculation appearing as a dark area around the point of inoculation. As the incubation period
increases, the lesions on the fruits inoculated with the mycelia of the pathogen expanded
rapidly (Plate 10B) but this was not evident on the fruits inoculated with the PDA only. The
isolates were re-isolated from the lesions.
4.7.2 Disease severity induced by different isolates
Every isolate used in the trial was able to induce the disease symptoms on each of the fruits it
was inoculated with lesion diameters caused by different isolates ranging from 12 mm to 33
mm. On the whole, a higher lesion diameter of 25.2 mm was caused by isolates obtained
111
from Yilo Krobo followed by 24.9 mm by isolates obtained from Hohoe. The lowest lesion
diasmeter of 22.5 mm was caused by isolates obtained from Kintampo. However, the
difference in disease severity induced by the isolates from the different districts was not
significant (Table 17).
Every cultivar of the crop used in the trial was susceptible to all isolates evaluated. Also,
every fruit inoculated was diseased and the nature of the disease symptoms was the same in
all cultivars of the crop (Plate 11). Among the different cultivars, the highest disease severity
of 24 mm was induced on Haden and Julie followed by a severity of 23.1 mm on Keitt, Kent
and Palmer. The lowest severity of 22.8 was recorded on Irwin. However, the difference in
disease severity induced by isolates on the different cultivars of the crop was not significant
(Table 17).
112
A B
Plate 10. Symptoms of anthracnose artificially induced on mango fruits.

A=fruit inoculated without prior wounding, B=a fruit inoculated with the pathogen through
wounds. (Mg x 0.7).
Plate 11. Some selected cultivars of mango fruit inoculated in the study.
(From left to right; Julie, Tommy Atkinson, Keitt, Haden and Kent), showing almost similar
severity of the disease. (Mg x 0.7).
113
Table 17. Lesion diameter induced on different cultivars of mango by isolates of
Colletotrichum gloeosporioides obtained from mango from different localities of Ghana
Districts* Mango cultivars/Lesion diameter (mm)* Means
Haden Irwin Julie Keitt Kent Palmer T/Atkins
Berekum 23.2 22.4 23.8 22.7 22.3 22.6 24.0 23.0

Ga West 24.0 23.3 24.7 23.6 24.4 23.1 24.7 24.0
Hohoe municipal 25.3 24.0 25.1 24.7 24.5 24.6 26.8 24.9
Kintampo 23.3 21.8 22.6 22.2 22.4 22.0 22.9 22.5
Kumasi metro. 23.6 22.9 23.3 22.9 23.2 23.1 24.0 23.2
Kwaebibrem 23.9 22.5 23.9 22.8 23.1 22.6 26.7 23.6
Manya Krobo 23.0 22.1 22.2 22.3 23.0 22.5 24.1 22.7
Nanton 23.0 21.4 23.1 21.9 22.0 22.4 23.4 22.5
North Tongu 25.0 23.9 25.3 24.1 24.1 23.3 25.4 24.5
Yilo Krobo 25.9 24.2 26.1 24.6 25.1 24.5 26.0 25.2
Mean 24.0 22.8 24.0 23.1 23.4 23.1 24.8
*Severity measured as diameter of the disease lesion.

L.S.D (5%). District =NS
Cultivars =NS;
District*Cultivar=NS.*.
114
4.8 Cross infection potential of isolates.
4.8.1 Mode of infection of fruits by isolates of the pathogen
All isolates of the pathogen from mango were able to induce the disease on all the mango
fruits inoculated with the spore suspension on the intact fruit surface. On the other hand,
isolates could not induce the disease on the intact fruits of avocado and papaya. However,
when fruits were wounded and inoculated with mycelia of the isolates, most isolates were
able to induce the disease on all fruits on the avocado (Plate 12) and papaya (Plate 13) fruits
except the citrus fruit. Inoculation of some of the papaya fruits with the spore suspension of
the isolates through wound created with inoculating pin also resulted in symptom
development (Plate 14).
4.8.2 Characterisation of isolates of the pathogen from mango based on their cross-
infectivity on other fruit crops
The 100 isolates of the pathogen collected from mango in Ghana could be placed in two
infectivity groups based on their reaction on the other fruit crops. One group, made up of 68
isolates contained isolates that were able to induce the disease symptoms on all the 6 fruits of
avocado and papaya but could not induce the disease on any of the citrus fruits. This was
similar to the infectivity of the two isolates from avocado and papaya which also induced the
disease symptom on all fruits on which they were inoculated but not on the citrus fruit (Table
18). The second group made up of 32 isolates were those isolates from mango that were able
to induce the disease on some but not all the 6 fruits of either avocado (Plate 12A and B) or
papaya (Plate 13). In most instances, the disease symptoms they induced initially failed to
expand compared to the other isolates. These isolates were also not able to induce the disease
on citrus. Therefore based on their limited infectivity on the other fruit crops in comparison
115
to the mango fruit, these isolates were placed in a different infectivity group compared to the
other isolates (Table 18).
The group 2 isolates included all the isolates previously identified as the mango bio-type of
the pathogen falling into rDNA-ITS1 group 2. By being very virulent only on mango they
were confirmed as the mango bio-type while the other isolates displaying the same infectivity
as those obtained from other fruit crops were also confirmed as cross-infecting mango on the
field.
116
Table 18. Cross infectivity of Colletotrichum gloeosporioides isolates on matured fruits
Virulence Origin No. of Test crop

group* isolates
of isolate
Avocado Citrus Mango Papaya
1 Mango 68 ++ - ++ ++
2 Mango 32 + - ++ +
1 Avocado 2 ++ - ++ ++
1 Citrus 2 ++ - ++ ++
1 Papaya 2 ++ - ++ ++
-=Avirulent (none of the 6 inoculated fruits developed the disease symptom).

+=weakly virulent (between 1-3 of the 6 inoculated fruits developed disease symptoms)
++=highly virulent (between 4 and 6 of the 6 inoculated fruits developed disease symptoms).
*Group numbers were arbitrarily assigned.
117
A B
Plate 12. Avocado fruits inoculated through wounds with isolates of Colletotrichum
gloeosporioides from mango.
A=absence of disease on avocado fruit inoculated with isolates designated 4 and 5,

B=avocado fruit showing the anthracnose symptoms induced by two other isolates. (Mg x
0.7)
Plate 13. A papaya fruit inoculated with four different isolates of Colletotrichum spp
from mango. Isolates designated 1 and 3 show expanded disease lesions while disease lesion
was restricted when isolates designated 2 and 4 were inoculated into the fruit (Mg x 0.7)
118
Plate 14. Symptoms of anthracnose showing on papaya fruits inoculated with conidial
suspension of the pathogen.
(Fruit was inoculated through wounds and incubated for 9 days). Note the absence of
symptoms on control (left) (Mg x 0.7).
119
4.9 Chromatographic determination and toxicity of secondary metabolites of isolates
4.9.1 Chromatographic screening of secondary metabolite.
The results of the qualitative screening of the secondary metabolites as observed under UV
are indicated in Plate 15. When the profile was visualized under both UV235 nm and UV365
nm without staining, several bands were found and differences in the occurrence of the bands
were observed among the individual isolates. Under UV 365 nm without prior staining (Plate
15A), isolates 1, 2 and 5 appeared to possess similar bands, though they belong to the
different types of strains (mango bio-type and those from other fruit crops) observed in the
study. Also, when the chromatograms were observed under UV 254 nm without prior
staining, almost all isolates (with the exception of isolate designated 4) possessed a clear
band at Rf =0.7. In addition to this band, individuals possess other bands (Plate 15C). Under
the visualization at UV254 nm, the isolates designated 8 and 9 showed two bands at almost
the same positions, though the isolate 8 was a mango biotype while the one designated 9 was
not.
Visualisation after staining resulted in the observation of coloured bands from the isolates.
Basically, two coloured bands, yellow and dark brown were observed (Plate 15B). These
were observed in all strains used in the study and most isolates showed these coloured bands
at the same points of the profile. Therefore based on the observations from the TLC plates at
the different modes of visualization, it could be inferred that individuals may be producing
different chemicals. However, all isolates, either mango bio-type or those from the other fruit
crops may be producing a common chemical at Rf=0.7.
120
4.9.2 Toxicity of secondary metabolites of isolates
The crude extract of the secondary metabolites of the isolates was not able to induce the
disease symptom on the inoculated leaves of the different crops inoculated, namely, mango,
avocado, papaya and cassava.
121
1 2 3 4 5 6 7 8 9
1 2 3 4 5 6 7 8 9
1 2 3 4 5 6 7 8 9
Plate 15. Secondary metabolite profile of some selected Colletotrichum gloeosporioides isolates
from mango.
A= visualisation under UV 365 nm without staining, B=visualization under UV 365 nm after

staining with anisaldehyde based stain and C=visualization at UV 254 nm without staining.
(Isolates designated 1, 2, 3 and 8 are isolates of the mango-biotype and 4, 5, 6, 7 and 9 are
strains from other fruit crops that were found on mango).
122
4.10 Effect of mango anthracnose disease on the juice quality of mango fruits.
4.10.1 Titratable acidity
The results showed that there was no significant difference in titratable acidity content
(p>0.05) among the sunset variety of mango showing different severity levels of the mango
anthracnose disease (including the healthy fruits) used in the study (Table 19). Similarly, the
titratable acidity content of the Irwin and local varieties of the crop of showing different
severity levels of the anthracnose disease was not significantly different (Table 19).
4.10.2 Total soluble solids
There was no significant difference in Total soluble solids content (p>0.05) between the
healthy and diseased sunset variety of mango fruits used in the study (Table 20). Similarly,
the soluble solids content of the Irwin and local varieties of the crop at the different severity
levels (including the healthy fruits) was not significantly different (Table 20).
4.10.3 The TSS/TTA ratio
The TSS/TTA ratio of the three mango cultivars at the different disease severity levels,
including the healthy fruits, was not significantly different at p>0.05 (Table 21).
123
Table 19. Effect of different severity levels of mango anthracnose disease on the
Titratable Acidity content of mango sunset, Irwin and local cultivars of mango fruit
Mango cultivars/Titratable acidity (%)
Disease severity* Sunset Irwin Local
0 0.138a 0.179a 0.162a

1 0.128a 0.183a 0.161a
2 0.125a 0.186a 0.161a
3 0.121a 0.185a 0.147a
4 0.123a 0.185a 0.151a
5 0.121a 0.171a 0.151a
Means followed by the same alphabet in a column are not significantly different at P>0.05
*0=no disease, 5=more than 50% of fruit surface diseased (Lakshmi and Prasad, 2011).
Table 20. Effect of different severity levels of mango anthracnose disease on the Total
soluble solids content of mango sunset, Irwin and local cultivars of mango fruit
Mango cultivars/Total soluble content (°Brix)
Disease severity* Sunset Irwin Local
0 16.3a 14.3a 15.4a

1 16.3a 14.0a 15.0a
2 16.3a 14.4a 15.8a
3 15.7a 14.2a 14.5a
4 15.6a 14.4a 15.1a
5 15.9a 14.1a 15.5a
124
Table 21. Effect of different severity levels of mango anthracnose disease on the ratio
Total soluble solid:Titratable acidity of sunset, Irwin and a local cultivars of mango
fruit
Mango cultivars
Disease severity Sunset Irwin Local
0 116.4a 80.0a 94.9a

1 128.5a 76.4a 91.1a
2 123.4a 78.8a 94.6a
3 129.0a 76.6a 98.8a
4 128.2a 77.5a 98.7a
5 131.2a 83.0a 103.9a
125
4.11. Control of mango anthracnose disease
4.11.1 Effect of selected fungicides on the mycelia growth of Colletotrichum

gloeosporioides
Each of the seven fungicides evaluated (Agriette, Bendazim, Funguran, Ivory, Prochloraz,
Sundomil and Top Cop) was able to suppress the growth of the pathogen throughout the
period of the experiment. The pathogen failed to grow in the PDA amended with the
fungicides from the 3rd day of incubation to the 8th day (Plate 16) resulting in a 100%
suppression of radial growth each day (Table 22). The observations show therefore that all
the fungicides evaluated at their recommended rates in the study were very effective against
the pathogen.
126
Table 22. Effect of different fungicides on radial growth of Colletotrichum

gloeosporioides obtained from mango on amended PDA
Incubation period (Days )
Type of Fungicide 3 4 5 6 7 8
/rate of application
Agriette (4 g/L) 100 100 100 100 100 100
Bendazim (2 g/L) 100 100 100 100 100 100
Funguran (2 g/L) 100 100 100 100 100 100
Ivory (4 g/L) 100 100 100 100 100 100
Prochloraz (1.5 ml/L) 100 100 100 100 100 100
Sundomil (4 g/L) 100 100 100 100 100 100
Top Cop (20 ml/L) 100 100 100 100 100 100
. (Values are percentage reduction in radial growth compared to the control)
Plate 16. Effect of different fungicides on the radial growth of Colletotrichum

gloeosporioides obtained from mango in Ghana.
A =Mycelial growth on PDA only, B=absence of mycelial growth on PDA amended with
Ivory, C= absence of mycelial growth on PDA amended with Bendazim, D=absence of
mycelial growth on PDA amended with Prochloraz, E=absence of mycelial growth on PDA
amended with Funguran and E=absence of mycelial growth on PDA amended with Top Cop.
127

severity of minor seasons mango production.
There was significant difference in disease incidence (p<0.05) among the different
treatments. The highest disease incidence of 49.1 % was recorded on control trees followed
by 38.6 % on trees treated with Top Cop fungicide. The lowest incidence was recorded on
trees treated with Bendazim (Table 23). The disease incidences recorded on trees treated with
Sundomil and Agriette were not significantly different (p>0.05) from what was associated
with trees treated with Top Cop. Similarly, disease incidence on trees treated with either
Ivory only or Ivory in combination with Bendazim or Funguran was not significantly
different (p>0.05).
There was significant difference in disease severity among treatments (p<0.05). The highest
severity index (1.8) was recorded on control plots while the lowest was recorded on trees
treated with Bendazim (0.8). Disease severity among the rest, Agriette, Sundomil, Ivory, Top
Cop and the Ivory plus Bendazim treatments was not significantly different (p>0.05). Also,
severity index on Funguran-treated trees was not significantly different (p>0.05) from what
was obtained on the Bendazim treated trees (Table 23).
Significant difference in percentage exportable fruits was recorded among treatments. The
highest of 70.2% of total production was recorded on trees treated with Bendazim, while the
lowest of 46.8% was recorded on control trees (Table 23). The percentage of exportable fruit
recorded on funguran-treated trees was not significantly different from what was recorded on
the trees treated with Bendazim. Exportable fruit obtained after treatment with the rest of the
indicated fungicides did not vary significantly from each other (Table 23).
128
anthracnose and on the fruit quality of Keitt variety of mango during the minor mango
production season of 2010 in the Yilo Krobo district of Ghana
1 2 3 4
Treatment Disease Severity Exportable Discarded
incidence index fruits (%)
(Fungicide/concentration) (%) (%)
Agriette (4 g/L) 37.1 1.5 59.7 1.4

Bendazim (2 g/L) 19.3 0.8 70.2 1.6
Funguran (2 g/L) 26.1 1.0 65.8 0.8
Ivory+Funguran (2 g+1 g/L) 32.9 1.6 58.4 1.4
Ivory+Bendazim (2 g+1 g/L) 33.9 1.3 60.4 1.1
Ivory (2 g/L) 32.4 1.3 62.9 2.2
Sundomil (4 g/L) 37.8 1.5 62.3 1.2
Top Cop (20 ml/L) 38.6 1.5 57.8 1.9
Control 49.1 1.8 46.8 1.8
L.S.D (5%) 3.5 0.2 6.4 NS

1
Incidence: Percentage of fruits showing the disease symptoms on the field.
2
Severity index based on a scale of 0-5 where 0= no disease symptoms and 5=more than 50% of fruit
surface disease
3
Exportable fruits are fruits without disease symptoms and could be sold on international markets.
4
Discarded fruits are those had the disease lesions such that they could not be sold on both the
international and local markets.
129
4.11.3 Effect of pre and postharvest treatments on the incidence and severity index of
mango anthracnose disease on the Keitt variety of mango in the minor season.
In the minor season trial, there was significant difference in incidence of postharvest
anthracnose disease (p<0.05) among fruits that received the different postharvest treatments,
namely prochloraz dips at either ambient temperature or 53ºC and hot water at 55ºC. The
lowest disease incidence (0%) was obtained on fruits treated with prochloraz dip at both
ambient and at 53ºC while the highest disease incidence of 97.8% was recorded on the
control fruits (treated with water at ambient). However, the difference in the disease
incidence on fruits treated with hot water and the control fruits was not significantly different
at p>0.05 (Table 24).
There was significant interaction between the preharvest and postharvest treatments on the
severity index of postharvest anthracnose disease (p<0.05) on the mango fruits used in the
trial (Table 25). The lowest disease severity index (0) was recorded on all fruits that were
dipped in the prochloraz solution at both ambient temperature and at 53ºC irrespective of the
type of preharvest treatment that the fruits received on the field. Hot water was superior to
the control only when the fruits were treated with Agriette, Bendazim, Sundomil, Top Cop,
Ivory and Bendazim, Ivory and Funguran or not were not treated with any fungicide (control)
on the field. However, hot water treatment and the control performed the same when fruits
were treated with either Funguran only or Ivory only on the field (Table 25).
130
Table 24. Effect of pre and postharvest treatments on the incidence of postharvest
anthracnose on fruits of the Keitt variety of mango in the minor season of 2010
Preharvest treatments Postharvest treatments/Disease incidence (%)
Water Hot water Prochloraz Prochloraz Mean

at ambient at 55ºC at ambient at 53ºC
Agriette (4 g/L) 100.0 100.0 0.0 0.0 50.0

Bendazim (2 g/L) 80.0 65.0 0.0 0.0 36.3
Funguran (2 g/L) 100.0 100.0 0.0 0.0 50.0
Ivory (4 g/L) 100.0 100.0 0.0 0.0 50.0
Sundomil (4 g/L) 100.0 100.0 0.0 0.0 50.0
Top Cop (20 ml/L) 100.0 100.0 0.0 0.0 50.0
Ivory+Bendazim (2 g+1g/L) 100.0 100.0 0.0 0.0 50.0
Ivory+Funguran (2 g+1 g/L) 100.0 100.0 0.0 0.0 50.0
Control 100.0 100.0 0.0 0.0 50.0
Mean 97.8 96.1 0.0 0.0
LS.D (5%): Preharvest=5.8 (NS)

Postharvest=3.9
Preharvest*postharvest=11.6 (NS)
131
Table 25. Effect of pre and postharvest treatments on the severity index of postharvest
anthracnose on fruits of the Keitt variety of mango in the minor season of 2010
Preharvest treatments Postharvest treatments/*Disease severity index
Water Hot Prochloraz Prochloraz Mean

water
at ambient at ambient at 53ºC
at 55ºC
Agriette (4 g/L) 3.3 2.7 0.0 0.0 1.5

Bendazim (2 g/L) 1.4 0.8 0.0 0.0 0.6
Funguran (2 g/L) 2.4 2.1 0.0 0.0 1.1
Ivory (4 g/L) 3.1 2.8 0.0 0.0 1.5
Sundomil (4 g/L) 3.3 2.9 0.0 0.0 1.6
Top Cop (20 ml/L) 2.5 1.9 0.0 0.0 1.2
Ivory+Bendazim (2 g+1 g/L) 2.3 1.9 0.0 0.0 1.0
Control 3.4 2.65 0.0 0.0 1.5
Mean 3.3 2.8 0.0 0.0

*Based on a scale of 0-5 where 0=no symptoms, 1=up to 5% of fruits surface diseased, 2=6-
10% of fruits surface diseased, 11-20% of fruit surface diseased, 3=21-50% of fruit surface
area diseased and 5=more than 50% of fruit area covered
LS.D (5%): Preharvest=0.2
Postharvest=0.1
Preharvest*postharvest=0.3
132

severity of major seasons mango production.
The disease incidence ranged from 0% on fruits from trees treated with Bendazim to 1% in
control trees. However, disease incidence among the different treatments was not
significantly different (Table 26). Similarly, disease severity was low with the severity index
ranging from 0 to 0.13. Among the different treatments, the difference in disease severity
index was not significant (Table 26). The percentage of fruits that are exportable also ranged
from 97.9 to 98.7% among treatments with the highest percentage being recorded on trees
that were treated with Bendazim while the lowest was recorded on trees treated with a
combination of Ivory and funguran. However, the difference in percentage of the exportable
fruits among treatments was not significant (Table 26).
133
anthracnose and on the fruit quality of Keitt variety of mango during the major mango
production season of 2011 in the Yilo Krobo district of Ghana
1 2 3 4
Treatment Disease Severity Exportable Discarded
incidence index fruits
(%)
(%) (%)
Agriette (4g/L) 0.3 0.01 98.4 0.9

Bendazim (2 g/L) 0.0 0.0 98.7 0.8
Funguran (2 g/L) 1.0 0.1 98.0 1.4
Ivory+Funguran (2 g/L+1 g/L) 0.3 0.0 97.9 1.5
Ivory+Bendazim (2 g+1 g/L) 0.0 0.01 98.3 1.2
Ivory (4 g/L) 0.3 0.02 98.6 0.7
Sundomil (4 g/L) 0.5 0.0 98.0 0.7
Top Cop (20 ml/L) 0.5 0.02 98.2 0.8
Control 1.0 0.13 98.2 0.6
L.S.D (5%) NS NS NS NS
1
Incidence: Percentage of fruits showing the disease symptoms on the field.
2
Severity index based on a scale of 0-5 where 0= no disease symptoms and 5=more than 50% of fruit
surface disease
3
Exportable fruits are fruits without disease symptoms and could be sold on international markets.
5
Discarded fruits are those had the disease lesions such that they could not be sold on both the
international and local markets.
134
4.11.5 Effect of pre and postharvest treatments on the incidence and severity index of
mango anthracnose on the Keitt variety of mango in the major season.
In the major season trial, there was significant difference in incidence of postharvest
anthracnose disease (p<0.05) among fruits that received the different postharvest treatments,
namely prochloraz dips at either ambient temperature or 53ºC and hot water at 55ºC (Table
27). The lowest disease incidence (0%) was obtained on fruits treated with prochloraz dip at
both ambient and at 53ºC while the highest disease incidence of 38% was recorded on the
control fruits (treated with water at ambient). However, the difference in the disease
incidence on fruits treated with hot water and the control fruits was not significantly different
at p>0.05 (Table 27).
There was significant interaction between the preharvest and postharvest treatments on the
severity index of postharvest anthracnose disease (p<0.05) on the mango fruits (Table 28).
The lowest disease severity index (0) was recorded on all fruits that were dipped in the
prochloraz solution at both ambient temperature and at 53ºC irrespective of the type of
preharvest treatment that the fruits received on the field (Table 28). Hot water was superior to
the control only when the fruits were treated with Agriette, Ivory, Sundomil, Top Cop, Ivory
and Bendazim, Ivory and Funguran or not treated (control) on the field. However, hot water
treatment and the control performed similarly on fruits that were treated with either Funguran
or Bendazim on the field (Table 28).
135
Table 27. Effect of pre and postharvest treatments on the incidence of mango
anthracnose disease on fruits of the Keitt variety of mango in the major season
Preharvest treatments. Postharvest treatments/Disease incidence (%)

water
at ambient at ambient at 53ºC
at 55ºC
Agriette (4 g/L) 40.0 35.0 0.0 0.0 18.7

Bendazim (2 g/L) 30.0 10.0 0.0 0.0 10.0
Funguran (2 g/L) 35.0 35.0 0.0 0.0 17.5
Ivory (4 g/L) 35.0 30.0 0.0 0.0 16.3
Sundomil (4 g/L) 40.0 30.0 0.0 0.0 17.5
Top Cop (20 ml/L) 40.0 40.0 0.0 0.0 20.0
Ivory+Bendazim (2 g+1g/L) 35.0 30.0 0.0 0.0 11.2
Ivory+Funguran (2 g/L+1 g/L) 40.0 35.0 0.0 0.0 18.7
Control 50.0 45.0 0.0 0.0 23.7
Mean 38 30 0.0 0.0
L.S.D (5%); Preharvest=16.0 (NS)

Postharvest=10.7
136
Table 28. Effect of pre and postharvest treatments on the severity index of mango
anthracnose on fruits of the Keitt variety of mango in the major season.
Preharvest treatments. Postharvest treatments/Severity index*

water
at at ambient at 53ºC
ambient at 55ºC
Agriette (4 g/L) 0.8 0.4 0.0 0.0 0.3

Bendazim (2 g/L) 0.3 0.1 0.0 0.0 0.1
Funguran (2 g/L) 0.7 0.4 0.0 0.0 0.3
Ivory (4 g/L) 0.7 0.3 0.0 0.0 0.3
Sundomil (4 g/L) 0.7 0.3 0.0 0.0 0.3
Top Cop 920 ml/L) 0.8 0.4 0.0 0.0 0.3
Ivory+Bendazim (2 g+1 g/L) 0.8 0.1 0.0 0.0 0.2
Control 0.9 0.6 0.0 0.0 0.4
Mean 0.3 1.18 0.0 0.0

*Based on a scale of 0-5 where 0=no symptoms, 1=up to 5% of fruits surface diseased, 2=6-
10% of fruits surface diseased, 11-20% of fruit surface diseased, 3=21-50% of fruit surface
area diseased and 5=more than 50% of fruit area covered.
L.S.D (5%); Preharvest=0.2
Postharvest=0.1
137
CHAPTER FIVE
5.0 DISCUSSION
The mango anthracnose disease produced dark sunken lesions on leaves, inflorescence and
fruits. This type of the disease symptoms accompanied by acervuli formation by the causal
agent has been described as a characteristic symptom of the disease and is mostly used as a
diagnostic feature of the disease (Agrios, 2005, Arauz, 2000, Ploetz, 1998). In this study,
another disease symptom, described as the ‘alligator skin’ is being reported for the first time
as an additional different symptom elicited by the same pathogen which induces dark sunken
lesion on fruits in Ghana. This confirms the report by Nelson, (2008) that some strains of the
pathogen are able to cause cracks in the epidermis resulting in the alligator skin effect. The
disease symptoms were observed at both the preharvest and postharvest stages and in most
cases were found to be restricted to the fruit pericarp. In very severe infections the lesions
were found to have penetrated the pericarp thereby infecting the pulp as well. These types of
symptoms have all been described as characteristic of the mango anthracnose disease (Arauz,
2000), confirming that the disease under study was mango anthracnose as has been reported
earlier in the country (Oduro, 2000: Offei et al, 2008).
The disease was found to infect the peduncle of young fruits leading to the abscission of
young fruits. Fruit drop due to the disease has been reported earlier on by Nelson (2008).
However, the mechanism involved was not elucidated. Therefore, apart from giving credence
to the report that the disease can cause fruit drop, current data from this thesis shows that
infection and subsequent withering of the fruit peduncle by the disease is the major cause of
fruit drop associated with the disease. This information, together with the observation that the
138
peduncle attached to the dropped fruits had necrotic surfaces with the disease symptom
concentrated around the peduncle end of the fruits is very useful for distinguishing between
fruits dropped by the disease and those that dropped due to other factors. This may be useful
in further studies on the disease.
The symptoms of mango anthracnose were found to be normally absent on fruits older than a
month. However, it was found to be induced on fruits hanging on the trees either by
wounding mechanically or by herbicide spray drifts. The use of herbicides as means of
breaking down the skin tissues to induce the latent infection on mango fruits after harvest has
been demonstrated (Paramasivan et al., 2009) and therefore supports the findings of this
current study. The stimulation of the disease symptoms on fruits hanging on trees by the
herbicide, paraquat is however being reported for the first time in Ghana and suggests that
the use of paraquat herbicide when fruits are still hanging on the trees is not advisable.
Prior to the flowering and fruiting period of the mango trees, it was observed that leaves and
panicles contained a high concentration of acervuli which are the sources of infective
propagules of the causal agent. Although no experiment was carried out to determine whether
inoculum emanates from other sources onto the infection courts of trees, the leaves and
panicles were considered to contain enough inoculum to trigger epidemics. This observation
is consistent with report by Arauz, (2000) that there may always be enough inoculum in the
tree canopy to trigger epidemics. As a good agronomic practice, it is recommended that
regular pruning of the mango trees must be carried out to facilitate the penetration of sunlight
into the canopy to reduce humidity and hence the incidence of the mango anthracnose
disease. The findings of this study show that another advantage of regular tree pruning is the
reduction in the concentration of inoculum in the tree canopy. Though both leaves and
139
panicles were found to be potential sources of inoculum on trees, the higher number of
infective leaves on the trees compared to the panicles indicates that between the two, the
leaves are of more importance in terms of harbouring of potential inoculum. Arauz (2000)
showed that removal of the dried panicles from the tree prior to fruiting did not significantly
reduce the incidence of anthracnose. This confirms the assertion that the panicles may not be
as important as leaves in terms of sources of inoculum in the tree canopy.
Apart from the leaves and panicles, the mummified fruits were also found to contain a high
level of inoculum, which agrees with a report by Arauz (2000) that the pathogen sporulates
abundantly on mummified fruits. In most cases, after harvesting, mummified fruits are either
left on the trees or are harvested and together with other fruits that dropped, are left on the
field. These, together with other abscising leaves, may constitute a large source of inoculum
in the orchard floors serving as alternative sources of inoculum in the orchard. It is
recommended that the removal of plant debris which is one of the good agronomic practices
must be considered for the control of mango anthracnose disease in Ghana.
Two other disease symptoms suspected to be bacterial black spot caused by Xanthomonas sp.
(Manicom and Pruvost, 1998) and stem end rot caused by Lasiodiplodia theobromae
(Johnson, 1998) both associated with mango (Ploetz, 1998) were identified as factors that
could mask the correct diagnosis of the mango anthracnose disease. The nature of the above-
mentioned disease symptoms is such that they were not easily distinguishable from the
mango anthracnose disease symptom. Their symptoms on the fruits may inadvertently be
attributed to mango anthracnose. During the study some farmers had consistently used the
dark spots suspected to be caused the bacterium Xanthomonas sp. as evidence of the presence
of mango anthracnose on the farm. Therefore farmers were consistent in their removal of
140
leaves showing such symptoms, wrongly assuming that they were reducing the inoculum
reservoir of mango anthracnose. Farmers have consistently reported that the fungicides
available on the Ghanaian market were not very effective against the causal agent of the
mango anthracnose disease (Odzeyem, 1998). However, the similarity in disease symptoms
caused by the target pathogen and those of other pathogens implies that it would not be easy
to determine whether the fungicide spray had been effective in reducing incidence of the
mango anthracnose disease until a proper assessment is made. It would be worthwhile to
separate the symptoms caused by non-target organisms from those caused by the anthracnose
fungus in future studies.
Two major types of control measures, namely fungicide applications and general farm
sanitation, including pruning of trees, were found to be practiced in the different mango
orchards during the study. However, the degree to which these methods were employed
varied from farm to farm. Most farmers relied on the regular application of fungicides such
as Mancozeb, Funguran and Bendazim. In general, the climatic condition in Ghana is
considered to be hot and humid with some seasonal rainfall obtained during the growing
season. This weather conditions is favourable for the development of the mango anthracnose
disease and in such cases, it will be almost impossible to produce mango profitably without
the application of fungicides (Arauz, 2000). This is one of the reasons why in majority of the
farms there were frequent fungicide applications during the production season. However, the
timing, frequency of application and the choice of fungicides being used in majority of these
farms leaves much to be desired. During the study it was noticed that the type of control
measure depended more on the targeted market rather than any sound scientific reasoning.
Farms in the coastal Savanna zone were applying fungicides based on calendar spray
141
schedule season after season, though the two mango production seasons in the area varied in
terms of weather conditions. It was noticed that during the major season which began from
February to May, rainfall is sparse in the coastal savanna zone, especially during the
flowering and early fruit development stage. During this period, fungicide application may
not be necessary. This and other reasons such as the random selection of fungicides which
was being practised in the mango farms and which could lead to development of resistant
pathogen strains to multiple types of fungicides is likely to impact negatively on the
production of good quality fruits in Ghana. This may be one of the reasons why farmers were
complaining of poor control results (Odzeyem, 1998).
Tree pruning which is one of the cardinal principles of good agronomic practices in mango
production was found to be practised at varying degrees among the different farms surveyed.
In agro-ecological zones where only one mango production season exist in one calendar year,
most commercial farms practiced heavy pruning of trees, which eventually contributes to
smaller tree sizes and clean farms. However, in the areas of the country where two mango
production seasons exist per calendar year, pruning of trees was not intense, presumably due
to the short interval between the major and minor seasons.
It is common knowledge that tree pruning prevents build up of high humidity in the tree
canopy which eventually contributes to reduced incidence of mango anthracnose (Arauz,
2000). In the areas where two mango production seasons exist, a combination of tree pruning
with well informed choice and proper usage of fungicides have a potential of contributing to
higher yield of mango in Ghana in general. Clearly, a well defined policy of control practices
informed by research results is required for Ghana.
142
During the field survey, variations in incidence and severity of mango anthracnose were
observed among the different farms spread across the different agro-ecological zones of
Ghana. In general, variations in incidence and severity of plant diseases can be attributed to
differences in cultural practices which include soil cultivation and removal of crop residues,
host genotypes, planting times and the growing environment (Neya and Normand, 1998;
Marley, 2004). In the mango anthracnose host-pathogen relationship, where the pathogen is
known to survive in fallen plant parts, removal of crop residues play an important role in
reduction of the inoculum in the farm. This may be one of the reasons accounting for the
variation in the disease incidence and severity among farms within the same agro-ecological
zone observed in the study. For example, in the Kwaebibrem District and Kumasi Metro,
where the highest disease incidence in terms of percentage of trees and fruits infected and the
severity of the disease, the two farms were found at Research Centres with no research
activities during the period of the study. Therefore, there was no evidence of removal of crop
residues during the period of the study. This contrasted with the farms in the Hohoe district
where plant debris were removed and farms were found to be well maintained during the
period of the survey. Consequently, the disease was not detected in farms surveyed in the
Hohoe district which was located in the same agro-ecological zone as compared to Kumasi
Metro and Kwaebibrem districts where all farms surveyed had the disease.
The survey was carried out on the same crop genotype, namely the Keitt variety of mango,
across the different farms in the study. However, great variations were found in the size of
the mango trees. Trees in the Hohoe, Kintampo, Berekum, Savelugu/Nanton and Tolon/
Kumbungu districts were much shorter and smaller in girth than those in the other remaining
districts. Incidentally, the lowest disease incidence and severity were also found in the above
143
districts. This must be expected since smaller trees are characterised by less dense foliage
and lower humidity within the canopy. Secondly, fungicide applications when necessary
would be more efficient on smaller trees than huge and tall trees. Furthermore, since the
leaves serve as one of the major sources of inoculum in the tree canopy (Arauz, 2000), there
may be a direct relationship between the number of leaves and the inoculum concentration.
In the coastal savanna zone, most trees were tall with larger canopies compared to the interior
savanna zone. Due to the short interval between the two mango production seasons in the
coastal savanna, farmers within the area find it almost impossible to carry out effective
pruning. The trees therefore grow luxuriously. Consequently, the disease was severer in the
Coastal Savanna than in Guinea Savanna.
The prevailing weather condition is another important factor that influences the incidence
and severity of plant diseases (Kranz and Rotem, 1987). Of major importance is rainfall
which has a major impact on the distribution and spread of mango anthracnose by serving as
a major vehicle for the dispersal of conidia within the tree canopy and also providing free
moisture for the germination of conidia (Jeffries et al, 1990; Arauz, 2000). Therefore, the
variations in rainfall patterns across the various regions may be another factor influencing the
distribution of the mango anthracnose disease in Ghana. The two farms recording the highest
disease incidence and severity in the Eastern and Ashanti regions all lie within the Semi
Deciduous Forest agro-ecological zone which is characterized by high amounts of rainfall
during most parts of the year (Fig. 6). In addition, temperatures are also high all year round
and this climate is known to increase relative humidity (Chala et al, 2010), that exacerbates
the anthracnose disease (Nelson, 2008). Under such environmental condition, the production
of good quality fruits depends on the rigid institution of control practices including the
144
frequent application of fungicides. Generally, farmers avoid these areas for the establishment
of orchards. However, certain benefits to be derived such as availability of land and rainfall
and ability of trees to flower at certain desirable periods entice some farmers to site orchards
in such areas. There was evidence during the study that most of the farms that were
practicing heavy pruning and heavy fungicide applications were found in the Hohoe district
(which was located in the semi-deciduous forest). These farms were able to supply good
quality fruits to the international markets by adhering to rigid disease control regimes. This
contrasted sharply with the farms in the Kwaebibrem and Kumasi Metro in the same agro-
ecological zones, where fruits produced during the period were of poor quality due to the
absence of rigid disease control.
The fact that rainfall pattern in the agroecological zones played a role in the disease
incidence and severity was supported by the absence of the disease symptoms in the Northern
region. Leaves and dried panicles from previous season’s production from the farms in both
the Savelungu/Nanton and Tolon/Kumbugu (both districts in the Northern region) were
found to harbour the pathogen’s acervuli (which contained the infective conidia of the
pathogen). Despite this evidence of infective propagules, the disease was not detected in the
field. This means the fruits were either not infected at all or the infections were quiescent and
prevailing environmental conditions to promote the development of disease symptoms was
not available during the production period. The first explanation is not plausible because
development of postharvest symptoms from fruits from the region showed that fruits were
infected. Presumably the absence of the disease in the field could be attributed either to the
absence of the requisite amounts of rainfall necessary to disseminate infective propagules
during the early fruit development stage (when infected fruits develop symptoms) or the
145
unavailability of successive rainy days that promote the development of the cracked skin
lesions attributed to the disease (Nelson, 2008). The agro-ecological zone in the parts of the
Northern region (where the field survey of the disease was carried out) is the Guinea Savanna
where the lowest amount of total rainfall in a year was recorded (Fig. 6). Furthermore, the
high all year round temperatures and low relative humidity resulted in the low disease
incidence and severity. Secondly, the rainfall pattern in the Northern region is seasonal with a
dry spell recorded in November to March. This period also coincides with the flowering and
early fruit set, the most susceptible stage of the fruit. The continuous rainy days without a dry
spell which leads to development of disease symptoms on older fruits is virtually non-
existent in the region. This unique rainfall pattern within the area may have contributed to the
absence of fruits with visible symptoms at the preharvesting stage. This presumably makes
the Northern Region very conducive and less expensive for the cultivation of mango fruits.
Consequently, more mango orchards are currently being set up in the area and if the trend
continues, the area may overtake the coastal savanna in terms of density of mango orchards.
The disease incidence and severity in the Brong Ahafo region was akin to what was recorded
in the Northern region. The Brong Ahafo region is a transition zone from the forest to the
Guinea savanna zone and hence climatic conditions and disease incidence and severity are
expected to be intermediate between the forest and interior savanna. During the study, the
trees found in the farms in the area were smaller and farms were relatively “cleaner” than
farms in the semi-deciduous forest. Cleaner farm practices coupled with high temperatures
would generally result in lower incidence and severity of the disease. Control measures such
as the application of fungicides would also be expected very efficient.
146
The prevailing climatic conditions in Ga West, Dangbe West, Yilo Krobo, Manya Krobo and
North Tongu in the coastal savanna were almost similar to what was recorded in the semi-
deciduous forest. During the study, rainfall and humidity were higher than the interior
savanna. Consequently, the disease incidence and severity recorded from farms in the zone
were intermediate between the semi-deciduous and the Guinea savanna agro-ecological zone.
These findings underscores the fact that the prevailing weather influences disease incidence
and severity in Ghana. These factors should be taken into consideration in the formulation of
a national control strategy for the mango anthracnose disease in Ghana.
The disease was also found after healthy fruits have been harvested stored for some time.
Results showed that postharvest anthracnose was prevalent in all the major mango growing
regions of the country. In most mango growing areas, it was believed that the disease was
only important at the postharvest stage and most control measures are aimed at preventing
disease development at this stage (Arauz, 2000). One major reason is the development of the
symptoms on fruits in storage or transit. Often such fruits might have been paid for and
therefore, their spoilage in storage is of much concern to exporters of the crop, since the
nature of the symptoms, irrespective of the size, renders the fruit un-marketable.
Comparatively more fruits were infected at the postharvest stage than the preharvesting stage
in all the districts, making the postharvest stage more destructive and confirm report from
elsewhere (Freeman et al, 1998). Unlike the preharvest stage where some of the diseased
fruits were marketable at least on the local market, the dark sunken lesions that developed on
fruits after postharvest renders those fruits unmarketable showing that the disease is a major
constraint on fruit production as well as marketing.
147
Though the incidence of postharvest anthracnose in the Savelugu/Nanton and Tolon/
Kumbungu districts of the Northern region was low, its detection is an indication that despite
the absence of the disease in the field the disease was not eradicated in the district.
Mango anthracnose disease was found to be a major cause of fruit quality and yield loss. The
disease caused dropping of fruits resulting in a direct yield loss of 6.4% and 29.9% of the
total fruits produced in the major and minor seasons respectively in a commercial mango
farm. Though it has been reported that the disease infects young fruits which eventually
shrivels and fall (Anonymous, 2013), quantitative estimates of the effect had not been
reported. The anthracnose disease in Ghana caused blemishes on the fruits resulting in the
reduction of marketable fruits by 22.9% in the minor season (Table 10). This qualitative loss
together with fruit drop of 29.9% resulted in a total of more than 50% of the total crop
produced in the minor season.
In a high value crop such as mango, yield loss up to 22.9% in a single season is unacceptable.
The expenses incurred in the production of the fruits are usually high and hence farmers are
likely to incur high loss in revenue with such high levels of yield loss. World production
records of mango fruits show that Ghana produced about 7000 MT of the crop in 2010
compared to 16,331, 400 MT from India, the world largest producer of the crop and 553, 710
MT from Kenya, the largest producer of the crop in Africa (FAOSTAT, 2010). The
production figure of Ghana is even lower than that of Cote d’Ivoire though Ghana has a
comparative advantage of a two production seasons which the other countries do not have.
This indicates that yield from the crop estimated at 11tonnes/Ha (MOFA, 2010) is one of the
lowest in the world. It is very obvious that the steady decline of the levels of production of
the crop in the country has been linked to dropping of immature fruits. However, the cause of
148
the problem was initially thought to be imbalances in nutritional status of the soils. Currently,
hormonal imbalances in the plant have been conjectured as the cause of the problem and
studies are on-going to evaluate some hormones such as Napthalene acetic acid (NAA) and
Gibberillic acid (GA3) to determine their ability to correct fruit drop. However, very little
focus has been directed at the losses caused by the mango anthracnose disease and possibly
other diseases such as the Xanthomonas fruit spot. This study has demonstrated clearly that
the anthracnose disease has the ability to cause substantial losses in yield and hence requires
more attention if the goal of increasing revenue from the crop is to be achieved in this
country.
Data from this research also show that yield/fruit quality loss was higher in the minor season
than the major season. This could be attributed to the continuous rains which were recorded
in the minor season coinciding with the early fruit development stage, compared to sparse
rainfall which was recorded during the major season. In effect the potential quantity of fruits
that could be produced in the minor season may not be realized and the contribution of the
season to the overall fruit production of the country within a particular year would be low.
This may account for the insignificant number of fruits sent to the export market by Ghana,
despite a possession of two production seasons within a calendar year. Consequently, despite
exporting the crop for the past 20 years, the country is still not considered an important
exporter on the world market (Anon., 1996).
In terms of aetiology, two Colletotrichum species have been recognized worldwide as
aetiological agents of mango anthracnose. In sub-tropical areas such as Brazil and Florida
both Colletotrichum gloeosporioides and Colletotrichum acutatum have been reported as the
causal agents of the disease (Peres et al., 2002; Davis, 1999) while Colletotrichum
149
gloeosporioides has been reported as the major cause of the disease in the tropics (Jeffries et
al., 1990). In Ghana, C. gloeosporioides is the only pathogen associated with the disease
(Oduro, 2000; Offei et al., 2008). To confirm that C. gloeosporioides is the causal agent of
the disease in Ghana, it was found to be very necessary to distinguish between the two
species since they are the only species currently reported on mango worldwide.
On mangoes and other fruit crops, growth rate and spore morphology have been commonly
used to distinguish between the two species with C. gloeosporioides showing a relatively
faster growth rate and possessing conical spores which are rounded at the edges compared to
the C. acutatum species that possess conidia that are fusiform in shape (Peres et al., 2002;
Martin and Garcia-Figueres, 1999; Bernstein et al., 1995). In this present study these
characteristics were found to be useful in distinguishing between isolates of Colletotrichum
species from mango in Ghana and elsewhere and C. acutatum from strawberry and bell
pepper. The isolates obtained from mango in this study produced acervuli with setae which
contained conical spores (Plate 5). These features of the isolates are consistent with the
description of C. gloeosporioides on mango (Ploetz, 1998; Agrios, 2005).
Apart from morphological characteristics, the use of biochemical reactions has distinguished
between different species of filamentous fungi (Paterson and Bridge, 1994). The casein
hydrolysis test has been used to distinguish between C. gloeosporioides and C. acutatum on
coffee and strawberry (Martin and Garcia-figueres, 1999). In this study also, the same
method was able to distinguish between the isolates from mango previously identified as C.
gloeosporioides with the morphological characteristics and the C. acutatum reference isolate.
This further confirms that the two species are distinct and hence the mango isolates in Ghana
are C. gloeosporioides and not C. acutatum. The other biochemical tests, i.e., the polyphenol
150
oxidase, the amylase and lipase tests were imprecise in distinguishing between the two
species, but nonetheless, confirmed that the isolates of the pathogen from mango were of the
same species.
Molecular characteristics have been found to be more reliable and some of the techniques
available were used to complement the morphological and biochemical characterization of
the pathogen (Bailey et al., 1996; Cannon et al., 2000; Freeman and Rodriguez, 1995;
Freeman et al., 2000). Species-specific primers that were designed based on dissimilarities in
the rDNA of putative species have been found to be very reliable in the diagnosing of
diseases caused by either C. gloeosporioides or C. acutatum (Sreenivasaprad et al., 1994).
The use of these primers have been evaluated against other diagnostic methods and found to
be very robust in distinguishing between isolates of the two species infecting a wide range of
plants (Liu et al., 2010). On mango, the method was used to complement morphological and
physiological methods to correctly differentiate between isolates identified as C.
gloeosporioides and C. acutatum infecting the crop in Brazil (Peres et al., 2002). In section
4.6.3.1 of this thesis, the use of the species specific primers in the polymerase chain reaction
gave results that were consistent with results obtained by Peres et al, (2002) and identified
the isolates of the pathogen from only mango as C. gloeosporioides thereby separating them
from the C. acutatum isolates from the bell pepper and strawberry.
Restriction digestion of the amplified ITS region carried out in the study involved the use of
one of the common enzymes that has been used elsewhere to distinguish between C.
gloeosporioides and C. acutatum (Abang, 2003; Martin and Garcia-Figueres, 1999). The Hae
III enzyme cleaved the products of all isolates of the pathogen from mango at the expected
points resulting in the RFLP profiles similar to what has been obtained for C.
151
gloeosporioides in previous studies (Abang, 2003; Martin and Garcia-Figueres, 1999)
showing that all the isolates of the pathogen from mango in Ghana were C. gloeosporioides.
In current phylogenetic studies of the genus Colletotrichum, several genes have been found
to be more phylogenetically informative than the ITS region. Among these is the glutamine
synthetase gene (Liu et al., 2010). The nucleotide sequences of the gene in the isolates of the
pathogen were found to be distinct compared to isolates of C. acutatum by possession of a
long chain of the nucleotide ‘T’ at the beginning of the gene intron (Fig. 6). According to Liu
et al., (2010), the presence of the ‘T’ chain is unique to C. gloeosporioides and several
isolates of the pathogen collected from a wide range of tree species showed this long chain
which is a diagnostic feature of members of the species. In fact, due to the presence of this T
chain, it was always found necessary for the design of a second internal primer before the
whole complement of the nucleotide sequences of the intron of the glutamine synthetate gene
could be obtained for isolates of C. gloeosporioides but this has not been found necessary in
other species (Liu et al., 2010). Therefore, by virtue of the possession of the poly T chains at
the beginning of the glutamine synthetase gene intron, the isolates of the pathogen infecting
mangoes in Ghana were identified as C. gloeosporioides, and augmenting the results of the
other methods employed in the identification in the present study.
In section 4.6.3.5 of this thesis, the phylogram (Fig. 9) drawn with the ITS1 region nucleotide
sequences of the isolates obtained from mango and those retrieved from the EMBL
GeneBank, resulted in clustering of the mango isolates from Ghana and other distinct species
in the same clade identified as the C. gloeosporioides complex. The cluster showed that the
mango isolates shared very similar nucleotide sequences in the ITS1 region with other
species which had been identified as members of the C. gloeosporioides complex (Damm et
152
al., 2010). In the same phylogram, the clade containing the mango isolates was formed far
away from the clade containing the C. acutatum species, indicating that the mango isolates
were not C. acutatum. These two features of the phylogram showed that the mango isolates
must be C. gloeosporioides.
From the on-going discussion, it could be inferred that the several methods, namely
morphological, biochemical, PCR with species specific primer and sequence analysis of the
glutamine synthetase gene intron and of the ITS region showed unequivocally that the
pathogen causing mango anthracnose in Ghana is C. gloeosporioides, thereby confirming the
identification of the pathogen by earlier researchers in the country (Oduro, 2000; Offei et al.,
2008). However, the identification of the pathogen in this study may indicate that the name
C. gloeosporioides refers to the group species that the pathogen belongs to rather than the
true species of the pathogen. The name C. gloeosporioides has been used interchangeably to
refer to C. gloeosporioides sensu stricto, a pathogen originally obtained from citrus and C.
gloeosporioides sensu lato, the group species encompassing several species including C.
gloeosporioides sensu stricto, C. kahawae, C. musae and other several undescribed species of
Colletotrichum brought together by possession of similar spore morphology and ITS
nucleotide sequences (Damm et al., 2010). If the naming of the pathogen in Ghana was in
reference to its group species name, then the naming is probably correct. However, if it refers
to its species, more data will be required to confirm this. This is because morphological
characterization and the ITS region are only effective in placing unknown isolates into their
group species but cannot be used to delimit species within complexes into their respective
species (Abang, 2003; Phoulivong et al., 2010).
153
Pathogenicity tests in section 4.7.1 and 4.7.2 of this thesis using isolates of the pathogen from
mango in Ghana resulted in the expression of the same disease symptoms on tests crops as
was recorded in the field. Subsequently, these isolates were re-isolated from the necrotic
lesions induced on the test fruits. This effectively confirms the isolates as the causal agent of
the disease in Ghana. This finding therefore confirms the earlier reports that C.
gloeosporioides was the pathogen responsible for the disease in Ghana (Oduro, 2000; Offei
et al., 2008). Since C. acutatum was not isolated and identified on mango in Ghana, it was
not considered as an aetiological agent of the disease in Ghana. This therefore supports the
reports that C. acutatum may not play a major role in the aetiology of mango anthracnose
disease in the tropics (Jeffries et al., 1990).
Every isolate of the pathogen used in the study was found to be pathogenic to the different
cultivars of the crop used in the study, indicating that each of the isolates collected from the
different locations of Ghana was capable of causing disease epidemics irrespective of the
variety being grown in Ghana. The isolates of the pathogen could not be differentiated based
on their district of origin in Ghana as the different isolates from the different districts induced
the same disease severity on the inoculated fruits of mango. This may indicate a uniform
spread of different virulent types of the pathogen in the districts. The attachment of C.
gloeosporioides to the stem tissues of the mango planting material (Johnson et al., 1992)
could facilitate the distribution of the different strains in the various districts
The study also showed that none of the major cultivars of the crop namely, Keitt, Kent,
Hdaen, Palmer, Irwin and Tommy Atkinson was resistant to the disease. This finding
informed the need for other methods of control such as fungicide application. Therefore, in
Ghana, the choice of cultivar to grow will depend more on the preference for the cultivar on
154
the international market than on its ability to withstand the anthracnose disease. Cultivars
such as Keitt and Kent are common in the Northern part of the country where organic
farming is being practiced mainly because of market preference.
One major problem concerning the aetiology of mango anthracnose is the unresolved issue of
the true species of the causal agent. The ITS region has been used severally to resolve
systematic issues within the genus Colletotrichum (Mills et al, 1992; Sreenivasaprad et al,
1996). In section 4.6.3.5 of this thesis, analysis of the nucleotide sequences of the ITS region
of isolates showed that there were variations in nucleotide sequences among the different
isolates of the pathogen obtained from mango and the type strain of C. gloeosporioides (CBS
953.7) and several other isolates. In the phylogram drawn, several isolates of different
species including the isolates obtained from mango in Ghana clustered together with the C.
gloeosporioides type strain (Table 14 and Fig. 7). Sequence comparisons showed that some
of the isolates of the pathogen from mango in Ghana shared a higher sequence homology
with the C. kahawae strain than with the C. gloeosporioides type strain (CBS 953.7) while
others shared the same sequence homology with both reference strains. The implication is
that some of the mango isolates could also be named as C. kahawae, rather than C.
gloeosporioides. This overlap of sequence divergence among species was also observed by
Sreenivasaprad, et al, (1996). Consequently, they suggested that the C. gloeosporioides
complex must be defined to contain the C. kahawae species and other distinct species that
showed a high sequence homology (>96.7%) with the C. gloeosporioides type strain.
What this suggests is that the pathogen infecting mango in Ghana and elsewhere may not
necessarily be C. gloeosporioides sensu stricto, but are species that can be accommodated
within the C. gloeosporioides complex. All species found in the C. gloeosporioides complex
155
possessed the same type of conidia which are short and rounded at the edges (Damm et al,
2010). This may be the reason why the pathogen infecting mangoes in Ghana was identified
as C. gloeosporioides earlier (Oduro, 2000; Offei et al, 2008) despite the absence of
molecular characterization. Therefore, the naming of the pathogen infecting mangoes in
Ghana was in reference to its group species name and not the true species of the pathogen.
This inadequacy of the ITS region to delimit species in species complexes has been observed
and attributed to its representation of a small proportion of the total genome (Abang, 2003)
Accordingly, it has been proposed that DNA from multiple loci is needed to be analysed to
provide independent evidence of lineages to evaluate species level systematic within
Colletotrichum genus (Cannon et al., 2000; Talhinhas et al., 2005). In this study, three loci,
the intron of the GAPDH and beta-tubulin genes and the ITS region were sequenced and
studied to obtain information for the resolution of the systematic issues pertaining in the
aetiology of mango anthracnose in Ghana. Similar to other gene regions such as the actin
gene and the 1st intron of the beta tubulin genes, the two introns employed in this study has
been found to be very phylogenetically informative and hence combined with the ITS region
and used to identify several species (Guerber et a.l, 2003; Liu et al., 2007; Prihastuti et al.,
2009; Phoulivong et al., 2010). These gene regions had either been combined to draw one
single gene tree (Phoulivong et al., 2010) or used to draw individual trees in The
genealogical concordance of phylogenetic species recognition (GCPSR) (Taylor et al, 2000)
to place isolates in species complexes into their respective species. In this study the GCPSR
was employed to delineate the species of the isolates of C. gloeosporioides infecting mango
in Ghana.
156
It is well documented that the GCPSR which relies on the drawing of different gene trees for
identification of species (Taylor et al, 2000) has been used to identify fungi species within
species complexes (O’Donnell et al., 1998; Koufopanou et al., 1997; Geiser et al., 1998; Ane
et al., 2007). By employing the analysis of nucleotide sequences, changes in nucleotide
sequences can long be detected before they manifest in morphological changes or biological
behaviour of the individual (Taylor et al., 2000). In the C. gloeosporioides complex where
cultural and morphological characteristics were not enough to separate species, the most
reliable method for the delineation of species was therefore the use of phylogenetic studies
using three different genes such as in this instance reported here.
Based on the three phylograms drawn in this thesis (Fig 8 A, B and C) the isolates of the
pathogen infecting mango in Ghana, Florida, Mexico and Puerto Rico were found to belong
to different species within the C. gloeosporioides complex. The representative isolates of the
pathogen from Ghana fell into three different categories of phylogenetic species. Two of the
reference isolates MAN-GH10 (representing 2 out of 45 isolates) and MAN-GH12
(representing 27 out of 45 isolates), could not be sufficiently identified hence were
tentatively identified as Colletotrichum species. On the other hand the third representative
isolate, MAN-GH21 (representing 16 out of 45 isolates) was identified C. asianum. In all the
three phylograms drawn, the representative isolate, MAN-GH21 clustered with the
representative C. asianum isolates and hence in consistence with the principle of the GCPSR,
the isolate was identified as C. asianum. The identification of C. asianum in this study agrees
with reports from Thailand where it was isolated from anthracnose symptoms on mango and
identified using five different gene regions (Phoulivong et al., 2010). This pathogen is being
157
reported for the first time in Ghana and has previously been found only on coffee (Prihastuti
et al., 2009).
The current level of the identity of the pathogen is important information for the current
evaluation studies on-going elsewhere to control the pathogen on mango using natural
enemies including bacterium (Govender et al., 2005). Currently, most of these studies focus
on the mango phylloplane as a source of antagonistic agents. However, having realized the C.
asianum which originally was found on coffee (Prihastuti et al., 2009) is the target pathogen,
the coffee phyllopane could offer a better alternative source of antagonistic agents for the
control of the anthracnose disease on mango.
The results obtained with the analysis of the three gene regions, namely the internal
transcriber spacer (ITS) region and the introns of the glyceraldehyde-3-phosphate
dehydrogenase and the beta tubulin gene were confirmed by the results of the BLAST search.
In most situations the isolates possessing similar nucleotide sequences as the representative
isolate MAN-GH21 of the pathogen in this study were reported as C. asianum rather than C.
gloeosporioides (www.ncbi.nlm.nih.gov). The results further showed that isolates with
sequences same as the representative isolates, MAN-GH10 and MAN-GH12 were being
identified as C. siamense, C. fructicola or C, gloeosporioides. This presumably indicates that
most researchers were confused about the identity of those isolates and hence justify
referring to them as Colletotrichum species such as in this study based on the analysis of the
different gene regions.
The pathogen responsible for mango anthracnose in Ghana, Florida, Mexico and Puerto Rico
were identified as species of different phylogenetic lineages in contrast with previous reports
158
that one type of C. gloeosporioides (usually referred to as the mango bio-type of C.
gloeosporioides) was responsible for the disease in humid tropical areas (Dodd et al., 1997;
Jeffries et al., 1990). In addition to the three different species identified in Ghana, isolates
from Puerto Rico and Florida were all found to be of different phylogenetic species. This
shows that different Colletotrichum species may be involved in the mango anthracnose
disease aetiology worldwide. Earlier researchers have observed genetic differences among
isolates of the pathogen on mango but had identified them as variants of C. gloeosporioides
(Alahakoon et al., 1994, Hodson et al., 1993). It could be conjectured that the taxonomy of
the pathogen infecting mangoes worldwide is not yet fully elucidated in some areas and this
could pose a risk in the dissemination of quarantine pests through mango fruit trade as
isolates with same morphology as the C. gloeosporioides sensu stricto may be identified as
C. gloeosporioides, in the absence of molecular studies. The need for updates of plant
pathogen checklists in countries where mangoes are grown to reflect the current observations
in this thesis could make them more relevant for both the pathologist and the plant health
practitioners to apply correct control strategies.
It has been reported that C. gloeosporioides was responsible for mango anthracnose in most
tropical areas (Jeffries et al, 1990). In other sub-tropical areas, ITS sequence analysis was
combined with molecular studies to justify the naming of the pathogen as C. gloeosporioides.
If the naming was in reference to the species complex to which the isolates belong, the
identification would be correct, but if it referred to the same pathogen originally found on
citrus, known as C. gloeosporioides sensu stricto, the naming would be wrong. It is widely
conjectured that the former is likely. Indeed, that the pathogen has been wrongly identified as
C. gloeosporioides was reiterated by other plant pathologists who believed that the wrong
159
identification of the pathogen was due to the comparison of unknowns to the wrong type
strains (Phoulivong et al., 2010).
It has been reported that the strain of C. gloeosporioides naturally infecting mango is
pathologically different from strains of the pathogen from other fruit crops (Hayden et al.,
1994) and maintains its genetic identity irrespective of its geographical location in contrast to
the other isolates of the pathogen on other fruit crops (Hodson et al., 1993; Hayden et al.,
1994; Sreenivasaprad et al., 1996). This strain is generally referred to as the mango bio-type
of C. gloeosporioides. In an instance when other strains of the pathogen with different
mtDNA and rDNA restriction profiles (compared to these profiles of the mango bio-type)
were found on mango, these strains were suspected to have cross-infected mango on the field
(Alahakoon et al., 1994) which could be interpreted to mean that these ‘foreign’ strains were
contributing to the anthracnose disease epidemiology on mango in the field.
The mango bio-type of C. gloeosporioides infecting mango could be distinguished from the
isolates on the other fruit crops based on two substitutions at the 78th and 138th nucleotide
positions of the ITS1 region (Mills et al., 1992). In this present study the two substitutions
were found at the 73rd and 133rd due to the point at which the ITS1 region started (Fig. 11).
Among the three representative isolates of the pathogen from mango in Ghana, the
representative isolate MAN-GH21 was identified as the mango biotype of the pathogen. This
meant that out of the 45 isolates subjected to the molecular characterization studies, 16
(represented by MAN-GH21) were mango bio-type of the pathogen. The pathogen was found
to share the same ITS nucleotide sequences with the isolate from Sri Lanka and Mexico and
may therefore be clonal (Fig. 11). This is consistent with reports that the mango bio-type of
the pathogen is genetically uniform irrespective of its geographical location (Mills et al.,
160
1992; Alahakoon et al., 1994; Hayden et al., 1994) and hence its identification in this study
agrees with its identification elsewhere. All the 16 isolates identified as the mango bio-type
were the same isolates identified earlier in section 4.6.3.6. in this thesis as C. asianum.
Therefore, the pathogen widely identified as mango bio-type is indeed C. asianum. This may
explain why the mango bio-type had been observed to be genetically and pathologically
distinct compared to other strains of C. gloeosporioides found on mango (Mills et al., 1992;
Hayden et al., 1994).
Cross infectivity trials using detached fruits showed that some of the isolates obtained from
mango in Ghana showed limited infectivity to avocado and papaya while the remaining were
very virulent to mango. These isolates were somehow restricted to the mango crop. This
finding is similar to reports by Hayden et al, (1994). They complemented the infectivity
studies with molecular characterization and consequently identified these isolates as mango
bio-type of C. gloeosporioides. Results obtained in section 4.8.2 of this thesis, cross
infectivity studies using 100 isolates of the pathogen from mango in Ghana which were
inoculated into mango, papaya and avocado fruits showed that some of the isolates (32)
could not cause the disease on some of the inoculated avocado and papaya fruits whilst they
were able to cause the disease on all mango fruits inoculated. These isolates showed limited
infectivity on the avocado and papaya fruits while they were very virulent on mango. These
isolates were therefore identified as the mango bio-type of C. gloeosporioides similar to the
identification of the pathogen by Hayden et al, (1994). Among the isolates identified as the
mango bio-type based on infectivity studies were the 16 isolates earlier on identified as
mango bio-type of C. gloeosporioides using molecular characterization in section 4.6.3.8.
161
This indicates that the identification of the isolates using cross-infectivity studies was
credible.
The cross-infection studies also showed that among the different fruit crops used in the study,
mango was more readily infected compared to avocado and papaya, requiring no wounds to
be infected by the pathogen. On the other hand, the other fruit crops especially papaya
required wounding before the pathogen could elicit the disease symptom. This means it is
easier for the isolates of the pathogen from other fruit crops to cross-infect the mango fruit on
the field, than for the mango biotype to cross-infect the other fruit crops. This may explain
why the pathogen from the other fruit crops was found on mango in this and previous studies
(Alahakoon et al., 1994). In contrast the mango bio-type has not been found on any other
fruit crops (Hodson et al., 1993), meaning cross-infection of the mango bio-type onto the
other fruit crops may not occur in nature.
The behavior of the mango bio-type of the pathogen in terms of its restriction to the mango
crop has not been fully elucidated. It is reported that the pathogen may have co-evolved with
the crop and may therefore be more aggressive to the crop than other strains of the pathogen.
However, its limited infectivity on the other fruit crops cannot be explained by co-evolution.
Morphologically, the mango bio-type of the pathogen could not be distinguished from the
other strains of the pathogen based on the type of structures produced by the germinating
spore. During the study, conidia from both the mango bio-type and the other strains from
avocado and papaya were found to germinate and produce a hyphae which terminates in a
bulbous appressorium of the same shape. This growth and development of the pathogens
observed in this study is a characteristic of the members of the genus Colletotrichum. It has
been reported that eventually, the appresssorium produces infection pegs with which the
162
pathogen penetrates and ramifies into the tissues of the host, using some types of enzymes
(Prusky, 1996). The similarity in the types of infective structures formed by the two types of
strains of the pathogen is an indication that any variations in terms of their pathogenicity
would depend on either the type of enzymes produced for the penetration, or on the type of
defensive structures that the host puts in place to defend itself as well as the anatomy of the
pericarp tissues of the host or the nature of the toxins produced by the pathogens to induce
the disease. Since the infective propagules of the pathogen were placed in a direct contact
with the internal tissues of the host through wounding, the infectivity of the isolates may not
be due to processes of penetration or the anatomic structure of the underlying tissues.
However, what cannot be ruled out is the nature of toxins or elicitors employed by the
pathogens to cause the infection of hosts.
Toxins are reported to be involved in the pathogenicity of C. gloeosporioides on crops.
According to Abang, (2003), the variations in pathogenicity of two strains of the pathogen
infecting yam in Nigeria could be traced to their variations in the nature of their secondary
metabolites and ultimately, the type of toxin(s) they produced. In this study, the secondary
metabolite profiles of the isolates were compared to determine differences between the two
strains. Though slight variations were observed among the chromatographic profiles of
individual isolates, the differences were not adequate to separate the isolates into the two
strain types (ie., mango bio-type and other strains), indicating that similar secondary
metabolites are produced by the two types of strains of the pathogen. It implies that during
the infection of the host, the different strains of the pathogen may release similar toxins into
the host cells. Presumably, fruits of avocado and papaya may be producing elicitor reactions
to these metabolites different from mango in response to the invasion by the mango bio-type
163
of C. gloeosporioides. This kind of elicitor responses therefore may have conferred varying
degrees of protection of the different fruits used in the study from the mango bio-type. The
response from these fruits may be such that avocado and papaya were protected to a higher
degree than mango. Eventually, the disease incidence may be reduced in the other fruits
compared to the mango.
In mango a compound, resorcinol: 5-(2(Z)-heptadecenyl) resorcinol has been isolated from
the latex and pericarp and found to have antifungal properties. Its concentrations in the
pericarp of the mango fruit has been found to correlate with the susceptibility of the fruit to
the anthracnose disease and hence is regarded as the major chemical induced by the host to
fight against the infection (Bandyopadhyay et al., 1985). In the latent infection of mango, the
pathogen enters into a period of dormancy till the concentration of the resorcinol level is
dissipated. It is conjectured that avocado and papaya tissues may be producing higher or
more potent concentrations of the antifungal chemical in response to invasions by the mango
bio-type of C. gloeosporioides than when invaded by other strains of the pathogen. It could
also be that the introduction of the mango bio-type of the pathogen triggers a series of
reactions in the avocado and papaya fruits which result in dissipation of the antifungal
substance at slower rates compared to when other strains of the pathogen infect these fruits.
Consequently, the growth and development of the mango bio-type of C. gloeosporioides is
impeded or the incubation period of the disease is prolonged indefinitely. These postulates,
however, require elucidation in future studies.
The confirmation of the mango bio-type of C. gloeosporioides on mango in Ghana using
both molecular technique and cross-infectivity studies raised questions on the origin of the
isolates of the pathogen that were not the mango bio-type of the pathogen. Using the same
164
analysis of the ITS1 nucleotides, these isolates were found to be the same as the isolates from
the other fruit crops notably citrus, papaya and avocado. A further analysis of the entire ITS
region showed that isolates in the rDNA-ITS1 group 1(represented by MAN-GH12) showed
a 100% sequence homology with the isolate from avocado an indication that those isolates
are originally from avocado (Table 15). The cross infectivity trials also show that these
isolates (68 including those identified as strains from other fruit crops using molecular
characteristics) behaved the same way as the isolates of the pathogen isolated from avocado
and papaya. These confirm that the avocado isolates had cross-infected the mango in the
field. Similar findings have been reported by Alahakoon et al., (1994) in Sri Lanka where the
same strains of the pathogen found on avocado were found on the mango. Alahakoon et al.,
(1994) indicated that the high monsoon winds facilitated the movement of the strains from
avocado to mango in orchards where the two crops are grown in some form of mix cropping.
In Ghana, other fruit crops including avocado are found in mango orchards. Therefore,
conditions also exist for these strains to cross-infect the mango fruits in the field as in Sri
Lanka. Therefore, in addition to the mango bio-type of C. gloeosporioides, other strains of
the pathogen originally found on avocado were also found on mango in Ghana.
Consequently, these isolates were considered to have cross-infected mango in the field.
Cross infection of mango by the other strains of the pathogen from other fruit crops means
that their involvement in the disease epidemics cannot be ruled out. They need to be
considered when applying control measures against the disease in the field. One way is to
avoid these other fruit crops particularly, avocado in mango orchards to prevent not only,
cross-infection of the mango crop but also to prevent the avocado or any other tropical fruits
from being used as alternative hosts by the pathogen from mango. In old orchards where
165
these other fruit crops are well established, if cutting them down is not desirable, then control
measures targeting the pathogen on mango must be extended to target the pathogen on these
other fruit crops as well.
Another major implication of the finding is its influence in the development of resistant
varieties of the crop. Currently, based on the premise that only one type of C.
gloeosporioides was responsible for most anthracnose on mango worldwide with C.
acutatum playing a minor role, new methods are being developed based on the biology of the
isolate, widely referred to as the mango bio-type of C. gloeosporioides. According to
Alahakoon et al., (1994), there is the potential of producing planting materials free from the
pathogen using tissue culture techniques to exclude the pathogen in stem tissues or by
selecting somoclonal variants resistant to the pathogen. Despite the potential of this method,
its application in a country such as Ghana would not be successful since other isolates of C.
gloeosporioides were found, contributing to the disease epidemiology.
Another important finding is that these other strains of C. gloeosporioides were also isolated
from fruits collected on farms where these trees were not found. This indicated that these
strains are also being distributed with planting materials and therefore, their involvement in
the disease epidemiology cannot be eradicated simply by excluding the hosts. Due to this
there is the need for the biology of these isolates to be studied so as to provide sufficient
information for their inclusion in any mango anthracnose control protocol that may be
developed against the disease on mango.
The effect of mango anthracnose disease on the fruit juice quality of the crop has largely not
been assessed, prior to this work. This was assessed in this study using the total soluble solid
166
content and organic acid content of the fruits. Total soluble solid and organic acid content are
two important parameters used to determine the juice quality of a fruit and subsequently
influences consumer’s acceptability of fruits (Zapata et al, 2008). In section 4.10.3 of this
thesis, the Total Soluble Solid and Total Titratable acidity content and the ratio of the
TSS:TTA of both healthy and diseased mango fruits infected at different severity levels of
mango anthracnose disease were determined to evaluate the effect on the juice quality of
mango. The results showed that the ratio TSS: TTA and hence the fruit juice quality was not
significantly affected by the mango anthracnose disease. This finding is similar to what was
reported by Brentu et al (2010) that ratio of the TSS:TTA in orange fruit and hence the juice
quality remains largely unaffected by the presence of the black spot disease caused by
Guinardia citricarpa. Certain post harvest fungi such as Aspergillus niger and Pestalopsis
anonicola have been reported as causing depletion of total sugar content and other nutrients
in the mango fruit (Reddy and Laxminaraya, 1984; Chaudary et al., 1986; Arya, 1992).
These pathogens usually penetrate the infected fruits causing rot of both the external and
internal parts of the fruits. In contrast, the disease lesions caused by C. gloeosporioides on
mango are mainly restricted to the fruit pericarp (may penetrate into the pulp when fruits are
heavily infested) and hence the quality of the juice was not expected to be affected. The
restriction of the mango anthracnose disease lesion to the fruit pericarp of the fruits used in
this study was similar to the restrictions of the lesions of the black citrus black spot attributed
to Guinardia citricarpa on the citrus fruit pericarp (Brentu et al., 2010). Consequently in
both instances, the juice quality of the fruits was not affected by the diseases.
On the local market in Ghana, fruits showing different rates of the disease are seen being
marketed. Except in very extreme cases where the diseased fruits are rotten, mango fruits
167
showing the anthracnose disease symptoms are rarely discarded. In these retail outlets, it is
common to see the fruits showing different severity levels of the disease going for the same
price. What can be conjectured from this is that consumers are aware that the disease does
not affect the juice or eating quality of the fruit. The findings of this work therefore support
such thinking as both the diseased and healthy fruits largely showed the same juice quality.
What remains to be carried out is a sensory evaluation by a taste panel on the organoleptic
and sensoric qualities of the juice from differently infected fruits as compared to the healthy
fruits in order to authenticate this view point.
Rejection of mango fruits showing anthracnose disease symptoms in international markets
may have very little to do with the effect of the disease on the juice quality. In these markets,
blemishes of any kind, once visible render fruits unsuitable for the market. Therefore
rejection of such fruits may have more to do with aesthetic than nutritional value. Also, it
would be impossible to convince consumers in international markets that a blemish seen on
the skin does not penetrate into the pulp (since heavily diseased fruits in which pulp is
affected as well are not likely to be sent to the international markets).,Consequently, fruits
showing the disease symptom at any level will understandably be rejected.
Mango anthracnose can be a devastating disease and hence measures are needed to be put in
place to control it. In Ghana, mango farmers continue to report that fungicides currently
available for the control of mango anthracnose are ineffective, raising questions as to whether
the causal agent had developed resistance to these fungicides. Therefore, as part of this
research, it was expedient to determine whether the causal agent of the disease in Ghana had
actually developed resistance to these fungicides. An in-vitro study of the growth of the
pathogen was assessed on PDA amended with eight different fungicides (Table 7) available
168
on the Ghanaian market. This technique has been used by several authors elsewhere and
found to be very reliable in assessing resistance of pathogens to fungicides (Sariah, 1989;
Sanders et al., 2000; Peres et al., 2002). The pathogen was found to be susceptible to all the
fungicides tested. There was no growth in the plates amended with the recommended rates of
the fungicides. Reports that the fungicides were ineffective may be attributed to other factors
than the development of resistance strains of the pathogen.
In section 3.10.2 field work to assess the efficacy of the fungicides against the disease for the
production of exportable quality mango fruits was carried out in two seasons (major and
minor) under prevailing environmental conditions in most of the major mango production
areas. In the minor season of 2010, the period of the experiment coincided with rains that fell
continuously over a certain number of days, a condition that was known to favour conidia
dispersal and increase in disease incidence and severity (Fitzell and Peak, 1984; Dodd et al.,
1991a). During the period, all fungicidal treatments were found to be effective in reducing
the incidence and severity of the disease and resulting in a higher percentage of exportable
fruits compared to the non-treatment control (Table 23). This confirms that the chemicals
used in the study were effective against the pathogen and corroborates the results of the in-
vitro studies. Therefore, if farmers in Ghana were recording poor control with these
fungicides other factors may be involved rather than the reduced efficacy of the fungicides.
One of these possible factors is the absence of proper tree maintenance and farm sanitation in
most of these farms. Apart from reducing the humidity in the tree canopy, removal of excess
foliages from trees also reduces the reservoirs of the conidia in the tree canopy which are the
primary sources of inoculum (Fitzell and Peak, 1984). However, the short interval between
seasons within the coastal savanna zone, where fungicides are mostly reported to be
169
ineffective (Odzeyem, 1998), does not permit the intense tree pruning that was employed in
this study to complement the fungicide treatments. Consequently, there could be a build-up
of inoculum in the farm and disease severity would increase. Under such circumstances
chemical application would have to be carried out at higher doses, an activity that the farmers
are unlikely to carry out due to the higher costs involved.
During the major season trial, there was no significant difference (p>0.05) between
treatments, showing that the control was as effective as any of the fungicides applied. This
could be attributed to the absence of rainfall which resulted in a lower dispersal of conidia
resulting in low disease incidence and severity. This finding is consistent with the report that
when fruits are produced in the dry season good control of the disease can be achieved
without the application of any fungicides (Arauz, 2000). In most of the mango production
seasons within the coastal savanna zone, the transitional and the Guinea savanna zones
rainfall is rarely recorded during the major mango production seasons (especially when fruits
are at their most susceptible stage) and therefore good control of the disease could be
achieved without the application of fungicides. Indeed, this is mostly the case in the Guinea
savanna where mangoes earmarked for the international organic markets are produced in
Ghana.
When conditions favour the development of the disease in the field, Bendazim was found to
perform better than all treatments, (except Funguran), reducing the disease incidence and
thereby increasing the number of exportable fruits. The fungicide Bendazim (Carbendazim)
together with Benomyl has been reported as being very effective against the disease before
resistance to the latter developed in the field elsewhere (Akthar et al., 1998; Akem, 2006).
One reason that accounted for superior performance of Carbendazim was its systemic nature
170
which enables it to be retained in the tree system while the contact fungicides such as Ivory
may be washed away or have their concentrations diluted by the rains. Secondly, being a
systemic fungicide, it may be more effective being applied at bi-weekly intervals than the
other fungicides which are mainly contact (Ullasa, 1989). Other fungicides such as Agriette
and Sundomil also contain some active ingredients which are systemic in nature, but are not
known to be effective against the pathogen which is an Ascomycete (Ware, 1998). Despite
the advantages of Carbendazim, its use is very limited to few farms currently applying the
chemical in their fields. One of the reasons for this is the fear of chemical residues being
absorbed in the final produce. Despite the advice for adherence to preharvesting intervals,
farmers are not willing to risk the use of the chemical.
Mancozeb, is a dithiocarbamate fungicide which is highly effective for the control of
anthracnose (Arauz, 2000). In this field work it was found to perform better than the control
but was inferior to the Bendazim. Mancozeb is a contact fungicide and fungicides of such
nature are required to be applied at shorter intervals to achieve the same results as systemic
fungicides which are applied at bi-weekly intervals (MacMillan, 1984). In Ghana, weekly
application of fungicides of any type is considered too expensive by farmers and hence,
Mancozeb, if applied would be done at bi-weekly intervals. In such a case, good control is
not likely to be achieved especially, when conditions favour the development of the disease
in the field. In this present study Mancozeb was applied at bi-weekly intervals but was found
to be effective compared to the control and when applied either singly or in combination with
other chemicals, it resulted in a harvest of more than 50% exportable fruits in the minor
season when conditions were favouring the development of the disease. This indicated that
despite, the recommendations that contact fungicides are applied weekly, a bi-weekly
171
application could also yield good results. The removal of excess foliage from trees prior to
the application of fungicides resulted in the reduction of the sources of inoculums in the tree
canopy. This cultural treatment could be a simple method that aided the Mancozeb to
perform better. In the coastal savanna zone of Ghana there are two mango production seasons
within a calendar year and hence the short interval between the seasons do not allow enough
time for the proper tree pruning before flowering. Consequently, inoculum build up in the
farms may be very high and bi-weekly applications of a contact fungicide may not achieve
much in terms of control. It is therefore recommended that farmers who prefer Mancozeb
(because it is a contact fungicide and hence less likely to leave residues in the final product)
must strategise in such a way that tree pruning and farm clearing are carried out long before
flowering of trees begin.
Funguran, a copper based fungicide was found to be as effective as the Bendazim and
provided a better control of the disease than the Mancozeb (Table 23). It has been reported
that copper based fungicides (especially the oxides of copper) are usually less effective than
the dithiocarbamates especially under high disease pressure (Arauz, 2000). However despite
the reports of lower potency of copper based fungicides, it is unclear whether the hydroxide
form of the element (the active ingredient in Funguran) had also been found to be of low
potency against the disease. The performance of the Funguran in this study may be similar to
what some farmers may be experiencing in their farm. Consequently, Funguran remained the
only type of fungicide that was used on some of this farms producing for the European
market. However, it must be stressed that the good farm sanitation practices carried out
during the trial was an important factor needed to attain good control results with most
fungicides including the copper based ones.
172
From the on-going discussions, it can be seen that several options exist in terms of
availability of fungicides and when combined with good farm sanitation each can be used to
achieve excellent control on most farms. It is also worth mentioning that continuous
application of fungicides season after season as currently pertains in the coastal savanna may
not be necessary and that in some seasons particularly, the major seasons, field application of
fungicides may be waste of resources.
The control of mango anthracnose at the postharvest stage is very important as it prevents the
rejection of fruits with blemished skins. In this study, Prochloraz either at ambient
temperature or at 53ºC was able to totally control the disease on the mango fruits at the
postharvest stage, irrespective of the preharvest treatment that the fruits had received. The
high performance of the fungicide has been reported by several authors and has also been
identified as an effective alternate to Benomyl (Dodd et al., 1991b), which was the most
potent fungicide until resistance was developed in the field (Akem, 2006). In Thailand,
postharvest dip of mangoes in prochloeaz was found to be more effective in controlling the
disease than Benomyl (Visaprathanonth and Puagmee, 1989). Therefore, the effective control
obtained with dipping of fruits in the prochloraz fungicide in this study was consistent with
earlier reports. In another study in Phillipines, the fungicide was not able to totally eradicate
the disease on the fruits despite its better performance than the water control (Dodd et al.,
1991). Changes in results obtained with the same fungicide from different locations have
been reported and the varying response of different cultivars of the crop has been reported as
responsible for these changes in potency of the fungicide on mango. For example it was
reported that in the Philippines, different results in terms of anthracnose control was obtained
when different cultivars of mango were dipped in the same fungicide (Hatton and Ryder,
173
1965). According to Dodd et al, (1991), the Caraboa cultivar of mango, by virtue of its
thinner cuticle in comparison to other cultivars, is more responsive to Benomyl dips than
other varieties. This further demonstrates that the good disease control achieved with the
prochloraz fungicide in contrast with the results obtained in the Phillipines could be due to
differences in anatomy of the pericarp of the fruit rather than differences in efficacy of the
fungicide.
The fungicide dips of the prochloraz at both the ambient and 53°C yielded the same level of
control of the disease. In terms of cost, the ambient treatment is preferable since costs may be
incurred in provision of energy to maintain water at a higher temperature. Also, dipping in
prochloraz at ambient may not require any complex structures to handle the large number of
fruits destined for the market and hence can be practiced by most farmers. On the other hand,
though moderately hot water was able to reduce the disease severity compared to the water
control the levels of the disease on the surface of the fruits after storage still reduces the
aesthetic value of the crop and consequently, these may not be marketable, resulting in losses
to retailers. Since prochloraz is acceptable on fruits destined for most markets, the fungicide
offers the best option for the control of postharvest anthracnose better than even the most
potent fungicide like carbendazim that can control the disease in the field.
This thesis has shown that the anthracnose disease was not found in 5 out of 12 districts
surveyed in the country. The incidence ranged from none in the Hohoe, Berekum, Kintampo,
Savelungu/ Nanton and Tolon/Kumbugu districts to total infection in Kwaebibrem and
Kumasi districts in the major mango growing seasons of 2010 and 2011. The prevailing
weather plays a role in the distribution of the disease in the country. The pathogen was
confirmed by cultural, morphological, biochemical and state of the art molecular biological
174
techniques, not excepting the Koch’s postulate of re-infection of host tissue. The pathogen
was found to be susceptible to 8 fungicides tested both in vitro and in vivo. The best
fungicide was carbendazim.
Many recommendations have been made to curtail the spread of the disease which when
implemented would be a springboard to the boosting of the mango industry by the farmer and
thus contributing to poverty alleviation in Ghana.
175
REFERENCES
Abang, M.M (2003). Genetic diversity of Colletotrichum gloeosporioides Penz causing

anthracnose disease of yam (Discorea spp) in Nigeria. Bibliotheca Mycologia. 139 pp.
Adaskaveg, J.E and Hartin, R.J (1997). Characterisation of Colletotrichum acutatum isolates
causing anthracnose of almond and peach in California. Phytopathology 87:979-987.
Agrios, G. M. (2005). Plant Pathology. 5th Edition. Academic Press, New York. 952 pp.
Akem, C.P. (2006). Mango anthracnose disease; present status and future research priorities.
Plant Pathology Journal 5:266-273.
Akhthar, N. A, Iqbal, Z., Maqbool, M. and Hafiz, I. A (2009). Postharvest quality of mango
(Mangifera indica) as affected by chitosan coating. Pakistan Journal of Botany 4
(1):343-357.
Alahakoon, W. P., Brown, A.E. and Sreenivasaprad, S (1994). Genetic characterization of

Colletotrichum gloeosporioides isolates obtained from mango. International Journal
of Pest management 40 (2):225-229.
Amusa, A., Ashaye, O.A., Oladepo, M.O. and Oni, M.O. (2005). Guava fruit anthracnose
and the effects on its nutritional and market value in Ibadan, Nigeria. World Journal of
Agricultural Sciences 1 92:169-172.
Ane, C., Larget, B. Baum, D.A, Smith, S.D, Rokas, A (2007). Bayesian estimation of
concordance among gene trees. Molecular Biology and Evolution 24: 412-426.
Anonymous, (1996). Mango, the next cocoa of Ghana. A news paper published by the
Graphic communications Group of Ghana. Accra
Anonymous, (2006). Assessment of mango diseases, pests and production problems in

Pakistan. Report of a small research activity (SRAhort/2005) on mango in Pakistan.
Queensland. 29 pp.
Arauz, L.F. (2000) Mango Anthracnose: Economic impact and current options for integrated
management. Plant Diseases 84 (6):600-611.
176
Arya, A (1993). Tropical fruits-diseases and pests. Kalyani Publishers, New Delhi.
Bailey, J.A, O’Connel, R.J, Pring, R.J and Nash, C. (1992). Infection strategies of
Colletotrichum sp. p 88-120 in J.A. Bailey and M.J. Jeger (eds). Colletotrichum-
Biology, Pathology and Control. Wallingford, UK; CAB International
Bailey, J.A., Nash, C., Morgan, L. W., O’Connel, R.J. and TeBeest, D. O. (1996). Molecular
taxonomy of Colletotrichum species causing anthracnose of Malvaceae.
Phytopathology 86: 1076-1083.
Bandyopadhyay, C., Gholap, A.S. and Mamdapur, V.R (1985). Characterisation of

Alkylresorcinal in Mango (Mangifetra indica L). Journal of Agricultural and Food
Chemistry 33(3): 376-378.
Bernstein, B., Zehr, E.I., Dean, R.A and Shabi, F (1995). Characterisation of Colletotrichum
from pear, apple, pecan and other hosts. Plant Disease 79:478-482.
Brentu, F.C., Oduro, K.A.,Offei, S.K., Odamtten, G.T., Vicent, A, Peres, N.A and Timmer,
L.W (2012). Crop loss, aetiology and epidemiology of citrus black spot in Ghana.
European Journal of Plant Pathology 133: 657-670.
Brown, A.E., Sreenivasaprad, S. and Timmer, L.W. (1996). Molecular characterization of

slow growing orange and lime anthracnose strains of Colletotrichum from citrus as C.
acutatum. Phytopathology 86:523-527.
Cannon, P.F., Bridge, P.D. and Monte, E. (2000). Linking the past, present and future of
Colletotrichum systematics. p 1-20 in Prusky D., Freeman, S. and Dickman, M. (eds)
Colletotrichum: Host specificity, Pathology and Host-pathogen interaction. American
Phytopathology Society. St Paul.
Chala, A., Burberg, M.B and Tronso, A.M (2010). Incidence and severity of Sorghum
anthracnose in Ethiopia. Plant Pathology Journal 9(1):23-30.
Chaudary, M.,Manajeet, K. and Dashpande, K.B (1986). Biochemical changes during rot of
apple. Indian Phytopathology 33:331-332.
177
Correl, J.C., Rhoads, D.D. and Guerber, J.C. (1993). Examination of mitochondrial DNA
restriction fragment length polymorphisms, DNA finger prints and randomly amplified
polymorphic DNA of Colletotrichum orbiculare. Phytopathology 83:1199-1204.
Crane, J.H. and Campbell, C.W. (1991). The Mango. Florida Cooperation Extension Service,
Institute of Food and Agricultural Science, University of Florida.
Damm U., Baroncelli R., Cai Lei, Kubo Y., O’Donnell R., Weir B., Yoshino K. and Cannon,
P. F. (2010). Colletotrichum: Species, ecology and interactions. International
Mycological Association 1(2):161-165
Dangan, J., Sanchez, F.F and Pordesimo, A.N (1988). Integrated control for mango
anthracnose. National Crop Protection Centre. Leaflet No.14. University of the
Phillipines at Los Banos College, Laguna.
Davis, M.J. (1999). Genetic and pathological diversity of the Mango anthracnose pathogen in
Florida. Proceedings, Florida State Horticultural Society 112-197.
Dodd J.C., Estrada, A.,B., Matchmen J., Jeffries P. and Jeger, M.J. (1991a). The Effect of
Climatic Factors on Colletotrichum gloeosporioides, the causal agent of Mango
anthracnose in The Philippines. Plant Pathology 40:568-575.
Dodd, J. C., Bugante, R., Kromen, I., Jeffries, P., and Jeger M.J (1991b). Pre and post harvest
control of mango anthracnose in the Philippines. Plant Pathology 40: 576-583
Dodd, J. C., Prusky, D. and Jeffries P. (1997). Fruit Diseases. p 25-280 in R E Litz (Ed)
Mango: Botany, Production and Uses. Cab International Oxon. U.K.
Dodd, J.C., Estrada , A.B. and Jeger, M.J., (1992). Epidemiology of Colletotrichum
gloeosporioides in the tropics. p 308-325 in J.A. Bailey and, M.J. Jeger (eds).
Colletotrichum-Biology, Pathology and Control. Wallingford, UK; CAB International
Dodd, J.C., Jeffries P. and Jeger, M.J. (1989). Management strategies to control latent
infection in tropical crops. Aspects of Applied Biology 20: 49-56.
178
Estrada, A.B., Dodd, J.C. and Jeffries, P. (2000). Effect of humidity and temperature on
conidial germination and appressorium development of two phillipine isolates of the
mango anthracnose pathogen Colletotrichum gloeosporioides. Plant Pathology
49:608-618.
Estrada, A.B., Jeffries, P. and Dodd, J.C. (1996). Field evaluations of a predictive model to
control anthracnose disease of mango in the Phillipines. Plant pathology 45:294-301.
FAOSTAT (2010a). 2002-2010. World mango production. www.novagrim.com.pages/2000-

2001_mango-statistics-EN.aspx.
FAOSTAT (2010b). 2000-2009. World mango exports. www.novagrim.com.pages/2000-

2001_mango-statistics-EN.aspx.
Felsenstein, J. (1985) Confidence limits on phylogenies: An approach using the bootstrap.

Evolution 39:783-791.
Fitzell, R. D. and Peak, C.M (1984) The Epidemiology of anthracnose disease of Mango:
inoculum sources, spore production and dispersal. Annual Applied Biology 104:451-
458.
Fitzell, R. D. and Peak, C.M (1986). Management strategies for control of anthracnose and
bacterial black spot in Northern New South Wales. p 253-257 in proceedings of the 1st
Australian Mango Research Workshop. Cairns, CSIRO.
Fitzell, R.D (1979). Colletotrichum acutatum as a cause of anthracnose of mango in New

South Wales. Plant Disease Reporter 63:1067-1070
Fitzell, R.D. (1981) Regular application of Benomyl on the population of Colletotrichum on

mango leaves. Transaction of the British Mycological Society 98:65-77
Freeman S. (2009). Genetic diversity and host specification of Colletotrichum sp. on various
fruits. p 131-144 in J.A. Bailey and M.J. Jeger (eds), Colletotrichum: host specificity,
pathology and control. Wallingford. UK. CAB International.
179
Freeman S., Katan T and Shabi E (1998) Characterization of Colletotrichum species

responsible for anthracnose disease of various fruits. Plant Diseases 82:596-605
Freeman, S and Rodriguez, R.J (1995). Differentiation of Colletotrichum species responsible

for anthracnose of strawberry by arbitrarily primed PCR. Mycological Research
99:901-905
Freeman, S, Pharm, M. and Rodriguez, R.J (1993). Molecular genotyping of Colletotrichum

species based on arbitrarily primed PCR, A+T-rich DNA and nuclear DNA analysis.
Experimental Mycology 17:309-322.
Freeman, S., and Shabi E. (1996) Cross infection of subtropical and temperate fruit by
Colletotrichum spp from various hosts. Molecular Plant Pathology 49:295-404
Freeman, S., Minz, D., Jukervitch E., Maymon, M.T.and Shabi, E. (2000). Molecular
analysis of Colletotrichum species from almond and other fruits. Phytopathology
90:608-614.
Gadgile, D. P.and Chavan A. M. (2011). Changes in phosphorus content of mango pulp due
to colonization of Aspergillus niger. Indian Journal of Phytopathology 64: 192-193.
Galinsky, R and Law, N. (1988). World market for mango. RAP Market information
Bulletin. No. 9.
Geiser, D. M., Pitt, J.I and Taylor, J.W. (1998). Cryptic speciation and recombination in the
aflatoxin producing fungus Aspergillus flavus. Proceedings, National Academy of
Sciences, U.S.A. 95: 388-393.
Govender, V., Korsten, L. and Sivakumar, D (2005). Semi-commercial evaluation of Bacillus

licheniformis to control mango postharvest diseases in South Africa. Postharvest
Biology and Technology 38: 57-65.
Guerber, J.C., Liu, B., Correll, J.C. and Johnston, P.R. (2003). Characterisation of the
diversity of Colletotrichum acutatum sensu lato by sequence analysis of two gene
introns, mtDNA and intron RFLP’s and mating compatibility. Mycologia 95:872-895.
180
Gupta, V.K., Pandey, A., Kumar, P., Pandey, P.R., Gaur, R.K., Bajpai, V., Sharma N. and
Sharma S. (2010). Genetic characterization of mango anthracnose pathogen
Colletotrichum gloeosporioides Penz. By random amplified polymorphic DNA
analysis. African Journal of Biotechnology 9 (26); 4009-4013.
Hatton, T.T and Reeder, W.F. (1965). Hot water as a commercial control of mango
anthracnose. Proceedings of the Caribbean Region. American Society for Horticultural
Sciences 81:76-84.
Hayden, H. L, Pegg K.G., Aitken, E. A. B and Irwin, J.A.G (1994), Genetic relationships as
assessed by molecular markers and cross infections among strains of Colletotrichum
gloeosporioides. Australian Journal of Botany 42:9-18
Hodson, A., Mills, P.R. and Brown, A.E. (1993). Ribosomal and mitochondrial DNA
polymophism in Colletotrichum gloeosporioides isolated from tropical fruits.
Mycological Research 97: 329-335
Ilag, L.I (1992) Diseases of mango and their control. Paper presented during the first national
symposium workshop on Mango diseases in The Philippines. Bureau of Plant Industry,
March 19-20.
Jabber, A., Malik, A.V, Ud-den I.A., Awer, R., Ayoub, M., Rajwana, I.A., Amusi, M., Ichan,
A.S. and Saeed M. (2011). Effect of combined application of fungicides and hot water
treatments on postharvest diseases and quality of mango fruit. Pakistan Journal of
Botany 43 (1):65-73.
Jedele, S., Hau, M.A. and von Oppen, M. (2003). An analysis of the world market for
mangoes and its importance for developing countries. Paper presented at the
Conference on International Agricultural Research for Development. Gottingen,
Germany. October 8-10.
Jeffries A, Dodd, J. C., Jeger M. J., Plumbley R. A. (1990). The Biology and Control of
Colletotrichum species on Tropical Fruit Crops. Plant Pathology 39:343-366
181
Johnson, G.I. (1998). Stem end rot p 39-40 in R.C Ploetz, G.A Zetmeyer, W.T.Nishijima,
K.G. Rohrbach and H.D.Ohr (eds). Compendium of tropical fruit diseases. The
American Phytopathological Society, Minnesota.
Johnson, G.I., Mead A.J., Cooke A.W.and Dean, J. R. (1992). Mango stem end rot
pathogens-Fruit infection by endophytic colonization of the inflorescence and Pedicel.
Annals of Applied Biology 120, 225-234.
Johnston, P.R. and Jones, D. (1997). Relationship among Colletotrichum isolates from fruit
rots assessed using rDNA sequences. Mycologia 89(3):420-430.
Koufopanou, V.,Burt, A. and Taylor, J.W. (1997). Concordance of gene genealogies reveals
reproductive isolation in the pathogenic fungus Coccidiodes immitis. Proceedings,
National Academy of Sciences, U.S.A. 94: 5478-5482.
Kranz, J. and Rotem, J. (1987). Experimental Techniques in Plant Disease Epidemiology.

Springer-Verlag, Berlin. 229 pp.
Lakshmi, B.K.M, Reddy P.N and Prasad R.D (2011). Cross infection potential of
Colletotrichum gloeosporioides Penz, isolates causing anthracnose in sub-tropical
crops. Tropical Agricultural Research 2:183-193
Lim, T. K. (1998) Gray Leaf Spot. p 36 in R.C Ploetz, G.A Zetmeyer, W.T.Nishijima, K.G.
Rohrbach and H.D.Ohr (eds). Compendium of tropical fruit diseases. The American
Phytopathological Society, Minnesota.
Litz, R.E. (1998). Mango; taxonomy description, genetics and breeding and propagation of
cultivars, p33-34 in R.C Ploetz, G.A Zetmeyer, W.T.Nishijima, K.G. Rohrbach and
H.D.Ohr (eds). Compendium of tropical fruit diseases. The American
Phytopathological Society, Minnesota.
Liu, B., Louws, F.J., Sutton, T.B and Correl, J. (2010). A rapid qualitative molecular method
for the identification of Colletotrichum acutatum and Colletotrichum gloeosporioides.
European Journal of Plant Pathology. DOI 10.1007/s10658-011-9904-1
182
Liu, B., Wasilwa, L.A., Correl, J.C., O’Neill, N. and Morelock, T.E (2007). Comparison of
Colletotrichum orbiculare and several allied Colletotrichum species for mtDNA
RFLP, intron RFLP and sequence variation, vegetative compatibility and host
specificity. Phytopathology 97:1305-1314.
Manicom, B, Q and Pruvost, O.P. (1998). Bacterial black spot. P 41-42 in R.C Ploetz, , G..A
Zetmeyer,., W.T Nishijima,., K.G Rohrbach and H.D Ohr. Compendium of tropical
fruit diseases. The American Phytopathological Society, Minnesota.
Marley, P.S (2004). Effects of integrating host plant resistance with time of planting and
fungicides on anthracnose, grain mold and yield of sorghum (Sorghum bicolor) in the
Nigerian Northern Guinea savanna. Journal of Agricultural Science 142:345-350.
Martin, M. P and Garcia-Figueres F. (1999). Colletotrichum acutatum and Colletotrichum

gloeosporioides causing anthracnose in Olives. European Journal of Plant Pathology
105:733-741
McMillan, R.T (1984), Control of mango anthracnose with foliar sprays. Proceedings of the
Florida State Horticultural Society 97:344-345
Mills, P.R., Hodson, A. and Brown, A.E. (1992). Molecular differentiation of Colletotrichum
gloeosporioides isolates infecting tropical fruits. p 326-336 in J.A. Bailey and M.J.
Jeger (eds). Colletotrichum-Biology, Pathology and Control. Wallingford, UK; CAB
International.
MOFA (2010). Agriculture in Ghana. Facts and Figures-2010. Statistics, Research and
Information Directorate. Ministry of Agriculture, Ghana.
Muirhead, I.F. and Grattidge, R. (1986). Mango disease. p 248-252 in proceedings of the
CSIRO first Australia mango research Workshop.
Nelson, S. C. (2008) Mango anthracnose (Colletotrichum gloeosporioides). College of

Tropical Agriculture and Human Resource. Publication PD-48.
Neya, A. and Normad, M.L (1998). Response of sorghum genotypes to leaf anthracnose (C.
graminicola) under field conditions in Bourkina Fasso. Crop Protection 17:47-53.
183
Nei M & Kumar S (2000) Molecular Evolution and Phylogenetics. Oxford University Press,
New York
Nishijima, W (1994), Mango Disease and their Control. p 20-24 in Proceedings, conference
on mango in Hawaii March 9-11,199. University of Hawaii at Manoa, College of
Tropical Agriculture and Human Research.
O’Connell, R., Perfect, S., Hughes, B., Carzaniga, R., Bailey, J. and Green, J (2009).
Dissecting the cell Biology of Colletotrichum infection processes. p 57-77 D. Prusky,
S. Freeman, and M. Dickman (eds) Colletotrichum: host Specificity, Pathology, and
Host-Pathogen Interaction. The American Phytopathological Society. St. Paul.
Minnesota.
O’Donnell K Cigelnik E and Nirenberd H J (1998), Molecular systematics and

phylogeography of the Gibberella fujikori species complex. Mycologia 90:465-493
Oduro, K.A. (2000). Checklist of plant pests in Ghana. Volume 1. Diseases. Plant Protection
and Regulatory Service Directorate , Ministry of Agriculture. Accra, Ghana. 105pp.
Odzeyem (1998). Technical challenges facing mango production in the Dodowa Somanya
area. A paper presented at the annual general meeting of the Yilo Krobo Mango
Growers Association. Somanya.
Offei, S.K., Cornelius, E. W. and Sakyi-Dawson, O. (2008). Crop Diseases in Ghana and
their Management. Smartline Publishing Limited. 104 pp.
Padda, M.S., do Amaranthe, C. V. T., Garcia, B.M., Slaughter, D.C. and Mitcham, E. (2011)
Methods for analysis of physicochemical changes during mango ripening. A
multivariate approach. Postharvest Biology and Technology 62: 267-274.
Paramasivan, M., Mohan, S., Li, G.G., Mathiyazhagan, S. and Muthukrishanan, N. (2009).
Detections of latent infections in mango fruits using herbicides. Archives of Plant
Pathology and Plant Protection 42 (4): 318-326.
Paterson, R.R.M and Bridge, P.D. (1994). Biochemical techniques for filamentous fungi. IMI.
Technical Handbooks. No. 1, CAB International. 123 pp.
184
Peres, N.A.R.,Kuramae, E.E., Dias, M.S.C. and De Souzza, N.L. (2002). Identification and
Characterisation of Colletotrichum species affecting fruit after harvest in Brazil.
Journal of Phytopathology 150, 128-134.
Pernezy, K. and Ploetz R. (2002). Some common diseases of mango in Florida. Florida
Extension Service, Institute of Food and Agriculture Services, University Of Florida.
23 pp.
Phoulivong S., Cai, L, Chen., H, Mckenzie, E.H.C., Abdulsalam, K., Chukeatirute, E. K.D.
(2010). Colletotrichum gloeosporioides is not a common pathogen on tropical fruits.
Fungal Diversity 44:33-43
Ploetz, R. C. (1998). Anthracnose. p 35-36 in R.C Ploetz, , G..A Zetmeyer,., W.T

Nishijima,., K.G Rohrbach and H.D Ohr. (Eds) Compendium of tropical fruit diseases.
The American Phytopathological Society, Minnesota.
Ploetz, R. E. and Prakash, O. (1997) Foliar, Floral, and Soil Borne Diseases, p 281-225 in R.
E. Litz (ed). The Mango: Botany, Production and Uses. Cab International Oxon. U.K.
Ploetz, R.E. (1999). Anthracnose, the most important disease in much of the mango
producing world. p1-2 in in PLP news, The newsletter of the Plant Pathology
Department. The University of Florida, Gainsville. Vol 3. Issue 9. September.
Prihastuti, H., Cai, L., Chen, H. and Hyde, K.D (2009). Characterisation of Colletotrichum
species associated with coffee berries in Chiang Mai, Thailand. Fungal diversity
39:89-109.
Prior, C. and Ryder, K. (1987). Effect of low volume copper sprays with polyisobutene
sticker on mango blossom blight (Glomerella cingulata) in Dominica. Tropical Pest
Management 33:350-352.
Prusky, D. (1996). Pathogen quiescence in postharvest diseases. Annual Review.

Phytopathology 34:413-434
185
Prusky, D. (1998). Alternaria Rot (Black Spot). p 34-35 in R.C Ploetz, G.A Zetmeyer, W.T.
Nishijima, K.G. Rohrbach and H.D.Ohr (eds). Compendium of tropical fruit diseases.
The American Phytopathological Society, Minnesota.
Reddy, S. M. and Laxminarayana, P. (1984). Post infection changes in ascorbic acid contents
of mango caused by two fruit rot fungi. Current Science 53:927-928.
Saitou, N. and Nei, M. (1987). The neighbor-joining method: A new method for
reconstructing phylogenetic trees. Molecular Biology and Evolution 4:406-425.
Sanders G. M and Korsten L (2003) Comparison of cross inoculation potential of South

African avocado and mango isolates of Colletotrichum gloeosporioides. Microbiology
Research 158:143-150
Sanders G. M., Korsten, L. and Wehner, F.C (2000). Survey of fungicide sensitivity in C.
gloeosporioides from different avocado and mango production areas in South Africa.
European Journal of Plant Pathology 106: 745-752
Sariah (1989). Detection of Benomyl resistance in the anthracnose pathogen, C. capsici.

Journal of Islamic Academy of Science 2 (3):168-171.
Simmonds, J. H. (1965) A study to demonstrate cross infection of the species of

Colletotrichum causing ripe fruit rots in Queensland. Queensland Journal of
Agriculture and Animal Science 22: 437-459
Sreenivasaprad, S, Mills, P.R. and Brown A.E. (1994), Nucleotide sequence of the rDNA
spacer 1 enables identification of isolates of Colletotrichum as Colletotrichum
acutatum. Mycological Research 98:186-188.
Sreenivasaprad, S, Mills, P.R. Meehen R.M. and Brown A.E. (1996). Phylogeny and
systematics of 18 Collectorichum species based on ribosomal DNA spacer sequence
Genome 39-499-512
Sutton B.C (1980), The Coelomycetes, fungi imperfecti with pycnidia, acervuli and stromata.
Commonwealth Mycological Institute. Kew.
186
Talhinas, P., Sreenivasaprad, S, Neves-Martin, J and Oliviera, A. (2005). Molecular and

phenotypic analyses reveal association of diverse Colletotrichum acutatum groups and
a low level of Colletotrichum gloeosporioides with olive anthracnose. Applied and
environmental Microbiology 71:2987-2989.
Tamura K, Dudley J, Nei M & Kumar S (2007) MEGA4: Molecular Evolutionary Genetics
Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24:1596-
1599.
Tamura, K., Nei, M. and Kumar, S. (2004). Prospects for inferring very large phylogenies by
using the neighbor-joining method. Proceedings of the National Academy of Sciences
(USA) 101:11030-11035.
Taylor, J. W., Jacobson D., Kroken S., Kasuga T., David M., Geiser, M, David S., Hibbett S
and Fissher M (2000). Ohylogenetic Species Recognition and Species Concepts in
Fungi. Fungal Genetics and Biology 31:21-32
Teng, D.S. (1983). Estimating and interpreting disease loss in commercial fields.
Phytopathology 73:1587-1590.
Trigiano R., N. and Ament, M. H (2008). Detecting and measuring extracellular enzymes
produced by fungi and bacteria. P 329-347 in: Trigiano, R., Windham, M.T. and
Windham, A.S (2008). Plant Pathology; Concepts and Laboratory Exercises. 2nd
Edition. Taylor and Francis Group. Florida. 558 pp.
Ullasa, B.A (1989). Effect of Pre-harvest fungicidal sprays for the control of anthracnose of
mango. Abstracts of the third international mango Symposium. Daron, Northern
Australia. 55 pp.
Visarathanonth, N. and Puagmee, A (1989). Efficacy of four fungicides against postharvest

diseases of mango. Abstracts of the 3rd International Mango symposium. Northern
Territory, Australia. 1989 pp.
187
Walker, J., Nikandrow, A. and Miller, G.D (1991). Species of Colletotrichum on Xanthium
(Asteracea) with comments on some taxonomic and nomenclatural problems in
Colletotrichum. Mycological research 95:1175-1193.
Ware G.W. (1991). Fundamentals of Pesticides-A Self Instruction Guide. Thompson

Publications. California. 307 pp.
Zainuri, N., Irving, D.E., Dann, E.K., Coates, L.M and Wearing A.H. (2003). Activating
mango fruit defense to anthracnose disease. 2 pp.
Zapata, P.J, Guillen, F., Martinez,-Romero, D., Castillo, S., Valero, D. and Serrano, M
(2008). Use of alginate or zein as edible coatings to delay postharvest ripening process
and to maintain tomato (Lycopersicon esculentus) quality. Journal of Science and
Food Agriculture 88:1287-1293.
188
APPENDICES
QUESTIONNAIRE (CONTROL OF MANGO ANTHRACNOSE IN GHANA)
A. DEMOGRAPHIC INFORMATION OF RESPONDENTS
1. Name of farmer/farm
2. Sex a) Male b) Female
3. Age a) 20-35
b) 36-45
c) 46-55
d) 56-70
4. Level of education
a) JHS
b) MSLC
c) SHS/O’L/TECH/VOC
d) Tertiary
B. DISEASE CONTROL IN MANGO FARM
5. Which of the following diseases do you find as a problem in your find?
a) Mango anthracnose
b) Stem end rot
c) Other diseases……………………..
6. Which of the following methods do you use to control mango anthracnose disease?
a) Heavy pruning and heavy fungicide application
b) Slight pruning and heavy fungicide application
189
c) Heavy pruning and occasional fungicide application
d) No pruning , no fungicide application

2. ANOVA for percentage of leaves showing acervuli after incubation.
SV df s.s m.s V ratio fpr

Treatments 11 30870.67 2806.42 28.13 <0.001
(12323.60) (1120.33) (26.00)
Residual 36 3592.00 99.78
(1547.92) (43.00)
Total 47 34462.67
(13871.52)
Transformed data in parenthesis
3. ANOVA for percentage of fruits showing acervuli after incubation.

Treatments 11 14987.67 1362.52 17.70 <0.001
(6990.24) (635.48) (14.46)
Residual 36 2772.01 77.00
(1582.35) (43.95)
Total 47 17759.07
(8572.59)
4. ANOVA for percentage of panicles showing acervuli after incubation.

Treatments 11 2259.7 205.4 1.95 0.065
(1889.91) (171.81) (2.21) (0.037)
Residual 36 3788.0 105.2
(2803.55) (77.88)
Total 47 6047.7
(4693.46
5. ANOVA for incidence of postharvest mango anthracnose disease in 2010.

Treatments 11 46954.67 4268.61 53.96 <0.001
(28501.27) (2591.02) (61.53)
Residual 36 2848.00 79.11
(1515.96) (42.11)
Total 47 49802.67
190
(30017.22)
6. ANOVA for incidence of postharvest mango anthracnose in 2011.

Treatments 11 38730.67 3520.97 49.21 <0.001
(18810.99) (1710.09) (47.63)
Residual 36 2576.00 71.56
(1292.57) (35.90)
Total 47 41306.67
(20103.56)
7. Percentage of diseased fruits and incidence and severity of mango anthracnose
disease in some selected administrative regions of Ghana.
Regions 2010 2011

Incidence Diseased Severity Incidence Diseased Severity
(%) fruits (%) (%) fruits (%)
Greater Accra(20)* 58.3±4.7 12.3±1.8 0.5±0.1 59.5±4.1 13.6±2.2 0.5±0.1
Eastern (36) 56.4±3.8 15.9±0.1 0.6±0.1 56.7±3.6 14.7±2.6 0.6±0.1
Volta (10) 27±11.5 4.7±1.9 0.2±0.1 27±11.5 5.5±2.4 0.2±0.1
Ashanti (1) 100 100 3.8 100 100 3.8
Brong Ahafo (5) 0.0 0.0 0.0 0.0 0.0 0.0
Northern (8) 0.0 0.0 0.0 0.0 0.0 0.0
*Number of farms surveyed in each administrative region in brackets.
8. Percentage of diseased fruits and incidence and severity of mango anthracnose

disease in agro-ecological zones of Ghana.
Agro-ecological
zones 2010 2011
Diseased Incidence Severity Diseased Incidence Severity
fruits (%) (%) fruits (%) (%)
Coastal savanna(59) 57±2.8 12.9±0.9 0.5±0.03 57.6±2.5 12.8±0.9 0.5±0.03
Humid forest (8) 25±16.4 25±16.4 0.9±0.6 25±16.4 25±16.4 0.9±0.6
Transitional (5) 0.0 0.0 0.0 0.0 0.0 0.0
Interior savanna (8) 0.0 0.0 0.0 0.0 0.0 0.0-
*Number of farms per agro-ecological zone in brackets.
191
9. Incidence and severity of mango anthracnose disease and percentage of fruits

showing the disease symptoms in some selected districts of Ghana.
Districts 2010 2011
Incidence Diseased Severity Incidence Diseased Severity

(%) fruits (%) (%) fruits (%)
Berekum (4)* 0.0 0.0 0.0 0.0 0.0 0.0
Dangme West (10) 69.5±7.6 15.3±3.3 0.6±0.1 65±7.5 17.5±4.1 0.7±0.2
Ga West (10) 47±3 9.3±0.6 0.4±0.02 54±2.7 9.6±0.6 0.4±0.02
Hohoe (6) 0.0 0.0 0.0 0.0 0.0 0.0
Kintampo (3) 0.0 0.0 0.0 0.0 0.0 0.0
Kwaebibrem (1) 100 100.0 3.8 100 100 3.8
Kumasi met. (1) 100 100.0 3.8 100 100 3.7
Manya Krobo (5) 42±8.6 9±1.3 0.4±0.1 58±9.7 11.4±1.2 0.5±0.1
North Tongu (4) 67.5±8.5 11.8±0.6 0.5±0.02 67.5±8.5 13.8±2.5 0.6±0.1
S./Nanton (5) 0.0 0.0 0.0 0.0 0.0 0.0
T. Kumbungu (3) 0.0 0.0 0.0 0.0 0.0 0.0
Yilo Krobo (30) 57.3±3.9 14.2±1.5 0.6±0.1 55±3.7 12.4±0.9 0.5±0.03
*Number of farms per district in brackets
9. ANOVA for effect of mango anthracnose disease on yield loss in the minor season
A. Fruits that dropped due to the disease
SV df s.s. m.s. V ratio fpr

Reps 3 25.58 8.53 0.45
(10.252) (3.417) (0.46)
Treatments 2 35.44 17.72 0.94 0.441
(13.882) (6.941) (0.94)
Residual 6 112.80 18.80
(44.188) (7.365)
Total 11 173.81
(68.321)
B. Fruits that dropped due to other factors

Reps 3 14.957 4.986 1.05
(5.560) (1.853) (1.03)
Treatments 2 20.898 10.449 2.20 0.192
(7.828) (3.914) (2.17) (0.195)
Residual 6 28.504 4.757
(10.803) (1.800)
192
Total 11 64.359
(24.191)
C. Harvested fruits without disease symptoms

Reps 3 2.188 0.729 0.29
(1.636) (0.545) (0.29)
Treatments 2 0.955 0.477 0.19 0.830
(0.764) (0.382) (0.21) (0.820)
Residual 6 14.896 2.483
(11.176) (1.863)
Total 11 18.039
(13.576)
D. Fruits that were diseased yet marketable

Reps 3 1.7350 0.5783 0.72
(8.519) (2.840) (0.68)
Treatments 2 0.1255 0.0627 0.08 0.926
(0.788) (0.394) (0.09) (0.911)
Residual 6 4.8464 0.8077
(24.989) (4.156)
Total 11
(34.246)
E. Fruits that were not marketable because they were diseased

Reps 3 1.90 0.63 0.06
(0.835) (0.278) (0.06)
Treatments 2 1.07 0.53 0.05 0.953
(0.543) (0.271) (0.05) (0.948)
Residual 6 66.42 11.07
(30.193) (5.032)
Total 11 69.36
(31.571)
193
F. Fruits that were not marketable due to other factors

Reps 3 0.21910 0.07303 4.63
(5.6347) (1.8782) (4.81)
Treatments 2 0.03060 0.01530 0.97 0.43
(1.0657) (0.5329) (1.36) (0.325)
Residual 6 0.09455 0.01576
(2.3452) (0.3909)
Total 11 0.34424
(9.0456)
G. Disease incidence

Reps 3 4.25 1.42 0.08
(1.740) (0.580) (0.09)
Treatments 2 6.00 3.00 0.17 0.845
(2.296) (1.148) (0.17) (0.547)
Residual 6 104.00 17.33
(40.257) (6.710)
Total 11 6.7069
(44.294)
H. Disease severity

Reps 3 0.05667 0.01889 0.25
Treatments 2 0.02167 0.01083 0.14 0.811
Residual 6
Total 11 0.53667
10. ITS1 nucleotide sequences of the representative isolates of Colletotrichum

gloeosporioides used in the study.
>MAN-GH10
AGGGATCATTACTGAGTTTACGCTCTATAACCCTTTGTGAACATACCTATAACTGTTGCTTCG
GCGGGTAGGGTCTCCGTGACCCTCCCGGCCTCCCGCCCCCGGGCGGGTCGGCGCCCGCCG
GAGGATAACCAAACTCTGATTTAACGACGTTTCTTCTGAGTGGTACAAGCAAATAATCAAAA
CTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGT
GAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGG
GCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCCCTACAGCTGATG
194
TAGGCCCTCAAAGGTAGTGGCGGACCCTCCCGGAGCCTCCTTTGCGTAGTAACTTTACGTCTCGCA
CTGGGATCCGGAGGGACTCTTGCCGTAAAACCCCCAATTTTCCAAAGGTTGACCTCGGATCAGGTA
GGAATACCCGCTGAACTTAA
>MAN-GH12
AGGGATCATTACTGAGTTTACGCTCTACAACCCTTTGTGAACATACCTATAACTGTTGCTTCGGCG
GGTAGGGTCTCCGCGACCCTCCCGGCCTCCCGCCTCCGGGCGGGTCGGCGCCCGCCGGAGGATAA
CCAAACTCTGATTTAACGACGTTTCTTCTGAGTGGTACAAGCAAATAATCAAAACTTTTAACAACG
GATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA
TTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTT
CGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCCCTACAGCTGATGTAGGCCCTCAA
AGGTAGTGGCGGACCCTCTCGGAGCCTCCTTTGCGTAGTAACTTTACGTCTCGCACTGGGATCCGG
AGGGACTCTTGCCGTAAAACCCCCAATTTTCCAAAGGTTGACCTCGGATCAGGTAGGAATACCCG
CTGAACTTAA
>MAN-GH21
AGGGATCATTACTGAGTTTACGCTCTACAACCCTTTGTGAACATACCTATAACTGTTGCTTCG
GCGGGTAGGGTCTCCGCGACACTCCCGGCCTCCCGCCCCCGGGCGGGTCGGCGCCCGCCG
GAGGATAACCAAACTCTGATGTAACGACGTTTCTTCTGAGTGGTACAAGCAAATAATCAAAA
CTGGGATCCGGAGGGACTCTTGCCGTAAAACCCCCAATTCTCCAAAGGTTGACCTCGGATCAGGT
AGGAATACCCGCTGAACTTAA
>MAN-PR1
AGGGATCATTACTGAGTTTACGCTCTATAACCCTTTGTGAACATACCCATAACTGTTGCTTCG
GCGGGTAGGGTCTCCGCGACCCTCCCGGCCTCCCGCCCCCGGGCGGGTCGGCGCCCGCCG
CTGGGATCCGGAGGGACTCTTGCCGTAAAACCCCCCAATTTTCCAAAGGTTGACCTCGGATCAGGT
>MAN-MX1
GCGGGTAGGGTCTCCGCGACACTCCCGGCCTCCCGCCCCCGGGCGGGTCGGCGCCCGCCG
GAGGATAACCAAACTCTGATGTAACGACGTTTCTTCTGAGTGGTACAAGCAAATAATCAAAA
CTGGGATCCGGAGGGACTCTTGCCGTAAAACCCCCAATTCTCCAAAGGTTGACCTCGGATCAGGT
195
>PAW-GH1
GCGGGTAGGGTCTCCGCGACCCTCCCGGCCTCCCGCCTCCGGGCGGGTCGGCGCCCGCCG
GCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCCCTACAGCCGATG
TAGGCCCTCAAAGGTAGTGGCGGACCCTCTCGGAGCCTCCTTTGCGTAGTAACTTTACGTCTCGCA
>MAN-CIT1
AGGGATCATTACTGAGTTTACGCTCTACAACCCTTTGTGAACATACCTACAACTGTTGCTTCG
GCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGGCCCTACAGCCGATG
CTGGGATCCGGAGGGACTCTTGCCGTAAAACCCCCCAATTTTCCAAAGGTTGACCTCGGATCAGGT
AGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA
>AVO-GH1
TAGGCCCTCAAAGGTAGTGGCGGACCCTCTCGGAGCCTCCTTTGCGTAGTAACTTTACGTCTCGCA
NB. ITS1 region (underlined) of isolate represented by MAN-GH10 were arbitrarily assigned
rDNA-ITS group number 3; those represented by MAN-GH12 were assigned group number
1 and those represented by MAN-GH21 were assigned group number 3 (Table 13).
11. Nucleotide sequences of the 1st intron Beta tubulin gene of isolates used in the study
>MAN10-GH
TGGTACGTGACGAGACCGCCGACGATCCGGCAATATATACTTGCGAGGACGGCAGATGTTGACGA
TAGAGTAGGCAAAACATTTCTGGCGAGCACGGCCTCGACAGCAATGGAGTGTATGTCATGCCCCT
TATCTGGCCACATTGGTGGTTGACCGCTAAACTCGAACAGCTACAACGGCACCTCTGAGCTCCAGC
TCGAGCGCATGAGCGTCTACTTCAACGAAGTTTGTTACCTTATAGCCCCCAGAGTGCAAGATAAAC
196
ATATTGACGAGTACTGACCTTCGCTCCTACCCAGGCTTCCGGCAACAAGTACGTGCCCCGTGCCGT
CCTCGTCGATTTGGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCG
CCCCGACAACTTCGTCTTCGGCCAGTCTGGTGCCGGCAACAACTGG
>MAN12-GH
TGGTACGTGACGAGACCGCCGACGATCCGGCAATATATACTTGCGAGGACGGCAGATGTTGACGA
TAGAGTAGGCAAAACATTTCTGGCGAGCACGGCCTCGACAGCAATGGAGTGTATGTCATGCCCCT
TATCTGGCCACATTGGTGGTTGACCGCTAAACTCGAACAGCTACAACGGCACCTCTGAGCTCCAGC
TCGAGCGCATGAGCGTCTACTTCAACGAAGTTTGTTACCTTATAGCCCCCAGAGTGCAAGATAAAC
ATATTGACGAGTACTGACCTTCGCTCCTACCCAGGCTTCCGGCAACAAGTACGTGCCCCGTGCCGT
CCTCGTCGATTTGGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCG
CCCCGACAACTTCGTCTTCGGCCAGTCTGGTGCCGGCAACAACTGG
>MAN21-GH
TGGTACGTGACGAGACCGCCGACGACCCGGCAATATCATACTTGCGAGGACGGCAGATGTTGACG
ATAGAGTAGGCAAAACATTTCTGGCGAGCACGGCCTCGACAGCAATGGAGTGTATGTTATGCCCC
TTATCTGGCCACATTGGTGGTTGACCGCTAAACTCGAACAGCTACAATGGCACCTCTGAGCTCCAG
CTCGAGCGCATGAGCGTCTACTTCAACGAAGTTTGTTACCTTATAGCCCCCAGAGTGCAAGATAAA
CATATTGACGAGTACTGACCTTCGCTCCTACCCAGGCCTCCGGCAACAAGTACGTGCCTCGTGCCG
TTCTCGTCGATTTGGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCC
GCCCCGACAACTTCGTCTTCGGCCAGTCTGGTGCCGGCAACAACTGGG
12. Nucleotide sequence of the intron of the glyceraldehyde-3-phosphate dehydrogenase

gene of representative isolates of C. gloeosporioides used in the study
>MAN-GH10
GACCAAGTACGCTGTGAGTATCACCCTACCTACCCCTCCAAACTCGCCATGACTTCACATCCATCA
CCACCACCACCGCTGCCATCTACATCTCGCCGCCCGCGTTTGGTAAACAAGAACGCCACCATGAAT
GGAGGCCAATTGAAACCATGGGTCGGGACGGCCGGACATATGCTATCACTCACATCAGCCCCATC
TGTCACATTTACTGACTCGCTCTTCACAGGCCT
>MAN12-GH
GACCAAGTACGCTGTGAGTATCACCCCGCCTACCCCTCCAAACTCGCCATGACTTCACATCCATCA
CCACCACCACCGCTGTCATCTACATCTCGCCGCCCGCGTTTGGTAAACAAGAAGGCCGTCATGAAT
GGAGGCCAATTGAAACCATGGGTCGGGACGGCCGGACACATGCTATCACTCATATCAGCCCTATC
>MAN21-GH
GACCAAGTACGCTGTGAGTATCACCCCACCTACCCCTCCAAACTCGCCATGACTTCACATCCATCA
CCACCACCACCGCTATCATCTACATCTCGCCGCCCGCGTTTGGTAAACAAGAAGGCCATCATGAAT
GGAGGCCAATTGAAACCATGGGTCGGGACGGCCAGACACATGCTATCACTCATATCAGACCCATC
>MAN-MX1
GACCAAGTACGCTGTGAGTATCACCCCACCTACCCCTCCAAACTCGCCATGACTTCACATCCATCA
CCACCACCACCGCTATCATCTACATCTCGCCGCCCGCGTTTGGTAAACAAGAAGGCCATCATGAAT
GGAGGCCAATTGAAACCATGGGTCGGGACGGCCAGACACATGCTATCACTCATATCAGACCCATC
197
>CIT-GH1
GACCAAGTACGCTGTGAGTATCACCCCACCTACCCCTCCAAGCTCGACAAGACTTCACATCCATCG
CCACCACTACCGCTGTCATCCGCATTTCGCCGCCCGCGGTTAGTACACAAGAAGGCCATCATGAAT
TAATGCCAATTGAAATCATGGGTCGGGACGGCCGGACACATGCTATCACTCATGTCAGCCCCATCT
GTCACATTTACTGACTCGCTCTTTACAGGCCT
>PAW-GH1
GACCAAGTACGCTGTGAGTATCACCCCGCCTACCCCTCCAAACTCGCCATGACTTCACATCCATCA
CCACCACCACCGCTGTCATCTACATCTCGCCGCCCGCGTTTGGTAAACAAGAAGGCCGTCATGAAT
>AVO-GH1
GACCAAGTACGCTGTGAGTATCACCCCACCTACCACTCCAAACTCGCCATGACTTCACATCCATCA
CCACCACCACCGCTGTCATCTACATCTCGCCACCCGCGTTTGGTAAACAAGAAGGCCGTCATGAAT
>MAN-FLO1
GACCAAGTACGCTGTGAGTATCACCCCACCTACCCCCTCCAAACTCTCCATGACTTCACATCCATC
ACCACCACCACCGCTGCCATCTACATCTCGCCGCCCGCGTTTGGTAAACAAGAACGCCACCATGA
ATGGAGGCCAATTGAAACCATGGGTCGGGACGGCCGGACATATGCTATCACTCATATCAGCCCCA
TCTGTCACATTTACTGACTCGCTCTTCACAGGCCT
Appendix 13. Effect of different fungicides on radial growth of Colletotrichum

gloeosporioides obtained from mango on amended PDA.
Incubation period (Days )
Type of Fungicide 3 4 5 6 7 8
/rate of application
Agriette (4 g/L) 0.0 0.0 0.0 0.0 0.0 0.0

Bendazim (2 g/L) 0.0 0.0 0.0 0.0 0.0 0.0
Funguran (2 g/L) 0.0 0.0 0.0 0.0 0.0 0.0
Ivory (4 g/L) 0.0 0.0 0.0 0.0 0.0 0.0
Prochloraz (1.5 ml/L) 0.0 0.0 0.0 0.0 0.0 0.0
Sundomil (4 g/L) 0.0 0.0 0.0 0.0 0.0 0.0
Top Cop (20 ml/L) 0.0 0.0 0.0 0.0 0.0 0.0
Control (no fungicide) 3.1 4.0 5.5 6.7 7.6 8.0
198
199

Joseph Okani Honger - Characterisation of The Causal Agent of Mango Anthracnose Disease in Ghana - 2014

Загружено:

Сведения о документе

Исходное описание:

Оригинальное название

Авторское право

Доступные форматы

Поделиться этим документом

Поделиться или встроить документ

Параметры публикации

Этот документ был вам полезен?

Это неприемлемый материал?

Авторское право:

Доступные форматы

Joseph Okani Honger - Characterisation of The Causal Agent of Mango Anthracnose Disease in Ghana - 2014

Загружено:

Авторское право:

Доступные форматы

University of Ghana http://ugspace.ug.edu.

CHARACTERISATION OF THE CAUSAL AGENT OF MANGO ANTHRACNOSE

(BSc. Agric, MPhil (Crop Science) Legon.

THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF GHANA, LEGON IN

PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE AWARD OF PhD

CROP SCIENCE DEGREE

whole nor part been presented for another degree elsewhere

Joseph Okani Honger

Prof. G.T Odamtten

sustained me throughout the period of my study.

International Students Exchange Programme for offering me the opportunity to study

aspects of my research in their laboratory.

CHAPTER FOUR ................................................................................................................ 60

4.9.1 Chromatographic screening of secondary metabolite. ................................................. 120

Table 17. Lesion diameter induced on different cultivars of mango by isolates of

Figure 1. Anthracnose disease cycle ................................................................................. 14

characterised using cultural, morphological, biochemical and molecular approaches. The

Savelungu/Nanton and Tolon/Kumbungu districts to 100% in the Kwaebibrem and

season in a mango orchard in the Yilo Krobo district. Colletotrichum gloeosporioides

16 (35%) were identified as Colletotricum asianum while 29 (65%) were identified as

Colletotrichum species. Artificial inoculations confirmed the pathogenicity of isolates of

found to be highly susceptible to 8 different fungicides available on the Ghanaian market.

crop (FAOSTAT, 2010).

replacing cocoa (Anon., 1996).

anthracnose caused by Colletotrichum gloeosporioides (Oduro, 2000; Offei et al., 2008) is

Australia. Currently, it is no more recognized as an aetiological agent of the disease (Ploetz,

attacked by C. asianum, C. fructicola and C. siamense (Prihastuti et al., 2009). In Florida

Offei et al., 2008) and therefore it would be important to confirm this.

Colletotrichum gloeosporioides is a group species made up of different species including C.

C. gloeosporioides complex. It is necessary, therefore to determine which of the distinct

In guava, anthracnose caused by C. gloeosporioides was found to reduce the nutritional

developed resistance to the fungicides or whether the ineffectiveness of the fungicides is as a

Specific objectives were:

against the mango anthracnose disease.

agro-ecological zones of Ghana.

anthracnose in a selected commercial mango farm in Ghana.

 Characterize the pathogen causing mango anthracnose disease in Ghana.

 Develop a protocol for the control of mango anthracnose in Ghana.

2.0 LITERATURE REVIEW

2.1 Origin, spread and production of mango

introduced into Mexico in the nineteenth century and Florida in 1833

(http.www.mango.tree.blogspot.com; Litz, 1998).

Producing country Production (MT)

Producing country Amount exported (MT)

2.2 Constraints to mango production

Dothiorella dominica (Johnson, 1998) and mango anthracnose caused by Colletotrichum

gloeosporioides or Colletotrichum acutatum (Ploetz, 1998). These diseases cause both

1998; Jeffries et al, 1990; Arauz, 2000).

2.3 Mango anthracnose disease: symptoms and importance

be found on them (Nelson, 2008).

infected (Arauz, 2000).

100% on fruits produced in wet or high humid conditions (Arauz, 2000).

2.4 Disease cycle and epidemiology

the plant from the pathogen (Agrios, 2005).

When infection is successful the pathogen multiplies by producing numerous conidia in

survives in between seasons by producing the reproductive structures on infected and

assessed (Arauz, 2000).

warm weather (Nelson, 2008).

Figure 1. Anthracnose disease cycle (Arauz, 2000)

2.5 Aetiology of mango anthracnose

worldwide. These are Colletotrichum gloeosporioides (Dodd et al, 1997), Colletotrichum