VERSION A (3A) ANSWER KEY

Hourly Fall 2008

BIO SCI 97 SECTION B MWF 3 – 3:50p

20 multiple choice questions. Each question is worth 1 point. No points are deducted
for a wrong answer. Select the best answer. A table with the standard genetic code is
at the end of the exam.

1. You have version A. Bubble in A for Question 1 on your scantron card.

2. In a primitive organism, there are 3 kinds of nucleotides, and 30 types of tRNA molecules,
each of which binds a different codon. What is the minimum size of the codon in this organism?
A) 1
B) 2
C) 3
D) 4
E) 5

3. Which of the following is a property of proteins but not DNA:

A) Polarity
B) Synthesis from a template
C) Enzymatic function
D) Polymer
E) Phosphodiester bond

1
4. The table below shows matching regions of the DNA, mRNA, and tRNA encoded in a
particular gene.

C - ? ? ? - - - - - A T DNA double helix

- - - - - - - A C A - -

5’ - - - - - - - A C A - - 3’ mRNA

3’ - - G A C - - - - - - - 5’ tRNA anticodon

What are the 3 nucleotides denoted by the three question marks on the upper DNA strand (write
the sequence 5’ to 3’)?

A) 5’ CAG 3’
B) 5’ GTC 3’
C) 5’ GAC 3’
D) 5’ CTG 3’
E) 5’ ACA 3’

5.Which of the following is true about the relationship between genotype and phenotype?
A) Phenotype is determined completely by genotype
B) Genotype is determined completely by phenotype
C) Phenotype contributes significantly to genotype
D) Genotype contributes significantly to phenotype
E) Phenotype and genotype are not related

6. In Martian Anteaters, DNA replication produces many mutations. Which protein is most likely
to be defective?
A) RNA polymerase
B) DNA polymerase
C) DNA helicase
D) DNA gyrase
E) DNA ligase

2
7. The following sequence from a primary transcript RNA contains a single intron. The transcript
is spliced, and the mature mRNA is translated. What is the amino acid sequence of the resulting
peptide?

The initiator codon is in bold and the 5’ and 3’ splice sites are in bold and underlined.

5’ AUGUCUAGUCAUUGACGACAGACGGCUAA 3’

A) N Met-Ser-Ser-His C
B) N Met-Ser-Ser-Gly C
C) N Met-Ser-Asn-Gly C
D) N Met-Ser-Thr-Ala C
E) N Met-Ser-Ala-Asn C

8. Lauren by mistake adds 50% dideoxyribose nucleotides to her PCR reaction (50% ddNTPs
and 50% dNTPs). What is the expected result of the PCR reaction to amplify a 100 base pair
region.
A) Normal amount of full-length product
B) Normal amount of short product
C) Half as much full-length product
D) Only one strand is amplified
E) Little to no product

9. How many chromosomes are present in meiotic cells after DNA replication and before
Meiosis I, and then after Meiosis I?
A) Before Meiosis I: n; After Meiosis I: n/2
B) Before Meiosis I: n; After Meiosis I: n
C) Before Meiosis I: 2n; After Meiosis I: n
D) Before Meiosis I: 2n; After Meiosis I: 2n
E) Before Meiosis I: 4n; After Meiosis I: 2n

3
10. Professor Yi repeats the Crick-Brenner experiment on Mars where the codon size is unknown
using Martian phage. (+) indicates a single base-pair insertion mutation, and (-) indicates a
deletion of unknown size. The following results show the effects of single and double mutations
on phage growth:

(+) = No growth
(-) = No growth
(+)(-) = Growth
(+)(+) = Growth

How long is the codon on Mars?

A) 1
B) 2
C) 3
D) 4
E) 5

11. Martian DNA is parallel; all other aspects are the same as DNA on Earth (e.g. DNA
synthesis is 5’ to 3’). For the Martian DNA replication bubble illustrated here (the parental
strands are the thick black lines), indicate the leading strands (thin grey strands labeled (1), (2),
(3), (4) are the newly synthesized
strands).
(1) (2)
A) Strands (1) and (3) 5’ 3’
B) Strands (2) and (4)
(4) (3)
C) Strands (1) and (4)
D) Strands (2) and (3)
E) Strands (1), (2), (3), and (4)

12. Bob has a benign skin tumor. The tumor cells contain an unusual mutation in the PAH gene;
his normal cells have the wild-type PAH gene. Which of the following is most likely to be true
of Bob’s children?
A) None will have the unusual mutant PAH gene in any of their cells
B) A few of will have the unusual mutant PAH gene in their skin cells only
C) A few will have the unusual mutant PAH gene in all of their cells
D) Half will have the unusual mutant PAH gene in their skin cells only
E) All will have the unusual mutant PAH gene in all of their cells

4
13. The template strand of a DNA molecule being transcribed into RNA possesses the sequence
5’ ATTGGACATGG 3’. The transcription start site is at the A residue in bold and underlined.
Which of the following represents part of the sequence of the transcribed RNA?
A) 5’ CCAUGU 3’
B) 5’ ACAUGG 3’
C) 5’ UCGACU 3’
D) 5’ AGGUUA 3’
E) 5’ UCCAAU 3’

14. Professor Yi wishes to PCR amplify only the DNA region in bold and underlined below:

5’ AGCGTTAGCTTCATTCAGCTTAGCATGAACCTGATTCG 3’
TCGCAATCGAAGTAAGTCGAATCGTACTTGGACTAAGC

Which of the following 6 base pair DNA primer sequences would be used in this PCR reaction:
A) 5’ TCGCAA 3’
B) 5’ CATTCA 3’
C) 5’ GATTCG 3’
D) 5’ GTAAGT 3’
E) 5’ CTAAGC 3’

15. True or False (The 2 questions are independent of each other).

James Watson’s genome has been sequenced.
(i) He now knows whether he possesses the CCR5+ allele or the CCR5-∆32 allele (True or
False).
(ii) DNA from his cheek cells were sequenced; these cells are haploid (True or False).
A) (i) True (ii) True
B) (i) True (ii) False
C) (i) False (ii) True
D) (i) False (ii) False

5
16. Professor Yi repeats the Avery experiment and obtains the results below (none of the mice
die). Which of the following is the best explanation for this surprising result?
A) There were live S cells in the S strain extract
B) Protein is the genetic material
C) Not all of the DNA was destroyed
D) The R strain cells also contain some S strain cells
E) R strain cells were not transformed by the genetic material

17. Regulation of all of the following processes affect gene expression EXCEPT
A) DNA replication initiation
B) Transcription initiation
C) Transcription elongation
D) Alternative splicing
E) Translation initiation

18. The following nucleic acid structure is most likely to

occur during which process?
A) PCR CH3 G H
H
O
B) DNA sequencing
C) Transcription O H G CH3 O P

D) Splicing P O CH3
C H
O

E) Translation CH3 O
O H
P O CH3
G C

O H

6
19. What is the proper order of the following three elements in the 5’ to 3’ direction of the
coding (sense) strand of the DNA: (i) Transcription start site, (ii) Promoter, (iii) Initiation codon?
A) (5’) Transcription start site, Promoter, Initiation codon (3’)
B) (5’) Transcription start site, Initiation codon, Promoter (3’)
C) (5’) Promoter, Initiation codon, Transcription start site (3’)
D) (5’) Promoter, Transcription start site, Initiation codon (3’)
E) (5’) Initiation codon, Promoter, Transcription start site (3’)

20. Which of the following statements is TRUE?

A) Proteins are synthesized C to N
B) DNA ligase joins together exons during splicing
C) A synonymous codon codes for more than one amino acid
D) Prokaryotes do not have introns
E) DNA shuffling removes introns in the DNA

21. Professor Yi performs a sequencing reaction and observes the

Top
following results after gel electrophoresis. The dideoxy nucleotides
are labeled as follows: ddGTP = black, ddATP = green, ddTTP = Black
red, ddCTP = blue. Green
Blue
What is the corresponding sequence of the template strand of the
Black
DNA (strand that is the template of the DNA sequencing reaction)?
A) 5’ CTGCA 3’ Red
Bottom
B) 5’ TGCAG 3’
C) 5’ GACGT 3’
D) 5’ ACGTC 3’
E) 5’ GACAG 3’

7
8