‘‘‘‘‘‘‘‘‘‘‘‘‘‘

S

‘‘‘‘‘‘‘‘‘Ubiquitin is a small compact, globular, heat stable protein found in all
the eukaryotes . Among the eukaryotes it is highly conserved, differing in only
three residues between yeast and humans. This conservation of residues implies
that some or all residues are important in structural as well as func tional aspects
of the protein. It is found throughout the cell (thus, giving rise to its name) and
can exist either in free form or as part of a complex with other proteins. In the
latter case, ubiquitin is attached (conjugated) to proteins through a covalent
bond between the glycine at the C-terminal end of ubiquitin and the side chains
of lysine on the proteins. Ubiquitin helps in the docking of the various protein
substrates to the proteasomes for their degradation .

Previously in the lab various mutants of ubiquitin had been obtained by the
error prone PCR method. The mutants were selected by expressing the protein
in temperature sensitive ubi4 deletion mutants of ubiquitin. Most of the
mutations in ubiquitin gene failed to complement UBI4 phenotype under heat
shock. Only one of the mutants caused cell lysis, even at permissive
temperature. Sequencing of the mutant gene showed four completely nov el
amino acid substitutions. They are namely, Ser20 to Phe, Ala46 to Ser, Leu50 to
Pro and Ile61 to Thr. The Functional characterization of the above single
mutants revealed that more than one single mutant may be responsible for
the lethality seen . The construction and study of the functional aspects
of the double mutants form part of the work.

c
 ‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘
‘
‘
‘
‘
‘
‘‘‘‘‘‘‘‘
 
‘

G
Ubiquitin :
Ubiquitin is a small protein universally present in the eukaryotic cells. It
consists of a single 8565Da polypeptide chain of 76 amino acids. It has no
disulfide bonds and cofactors. The Ubiquitin molecule is extremely resistant to
tryptic digestion despite the presence of seven lysine residues and four arginine
residues. It is stable over a wide range of pH and temperature conditions. It has
half-life of 2hours. The protein has a pronounced hydrophobic core; of the 21
valine, leucine, isoleucine, and methionine residues, 16 are buried within the
interior of the molecule. The molecule comprises a compact globular domain that
consists of a five-stranded ȕ-sheet and an Į-helix and flexible tail formed by four
protruding residues. The ubiquitin tail has essential residues Leu73, Arg74,
Gly75 and Gly76. Gly75 and Gly76 are important for ubiquitin conjugation and
deubiquitination c. A hydrophobic patch including Leu8, Ile44 and Val70 is
required for proteasome degradation and plays a critical role in endocytosis . Phe4
and adjacent residues are important for the endocytic role of u biquitin but do not
function in proteasome binding and degradation .
Ubiquitin is most conserved protein from yeast to humans.‘This high degree
of conservation has been considered indicative of the importance of each amino
acid for the functionality of ubiquitin. It highlights the importance of ubiquitin in
regulating the degradation of proteins as well as other functions such as cell-cycle
control 3, signal transduction, neuronal 4 and immune function5.

Ubiquitin structure
Secondary Structure6:

-
‘
‘ i ‘
‘i iti ¶ ‘
 ‘tt‘‘t‘
‘ l ‘t ‘‘li ‘‘
t‘i‘‘‘‘
‘‘li ‘‘li ‘it‘‘i
‘‘t ‘i t
‘‘‘‘
li‘‘i 
‘t‘tt‘ ti ‘i ‘t
‘
‘i ‘‘t ‘t‘‘i‘
 i 
‘i ‘‘  ‘‘i ‘‘!  ‘‘t‘‘l
‘
‘
‘ î
i


 ‘
‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘ ‘
‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘

i‘ ‘

'‘ttl‘i‘‘ ‘i"iti ‘

l
‘t‘
(‘‘lti ‘) ‘
 tll ‘it‘li‘i ‘l‘t‘

‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘ ‘‘‘ t‘i ‘l‘

‘il‘i ‘ ‘
‘
‘
‘Mi  ‘
‘‘
 ‘   ‘
‘‘‘
 ‘ l‘i it lti ‘‘‘‘lt‘‘t‘" til‘ti ‘‘t‘
l‘ ‘  # ‘ $
‘ ‘ i"iti ‘ titi ‘  # ‘ $ ‘ ‘ i"iti ‘‘
 jti ‘‘ # ‘
‘$‘‘i"iti ‘ti ‘li‘$
‘t‘it‘ # ‘i ‘t‘
i"it lti ‘ t ‘ ‘ ‘ tilt‘ 
‘ t ‘ it‘ ti‘ it‘  ti ‘

‘ t‘ % lti l‘ l i ‘ ‘ i"iti ‘ &‘ tit
‘ i"iti ‘  ‘ $
‘ i‘
" tl ‘ t 
‘ t‘ t‘ ti‘ it‘  ti ‘ ‘  ‘ $ ‘  ‘
t titiiti ‘$‘i
‘i"iti 
‘$ ‘
‘ tt‘
‘ilitt‘
ti ‘ ‘  ‘ iti
‘ li !‘ t ‘ t‘ % l‘ ti l‘ l i ‘ ‘
i"iti ‘
‘t‘ 6i ‘‘‘ ‘i t l‘l i ‘i
‘ ‘t‘tt‘‘ ‘
i"iti ‘l
‘tt
‘t‘t‘ti ‘ ‘‘‘i"iti ‘i‘tt
‘t‘t‘
‘ i ‘‘‘t‘tt‘t‘t ‘t‘‘l i ‘‘


Ô
mc mnzyme ±
It is generally known that a single essential E1 governs ubiquitylation. In
mammals utilization of two translation initiation sites results in two E1 isoforms
referred to as E1a and E1bÊ. Cells expressing a temperature-sensitive E1 first led
to the discovery that ubiquitylation is essential for cell cycle prog ression and
provided in vivo evidence of its role in the proteolysis of short-lived proteinsc
. To
activate ubiquitin, E1 binds to Mg2+ATP and subsequently to ubiquitin, forming a
ubiquitin adenylate that serves as the donor of ubiquitin to the active cysteine in
E1cc. Each fully loaded E1 carries two molecules of ubiquitin, one as a thiol - ester
and the other as an adenylate. The activated ubiquitin is then transferred to t he
active site cysteine in E2. The carboxyl-terminal glycine of ubiquitin is essential
for its activation by E1.

m mnzyme ±
The 0

genome encodes a total of 13 E2 -like proteins (Ubc1-
Ubc13)c . Mammalian genomes include over 100 E2 domains. A conserved ~15
amino acid core domain (UBC) that includes an invariant cysteine that accepts
ubiquitin from E1 is the hallmark of E2s. These sequences may either facilitate or
preclude interactions with specific E3s c3.
Similarly, the amino acid composition in predicted or defined regions of
contact between E2 and E3 may affect productive E2 -E3 interactions. With few
exceptions E2s range from 14 to 36 kDa. E2s are subdivided on the basis of their
distinct primary sequences, presumably reflecting their different specificities for
their cognate E3s. For example, class I E2s, such as UBC4, UBC5, UBC7, and
UBC9-13 consist exclusively of UBC domain and may require their cognate E3s
for recognition of substrates, since they cannot alone transfer ubiquitin to
substrates. Class II (UBC1, UBC2/RAD6, UBC3/CDC34, UBC6, and UBC8),
class III (UBC6), and class IV E2s contain unique carboxy or amino terminal

£
extensions or both that may mediate substrate specificity as well as intracellular
localization.

m3 mnzyme ±
E3 ligases or ligase complexes recognize specific motifs on their substrate(s)
and catalyze the transfer of ubiquitin directly or indirectly from a thioester
intermediate from their cognate E2 to form an amide isopeptide bond bet ween
protein substrate and ubiquitin.

There are various types of E3-type ligases-

a) HECT Type ligases - A family of proteins that have a highly conserved regi on
of approximately 350 amino acids similar to the C-terminus of E6-APs. An
active cysteine residue in the C terminus, which forms a high-energy thio-ester
bond with Ub and constitutes a necessary step for t he Ub transfer to the substrate c4.

b) Ring finger type ligases - They have common 40 to 100 amino acid RING
domain. The RING class of E3 enzymes is further subdivided into the plant
homeobox domain/leukemia-associated protein and U-box familiesc5,c6. The RING
finger is defined by eight conserved cysteines and histidines that together
coordinate two zinc ions in a cross-braced fashion [CX2CX(9±39)CX(1±3)HX(2±
C/HX2CX(4±48)CX2C]17.

Proteasome18 ±

Proteasome consists of two major assemblies- 28-subunit core particle (CP,

also known as the 20S particle) and a regulatory particle. The CP is a barrel-like
structure whose subunits are arranged in four stacked seven membered rings. The

u
proteasome s proteolytic active sites are in internal space of the CP. Regulatory
particle (RP, also known as the 19S particle /PA700) or 19S regulatory complex,
consisting of a lid and a base that binds to the 20S particle to form the 26S
proteasome. The lid recognizes ubiquitinated protein substrates, the base, which
contains six ATPases and caps the end of the 20S proteasome core, unfolds
protein substrates in an ATP-dependent manner.

Ubiquitin mediated protein degradation pathway19

-

‘
Figure 3-The pathway can be divided into 3 steps- a) First step (activation)- In
this the carboxyl group of Gly-76 of ubiquitin is activated by ubiquitin-
activating enzyme (E1) in a two step mecha nism - formation of ubiquitinyl-
adenylate intermediate, and transfer of this activated UB on to active cys residue
on E1. b) Second step - activated ubiquitin is then transferred by transacylation
reaction on to a thiol group of an active site Cys residue of E2 ‘ c) Third step-
ubiquitin is transferred to a target protein, forming an isopeptide bond between the
C-terminal glycine of ubiquitin and the İ- amino group of a lysine residue on the
target protein‘
‘‘‘‘‘‘‘‘‘
‘Substrate Recognition ‘
The N-end rule relates the 



half life of a protein to the identity of its
N terminal residue and the underlying proteolytic pathway is called the N -end
rule pathway (Fig. 6). Its Ub ligases target protein substrates that bear specific

r
destabilizing N-terminal residues. The corresponding degradation signal (degron),
called the N-degron, consists of a substrate destabilizing N-terminal residue and
an internal Lys residue, the latter being the site of formation of a substrate- linked
poly-Ub chain. A ubiquitylated substrate is processively degraded by the 26S
proteasome. Because an N-degron must be produced through a proteolytic
cleavage that yields a destabilizing N-terminal residue, a nascent N-end rule


substrate contains a cryptic N-degron, called a pro-degron

Primary Destabilizing Residues c:

Destabilizing activity of these N-terminal residues, denoted N-dP, requires their
physical binding by a protein called N-recognin or E3. In eukaryotes, the type 1
binding site of N-recognin binds N-terminal Arg, Lys, or His, a set of basic N-
dP residues, whereas the type 2 site binds N-terminal Phe, Leu, Trp, Tyr, or Ile-a
set of bulky hydrophobic N-dP residues.

Secondary Destabilizing Residues:

These N-terminal residues denoted N-ds, are Asp and Glu in yeast; and Asp, Glu,
and Cys in mammalian cells. In eukaryotes, destabilizing activity of N-ds residues
requires their accessibility to Arg-tRNA-protein transferase.

îertiary Destabilizing Residues:

N-terminal Asn and Gln residues denoted N-dt. Destabilizing activity of
N-dt residues requires their accessibility to N-terminal amidohydrolase (Nt-
amidase).

Stabilizing Residues:
A stabilizing N-terminal residue is a "default" residue, in that it is stabilizing
because targeting components of an N-end rule pathway do not bind to it .
[
Figure 4 - THE N- End rule pathway ± the primary destabilizing residues are
converted into Secondary destabilizing residues by N -ter amidases. This
secondary residues are converted into ter destabilizing residues by Arg-transferase
and subsequently recognized and degraded by the 26S proteasome pathway.
‘
Biochemical Profile of Yeast Ubiquitin
(Information is generated from ProtParam online tool present on ExPASy Proteomics Server)

Protein sequence:
10 20 30 40 50
MQIFVKTLTG KTITLEVESS DTIDNVKSKI QDKEGIPPD QRLIFAGKQL

60 70
EDGRTLSDYN IQKESTLHLV LRLRGG

- Number of amino acids: 76

- Molecular weight: 8556.7
- Theoretical pI: 6.56
- Amino acid composition:

Ala (A) 1 1.3%

Arg (R) 4 5.3%
Asn (N) 2 2.6%
Asp (D) 6 7.9%
Cys (C) 0 0.0%
Gln (Q) 6 7.9%
Glu (E) 5 6.6%
Gly (G) 6 7.9%
His (H) 1 1.3%
Ile (I) 7 9.2%
Leu (L) 9 11.8%
Lys (K) 7 9.2%
Met (M) 1 1.3%
Ê
 Phe (F) 2 2.6%
Pro (P) 2 2.6%
Ser (S) 5 6.6%
Thr (T) 7 9.2%
Trp (W) 0 0.0%
Tyr (Y) 1 1.3%
Val (V) 4 5.3%
Pyl (O) 0 0.0%
Sec (U) 0 0.0%

Yeast Ubiqutin Gene family

There is family of four ubiquitin-coding loci in the yeast 0

 

. UBI1, UBI2 and UBI3 encode hybrid proteins in which ubiquitin is
fused to some 'tail' amino acid sequences coding for ribosomal proteins.
The ubiquitin coding elements of UBI1 and UBI2 are interrupted at
identical positions by non-homologous introns. UBI1 and UBI2 encode
identical 52-residue tails, whereas UBI3 encodes a different 76-residue tail.
The tail amino acid sequences are highly conserved between yeast and mammals.
Each tail contains a putative metal-binding , nucleic acid-binding domain of
the form Cys-X2-4-Cys-X2_15-Cys-X2-4-Cys, suggesting that these proteins may
function by binding to DNA. The fourth gene, UBI4 , encodes a polyubiquitin
precursor protein containing five ubiquiti n repeats in a head-to-tail,
spacerless arrangement. All four ubiquitin genes are expressed in exponentially
growing cells,while in stationary-phase cells the expression of UBI1 and UBI2
is repressed. The UBI4 gene, which is strongly inducible by starvation, high
temperatures and other stresses, contains in its upstream region homologies to
the consensus 'heatshock box' nucleotide sequence.

Figure 5- Ubiquitin gene family comprises UBIc,UBI ,UBI3 fused with

ribosomal proteins.

c

Conservation of the deduced amino acid sequences of the tails of UBI1 -UBI3
protein between yeast and mammals:

cc
 UBIQUIîIN GmNm SmQUmNCm
[Ym Sî SYNî
mîIC]
Bgl II Hpa I

1 ATG CAG ATC TTC GTC AAG ACG TTA ACC GGT 30
Met Gln Ile Phe Val Lys Thr Leu Thr Gly
1 5 10
Xbal I

31 AAA ACC ATA ACT CTA GAA GTT GAA TCT TCC 60
Lys Thr Ile Thr Leu Glu Val Glu Ser Ser
11 15 20

61 GAT ACC ATC GAC AAC GTT AAG TCG AAA ATT 90
Asp Thr Ile Asp Asn Val Lys Ser Lys Ile
21 25 30
Bsm I

91 CAA GAC AAG GAA GGC ATT CCA CCT GAT CAA 120
Gln Asp Lys Glu Gly Ile Pro Pro Asp Gln
31 35 40
Xho I

121 CAA AGA TTG ATC TTT GCC GGT AAG CAG CTC 150
Gln Arg Leu Ile Phe Ala Gly Lys Gln Leu
41 45 50
Xho I

151 GAG GAC GGT AGA ACG CTG TCT GAT TAC AAC 180
Glu Asp Gly Arg Thr leu Ser Asp Tyr Asn
51 55 60
Sal I Afl II

181 ATT CAG AAG GAG TCG ACC TTA CAT CTT GTC 210
Ile Gln Lys Glu Ser Thr Leu His Leu Val
61 65 70
Afl II

211 TTA AGA CTA AGA GGT GGT TGA 231

Leu Arg Leu Arg Gly Gly End

71 75 76

cG
‘‘‘‘‘‘‘‘‘‘‘‘‘
‘
‘
‘
‘
‘
‘‘

 
‘
‘
‘
‘
‘
‘
‘
‘
‘
c-
 ‘
‘
‘
‘
‘
‘‘‘‘
1)‘ Construction of the double mutant YEp96 UB[L50P] [I61T] .

2)‘ Transformation of the above mutant in yeast S

 
.

3)‘ Functional characterization of the above mutant and some already constructed
mutants YEp UB [A46S][L50P], YEp UB [S20F][I61T] , YEp UB [S20F][L50P]
and YEp UB[S20F ][A46S] in 0
 
.

cÔ
‘
‘
‘
‘‘‘‘ 
‘‘
‘‘‘

c£
 3
PCR based Site-directed mutagenesis
(Recombinant PCR)

Figure 6 PCR reactions that produce products which overlap in the region of the
mutation , in the above figure, primer B ,used in the PCR reaction 1, is
complementary to primer C used in the second PCR. Both PCR contain the
required alteration in the sequence ( bu t on the opposite strandes). If we mix
products of the two reactions , denature and re-anneal, some of the single strands
from reaction1 will anneal to strands from reaction 2 in the region where they
overlap , corresponding to sequences of primers B and C . One of the two possible
hybrid molecules contain 3 ends which can as a primer for extension by DNA

cu
polymerases to produce completed double stranded molecule containing the
mutation.

Cloning strategy

Figure 7 ± Both PCR product and the yeast expression vector are digested with

 and  
. both digested product are then ligated to produce a recombinant
clone containing the double mutant ubiquitin gene product .

cr
‘‘‘‘‘‘‘‘‘‘
‘‘‘‘‘‘‘‘
‘‘‘‘‘‘‘‘‘‘‘‘ 
 ‘‘
‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘

‘

c[
Yeast Strains, Media and Plasmids ‘
Strains SUB62 (MATĮ lys2-801 leu2-3,112 ura3-52 his3-A200 trpl-1) a
SUB60 (MATĮ ubi4-A2:: LEU2 lys2-801 leu2-3,112 ura3-52 his3-A200 trpl-1)
.Cultures were grow at 30°C at 200 rpm, except where indicated in synthetic
dextrose medium consisted 0.67% Hi-media yeast nitrogen base supplemented
with histidine, leucine ,tryptophan, lysine and uracil as and when required with
2% glucose as carbon source. Ubiquitin is expressed from a high copy number
yeast episomal plasmid that is identical to TRPI copper inducible ubiquitin
expression plasmid YEp 96. YEp 96 is a 2 ȝm based shuttle vector between
m




and 0
. The ubiquitin gene is expressed from CUP1
promoter induced by the addition of 100 ȝM CuS04.

Bacterial Strains and Media

Escherichia coli DH5Į culture was grown at 37oc at 200rpm in nutrient rich
Luria broth from Hi-media. Selection pressure of 100ȝg/ml of ampicillin was used
with the strains transformed by the plasmid .

Plasmid Construction (Yeast m
pression Vector)

All ubiquitin gene mutations were carried out in plasmids derived from YEp
96 (Figure 8). Amplicons of mutant ubiquitin gene generated by recombinant PCR
were cloned into the 
, 
 sites of YEp96©

cÊ
 ‘ Figure 8 . The YEp 96 vector
contains 6179 bps. It contains wild type synthetic yeast ubiquitin gene under the
CUP1 promoter, hence copper inducible. It is ampicillin resistant - 50-100ȝg/ml
final concentration. It has one 
, one 

and two m


sites.‘

îhe DN sequence of the m
R I -  synthetic yeast ubiquitin gene insert
in Ymp Ê6 / UbWt -

GAATTC ATTATGC AGATCT««.Yeast-UB«.GGT GGT TGA GGTACC

m

I Met 
II Gly Gly 


G

 Primers Used For Recombinant PCR
(Site-Directed Mutagenesis)
The EP I61T vector backbone was used to amplify mutated gene with the primers
42 EP 50 FR, 42 EP 50 RE to bring L50P mutation.

Primer Sequence

175 FP 5 ACAGAATTCATGAACATCTTCGTCAA3

175 RP 5 TCCGGTACCCGCTCAACCACCTCTTAG 3

EP 50
RP 5 GATC TTT GCC GGC AAG CAG CCT GAG GACGGT AG 3

EP 50
RP 5 CT ACC GTC CTC AGG CTG CTT GCC GGC AAA GAT C 3

Table 3- List of the primers used in the study.

Gc
Protocol for Yeast îransformation (Lazy Bones) 4
Materials:

PLATE Solution
‡ 40% PEG 3350
‡ 0.1M LiAc (Lithium Acetate)
‡ 10mM Tris-Hcl pH-7.5
‡ 1mM EDTA

Method:
‡‘ 0.5 ml of culture was taken and spun for 10sec in microfuge. The tube was
decanted by inverting it.

‡ 10ȝl of carrier DNA (100ȝg) plus 1ȝg transforming DNA (in 10ȝl) was added
and vortexed well.

‡ 0.5ml PLATE solution was added and vortexed.

‡ 57ȝl DMSO was added and vortexed briefly and left for 15min at R.T.

‡ Heat stock for 15min at 42 oC was given.

‡‘ Cells were pelleted in microfuge for a few seconds at 10K. Supernatant was
carefully removed.

‡‘ 200ȝl T.E. was added to the cell pellet and gently responded cells by
aspirating up and down a pipette tip . Then suspended cells were
immediately spread on the selective media plates.

GG
 Protocol for Bacterial îransformation 5

Carried out using CaCl2 method. (Sambrook 
)

Materials:
‡ Luria broth- 10ml.
‡ Luria agar- 100ml
‡ MgCl2- 0.1 M, CaCl2- 0.1 M

Method:
‡ 100ȝl of over-night grown bacterial culture was inoculated into 10 ml LB
broth in 100ml conical flask. The culture is grown by constant shaking till it
reaches an O.D. of 600 nm.

‡ The culture was chilled on ice for 10 min. 1.5ml culture was taken in microfuge
tube and spun at 3500rpm for 5-10min for 4oC.

‡ The supernatant was discarded. The cells were re-suspended in equal volume of
Precooled solution of 0.1M MgCl2 and kept on ice for 15min. The cell
suspension was centrifuged at 3500 rpm for 5min at 4 oC.

‡ The supernatant was discarded. The cells were re-suspended in 100ȝl of pre-
cooled solution of 0.1M CaCl2 and kept on ice for 30-45mins.

‡ Plasmid DNA approx. 50ng-1ȝg was added for each transformation reaction and
kept on ice for 45mins.

‡ The tubes were transferred to water bath, pre heated to 39-42oC and kept for
90sec.

‡ 1ml LB was added to each tube and incubated at 30-37oC for 30 min to 1 hr.

G-
±‘ An appropriate quantity of cells was spreaded on to selective media using a
glass spreader

‡ The plates were left open in the laminar hood till the liquid dried up
and then incubated at 37oC for 12-24 hrs.

‡ The transformants were amplified on Luria agar containing suitable

selection antibiotic and inoculated from this amplified plate in the
LB broth containing appropriate antibiotic for plasmid preparation.

Plasmid Preparation by lkaline Lysis Method

Materials:

’‘ Solution I: 50mM glucose, 25mM Tris-Cl pH-8.0, 10mM EDTA.

’‘ Solution II: 0.2 N NaOH, 10% SDS.
’‘ Solution III: 60ml of 5M potassium acetate, 11.5 ml of glacial acetic acid,
28.5 ml H2O
’‘ TE [pH-8.0]- 10mM Tris-Cl [pH-8.0]
’‘ Luria broth- 25ml
’‘ 1mM EDTA [pH-8.0]

Method:

‡ 25ml overnight grown culture of bacterial cells was harvested by centrifugation

at 4000 g for 10min at 4OC.

‡ The bacterial pellet was re-suspended in 1ml of solution I and kept at room
temp. for 5mins.

‡ 2ml of freshly made solution II was added and mixed gently by inverting the
tube several times and kept on ice for 1min.

GÔ
‡ 1.5ml of ice cold solution of 5M potassium acetate [solution III] was added and
kept on ice for 15mins.

±‘ It was then centrifuged at 10,000 rpm for 10min at 4 oC. Bacterial debris formed
a tight pellet.

‡ The supernatant was into another tube and equal volume of Phenol:
chloroform:Iso-amyl alcohol (25:24:1) was added and vortexed thoroughly to
mix the contents well. It was then centrifuged at 5000 rpm for 5min.

±‘ The supernatant was transferred to another tube and equal volume of

Chloroform :Iso-amyl alcohol (24:1) was added and vortexed to mix the
contents well. It was then centrifuged at 5000rpm for 5min.

‡ The supernatant was transferred into another tube and 0.6 volumes of
isopropanol was added and mixed well and kept at room temperature for
15min.

‡ The DNA was pelleted down by centrifugation at 10,000 rpm for 15min.The
supernatant was discarded and the pellet was washed with cold 70% ethanol at
room temperature, twice. As much as possible ethanol was discarded and then
dried.

‡ TE [pH-8.0]- 80 to 100ȝl was added.

G£
 garose Gel mlectrophoresis
DNA digested with different restriction enzymes will generate different
sized fragments. These fragments can be separated, identified, and purified with
the help of gel electrophoresis. Location of the DNA in the gel can be detected by
using the fluorescent dye called ethidium bromide, which binds the DNA and
fluoresces when illuminated under UV light of 302nm and can detect as low as 1ng
of DNA. The electrophoretic migration of DNA through the agarose gel depends
upon few main parameters:

‡ Molecular size of DNA : Molecules of linear or duplex DNA travels

through the gel matrix at rates that are inversely proportional to log 10 of their
molecular weights.

‡ The agarose concentration: DNA fragment of a particular size will

migrate at different rates through gels containing concentration of agarose.
There is linear relationship between logarithm of electrophoretic mobility of
DNA and the concentration of agarose.
‡ The conformation of DNA: closed circular [form I], nicked circular [form
II] and linear [form III] DNA of the same molecular weight migrate through
agarose gels at different rates. The relative mobility s of these forms are
dependent primarily on agarose concentration in the gel, but are also influenced
by the strength of the current applied, the ionic strength of the buffer and the
density of super helical twists in the form DNA.
‡ The applied current: At low voltages the rate of migration of linear
DNA fragment is proportional to the voltage applied.
‡ Base composition and temperature: In agarose gel the relative
electrophoretic Mobility of DNA fragment of different sizes do not change
between 4-30oC. Generally agarose gels are run at room temperature. The gels
less the 0.5% are run at 4oC.

Gu
DN P Gm (De-O
y Nucleic cid
Polyacrylamide Gel mlectrophoresis)
Principle :
DNA-PAGE is used to separate, identify and purify fragment s which highly
smaller in size, and cannot be resolved properly on agarose gels, e.g - the PCR
products or the digestion products of the PCR. It consists of acrylamide which
forms linear chains, while bisacrylamide is the cross-linking agent. Acrylamide
and bis-acrylamide, together form a network of very fine pore size. Ammonium
Per- Sulphate (APS) acts as an initiator of the polymerization reaction. TEMED
acts as a catalyst of for the polymerization reaction .
Materials:
±‘ 5X TBE ( Tris Borate EDTA)

±‘ Monomer solution (30%T, 2.7% Cbis)

- Acrylamide 58.4g
- Bis acrylamide 1.6g
- Distilled water make upto 200ml. (Store at 4 C in dark)

’‘ 10% APS

’‘ TEMED 2 ȝl

Protocol for heat stress complementation

’‘ Exponentially growing yeast cells were plated on supplemented minimal
medium containing 100 ȝM CuSO4.

’‘ The plates were then incubated at 40° C for 16 hrs.

’‘ This was followed by a shift to 30 °c for 4 days to allow for colony

development .

Gr
 RESULTS &
DISCUSSION
‘

G[
‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘

  i ‘
i i
   i
‘‘‘‘‘‘‘‘
*+,
&-‘li
‘! ‘ ‘t! ‘‘.CR‘t‘ t‘ t t‘ *‘
,/0.
&-‘ &‘ l t ‘ t i‘ i‘ 0‘ .‘ 
‘ 0R.‘ ‘
t! ‘‘i  t‘.CR‘&‘i  t‘.CR‘
t‘i‘ tt
‘i ‘t‘
t‘ &‘ it‘ 
‘ 
‘ .CR‘ t‘ ‘ i l‘ ‘ liiti ‘ ‘ ‘
 ‘ ‘ 
‘

‘
‘i‘
t‘‘
‘
‘‘
iti ‘‘ ‘i ‘ ‘ ‘ii‘
i‘ ‘
10‘ .‘
‘
10‘ R‘
‘‘ ‘i t l‘i‘0‘ .‘
‘0‘ R.‘‘&i
‘
t‘i l‘liiti ‘‘ 0‘‘i  t‘
t‘i ‘t‘ ‘ii‘
i‘'ll‘t‘.CR‘
t‘‘ ‘i ‘t‘i
‘‘l‘‘‘‘
‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘ ‘
‘‘‘‘‘‘‘/'2$‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘
‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘ ‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘3‘

‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘ ‘
‘
i‘+‘‘42'‘.'5$‘ l i‘‘‘t‘i  t‘.CR‘
t‘/ 
‘‘‘

‘‘!‘‘/ ‘ ‘i
it‘t‘
 ‘‘.CR‘
t‘lii
‘i ‘i‘

10‘ .‘ ‘ 
‘ ‘ $.‘ 0‘ R$‘ ‘ / ‘ ‘ ‘ i‘ ‘

‘ ‘ .CR‘ 
t‘ lii
‘ i ‘
i‘
10‘ R.‘ 
‘ $.‘ 0‘ .‘ ‘ / ‘ 3‘ i‘ ‘ 0‘ ‘ i  t‘ .CR‘ 
t‘


‘ i ‘ t‘ 
‘

‘ ‘ 
t‘ ‘ tlt‘ 
‘ t‘ i‘
10‘ .‘ 
‘

10‘R$‘

GÊ
 Recombinant PCR Digestion

The recombinant PCR product YEp 96[L50P-I61T] is digested separately with

Ú

, 0 & Ú 
There is no digestion seen with XhoI and SalI, hence the
mutations at 50th and 61th positions as indicated in the figure cc below are
confirmed-

1 2 3 4 5

Figure 11- Showing the digestion pattern of Recombinant PCR product. The wild
type yeast ubiquitin has synthetic gene contain sites for Ú

, 0 & Ú 
Lane 1
is a 100 bp marker, Lane 2 showing the Undigested Recombinant PCR product
used as (control) , Lane 3 & Lane 5 showing the digestion with XhoI and SalI
has failed and confirms the mutation at the 50th and 61th position. Lane 4 shows
digestion of the Recombinant PCR product by Ú 
showing the intact restriction
site.

-

 Confirmation of Ymp [L5
P I6cî] Mutation
(Plasmid Digestion)
The confirmation of the mutation was done by plasmid digestion with various
restriction enzymes ‰ 
III

I
II
m
RI
, Ú
I and 0I. The
incorporation of the two mutations at 50th and 61st disrupts the Ú
I and 0I
sites and shows identical digestion pattern as the Undigested YEp 96 WT plasmid
, shown in the figure c
below-

1 2 3 4 5 6 7 8

Figure 10- showing the digestion pattern of YEp 96[L50P-I61T] . Lane 1 is the Ȝ
‰ 

marker Lane 2 showing the Undigested YEp96 [L50P- I61T] plasmid used
as control Lane 3, Lane 6, Lane 7, Lane 8 showing the Linearization of [L50P-
I61T] plasmid after digestion with ‰ 





m


indicative of
intact restriction sites. Lane 4 & lane 5 showing the digestion with Ú
 and SalI
failed, which confirms the mutation .

-c
‘

i
il   i 

*$‘ +‘ ,/0.
&-‘  tt‘ ‘  ‘ t‘  i
‘  ‘ t‘
" i ‘t
‘‘Rlt‘ ‘i ‘t‘i‘
‘l‘

‘‘‘‘‘‘‘‘‘‘‘‘‘‘‘

‘
‘‘
‘
‘ i‘
6" i ‘‘t‘Ri  t‘.CR‘
t‘ i‘‘ ‘‘‘/‘‘
t‘.‘‘t‘0t‘i ‘i
‘i
‘‘
‘‘‘‘‘‘l‘t‘&‘t‘
t‘iti ‘‘
‘

-G
 ‘
‘
‘
‘
‘‘‘‘‘‘‘‘‘‘‘‘‘‘ ! "‘‘#‘‘$%!‘&"
‘‘‘'!"‘‘0

 


 ‘

--
Growth curve analysis
The growth curve analysis of the wild type strain SUB 62 ( having WT
UB gene), SUB 60 (UBI4 gene deleted strain ) and SUB 60 cells transformed
with the double mutant constructs namely [A46S][L50P], YEp UB [L50P][I61T],
YEp UB [S20F][I61T], YEp UB [S20F][L50P] and YEp UB[S20F][A46S] was
done for about 32 hours. The growth pattern of all of the above is shown in the
figure below (Figure 13).

‘ 
 ^
  
‘ ^
 




 ^

^
‘ 
^
^
 ^
‘ ^
 ^^
^
 

‘ ^^ ^
^
  ^  
  ^
  ^  

î
‘ ‘

Figure 13- Growth curve analysis of the five double mutants along with wild type
strains SUB60, SUB 62, SUB60/YEp 96 WT.

-Ô
 Generation time
The generation time of SUB62, SUB 60, and the double mutants
[A46S][L50P], YEp UB L50P][I61T] , YEp UB [S20F][I61T], YEp UB
[S20F][L50P] and YEp UB[S20F][A46S] have been calculated by taking two log
phase values.

Figure 14- The generation time of all the double mutants and the cont rols.

‘"
-‘ YEp UB [A46S][L50P] and YEp UB [L50P][I61T] are showing reduced
growth than the wild type strain SUB 62.

-‘ YEp UB [S20F][I61T] , YEp UB [S20F][L50P] and YEp UB[S20F][A46S] are

showing comparable growth to the wild type .

-£

eat Stress Complementation
In the heat stress complementation experiment, the SUB 62, SUB 60 and SUB 60
transformed with the YEp 96 UB [A46S][L50P] and YEp96 UB [S20F]
[L50P] , YEp UB [S20F][I61T] were plated on selective media and incubated for
various time intervals 4hrs, 8hrs, 12hrs, 16hrs at 400 C and returned to allow
growth at 300C. The percent survival obtained by counting the colonies is shown
in the figure 15 below.

 ^

^^
 ^
‘ 

^  ^ 
‘ ^

^
 ^^

^  ^
‘ ^

‘ ^
^
  
 ‘ ‘
‘‘‘‘
Figure 15- The heat stress complementation experiment was performed with three
double mutants by incubating the respective plates for 4hrs, 8hrs, 12hrs,16hrs time
intervals.
‘‘‘‘‘‘‘‘

‘
‘
‘
‘
‘
-u
 ‘‘‘‘‘‘‘‘‘‘iili 
il  ‘
&‘ t‘iilit ‘‘t t‘‘llt
‘ ‘ill ‘
ilti ‘
‘lti ‘t‘
ll‘ i ‘ tti ‘  ‘ lti‘ 
i‘ ‘ 6B‘  ‘ 6B‘ ‘ 
‘ 6B‘ ‘
t 
‘it‘t‘*$‘+‘B‘,'36-,/0.-‘‘‘
‘‘‘*$+‘B‘,6  -,/0.-‘‘‘
*$‘B‘,6  -,
&-‘‘ ‘‘ ‘i ‘t‘i‘
‘l‘‘

‘‘‘‘‘
‘  0

 0

ÿ
   

‘ 

 0 

‘  0 
0

‘ 

‘ 0
 0
 
0  0  0

‘ 

 cu   
          
  

    

‘


‘
‘‘‘‘‘‘‘‘‘‘*$‘+‘B‘,'36-,/0.-‘‘
‘‘*$+‘B‘,6  -‘,/0.-‘t‘‘‘‘
 l‘‘t‘‘l t‘‘‘‘t‘‘t‘‘t‘‘‘Bt‘t t‘l‘ti‘iilit ‘

‘
‘
‘‘
‘
‘

-r
Discussion
Ubiquitin is a small protein found in all eukaryotic cells. It is highly conserved
from yeast to humans differing in only three residues. This implies that
some residues are important for the structural and functional aspects of the
protein.

Katherine 
., 2001 have identified three important structural features on the
surface of ubiquitin involved in many important cellular process such as
proteasomal degaradation, endocytosis etc. The essential surface cluster
including Leu8, Ile44, and Val70 consists of nine amino acids that extend from
the base of the ubiquitin tail up to Gly47 and Lys48. All of these residues are
probably involved in ubiquitin conjugation and/or proteasome degradation,
and they may also be important for deubiquitinat ion. Lys48 is the major site of
polyubiquitin chain formation that is necessary for proteasome degradation. The
second essential cluster on the globular domain surface consists of residues
Gln2, Phe4, and Thr12. Phe4 is critical for endocytosis, and Gln2 and Thr12
play a minor role. The ubiquitin tail consists of the essential residues Leu73,
Arg74, Gly75 and Gly76. Gly75 and Gly76 are important for ubiquitin
conjugation and deubiquitination. Arg74 is essential even though it is not
important for E1 interaction or ubiquitin conjugation. These residues may be
important for deubiquitination and possibly for proteasome recognition as well.
Arg74 and Leu73 play a minor role in endocytosis.
To understand more about the structural aspects, our lab has obtained som e
mutants of ubiquitin by in vitro evolution method. All the mutants were
selected in a 
gene deleted strain (ubi4 is a yeast ubiquitin expressed
under the stress conditions). All but one mutant named EP 42 failed to show
complementation to stress survival functions of the ubi4 gene. Sequencing

-[
of the EP42 mutant revealed some four novel amino acid substitution mutations
Ser20 to Phe, Ala46 to Ser, Leu50 to Pro and Ile61 to Thr.
In this work a double mutant construction namely YEp UB [L50P][I61T] has
been carried out . Also Functional study of 5 double mutants name ly YEp
UB [A46S] [L50P], YEp UB [S20F] [I61T] , YEp UB [S20F] [L50P] , YEp
UB[S20F][A46S] and YEp UB[L50P][I61T] has been carried out in
0
 


The results of the functional studies showed that YEp UB [A46S] [L50P] and
YEp UB [L50P] [I61T] are showing reduced growth than the wild type
strain SUB 62. While YEp UB[S20F] [I61T] , YEp UB [S20F] [L50P] and YEp
UB[S20F][A46S] are showing growth comparable to the wild type. Both YEp
96 UB [A46S][L50P] and YEp96 UB [S20F] [L50P] are unable to
complement under heat stress. Here it is observed that the mutation at 46 th
position was not lethal to the cell, while the mut ations at 50th position cannot
complement the heat stress and losing the viability. Thus, A46S in combination
with L50P is proving to be more detrimental to the cell. Ile 61 has been
shown to be important in folding based on the H-D exchange NMR studies. A46S
is showing lesser effect, ser at this position is also found naturally in some SUMO
proteins.

Functional studies on some others parameters and structural data of the above
mutants will help to pinpoint the amino aci d residues whose substitution is
responsibe for the dosage dependent lethality.

-Ê
FUîURm PROSPmCîS

Functional evaluation of all the double mutants on other parameters

- Antibiotic stress

- N-end rule

- Amino acid analog stress

Ô

 BIBLIOGRAPHY‘
‘
‘
‘
‘
‘
‘
‘
‘
‘
Ôc
1.‘ S. Vijay-Kumar, C.E. Bugg, and W.J. Cook. Structure of ubiquitin refined at
1.8 °A resolution. J. Mol. Biol., 194:531±544, 1987.‘

2.‘ Katherine E. Sloper-Mould, Jennifer C. Jemc, Cecile M. Pickart , and Linda

Hicke. Distinct functional Surface Regions on Ubiquitin . The Journal of
biological chemistry., Vol. 276, No. 32, Issue of August 10, pp. 30483±
30489, 2001.

3.‘ Ang, X. L. & Harper, J. W. Interwoven ubiquitination oscillators and

control of cell cycle transitions. 0
0m
pe31 2004.

4.‘ Jason j. yi and michael d. ehlers,

Emerging Roles for Ubiquitin and Protein
Degradationin Neuronal Function.,



59:14±39, 2007.

5.‘ Ben-Neriah Y. Regulatory function of ubiquitination in the immune

system. ÿ 

3:20±26.2002

6.‘ Protein data bank

7.‘ Fanga and A. M.Weissmanb. A field guide to ubiquitylation . CMLS, Cell.

Mol. Life Sci. 61,1546±1561, 2004.

8.‘ Daniel Finley. Recognition and Processing of Ubiquitin-Protein Conjugates

by the Proteasome .‘Annu. Rev. Biochem ., 78:477±513 , 2009.

9.‘ Handley-Gearhart P. M., Stephen A. G., Trausch-Azar J. S.,Ciechanover A.

and Schwartz A. L. Human ubiquitin activating enzyme , E 1. Indication
of potential nuclear and cytoplasmic subpopulations using epitope -tagged
cDNA constructs. J. Biol. Chem. 6Ê: 33171±33178.1994.

10.‘Ciechanover A., Finley D. and Varshavsky A. Ubiquitin dependence of

selective protein degradation de monstrated in the mammalian cell cycle
mutant ts85. Cell 37: 57±66 . 1984.

11.‘Haas A. L. and Rose I. A. The mechanism of ubiquitin activating enzyme.

A kinetic and equilibrium analysis. J. Biol.Chem. 57: 10329±10337.1982.

ÔG
12.‘Jentsch S. Annu Rev Genet ; 26:179 20 .1992.

13.‘Pickart C. M. Mechanisms underlying ubiquitination Annu. Rev. Biochem.

7
: 503±533 ,2001

14.‘Huibregtse JM, Scheffner M, Beaudenon S, and Howley PM A family of

proteins structurally and functionally related to the E6 -AP ubiquitin-protein
ligase. 

ÿ

0
0
Ê :2563±2567. 1995.

15.‘Boname JM and Stevenson PG MHC class I ubiquitination by a viral PHD/

LAP finger protein.  
c5:627±636.2001

16.‘Koegl M., Hoppe T., Schlenker S., Ulrich H. D., Mayer T. U. and Jentsch S.
A novel ubiquitination factor, E4, is involved in multiubiquitin chain
assembly. Cell Ê6: 635±644.1999.

17.‘Borden KL and Freemont PS The RING finger domain: a recent example of

a sequence-structure family. x



0



6:395±401.1996.

18.‘Jan Smalle and Richard D. Vierstra . The Ubiquitin 26S Proteasome -

Proteolytic Pathway Annu. Rev. Plant Biol. 55:555-90.2004.

19.‘Pickart C. M. Mechanisms underlying ubiquitination. Annu. Rev. Biochem.

7
: 503±533. 2001.

20.‘Alexander Varshavsky .The N-end pathway of protein degradation.

Genes to Cell 13-28, 1997.

21.‘Engin Ozkaynak, Daniel Finley, Mark J.Solomon' and Alexander

Varshavsky. The yeast ubiquitin genes: a family of natural gene fusions. The
EMBO Journal, vol.6 no.5 pp. 1429-1439 , 1987.

22.‘Daniel Finley , Engin bzkaynak, and Alexander Varshavsky 1987. The

Yeast Polyubiquitin Gene Is Essential for Resistance to High Temperatures,
Starvation, and Other Stresses,‘Cell, Vol. 48, 10351046. March 27, 1987.

Ô-
23.‘Jeremy W dale and Malcolm von schantz .,Genes and Genomes , concepts
and applications of DNA technology, John wiley & Sons ,UK.20 .

24.‘J. S. Richardson, E. D. Getzoff, David C. Richardson, 


ÿ


0. USA Vol. 75: 2574-2578. 1978.

25.‘Sambrook and Russel ë



 




ë 

, Cold Spring Harbour Laboratory Press, New York, 1:1.116,

ÔÔ