You are on page 1of 12

HAEMATOLOGY DEPARTMENT, HOSPITAL UNIVERSITI SAINS MALAYSIA TITLE: PROCEDURE NO.

BCR-ABL FUSION TRANSCRIPT USING MULTIPLEX RT-PCR HUSM/HEMA-UPT/STM-M2 VERSION : VERSION DATE: 2 01.03.2011

APPROVED BY :

... ASSOC PROF DR ROSLINE HASSAN HEAD OF HAEMATOLOGY DEPARTMENT

CONTROLLED COPY NO : 4 REGISTERED HOLDER HAEMATOLOGY LABORATORY

RECORD OF REVIEW/AMMENDMENT

DATE
01.03.2011 01.03.2011

VERSION NO.
2 2

DETAIL OF AMMENDMENT
4.4 added a clause for the positive control criteria 5.2 added appendix 1: Safety precaution of ethidium bromide.

BY
Selamah Ghazali Selamah Ghazali

Page 1 of 12

STANDARD TECHNICAL MANUAL

HAEMATOLOGY DEPARTMENT, HOSPITAL UNIVERSITI SAINS MALAYSIA TITLE: PROCEDURE NO.


PREPARED BY DESIGNATION CHECKED BY DESIGNATION AUTHORISED BY DESIGNATION

BCR-ABL FUSION TRANSCRIPT USING MULTIPLEX RT-PCR HUSM/HEMA-UPT/STM-M2

VERSION : VERSION DATE:

2 01.03.2011

: SELAMAH GHAZALI : TECHNICAL MANAGER / MEDICAL LAB TECHNOLOGIST U36


: ANG CHENG YONG : TRAINING OFFICER / SCIENTIFIC OFFICER : : ASSOC PROF DR ROSLINE HASSAN HAEMATOLOGIST/LAB DIRECTOR/ HEAD OF DEPARTMENT

1.

OBJECTIVE
To detect qualitatively BCR-ABL fusion transcript in patients diagnosed as leukemia

2.

METHOD
One Step Multiplex RT-PCR

3.

PRINCIPLE
This is a qualitative one step multiplex RT-PCR assay. The assay contains 4 sets of primers inclusive of a control primer BCR-C serves as internal control. Positive and blank controls are run for each assay.

4.

REQUIREMENTS 4.1 EQUIPMENT


Pipette 10 - 100 L and tip (pre PCR) Pipette 0.5 - 10 L and tip (pre-PCR) Pipette 0.1 2.5 L and tip (pre-PCR) Pipette 0.5 - 10 L and tip (post-PCR) PCR Thermal cycler PCR tube 0.2 mL Micro centrifuge tube 1.5 mL Lab top cooler ( -20 o C) Electrophoresis systems Microwave oven Mini Spin Vortex Rack

Page 2 of 12

STANDARD TECHNICAL MANUAL

HAEMATOLOGY DEPARTMENT, HOSPITAL UNIVERSITI SAINS MALAYSIA TITLE: PROCEDURE NO. BCR-ABL FUSION TRANSCRIPT USING MULTIPLEX RT-PCR HUSM/HEMA-UPT/STM-M2 VERSION : VERSION DATE: 2 01.03.2011

4.2

REAGENT
5 X PCR buffer (Titan Kit) 25 mM Magnesium Chloride (Titan Kit) 2 mM dNTP 100mM DTT (Titan Kit) Rnasin (40 U/ L ) Enzyme Mix (Titan Kit) PCR water Primer BCR/ ABL mix (refer to Table1) Template RNA (100 ng /mL) 1 x TBE (Tris borate EDTA buffer) 1.5 % Agarose Ethilium bromide: 10 mg/mL 6 x Loading dye 100bp DNA ladder
Table 1

Primer name BCR-C B2B C5eCA3-

Sequences 5 ACC GCATGTTCCGGGACA AAAG 3 5 ACAGaATTCGCTGACCATCAATAAG 3 5 ataggaTCCTTTGCAACCGGGTCTGAA 3 5 TGTTGACTGGCGTGATGTAGTTGCTTGG

Working primers 10 M 10 M 10 M 10 M

4.3

METHOD VALIDATION Positive control for BCR-ABL from previous known cases and confirmed by sequencing. Sensitivity of the test is 10-4

4.4

QUALITY CONTROL
Each sample is run in duplicate Each run will have appropriate controls Each run at least needed one of positive control form either one to three fusion transcript.The positive control either from previous run sample which validated as positive or from commercial (K-562) The results are only valid if the blank has no band and the positive control give the appropriate bands.

Page 3 of 12

STANDARD TECHNICAL MANUAL

HAEMATOLOGY DEPARTMENT, HOSPITAL UNIVERSITI SAINS MALAYSIA TITLE: PROCEDURE NO. 5.


NO 5.1 5.1.1 5.1.2

BCR-ABL FUSION TRANSCRIPT USING MULTIPLEX RT-PCR HUSM/HEMA-UPT/STM-M2

VERSION : VERSION DATE:

2 01.03.2011

PROCEDURE
ACTIVITY RESPONSIBILITY MLT/SO MLT/SO MLT/SO

PCR AMPLICATION
Prepare worksheet PCR Testing BCR-ABL using multiplex RT-PCR (refer to Document No: Worksheet BCR-ABL, Feb.2007) Prepare master mix for the samples in Biohazard cabinet in Pre-PCR room. Prepare master mix of appropriate volume containing 5 x RT buffer (Titan Kit), 2 mM dNTP, BCR/ABL mix (10 m each primer ), 25 mM MgCl2 (Titan kit ), 100 mM DTT ( Titan Kit), 40 U/ L RNASIN (Promega), Rnase- free H2O, Enzyme mix (Titan Kit). Consult the worksheet for the total number of reactions needed and then add enough of each reagent for another reaction to ensure an excess of PCR mix. Each tube will contain 5 x RT buffer (Titan Kit) 2 mM dNTP BCR/ABL mix (10 m each primer ) 25 mM MgCl2 (Titan kit ) 100 mM DTT ( Titan Kit) 40 U/ l RNASIN (Promega) Rnase- free H2O Enzyme mix (Titan Kit) Total 2.0 L 1.2 L 0.25 L 0.5 L 0.5 L 0.1 L 0.35 L 0.1 L 5.0 L

5.1.3 5.1.4 5.1.5 5.1.6 5.1.7 5.1.8

Label tubes according to the worksheet. Add 5.0 L of master mix to each tube Add 100-200 ng of RNA of patients and make up to 5.0 L with water. Add 100 ng positive control and make up to 5.0 L with water. Add 5.0 L water as blank control. Spin for ~5000 rpm for a few second. Note: Master Mix without Rnasin / Enzyme mix can be stored at 20oC for up to 1 month. The reaction mixture must be prepared in ice box
Page 4 of 12 STANDARD TECHNICAL MANUAL

MLT/SO MLT/SO MLT/SO MLT/SO MLT/SO MLT/SO

HAEMATOLOGY DEPARTMENT, HOSPITAL UNIVERSITI SAINS MALAYSIA TITLE: PROCEDURE NO.


5.1.9

BCR-ABL FUSION TRANSCRIPT USING MULTIPLEX RT-PCR HUSM/HEMA-UPT/STM-M2

VERSION : VERSION DATE:

2 01.03.2011
MLT/SO

A) If Ep Gradient Master Cycle is used, amplify using the following program: i) ii) iii) iv) Turn on the power of the master cycle Select user name and key in password then press enter Select user file then press enter Select the program file: BCR-ABL) and amplifying using the following thermal profile as shown in table 2
Table 2: Thermal Profile for BCR-ABL

Steps Reverse Transcription Pre-Heating Denaturing PCR Annealing (30 cycle) Extension Final Extension Hold
v) vi) vii) viii)

Temperature (oC) 50 94 94 55 72 72 4

Time 30min 2 min 20sec 30 sec 30 sec 10 min

Push the cover backward to open the cover and put the tubes in the master cycle then push the cover forward to close it. Press Start Key in the number of tubes Key in the volume of tube and press ok.

B) If Master Cycle Gradient is used, amplify using the following program: i) ii) iii) iv) v) vi) Turn on the power of the master cycle Open the cover and put the tubes in the master cycle then cover it and turn the cover button according to the volume of the tubes using. Select the program file: BCR and amplifying using the following thermal profile as shown in table 2 Press enter Key in the volume of tube, then press enter Key in the volume of sample and press enter

Page 5 of 12

STANDARD TECHNICAL MANUAL

HAEMATOLOGY DEPARTMENT, HOSPITAL UNIVERSITI SAINS MALAYSIA TITLE: PROCEDURE NO.


5.1.10

BCR-ABL FUSION TRANSCRIPT USING MULTIPLEX RT-PCR HUSM/HEMA-UPT/STM-M2

VERSION : VERSION DATE:

2 01.03.2011
MLT/SO

Proceed to gel electrophoresis or keep the reaction at 2-8 0C until ready to use. Spin down the contents in sample vials before opening the vials.

5.2 5.2.1

EXAMINATION OF AMPLICATION PRODUCTS


Make A 1.5 % agarose gel in 1x TBE buffer. i) Assemble gel casting system, molding tray and analytical comb according to manufacturers instruction (Mupid-EX) MLT/SO

ii) Measure approximately 1.5 g of agarose on a clean plastic tray iii) Aliquot approximately 100-mL of 1x TBE Buffer into a 200-mL Schott bottle (Duran, Germany). iv) Add in the agarose and heat in microwave oven for approximately three minutes till the agarose is dissolved. v) Remove Schott bottle from microwave oven and pour the gel into the mould and make sure no air bubble is formed or trapped either within the gel or between the combs teeth. vi) Allow to solidify for at least half an hour. 5.2.2 5.2.3 5.2.4 5.2.5 5.2.6 5.2.7 5.2.8 Add 1.0 L loading dye to 8.0 L of each PCR product Load the mixture from 5.2.2 into a lane for each reaction tube, preferably in a sequence according to the worksheet. Load 2 L of 100 bp marker preferably onto the first and last lane. If no more well available, load only on the first lane. Run at 100 volts for 30 minutes in small electrophoresis tank. Transfer the gel from the tank and soak it in the 1% Ethidium Bromide solution for 10 minutes Soak the gel in double distilled water for 5 minutes. Transfer the gel from the tank to Alphalmager and capture the image by using the AlphaImager with the procedure (refer to Document No: AlphaImager
System 2007).

5.2.9 5.2.10

Make a thermal printout. Paste the thermal printout on the worksheet interpretation (refer to Document no: worksheet interpretation 2007)
Page 6 of 12 STANDARD TECHNICAL MANUAL

HAEMATOLOGY DEPARTMENT, HOSPITAL UNIVERSITI SAINS MALAYSIA TITLE: PROCEDURE NO. BCR-ABL FUSION TRANSCRIPT USING MULTIPLEX RT-PCR HUSM/HEMA-UPT/STM-M2 VERSION : VERSION DATE: 2 01.03.2011

6.
NO 6.1

INTERPRETATION OF RESULTS
ACTIVITY RESPONSIBILITY MLT/SO

Before reporting make sure the blank controls do not show any band other than the bands of primer or primer dimer. Sample which give distinct band of 310 bp is considered BCR-ABL Fusion transcript present for b2a2. Sample which give distinct band of 385 bp is considered BCR-ABL Fusion transcript present for b3a2. Sample which give distinct band of 481 bp is considered BCR-ABL Fusion transcript present for e1a2. Sample with normal strand should give a 808 bp only. Sampel which does not give 808 bp band should proceed for integrity test 7. INTEGRITY TEST

NO 7.1

ACTIVITY Make A 1.5 % agarose gel in 1x TBE buffer. vii) Assemble gel casting system, molding tray and analytical comb according to manufacturers instruction (Mupid-EX) viii) Measure approximately 1.5 g of agarose on a clean plastic tray ix) Aliquot approximately 100-mL of 1x TBE Buffer into a 200-mL Schott bottle (Duran, Germany). x) Add in the agarose and heat in microwave oven for approximately three minutes till the agarose is dissolved. xi) Remove Schott bottle from microwave oven and pour the gel into the mould and make sure no air bubble is formed or trapped either within the gel or between the combs teeth. xii) Allow to solidify for at least half an hour.
Page 7 of 12

RESPONSIBILITY MLT/SO

STANDARD TECHNICAL MANUAL

HAEMATOLOGY DEPARTMENT, HOSPITAL UNIVERSITI SAINS MALAYSIA TITLE: PROCEDURE NO.


7.2 7.3 7.4 7.5 7.6 7.7 7.8 7.9

BCR-ABL FUSION TRANSCRIPT USING MULTIPLEX RT-PCR HUSM/HEMA-UPT/STM-M2

VERSION : VERSION DATE:

2 01.03.2011
MLT/SO

Add 1.0 L loading dye,2-3 L ddH20 and 2- 3 L of patients RNA of each sample. Load the mixture from 7.2 into a lane for each sample Run at 100 volts for 20 minutes in small electrophoresis tank. Transfer the gel from the tank and soak it in the 1% Ethidium Bromide solution for 10 minutes Soak the gel in double distilled water for 5 minutes Transfer the gel to AIphalmager and capture the image by using the Aphlalmager with the procedure (refer to Document No: AIphalmager System 2007) Make a thermal printout Paste the thermal printout on the worksheet interpretation i) ii) If no band was shown, then report as A result cannot be reported. Poor quality of RNA. Please send sample immediately after blood collected. If there were at least 2 bands (28s RNA, 18s RNA) shown, then repeat the test procedure started from 5.1 till 5.2.10

Page 8 of 12

STANDARD TECHNICAL MANUAL

HAEMATOLOGY DEPARTMENT, HOSPITAL UNIVERSITI SAINS MALAYSIA TITLE: PROCEDURE NO. 8. BCR-ABL FUSION TRANSCRIPT USING MULTIPLEX RT-PCR HUSM/HEMA-UPT/STM-M2 VERSION : VERSION DATE: 2 01.03.2011

REPORTING OF RESULTS
Report the results on request Hematology form. Multiplex RT-PCR for BCR-ABL gene: BCR-ABL fusion transcript absent band detected 808 bp only

Multiplex RT-PCR for BCR-ABL gene BCR-ABL fusion transcript present (b3a2,b2a2,e1a2)

band detected 808 bp and 385bp

Multiplex RT-PCR for BCR-ABL gene BCR-ABL fusion transcript present (b3a2,b2a2,e1a2)

band detected 808 bp and 310 bp.

Multiplex RT-PCR for BCR-ABL gene BCR-ABL fusion transcript present (b3a2,b2a2,e1a2)

band detected 808 bp and 481 bp

Multiplex RT-PCR for BCR-ABL gene A result cannot be reported. Poor quality of RNA. Please send sample immediately after blood collection

Result is reported by lecturer.

9. REFEERENCES
Protocol from Molecular Laboratory, Westmead Hospital, Australia.

Page 9 of 12

STANDARD TECHNICAL MANUAL

HAEMATOLOGY DEPARTMENT, HOSPITAL UNIVERSITI SAINS MALAYSIA TITLE: PROCEDURE NO. BCR-ABL FUSION TRANSCRIPT USING MULTIPLEX RT-PCR HUSM/HEMA-UPT/STM-M2 VERSION : VERSION DATE: 2 01.03.2011

Appendix 1: SAFETY PRECAUTION OF ETHIDIUM BROMIDE.

Favorgen EtBr Destroyer is a specifically designed reagent effectively degrade and destroy Ethidium Bromide and result in both non-fluorescence and non-mutagenic remain. Favorgen EtBr Destroyer is provided in two different formats for the treatment of both solid and liquid Ethidium Bromide contaminant. The ready pack Favorgen EtBr Destroyer Bag is idea for the treatment of liquid Ethidium Bromide contaminant while Sprayer can be used for the treatment of solid contaminant waste including electrophoresis gels, glassware, paper towels, gloves, laboratory equipment, bench surface etc. FEATURES 1. Effective: Favorgen EtBr Destroyer is a laboratory reagent intended for the removal and destruction of Ethidium Bromide contamination. This effect can be monitored and confirmed by UV light expo-sure whereby once the EtBr has been destroyed the fluorescence will disappear. 2. Fast: For general protection of uncontaminated area, spray the EtBr Destroyer on the entire working area, leave for about 5 minutes, then wipe it dry with paper towel. When dealing with more seriously contaminated liquid samples the EtBr Destroyer bag is an ideal solution. Three litters of double distilled H2O containing 30mg of Ethidium Bromide can be destroyed in a matter of days using Favorgen easy-to-follow up protocol with the bag format. (REFER TABLE 1) 3. Specific: Two specific designs are for different purposes : Ethidium Bro-mide Destroyer bags and Ethidium Bromide Destroyer Spray . 4. Safe: Favorgen EtBr Destroyer has been demonstrated by Ames test to safely and effectively destroy EtBr without any mutagenic effect. The AMES test result data supports that the genotoxicity of EtBr contaminated solution, treated by both the Favorgen EtBr Destroyer Band and Sprayer was reduced significantly and a negative result was determined. (TABLE 1) Ethidium Bromide containing gels : Step 1 Tear open the package and take out the Favorgen EtBr De-stroyer Bag onto the container which fills with 3L d.d.H2O Step 2 30 minutes later, you can drop the EtBr-contaminated gels into this container filling with the solution of Favorgen EtBr Destroyer Bag.

Page 10 of 12

STANDARD TECHNICAL MANUAL

HAEMATOLOGY DEPARTMENT, HOSPITAL UNIVERSITI SAINS MALAYSIA TITLE: PROCEDURE NO. BCR-ABL FUSION TRANSCRIPT USING MULTIPLEX RT-PCR HUSM/HEMA-UPT/STM-M2 VERSION : VERSION DATE: 2 01.03.2011

Step 3 You can drop as many as gels into the container during the 6 months period, but the total amount of EtBr in all gels cant be over 30mg and the solution of Favorgen EtBr Destroyer Bag has to cover the whole gels. The last gel dropped into the container only can be thrown away after 24 hours treatment. Step4 When the treated gel becomes clear, please use the UV light box (UV Wavelength 254nm) to ensure the Ethidium Bromide has been totally destroyed. Step 5 After 6 months, no matter how much EtBr has been destroyed, the solution of Favorgen EtBr Destroyer Bag cant be used any more. The users need to clean up the container for another new solution. Step 6 After gels containing EtBr which have been destroyed can be collected as the non-hazardous item in compliance with the local waste removal regulations. Ethidium Bromide containing buffer : Step 1 Tear open the package and take out the Favorgen EtBr De-stroyer Bag. Use the product immediately or seal it into a zip-lock bag to avoid prolonged exposure to the air. Step 2 Put the EtBr Destroyer into the EtBr-containing buffer. Completely submerge the bag so that the entire Destroyer bag is in the solution. Step 3 Destroyer Working Timetable EtBr-containing Quantity Working Time 2mg/3L 16hrs 5mg/3L 30hrs 10mg/3L 3 days 20mg/3L 5 days 30mg/3L 6 days

Page 11 of 12

STANDARD TECHNICAL MANUAL

HAEMATOLOGY DEPARTMENT, HOSPITAL UNIVERSITI SAINS MALAYSIA TITLE: PROCEDURE NO. BCR-ABL FUSION TRANSCRIPT USING MULTIPLEX RT-PCR HUSM/HEMA-UPT/STM-M2 VERSION : VERSION DATE: 2 01.03.2011

Step 4 When the treated buffer becomes clear, please use a UV light (254nm) to observe the EtBr-content remaining. If exposure to the UV light displays no fluorescence and the O.D. value is equal to that of d.d.H2O it means that the EtBr containing buffer has been totally destroyed. Step 5 The Favorgen EtBr Destroyer Bag has absorbed and destroyed all of the EtBr content in the liquid. Following treatment the bag can be thrown away as a non-hazardous item in compliance with the local waste removal regulations.

END OF DOCUMENT

Page 12 of 12

STANDARD TECHNICAL MANUAL