Вы находитесь на странице: 1из 667

La salud pblica hoy: enfoques y dilemas contemporneos en salud pblica.

Memorias ctedra Manuel Anczar - Repositorio Institucional UN

q q q q q q q

Pgina Inicial Acerca de Consultar por Ao Consultar por Materia Consultar por Divisin Consultar por Autor Consultar por Tipo de Documento
Search

Ingresar | Crear cuenta

La salud pblica hoy: enfoques y dilemas contemporneos en salud pblica. Memorias ctedra Manuel Anczar
Franco Agudelo, Sal, ed. (2005) La salud pblica hoy: enfoques y dilemas contemporneos en salud pblica. Memorias ctedra Manuel Anczar. Universidad Nacional de Colombia. Facultad de Odontologa, Bogot . ISBN 9587012216 Imagen (JPEG) (Portada) - Cover Image Available under License Creative Commons Attribution Non-commercial No Derivatives. 2112Kb

http://www.bdigital.unal.edu.co/784/ (1 of 6)02/07/2011 07:25:52 p.m.

La salud pblica hoy: enfoques y dilemas contemporneos en salud pblica. Memorias ctedra Manuel Anczar - Repositorio Institucional UN

Preview PDF (Preliminares) - Submitted Version Available under License Creative Commons Attribution Non-commercial No Derivatives. 542Kb PDF (Primera parte) - Submitted Version Available under License Creative Commons Attribution Non-commercial No Derivatives. 15Mb

http://www.bdigital.unal.edu.co/784/ (2 of 6)02/07/2011 07:25:52 p.m.

La salud pblica hoy: enfoques y dilemas contemporneos en salud pblica. Memorias ctedra Manuel Anczar - Repositorio Institucional UN

Preview PDF (Segunda parte) - Submitted Version Available under License Creative Commons Attribution Non-commercial No Derivatives. 21Mb

Preview PDF (Anexo 1) - Submitted Version Available under License Creative Commons Attribution Non-commercial No Derivatives. 16Kb

http://www.bdigital.unal.edu.co/784/ (3 of 6)02/07/2011 07:25:52 p.m.

La salud pblica hoy: enfoques y dilemas contemporneos en salud pblica. Memorias ctedra Manuel Anczar - Repositorio Institucional UN

Preview Imagen (JPEG) (Contraportada) - Submitted Version Available under License Creative Commons Attribution Non-commercial No Derivatives. 2168Kb

Preview

http://www.bdigital.unal.edu.co/784/ (4 of 6)02/07/2011 07:25:52 p.m.

La salud pblica hoy


Enfoques y dilemas contemporneos en salud pblica Memorias Ctedra Manuel Anczar -1 Semestre 2002 Editor: Sal Franco Agudelo

UNIVERSIDAD NACIONAL DE COLOMBIA Sede Bogot Vicerrectora de Sede Direccin de Programas Curriculares FACULTAD DE ODONTOLOGA

UNIVERSIDAD NACIONAL DE COLOMBIA Direccin de Programas Curriculares FACULTAD DE ODONTOLOGA

La Salud Pblica Hoy


Enfoques y dilemas contemporneos en Salud Pblica Memorias CTEDRA MANUEL ANCZAR / Semestre de 2002

Rector
Ramn Fayad Nafah Vicerrector Sede Bogot Fernando Viviescas Monsalve Director Acadmico - Sede Bogot Andrs Sicard Correa Secretara Sede Bogot Cannen Mara Romero Directora de Programas Curriculares Sede Bogot Diana Obregn Direccin Nacional de Divulgacin Cultural Francisco Montaa bez Director Decana Facultad de Odontologa Gladys Azucena Niiiez Editor Sail Franco Agudelo

Portada Mara Jos Arbelez Diseo y Diagramacin Gustavo Antonio Daz Toro Correccin de textos Julio Csar Corles Ri. Luis Fernando Garca Niiez Primera edicin, Bogot, 2003 Universidad Nacional de Colombia Primera reimpresin: Bogot, septiembre de 2005 Seccin de Publicaciones, Universidad Ni de Colombia Universidad Nacional de Colombia, Sede Bogot - 2005 Facultad de Odontologa Memorias Ctedra Manuel Ancfzan / Semestre 2002 La Salud Pblica Hoy Enfoques y dilemas contemporneos en Salud Pblica

ISBN: 958-701-221-6 Impreso en Colombia Printed and made in Colombia Se autoriza la reproduccin total o parcial citando la fuente.

Proyecto ganador del concurso Divulgacin de la Produccin Acadmica, 2004, convocado por la Direccin Acadmica de la UN - Sede Bogot. Su reproduccin estuvo a cargo de la Direccin Nacional de Divulgacin Cultural de la Vicerrectora Acadmica de la Universidad Nacional de Colombia.

ndice
Presentacin II

PRIMERA PARTE La salud pblica en el mundo contemporneo


CAPTULO I GLOBALIZACIN Y SALUD

La globalizacin y su impacto sobre la salud


CONSUELO AHUMADA BELTRN

19

Amenazas y desafos de la globalizacin a la salud


ARCADIO GUZMN NOGALES CAPTULO II DILEMAS TICOS CONTEMPORNEOS EN SALUD
i

37

'
i

Dilemas ticos contemporneos en salud: el caso colombiano desde la perspectiva de la justicia social 49
ROMN VEGA ROMERO

Problemas bioticos y dilemas ticos contemporneos en salud


BEATRIZ PEA RIVERO

75 89

Dilemas ticos contemporneos en salud


JAIME ESCOBAR TRIANA

CAPTULO III

Desafos del genoma humano a la salud pblica El proyecto del genoma humano
JUAN JOS YUNIS LONDOO

707 117

El genoma humano y su impacto en la salud ptiblica


SAL FRANCO AGUDELO

Los nuevos paradigmas cientficos frente alimpacto ecolgico de la biotecnologa transgnica


OMAR GARCLI ALZUGARATE CAPTULO IV

133

La promocin de la salud: Teora y prctica La promocin de la salud en el siglo XXI


RAMN GRANADOS TORAO

153 777

Teoras y prcticas en promocin y prevencin


MERY CONSTANZA GARCA VARGAS

Pobreza y corrupcin: dos obstculos dificiles para la promocin de la salud


BENJAMN HERAZO ACUA CAPTULO V

797

Salud en calidad de vida: u n enfoque innovador Repensar las relaciones entre la calidad de vida y salud
RAFAEL MALAGN OVIEDO

209

Salud en calidad de vida: un enfoque innovador


ISABEL CRISTINA RUIZ BUTTRAGO

239

Saliui y calidad de vida: hacia la conformacin del campo de accin institucional


CARMEN ALICIA CARDOZO DE MARTNEZ CAPTULO VI

257

La salud en las agendas polticas La salud en la agenda de los organismos internacionales


EDUARDO LVAREZ

275

SEGUNDA PARTE: La salud pblica en Colombia: presente y futuro


CAPTULO I > -'

El derecho a la salud en Colombia La garanta al derecho a la salud en Colombia, a la luz del Derecho Internacional de los Derechos Humanos
NATALIA PAREDES HERNNDEZ

287

< El derecho a la salud en el derecho constitucional colombiano


CARLOS GAVIRIA DAZ

305

El derecho a la salud en la jurisprudencia constitucional colombiarm


RODRIGO UPRIMNY YEPES CAPTULO II

575

P a n o r a m a de la salud pblica en Colombia La situacin de salud en Colombia


MARA ESPERANZA ECHEVERRI LPEZ

345

Aproximaciones a un concepto de hospital universitario y algunas consideraciones sobre la crisis hospitalaria en Colombia
JUAN CARLOS ESLAVA CASTAEDA

373

La salud en las campaas presidenciales en Colombia


PEDRO ELL^^S GALINDO LEN

385

Panorama de la investigacin sobre salud ptiblica en Colombia Realidad o... Utopa?


JOHN HAROLD ESTRADA MONTOYA

407

Podemos comprender la problemtica de salud ptiblica. ?


CARLOS ALBERTO AGUDELO CALDERN

421

CAPTULO III

Pasado, presente y futuro de la Ley 100 de 1993 Qu sigue despus de la Ley 100?
JUAN LUIS LONDOO DE LA CUESTA

435

La reforma de la reforma en salud


CARLOS CORSI OTALORA

449

El debate sobre la Ley 100 de 1993 antes, durante y despus Mario Hernndez lvarez
,.

^ 463

CAPTULO IV

Gnero y salud en Colombia Gnero y salud reproductiva en Colombia


MAR VIVEROS VIGOYA

481

La interrupcin voluntaria del embarazo: una cuestin de dignidad para la mujer


FLORENCE THOMAS

497

Por el derecho al derecho: Alba Luca libre


MARA XIMENA CASTILLA JIMNEZ

507

CAPTULO V

Ambiente, trabajo y salud en Colombia Ambiente, trabajo y salud


JUAN VICENTE CONDE SIERRA

527

Procesos sociales, ambiente y salud: una mirada desde la Amazonia


MARTHA CECILIA SUREZ MUTIS

539

CAPTULO VI

Guerra, salud y paz en Colombia Salud y paz en un pas en guerra: Colombia, ao 2002
SAL FRANCO AGUDELO Y LUZ JANETH FORERO MARTNEZ.

555

- Breves reflexiones acerca de algurms teorizaciones sobre la violencia en Colombia


ALVARO CAMACHO GUIZADO CAPTULO V H

585

El mercado de los medicamentos - El mercado de los medicamentos en Colombia: entre la salud y los negocios 597 FRANCISCO A. Rossi BUENAVENTURA - El mercado de los medicamentos en Colombia
JESS BECERRA CAMARGO CAPTULO

677

Vffl La universidad y la salud

- La universidad y la salud: historia, retos y nuevas respuestas


RosALBA MEDINA ARVALO

635

- Autores

653

Presentacin
Por qu "La salud pblica hoy"?. La salud pblica es un campo siempre inacabado de ideas, preocupaciones, propuestas y trabajos destinados a enteruier y garantizar el bienestar colectivo. Este carcter esencial de campo inacabado implica la exigencia permanente de integrar a las discusiones los nuevos problemas, de persistir en la bsqueda de respuesta y solucin al conjunto de viejas y nuevas preocupaciones e, inclusive, de adelantarse visionariamente a las tensiones del futuro a partir de la identificacin y el anlisis de las dinmicas y tendencias contemporneas. En ese esfuerzo de bsqueda permanente de explicaciones, preguntas y propuestas en el campo de la salud de la poblacin, se inscribe La salud pblica hoy. La obra naci del inters de la Universidad Nacional de Colombia por ponerse al da en su responsabilidad social en salud y de la respuesta positiva tanto de un reconocido grupo de docentes, investigadores y funcionarios del sector que elaboraron los temas propuestos, como de la acogida y el entusiasmo brindados por un grupo an ms amplio de universitarios y poblacin general que discuti y aport a los planteamientos originales. Este proceso tuvo lugar en desarrollo de una ctedra institucional de la Universidad abierta a todo el pblico, denominada Ctedra Manuel Anczar, en homenaje a su primer rector, y dedicada al tema Enfoques y dilemas contemporneos en salud pblica, en el primer semestre del ao 2002. Cada mirada sobre el campo de la salud pblica tiene al mismo tiempo la riqueza y las limitaciones de la disciplina, la prctica profesional, el momento y el espacio social desde el cual se hace. El conjunto deformulaciones que conforman La salud pblica hoy tiene un origen multidisciplinar y multiprofesional en la Colombia de principios del siglo XXI. Es decir: su

11

La Salud PbUca Hoy

hoy recoge las reflexiones acumuladas en ms de medio siglo de desarrollo de la Salud Pblica en Colombia y las tensiones surgidas de la problemtica poltica, acadmica y social relacionada con el bienestar de la humanidad al comienzo del nuevo milenio. La mirada se hace desde Colombia, en un momento excepcionalmente difcil de su historia como nacin, al enfrentar un complejo conflicto armado interno y los saldos rojos de inequidades, intolerancias, impunidades y deslegitimaciones acumuladas durante muchos aos. Pero si bien la mirada es desde Colombia, no se hace slo sobre Colombia. Se hace sobre los temas prioritarios de la agenda mundial en salud, surgida tanto de los nuevos desarrollos cientficotecnolgicos, como del replanteamiento de las polticas sociales en salud y seguridad social, de las crecientes preocupaciones ticas y ambientalistas y de la reubicacin de la salud en las prioridades de las sociedades y los estados contemporneos. La diversidad de disciplinas y profesiones de los autores contribuye a superar la limitacin frecuentemente debida a la uniformidad profesional y a la unidisciplinaridad en un campo esencialmente multiprofesional y pluridisciplinario. Economistas, bilogos, mdicos, socilogos, abogados, enfermeras, mdicos veterinarios, antroplogas, odontlogos y politlogos, configuran un amplio y diverso espectro profesional que contribuye a enriquecer las miradas sobre las cuestiones tratadas. En esencia La salud pblica hoy consta de dos partes. La primera est dedicada a un panorama de los grandes temas-problema de la salud pblica a nivel mundial. La segunda se centra en la problemtica actual y futura de la salud pblica en Colombia. La primera parte, organizada en seis captulos y quince artculos, parte de una reflexin sobre los significados de la globalizacin y su impacto sobre varios campos afines a la salud pblica. Se avanza luego a la formulacin de algunos de los principales dilemas ticos que las nuevas realidades cientfico-tcnicas y econmicopolticas le estn planteando a la medicina y al campo ms amplio de la salud. Se presenta a continuacin una sntesis de los avances logrados por la genmica humana, acompaada de una discusin sobre su impacto actual y potencial en el diagnstico, manejo y pronstico de varias patologas tanto del mundo bionatural como del campo sicolgico; en la investigacin y la formacin en salud; en la cultura de la salud y la conciencia que tenemos de nosotros mismos, y en el campo ecolgico, con especial referencia a los productos transgnicos. La promocin de la salud, identi-

12

Presentacin

ficada desde la Caria de Ottawa en 1986 como el campo ms promisorio de la salud pblica, merece tanto una consideracin terica, como el reconocimiento de su entorno poltico y de algunos de sus principales obstculos. Cierran la primera parte dos reflexiones importantes: una sobre el concepto de calidad de vida y sus relaciones e implicaciones en salud, y otra sobre el lugar actual de la salud en las agendas de los organismos internacionales, en particular el papel que ha cumplido en sus primeros cien aos de existencia la Organizacin Panamericana de la Salud. Los ocho captulos de la segunda parte van presentando los desarrollos conceptuales, los logros, dificultades y propuestas para el abordaje de los problemas contemporneos de la salud pblica en Colombia. Se parte de una discusin bien argumentada sobre la naturaleza filosfico-jurdica del derecho a la salud y sobre la situacin de este derecho en el ordenamiento legal y la jurisprudencia del pas. Se presenta a continuacin un panorama actualizado y preocupante de la salud pblica en Colombia, tanto en trminos de problemas prioritarios, acciones en marcha, produccin de conocimiento, presencia poltica y legislacin y polticas de Estado. Especial atencin merece la discusin sobre la polmica Ley 100 de 1993 que signific el cambio ms radical hasta ahora en la concepcin y las polticas de Estado en salud, que es vista por algunos como exitosa y modelo exportable, y por muchos otros como concrecin nacional en salud del modelo neoliberal y, en consecuencia, como corresponsable y/o agravante de muchos de los problemas actuales de salud pblica en el pas. El captulo de gnero y salud en Colombia aborda, desde miradas complementarias descriptiva, analtica y prepositiva, algunos de los temas ms candentes en la salud r^eproductiva y en las especificidades de los derechos de las mujeres en salud. La cuestin ambiental, que sin duda merece mayores desarrollos dada su creciente importancia y complejidad, se introduce en sus relaciones con el mundo del trabajo y en una mirada desde la estratgica regin amaznica. Siendo la violencia el principal problema de salud pblica de Colombia desde hace ms de una dcada, el tema es tratado en sus dimensiones tericas, en su magnitud y dinmica actuales, y en sus mltiples implicaciones negativas sobre la calidad de vida de los colombianos y sobre el sector salud, que ha devenido en una de las vctimas del conflicto armado que padece el pas. A ms de instrumentos para el tratamiento de las enfermedades, los medicamentos se han convertido en la sociedad moderna en una gigantesca industria y en un prspero negocio, no siempre

13

La Salud Pblica Hoy

supeditado a los imperativos de la ciencia, la equidad y la accesibilidad universal El tema se introduce tratando de mirar sus diferentes caras y sus particularidades en la situacin nacionai Y, por tratarse de reflexionar, debatir y proponer sobre salud pblica desde la Universidad, el material termina con un breve enunciado sobre algunos de los retos y nuevas respuestas de la institucin a los distintos frentes del campo de la salud. Obviamente es imposible abarcar la totalidad de los temas propios o afines a la salud pblica en cualquier momento, circunstancia o regin. Todo esfuerzo es necesariamente insuficiente e incompleto tanto en el espectro temtico como en la diversidad de enfoques y en los niveles de profundidad. Con todo, La salud pblica hoy, sin ser un texto compacto ni tener un desarrollo progresivo, intenta y espera convertirse en un instrumento serio y til para todas las personas e instituciones que, interesadas en el bienestar colectivo, traten de ir ms all de lo convencional y ya sabido y busquen nuevos temas, borradores de respuesta y, sobre todo, estmulos para seguir actuando de mejor manera. Es de lgica elemental terminar esta presentacin con la expresin de reconocimiento y gratitud para las instituciones y personas que hicieron posible tanto la versin de la Ctedra Manuel Anczar que origin los materiales, como esta publicacin. Sin mencionar nombres para evitar olvidos, es preciso destacar colectivamente el apoyo, el trabajo y la colaboracin decidida de las siguientes instituciones y colectivos: - La Vicerrectora, la Secretara y la Direccin de Programas Curriculares de la Sede Bogot de la Universidad Nacional de Colombia. - La Decanatura y el personal docente, tcnico y administrativo de la Facultad de Odontologa de la Universidad Nacional de Colombia, y en particular el correspondiente al antiguo Departamento de Odontologa Preventiva y Social. - Al grupo de conferencistas y panelistas que intervino en la realizacin de la Ctedra Manuel Anczar en el primer semestre del 2002. A ellos corresponde el mrito principal en la calidad y el xito de la Ctedra y, ojal, del presente material - Al grupo de asistentes a la Ctedra el cuai en un promedio de 1.100 por sesin estimul el trabajo de los panelistas, cuestion muchos plan-

14

Presentacin

teamientos, hizo aportes esenciales para nuevos desarrollos y propuestas y justific todo el esfuerzo realizado. Al grupo de monitoras que colaboraron decididamente en el desarrollo de la Ctedra. Es de justicia hacer una excepcin y sealar que de ellas, la doctora Andrea Ibarra dedic mucho tiempo y entusiasmo a la preparacin de estas Memorias. Al grupo de Publicaciones de la Universidad Nacional de Colombia por su dedicacin a la realizacin del proyecto editorial

SAIJL FRANCO A.

Profesor asociado. Coordinador Ctedra Manuel Anczar 01-2002

15

isNlS

PRIMERA PARTE

L/E SdillQ pUDllCH

en el mundo contemporneo

*?

Cyan Magenta

Biack

. ^

CAPTULO I

GLOBALIZACIN Y SALUD

La globalizacin y su impacto sobre la salud


CONSUELO AHUMADA

La crisis por la que atraviesa la salud pblica en Colombia slo puede entenderse a cabalidad si se examina a la luz de las reformas econmicas y sociales que se generalizaron en la dcada del noventa en los pases subdesarrollados y particularmente en Amrica Latina. Este trabajo se centra en el anlisis de la conexin que se presenta entre dichas reformas y el deterioro de las condiciones sociales en Colombia, en particular las de salud, y se divide en tres partes. En la primera, se examina el concepto de globalizacin y se destacan los principales rasgos del Nuevo Orden Mundial. La segunda se refiere a la crisis econmica y social del pas, en el contexto latinoamericano. Por ltimo, en la tercera parte se hacen algunas apreciaciones sobre la situacin de la salud pblica, como consecuencia de la puesta en prctica de las polticas derivadas de la globalizacin. 1. La globalizacin y el Nuevo Orden Mundial El trmino "globalizacin" se viene utilizando desde las ms diversas posturas. Kelley Lee seala que, si bien este vocablo se ha estudiado y debatido ampliamente desde la dcada del setenta, slo ha empezado a ser explorado por los investigadores de la salud y los encargados de formular polticas a mediados de los aos noventa. "Repentinamente, la globalizacin ha llegado a ser reconocida como una caracterstica sumamente importante y definitoria de la poltica sanitaria a fines del siglo XX", (2000:17). La misma autora sintetiza en dos enfoques opuestos las distintas acepciones utilizadas durante las tres ltimas dcadas con respecto a este trmino: la teora liberal y la teora crtica. La primera ha sido la defensora ms importante de

19

La Salud PbUca Hoy

dicho fenmeno, aclamndolo como el triunfo del capitahsmo de mercado en el mbito mundial. Es defendido como un proceso esencialmente racional, que libera al sector privado de las limitaciones de un aparato estatal excesivamente grande, y del sindicalismo organizado. Sostiene, igualmente, que la globahzacin no es ms que una expresin de las fuerzas del mercado, que adquiere su propio impulso ms all del control humano. La teora crtica, por su parte, advierte sobre las consecuencias desestabilizadoras y destructoras del proceso. Este enfoque pone el nfasis en la polarizacin social que se viene acentuando entre los pases poderosos y los subdesarrollados, as como al interior de todos los pases, como resultado de la disminucin de la funcin econmica y social del Estado, la privatizacin de las empresas pblicas estratgicas y de los servicios sociales bsicos y la "flexibihzacin" de las condiciones laborales, entre otras polticas cuya prctica se ha generalizado en los pases subdesarrollados. As, mientras que el primer enfoque se centra en los "ganadores" del proceso, el segundo examina su impacto sobre sus "perdedores". En concepto de Lee, la forma actual de la globalizacin, caracterizada por el neoliberalismo y las exigencias econmicas, tiene entre los "ganadores" a las empresas transnacionales y las eUtes polticas y econmicas, y entre sus "perdedores" a los negocios locales pequeos y a los excluidos o marginados sociales. Estos dos enfoques opuestos se expresaron claramente en dos reuniones de alcance planetario que se realizaron de manera simultnea a fines de enero pasado: de un lado, la cumbre econmica mundial, que rene anualmente a los dirigentes de los pases poderosos y a los representantes de los organismos internacionales, y que este ao se realiz en Nueva York en lugar de Davos; del otro lado, el segundo Foro Social Mundial de Porto Alegre, en el cual el llamado movimiento antiglobalizacin congreg a ms de cincuenta mil personas provenientes de los cinco continentes. En 1991, poco antes de la guerra del Golfo Prsico, el presidente Bush proclam el advenimiento del Nuevo Orden Mundial, entendido como la era del libre comercio y la globalizacin. Este orden fue concebido por los Estados Unidos, con el apoyo de las dems potencias econmicas, a la medida de los intereses imperiales de la nica superpotencia que sobrevivi a la Guerra Fra. La creacin y puesta en funcionamiento de la Organizacin Mundial de Comercio, OMC, a comienzos de 1995 y el protagonismo adquirido por esta institucin en el plano mundial, consagraron la generalizacin de las polticas neoliberales en todo el orbe.

20

La globalizacin y su impacto sobre la salud

A lo largo del decenio de los noventa, se acentu la tendencia a la concentracin del comercio y las actividades productivas fundamentales en manos de los pases ms desarrollados, en especial Estados Unidos, cuya economa experiment en ese perodo una extraordinaria recuperacin. Al mismo tiempo, el sector financiero adquiri cada vez mayor preponderancia en la economa internacional. La llamada globalizacin financiera ha intensificado la presin poltica sobre los pases del Tercer Mundo para que abran sus economas a los flujos internacionales de capitales. El FMI, con el respaldo del Departamento del Tesoro de Estados Unidos, ha dirigido este empeo, forzando a los gobiernos a que liberahcen las regulaciones en cuanto a la inversin extranjera directa y otros flujos de capital. 2. Crisis econmica y social de Colombia en el contexto latinoamericano Sin duda, el factor determinante para la adopcin de las reformas econmicas y sociales de corte neoliberal fue la severa crisis de los pases latinoamericanos, acentuada de manera considerable por el estallido del problema de la deuda extema a comienzos de los ochenta. Aunque durante dicha dcada la regin dedic casi 224 mil millones de dlares al servicio de la deuda, su monto ascenda a 750.000 millones de dlares a mediados del 2000. A pesar de los procesos de reestructuracin, o ms bien debido a ellos, un buen nmero de estas naciones tiene pasivos pblicos que superan el 50 por ciento de su Producto Interno Bruto y el 170 por ciento de sus exportaciones'. Por ello, para todos estos pases el servicio de la deuda representa crecientes sacrificios en lo que tiene que ver con la inversin pblica y social. No obstante, para el cada vez ms poderoso sector financiero internacional, el negocio ha sido excelente, por lo que el endeudamiento permanente de nuestros pases es percibido en los noventa como factor de confianza por parte de los pases ms poderosos y de los grandes bancos sobre los cuales ejercen control. A partir de la segunda mitad de la dcada del noventa, la financiacin privada, que se desarrolla fundamentalmente mediante la llamada inversin de portafolio, adquiri gran importancia en Amrica Latina y el Caribe, en tanto que los prstamos de instituciones y gobiernos oficiales se redujeron

"La gran banca internacional se lanza con sus crditos a Amrica Latina", Wall Street Journal Amricas. El Tiempo, mircoles 9 de julio de 1997, p 5B; datos de la CEPAL, citados en "La deuda ahorca la regin". Portafolio, agosto 3 de 2000, p.32.

21

La Salud PbUca Hoy

en forma considerable. Cerca del 70 por ciento de los flujos de capital a la regin en ese perodo se dieron bajo esta modalidad, lo que represent un porcentaje tres veces superior al de la dcada precedente (Henwood, 1999: 13-23). La inversin de portafolio en Amrica Latina se increment por cuenta de las multinacionales en el marco de las pohticas de privatizacin. Si bien en la dcada de los ochenta Colombia logr sustraerse en alguna medida de la crisis financiera que afect a los dems pases latinoamericanos, su deuda se ha incrementado de manera notoria a partir de los aos noventa. Mientras en 1988 su monto se elevaba a US 16.000 millones, en marzo de 2000 lleg a $36.000 miUones de dlares^. Por otra parte, la deuda interna del sector pblico tambin ha aumentado, hasta superar los 22 billones de pesos, que equivalen al 12 por ciento del PIB'. La relacin entre el servicio de la deuda y el presupuesto nacional se incrementa ao tras ao. Segn datos de la Contralora General de la Nacin, mientras que en 1993 el servicio de la deuda representaba el 30 por ciento de los ingresos tributarios, en 1999 este mismo servicio representaba el 87 por ciento. Pero la situacin en este respecto tiende a empeorar. El peso de la deuda es de tal magnitud, que en el ao 2001 el servicio de la deuda extema e intema demand recursos por 21.4 billones de pesos, que equivalen al 41 por ciento del presupuesto de ese ao, calculado en $57 billones". Resulta claro que en los gastos del Estado la mayor prioridad la tiene el servicio de la deuda pblica extema e intema y ello es un factor fundamental para entender la reduccin de la inversin pblica y la crisis de la salud pbhca, tal como lo veremos ms adelante. En medio de una profunda recesin, el 20 de diciembre de 1999 el gobiemo de Colombia suscribi el llamado Acuerdo de Facilidades Extendidas con el FMI. El acuerdo obliga a Colombia a adelantar un programa de ajuste macroeconmico durante un perodo de tres aos. El compromiso central que contrae el pas es el mismo que obsesiona a la ortodoxia neoliberal a partir de la dcada de los ochenta y que se impone por igual en todos los pases de la regin: la reduccin del dficit fiscal y la bsqueda del equili-

^ ' *

Datos de la agencia calificadora de riesgo estadounidense, Bank Watch Rating, Eo :"Colombia, con preocupantes niveles de su deuda extema", El Tiempo, febrero 4 de 2000, p.l O". . "El Consejo Nacional de Planeacin pide reactivacin". La Repblica, enero 29 del 2000, p.7. "A liquidacin 20 entidades pblicas". El Tiempo, julio 29 de 2000, p.2-2.

22

La globalizacin y su impacto sobre la salud

brio de las finanzas del Estado. Con ello, el objetivo primordial del Fondo es garantizar y aumentar el flujo de capitales desde las naciones latinoamericanas a los pases industriazados, en especial a Estados Unidos. As, el plan de ajuste trae consigo una cada drstica del consumo y la inversin pbhca en momentos en que, como consecuencia de la crisis econmica del pas, la inversin del sector privado se ha visto seriamente diezmada. Es decir, la recesin no es slo una consecuencia de las medidas neoliberales sino tambin un objetivo que se busca de manera dehberada, y ste es el factor fundamental de la crisis econmica del pas. Con una poltica tendiente a reducir el gasto pblico, se les impone a las naciones latinoamericanas un criterio que va en contrava del camino seguido por los pases industrializados para superar las crisis econmicas. El acuerdo ordena un cronograma de supervisin estricta por parte del Fondo. Cada tres meses se le informa sobre el cumphmiento de las metas y cada seis meses se desplaza una misin del organismo intemacional para negociar algunas variables especficas para los meses siguientes. De igual manera, se contempla que se realicen esfuerzos para incrementar la participacin del sector privado en la provisin de servicios de infraestmctura, tales como proyectos de constmccin y ojjeracin de vas, ferrocarriles y servicios aeroportuarios. En la carta de intencin se establece, adems, que Colombia seguir comprometida con un rgimen de libre comercio y actuar de acuerdo con los principios de la Organizacin Mundial del Comercio. En la legislatura del 2001 se discutieron dos de los proyectos centrales contemplados en el acuerdo con el FMI: la reforma de las transferencias a las entidades territoriales y el proyecto de pensiones. El primero, aprobado como Acto Legislativo 01, establece que en los prximos cinco aos los gastos de la nacin, salvo los relativos a pensiones, no podrn incrementarse por encima del 1.5 por ciento', lo que, en trminos reales, representa una reduccin notoria de las transferencias. Las gravsimas consecuencias que traer la aprobacin de este proyecto en lo que respecta a la inversin en salud y educacin, son analizadas por Ivn Jaramillo Prez de la siguiente manera:

"De todo en la agenda econmica legislativa". Portafolio, marzo 8 de 2001, p.4.

23

La Salud PbUca Hoy

La desaceleracin del crecimiento de las transferencias a las entidades territoriales es un recorte directo a las metas de las polticas sociales e implica la reduccin de las expectativas de expansin del gasto social en $1.227.926 millones anuales a precios de 2001, en un plazo de diez aos. Este recorte de recursos traer como consecuencia la limitacin en 2.128.405 cupos en la expansin del rgimen subsidiado de salud, equivalentes al 23 por ciento de su cobertura actual y de 1.252.000 cupos en las escuelas pblicas, y reducir la tasa de cobertura esperada para 2010 del 90 por ciento al 80 por ciento. Con este recorte del gasto social el gobiemo aspira a financiar el dficit flscal (Jaramillo, 2001:7). Por lo dems, el proyecto va en contrava de la Ley 60 de 1993, que determin que la participacin municipal de los ingresos corrientes de la nacin crecera del 14 por ciento en 1994 al 22 por ciento en el ao 2002 (Mlaga, Latorre y otros, 2000). El Acto Legislativo 01 sobreviene en momentos en que el proceso de descentralizacin se encuentra en una profunda crisis debido al peso abmmador de los compromisos financieros sobre los departamentos y municipios. 19 departamentos registraron saldo en rojo en sus balances y ms de la mitad est en venta, lo mismo que un alto porcentaje de los municipios del pas*. A comienzos del 2001 el dficit de los 32 departamentos superaba los 1.450 millones de dlares y su deuda pblica era de 22.1 billones de pesos^. Lo cierto es que los entes territoriales no estn en capacidad de generar suficientes recursos propios, como consecuencia de la crisis econmica, que ha llevado a una cada vertiginosa del recaudo de impuestos. El acuerdo con el FMI se suscribi durante la ms grave recesin econmica del pas en todo el siglo, como consecuencia de la profundizacin de las medidas neoliberales. La economa colombiana present un crecimiento negativo del cinco por ciento en 1999, el peor resultado de Amrica Latina despus del de los pases vecinos, Venezuela y Ecuador. De acuerdo con el Documento Compes 3061, denominado "Balance macroeconmico y perspectivas para el ao 2000", en 1999 la industria manufacturera y el comer-

"5.2 billones, deuda de los departamentos". El Tiempo, marzo 13 de 2000 y "Est embargado el Cauca", Portafolio, agosto 19 de 1999, p.l2. "Dficit alcanza US $ 1.450 millones", Ponafolio, febrero 23 de 2001, p. 11.

24

La globalizacin y su impacto sobre la salud

CO experimentaron drsticas cadas de -14.6 por ciento y -7.3 por ciento, respectivamente. Aade el documento que en trminos reales, la demanda intema se redujo 11.4 por ciento, el consumo total registr una disminucin de 4.9 por ciento, la formacin bmta de capital privado se redujo en 65.4 por ciento y lleg a su nivel histrico ms bajo, en tanto que la del sector pblico lo hizo en 3.3 por ciento, mientras la variacin de existencias registr una reduccin del 75 por ciento*. - Como consecuencia de la crisis del sector productivo, la situacin social se deterior sobre todo en los ltimos aos, como lo reconocen incluso los datos oficiales: de 42 millones de colombianos, 15 presentan Necesidades Bsicas Insatisfechas (NBl)^ En 1999 el porcentaje de poblacin bajo la Lnea de Pobreza (LP) era del 55 por ciento y en el sector rural del 80 por ciento, en tanto que en 1997 la primera cifra era del 50 por ciento. En ese mismo ao, 18 de cada cien colombianos no podan comprar la canasta bsica de alimentos y en 1999 ese porcentaje subi a 21. Los datos ms recientes son todava ms alarmantes. Segn la Misin Social de Planeacin Nacional, alrededor de 33 millones de colombianos (77 por ciento del total de la poblacin), estn entre la pobreza y la miseria absoluta. En la lnea de indigencia absoluta est el 20 por ciento de los colombianos (9 millones de personas), mientras que en la pobreza se encuentra el 60 por ciento de la poblacin (24 millones)'". La cifra del desempleo, que en el 2001 ascenda al 20.5 por ciento en las siete principales ciudades, es quizs el indicador que expresa de manera ms clara la dimensin de la crisis social. En todo el pas el nmero de personas sin trabajo llega a 3.085.000, de acuerdo con las mismas cifras oficiales, que gozan de tan poca credibilidad" . El proceso de deterioro del empleo, ligado a la crisis de los sectores productivos, se increment notoriamente en la dcada pasada.

www.larepublica.com.co, febrero 12 del 2000. "Colombianos cada vez ms pobres ", La Repblica, marzo 8 de 2000, p.6'. "Aument la pobreza", www.larepublica.com.co, 8 de febrero de 2002" "Desempleo lleg a 20.2 por ciento". El Tiempo, abril 26 de 2000, p. 9*; "3.1 millones de desempleados". El Tiempo, agosto 21 de 2000, p.2-7.

25

La Salud PbUca Hoy

Para agravar an ms esta situacin, la Ley 617 sobre ajuste en el gasto pblico, aprobada por el Congreso a fines del 2000, obliga a los municipios y departamentos a hacer un ajuste fiscal que consiste bsicamente en una reduccin de los gastos de funcionamiento en los porcentajes fijados en la mencionada ley. Ello se traducir en el despido de entre setenta y ochenta mil empleados de alcaldas y gobernaciones, de acuerdo con la Federacin de Municipios'^ 2. Impacto de las reformas neoliberales sobre la salud pblica Sealemos que el impacto de la globalizacin sobre las condiciones de la salud de las poblaciones abarca un espectro muy amplio de problemas. Para Kelley Lee, la creacin de la Organizacin Mundial del Comercio, OMC, ha suscitado inquietud por la proteccin cada vez ms deficiente de los intereses de la salud pblica, en especial en los pases pobres. Un factor que resulta fundamental es "la falta de regulaciones acordadas y exigidas para proteger la salud, que garanticen la calidad, las normas de higiene, rotulacin, prcticas ticas de comercializacin y seguridad ocupacional, entre otras cosas". Otros factores importantes que afectan de manera directa o indirecta las condiciones sanitarias de las poblaciones son: la produccin y comercializacin de alimentos y bebidas a nivel mundial y las condiciones laborales en que se producen (Lee, 2000: 26). La crisis social del pas, agudizada con el programa de ajuste fiscal impuesto a Colombia por el FMI, se ha manifestado de manera clara en el campo de la seguridad social y la salud. Los datos muestran que se ha producido una verdadera desercin en estos sectores. Cada vez que un trabajador pierde el empleo, la empresa deja de cotizar a la AFP, al ISS, a la Caja de Compensacin o a la EPS, con lo cual la persona, aparte de desempleada.

"Gran debate por la Ley 617", Portafolio, marzo 12 de 2001, p.l 1. La Ley 617 establece que los gastos de funcionamiento de departamentos y municipios -sueldos, salarios, prestaciones, pensiones, transferencias- deben financiarse con un porcentaje de ingresos propios que va del 50 por ciento en el caso de municipios de categora especial hasta el 80 por ciento en los municipios ms pequeos. Un tratamiento similar se le da a los departamentos. Por ningn motivo, las regiones podrn utilizar para cubrir gastos de funcionamiento recursos del situado fiscal, regalas, crdito, sobretasa a la gasolina, venta de activos o rendimientos financieros.

26

La globalizacin y su impacto sobre la salud

queda completamente desprotegida. Lo mismo sucede con mucha frecuencia cuando la empresa entra en concordato, aunque por ley deba seguir cotizando a la seguridad social. En cuanto a pensiones, segn la Superintendencia Bancaria al cierre del tercer semestre de 1999, de 3.318.356 de personas que se encontraban afiliadas al rgimen privado de pensiones, ms de la mitad no cotizaba desde haca seis meses. Estos son los que se conocen como trabajadores inactivos'^. En trminos reales, como lo muestra el cuadro y los grficos siguientes, el porcentaje de poblacin sin cobertura de salud se increment entre 1992 y 2000.
"t " \.

Tabla 1.1
COBERTURA DEL SISTEMA GENERAL DE SEGURIDAD SOCUL EN SALUD 1992-2000 Rgimen de afiliacin 1992 (a) 2000 (b) No. % No. % 6,931,950 Seguridad Social (Contributivo) 20.6 13,898,337 32.8 Sist. Nal de Salud (Subsidiado) 11,758,545 35.0 8,833,074 20.9 Otros (Medicina Prepagada) 2,351,709 0.0 7.0 0 37.4 19,598,963 46.3 Poblacin no cubierta (Vinculados) 12,553,640 POBLACIN TOTAL 33,595,844 100.0 42,330,374 100.0
Fuente: (a)Ministerio de Salud, Reforma a la Seguridad Social en Salud, tomo 3, p. 113 y 114 (b)Super5alud, tomado de la revista Hospitalaria. ACHC, maizo-abril, p. 32

Grfica 1.1

COBERTURA EN SALUD 1992 7.0%

35.0%

37.4% 20.6%
Seguridad Social (Contributivo) Otros (Medicina Prepagada) Sist. Nal de Salud (Subsidiado) a Poblacin no cubierta (Vinculados)

"Desbandada en seguridad social", "Recesin desprotege a los trabajadcMes", Portafolio, octubre 27 de 1999, p.l y 7.

27

La Salud Pblica Hoy

Grfica 1.2

COBERTURA EN SALUD 2000

46.3%

20.9%

Seguridad Social (Contributivo) n Otros (Medicina Prepagada)

Sist. Nal de Salud (Subsidiado) D Poblacin no cubierta (Vinculados)

Para complicar an ms la situacin de los servicios de salud, la red pblica hospitalaria del pas se encuentra en condiciones deplorables, en buena medida como resultado de la intermediacin financiera desarrollada por las EPS y ARS. De acuerdo con la Academia Nacional de Medicina, la reforma de salud ha llevado a consumir nuevos y cuantiosos recursos en un costoso mecanismo de intermediacin guiado por el afn de utilidades corporativas, lo cual ha contribuido significativamente a la quiebra de las instituciones que prestan los servicios, en especial los hospitales pblicos. Segn afirma. Se ha sometido la prctica de la medicina a una argumentacin econmica que somete el acto mdico a la infraestructura de la industria y al poder del mercadeo (...) en esencia, es la conversin de la medicina, que como disciplina intelectual es una profesin de com. promiso social en un oficio que, al disminuir costos, resulte en mayores mrgenes de utilidad para las entidades intermediarias'^.

Academia Nacional de Medicina de Colombia. Comisin de Salud, Ley 100 de 1993. Reforma y crisis de la salud. Bogot, Colombia, febrero de 1999, citado por Ramn Granados y Mara C. Gmez En : "La reforma de los sistemas de salud en Chile y en Colombia: resultados y balance". Revista de Salud Pblica. 2000.

28

La globalizacin y su iinpacto sobre la salud

En un estudio de Fedesarrollo se seala que a comienzos del ao 2001 las 27.052 IPS corran el riesgo de desaparecer debido -en primer trmino- al atraso en el pago de las cuentas por atencin a los afiliados a las Empresas Promotoras de Salud. Este retraso fue calculado en OC K millones de O.K) pesos en 1999. Los voceros de los hospitales pblicos que se encuentran en serias dificultades econmicas, coinciden en sealar que las ARS demoran por varios meses el dinero que antes flua directamente del Estado y que casi siempre llegaba a tiempo. La segunda causa de la crisis es el incumplimiento en los giros por rentas cedidas (impuesto a hcores, juegos de azar, cerveza) de los departamentos y de los dineros del situado fiscal que el gobiemo no ha desembolsado. Por este ltimo rubro, el dficit asciende a 180 mil millones de pesos''. A todo ello hay que sumarle los costos en que incurren las clnicas y hospitales cuando, principalmente por situaciones de urgencia, atienden a personas que no se encuentran cubiertas por el sistema de salud y estos gastos no se les reconoce. De otro lado, seala el estudio, la "contencin de costos"aplicada por las EPS y las ARS, junto con otras prcticas, le costaron a las IPS 70.000 millones de pesos en ese mismo ao. El atraso en los pagos le represent a las IPS prdidas por 45.000 millones de pesos, cuya contrapartida son las ganancias, por una cifra igual, que tienen las EPS al demorar la cancelacin de dichas cuentas, en muchos casos hasta por270das'^ En el mismo sentido crtico de la Academia Colombiana de Medicina, se han venido pronunciando los sindicatos del sector. De acuerdo con Aldo Cadena, presidente del Sindicato Nacional de la Salud y Seguridad Social, SINDESS, la crisis financiera que afrontan los hospitales responde a las siguientes causas: primera, las EPS se quedan con ms del 60 por ciento de los recaudos del rgimen subsidiado; segunda, las transferencias nacionales por intermedio de los municipios no llegan a los hospitales, aparte de que se reduce el situado fiscal (aportes a salud y educacin del presupuesto nacional); tercera, el gobiemo no cancela las facturas por atencin a los "vinculados" (quienes no estn en ninguno de los dos regmenes, el contributivo o el subsidiado y son aproximadamente 18 millones de personas, el 46 por ciento de la poblacin); y cuarta, el gobiemo se exoner de hacer aportes al rgimen subsidiado por medio de la Ley 344 de 1996. Por eUo,

"Salud en regiones podra colapsar". El Tiempo, abril 26 de 2001, p. 1-2. "Se agrava crisis en salud". El Tiempo, febrero 28 de 2001, p. 1-4.

29

La Salud PbUca Hoy

seala que el problema de la salud est tanto en la Ley 100 como en su implementacin: "en la Ley 100 de 1993, porque es la expresin ms acabada de la poltica neoliberal en materia de salud, y en su implementacin, porque no hace cosa distinta a desarrollar dicha poltica" '^ Como un problema adicional, con la reforma de los servicios de salud se ha evidenciado la tendencia de los establecimientos de salud a una operacin aislada, que atenta contra el trabajo conjunto en funcin de la estrategia en red, ante los problemas de salud de las comunidades. As, "la descentralizacin de los sistemas locales e intermedios de salud se entendi como autonona o autarqua de los sistemas regionales y locales y realmente no se acompa de adecuadas transferencias de competencias ni de recursos tecnolgicos y financieros" (Mlaga y otros, 2000). Tanta penuria de la salud pblica contrasta con las ganancias del sector privado, representado por las EPS. Segn informe de la Asociacin Colombiana de Empresas de Medicina Integral, Acemi, en diciembre de 1999 quince de las diecisiete empresas que prestan el Plan Obligatorio de Salud ya haban logrado generar utilidades, mientras que en el ejercicio del ao anterior slo siete arrojaron resultados positivos. En su conjunto, las EPS obtuvieron ganancias por $35.883 millones en 1999,frentea prdidas por $23.332 millones registradas en el 98. Sin embargo, lo ms significativo fue el resultado no operacional del perodo, que lleg a los $13.000 millones, cifra que corresponde a utilidades por el manejo de portafolio de inversiones diferentes a la salud. Lo cierto es que en los ltimos aos las EPS se concentraron en mejorar el tamao de sus economas, es decir, en conseguir muchos ms afiliados y bajar el margen de la actividad como tal. De esa manera, mejoraron su flujo de caja, redujeron en buena medida los costos por compra de medicamentos y han tratado de optimizar los gastos de atencin por usuario'*. Por otra parte, la deficiencia de los servicios pbhcos domiciliarios que afecta a buena parte del pas en los inicios del siglo XXI incide en el deterioro de la salud pblica. De acuerdo con el Informe Nacional sobre la

" Entrevista a Aldo Cadena, octubre 15 de 2001. '* "EPS Resultados a la vista". Revista Dinero, Bogot, abril de 2000

30

La globalizacin y su impacto sobre la salud

Gestin del Agua en Colombia, la poblacin sin servicio de acueducto es de 10.1 miUones (25 por ciento); 16.1 millones no cuenta con servicio de alcantarillado (40 por ciento); de las 750 plantas de tratamiento existentes, el 50 por ciento se encuentra en mal estado. Muchas personas estn en riesgo de contraer un sinnmero de enfermedades, algunas de ellas mortales, por el consumo de agua contaminada y de muy baja calidad. El riesgo va desde enfermedades respiratorias, diarreicas y dermatolgicas hasta leishmaniasis, malaria, dengue hemorrgico y clera. Seala este informe que slo el 10 por ciento de las cabeceras municipales hace algn tipo de tratamiento de las aguas residuales. L En cuanto a la evolucin de las coberturas de vacunacin, puede afirmarse que el resultado ha sido negativo en los ltimos aos. Segn un trabajo reciente, al comparar la vacunacin con antipohomeltica durante los perodos 1995-1996 y 1997-1998 por departamentos, se nota un claro deterioro, en la medida en que en los departamentos en donde el porcentaje de NBI es mayor, la disminucin de la cobertura es tambin mayor que en los departamentos en donde existen mejores condiciones de vida. "Esta cada de cobertura de vacunacin es prevalente en todas las vacunas, a partir de 1997, siendo ms evidente en unos departamentos que en otros" (Mlaga y otros, 2000). . . El estudio antes mencionado hace una sntesis de los programas especficos en los cuales ha habido deterioro a partir de la puesta en prctica de la Ley 100. Destacamos los siguientes: el programa de proteccin de alimentos, que se sustentaba en la Ley 9, fue prcticamente desconocido por la reforma, al incorporrsele dentro del PAB (Plan de Atencin Bsica) y reducrsele sustancialmente su presupuesto. As, por ejemplo, se elimin la inspeccin veterinaria de muchos de los mataderos. Se redujo la prevencin y diagnstico temprano de la tuberculosis (TBC), que representa uno de los problemas ms graves del pas actualmente. Resultado sinlar se observa en los casos de lepra y de sfilis congnita. La incidencia de esta ltima enfermedad vena disminuyendo en los ltimos quince aos, con tasas que van de 0.97 por mil nacidos vivos en 1985 a 0.37 en 1997, pero en los dos ltimos aos se ha incrementado el nmero de casos. Lo mismo sucede con otras enfermedades de transmisin sexual (Mlaga y otros, 2000).

31

La Salud Pblica Hoy

Un factor adicional que incide en el deterioro de las condiciones sanitarias de la poblacin tiene que ver con la presin que ejercen las multinacionales farmacuticas para cambiar las normas legales y acabar con los medicamentos genricos. Esta conducta tiene su origen en las normas internacionales de proteccin de los derechos de propiedad intelectual, impuestas por los pases ms industrializados, en especial Estados Unidos, al resto del mundo, a travs de la OMC. En Colombia existe actoalmente un proyecto de decreto que, de aprobarse, le otorgara a estas empresas el secreto industrial, con lo cual conservaran toda la informacin contenida en la solicitud de registro sanitario de los medicamentos. Segn Asinfar, gremio que agmpa a los laboratorios nacionales, lo que en la prctica sucedera con su aprobacin sera la conformacin de un monopolio en el comercio de medicamentos y se frenara la comercializacin de productos genricos, con las consecuencias que ello traera sobre los precios. "Aqu lo que se est comprometiendo es la salud pblica de los colombianos, sobre todo de la poblacin de menores ingresos", afirm Germn Holgun. presidente del movimiento ciudadano por la defensa de los consumidores de medicamentos. De acuerdo con un estudio elaborado por Fedesartollo, si se eliminaran los medicamentos genricos, habra un alza inmediata de 61 por ciento en los costos de estos productos, y su impacto sobre el bienestar de la poblacin equivaldra a 777 millones de dlares por ao, es decir, ms de un billn 800 mil millones de pesos a precios del 2000. Adicionalmente, de acuerdo con estimativos de Asinfar, las IPS recibiran un duro golpe, pues con el sistema actual de adquisicin de medicamentos se logran descuentos hasta del 80 por ciento'**. No hay duda de que este es un factor que tambin muestra cmo las decisiones de las instituciones internacionales y los pases poderosos en materia econmica y comercial ejercen un impacto negativo sobre las condiciones de salud de la poblacin. Por ltimo, la cn'tica situacin del sector salud en Colombia contrasta de manera notoria con la decisin de la OMS de asignarle al pas el primer lugar en equidad financiera entre 191 pases en su Informe sobre la salud en el mundo 2000, publicado a mediados de ese ao. Por ello, este informe ha causado indignacin entre diversos sectores acadmicos y sociales, tanto en Colombia como en Amrica Latina. "Denunciamos el ranking de la OMS

"

"En jaque drogas baratas", /Tiempo, abril 27de2(X)l, p.l-2.

32

La globalizacin y su impacto sobre la salud

como una forma ms de fomentar un pensamiento que nos conduce a la inequidad y la injusticia a partir de criterios sin ninguna orientacin humana", seal la declaracin poltica del VII Congreso de Medicina Social, celebrado en el 2000^. A manera de conclusin, sealemos que las reformas econmicas y sociales, impuestas por la llamada globalizacin neoliberal a partir de la dcada de los noventa, han incidido claramente en el deterioro de las condiciones sociales, y por tanto en las condiciones de salud de la poblacin en Colombia. Polticas como la de reduccin de la funcin social del Estado y del gasto pblico, la llamada modemizacin del Estado, la privatizacin de las empresas estratgicas y de los servicios sociales bsicos y la apertura econmica y comercial han generado costos sociales muy grandes en el pas durante la ltima dcada. Indudablemente, la salud pblica ha sido uno de los sectores en donde el impacto negativo del modelo econmico y social se ha manifestado de manera ms clara.

Declaracin poltica del Vn Congreso Latinoamericano de Medicina Social y del XI Congreso de la Asociacin Internacional de Polticas de Salud, La Habana, Cuba, 3 al 7 de julio de 2000, reproducido por Nueva Gaceta No. 1, Bogot.

33

La Salud PbUca Hoy

Referencias bibliogrficas HENWOOD, Doug, "The Americanization of Global Finance", Nada Reportan the Amricas,Vol. XXXm, No.l, July-August 1999, p.l 3-23). JARAMILLO PREZ, Ivn. "Rgimen de transferencias: Recorte al Estado social", En : UN Peridico No. 22, mayo 20 de 2001, p.7. LEE, Kelley. "Globalizacin y poltica sanitaria: marco conceptual y programa de investigacin y polticas", En : Salud y desarrollo humano en la nueva economa global: contribuciones y perspectivas de la sociedad civil en las Amricas, Organizacin Panamericana de la Salud, Washington : Universidad de Texas, 2000.
:1 ' '

MLAGA, Hernn, LATORRE, Mara C , CRDENAS, Jaime y o-os. 2000. "Equidad y reforma en salud en Colombia", Bogot : Revista de Salud Pblica, Vol.2, No.3, noviembre 2000, pp. 193-219.

34

Amenazas y desafos de la globalizacin a la salud


ARCADIO JOS GUZMN NOGALES

La globalizacin se percibe en forma abrumadora, pero casi no se entiende y no es extrao que as sea, porque no es sencillo entender los planos a que pertenecen sus mltiples dimensiones, su significado y sus interrelaciones que a veces muestran rasgos contradictorios. La globalizacin por un lado, articula y homogeniza; y por otro, excluye, margina y profundiza la desigualdad. Ofrece rasgos de realidad y tambin de constmccin ideolgica. Es smbolo de innovacin y amenaza de riesgos desconocidos. En este trabajo concebimos la globalizacin como un proceso multidimensional de contraccin del espacio y del tiempo que ha dado origen a una creciente interconexin entre las sociedades, las culturas, las instituciones y las personas. Este proceso articula mltiples niveles (naturales, ideolgicos, econmicos, polticos, sociales, culturales, toicos, tecnolgicos, mediticos) con ritmos, intensidades y alcances desiguales y contradictorios (Fazio, 2001). Con este enfoque intentaremos una aproximacin a la forma en que las diferentes dimensiones del proceso de globahzacin atraviesan la problemtica de la salud. La globalizacin del sistema fsico y de la biosfera evidencian la emergencia de la naturaleza como realidad global. Hay interdependencias objetivas de rango global: en los sistemas fsico y biolgicos mundiales aparecen procesos originados en la interaccin de distintas partes del mundo y procesos puntuales que generan consecuencias planetarias. Todo ello tiene implicaciones en el campo de la salud. La amenaza de escasez absoluta de ahmentos se perfila en el horizonte debido a la imposibihdad de amphar la

37

La Salud Pblica Hoy

frontera agrcola, por la inexistencia de nuevos espacios o recursos que puedan explotarse de manera extensiva, y a la dificultad de mantener el progreso de la productividad, por varias razones entre ellas: la reduccin de la disponibihdad mundial de agua, los rendimientos decrecientes en el uso de los fertilizantes, la prdida de biodiversidad y la reduccin en tamao de los bosques del mimdo que ligan el suelo, previenen la erosin y ayudan a regular el clima. Frente a estos problemas las soluciones del mercado no son eficaces, porque ni el mecanismo de los precios lo es ante lmites ecolgicos, ni el comercio exterior aporta soluciones cuando el problema es la carencia de un excedente alimentario global que pueda ser comercializado. Otra amenaza para la salud se deriva de la globalizacin de la contaminacin, de la tierra, del agua, del aire, de la radiacin, de los organismos vivos empleados en la alimentacin y de la manipulacin gentica. La contaminacin global y los grandes problemas planetarios del cambio climtico y de la capa de ozono, vinculados al cncer de piel, estn claramente relacionados con pautas de produccin y consumo profundamente enraizadas en el capitahsmo actual. El agotamiento de los yacimientos de recursos no renovables resucita el viejo tema de los lmites del crecimiento planteado por el Club de Roma a comienzos de los aos setenta. Esta problemtica permanece, a pesar de que se argumente una pretendidamente ilimitada capacidad de reciclaje y la supuesta desmaterializacin de los procesos productivos como consecuencia del aumento de los servicios en el producto total. Porque, ni el reciclaje puede ir ms all de lo que permiten las leyes fsicas ni la desmateriahzacin en trminos absolutos existe en la realidad. El uso de combustibles fsiles y el avance de la industria automotriz estn aumentando las emisiones anuales de dixido de carbono (C02). El recalentamiento mundial de la atmsfera amenaza con amainar cosechas, inundar permanentemente superficies, aumentar la frecuencia de las tormentas y las sequas, acelerar la extincin de algunas especies, difundir enfermedades contagiosas y causar graves cambios en el clima mundial (Martnez Gonzlez-Tablas 2000). En medio de la amenaza de escasez absoluta de alimentos, de la globalizacin de la contaminacin y del probable agotamiento de los recursos no renovables, la poblacin mundial contina creciendo en forma desigual, los pobres del mundo se multiplican, debido a que los avances cientficos disminuyen la mortahdad infantil y/o alargan la vida y tambin

38

Amenazas y d e s e a s de la globalizacin a la salud

porque la globalizacin capitalista y neoliberal expanden la pobreza. En 1999 ya 1700 millones de personas vivan en la pobreza. En otras palabras, un 29.7% de la poblacin mundial vive con menos de un dlar al da y simultneamente la ayuda internacional al desarrollo se ha reducido sustancialmente. Los pobres del mundo son una manifestacin de la globalizacin si en todo o en parte su existencia se relaciona con procedimientos globalizantes neoliberales como, entre muchos otros, el desplome de la cooperacin intemacional para el desarrollo. Es conveniente recordar que una abundante bibliografa documenta la relacin existente entre pobreza y deterioro de la salud. ' - . Como consecuencia de las innovaciones en el mbito del transporte, el grado de movilidad potencial de objetos materiales y de personas es hoy incomparablemente superior a lo que pudo ser en el pasado. Pero la revolucin en el transporte ha utilizado un modelo tecnolgico intensivo en consumo de energa y en produccin de contaminacin; ha propiciado, con la generalizacin del turismo, el desplazamiento masivo de personas conllevando graves repercusiones ecolgicas, sociales, culturales y probablemente epidemiolgicas. Es cierto que debido al mejoramiento en el transporte se han incrementado las corrientes comerciales legales, pero simultneamente, el comercio ilegal de drogas, auspiciado por los pases desarrollados, ascendi al 8% del comercio mundial, el comercio ilegal de armas tambin es un negocio de los pases desarrollados que est en auge y desata y fomenta la guerra desestabilizando sociedades y gobiemos; el trafico ilcito de personas indica que a Europa Occidental han sido trasladadas en modernsimo transporte areo unas 500 mil mujeres y nias de pases en desarrollo para su explotacin sexual y las ltimas estimaciones indican que para fines de 1998, en el mundo ms de 33 millones de personas estaban contagiadas por el VIH/SIDA, que tambin se globaliza (Martnez GonzlezTablas 2000). Mientras tanto, en los pases pobres (o empobrecidos) la televisin agrede mostrando el nivel de vida de los estados industrializados, el propio pas no tiene nada que ofrecer aparte de pobreza; la nueva generacin, hambrienta de ganas de vivir se dispone a emigrar en precarios medios de transporte. Pero a los que cmzan a nado el Ro Grande hacia los Estados Unidos en recesin, les va muy mal y a los que atraviesan en balsa el Mediterrneo hacia Europa en crisis de empleo, les va peor. Los pases desarrollados se cierran, niegan las visas y los permisos de trabajo y sus ciudadanos de clase

39

La Salud Pblica Hoy

media acosados por el miedo a perder su empleo desarrollan una abierta hostilidad contra todo lo extranjero, buscan la salvacin en la xenofobia, el separatismo y el aislamiento, formas de psicopatologa social (Martin, Hans Peter 1998). . Por otro lado, los agentes financieros, las empresas trasnacionales, los turistas y la mano de obra altamente calificada (profesionales de la salud, entre otros) y en general todos los que disponen de conexin electrnica en hnea circulan fluidamente por la aldea global. En otras palabras: La reduccin del espacio, el tiempo y las fronteras puede estar creando una aldea global, pero no todos pueden ser ciudadanos. La revolucin en los sistemas de transmisin y tratamiento de la informacin tiene implicaciones para la salud y para todas las actividades que utilizan informacin y se ven afectadas por la riqueza y velocidad de su transmisin y, adems, afecta a la posicin relativa del conocimiento y del dominio de elementos inmateriales como factores de poder. Internet introdujo toda una estmctura nueva de comunicacin a menor costo, permitiendo la transferencia simultnea de informacin en palabras, nmeros e imgenes a lugares situados en todo el mundo, haciendo posible la interaccin a distancia en tiempo real. La nueva perspectiva de contraccin espaciotemporal permite hablar del empequeecimiento del planeta y del desplome de las fronteras hasta constituir una hipottica aldea global. Es posible que las redes informticas abran la posibilidad de prestacin de servicios de salud de una forma mejor y ms barata. Los profesionales de la salud podrn aprovechar mejor su tiempo y disponer de la experiencia de otros en un rea geogrfica muy amplia; podrn compartir electrocardiogramas, ultrasonidos, rayos X y mamografas a travs de la red y as ahorrarn tiempo. Diversos hospitales podrn unirse a la red, los mdicos mrales podrn ser ayudados por respuestas a las consultas mediante la transmisin de sonidos, video, imgenes y datos. Hospitales de diferentes ciudades podrn realizar seminarios de formacin por video enviando imgenes de alta resolucin de diapositivas de tejido microscpico para que sean simultneamente observadas y comentadas. Los patlogos reducirn el tiempo de desplazamiento entre hospitales utilizando en su lugar sonido, video y datos interactivos. El uso combinado de tarjetas de asistencia mdica y de historias clnicas informatizadas podr reducir costos y mejorar la calidad de los servicios de salud (Cebrin 1998).

40

Amenazas y desafos de la globalizacin a la salud

En el ciberespacio y la sociedad digital, el mundo es ahora ms pequeo e infinitamente ms complejo, pero, ser este mundo ms pequeo que van a heredar nuestros hijos un mundo mejor? Un mundo donde podr verse realizado, al fin, el sueo de salud para todos?
t . I

No parece que ser as. En esta era de la inteligencia interconectada todo se transforma: empresas, gobiemos, instituciones sociales y las relaciones interpersonales. La frontera digital es tambin un lugar de temeridad, confusin, incertidumbre y posibles desastres y amenazas. Hay indicios del surgimiento de una nueva economa informatizada en la que la riqueza est an ms concentrada, el derecho a la intimidad desaparece y una espiral de violencia y represin socava la seguridad y las libertades fundamentales. Hay pmebas fehacientes de que el tejido social empieza a desintegrarse a la par que se deteriora la calidad de vida. En la bsqueda de respuestas al interrogante formulado no constituye gran ayuda el proceso de globalizacin ideolgica que se expresa en la vigencia de una especie de falsa conciencia (ideologa globalista o "globalismo") que modifica y dificulta la capacidad normal de comprensin y evaluacin de los propios procesos de globalizacin. Esta falsa conciencia presenta una visin unilateral de los procesos objetivos de globalizacin: oculta el hecho de que la mayor capacidad comunicativa requiere infraestmcturas materiales y entornos sociales de los que carecen muchos pases pobres (o empobrecidos) de tal manera que la posibihdad comunicativa en vez de producir un efecto de acercamiento real y total, aleja a los pases excluidos o subordina a los conectados de forma pasiva a los flujos informticos globales.
' ' t . . -i ,' i,^ - '

Para la falsa conciencia las nuevas redes de comunicacin son igualmente accesibles a todas las personas y colectivos, ignorando que no todo es aproximacin y tendencias integradoras y que Internet plantea grandes problemas de exclusin: la educacin superior y el ingreso dem son un requisito para el acceso, el ingreso econmico compra acceso, el ingls se utiliza en casi el 80% de todos los lugares de la Web cuando menos de 1 de cada 10 habitantes del mundo lo habla. Y grandes problemas de salud: en la red abunda la sordidez y la pomografa y los nios y jvenes tienen a su disposicin experiencias exageradas y, sin embargo, extremadamente reales, malsanas, violentas, sexistas y racistas. La re/tiene adems un escalofriante potencial de destmccin de la intimidad, sin precedentes en la historia, y

41

La Salud PbUca Hoy

paralelamente estimula la esquizofrenia global: los cibemautas, en cierta medida, son navegantes solitarios, millones de personas que se la pasan hablando entre s, en crculos cuya composicin racial, social, nacional y cultural puede ofrecer infinitas variantes. Al final del viaje "interactivo" se quedan solos frente a un teclado imaginando que el sistema de valores de la sociedad puede ser sustituido en gran parte por el caos y que lo irreal es "reahdad"... "vtual"! Por su parte la televisin y la prensa hablada y escrita tambin promueven la esquizofrenia global pues, en esta sociedad teledirigida, sustituyen a los partidos pohticos y la discusin democrtica de sus programas por la imagen telegnica de los candidatos (videocracia), todo ello respaldado por las consabidas encuestas donde obtienen la respuesta que ya haban prefabricado y presentan las opiniones despistadas de unos cuantos despistados (encuestados) como si fueran la "opininpblica" de la totahdad del pas (Sartori 1998). La falsa conciencia tambin oculta los costos ecolgicos del incremento en la capacidad de transporte y propone examinar la crisis ecolgica general concentrndose en los sntomas en lugar de hacerlo en las causas y de esta manera los problemas ecolgicos globales resultan ser de efectos inciertos y responsabilidad difusa. Por lo tanto, los pases poderosos, que son los mayores contaminantes, pueden continuar sindolo impunemente mientras el desarrollo industrial en todo el mundo avanza con aterradora ignorancia ecolgica y una cuarta parte de la poblacin mundial mejora su nivel de vida a costa del deterioro creciente del globo terrqueo. La falsa conciencia invade tambin los terrenos de la poltica y la economa: cada vez son ms los ciudadanos que se sienten atrapados, empapados en una especie de doctrina viscosa que, insensiblemente envuelve cualquier razonamiento rebelde, lo inhibe, lo perturba, lo paraliza y acaba por ahogarlo. Esta doctrina es el pensamiento nico, el nico autorizado por una invisible y omnipotente polica de la opinin; qu es el pensamiento nico? La formulacin en trminos ideolgicos con pretensin universal de los intereses del capital financiero transnacional. Sus fuentes principales son las grandes instituciones multilaterales (FMI, BM, OMC) que, mediante su financiacin, vinculan al servicio de sus ideas, a travs de todo el planeta, numerosos centros de investigacin, universidades y fundaciones las cuales perfilan y expanden la buena nueva en su mbito. Este discurso

42

Amenazas y desafos de la globalizjacin a la salud

annimo es retomado y reproducido por los principales rganos de informacin sabiendo con certeza que, en nuestras sociedades mediticas, repeticin equivale a demostracin. El pensamiento tnico asume la globalizacin como im proceso natural, resultado de un incesante progreso tcnico y econmico, en el cual toda economa nacional se vuelve provincia de la econorm'a global y, por tanto, el Estado nacional, si no quiere actuar en contra de los intereses de su propia sociedad, tiene que desarroUar la competitividad mtemacional actuando a favor de que los actores econmicos internos intemacionacen sus actividades y hacer atractivos sus pases para los grandes inversionistas transnacionales. El pensamiento nico presupone que cualquier pas est sometido a fuerzas extemas incontrolables que anulan cualquier intento nacional para contrarrestarlas. Esta idea es promovida por los beneficiarios de la globalizacin para impedir los esfuerzos de reflexin y accin de los sectores opositores. La falsa conciencia encuentra en el neoliberalismo el discurso que le permite recomponer el capitahsmo sobre bases transnacionales, es decir, que le permite reorganizar la economa mundial para adecuarla a las normas de beneficio de las empresas transnacionales. Estas empresas se han convertido en instituciones pohticas que estn rediseando el panorama econmico y pohtico mundial en la medida en que han desplazado al Estado de algunas funciones econmicas y han invadido el rea de la produccin y prestacin de servicios pbhcos fundamentales, intensificando as la transnacionalizacin de las economas nacionales. El internacionalismo que fue un planteamiento de los socialistas contra los capitalistas, hace mucho que ha cambiado de bando. En todo el mundo las empresas transnacionales se enfrentan a los trabajadores y al Estado-nacin, la nueva intemacional del capital desquicia a estados y sociedades enteras. Amenaza con fugas de capital artancando as reducciones de impuestos o subsidios multimillonarios o infraestmctura gratuita y enva sus ganancias a los parasos financieros. En todo el mundo desciende el porcentaje con que los propietarios del capital y el patrimonio contribuyen a financiar los gastos del Estado mientras economistas y polticos neohberales elevan sus lamentos y exigencias: "la gente trabaja muy poco", "tiene salarios demasiado altos", "demasiadas prestaciones sociales" y "enferma con mucha frecuencia". Al coro se une la prensa, la radio y la televisin: "El Estado de bienestar se ha convertido en una amenaza para el futuro", "hemos estado viviendo por encima de nuestras posibilidades", el cambio es "inevitable", "todo el mundo" tendr que hacer sacrificios.

43

La Salud Pblica Hoy

Para esto la receta es la misma en todas partes: recorte del gasto social del Estado, descenso de los salarios y ehminacin de prestaciones sociales, todo con la idea implcita de responsabilizar a los trabajadores de la crisis econmica y social y con el objetivo explcito de que los pases paguen religiosamente los intereses de la deuda extema y se ponga a salvo el sector financiero transnacional Mienfras tanto crecen las cotizaciones en las bolsas de valores y las ganancias de los especuladores intemadonales y tambin el desempleo y los dficits de los presupuestos pblicos. Pero la economa global, dominada por empresas e instituciones financieras transnacionales que operan en los mercados mundiales independientemente y en contrava de objetivos polticos de desarrollo nacional y de condiciones econmicas nacionales, no es en modo alguno un acontecimiento natural sino el resultado de una poltica consciente orientada a esos fines. Tratado a tratado, ley a ley, gobiemos de pases desarrollados (G-7) y organismos financieros multilaterales (FMI, BM, OMC) han liberalizado los mercados nacionales y mundiales y privatizado empresas pblicas en la creencia esquizofrnica de que las corrientes libres de capital, comercio e informacin y la desregulacin estatal producirn el mejor resultado para el bienestar humano. Su tesis fundamental es: el mercado es bueno y las intervenciones estatales son malas. Armados con este dogma emprendieron en la dcada de los ochenta una guerra de liberacin del capital que perdura hasta hoy: nada ni nadie debe sustraerse a la ley de la oferta y la demanda, incluidas la educacin y la salud pblicas. El dermmbe de las dictaduras de partido del bloque del Este dio un impulso complementario y una eficacia global a esta creencia. Liberados de la amenaza de la dictadura del proletariado, los neoliberales, se dedicaron a trabajar duramente en la instauracin de la dictadura del "mercado mundial" (as llaman ellos a los mecanismos de poder y fuerza con que el gran capital transnacional exprime el excedente econmico global). Pero el capitahsmo transnacional, neoliberal, globalizante y darwinista destmye los fundamentos de su existencia: el Estado y la democracia. El ritmo del cambio y la redistribucin del poder y el bienestar erosionan las viejas unidades sociales con mayor rapidez de lo que las nuevas pueden desarrollarse. Los hasta ahora pases del bienestar consumen la sustancia social de su cohesin ms de prisa an que la sustancia ecolgica. Gobiemos y poli-

44

Amenazas y desafos de la globcUizacin a la salud

ticos ven como su poder para configurar la evolucin de los acontecimientos se reduce de continuo. Da igual si hay que establecer la justicia social o proteger el medio ambiente y la salud, si hay que limitar el poder de los medios de comunicacin o poner en cintura el capital financiero: el Estado nacional se ve siempre desbordado y la concertacin intemacional fracasa con igual regularidad (Martin, Hans Peter 1998). Pero si en todas las cuestiones vitales que afectan el futuro de los pueblos los gobiemos se limitan a plegarse a las abmmadoras presiones de la economa transnacional, la poltica se transforma en un juego impotente y el Estado democrtico pierde su legitimidad. Sometida al despotismo neoliberal. La globalizacin se convierte en una trampa para la democracia: menos Estado para hacer justicia social y ms Estado para abolir libertades y derechos sociales y garantizar las mejores condiciones para la acumulacin del capital transnacional. La antidemocracia, el autoritarismo estatal y la violencia legal e institucional son la verdadera esencia del neoliberalismo, solapada detrs de una imaginaria libertad de "mercado", donde la videocracia sustituye a la democracia. La globalizacin se convierte en una trampa para el bienestar, propicia la sustitucin del Estado de bienestar por el Estado Quirrgico Antianestsico es decir, un tipo de Estado al servicio del capital financiero en el que los tecncratas cercenan y extraen por medio del sufrimiento el excedente econmico social. Recordemos que los programas de ajuste estmctural del FMI siempre se justifican como "dolorosos", pero "necesarios" y afirmando que no puede haber crecimiento econmico sin dolor y sacrificio. Bajo la dominacin de estos programas la globalizacin se convierte en una trampa para la salud, al promover el progresivo abandono del Estado de su obligacin de garantizar el ms elemental de los derechos humanos, el derecho a la vida y las condiciones de salud correspondientes. La irresponsabilidad estatal se manifiesta en la drstica reduccin del gasto pblico en el sector y la tendencia privatizadora de prestacin de servicios y seguros de salud, la reduccin de la problemtica sanitaria a la prestacin de servicios mdicos curativos y la conversin de la salud en una mercanca de alta rentabilidad. A esto se suman otros efectos directos e indirectos de las poUcstsfondomonetaristas como el aumento del hambre y del desempleo, la disminucin del salario real, la creciente deficiencia de viviendas y de servicios higinicos bsicos, el deterioro general del aparato educativo estatal, el alarmante incremento de la violencia en todas sus for-

45

La Salud Pblica Hoy

mas y el resurgimiento de enfermedades endmicas, para completar el sombro cuadro de los costos humanos del modelo neoliberal (Alames 2001). Si la salud se entiende como un estado de completo bienestar fsico, mental y social del ser humano y no slo como la ausencia de enfermedad o invalidez, y como un derecho vigente en la totalidad de su existencia, desde la concepcin hasta la muerte en todo tiempo y lugar, de tal manera que mientras haya vida humana hay derecho a la salud; entonces la salud es un derecho humano fundamental interdependiente con otros derechos de rango igual como el derecho a la vida, a la libertad, al medio ambiente sano, al trabajo, a la educacin, entre otros. El Estado tiene el deber de garantizarlo y el ciudadano la autoridad para exigirlo. El Estado tiene la obligacin de reconocer, promover, proteger, satisfacer y garantizar el derecho a la salud y para ello debe desarrollar polticas en las reas de promocin, prevencin, ttatamiento y rehabilitacin concibiendo los recursos destinados a la salud como inversin social y no simplemente como gasto y abstenerse de formular polticas que reviertan los logros alcanzados en materia de salud, deber de satisfaccin progresiva del derecho. (De Currea Lugo, Vctor 2000). El derecho a la salud as entendido de ninguna manera podr ser garantizado por la actual globalizacin neoliberal inhumana y su Estado Quirrgico Antianstesico. Slo una globalizacin humanstica y un modelo de desarrollo democrtico fundamentado en un Estado social de derecho guiado por el inters nacional, y no por el inters de los pases poderosos y el capital transnacional, podrn acercamos al logro de un mundo con salud para todos.

46

Amenazas y desafios de la globalizacin a la salud

Referencias bibliogrficas ALAMES. Observatorio Universitario de Poltica Social y Calidad de Vida, Plataforma Colombiana de Derechos Humanos, Democracia y Desarrollo. "Equidad? El problema de la equidadfiruinciera en saliui". Bogot: Ediciones Antropos, 2001. CEBRIN, Juan Luis. La red Cmo cambiarn nuestras vidas los medios de comunicacin?, Madrid : Taums, 1998. DE CURREA LUGO, Vctor, HERNNDEZ, Mario, PAREDES, Natalia. La salud est grave - Una visin desde los derechos humanos. Bogot : Plataforma Colombiana de Derechos Humanos, Democracia y Desarrollo, 2000. FAZIO VENGOA, Hugo. Globalizacin: discursos, imaginarios y realidades, Bogot :Eicio\\es\ixdcndQS, 2 ^ 1 . GREEN, Duncan. La Revolucin Silenciosa: El auge de la economa de mercado en Amrica Latina, Bogot : Tercer Mundo Editores, 1997. MARTIN, Hans Peter. La trampa de la globalizacin: El ataque al bienestar y la democracia. Madrid : Taums, 1998. MARTNEZ GONZLEZ-TABLAS, ngel. Economa Poltica de la Globalizacin, Barcelona : Editorial Ariel S.A. 2000. SARTORI, Giovanni. Homo Videns: La sociedad teledirigida, Madrid : Taums, 1998.

47

CAPTULO II

DILEMAS TICOS CONTEMPORNEOS EN SALUD

Dilemas ticos contemporneos en salud: el caso colombiano desde la perspectiva de la justicia social
ROMN VEGA ROMERO

Introduccin
' . " . r J : " ' ; 1

En un artculo reciente (Vega Romero, 2001a), he sostenido que la actual reforma del sistema de salud tuvo como uno de sus objetivos establecer las condiciones para la intervencin de las fuerzas del mercado en el sector salud. Que la accin de estas fuerzas, junto con las de un Estado minimizado, busca el control de la conducta y comportamiento de los individuos para estimular el auto-cuidado de la salud de acuerdo con ciertos patrones preestablecidos, y el control de la demanda y oferta de los servicios mdicos y de sus costos para disminuir el gasto pblico y garantizar las ganancias de los agentes del sistema. He sostenido tambin que estas fuerzas han legitimado un sistema que, a la larga, parece estar generando ms y nuevas desigualdades, y coartando el desarrollo de la libertad de las comunidades y de los individuos. En relacin con la justicia social, los problemas ticos del nuevo sistema se nos plantean al menos a tres niveles: A nivel de la relacin entre los procesos del conjunto del sistema de seguridad social en salud y la poblacin. A nivel de la relacin mdico paciente. A nivel de la relacin entre las organizaciones de salud y el paciente

49

La Salud Ptiblica Hoy

Por supuesto, las relaciones ticas pueden ser examinadas en un plano ms ampho: en trminos de uno consigo mismo, con el otro y con el ambiente. En este caso he preferido detenerme en el campo especfico de la relacin con el otro, que es el campo de los procesos ticos relacionados con la justicia social. Para ilustrar la discusin me referir a tres aspectos que vulneran la dimensin de justicia de la tica y que en la experiencia vivida del actual sistema de salud han venido generando amplia preocupacin en la opinin pblica: la cobertura del aseguramiento, la focalizacin de subsidios a la demanda, y el uso de los servicios de urgencias. La cobertura El gasto del sistema de salud como porcentaje del producto intemo bmto ha aumentado de manera sustancial. Ahora estamos ms o menos ahededor de 9% del PIB cuando al inicio de la dcada del noventa estbamos en el 7% (Barn Leguizamn, 2001). Sin embargo, las coberturas del aseguramiento no slo estn por debajo del 60% para la poblacin general, sino que protegen menos a los sectores pobres, de los cuales aproximadamente el 60% no est afiliado, como se desprende de la encuesta hecha por Fedesarrollo (2002) en las cuatro principales ciudades del pas en octubre del ao 2001. Esa misma situacin de inequidad en la cobertura de los pobres, medida por quintiles de ingreso, puede mostrarse con los datos de Moreno Guertero (2001), en las Tablas No. 2.1, 2.2 y 2.3. .

50

-^'--

Dilemas ticos contemporneos en salud: el caso cohmbiano desde laperspectiva de la justicia social

Tabla 2.1 Cobertura de la seguridad social segn quintiles de ingreso, regmenes contributivo y subsidiado 1997-2000
Quintiles de ingreso Cobertura ECV-97 ENH-2000 1 43.2 35.0 2 46.0 43.9 3 54.0 48.9 4 64.0 59.4 5 78.8 74.8 1

Tabla 2.2 Cobertura de la seguridad social en el rgimen subsidiado segn quintiles de ingreso 1997-2000
Quintiles de ingreso Cobertura ECV-97 ENH-2000 1 37.5 27.1 2 30.2 25.8 3 19.4 15.4 4 9.3 lO.l 1

5
2.2 4.2

Tabla 2.3 Cobertura de la seguridad social en el rgimen contributivo segn quintiles de ingreso 1997-2000
Quintiles de ingreso Cobertura ECV-97 ENH-2000 1 5.7 7.9 2 15.8 18.1 3 34.7 33.5 4 54.7 48.4 5 76.6 70.5 1

Fuente: Tomado de Revista Salud Colombia, No. 58,2001, con base en resultados de Moreno Guerrero, 2001.

51

La Salud Pblica Hoy

Si observramos la cobertura del rgimen subsidiado (ver Tabla No. 2.4), que ofrece un paquete de beneficios mucho menor de lo que brinda el rgimen contributivo, tambin nos daramos cuenta que la cobertura de los pobres medida en trminos de lnea de pobreza est muy por debajo de la cobertura del conjunto de la poblacin pobre medida por necesidades bsicas insatisfechas, a tal grado que pudiera decirse, de acuerdo con los ltimos datos, que slo entre el 37% y 40% de los pobres por lnea de pobreza estaban cubiertos por el rgimen subsidiado enfre 1999 y el ao 2000. Si usramos la concepcin de Sen (2000a) para hablar de la pobreza, probablemente los pobres seran mucho ms de lo que muestra su medicin por ingresos, la cobertura sera menor y mayores las desigualdades de lo que exhiben las estadsticas oficiales El enfoque metodolgico de medicin de la pobreza se ha convertido entonces en un punto importante de discusin acerca del alcance de la cobertura del aseguramiento del sistema de seguridad social en salud. Tabla 2.4 Evolucin de la cobertura en el rgimen subsidiado segn pobreza
Ao 1996 1997 1998 1999 2000 Beneficiarios 5981774 7026690 3527061 9325832 9510566* Poblacin NBI Cobertiu^ NBI Poblacin LP Cobertura 14936469 14938470 15357180 15626327 15900191 W,0 17,0 55,5 59,7 59,8 20373774 19773975 20363779 22647877 25500000** 29,4 35,5 41,9

ll,2
37,3

Fuentes: Elaborados propios con base en clculos de Fedesarrollo, 2000; Informe de Coyuntura Econmica, DNP, julio de 2000b. *Ministerio de Salud. Informe del CNSSS a las Comisiones sptimas de Cmara y Senado aos 1999-2000 y 2000-2001. **CEPAL, Panorama social de Amrica Latina 2000-2001. La racionalidad poltica del modelo define que el derecho al aseguramiento en salud se garantiza a partir del ingreso de las personas, y los que no tienen ingresos suficientes deben recibir un subsidio del Estado. Pero hay dos gran-

52

Dilemas ticos contemporneos en salud: el caso colombiano desde la perspectiva de la justicia social

-^

des restricciones para que se cumpla ese objetivo: por un lado, la dependencia del crecimiento de la cobertura del crecimiento econmico y del comportamiento del empleo; por el otro, la poltica intemacional de reduccin del gasto fiscal, y la poltica impositiva nacional, que evita gravar con impuestos a los sectores de ms altos ingresos y ms ricos del pas. El comportuniento de algunos indicadores sociales en la ltima dcada indica que el modelo econmico y social adoptado en el pas ha disparado la pobreza y ha generado ms desempleo y subempleo del que se tena previsto (ver Grficas No. 2.1 y 2.2), desincentivando la afiliacin al rgimen contributivo del sistema y haciendo necesario un mayor volumen de subsidios para asegurar a la poblacin pobre. De otra parte, los acuerdos recientes suscritos enfre Colombia y el Fondo Monetario Intemacional (Ministerio de Hacienda y Crdito Pblico, 1999) se han hecho sobre la base de un conjunto de mecanismos de ajuste que han obligado a la lite gobemante a disminuir el gasto pbhco y la inversin social del Estado, ejemplo de lo cual son la Ley 012 de transferencias fiscales territoriales y el proceso de reformas a la Ley 60, con lo cual se disminuyen las posibilidades de ampliar la afiliacin de los pobres en un escenario donde crece cada vez ms la pobreza, el desempleo y el subempleo. Grfica 2.1 Pobreza
Proporcin de Pobres

1982 1983 1964 1985 1988 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1

Fuente: Vivas (2000). Poltica Social de Estado en Colombia (mimeo). Bogot: PUJ.

53

La Salud Pblica Hoy

Grfica 2.2 Tasa de desempleo, subempleo y ocupacin.

Fuente: Vivas (2000). Poltica Social de Estado en Colombia (mimeo).Bogot: PUJ.

La focalizacin de subsidios y el SISBEN La lite del pas ha resuelto el problema de la redistribucin de los ingresos y de la riqueza por la va de la adopcin de pohticas de focalizacin de subsidios en los ms pobres para acceder a los programas sociales (ver Vega Romero, 2001b), excluyendo del derecho a la salud a amplios sectores de la poblacin tambin pobres y quizs ms necesitados de asistencia sanitaria. En un estudio reahzado con el objetivo de evaluar los efectos de la pohtica de focahzacin de subsidios en salud y del SISBEN sobre la poblacin sin capacidad de pago (Vega Romero, Barajas, Conversa, Hemndez Bello y Cantor, 2001) hemos encontrado evidencias que indican que para efectos de la seleccin de beneficiarios de subsidios para aseguramiento en salud, la pobreza no puede ser reducida a una nocin estrecha y utilitarista del bienestar y de los ingresos, haciendo abstraccin del espacio especfico de la salud y de otros factores econmicos, sociales y polticos. La focalizacin de subsidios en los ms pobres para aseguramiento en salud se hace sobre la base de enfoques metodolgicos utihtaristas que dan gran peso a variables como el nivel educativo y las caractersticas de la vivienda como aproximacin del nivel de bienestar o de pobreza, en detrimento de otras que pudieran ser ms relevantes para distinguir entre pobres

54

Dilemas ticos contemporineos en salud: el caso colombiano desde la pexspectiva de ajusticia social

y no pobres. Hemos encontrado que dada la heterogeneidad de la condicin humana, las caractersticas de las necesidades de salud, del acceso y uso de los servicios de salud, y las circunstancias de un pas como Colombia, amplios sectores de poblacin desempleada y subempleada con medios y altos niveles educativos y con viviendas aceptables (ver Grfica No. 2.3), son pobres para efectos de la demanda de atencin mdica y aseguramiento (Restrepo Mesa, 2001; Vega Romero, Barajas, Conversa, Hemndez Bello y Cantor, 2001). Grfica 2.3 TaSa de desempleo, por niveles educativos

Fuente: Vivas (2000). Poltica Social de Estado en Colombia (mimeo). Bogot: PUJ.

Otros estudios (Cendex, Fundacin Corona, Fundacin Ford, 1999) tambin sugieren la existencia de una no-correspondencia entre la racionalidad de mercado, homogenizante y utihtaria de la pohtica de focalizacin del gasto social y de su instmmento de aphcacin, el SISBEN, frente a la diversidad de necesidades y valores de la poblacin. La racionalidad de la pohtica de focalizacin y del SISBEN est soportada en la idea de la constitucin de un sujeto racional que optimiza sus acciones en funcin del ndice de utilidad resultante de las relaciones entre los ndices de utilidad del consumo, del ingreso y de la dotacin de capital humano (ver, Vlez, Castao y Deutsch, 1999). Este modelo del actor racional del mercado no es compartido por otros actores, cuya racionalidad puede estar legtimamente fundada en otros valores.

55

La Salud Pblica Hoy

Tambin hemos encontrado que no es posible definir solamente desde los escritorios de los expertos y desde las oficinas del gobiemo ningn procedimiento metodolgico que permita captar las distintas expresiones de la pobreza para efectos de asignar subsidios para aseguramiento en salud, y que si se quiere seguir manteniendo el actual modelo de sistema de seguridad social en salud, es pertinente abrir un espacio de amplia participacin de la poblacin en los procesos de discusin y toma de decisiones respecto de los mecanismos de seleccin de beneficiarios de subsidios para aseguramiento en salud (Vega Romero, Barajas, Conversa, Hernndez Bello y Cantor, 2001). En ese estudio hemos referido tambin que hallazgos empricos sobre el acceso a los servicios de salud y la distribucin de subsidios para 1992, que mostraban inequidades en detrimento de los pobres, empujaron a la suposicin de que la focahzacin del gasto social era la va para superar tales injusticias (Vlez, 1996). Ello influy en la definicin de una poltica y normatividad de ampliacin de la cobertura fundada en la reduccin del derecho a la salud a un derecho-prestacin que garantizara el acceso de los sectores de menores ingresos por la va de la focalizacin de subsidios a la demanda en los ms pobres (leyes 60 y 100 de 1993). Consustancial a tal enfoque focalizador fue el diseo del SISBEN y del procedimiento de toma de decisiones para la seleccin de beneficiarios. Luego de diez aos del surgimiento de ese conjunto poltico normativo, tcnico y gerencial de la poltica actual de salud, el problema central identificado desde una perspectiva de justicia social, ha sido la oposicin entre universalidad y focalizacin y, como consecuencia, la oposicin entre inclusin y exclusin (para una ilustracin terica general del tema ver Castel, 1997 y Sen 2000b). Distintos problemas ticos se desprenden de esta experiencia. Como se ha mostrado antes en las Tablas No. 2.1, 2.2, 2.3 y 2.4, con el actual sistema no slo se mantienen o ahondan las inequidades de acceso entre pobres y no pobres, sino entre los mismos pobres. En el caso de la atencin mdica, las barreras financieras estn obligando a la poblacin excluida y sin capacidad de pago no slo a la sustitucin de la medicina institucional por la automedicacin, los remedios caseros y la medicina tradicional, sino a la promocin de un mayor gasto privado de bolsillo (Cendex,

56

Dilemas ticos Contemporneos en Salud: el caso colombiano desde la perspectiva de la justicia social

Fundacin Corona, Fundacin Ford, 1999; Eslava, Hemndez, Ruiz y otros, 1999; CID-UN, 2001), y al empeoramiento de sus condiciones de salud y de vida. Dicho argumento tiene ms peso si se tienen en cuenta los complejos cambios e inestabilidad en el empleo y los ingresos introducidos por la situacin de recesin econmica, por las polticas de ajuste econmico y flexibihzacin laboral, la violencia y la migracin, dificultades que la seleccin excluyente del SISBEN agrava (Lamas 1997; Vega Romero, Barajas, Conversa, Hemndez Bello y Cantor, 2001). Pero la focalizacin y el SISBEN no slo se han convertido en una barrera ms para el acceso a los servicios de salud institucionales por parte de la poblacin pobre que no clasifica como beneficiaria del rgimen subsidiado, sino que inducen comportamientos inmorales, ilegales y clientelistas para acceder al subsidio, e imponen prcticas de gobiemo que colindan con la violacin del derecho a la vida, a estar enfermo y ser atendido, y con la libre escogencia de estilos de vida (ver Vega Romero, Barajas, Conversa, Hemndez y Cantor, 2001). La tragedia de los pacientes que requieren atencin urgente Si del anlisis de la cobertura del aseguramiento y de la focalizacin pasamos al uso de los servicios, uno puede, a partir de los datos de la encuesta de calidad de vida, mostrar resultados de esta ndole: por lo general, los sectores ubicados en los quintiles de menores ingresos y las poblaciones mrales, es decir, la poblacin hacia quien debera dirigirse una poltica redistributiva progresiva, son los que salen ms perjudicados con el actual sistema de salud (ver OPS/OMS, 2001). La tesis que sostengo es que a partir de la emergencia del nuevo sistema de seguridad social en salud se ha constituido un nuevo practicante de la medicina, ms preocupado por los imperativos econmicos de la ganancia, el control de costos y la eficiencia que por la salud del paciente y la equidad. Lo mismo podra decirse de las "nuevas organizaciones" del sector, que han sido reconstituidas para funcionar ms como empresas eficientes y productoras de ganancias que para dar respuesta a las necesidades de salud de los pacientes.

57

La Salud Pblica Hoy

Para ilustrar esta discusin tomar como ejemplo distintas experiencias recogidas de las denuncias pbhcas de lo que en el lenguaje popular y de los medios se ha dado en llamar "los paseos de la muerte". Algunos de estos casos ayudan a esclarecer el peso que ejercen las presiones financieras, el nimo de lucro y el eficientismo en la conducta de los mdicos y de las instituciones de salud, y ponen sobre el tapete problemas recientes como el de la confianza, el trato igual y no discriminatorio de los pacientes. Entre los incontables casos existentes me refiero a tres, en particular, de los cuales tuve informacin suficiente al momento de preparar esta conferencia: Primero, el de un menor de diecisis aos que sufre un accidente de trnsito con politraumatismo con compromiso crneo enceflico severo que amerita la realizacin de una cimga de urgencias en una institucin con unidad de cuidados intensivos y que muere por la no prestacin oportuna de los cuidados requeridos. A pesar de que el paciente tiene derecho a que se le preste no slo la atencin inicial de urgencias sino toda la necesaria para salvar su vida, sta le es negada en forma reiterada por los mdicos e instituciones que tenan el poder de hacerlo por anteposicin del inters econmico particular al deber moral de salvar la vida de una persona. Segundo, aquel otro de un paciente de catorce aos que muere en shock hipovolmico debido a la hemorragia causada por una fractura sea con compromiso vascular en miembros inferiores fmto de un accidente de trnsito y a quien se le niega la oportuna e integral atencin mdica requerida por no presentar, al momento del ingreso a las instituciones de salud, donde fue llevado por sus angustiados famihares, el certificado SOAT, ni su familia disponer de los recursos monetarios lquidos para hacer el depsito exigido previo el inicio de la atencin. El tercero, en el cual me detendr un poco ms, es el de una mujer de 37 aos, muy pobre, en estado de desnutricin severa, quien consulta, por un episodio diarreico agudo, en una institucin de primer nivel de atencin. Por coexistir factores de riesgo sugestivos de VIH (+), y por no tener recursos ni apoyo famihar capaz de procurrselos, la paciente es remitida a la institucin pbhca de segundo nivel de la locahdad para disponer sobre hospitahzacin, valoracin por especiahstas y manejo de tercer nivel, si fiese el caso.

58

Dilemas ticos contemporneos en salud: el caso colombiano desde la perspectiva de la justicia scKial

La paciente es contra-remitida al primer nivel de atencin en forma sucesiva en los dos das subsiguientes por el mdico de tumo del servicio de urgencias de la institucin pblica de segundo nivel con el argumento de que su patologa no ameritaba manejo de segundo o de tercer nivel. AI ser rechazada, la paciente es trasladada por el conductor de la ambulancia que la transportaba a las instituciones privadas con las cuales la autoridad local de salud, al parecer, tem'a contrato vigente de prestacin de servicios, donde tampoco es recibida. En el proceso, al fracasar los intentos de hospitalizacin en las instituciones de prestacin de servicios de segundo o de tercer nivel tanto pblicas como privadas, y ante la tentativa de ser reubicada transitoriamente en la institucin de primer nivel de atencin que originalmente la remiti, la comunidad de la localidad se opone con el argumento de que la paciente es una amenaza para la salud de la poblacin que demandaba servicios de asistencia en ese centro. En este recorrido hacia la muerte, la paciente fue dejada abandonada por el conductor de la ambulancia a la entrada del servicio de urgencias del hospital pblico de segundo nivel, ante lo cual esta institucin se ve obligada a recogerla, no sin antes someterla al escarnio de un bao callejero por parte de uno de los vigilantes de la misma. Por las notas de enfermera se conoce que la paciente, luego de ser recogida de la entrada del servicio de urgencias y baada en la calle, no fue inmediatamente hospitalizada sino que permaneci en el patio de la institucin por tiempo indeterminado hasta cuando fue pasada a la unidad de observacin. Una vez ingresada, la paciente es valorada por el mdico de tumo quien, reconociendo su estado caquctico y anotando los factores de riesgo para VIH, sin embargo, slo hace impresin diagnstica de enfermedad diarreica aguda y VIH (-I-). Ordena tratamiento con lquidos endovenosos a chorro, un antimictico oral, dieta normal y sohcita hemograma, coprolgico y VIH. Al da siguiente de su hospitalizacin, sin que se le hubiesen practicado las pmebas de laboratorio, ni haber sido valorada por los especialistas, ni terminado su tratamiento, pero ante la constatacin de la mejora de la diarrea, se decide dar sahda a la paciente con indicacin de soporte nutricional.

59

La Salud Pblica Hoy

Por las mismas notas de enfermera se sabe que el cuerpo de la paciente era maloliente, plido, daba la impresin de mal estado de salud nutricional, y que al momento de ser emitida la orden de salida, la paciente no tena familiares ni amigos que se hiciesen cargo de la misma. Ante la imposibihdad de abandonar el hospital por no poder valerse de s misma, la paciente permanece en el pasillo de la institucin sobre una colchoneta tirada en el suelo, sin recibir tratamiento por no haberle sido ordenado alguno. Luego de la orden de salida, la paciente slo fue valorada por las enfermeras las cuales, especialmente en los ltimos das de su estancia, siguen anotando su mal estado nutricional y de salud. A los doce das de privacin de la atencin mdica, los mdicos reaparecen en el escenario cuando la paciente presenta un paro cardio-respiratorio de infmctuosa reanimacin. A pesar de las reiteradas omisiones en la atencin cientfica y de la despreocupacin humana por esta paciente, la institucin pblica pasa la cuenta de cobro por valor superior a un milln de pesos por los das de estancia y por la supuesta atencin prestada a la paciente. Al increparse al gerente del hospital por las fallas cientficas y ticas detectadas en la atencin de esta mujer, ste se defiende diciendo que en las condiciones tecnolgicas y circunstancias econmicas de la institucin se hizo todo lo que se pudo ya que incluso se le pudo brindar "cristiana sepultura". Se sabe de la honda crisis econmica de la red pbhca de servicios de salud, del cierre al que constantemente son sometidos los hospitales, de la bajsima cobertura del aseguramiento de los pobres, y de la falta de compromiso del alto gobiemo para entregar recursos frescos suficientes para sacar de la crisis a las instituciones de salud y garantizar la atencin de la poblacin pobre. . A pesar de los factores contextales que explican las dificultades de la atencin de los pobres, y de la crisis econmica que explica en parte el bajo desempeo de los hospitales y la desmotivacin del recurso humano, hay que tener en cuenta las presiones comerciales y financieras con que las polticas generales de salud vigentes y las gerencias de estas instituciones condicionan a los practicantes de la medicina. Las siguientes preguntas emergen frente a estos casos: ^

60

Dilemas ticos contemporneos en salud: el caso colombiano desde la perspectiva de la justicia social

Es ticamente justificada la conducta de los mdicos de urgencias de no recibir a los pacientes por no tener recursos para pagar y preferir, en su defecto, contra-remitirlos? Es ticamente justificado el alegato de los gerentes de los hospitales en el sentido de que las presiones financieras de las instituciones, las polticas de control de costos, o los intereses de asociaciones particulares de mdicos, les impiden legtimamente cumplir con su obligacin de abrir las puertas de las instituciones a quienes las necesitan? Es ticamente justificable la conducta de la comunidad de rechazar a un paciente por presentar SIDA? Es ticamente justificable la conducta de quienes dirigen las redes de ambulancias o la de sus conductores al retrasar el transporte de los pacientes o dejarlos abandonados a las puertas de los servicios de urgencias de los hospitales? Existe alguna relacin entre la conducta de los mdicos, las direcciones de los hospitales y servicios de salud, y los conductores de las ambulancias? Cul es esa relacin? Una respuesta desde la reflexin terca Estos casos, que son de comn ocurrencia a todo lo largo y ancho del pas, no son fenmenos fmto de la mala fe e iimioralidad de sujetos aislados que actan por s solos, sino resultado de la influencia de los valores y cdigos de comportamiento dominantes en el conjunto del actual modelo de desarrollo econmico, poltico y social, de los incentivos y constreimientos que el sistema de salud impone sobre el comportamiento de los mdicos y las organizaciones de salud, y de una filosofa gerencial del sistema y de las organizaciones que lo componen, que antepone los valores comerciales, utilitaristas y de rentabilidad econmica sobre valores ticos que tienen que ver con el bienestar de la poblacin y de los pacientes y con la probidad moral y cientfica de los practicantes de la medicina (ver Vega Romero, 2001'; Bowles, 1998). Comparando la experiencia del modelo de desarrollo econmico con amphos y universales sistemas de seguridad social de los pases capitalistas

61

La Salud Pblica Hoy

europeos emplazados a la orilla del Rin con el modelo de capitalismo de mercado instaurado por Ronald Reagan en los Estados Unidos, Albert (1992) ha hecho dos planteamientos sobre los efectos de los valores del mercado en la conducta de los mdicos, las organizaciones de salud y los sistemas sanitarios, que me parecen iluminantes para nuestro caso: primero, "En materia sanitaria, el sistema de mercado, fundado en el inters pecuniario personal del mdico (y aadin'a, en el inters pecuniario del capital financiero impuesto al sistema de salud como un todo), no es siempre el ms eficaz sino todo lo contrario. La salud no es ciertamente un terreno que pueda, sin discernimiento, hbrarse a las leyes del mercado" (p. 139). Segundo, "...a partir del momento en que, siguiendo la misma lgica capitalista, su mdico lo trata como a una fuente de ganancias, en quin puede confiar?Y qu valor tiene una sociedad que destmye la confianza?" (p. 101). Otro elemento que quisiera destacar es el de la relacin del sistema de salud en su conjunto, de la poltica detrs del mismo, con la justicia social, particularmente con aquella nocin extensa del principio de libertad que puede hacer confluir igualdad y autonoma, es decir, igualdad y pluralidad (ver Vega Romero, 2001a, 2001c; Vega Romero y Hemndez Bello, 2001). Desde esta perspectiva es particularmente importante el planteamiento que subraya la justicia social como un compromiso social que valora tanto los aspectos positivos como los negativos de la libertad. En efecto Sen (1996) sostiene que "el contenido de la libertad individual incluye, de un lado, aquellos medios e instmmentos positivos que nos hacen posible actuar como individuos viables y responsables, incluyendo cuidados bsicos de salud, educacin bsica, estar hbre del hambre y de la pobreza extrema, etc. Tambin incluye, por otra parte, nuestras hbertades y derechos bsicos, la hbertad y oportunidad de participar en los procesos polticos y sociales que afectan a nuestras vidas" (p. 35). De otra parte, un mes antes de su muerte, Donabedian (2001), ilustre mdico, salubrista, poeta y acadmico, pionero en el estudio de la cahdad de los sistemas de salud, sostuvo, al observar la conducta de los mdicos que lo atendan como enfermo terminal de cncer en un hospital de los Estados Unidos, que a pesar de las presiones e incentivos financieros impuestos sobre la conducta de los mdicos para la reduccin de costos, stos an tem'an la posibilidad, si se lo propusieran, de resistir y de preservar su

62

Dilemas ticos contemporneos en salud: el caso colombiano desde la perspectiva de la justicia social

libertad y la de los pacientes, sobre la base de la conciencia de su misin mdica y humanitaria, conciencia que por lo menos debera hacerles capaces de reflexionar de manera autnoma e "identificar las fallas y ponerlas a la vista de quienes pueden resolverlas" (p. 2). Adems de sealar elfi-acasode la prctica mdica en incorporar mecanismos de atencin que promuevan el respeto por la autonoma del paciente y su participacin en las decisiones chuicas, Donabedian sostuvo que "la comerciahzacin de la medicina es un gran error", no slo porque "la salud es una misin sagrada", sino porque la comercializacin de la medicina pervierte la prctica mdica (p. 2). Donabedian tambin argument que el diseo de los sistemas de salud y de sus organizaciones slo deben ser mecanismos potenciadores de la accin de los mdicos y de las enfermeras, es decir, que sta dimensin no explica por s sola todo lo que stos hacen o pudieran hacer por los pacientes; que an a pesar de los valores comerciales que pueden regir la racionalidad poltica que determina el diseo de un sistema de salud y de sus organizaciones, todava queda un espacio para la hbertad que puede no ser invadido por aquellos imperativos instmmentales de la racionahdad del capitalismo de mercado: ese es el espacio de la dimensin tica de los individuos. Para Donabedian, en el caso de la misin de la profesin mdica, esa dimensin tica debe estar regida por los valores del amor y la equidad. Los anteriores argumentos nos mueven en dos direcciones: primero, los alcances de la justicia sanitaria estn en estrecha relacin con la lgica del diseo de un modelo econmico, social y de salud, y con la praxis que sta determina entre sus actores. Segundo, la tica de la relacin entre mdicos, organizaciones de salud y pacientes deriva, por un lado, de los valores dominantes en el sistema y, por el otro, de los valores propios de los actores del sistema no sometidos a los primeros. Para clarificar este planteamiento me apoyar en el enfoque que postula que en el campo de la justicia social y de la tica el sujeto es de una parte constituido por las relaciones dominantes de saber y poder, y de otra parte por la resistencia que stos oponen a las anteriores y por su propia autoconstitucin como sujetos (ver Deleuze, 1988; Vega Romero 2002a).

63

La Salud PbUca Hoy

He adoptado la tesis de Donzelot (1991) en el sentido que en el plano de la justicia social histricamente los sujetos sociales haban venido siendo constituidos a travs de un doble mecanismo: uno jurdico, que constituye sujetos de derechos para efectos de solidaridad, y otro cientfico y tecnolgico, que constituye sujetos de deberes para efectos de la optimizacin de la economa y de la regulacin del comportamiento individual y colectivo. Por ejemplo, en los inicios del Estado de bienestar, una nocin jurdica de sohdaridad social (igualdad de derechos) haba sido articulada con una concepcin cientfica del individuo y de la poblacin en materia de necesidades de salud que giraba alrededor de las nociones bio-mdicas de lo normal y de lo patolgico, como bien lo ha descrito Canguilhem (1991), y de tecnologas de gobiemo como las de la seguridad social y el taylorismo. Con la emergencia del neo-liberalismo (ver Castel, 1991), concepciones gerencialistas del gobiemo de lo social fundamentadas en relaciones de mercado y el utilitarismo (costo-efectividad, control de costos, ganancia, maximizacin de la utilidad o del bienestar) han sido articuladas con nociones cienTicas que gobieman los individuos y las colectividades con mecanismos epidemiolgicos orientados al control de riesgos, con una concepcin jurdica de solidaridad complementada con la nocin de responsabilidad cvica, con mtodos de distribucin y asignacin de recursos como la focalizacin, y con tecnologas de gobiemo de lo social como el aseguramiento. As, las relaciones entre los sujetos, los expertos y las tecnologas de gobiemo no pueden ser definidas y entendidas sin tomar en cuenta las mutaciones e interacciones histricas entre saber y poder en la constitucin de racionalidades y prcticas hegemnicas, usadas como medios para gobernar los individuos, la poblacin, la salud y los servicios de salud. De acuerdo con Foucault (1991a), toda racionalidad contiene un significado instmmental y relativo. A su vez, cada racionalidad se inscribe en una prctica, sistema o rgimen de prcticas, que es a su vez la expresin de un cierto rgirhen de racionalidad. Tanto el rgimen de racionalidad como el de prcticas contiene dos ejes: de una parte, el eje codificacin /prescripcin, formado por un conjunto de reglas, procedimientos, relaciones de medios a fines; y de otra parte, el eje e formulaciones de verdad/falsedad, que determina el dominio de los objetos acerca de los cuales es posible articular proposiciones verdaderas y falsas.

64

Dilemas ticos contemporneos en salud: el caso colombicmo desde la perspectiva de la justicia social

Podra decirse que para facilitar su anhsis Foucault (1991b) divide las racionalidades y prcticas en tres ejes: primero, el de los regmenes de verdad y sus efectos en materia de verdaderas y falsas formulaciones de un discurso; segundo, el del poder, que define las prcticas de gobiemo, ordenamiento, control y regulacin de los sujetos y de las poblaciones, fundamentadas en el disciplinamiento, divisin y exclusin de los mismos; y tercero, el eje de la tica o de los sujetos, que analiza la prctica de establecer cdigos universales con efectos morales obhgatorios sobre todos los individuos. Esas racionalidades y prcticas no son el resultado de un proceso natural, evolutivo, siempre progresivo, de perfeccionamiento de la razn y de la accin humana. Ellos son eventos contingentes, transitorios e histricos que, en un proceso de ensayo y error, pretenden dar respuesta a ciertas demandas y circunstancias, sobre la base de relaciones de fuerza constituidas por la lucha entre diferentes actores sociopolticos, y sobre la base de su posicionamiento estratgico en ciertos dominios del saber (la economa poltica, por ejemplo), de las tecnologas sociales (por ejemplo, la seguridad social), y de instituciones de poder (el Estado, las organizaciones), todo lo cual tiene como blanco el control del cuerpo de los individuos y la regulacin de la poblacin como especie. A partir de all, estas racionahdades y prcticas, una vez constituidas, dan forma al orden social, a nuevas instituciones, constituyen la identidad de los sujetos, gobieman y regulan sus comportamientos, conductas y acciones. Foucault (1988a) ha descrito y analizado las implicaciones de este doble mecanismo para la constitucin de los sujetos sociales: sujecin, cosificacin y dominacin, individualizacin y totalizacin, exclusin e integracin, control y normalizacin de los individuos y de las poblaciones. En el caso de la salud ha descrito los efectos de una poltica que medicaliza, normaliza, totaliza e individuahza, incluye y excluye. Pero tambin se ha referido a los efectos iatrognicos como lmites de la eficacia del saber mdico, a la comercializacin de la medicina, de la enfermedad y de la salud, a sus costos, y a los mecanismos reguladores que constrien an ms la libertad y autonoma de distintos sujetos sociales. Sin embargo, la accin de las fuerzas que constituyen esa relacin entre saber y poder sobre el sujeto, sin bien puede ser asimtrica, no es necesariamente unilateral, es decir, el sujeto no queda totalmente sometido a sus

.'

65

La Salud Pblica Hoy

designios, sin ninguna opjcin de resistencia, de preservar o reinventar su hbertad. Es esta opcin lo que en esta perspectiva puede ser entendido como el campo de una nueva concepcin de la tica: la esttica de la existencia. Foucault (1997e) no slo rompe con los patrones ticos fundamentados en sistemas autoritarios y en estmcturas disciphnarias cientficas, morales o jurdicas, que reducen la justicia social a los intereses, desarrollos y mandatos de ciertos modelos de sociedad, de estmcturas y poderes econmicos y polticos que constrien las posibilidades de acceso personal y la escogencia de sistemas de cuidados mdicos, sino que desarrolla las bases de una concepcin plural de la tica que es una esttica de la existencia que defiende y promueve relaciones de autonoma y libertad entre los sujetos sociales (ver, por ejemplo, Foucault, 1988b, 1988c, y 1997e). Ese enfoque hace dos cosas: de una parte, promueve la resistencia contra las relaciones coercitivas o controladoras de poder y saber sobre el sujeto y, de otra parte, estimula el desarrollo de nuevas relaciones ticas con uno mismo y con otros (ver Foucault, 1988a, 1988b, y 1997e). El punto nodal de su tica es una concepcin que estimula prcticas de libertad o relaciones de autonoma entre los sujetos, mediante el auto-conocimiento y la auto-regulacin de los sentimientos, de los deseos y de los placeres propios (Foucault, 1997e). As, al contrario de Kant (1949), quien fundamenta la moralidad en imperativos categricos universales de la razn prctica pura, la tica de Foucault se funda en la esttica de la existencia. O sea, el arte del uso de distintas tcnicas de auto-constitucin del sujeto: a travs de la forma en que reconocemos nuestras obligaciones morales con otros y con nosotros mismos; mediante la transformacin de nosotros mismos por medio de actividades de auto-conocimiento y de auto-formacin; y mediante la auto-definicin de la clase de fin a que aspiramos o de la clase de sujeto que deseamos ser. Ese arte es el que debe definir el contenido moral de nuestras relaciones con nosotros mismos, con otros, y con el ambiente. La hbertad es el centro de esta tica en relacin con otros porque es el riesgo de dominacin materializado en las relaciones de poder y sus conexiones con los juegos de verdad, lo que debe ser resistido (Foucault, 1997a).

66

Dilemas ticos contemporneos en salud: el caso colombicmo desde la perspectiva de la justicia social

A travs de esta tica, FoucauU busca ayudar a constituir nuevas prcticas de gobiemo, de la toma de decisiones, ftindamentadas en la participacin, en la hbre escogencia, y en un dilogo que conduzca hacia un "consenso tico" (Foucault, 1988c, p. 174) no orientado por la discusin de los supuestos de la comunicacin ideal, como las condiciones ideales de los actos de habla del consenso Habermasiano (1992), ni por el recurso a ninguna teora de la namraleza humana, de la razn universal, o de la verdad absoluta, que lo hacen universal, sino por los compromisos y acuerdos que emergen de la lucha pohtica y social, de la posicin tica de responsabihdad hacia otros. Conclusin As pues, teniendo en cuenta nuestra experiencia y aportes tericos adicionales como los de Foucault (1973,1976), Foucault y Chomsky (1974), puede concluirse que los principios que han regido la distribucin de recursos, acceso y uso de los servicios y cuidados referentes a la salud de los individuos y de la poblacin, han sido ms el resultado de la imposicin y generalizacin de concepciones especficas de justicia social mediante el recurso a la fuerza de actores y racionalidades dominantes, que el resultado natural de un acuerdo o de un consenso fundamentados en la verdad universal de una teora de la sociedad o de una concepcin moral. Por eso, la igualdad no puede ser el resultado de un contrato social trazado a travs de un procedimiento puramente racional, ni puede tampoco ser la expresin lgica de la aplicacin de un modelo terico de sociedad, sino la consecuencia de la victoria de fuerzas, o del acuerdo y. del compromiso entre fuerzas, que se articulan estratgicamente a posiciones dentro de los dominios del saber, de las tecnologas sociales y de gobiemo, y que constmyen, escogen o se ven obhgadas a apoyar una racionahdad o racionalidades particulares sobre otras que no expresan bien sus intereses. Desde esta perspectiva el mejoramiento de los problemas ticos y de jisticia identificados pasa por la generacin de un nuevo discurso de la poltica social y de salud creado conjuntamente por distintas voces y racionalidades a partir del dilogo. Discurso capaz de propiciar el cambio del modelo de desartollo econmico adoptado en el pas en la ltima dcada, la transformacin de los fundamentos y valores del sistema de salud, y la incorporacin y desarrollo de una nueva tica de la prctica mdica fundada en la igualdad y la hbertad.

67

La Salud PbUca Hoy

En un ensayo anterior (Vega Romero 2002b) expuse que el cambio en el sistema de salud debe apoyarse en tres elementos centrales: primero, la declaracin del derecho a la salud como un derecho humano fundamental; segundo, la ampliacin de la intervencin del Estado en la produccin y distribucin de los medios de la salud; y tercero, la apertura de espacios para una ms amplia, diversa y dinmica participacin social en los procesos de toma de decisiones, control y vigilancia del sistema y de la prctica mdica. La nueva tica de la prctica mdica y del sistema debe estar afianzada en una concepcin de justicia que promueva el respeto y desarrollo de la libertad del paciente, en la igualdad de acceso y uso de los servicios mdicos segn necesidad, y en una concepcin progresiva del financiamiento y distribucin de los recursos del sector (ver Vega Romero y Hemndez Bello, 2001).

68

Dilemas ticos contemporneos en salud: el caso colombiano desde la perspectiva de la justicia social

Referencias Bibliogrficas ALBERT, M. Capitalismo contra Capitalismo. Barcelona: Paids, 1992. BARN LEGUIZAMN, G. Proyecto Cuentas Nacionales en Salud de Colombia. Bogot : Departamento Nacional de Planeacin / Direccin de Desarrollo Social / Subdireccin de Salud. 2001 BOWLES, S. Endogenous Preferences: The cultural consequences of markets and other economic institutions. En : Journal of Economic Literature. Vol. 36, No. 1, 1998 pp. 75-111. CANGUILHEM, G. The Normal and the PathologicaL New York : Zone Books. 1991. CASTEL, R. From dangerousness to Risk. En : BURCHELL G, GORDON C, y MILLER R (eds) 1991. The Foucauh Effect. Studies m govemmentality. London : Harvester Wheatsheaf, 1991. . Las metamorfosis de la cuestin social Una crnica del asalariado. Buenos Aires : Paids, 1997. . CENDEX (Centro de Estudios para el Desarrollo) - Fundacin Corona Fundacin Ford. Entorno, Aseguramiento y Acceso en el Rgimen Subsidiado de Salud en Colombia: Seis estudios de caso. Bogot, 1999. CID-UN. SISBEN: identificacin y afiliacin al RS. Bogot : Ministerio de Salud-Programa de Apoyo a la Reforma (borrador), 2001. DANIELS, N. Just Health Care. USA: Cambridge University Press. 1985 DELEUZE, G. Foucault. London : Athlone, 1988. DONABEDIAN A., Avedis. Una experiencia directa con la calidad de la atencin. En : Informando & Reformando, abril /junio, No. 8, 2001. DONZELOT, J. Pleasure in Work. En : BURCHEL, G. GORDON, C. y MILLER, P. (eds.). The Foucault Effec: Studies in Govemmentality. London: Harvester Weatsheaf, 1991.

69

La Salud PbUca Hoy

FOUCAULT, M. The Birth of the Clinic. An archaeology of medical perception. London : Tavistock Pubhcations, 1973. ESLAVA, J., HERNNDEZ, A., RUIZ, F. y otros, 1999. Factores condicionantes y determinantes del acceso a los servicios de salud para la poblacin del rgimen subsidiado y los participantes vinculados del nivel Ul de SISBEN de 14 localidades del Distrito. Santa Fe de Bogot : Universidad Javeriana - Secretara Distrital de Salud, Documento Tcnico ASS/ 691B-99. . FEDESARROLLO. Indicadores de Encuesta Social Etapa V. En : Coyuntura Social, 2002. FOUCAULT, M. and CHOMSKY, N. Human Nature: Justce vs Power. In : Fons Elders (ed). Reflexive Water. The basic concems of humankind. London: Souvenir Press, 1974. La crisis de la medicina o la crisis de la antimedicina. En : Educacin Mdica y Salud, 10 (2). 1976. Social Security. En : Kritzman, LD, (ed.). Michel Foucault. Politics, philosophy, culture. USA : Roudedge, 1988a. Critical Theory/Intelectual History. En: Kritzman LD, Michel Foucault. Politics, philosophy, culture. USA : Routledge, 1988b. Social Security. En: Kritzman LD. Michel Foucault. Politics, philosophy, culture.\SA.:^o\ii\ege,\9%%c. Questions of Meiod. En : BURCHELL, G. GORDON, C. y MILLER, P. (eds). The Foucault Effect. Studies in Govemmentality. London : Harvester Weatsheaf, 1991. Govemmentality. En : BURCHELL, G. GORDON, C. y MILLER, P. (eds). The Foucault Effect: Studies in Govemmentality. London: Harvester Weatsheaf, 1991b.

70

Dilemas ticos contemporneos en salud: el caso colombicmo desde la perspectiva de la justicia social

The Ethics ofthe Concem ofthe Self as a Practice of Freedom. En : Rabinow P, 1997. Ethics, subjectivity and truth. (The essential works of Michel Foucault 1954-1984, Vol 1). London : Alien Lae. On the Genealogy of Ethics: An overview of work in progress. En : Rabinow P. Michel Foucault: Ethics, subjectivity and truth. (The essential works of Michel Foucauh 1954-1984, Vol 1). London: Alien Lae, 1997e. HABERMAS, J. Moral Consciousness and Communicative Action. Great Britain : polity Press, 1992. KANT, I. The Critique ofPractical Reason. Chicago: University of Chicago Press, 1949. LAMAS, A.E. Mitos y desafos de la poltica social. En : ROJAS M.C. y DELGADO, A. (Ed.). Poltica Social Desafios y Utopas. Bogot : Pontificia Universidad Javeriana, 1997. Ley 60 de 1993. "Por la cual se dictan normas orgnicas sobre la distribucin de competencias de conformidad con los artculos 151 y 288 de la Constitucin Poltica y se distribuyen recursos segn los artculos 356 y 357 de la Constitucin Poltica y se dictan otras disposiciones". Bogot, Agosto. Ministerio de Hacienda y Crdito Pblico. Acuerdo extendido de Colombia con el Fondo Monetario Internacional, (mimeo) Bogot : 1999. MORENO GUERRERO, H. La afihacin a la salud y los efectos redistributivos de los subsidios a la demanda. ^ : Archivos de Economa, No. 145, Direccin de Estudios Econmicos, Departamento Nacional de Planeacin, p. 25. 2001. OPS / OMS. Hoja resumen sobre desigualdades en salud. Colombia, http:/ /www.org/Spanish/HDP/HDD/colombia-res.pdf .2001. RAWLS, J. A Theory ofJustice. Great Britain : Oxford University Press. 1972.

71

La Salud PbUca Hoy

Repblica de Colombia / Ministerio de Salud, 1993. Ley 100 de 1993. Bogot : Publigrficas. RESTREPO MESA, C.l. La focalizacin en acceso a los servicios de salud para la poblacin ms pobre. 2001. Un anlisis participativo de los resultados del SISBEN. En : Facultad Nacional de Salud Pblica (ed). Pensamiento en Salud Pblica. El derecho a la salud, pp. 142-163. Medellin : Universidad de Antioquia, 2001. SEN, A. Desarrollo como Libertad. Planeta : Bogot, 2000a. Social Exclusin: concept, application, and excmtiny. Social Development Papers No. 1. Office of Environment and Social Development / Asian Development Bank, 2000b. Compromiso Social y Democracia. Las demandas de equidad y el conservadiu-ismo financiero. &i : BARKER, P. (comp.). Vivir como Iguales, Barcelona : Paids Studio, 1996. VEGA ROMERO, R. Evaluacin de polticas de salud en relacin con justicia social. En : Revista de Salud Pblica. Vol 3, No. 2, pp.97-126, Bogot, 2001a. Anlisis del discurso de focalizacin de subsidios en salud y del SISBEN en Colombia durante la dcada de los noventa (mimeo). Pontificia Universidad Javeriana (Facultad de Ciencias Econmicas y Administrativas, Programas de Posgrados en Administracin en Salud y Seguridad Social) / Secretara Distrital de Salud / Red de Hospitales del Suroccidente de Bogot, 2001b. Justicia Sanitaria como igualdad: universalismo o pluralismo? En : Facultad Nacional de Salud Pblica (ed). Pensamiento en salud pblica. El derecho a la salud, pp. 54-89. Medellin : Universidad de Antioquia, 2001c. The Relevance of UMch's Critical Systems Heuristics for Social Planning and Evaluation (Mimeo). En proceso de edicin para pubhcacin en Cuadernos de Administracin No. 23, Bogot : Pontificia Universidad Javeriana, 2(X)2a.

72

Dilemas ticos contemporneos en salud: el caso colombiano desde la perspectiva de la justicia social

El derecho a la salud y las reformas del sector. En proceso de edicin para publicacin en Cartiha de Seguridad Social. Medellin : Universidad de Antioquia, 2002b. VEGA ROMERO y HERNNDEZ BELLO. El sistema colombiano de seguridad social en salud: Desigualdad y exclusin. En: Revista Gerencia y Polticas de Salud, pp. 48-73, Bogot : Pontificia Universidad Javeriana, 2001. VEGA ROMERO, R. BARAJAS, L.C. CONVERSA, L. HERNNDEZ BELLO, A. y CANTOR. B. Evaluacin de los efectos de la poltica de focalizacin de subsidios y del SISBEN sobre la poblacin vinculada, sin capacidad de pago, de las localidades de Bosa, Fontibn, Kennedy y Puente Aranda de Bogot (Mimeo). Pontificia Universidad Javeriana (Facultad de Ciencias Econmicas y Administrativas, Programas de Posgrados en Administracin en Salud y Seguridad Social) / Secretara Distrital de Salud / Red de Hospitales del Sur-occidente de Bogot, 2001. VLEZ, CE. Gasto Social y Desigualdad. Logros y extravos. Bogot : Departamento Nacional de Planeacin - Misin Social, 1996. VLEZ CE. CASTAO, E. Y DEUTSCH, R. Una interpretacin econmica del sistema de focalizacin de programas sociales: el caso SISBEN en Colombia. En : Coyimtiu-a Social, No. 21, 1999. VrVAS, A. Poltica social de Estado en Colombia (Mimeo). Bogot : Pontificia Universidad Javeriana / Facultad de Ciencias Econmicas y Administrativas, 2000.

73

Problemas bioticos y dilemas ticos contemporneos en salud


BEATRL PEA

1. Aproximacin conceptual Para una mejor apreciacin de los problemas en tomo a la biotica y la tica en la actualidad, me parece necesario comenzar mencionando lo que, a mi modo de ver, es el fundamento de estas discusiones. Me refiero a lo que la mayora de las personas llamamos moralidad diaria, la cual denota el fuerte nexo que hay entre la tica y la vida cotidiana. Entendiendo la tica como la posibilidad que tiene el ser humano de reflexionar sobre sus actos y comportamientos, pienso que se la debe concebir como un espacio para recreamos, para repensar el ser y el hacer, para reentender lo que es la convivencia de los seres humanos. Quiero hacer un nfasis especial en las palabras: 'recreamos', 'repensar' y 'reentender', con el nimo de llamar la atencin sobre el doble acto o reiteracin que implica la preposicin re-. No se trata tanto de la repeticin de un acto determinado -pensar dos veces, por ejemplo-, como de un actuar reflexivo que, en consecuencia, es crtico. El pensamiento tico implica un movimiento reflexivo, una crtica constante que no puede perder de vista la poca o estado de cosas en el cual se encuentra inmerso, y la necesidad de hacer valoraciones. Es por ello que podemos examinar primero, as sea de un modo muy general, la problemtica actual en tomo a la moralidad diaria. Para ello, considero pertinente mencionar uno de los problemas ms difciles de la filosofa moral, como lo es el de la articulacin entre la teora y la prctica, es decir, el alcance que puedan o no tener las reglas morales en las decisiones en pro o en contra de una accin en una situacin particular.

75

La Salud PbUca Hoy

n . Dilemas ticos El profesor Garret Thompson, de la Universidad de Wooster, en su artculo Problemas y dilemas ticos (Thompson, 1997J, se refiere a este problema, articulndolo, claro est, desde una perspectiva filosfica. Pero antes de entrar a examinar esta postura, quiero hacer una aclaracin en tomo a las nociones que en ella se tratan. Etimolgicamente, la palabra dilema (di=dos -lema=premisa) significa un argumento entre dos principios que generalmente se contradicen o son contrarios -negados o concedidos, cualquiera de los dos-, demostrando as lo que se intenta probar (Diccionario filosflco). Dilemas ticos, por su parte, son situaciones que involucran proposiciones o afirmaciones sobre principios o derechos en conflicto. En tanto que exige un anhsis decidir qu hacer para actuar correctamente, se requieren elementos de la teora tica ante una determinada situacin presentada. Se requiere, adems, identificar, en primer lugar, si se trata de un dilema tico, es decir, si se hace una valoracin usando la racionalidad. Cabe anotar que, en salud, se ha comenzado, hoy da, con la estmcturacin de mecanismos para analizar los dilemas ticos. As pues, para el profesor Garret Thompson, el problema del alcance que puedan o no tener las reglas morales en las decisiones en pro o en contra de una accin en una situacin particular tiene su origen en "el hecho de que hay un conflicto entre dos elementos de lo que podra llamarse la tica en la cotidianidad: el kantiano y el utilitarista" (Thompson, 1997, p. 21). Para aclarar esto, debemos decir que una teora de tipo utilitarista defiende que una accin es correcta en tanto que tiene como resultado aumentar -nunca disminuh- la felicidad o la utilidad general. La teora kantiana, en cambio, dice que una accin est correcta si la voluntad del individuo es movida por el imperativo categrico, a saber, por el principio de tratar siempre a otras personas como fmes y nunca meramente como medios. Garret Thompson presenta tambin dos de las diferencias ms pertinentes entre los dos tipos de categoras: 1. Por un lado, el utihtarismo es consecuencialista; es decir lo que cuenta moralmente son meramente los efectos de nuestras acciones. No importa directamente cmo se producen los resultados. Mientras que en la

76

Problemas bioticos y dilemas ticos contemporneos en salud

teora kantiana lo que es relevante moralmente es la intencin con la cual la accin est hecha y los resultados de una accin son relevantes nicamente en cuanto ellos definen la intencin con la cual la accin fue hecha. 2. Por otro lado, el utilitarismo acierta en que la felicidad o utilidad es el nico valor intrnseco. Se acepta que hay otros valores, como la autonoma, la justicia retributiva y distributiva, pero esos son valores solamente en cuanto promueven ms utihdad, es dech, son valores instmmentales. La teora kantiana, por su parte, acierta en que la autonoma y la justicia retributiva son tambin valores intrnsecos, pero dice que la felicidad debe ser merecida y que nuestras acciones, en sus orgenes intencionales, deben respetar el hecho de que las personas tienen una voluntad libre. Tendramos entonces que, en un sentido muy general, el utilitarismo propende por algo as como 'el fin justifica los medios', mientras que el kantismo se aferra a la nocin del deber que motiva una determinada accin. As pues, los dos tipos de teoras estn en conflicto y no se trata tanto de determinar cul de los dos sea mejor que el otro, ya que no hay necesariamente una nica manera de analizar los hechos, como de extraer lo que de cada tipo de teora es til para el examen de las diversas situaciones. En cada situacin particular se ha de analizar el caso que representa cada una de las personas implicadas junto con los valores o principios, los deberes o derechos y las circunstancias mismas que rodean la situacin especfica a tratar. Esto no implica entrar a desbordar en un relativismo tico, sino que es aqu en donde se aprecia mejor que las decisiones no deben guardar esperanza en tener reglas morales que van a decidir por nosotros, puesto que las reglas nos sirven de gua pero no pueden dictamos la solucin. El examen de esta complejidad es el trabajo de los comits de tica y requiere de nosotros el tomar todos los puntos de vista y considerar todos los posibles criterios; teniendo en cuenta, para nuestro caso particular como lo es el del problema de la salud, tres principio ticos fundamentales en salud, a saber: la autonorm'a, la beneficencia y la justicia. Como concluye el profesor Thompson, "las reglas conclusivas son demasiado fuertes y las reglas no conclusivas son demasiado dbiles para encasillar la gua de la moralidad" (Thompson, 1997, p. 31). Todo esto nos muestra que la comprensin moral no consiste nicamente en conocer reglas fijas

77

La Salud Pblica Hoy

porque su contenido es esencialmente abierto. Por eho, entraremos ahora a examinar detenidamente la problemtica en salud tanto a nivel global o intemacional como especfico o nacional. La complejidad del tema exige que este tipo de situaciones sea mirado de manera interdisciplinaria y para ello se han hecho diferentes propuestas para analizar este tipo de casos que, se podran sintetizar de la siguiente manera: , 1. Recopilar y evaluar hechos. 2. Identificar si se trata de un dilema tico, es decir, cul es realmente el conflicto y qu prioridades se deben establecer. 3. Considerar los cursos de accin altemos. 4. Considerar y decidir cmo llevar a cabo los mecanismos de accin y su respectivo seguimiento. III. Problemas bioticos Es muy grato, al revisar el programa como el que propone este tipo de ctedras que apuntan a la constmccin y a la solucin de problemas reales que vive el pas, hacerse partcipe de quienes intentan abordar estas temticas. Pienso que, mediante un atento examen de los temas propuestos en cada sesin, podramos elucidar que los problemas bioticos en el rea de la salud se enmarcan principalmente en las dificultades cotidianas para las personas que en este sector laboral operan. Para el tratamiento de este tema es necesario revisar las conclusiones del len Congreso Nacional por la Salud, realizado en Bogot en octubre de 2001 en la Universidad Nacional de Colombia, y los materiales preliminares de dicho documento. De all, son dignos de destacar los: A. Principales problemas bioticos de la salud en Colombia 1. Problemas de la situacin de salud ' - Exclusin persistente de poblaciones vulnerables, - Mltiples violencias, - Problemas de salud pblica antes controlados. 2. Problemas del sistema de seguridad social en salud

78

Problemas bioticos y dilemas ticos contemporneos en salud

- En lo financiero: bajas del aseguramiento y dificultad en el acceso a los servicios; concentracin y apropiacin de los recursos por intermediarios financieros EPS y ARS; quiebra progresiva de los hospitales pbhcos; dificultad para pagar los servicios prestados por los hospitales pblicos por parte de los entes gubemamentales; laxitud de los organismos de control del sistema a favor de los intermedios financieros. - En cuanto a la prestacin de servicios en s: persistencia de planes de beneficio desiguales segn capacidad de pago; el escaso acceso a los medicamentos y a otros medios de atencin; la exclusin o desvinculacin del sistema de gmpos vulnerables de la poblacin de bajos ingresos; incremento de enfermedades evitables y mortahdad prematura. - En cuanto al personal y la prctica profesional: deterioro de la calidad de trabajo y de la atencin; sujecin de la autonoma de la prctica profesional a los imperativos de productividad y control de costos; exclusin de prcticas de salud no accidentales; cada y debilitamiento de la prevencin de enfermedades; escasa prevencin y atencin de la salud de los trabajadores. - En cuanto a prevencin de la enfermedad y promocin de la salud: debilidad en la promocin de la salud; deterioro de las condiciones sanitarias y ambientales; deterioro de la salud sexual y pro-creativa; y el derecho a la igualdad de las mujeres (Torres, 2001 p. 11/15) Todo lo anterior coloca al trabajador de la salud (cualquiera que sea su ubicacin en el sistema) ante dilemas ticos muy complejos que indudablemente requieren la revisin del actual sistema de salud y la participacin de un equipo interdisciplinario en el diseo de una pronta solucin. B. Prncipales problemas bioticos de la salud en Latinoamrca El doctor Mario Hernndez, en su artculo. La Biotica un Espacio Transdisciplinario, plantea como problemas bioticos en Latinoamrica: a. b. c. Los problemas profesionales, Problemas especficos: '' . Alfa o problemas del comienzo de la vida, Beta o problemas intermedios (por ejemplo, dilisis), Omega o problemas del final de la vida, Problemas generales: desarrollo sostenible.

79

La Salud Pblica Hoy

El doctor Hemndez, hace un nfasis especial en que los problemas bioticos son dilemas en cuanto dan la posibilidad de diversas opciones en su resolucin. Esto imphca reconocer distintos caminos, moralmente justificables y en conflicto entre s, para llegar a una solucin. En la clnica, teniendo en cuenta el avance de la ciencia y la tecnologa de punta que continuamente influye en las instituciones, generan en cada persona implicada una alta angustia moral que vara segn el tipo de institucin. As, por ejemplo, en una institucin en donde existen los recursos suficientes, se presenta el caso del mdico que reconoce a un paciente en cuadro irreversible neurolgicamente y debe considerar la posibilidad de retirar o no el respirador. En tal situacin: qu siente el paciente?, qu piensa la famiha? An peor sucede en otro tipo de institucin, como es ya frecuente en las del sector estatal, cuando el dilema se da por falta de los instrumentos necesarios o suficientes: Un doctor ante la situacin de dos recin nacidos que requieren respirador, pero solo existe una mquina: a cul de los dos nios se la coloca?, qu se hace con el otro nio? En otro contexto, y bajo las condiciones del actual sistema de salud, los dilemas surgen cuando hay desacuerdos entre la norma, la ley, las obligaciones o responsabilidades entre s y la accin requerida en una determinada situacin; algunas acciones de emergencia no pueden ser cumplidas en su totahdad debido a problemas burocrticos o de conducto regular. La atencin en salud presenta tambin innumerables dilemas, en gran parte y aunque parezca evidente, porque se trata del cuidado de la vida de los seres humanos. Algunas veces, por el propsito de preservar la vida, se presenta un conflicto entre valores en casos como respetar el deseo del paciente aliviando su sufrimiento, mantener la solvencia econmica o asegurar un igual acceso de toda la comunidad a la prestacin de servicios de salud.
')'
,

En otros casos: cundo se puede ordenar o cumplir la orden de no reanimar al paciente?, hasta dnde se debe llegar con lo que se denominan medidas extraordinarias? Estas y otras inquietudes requieren un profundo anhsis desde la tcnica, lo tico y lo legal. ' , ;'. En el rea administrativa tambin la disyuntiva es grande, debido al condicionamiento que, a partir de la aplicacin de la ley 100/93 y, en general, de las contradicciones que se presentan entre el marco legal vigente y la

80

Problemas bioticos y dilemas ticos contemporneos en salud

misma constimcin poltica de 1991 que propende por derechos individuales y deja de lado los derechos colectivos, a pesar de que en la presentacin de dicha ley se enuncian unos principios que son ms bien generales, pues difcihnente se podran abordar desde la tica. C. En el plano intemacional Presentar a continuacin una sntesis del documento elaborado por la profesora Mery Constanza Garca, profesora de la Facultad de Enfermera de la Universidad Nacional, sobre el XVII Congreso Mundial de Promocin de la Salud y Educacin en Salud (realizado en Pars, julio 15 al 20 de 2001). Durante la semana del 5 al 10 de julio en la ciudad de Pars, la UIPES^ y el CFES^, organizaron la XVII Conferencia Mundial de Promocin de la Salud y Educacin para la Salud. A ella asistieron aproximadamente 2000 personas provenientes de 167 pases de todos los continentes. Amrica Latina estuvo presente con la participacin de Panam, Venezuela, Colombia, Brasil, Per, Ecuador, Chile y Argentina. El Congreso fue convocado con el lema: "La Salud una Inversin ms Justa". En tomo a esta idea se profundiz en cuatro temas centrales, los cuales se establecieron en las sesiones plenarias y en los debates, ellos son: 1. 2. 3. 4. La dimensin tica en la promocin de la salud. Defensa pblica de la salud. Consolidacin de ahanzas. Pmebas de eficacia y evidencias en promocin de la salud.

a) La dimensin tica en la salud Pese a que el tema de la tica en salud pblica es muy amplio y controvertido, se examinaron las siguientes ideas y reflexiones:

UIPES: Unin Internacional de Promocin de la Salud y Educacin.Creada en Pars en 1951; se trata de una organizacin mundial no gubernamental, cuya misin es promover la salud mundial. Colabora con la OMES, la UNESCO y la UNICEF CFES: Comit Francs de Educacin para la Salud.

81

La Salud PbUca Hoy

La problemtica de la moral que ejercen los estados en su ejercicio de proteccin de la salud pblica. LoseEstados, a nombre de la salud pblica, crean estrategias que se caracterizan por imposiciones o prohibiciones que hacen a los ciudadanos, generando en ellos culpas y penalizaciones. Un ejemplo claro de eho es la prohibicin de fumar en sitios pblicos y la sancin correspondiente en caso de violacin. El anlisis gir en tomo a dos interrogantes: * Acaso estas polticas y estrategias no rien con los principios de libertad y de autonoma de los ciudadanos? : ' * Los estados tienen una doble moral cuando, al tiempo que prohiben el tabaco, estn financiando la salud con recursos provenientes de empresas tabacaleras y licoreras? La reflexin dej entrever que los estados han ejercido y ejercen autoritarismo en nombre de la salud pblica y que ello -puesto en trminos de moral- induce a estimular la formacin de ciudadanos heternomos. La televisin, la radio, el peridico, los afiches y dems medios de comunicacin, son los mecanismos predilectos del Estado para lograr transmitir este tipo de mensajes: como si los ciudadanos fueran menores de edad. El Estado tambin fue cuestionado en cuanto a su papel en el manejo de los organismos nacionales e intemadonales de salud y de las empresas e industrias que son causantes de alterai" la salud de los ciudadanos. Esta cuestin se present teniendo en cuenta las situaciones en las que el Estado tiene que tomar una decisin entre defender la salud de los ciudadanos y colectivos y, por el contrario, beneficiar las industrias y grandes empresas que atentan contra la salud, en procura de una mejor economa. Aqu se presentaron varios casos en los cuales hubo demandas de ciudadanos contra grandes empresas por el dao que ellas causaron a su salud. Las empresas actuaron presionando al Estado para eliminar las barreras y normas de proteccin a la salud que afectaban sus intereses. Se demostr as que el Estado tiende a favorecer a las empresas e industrias, porque stas -por una u otra razn- tienen mayor poder sobre el mismo, obviamente econmico. Uno de los puntos ms recurrentes fue la denuncia de que los estados y organizaciones sanitarias no cumplen un papel de proteccin a la comunidad y que esta tendencia es ms grave en pases no desarrollados.

82

Problemas bioticos y dilemas ticos contemporneos en salud

Como propuestas finales podemos destacar las siguientes: - El principio de proteccin de salud pblica que le compete al Estado, a las organizaciones, a las empresas y al comportamiento de los ciudadanos, debe entenderse y asociarse con el de responsabilidad y, por ende, con el de solidaridad. - El Estado es altamente responsable de las polticas pblicas de proteccin de la salud pblica de sus ciudadanos y colectivos, por eso debe asumir su papel y no dejarlo al sector privado. - La poltica de Estado debe cambiar su mmbo dejando de ser tan impositiva y, en su lugar, buscar la generacin de solidaridad colectiva y compartida. - El papel de la educacin en salud debe procurar que los ciudadanos tengan un alto nivel de informacin y formacin. b) Los derechos humanos y los derechos colectivos como componentes esenciales en la salud Otro componente que se trat en el tema de la tica fue el relacionado con los derechos humanos individuales y colectivos. Trabajar tica en salud, exige abordar el tema de la defensa y proteccin de los derechos humanos, los cuales cada da estn siendo ms vulnerados. Esta reflexin condujo a mostrar la necesidad de incluir temas y prcticas de salud relacionados con la proteccin de los derechos humanos. Se resalt la importancia de incluir temas afines con los derechos humanos en la formacin del recurso humano en salud. Otro anlisis fue diferenciar el papel que juega el Estado frente a los derechos individuales y colectivos en la salud. c) Las reformas de los sistemas de salud y la privatizacin de la salud

Aqu se observ que las reformas de salud que se han promovido en Amrica Latina y en frica estn basadas en los componentes exclusivamente polticos y econmicos, dejando de lado las dems condiciones de las comunidades. El cambio esencial se da a partir de la concepcin de la salud que pasa a ser considerada como un bien de consumo -una mercanca-,

83

La Salud PbUca Hoy

subordinando as la salud como bien fundamental. De esta manera, los principios de libertad, igualdad y solidaridad, universalidad y autonoma que pregonan las reformas resultan altamente contradictorios. Otro elemento de anlisis hizo referencia a las reformas privatizantes de los sistemas de salud en cuanto a derechos individuales y colectivos y en cuanto al papel del Estado. Las reformas de la salud que se estn imponiendo han creado y reforzado los sistemas de aseguramiento, los cuales indican que la poltica pblica se ha encargado de privilegiar la proteccin individual en desmedro de la salud pblica, en cuanto a la proteccin de los derechos colectivos. Por supuesto, esta posicin merece un anlisis tico del comportamiento del Estado. As pues, la responsabilidad del Estado se relaciona con las polticas pblicas y la salud pbhca debe ser una pohtica que se encargue de la proteccin de la salud de los colectivos, constituyndose as como su principal responsabilidad. Bajo esta concepcin se analiza la tica de los estados, y se plantea el debate alrededor de: Cul es la responsabihdad tica del Estado en las polticas pblicas, de la salud pblica, en las reformas de privatizacin de la salud? - Cul es la responsabilidad del Estado y de los ciudadanos en la financiacin de la salud? - Quines se estn beneficiando y a quin se protege con estos nuevos modelos de reformas de la salud?, las entidades privadas?, la poblacin? De esta manera, el debate y la reflexin quedan finalmente planteados en los siguientes trminos: Se debe imponer una nueva tica de la responsabilidad de los estados en las polticas pbhcas de salud que promulgan la privatizacin. Una observacin especial . .; i

No quisiera terminar sin antes llamar la atencin sobre los problemas que se presentan a quienes hoy da estn dedicados a la formacin de los profesionales de la salud. All, ante el panorama presentado, los dilemas son

84

Problemas bioticos y dilemas ticos contemporneos en salud

complejos. Se comienza con la cuestin acerca de qu ensear, cmo no ilustrar a los futuros profesionales sobre la situacin actual del sector salud y del sector educacin; y se hace conciencia tambin acerca de cmo seguir el juego de las propuestas econmicas que no han resultado en el resto del mundo. En aras de la funcionalidad y de la productividad, como parte del modelo del actual sistema, se ubica a los terapeutas ante dilemas ticos relacionados con la justicia en la prestacin de servicios. El estudiante del rea de la salud que conoce su quehacer y el cmo debe ser, se enfrenta ante su paciente a quien sabe qu tipo de tratamiento necesita y qu materiales debe usar, pero el rgimen no cubre su necesidad ni el paciente tiene poder adquisitivo, entonces desde el punto de vista tico qu puede determinar el estudiante? cmo afrontar esto desde la academia? Es claro que a pesar de que en la mayora de las facultades o escuelas de ciencias de la salud, no se ha dado el espacio requerido para el estudio de la tica y la biotica, en la formacin de los profesionales si es un tema que debe ser componente bsico en la presentacin del anlisis de casos, as como en todas y cada unas de las investigaciones que se reahzan en pregrado y posgrado. Definitivamente la biotica no tiene las respuestas a todos lo interrogantes o dilemas planteados, es decir no estamos hablando de la tica como panacea, solo se pretende insistir de una manera didctica en la necesidad de reflexionar, analizar y valorar los campos profesionales en la vida cotidiana.

85

La Salud PbUca Hoy

Referencias bibliogrficas GARCA, M.C. Informe XVII Congreso Mundial de Promocin de la Salud y Educacin en Salud. (Artculo indito). Pars : junio 15 a 20 de 2001. HERNNDEZ, M. Biotica: un espacio transdisciplinario. En : Memorias Ctedra Manuel Anczar: tica y Biotica. (En prensa) Bogot : Universidad Nacional de Colombia, 2002. ROSS, W. J. Manual para comits de tica de hospitales. U.S.A.: American Hospital Pubhshing, 1986. THOMPSON, G. Problemas y dilemas ticos. En : Revista Ideas y Valores No. 103. Bogot : Departamento de Filosofa, Universidad Nacional de Colombia, abril 1997. TORRES, M. (Editor) Primer Congreso Nacional por la Salud (octubre 3 al 6 de 2001) Conclusiones generales. Bogot : Universidad Nacional de Colombia y otras instituciones organizadoras, 2001.

86

Dilemas ticos contemporneos en salud


JAIME ESCOBAR TRLVNA

El desbordamiento de la tradicional tica hipocrtica por las situaciones planteadas a raz de los avances de la biomedicina propici el surgimiento de la biotica como manera de enfrentar los difciles dilemas ticos no previstos e imposibles de asumir por la tica mdica tradicional. A esto se unieron otros cambios como: la concepcin misma del Estado modemo, la crisis ecolgica, los derechos humanos y civiles, la emergencia del paciente como sujeto moral con derechos, el poder mdico y el triunfo de la biologa como ciencia que contribuyeron a acreditar hacia el final del siglo XX la aparicin y rpida expansin de la biotica como tica por la vida: comprensiva de todas las ticas, con aplicaciones prcticas como lo es la misma medicina, y como medio de explicar y al mismo tiempo ayudar a solucionar en parte la crisis de las profesiones clsicas como la medicina, el derecho, la poltica y la religin cuya fuerte formacin moral o deontolgica las diferenciaba de los oficios. En relacin con la salud, podemos sealar a grandes rasgos dos campos de accin de la Biotica, la chuica y la salud pblica. Estrechamente hgada a ambas e imprescindible como creadora de hechos de reflexin moral est la investigacin en seres humanos y en otros seres vivientes con fines de aplicacin en la biomedicina.

89

La Salud PbUca Hoy

Tres reas de conflictos bioticos Clnica: prctica mdica Salud pblica: Sistema social (justicia sanitaria) Investigacin: justificacin tica de los proyectos

Biotica clnica: Comprende lo relacionado con muchos elementos de la prctica mdica actual como la tica en los confines de la vida, nacimiento y final de la vida. Dolor y sufrimiento humano, informacin al paciente y a la familia: confidencialidad, veracidad, confianza. Medicina reproductiva, anticoncepcin, tcnica de fertilizacin asistida; aborto; problemas del cuidado intensivo, rdenes de no resucitacin, suspensin de tratamientos; transplantes, muerte cerebral, donacin de rganos; SIDA; drogadiccin; violencia, maltrato a menores, tortura. Todos estos grandes temas comprometen de diversa forma la actuacin de los profesionales de la salud y deben ser objeto de discusin amplia basndose especialmente en los principios Bioticos de beneficencia, autonoma, no-maleficencia y justicia. Para la toma de decisiones en la prctica se establecen procedimientos que ayudan a precisar las ms aconsejables teniendo en cuenta los principios mencionados: beneficencia como principio rector de la prctica mdica; autonoma, el paciente como sujeto moral (usuario con derechos); nomaleficencia principio de la tica hipocrtica representada por el mdico, y justicia, que representa la sociedad. Figura ^ . i r i g u r a 2.1 Procedimientos para la toma de decisiones en la prctica
Paciente (autonomfa) Principios de la Biotica Be neficenci a*

Mdico ^r (Nomaleflcencia> x

^^ X

Sociedad (Justicia)

90

Dilemas ticos contemporneos en salud

Las prioridades resultantes son: el consentimiento informado; la proporcionalidad de los tratamientos; la metodologa en la toma de decisiones en tica clnica; las virtudes en las profesiones de la salud; la objecin de conciencia del profesional de la salud ante situaciones complejas; la asignacin de recursos como conflicto entre necesidades del paciente y la comunidad. Los comits de tica hospitalaria juegan aqu un importante papel de asesoramiento en la toma de decisiones y coadyuvan a la resolucin de los conflictos. Se advierte que no son decisorios ni impositivos, son consultivos y no deben estar compuestos slo por profesionales de la salud sino adems por filsofos, juristas, bioeticistas, telogos y representantes de la comunidad. Biotica y salud pblica: Puede un economista asumir el Juramento Hipocrtico? pregunta P. Menzel en Strong Medicine, The Ethical Rationing of Heath Care. (Oxford University Press N. York 1990. Pg. 19.) La tica y la economa no viven de espaldas la una de la otra, pertenecen a un mismo terreno. Para Amartya Sen la divisin entre tica y economa ha empobrecido a la ciencia econmica. Desde Aristteles la economa era una ciencia ntegra y subordinada moralmente al bien comn y si era amable hacer el bien a uno solo, era ms bello y divino hacerlo al pueblo y a los ciudadanos. El derecho a la asistencia en salud reclama la disponibilidad de recursos y la accin del Estado que es interferida principalmente por los costos de la atencin, debidos a la tecnologa mdica y el mejoramiento de la calidad de los bienes y los servicios mdicos. En Colombia se pretendi subsanar las deficiencias e inequidades atribuidas al sistema nacional de salud vigente hasta 1993, con la ley 100 de Seguridad Social cuya intencin era lograr una adecuada administracin de los recursos destinados a la atencin de la salud. Infortunadamente, el resultado hasta hoy no ha sido el esperado y el enfoque exclusivamente utihtarista, con criterio de eficiencia, de costo-beneficio, entre otros, ha llevado a un desastroso panorama a la atencin de la salud en el pas.

91

La Salud PbUca Hoy

Adems de las anteriores implicaciones bioticas de la Ley 100 de Seguridad Social, se sealan observaciones relacionadas con la total ausencia de consideraciones educativas para la formacin de profesionales en un sistema que no admite ni reconoce la importancia de su formacin; por el contrario, se la demerita al enfocar la calidad de la atencin slo relacionada con que sea correcto lo tcnico-instmmental, medible si se quiere, pero que desconoce la adecuada tica del acto mdico que se realiza. Prima el criterio de eficiencia costo-beneficio y no prev las consecuencias educativas inherentes de la atencin de la salud y de la prctica mdica, necesarias para la formacin profesional. Se propende por elaborar primero la factura y luego la frmula mdica del profesional que pasa a un segundo plano, sin consideracin por el paciente. Salud y enfermedad, justicia sanitaria
.: , - 1 , i.' . .1 '

El proceso salud-enfermedad no se define fuera del individuo, es una representacin social, una constmccin, una estmctura simblica a la que se le atribuye sentido como resultado de la interaccin individuo-sociedad. Todos los planteamientos de justicia sanitaria, un captulo propio de la macrobiotica, se comprenden dentro de la pregunta trascendental por la salud. El Estado tiene responsabihdades polticas y tico-sanitarias vistas desde la filosofa y las ciencias sociales. De otra parte, la salud no es nica ni principalmente humana, sino que, por el contrario, es un concepto "holstico" o sistmico, un concepto complejo. Asistimos a una poca de un enorme mercado de salud con un gran podero econmico de la industria farmacutica, que abarca tambin polticas investigativas y cientficas, poder psicolgico sobre la poblacin y poder poltico. La salud, en la sociedad contempornea, hedonista, de consumo, es uno de los tantos objetos satisfactorios subordinados a la demanda del mercado; esto se hace explcito en la concepcin neoliberal de la profesin mdica, al medicalizar la salud hacia la perspectiva curativa. Pero cuando se solicitan mayores presupuestos en atencin de salud, ese incremento puede ir en detrimento de otros bienes como son la educacin.

92

Dilemas ticos ccmtemporneos en salud

la vivienda o la citura. El modelo de justicia social de desarrollo, prevalente en Amrica Latina, no es diferente a muchas partes del mundo. Sin embargo, existen dos tipos de inequidades: las inequidades en salud y las inequidades en el acceso a los servicios y, dentro de stos, las inequidades en acceso a servicios de calidad. Los costos de la tecnologa, cada vez ms edtos, son un desafo para lograr el acceso a ella; su utilizacin en sociedades con marcadas desigualdades, plantea un debate biotco en relacin, especialmente, con el principio de justicia distributiva. Qu es un sistema justo de salud? qu responsabihdades en cuanto a la equidad tienen los planificadores pohticos y sobre qu criterios ticos se toman las decisiones para la asignacin de recursos? La calidad de la atencin tiene que ver con dos vertientes: la tctca-cientfica y la interpersonal. La calidad no es obligacin sino una actitud y, por otra parte, la calidad se dar cuando el usuario la sienta, por lo cual, la calidad as descrita depende de todos y de cada uno de los miembros del equipo de salud. En la Ley 100 colombiana se introducen algunos elementos en la estmcmra del sistema de salud, incluyendo varias instancias de coordinacin, gestin y control que buscan la participacin activa de mltiples actores. Una de las hmitaciones del modelo es la introduccin de planes diversos, como el rgimen contributivo de los empleados o el rgimen subsidiado para acceder al servicio por ser el beneficiario de un subsidio. La crtica aqu se centra sobre la discriminacin que la propia ley plantea. Si dichos beneficios tutelados no estaban contemplados inicialmente en los planes de beneficios sealados expresamente en la ley, se supone que dichas limitaciones de los planes se atienen a las posibilidades financieras. Adems, los compromisos del Estado relacionados con las condiciones iniciales de financiacin, son incumplidos o modificados, como en el caso de la contribucin estatal a la financiacin de la subcuenta de solidaridad, modificada por la Ley 344 que disminuye dicha participacin. Otros muchos interrogantes bioticos surgen respecto a la Ley 100 de seguridad social. Corresponde a los gestores polticos preguntarse si el excesivo

93

La Salud PbUca Hoy

nfasis en los indicadores, en la definicin de tiempo, en la preocupacin por la cobertura (pero no por el acceso) o en los flujos de los recursos, ha puesto en riesgo la calidad global del sistema. Dilemas ticos La biotica, se pronostica como la tica civil del siglo XXI y ser una tica de mnimos, de acuerdo con ciertos principios adoptados por toda la sociedad. La justicia sanitaria es el tema que genera mayor demanda de conocimiento en Amrica Latina y desde luego en Colombia. As se expresa en todas las jomadas y eventos que tratan el tema. Surgen problemas ticos en la atencin, pues debe tenerse en cuenta que el mdico ya no est solo con el paciente en la consulta, hay terceros que se involucran, como los seguros privados o pblicos, y las instituciones privadas. La reflexin filosfica y moral sobre la medicina, su ejercicio y sus fines, a travs de la biotica ha reconfigurado en muchos aspectos, la prctica mdica. Al hablar de justicia sanitaria, se parte del supuesto bsico de que existe un derecho a la asistencia sanitaria consagrada por ley. Pero esta sola consagracin legal no garantiza la materializacin del derecho. De all surge que deba pensarse en los hmites justos de ese derecho. Debido a los cada vez ms altos costos, el cuidado de la salud se entiende como un deber de la poblacin. Sin embargo, puede considerarse en el mbito de la justicia sanitaria, como un derecho, entendido como el derecho de toda la poblacin de acceder a los servicios de salud y a la proteccin que a eUa debe dar el estado.
't

Sin embargo, el mejoramiento de la salud de la poblacin depende fundamentalmente de factores diferentes a la atencin sanitaria. Medio ambiente, alimentacin, vivienda, educacin y promocin sanitaria, son factores para ese mejoramiento de la salud. El enfoque monocausal de la enfermedad, sobre lo biolgico (modelo biomdico), excluye otros rdenes que constimyen a la persona y que tambin se alteran por la enfermedad. Excluye toda actitud bolista y genera los conflictos que vive la medicina orientada hacia esa desviacin epistemolgica.

94

Dilemas ticos contemporneos en salud

El derecho a la asistencia sanitaria es un derecho positivo, a diferencia de los derechos de primera generacin, civiles y polticos, considerados negativos (que exigen que algo no debe ser hecho contra nuestra integridad fsica, nuestra libertad, nuestra vida y nuestra propiedad) Los derechos humanos de primera generacin son derechos de naturaleza moral y no creaciones del derecho positivo. Corresponden a los previstos en la carta de los Derechos Humanos de la Revolucin Francesa de 1789. Los derechos positivos demandan que un tercero reahce acciones. Como derechos tienen tambin una correspondiente obligacin. El derecho a la asistencia en salud reclama una disponibihdad de recursos y accin del Estado que se ve interferida por los costos de salud, determinados principalmente por la tecnologa mdica y el mejoramiento de la calidad de los bienes y servicios mdicos. Se enfrentan as: Derecho bsico a la asistencia sanitaria vs. Costos de la tecnologa mdica y hmitacin de recursos. La justicia es uno de los principios ms polmicos de la biotica. Tiene relacin con la poltica sanitaria y la distribucin de los recursos para la atencin en un sistema de salud que busca ser justo. Se deben tener en cuenta dos niveles distintos: uno deontolgico, o de los principios y otro teleolgico o de las consecuencias. Las personas experimentan un desequilibrio entre la enfermedad y la salud como si fuera una injusticia particular, como si la naturaleza no hubiera guardado el equilibrio, que debe ser restablecido por la medicina. Esto es justicia como equilibrio y, as, curar a alguien es curar a la sociedad. El otro nivel, teleolgico, es el de las consecuencias de los actos y tiene que ver con la adecuada distribucin de los recursos para la atencin de la salud; esto es cuantificable matemticamente en economa. La discusin hoy tiene que ver con los derechos humanos y la proteccin de la salud como uno de ellos.

95

La Salud PbUca Hoy

Tabla 2.1
T r e s G e n e r a c i o n e s de Derechos H u m a n o s .

Derechos H u m a n o s

Valor Normal Gua Vida Integridad Fisica- salud Libertad Propiedad

Modelo de Estado

Primera Generacin:

Civiles y Politices

Estado de Derecho

<

Segunda Generacin:

Asistencia a la Igualdad

Estado Social Sociales y Salud de Derecho

^ Econmicos, culturales

Tercera Generacin: L Paz y Medio Ambiente

Solidaridad

Estados Solidarios entre s

La asignacin de recursos para la salud en una sociedad constituye un gran desafo para los estados y los gobiemos y es una decisin poltica. El conflicto se da entre el derecho bsico a la asistencia sanitaria y la proteccin de la salud y los costos de la tecnologa biomdica, de una parte, y la limitacin de recursos de otra. Los recursos son limitados y las necesidades son muchas. Cmo lograr una distribucin equitativa? Derecho bsico a la asistencia sanitaria vs Costos de la tecnologa biomdica y limitacin de recursos -

. ,,'<

La distribucin de los recursos en un sistema de salud se presta para manipulaciones demaggicas y para interpretaciones estadsticas. Aqu surge lo que se ha denominado "vidas estadsticas" cuando se manejan grandes masas de poblacin, que framente se muestran en las cifras. Sin embargo, saber la vida de una persona conocida, o mostrarla en fotografas por los medios de comunicacin, con nombre propio impresiona mucho ms. Es el sndrome del minero atrapado.

96

Dilemas ticos contemporneos en salud

Una segunda fase se destina a una valoracin preliminar de la eficacia teraputica; un paso siguiente comprende el estudio comparativo con un gmpo, control simultneo y, por ltimo, la investigacin en poblaciones amplias. Es necesario presentar cada paso a un comit de tica responsable de aprobacin del protocolo de acuerdo a los objetivos propuestos. Los comits deben velar por la proteccin del paciente frente a los intereses econmicos u otros de los proponentes, teniendo en cuenta la dignidad de los sujetos de investigacin (seres vivos ) quienes tienen dignidad y se les debe proporcionar el mximo beneficio y respetar su libertad de decisin. Requisito tico es que el ensayo clnico proporcione una respuesta sin ambigedad a lo que se plantea. El comit debe, adems, debatir en forma detallada cada protocolo y seguir las exigencias relacionadas con los controles, el uso de placebos, los estudios doble ciego, la aleatorizacin, el tamao de los gmpos, parmetros de eficacia, anlisis estadstico y expresin de resultados. Se deben considerar los dilemas ticos en relacin con un ensayo cuando se sabe que el nuevo producto tiene pocas probabilidades de marcar una diferencia respecto al frmaco original. Esto porque hay inters de competir econmicamente en el mercado, son los ensayos "me too", Por qu exponer a los pacientes a este frmaco "nuevo" si no hay pmeba de un mayor beneficio? Tambin se presiona por parte de los interesados econmicamente en reahzar estudios con un nmero bajo de pacientes. Cuando, por el contrario, se realizan mega-ensayos puede producirse distorsin de la informacin si no se consideran todas la variables. Las empresas farmacuticas pueden tener el poder de controlar la medicina, a los mdicos y a los consumidores, ya que el enfoque biomdico (monocausal) de la enfermedad y la tendencia neoliberal de la economa es el contexto en que vivimos. Para fomentar la investigacin cientfica se hace necesario tanto una formacin y una pericia cientfica, como tambin una instmccin similar para comprender y abordar los dilemas ticos que surgen en el proceso. Esto se evidencia hoy ms con la emergencia de las ciencias de la vida y de la complejidad en que los debates sobre las diferencias deben tener un carcter intelectual abierto para la toma racional de decisiones ticas.

101

La Salud PbUca Hoy

Investigacin en salud pblica: En salud pblica el principio rector es la justicia que debe propender por una poltica equilibrada en cuanto a lo relacionado con la atencin primaria y la atencin terciaria, pues se observa casi siempre un sesgo a favor de esta ltima. Igualmente, se debe propender por dar oportunidades de servicio a todos los gmpos sociales. Con frecuencia los sistemas de salud pueden basarse excesivamente en el mercado y la salud slo es un producto ms. Varios elementos deben tenerse en cuenta en las polticas de salud pblica como los comits de tica, las comisiones nacionales de biotica, la asignacin de reciu'sos con enfoque tico para asegurar beneficios a toda la poblacin sin exclusiones, como se da en el caso de las "enfermedades hurfanas" del tercer mundo, fomentar la prevencin y la educacin, proteccin del medio ambiente evitando su destmccin por cultivos ihcitos y su fumigacin. ' > . . , . , Los investigadores pueden descubrir amenazas a la salud que requieren correccin y deben propugnar la proteccin y restauracin de la salud. En este evento su intercesin debe ser confiable con datos cientficos objetivos. Etica de la investigacin epidemiolgica Requiere protocolos aprobados por comits de tica. Requisitos: Con la persona (consentimiento, privacidad y proteccin de su bienestar) Con la sociedad (evitar parcialidad y conflictos de inters). Mantener la confidencialidad pblica. Con los auspiciadores econmicos y empleadores: proteger la informacin privilegiada, especificando obligaciones. Con los colegas: evitar confrontac9nes no profesionales, mtodos apropiados de informes y resultados. El genoma humano es patrimonio de la humanidad. No deben permitirse las prcticas que sean contrarias a la dignidad humana (clonacin) Toda persona debe tener acceso a los progresos de la biologa, la gentica y la medicina en materia de genoma, respetndose su dignidad y derechos. UNESCO. .

102

Dilemas ticos contemporneos en salud

Toda intervencin en el mbito de la sociedad, comprendida la investigacin, deber efectuarse dentro del respeto a las normas y obligaciones profesionales, as como a las normas de conducta aplicables en cada caso (Derechos humanos y biomedicina - Consejo de Europa) La investigacin farmacolgica en relacin con las "enfermedades hurfanas" del tercer mundo plantea dilemas ticos con respecto a la preferencia de las investigaciones por los rendimientos econmicos que de ella se derivan para pases desarrollados y el muy poco mercado para enfermedades del tercer mundo. Lo ideal para algunos es que no existan pases del tercer mundo, pero mientras tanto, hay un deber moral y un compromiso tico para investigar y poner sus resultados al servicio, a favor, de las cuatro quintas partes de la poblacin que vive en condiciones de inequidad y de pobreza.

103

La Salud PbUca Hoy

Referencias Bibliogrficas BECA, J.P. Prioridades temticas de biotica en Amrica Latina y el Caribe. Santiago : Cuadernos de Biotica No.l OPS, 1995. BENATAR, S. Etica de la investigacin en los pases en vas de desarrollo. Barcelona : Cuadernos Fundacin Vctor Grifis i Lucas No.l, 2000. BEAUCHAMP, D., STEINBOCK, B. New ethics for thepublics health. N. York : Oxford University Press, 1999. BRODY, B., The ethics ofbiomedical research an intemationalperspective. N. York : Oxford University Press, 1998. BROEKMAN, J., Biotica con rasgos jurdicos. Madrid : Dilex, 1998. BUCHANAN, D. An ethicfor health promotion. Rethinking the sources of human well-being. N. York : Oxford University Press, 2000. DE ABAJO, F. Etica de la investigacin epidemiolgica. Santiago: Cuademos de Biotica OPS, N. 3, 1996. ESCOBAR, T. J., Ley 100 de Seguridad Social: implicaciones bioticas en biotica y justicia sanitaria. Bogot: Bios y Ethos No.9, Universidad El Bosque, 1999. GARCA, F. La influencia del progreso mdico y la industria farmacutica sobre nuestra salud. Barcelona : Cuadernos Fundacin Victor Grifis i Lucas, No. 3, 2001. GARATTINI, S. Normas ticas y cientficas en los ensayos clnicos con medicamentos. Barcelona : Cuadernos Fundacin Victor Grifols i Lucas, No. 2, 2000. HALL, R.T. An introduction to health care organizational ethics. N. York : Oxford U.R 2000. HOTTOIS, G. Essais de philosophie biothique et biopolitique. Pars: Vrin, 1999.

104

Dilemas ticos contemporneos en salud

La justicia sanitaria nos lleva necesariamente a las diversas teon'as de la justicia que desde el siglo IV antes de Cristo se han debatido. En Grecia la justicia era el ajustamiento al orden natural. En el mundo modemo es lo pactado en un contrato.
. ^ -

Teoras utilitaristas (Bentham, J. Stuart Mili)

^^

Se enmarca en el consecuencialismo: qu genera una decisin moral o poltica?, importa es el bienestar que se deriva y no su adecuacin a principios morales sociales o polticos preestablecidos. Lo til se identifica con la justicia distributiva. El bienestar social depende directa y nicamente de los niveles de satisfaccin de los individuos. Justicia distributiva: Estado de Bienestar: despus de la Segunda Guerta Mundial, la asistencia social se empieza a considerar como un derecho social promovido por el Estado. En 1973 se pone en evidencia los altos costos en atencin debido principalmente a la crisis de la economa. Teora libertaria o neoliberal: Tiene una concepcin monocausal de la enfermedad centrada en el reduccionismo biolgico (F. Hayek y R. Nozick), propende por un Estado mnimo. El mercado y sus leyes como medio de lograr reparto de la riqueza no a la justicia distributiva. Niega los derechos sociales. Reconoce derechos naturales como el de propiedad, inviolables e intocables por el Estado. T. Engelhard: es el exponente destacado en su aplicacin en salud. Ch. Fried propone un mnimo decente de asistencia. Implicaciones de la teora neoliberal en salud: Reduccin de la justicia a la libertad individual. No al derecho a la atencin en salud. La sociedad no es responsable en los problemas de salud. Preferencia por seguros privados: la salud como bien de consumo y cahdad por competencia en el mercado. Mnimo decente: la atencin en salud no da derecho a la igualdad de acceso. Pero es preciso cuestionar: si muchas innovaciones tecnolgicas y mdicas se financian pblicamente, Por qu negarlas al conjunto de la poblacin?

97

La Salud PbUca Hoy

Igualitarismo liberal: Sin un mnimo suficiente de recursos materiales, no se puede conservar la hbertad individual; se basa en la teora de John Rawls de justicia con equidad. Es una visin kantiana de la autononua personal como garanta de libertad e igualdad. Plantea una sociedad bien ordenada; las personas son racionales y razonables. N. Daniel: Relaciona el principio de igualdad de oportunidades de Rawls con la equidad en la atencin en salud. Igualdad equitativa de oportunidades en el sistema de salud y distribucin segn las necesidades. "Funcionamiento tpico de la especie". Ej. La apendicitis es una enfermedad. La cimga esttica no. "No" resuelve las necesidades en salud generadas por la biotecnologa. La igualdad de recursos R. Dworkin Considera que el funcionamiento de los sistemas de salud sigue un modelo inadecuado de justicia pues tiene la salud como el ms importante bien de consumo, acceso al costo y efectividad del tratamiento. Propone un seguro mnimo (Canad, Inglaterra, Espaa) con criterio de necesidad y pmdencia. Igualdad de capacidad: Amartya Sen Las capacidades representan las mltiples combinaciones de realizaciones que las personas pueden llegar a tener. Critica a las corrientes utilitaristas (utilidad, individual) o de ingresos (PNB o el PIB). Tiene en cuenta el concepto de felicidad humana: especificidades locales y culturales y pone de presente el fracaso de planes impuestos desde pases desarrollados a los pases del tercer mundo. Todo este marco de teoras se enfrentan al llamado mercado de la salud en el que el consumidor del bien salud desconoce sus necesidades, no cuenta con deseos bien definidos y carece de buena informacin acerca de la naturaleza del bien o servicios a comprar.

98

Dilenuis ticos contemporneos en salud

En el mercado de la salud los deseos del consumidor estn mal definidos y delimitados; no existe un verdadero conocimiento de las propias necesidades; ignora la naturaleza y propiedades de los servicios; desconoce los grados de eficacia y los riesgos de los tratamientos; el mdico es quien instmye al consumidor pudindose llegar a la demanda inducida y propiciar un alto consumo dando un sesgo de la demanda de diferentes maneras. Se generan conflictos ticos en los que el mdico se enfrenta a una lealtad dividida: de un lado, como agente de la institucin en que se desempea, debe cumplir roles legales o sociales. De otra parte, est comprometido con la tica por el cuidado del paciente y con las responsabilidades sociales de su profesin. Una gua para tomar decisiones en contextos conflictivos debe tener en cuenta los que su profesin promulga; su conciencia personal; las virtudes de la profesin; las situaciones culturales o de ley y su anlisis racional tal como se realiza para la toma racional de decisiones en tica clica, y apoyarse en comits de salud o de tica. Riesgos asistenciales del mercado de la salud Procedimientos diagnsticos y teraputicos no estrictamente requeridos. Aumento de prcticas alejadas de las realidades individuales corriendo riesgos innecesarios. Tecnologizacin exagerada. ^ .: Preferencia de medicina curativa con descuido de la promocin, prevencin y, educacin en salud, de la asistencia primaria y ambulatoria, de enfermedades crnicas, catastrficas y degenerativas.

La promocin de la salud tambin plantea dilemas ticos relacionados con la iatrognesis o dao inadvertido infligido en la prctica mdica. Hay iatrogenia en tres teoras aplicadas a la promocin de intervenciones en salud: Teora social del aprendizaje, mercado social y empoderamiento de la comunidad (segn David R. Buchaiman, An Ethic for Health promotion) Teora social del aprendizaje Es la ms usada hoy. Es utilitarista y afirma que todos los valores pueden medirse en una escala nica de satisfacciones.

99

La Salud PbUca Hoy

Es antitica al dar la idea de que los valores son cualitativamente distintos e ncoimiensurables. Es una teora Skineriana. Mercado social: Est regida por el mercado comercial, con actitudes y estilos de vida consumistas. Busca cambios de comportamiento social. Problema tico: el fin justifica los medios Las mismas compaas a su cargo que "mercadean" el valium, hbrium, Tylenol con codeina y otros ms, son los encargados de la campaa "Amrica libre de drogas" -promueve el mercado por costo/beneficio-. Empoderamiento: Tener poder sobre el otro, as est de acuerdo o no. Busca a travs del poder, lograr lo que uno desea. Cuando el especialista en promocin de la salud disea estrategias de poder, devala el poder de la razn, el dilogo y la deliberacin. El empoderamiento as, engendra cinismo. El acuerdo razonable no se logra. Investigacin: problemas ticos y cientficos Toda intervencin en el mbito de la sociedad, comprendida la investigacin, deber efectuarse dentro del respeto a las normas y obligaciones profesionales, as como tambin a las normas de conducta aphcables en cada caso, teniendo presente los derechos humanos en las investigaciones biomdicas. La investigacin clnica y la investigacin experimental ha permitido la obtencin de conocimientos mdicos y nuevos frmacos. Pero estas investigaciones obligatoriamente deben seguir pasos claramente establecidos. Se debe obtener informacin con estudios preclnicos in vitro y en animales, antes de intentar su aphcacin en seres humanos, que fundamente de modo racional el posible beneficio teraputico; superado este proceso, se deben realizar lo ensayos clnicos que comprenden su uso en voluntarios sanos.

100

Dilemas ticos contemporneos en salud

MALDONADO, C Contrapuntos de investigacin. Bogot: Bios y Ethos, No. 16, Universidad El Bosque, 2001. MARCOS, A. Pensar la vida para la biotica. En : Racionalidad cientfica y racionalidad humana. Tendiendo puentes entre ciencia y sociedad. Valladolid : Universidad de Valladolid-Universidad El Bosque, 2001. MEZEL, P. Strong medicine. The ethical rationing of health care. N. York: Oxford U. Press, 1990. PELLEGRINO, E. Deber social y comphcidad moral, conflicto de lealtades para los mdicos. Santiago: Cuadernos de Biotica No.4, OPS, 1997. PERIS, X. La industria farmacutica y el progreso mdico. Barcelona : Cuadernos Fundacin Victor Grifols i Lucas No.3, 2001. RODRGUEZ DEL POZO, P. Biotica y asignacin, de recursos en salud. Santiago : Cuadernos de Biotica No.l, OPS, 1995.

105

CAPTULO III

DESAFOS DEL GENOMA HUMANO A LA SALUD PBLICA El proyecto del genoma humano
JUAN JOS YUNIS LONDOO

Qu es el genoma humano? El genoma humano es todo el contenido de ADN (acido Dexoxirribonuclico) que posee una especie. En el ser hvmiano, el ADN se locahza en el interior del ncleo de las clulas en estmcturas denominadas cromosomas. Cada cromosoma, que est constituido por ADN enroUado, contiene cientos de miles de genes as como secuencia de ADN cuya funcin an es desconocida. El ADN en cada cromosoma est formado por una doble cadena cuyo esqueleto lo costituyen azcares y fosfato, y en su interior se encuentran los cuatro nucletidos, Adenina (A), Guanina (G) Citosina (C) y Timina (T). Estos cuatro nucletidos constituyen entonces el cdigo gentico y dependiendo del orden en el cual se encuentren uno tras otro en la molcula de ADN, codificarn las protenas necesarias para la vida y el desarroUo del ser humano. Una de las metas del proyecto del genoma humano radicaba entonces en determinar el orden exacto y la ubicacin en cada cromosoma del cdigo gentico constituido por estas letras ( GTATCGTTCCACCCCTATCGTCTTATCCC) Figura 3.1: El Genoma Humano
l>C^

Cromosoma

107

La Salud PbUca Hoy

Con base en el conociiniento que poseemos actualmente podemos decir que todas las enfermedades tienen un componente gentico, ya sea por accin directa de un gen o un gmpo de ellos, o por la forma como el cuerpo humano responde a los agentes extemos, ya sean vims, bacterias o toxinas e incluso al medio ambiente. ,, Cronologa del desarrollo del proyecto del genoma humano 1987 1988 1990 1991 1992 Iniciativa del DOE Presentacin de Propuesta al Congreso USA Inicia el Proyecto del Genoma Humano Financiacin de US$3000.000 a 15 aos 1990-2005 Desarrollo de Banco de Datos para mapeo cromosmico. Recopilacin de informacin cientfica existente Mapa completo de ligamientos genticos de baja resolucin 1993 Mega-YAC (Yeast Artificial chromosomes) utilizados para clonar grandes fragmentos de ADN para ser secuenciados Segunda generacin de libreras genmicas para secuen-ciamiento. BAC (Bacterial Artifitial Chromosomes) Mapa fsico de alta resolucin, cromosomas 16 y 19 Mapa fsico de media resolucin cromosomas 3, 11, 12 y 22 Secuencia Haemophilus influenzae Secuencia Mycoplasma genitalium Mapas de STS (Sequence tag sites) 30.000 Secuencia Methanococus jannaschii (arqueobacteria) Secuencia Saccharomyces cerevisiae Secuencia receptor de clulas T humano Secuencia Escherichia coh Mapa fsico alta resolucin cromosoma X y 7 Declaracin de la UNESCO sobre el genoma humano Secuencia Caenorhabditis elegans Creacin de Celera Genomics, compaa privada que compite con el consorcio intemacional Secuencia Mycobacterium tuberculosis Multinacionales farmacuticas crean consorcio SNP SNP Polimorfismos de nucletido simple Cromosoma 22 (1 Die. 1999) secuenciado Secuencia de Drosophila melanogaster (marzo)

1994 1995 1995

1996

1997

1998

1999

2000

108

El proyecto del genoma hurrumo

2000

Gobiemo USA apraeba ley en contra de discriminacin Secuencia completa de los cromosomas 5, 16, 19 (abril) Secuencia completa del cromosoma 21 (mayo) Celera informa tener el 99% del genoma secuenciado Anuncio conjunto del HUGO y CELERA reahzado por el presidente Bill Chnton de USA y el primer ministro Tony Blair de Inglaterra sobre el resultado del proyecto.

Objetivos del proyecto del genoma humano 1. Identificar -100.000 genes humanos que a la postre resultaron unos -35.000. 2. Determinar la secuencia de 3.000 millones de letras del cdigo gentico. 3. Establecer bases de datos de ADN y desarrollar herramientas para su anhsis. 4. Discutir aspectos ticos, legales y sociales del proyecto. Esfuerzos mancomunados Los resultados obtenidos se deben en gran parte a los esfuerzos mancomunados de la biologa, permitiendo obtener el ADN de los voluntarios, fragmentarlo y clonarlo en vectores bacterianos y de levaduras para su distribucin posterior a todos los centros participantes; la biotecnologa, que mediante el uso de secuenciadores de cidos nucleicos (equipos que permiten leer con exactitud el orden del cdigo gentico) y la informtica, que gracias a los supercomputadores permitan empalmar con certeza los resultados de las secuencias de los miles de millones de fragmentos de ADN analizados, generados diariamente. Beneficios del proyecto del genoma humano -Mdicos Mejores mtodos diagnsticos, Deteccin temprana de susceptibilidad a enfermedades, Diseo de frmacos en forma racional encaminados al tratamiento de la causa de enfermedad y no a los sntomas. Terapia gnica. Reemplazar los genes defectuosos en un individuo, Farmacogenmica (medicamentos personales),

109

La Salud PbUca Hoy

Reemplazo de rganos e histocompatibilidad, Determinar el riesgo y dao a la salud ocasionado por radiacin. Determinar el riesgo y dao a la salud ocasionado por qumicos y txicos productores de cncer. Reducir la probabilidad de mutaciones heredables. -Antropolgicos v, .

Utilizar el anlisis de las variaciones existentes entre individuos para estudios evolutivos. Estudiar migraciones de poblaciones con base en marcadores genticos heredados por va materna. Estudios de linaje y migraciones con base en marcadores del cromosoma y gentica forense, Identificar a los sospechosos de un crimen. Exonerar a los falsos acusados. Identificar vctimas de crmenes y catstrofes. Determinar la Patemidad. . ,-, -Agricultura y veterinaria ,* .

Plantas resistentes a insectos, enfermedades y sequas. Alimentos transgnicos seguros. Productos agrcolas ms nutritivos, Biopesticidas, . . Vacunas orales incorporadas a alimentos. Conservacin del medio ambiente y descontaminacin por plantas. Certificar pureza de raza en bovinos, equinos, caninos, etc. Otros proyectos paralelos - '

Nuevas fuentes de energa (biocarburantes) Monitoreo ambiental para detectar contaminantes Proteccin para guerra qumica y biolgica Eliminacin de residuos txicos en forma segura Detectar Bacterias y ottos microorganismos que contaminen agua, aire, tierra y alimentos.

110

El proyecto del genoma humcmo

Resultados e implicaciones del genoma humano En el mes de febrero del 2002 se dieron a conocer en el mbito mundial los resultados obtenidos del Proyecto del Genoma Humano. Las dos revistas ms importantes de la ciencia en el mundo reportan los hallazgos obtenidos. Nature publica los resultados del consorcio Internacional HUGO (Human Genome Organization) y en la revista Science los resultados de la compaa privada Celera Genomics, unos meses despus del anuncio reahzado a mediados del ao pasado. Los resultados de ambos trabajos coinciden en sealar que el nmero de genes que posee la especie humana es un poco ms de 30.000 (26000 a 39000 de acuerdo con Celera y 30.000 a 40.000 de acuerdo con HUGO). Este nmero resalta con relacin al nmero estimado hace algunos meses en donde se pensaba que seran alrededor de 100.000. Este valor indica que no necesariamente los organismos de mayor complejidad, como es el ser humano, deberan tener un nmero excesivamente mayor de genes que otras especies. La mosca de la fmta, la Drosophila melanogaster, posee 14000 genes y el Caenorhabditis elegans (un pequeo gusano) aproximadamente 20.000. Se plantea entonces que el nivel de complejidad de estos genes y de las protenas que codifican es determinante para que se desarrolle una u otra especie. Una de las grandes conclusiones derivadas de dicho proyecto, y que ha tenido poca difusin, es la re-afirraacin de la teora evolutiva planteada por Charles Darwin y Alfred R. Wallace. La especie humana comparte genes con otras especies de la cadena evolutiva, desde las bacterias, pasando por el ratn y otros mamferos hasta llegar a los grandes simios. Otra de las principales conclusiones obtenidas de dicho proyecto es que no existen diferencias entre razas. Los resultados se obtuvieron a partir del ADN de aproximadamente 20 individuos de diferentes gmpos tnicos (caucasoides, orientales, raza negra, etc.) que voluntariamente donaron su material gentico para ser secuenciado. Al respecto debemos mencionar que los resultados obtenidos muestran que todas las razas poseen el mismo nmero de genes. Esto indica que no podemos hablar de razas con mayor o menor nmero de genes, no hay razas superiores o inferiores; sin embargo no podemos negar la variabilidad biolgica existente. La expresin de dichos genes determina que un individuo sea diferente a otro, que algunos expresen ms melanina en la piel que otros, que la configuracin corporal sea ms atltica y musculosa en algunos individuos y menos en otros. Somos idnticos en el nmero de genes pero vara su expresin.

111

La Salud PbUca Hoy

Qu tan idnticos son dos seres humanos en su secuencia? En general podemos decir que todos los seres humanos somos idnticos en un 99.9-99.99% de nuestro ADN. Los resultados obtenidos del anlisis de cambios en la secuencia han identificado hasta el momento 1.42 millones de tales cambios. Se denominan polimorfismos de un solo nucletido (en ingls SNP, Single nucelotide polymorphisms). Se ha identificado un SNP cada 1000 a 2000 nucletidos en la secuencia. Si el genoma humano tiene 3.200 millones de letras, dos personas sern diferentes en 1.6 a 3.2 millones de polimorfismos SNP. Estos polimorfismos tienen mucha importancia, no solo desde el punto de vista antropolgico (determinantes de la variabilidad biolgica) sino en el mbito mdico y farmacolgico. Estos cambios determinan quin sufrir o no una enfermedad o si responder o no a los tratamientos farmacolgicos. Sin embargo, an queda mucho trabajo por reahzar y los resultados de este monumental proyecto no estn a la vuelta de la esquina. Para ocmbre del 2001, slo se haban identificado unos 13.000 de los 35 a 40.00(X) genes identificados. Dos tercios de los genes no han sido identificados y se desconoce su fincin. Una vez sean reconocidos, el siguiente paso ser determinar qu funcin cumple cada uno de estos genes, qu protenas son codificadas, qu tipos de interacciones tienen con otras protenas y con el ADN mismo. En pocas palabras, las puertas se han abierto a im nuevo mimdo que requiere ser explorado. Adems de los beneficios mdicos que se obtendrn al conocer qu funcin cumple cada uno de nuestros genes, se suscita una gran polmica sobre el acceso a la informacin obtenida y los beneficios econmicos que de ella pueden derivarse. Las patentes de los genes y de protenas se han convertido en sucesos diarios. Desde hace algunos aos se inici una carrera por parte de las empresas de biotecnologa de los pases desarrollados, encaminadas a desarrollar nuevos mtodos diagnsticos, ms certeros, rpidos y efectivos, as como nuevas modalidades teraputicas, entre ellas la terapia gnica y la farmacogenmica gracias al conocimiento generado. Esta industria se espera generar billones de dlares en la siguiente dcada.

112

El proyecto del genoma humano

Aspectos ticos, legales y sociales del proyecto del genoma humano Desde la formulacin del Proyecto, varios aspectos ticos, legales y sociales fueron vislumbrados como cmciales para la discusin por la comunidad cientfica y la sociedad en general. Entre ehos se puede mencionar: 1. 2. 3. 4. 5. 6. 7. 8. Privacidad y confidencialidad de la informacin gentica Utilizacin de informacin gentica, Impacto psicolgico y estigmatizacin, Evaluacin de las pmebas genticas, Aspectos reproductivos, Comercializacin, Educacin, control de calidad y aseguramiento de la calidad, Implicaciones filosficas y conceptuales.

Se ha planteado la necesidad de implementar estndares y controles de calidad en las pmebas genticas utilizadas para evitar fallas diagnsticas que podran tener serias repercusiones sobre la vida de la persona. De la misma, manera es necesaria la educacin al Personal mdico, a los pacientes y al pbhco general sobre los alcances y repercusiones de dichas pmebas. Es necesario establecer si las pmebas genticas actuales son confiables e interpretables por la comunidad mdica. Si tienen los padres el derecho para analizar en los hijos genes de susceptibilidad para desarrollar enfermedades del adulto y si deben analizarse estos genes de susceptibilidad an cuando no exista tratamiento disponible. Deben hacerse pmebas cuando existe historia familiar para tomar decisiones a nivel prenatal?; debe realizarse tamizaje gentico, y a qu nivel, en recin nacidos, a nivel prematrimonial o a nivel ocupacional?; cmo nos afectara conocer nuestros riesgos genticos?; cmo afectara la percepcin famihar y de la sociedad al riesgo gentico de un individuo? Los temas relacionados con el acceso a la informacin gentica de un individuo son de especial discusin ya que podran prestarse a discriminacin en diversos niveles de la sociedad. Entre otros, quines debe tener acceso a la informacin y cmo debe usarse?; a quin le pertenece y quin la controla?; pueden las aseguradoras, entidades prestadoras de salud (EPS), empleadores y entes estatales tener acceso a dicha informacin?

113

La Salud PbUca Hoy

Notas Finales Infortunadamente, Colombia no particip en el mencionado Proyecto. No slo por la falta de inversin tanto estatal como por parte de la industria privada, al contrario de lo sucedido en los Estados Unidos y otros pases desarrollados, sino tambin por la carencia en su momento, de investigadores capacitados para llevar a cabo dicha tarea. Para recuperar algo del terreno perdido se requerira tanto de lo uno como de lo otro, de lo contrario nos limitaremos a ser simples espectadores y consumidores de los adelantos cientficos mundiales. No debemos olvidar que el conocimiento es poder.

114

El genoma humano y su impacto en la salud pblica


SAL FRANCO AGUDELO

El desciframiento del cdigo gentico de varias especies, y en especial del ser humano, representa uno de los mayores avances logrados hasta hoy con el aporte de varias disciplinas, campos y equipos cientfico-tecnolgicos. El avance tiene un potencial incalculable de transformacin del saber y de las prcticas relacionadas con la vida en general y con la salud y la salud pbhca en particular. Al mismo tiempo, los logros de la genmica humana plantean nuevos y complejos interrogantes ticos, jun'dicos y econmicos no slo a la medicina sino a la humanidad. De hecho, el proyecto y sus logros progresivos han estimulado intensas discusiones sobre la naturaleza y el sentido mismo de la vida, en particular de la vida humana, su historia, sus lmites y su futuro. Como ciudadanos del mundo y de la ciencia tenemos el deber y la posibilidad de acercamos a estos avances y tratar de comprender su significado, sus potencialidades y sus riesgos. No est bien que el peso de los afanes cotidianos y la fragmentacin disciplinaria y profesional nos sigan privando del derecho a acercamos a la orilla del conocinento que pretende dar cuenta de los ms ntimos secretos de nuestro ser y nuestra existencia. En particular quienes dedicamos la vida al ampho campo de la salud, y ms especficamente an a la salud pblica, estamos en la obligacin de dar a estas preocupaciones un carcter de prioridad si queremos estar a la altura de nuestro compromiso personal y de nuestra responsabilidad social. Es por esto que, asumiendo la doble funcin de ciudadano y salubrista y sin ninguna pretensin de posar de genetista o experto en materias que apenas comprendo y que otros dominan, me atrevo a plantear las siguientes consi-

117

La Salud PbUca Hoy

deraciones y preocupaciones relacionadas con algunos de los impactos, posibihdades y riesgos ya identificados de los avances genmicos en la salud pblica. Y si, en general, puede afirmarse que todo conocimiento es provisional y transitorio, la constatacin es mucho ms vhda en un campo como el que nos ocupa en el cual, a pesar de los enormes avances logrados, casi todo est apenas comenzando. Despus de anahzar los distintos aspectos, seleccion slo cuatro puntos para compartir con ustedes en esta presentacin: , 1. Algunas consideraciones sobre la relacin entre ciencia y vida. 2. Principales reas de aplicacin del saber genmico en salud pblica. 3. Algunos interrogantes suscitados y an no resueltos por el genoma. 4. Hacia un nuevo paradigma integrador de la vida y la salud. 1. Ciencia y vida .

Hace sesenta y dos aos el gelogo, paleontlogo y jesuita Teilhard de Chardin escribi: Desde que naci, la ciencia ha crecido sobre todo por el incentivo de resolver todos los problemas relacionados con la vida'. Hay una relacin esencial ciencia-vida. Se hace ciencia para comprender y mejorar la vida. Y, siendo mucho ms que la ciencia - porque es tambin arte, cotidianidad, amor y luchas - la vida es el alma de la ciencia y, en parte, tiene sentido por ella. Para algunos, los cientficos, buena parte del sentido de la vida se lo da la bsqueda cientfica. Como parte del saber y del hacer humano, la salud pblica tiene tambin razn de ser en cuanto aporta a la comprensin y a las acciones para hacer mejor la vida humana tanto en los individuos como en sus diferentes formas colectivas. Sin relacin con la vida y el bienestar humanos, la Salud Pbhca - en su triple dimensin de campo de conocimiento del bienestar colectivo, conjunto de acciones sociales y estatales para hacerlo posible, y la consiguiente situacin resultante de vida mejor para cada sociedad - pierde su objeto y su norte y puede convertirse en una repeticin casi sin sentido de acciones y procedimientos tcnicos, operativos y administrativos.

DE CHARDIN, Teilhard, P.O fenmeno humano. P. 272. Liviana Tlivares Martins. Portugal, 1970

118

El genoma humano y su impacto en la salud pblica

En esencia, el trabajo sobre el genoma humano es la incursin ms avanzada de la humanidad, de la mano de la ciencia y la tecnologa, en los secretos de la vida. En una metfora rehgiosa, el entonces presidente de los Estados Unidos lo dijo as al presentar en sociedad el hallazgo maravilloso: Estamos aprendiendo el lenguaje con que Dios cre la vida humana. Se ha llegado ya hasta intimidades que considerbamos inexpugnables. Y a un ritmo que ni los ms arriesgados se haban atrevido a pensar hace menos de medio siglo. James Watson, por ejemplo, dijo a finales de junio del ao 2000: Ninguno de los que tuvimos el privilegio de ver por primera vez a finales de 1953 la doble hlice del/U)N pensamos jams que viviramos lo suficiente para verla totalmente descodificada. Una dcada antes de que Watson, Crick y su equipo descubrieran la estmctura del ADN, el jesuita-gelogo ya citado se haba atrevido a preguntar si por el descubrimiento de los genes no iremos a controlar en poco tiempo los mecanismos de las herencias orgnica cuyas bases haban sido puestas desde 1865 por Gregor Mendel e ignoradas por los cientficos durante todo el final del siglo XIX^. Ms an: el propio Teilhard de Chardin se atrevi a predecir la produccin de lo que l mismo llam Una Neovida, artificialmente producida (1, p:273). No ser exactamente eso la clonacin, ya experimentada en Dolly y ofras ovejas famosas^ y que ahora se aproxima a pasos incontenibles a la propia clonacin humana? Con todo, lo esencial no parece ser saber hasta dnde vamos a llegar sino si los avances de la ciencia en el conocimiento de la vida se traducirn o no en una mejor vida para todas las especies, en especial la especie humana. En presente, esta preocupacin terica por la relacin ciencia-vida debe traducirse en lograr que los avances genmicos permitan no slo prevenir y ciu-ar ms y ms enfermedades sino tambin estimular el trabajo colectivo por mejores relaciones ambientales, cultivar mejores estilos y calidad de vida y sobre todo, recuperar el sentido de la vida, de su valor casi supremo, depreciado hoy hasta niveles irrisorios en la mortandad violenta que padecemos. Porque en Colombia, paradjicamente a la orga de sangre y muerte que padecemos, experimentamos una intensa pasin por la vida. Garca

^ '

LANDER, E.S. and Weimberg, RA. Genomics: journey to die center of biology. Science, Vol.287:1777-1782.10, march 2000. WILMUT, I. CAMPBELL, K. y TUDGE, C. La segunda creacin. Sine qua non. Barcelona, 2000

119

La Salud Pblica Hoy

Mrquez lo expres as hace ocho aos en la proclama introductoria al Informe de la Misin de Ciencia, Educacin y Desarrollo, mejor conocido como el Informe de los Sabios: Tenemos un amor casi irracional por la vida, pero nos matamos unos a otros por las ansias de vviV. 2. Principales reas de aplicacin del saber genmico en salud pblica En las tres dimensiones ya enunciadas de la salud pblica, los avances en la ciencia del ADN estn teniendo una influencia significativa y, sin duda, la tendrn mayor en el futuro prximo. El campo del conocimiento de la salud pblica empieza a ampharse de manera ilimitada con los interrogantes que introduce el nuevo saber tanto a lo que hasta ahora dbamos ya por conocido como a lo que apenas empezamos a descubrir de la mano del desciframiento del ADN. Las prcticas preventivas y en especial de deteccin precoz de enfermedades con las consiguientes modificaciones de hbitos y estilos de vida, tienen ahora nuevas posibilidades y muchsimos cuestionamientos ante la inminente aplicacin de nuevas y ms precisas y efectivas pmebas genticas. Y, al menos en teora, es de esperarse que el nuevo saber gentico y sus derivaciones tecnolgicas y teraputicas contribuyan a generar mayor bienestar para los individuos y los gmpos. Dados los ms recientes desarrollos cientfico-tecnolgicos y el nivel de preocupacin social suscitado, merecen destacarse, entre otros, los siguientes campos especficos de utilizacin e impacto del saber genmico en salud pblica. 2.1. Deteccin precoz de predisposicin a ciertas enfermedades. La posibihdad de establecer con suficiente anticipacin si un individuo es o no portador de una mutacin en el locus gentico de una enfermedad, que es lo que entendemos por predisposicin gentica, constituye uno de los aportes importantes de la gentica a la salud pblica. Ms an cuando se trata de enfermedades mortales, tales como la fibrosis qustica o mucoviscidosis, considerada como la ms importante de las enfermedades genticas peditricas y como la enfermedad gentica mortal ms

COLCIENCIAS. Misin Ciencia, educacin y DesarroUo. Colombia al filo de la oportunidad. P. 7. Bogot, 1994

120

El genoma humano y su impacto en la salud pblica

abrumar o damos pistas mucho ms precisas sobre lo esencial de la diferencia entre las dos especies y lo importante de cultivarla cada vez ms. Algo similar puede ociurir con la cuestin de las diferencias raciales entre los humanos. El hecho de que en trminos genticos la diferencia no sobrepase el 0.1% puede contribuir a reducir la rigidez de ciertos racismos y xenofobias. Pero igual puede llevar a discutibles pretensiones eugensicos y a consohdar una supuesta aristocracia gentica con nuevas modahdades de xenofobia. Tiene todo esto algo qu ver con la salud pbhca? Creo que s, y mucho. En especial porque dentro de ella caben muchas de las dimensiones y consecuencias de nuestras relaciones con la naturaleza en general, con los dems seres vivos en particular y con los dems humanos en especial. 3. Algunos interrogantes suscitados y an no resueltos por el genoma Por el enorme avance cientfico que significa el genoma humano, posiblemente son ms los interrogantes que formula que las respuestas que ya ha dado. Se presentan a continuacin algimos de los cuestionamientos ms frecuentes hasta ahora, con la intencin de invitar a intensificar la bsqueda de respuestas y, por tanto, sin ninguna pretensin de respuesta inducida o acabada. Casi desde el comienzo de la ejecucin del proyecto genoma humano, en 1990, se financi con el 5% de su presupuesto un programa para investigar y reflexionar sobre las implicaciones ticas, legales, y sociales del proyecto y sus posibles hallazgos - programa ELSI '^-. Las cuatro prioridades de dicho programa enuncian buena parte de las preocupaciones e interrogantes que el genoma pone a la sociedad y a la salud pblica. Son ellas: - Privacidad y justicia en el uso e interpretacin de la informacin gentica. Tiene que ver en concreto con cuestiones como: De quin es la informacin gentica? Quin, cmo y para qu puede usarla? Es posible patentar el genoma humano?'^ Hasta dnde llega la propiedad individual y la privacidad del paquete gentico'"? Qu uso puede drsele a la informacin gentica de un individuo en cuestiones de empleo, seguros, adopciones, patemidad, investigacin criminal, etc.?
'" " " JEFFORDS,J.DASCHLE,T. Politicalissuesinthegenomaera.ScCTice.Vol291:1249.I6februaiy 2001. RESTREPO, L.M. Es posible patentar el genoma humano?. Temas de Biotica. Universidad de Antioquia No.l;29-35. Enero -junio de 2001. Prvate genes, public health, commentary. The Lancet, VoI. 349:1338-1339. May 10,1997.

125

La Salud PbUca Hoy

No ha estado quieta la sociedad ante tales interrogantes. Propiedad, privacidad, pbhco-privado, exclusin, discriminacin son algunas de las categoras que articulan los debates al respecto. La rivahdad ya universalmente conocida entre los gmpos pblico y privado de la investigacin original, expresada institucionalmente en el NIH y la empresa Celera y personificada en los doctores Francis CoUins y Craig Venter es apenas el primer acto - seguramente premonitorio - de una larga obra en la que habr demasiados intereses, poderes y dlares en juego. Los tres mil millones de dlares del presupuesto original del Proyecto Oficial, curiosamente equivalentes en nmero al total de nucletidos que componen el genoma humano, son tambin apenas el case inicial de un inversin y un negocio multimiUonario. La polmica pone sobre el escenario el papel y la responsabilidad del Estado en la investigacin de punta, la relacin entre lo pbhco y lo privado, y entre el inters colectivo y los intereses de ganancia particular. Y pone tambin en discusin otro tema de especial relevancia: el papel y la responsabilidad social de los investigadores. El Congreso Mundial de Biotica, reunido en Espaa en junio del ao 2000, expres categricamente en el numeral ocho de su declaracin: El genoma humano es patrimonio de la humanidad, y como tal no es patentable'^Estados Unidos y Gran Bretaa tienen un proyecto de acuerdo para impedir que el genoma humano termine en poder de compaas privadas. El anterior presidente de los Estados Unidos firm un decreto prohibiendo a las agencias federales y a los departamentos del Estado el uso de la infonnacin gentica en cualquier contratacin. Y resulta casi impensable hoy un Congreso de temas legales, ticos, jurdicos, pohticos y de salud pblica en cuya agenda no figure esta problemtica. - Integracin clnica de las nuevas tecnologas. Este aspecto, obviamente, tiene que ver ms con la prctica clnica y por eso apenas se enuncian las preguntas claves. Es hora de iniciar las terapias gnicas? En cules patologas tanto orgnicas como mentales? A quines deben aplicarse? Deben incluirse en los paquetes de atencin? Cmo valorar los riesgos inevitables, evidenciados ya an con la muerte reportada de algunos pacientes?

Congreso Mundial de Biotica. Declaracin Biotica de Gijn 2000. Temas de Biotica. Universidad de Antioquia. No,l:I3-14. Enero-junio de 2001.

126

El genoma humarw y su impacto en la salud pblica

Cuestiones afines a la investigacin gentica. Aqu aparecen en especial tres grandes problemas: los ticos, los econmicos y los de poder, expresados en mltiples preguntas y subtemas. Pero el interrogante que domina el escenario es este: Clonar o no clonar, en especial al ser humano? Los padres de la clonacin de ovejas han insistido en sus reservas acerca de la conveniencia y oportunidad de la clonacin humana (3). Y varias legislaciones, entre ellas el reciente Cdigo Penal Colombiano, se han anticipado a proscribir la clonacin humana (13, p:34). Pero, al mismo tiempo, varios equipos cientficos en distintas partes del mundo dicen estar a punto de poder realizarla. Es posiblemente la cuestin ms candente planteada hasta ahora por la gentica, posibilitada por las tecnologas afines y clavada como una espina en la mente y la conciencia de los cientficos, los polticos, los eticistas, los legisladores, los salubristas y el pbhco en general.

_ Finalmente: las implicaciones y retos del avance gentico en la educacin pblica en salud y en la formacin profesional y tcnica del sector. Qu debe saber la poblacin general sobre gentica y sus relaciones e implicaciones en la vida cotidiana? Qu deben saber los mdicos, las enfermeras, los odontlogos, los salubristas y las bacterilogas sobre los mismos temas a un nivel ms tcnico y elaborado? Qu estamos haciendo por introducir responsablemente estos temas, estas tecnolo> gas y estas inquietudes en nuestros crculos acadmicos, profesionales y sociales? > , : :. Es claro que las anteriores preocupaciones e interrogantes tienen ciertas especificidades para los pases denominados subdesarrollados y de menor nivel cientfico-tecnolgico. Algunas de eUas se pueden enimciar as: Cundo y en qu condiciones accederemos a los beneficios de los nuevos conocimientos y tecnologas genticas? Qu tipo de aportes podremos hacer tanto en la investigacin como en los debates sobre el tema? Hasta dnde podremos controlar y disponer de nuestro material gentico y nuestra riqusima biodiversidad? 4. Del genoma humano a un nuevo paradigma integrador de la vida y la salud Estando an por sedimentarse muchas de las expectativas que ha generado el genoma humano, me atrevo a enunciar tambin en esta ocasin, una im-

127

La Salud PbUca Hoy

plicacin sobre la cual no he encontrado nada en la literatura revisada sobre el tema. No se trata, por supuesto, de un desarrollo sistemtico y completo de la idea, sino de una formulacin embrionaria que invite al debate y al trabajo en la constmccin del modelo Se trata del impacto que el nuevo descubrimiento puede llegar a tener en la constmccin de un nuevo paradigma del conocimiento en salud, al que preliminarmente puede denominarse paradigma integrador de la vida y la salud. Dicho paradigma representara la superacin positiva de la antigua e intensa confrontacin entre los componentes biolgicos y sociales del saber en salud. Buena parte de los avances, y muchas de las limitaciones del actual conocinento mdico en particular y en salud en general, las debemos a la hegemona histrica del saber bio-natural. Desde la revolucin microbiolgica de finales del siglo XIX fueron adquiriendo estatuto excluyente de cientificidad en salud las ciencias y disciplinas positivas y naturales: biologa, gentica, inmunologa, bioqumica, farmacologa, y sus versiones ms recientes: biologa celular y despus molecular, iiununogentica, ingeniera gentica, etc. Las ciencias sociales llegaron tarde y relativamente mal al campo mdico y sanitario. Es una historia de poco ms de siglo y medio. Penetraron de la mano de las ciencias de la conducta y de manera ms instmmental y aphcativa que cientfica y explicativa. Vino luego el auge de la economa poltica, con avances significativos tanto temticos como conceptuales y metodolgicos. Pero tambin, hay que aceptarlo crticamente, con cierto aire dogmtico y un dejo de determinismo econmico. En la etapa actual hay una saludable apertura a bsquedas sociolgicas y culturales en salud, a esclarecimientos histricos y exploraciones ticas y bioticas y al reconocimiento de la racionahdad poltica del campo sanitario. Con dificultades y altibajos, por supuesto, pero es claro que el conjunto de las denominadas ciencias sociales ha hecho aportes sustanciales al saber en salud, en cada una de sus disciphnas y profesiones y, por consiguiente, a los intentos de superar los problemas y crear mejores condiciones y calidad de vida. A primera vista, todo indica que la secuenciacin del genoma humano es la consagracin definitiva e irrefutable de la racionalidad bionatural, de las ciencias positivas y de la primaca de lo individual sobre lo colectivo. Y puede llegar a ser as. Pero, como plante en la instalacin del reciente Congreso Mundial de Medicina Social en Cuba, me arriesgo a pensar que

128

El genoma humano y su impacto en la salud pblica

frecuente que afecta a la poblacin de raza blanca'. Obviamente la predisposicin es ms fcil de detectar cuando se trata de alteraciones de un solo gen, como el caso de la enfermedad anterior, la enfermedad de TaySachs (defecto enzimtico genticamente determinado, conocido tambin como gangliosidosis GM2), la enfermedad de Huntington (entidad hereditaria, autosmica dominante, caracterizada por movimientos incontrolados y demencia progresiva, cuyo locus gentico fue ubicado en el cromosoma 4), y trastomos cromosmicos tales como el sndrome de Down^. La cuestin es ms compleja cuando no se trata de efectos de una variacin gentica especfica sino de un juego de mltiples genes, casos en los cuales se hace ms difcil tanto la identificacin del problema como la posibilidad de intervencin. En la diabetes, por ejemplo, se ha identificado la intervencin de al menos tres genes como factores contribuyentes al desencadenamiento de la enfermedad. En el cncer de mama se han reconocido dos o tres trastomos hereditarios dominantes y muy raros'. Los investigadores reconocen que la gentica modema no ha descubierto que haya ms enfermedades de origen gentico, sino que ha confirmado estudios previos que demuestran que algunas enfermedades tienen influencias genticas en su etiologa y ha ofrecido tcnicas que pueden descubrir exactamente cules genes estn relacionados con cules enfermedades. El poder predictivo de las pmebas genticas es muy variado en funcin tanto de los factores anteriormente enunciados, como de otro aspecto esencial: que la predisposicin gentica acta en relacin muy estrecha con los factores ambientales para producir un cuadro clnico especfico (7. p. 647). Es decir: con la excepcin de algunos pocos casos especficos, no existe un determinismo gentico. Este postulado de la interaccin entre gentica y ambiente es esencial y cobra cada vez mayor importancia tanto entre los investigadores como entre quienes aphcan los conocimientos genticos. En

ROBBINS. Patologa estructural yfuncional, p. 505. Interamericana-Mc Graw Hill, Madrid, 1995. KHOURY,M.J. From genes tp public health: die apphcations of genetic technology in desease prevention. American Journal of Public Health, Vol. 86, No. 12:1717-1722. BOBROW, M. and GRIMBALDESTON, A.H. Medical Genctics: die human genome project and pubhc health. Journal of Epidemiologic Community Health, 54: 645-649. 2000.

121

La Salud PbUca Hoy

1996 un profesor de la Universidad de Liverpool present un cuadro (7.p. 648) sobre el poder predictivo de las pmebas genticas para algunas enfermedades, en el siguiente orden porcentual: . Distrofia muscular de Duchenne . Enfermedad de Huntington . Cncer de mama . Enfermedad de Alzheimer . Espondilitis anquilosante . Diabetes 100% 95% 80% 50% 30% 0.5%

Reconocer la naturaleza predominante o parcialmente gentica de una enfermedad y disponer de pmebas genticas an con un alto poder predictivo significa sin duda un avance importante en trminos tanto mdicos como de salud pblica. Puede ser posible la terapia gnica en algunos casos, en otros puede darse un oportuno consejo gentico y pueden identificarse y prevenirse en otros los factores ambientales relacionados, tales como la exposicin a ciertas sustancias en los espacios laborales o domsticos, la utilizacin de ciertos suplementos alimenticios o evitar determinadas radiaciones, etc. Pero existen tambin limitaciones serias al momento de pretender masificar las pmebas debido a sus costos, a la dificultad para convencer a la poblacin en relacin con la utilidad potencial de la pmeba y, adems, a la limitada disponibilidad actual de terapias genticas para tratar los casos comprobados de portadores del riesgo. En trminos laborales, las pmebas genticas presentan, adems, la ambivalencia de poder evitar el riesgo de la exposicin pero poder al mismo tiempo discriminar a algunos de los candidatos a un trabajo determinado, tema que se enunciar ms adelante. Las pmebas genticas hacen entonces parte de los aportes de la medicina genmica a la promocin de la salud y la prevencin de la enfermedad. Pero requieren "una nueva responsabihdad para garantizar que sean usadas con pmdencia y correctamente"*. --.

S T E I N B E R G , K.K. GWIN, M. and KHOURY. The role of genomics in pubhc health and disease prevention. JAMA, Vol.286, No 13:1635, october 3,2001.

122

El genoma humano y su impacto en la salud pblica

2.2. La genmica de la conducta. Como lo reconocen los propios investigadores especializados, la gentica del comportamiento se presta ms para el sensacionalismo de los medios de comunicacin que cualquier otro campo de la ciencia modema'. De hecho a los medios les seduce poder informar sobre el descubrinento del gen de la homosexualidad, de la intuicin femenina y, en particular, en nuestro caso colombiano, del gen responsable de la violencia. La ciencia, en cambio, es ms cauta. Ya se vio en el numeral anterior que son muy pocos los casos de patologas ligadas a variaciones de un solo gen. Y en los trastomos de la conducta, la mayor parte de los casos dependen de la interaccin entre factores ambientales y mltiples genes. La unicausahdad contina perdiendo terreno. La gentica est contribuyendo significativamente a la sicopatologa, a la comprensin de la personalidad y de las habilidades e inhabilidades cognitivas. Y ha podido establecerse que casi todos los trastomos de la conducta estudiados con apoyo gentico -entre ellos la enfermedad de Alzheimer, la enfermedad de Huntington, el dficit de atencin, la dislexia y la esquizofrenia- muestran un carcter hereditario entre moderado y alto, generalmente a un nivel mayor del que presentan las enfermedades fsicas. Al parecer, el mayor impacto de los avances en el genoma humano sobre la psicologa y la psiquiatra se refieren a la comprensin de las bases neurogenticas de las diferencias individuales y a lograr una base ms slida en cuanto a la etiologa de las enfermedades. Todo esto puede llevar al descubrimiento de tratamientos nuevos y ms especficos y, sobre todo, a incrementar la percepcin y la tolerancia de los trastomos de la conducta, .aspecto esencial en trminos de salud pblica. 2.3. El genoma humano y la percepcin que tenemos de nosotros mismos. Desde la reformulacin de preguntas centrales como: en el fondo qu es la vida y qu es lo especficamente humano, hasta cuestiones ms secundarias y en ocasiones prximas a la fantasa, tanto la secuenciacin como la relativa popularizacin del genoma han suscitado una creciente curiosidad y algunas reflexiones substanciales. An sedimentando el margen de exageracin y esnobismo que puede darse por lo que podra-

McGUFFIN, R RILEY, B. and PLOIN, R. Toward Behavioral Genomics. Science, Vol 291:12321233.16 febniaiy 2001.

123

La Salud PbUca Hoy

mos llamar una especie de genomitis, es preciso reconocer que el genoma tiene un enorme valor simblico para buena parte de la poblacin que accede a algn nivel de informacin y de conocimiento bsico sobre el tema. Slo en el campo del lenguaje, que es un indicador sensible de cambio social, el genoma est produciendo una verdadera revolucin'", como bien nos consta incluso a quienes hemos estado durante muchos aos dentro del lenguaje mdico. Pero no es slo cuestin de renovacin en el lenguaje. La manera como nos concebimos, los criterios que fundamentan nuestras formas de relacin con otros seres vivos y con los dems seres humanos y an las concepciones religiosas sobre el origen de la vida estn sufriendo replanteamientos fundamentales a raz de los hallazgos de la nueva gentica. El propio Eric Lander, jefe de la investigacin genmica en el MIT, escribi: ..el impacto ms serio de la genmica puede consistir en cmo vamos a decidir percibimos a nosotros mismos y cmo percibimos unos a otros (2, p:1782). Tres hechos demostrados por la gentica dan pie a reflexiones sobre el tema en cuestin. El primero: que nuestro genoma humano no es tan significativamente ms rico que el de seres vivos que consideramos tan lejanos y poco desarrollados como las moscas, los gusanos y los ratones, o que compartimos con ellos muchos ms elementos genticos de los que creamos". El segundo: que nuestra secuencia total de ADN es semejante en un 99% a la de los chimpancs. Es decir nuestra diferencia gentica con un chimpanc es slo del 1%. Y el tercero: que entre los seres humanos tenemos una identidad gentica del 99.9%. Es decir: slo diferimos en un 0.1%. Constataciones como estas nos van a seguir desvelando y podrn inclusive modificar no slo nuestros criterios sino tambin nuestras conductas. Conceptos tan caros a nuestra cultura como el de la superioridad y especificidad humanas y el de raza pueden matizarse y, segn el ngulo de mirada, enriquecerse o empobrecerse. Nuestra escasa diferencia con los primates nos puede deprimir en un sentdo y, en otro, Uevamos a apreciarlos mucho ms y a relacionamos mejor con ellos. Igualmente el margen de diferencia de slo el 1% nos puede

' "

GOODFELLOW, RN, and SEFTON, L. Language of die genome. Nature, Vol 353:117-118.12 september 1991. PAABO, S. The Human Genome and our view of ourselves. Science, Vol. 291: 121912-20. 16 february 2001.

124

El genoma humcmo y su impacto en la salud pblica

puede llegar a ser lo contrario. Es decir: si en definitiva lo que el genoma expresa es la impronta en el individuo, por la va qumica y hereditaria, del resumen de toda la trayectoria de la humanidad...podemos estar tambin al borde de entender lo biolgico como materializacin de lo social plantendose as una alternativa al viejo dilema que nos ha desvelado mucho y abriendo la posibilidad de construir un paradigma alternativo e integrador de ambos niveles'^. Teilhard De Chardin haba planteado que lo social no es negacin sino culminacin de lo biolgico. Los avances en el genoma permiten plantear que lo biolgico no es negacin sino materializacin individualizada de lo histrico-social Eric Lander, ya citado, dice con claridad: el genoma es un libro de historia y nos muestra que los 6.000 millones de nuestra especie, descendientes de 7.000 generaciones, provienen de una pequea poblacin original de 60.000 personas. Nuestra especie presenta escasa variacin gentica: el ADN de los seres humanos es idntico en un 99.9%.(2). Es justamente esta constatacin de que la biologa no slo no es autnoma o independiente de lo histrico-social, sino que es en s misma transmisin histrica, puente generacional, bisagra entre lo individual y lo colectivo, lo que permite entrever una nueva relacin entre los dos mundos cientficos. Ni es comprensible lo social sin la infraestmctura y el funcionamiento orgnico bio-natural, ni es comprensible lo biolgico sin su historia y la cultura. Ni determinismo gentico, ni omnipotencia social. Y es esa nueva relacin la que parece poner las bases de la superacin del viejo dilema biolgico-social y del advenimiento de un paradigma comprensivo e integrador. Paradigma, adems, no slo del conocimiento, sino tambin de la accin y de la conducta. Vamos a tener que estudiar ms ambos campos cientficos. Nos van a sorprender nuevas explicaciones de viejos problemas, enfermedades y conductas. Vamos a tener que ir ms del laboratorio al consultorio y de este al debate pblico o a los medios de comunicacin. Nos va a costar muchsimo dudar de algunas verdades que hoy nos tranquilizan y vamos a tener que arriesgamos a cuestionar algunos valores establecidos y a constmir nuevos cdigos, legislaciones y reglamentaciones''.
FRANCO, S. Saludo de Bienvenida. Octavo Congreso Latinoamericano y XI Mundial de Medicina Social. La Habana, Cuba, Juho de 2000. FRANCO, S. Del genoma humano a un nuevo paradigma en salud, Temas de Biotica. Universidad de Antioquia. No. 1:22-28. Enero -junio de 2001. Este artculo sirvi en buena parte de base para la presente fonnulacin.

129

La Salud Pblica Hoy

Considero que en principio la primera demanda para poder avanzar hacia la constmccin de este nuevo paradigma y hacia una prctica profesional en salud adecuada a la nueva situacin, es la de sacudir la indiferencia o la pereza intelectual y retomar con paciencia libros, revistas e intemet para enteramos de cerca y crticamente del que es sin duda el primer gran avance cientfico-tecnolgico del milenio. Y como la prevencin es tan cara a la salud pbhca, prevenimos de una posible epidemia de genomitis que nos puede llevar a esnobismos casi ridculos o a olvidamos de que, por suerte, los genes son una parte importante, pero no la nica de nuestra historia. Y, sobre todo, que la vida sigue siendo un fenmeno mucho ms maravilloso y variado que los 23 pares de cromosomas, los 30.000 genes y los tres mil millones de nucletidos de nuestro genoma.

130

..^^^'9'-.

Jl-I

IL

.T-i ,

Los nuevos paradigmas cientficos frente al impacto ecolgico de la biotecnologa transgnica


OMAR GARCA ALZUGARATE

Una nueva concepcin de la vida La vida hay que definirla bajo los nuevos paradigmas, bajo un concepto csmico siendo este ltimo un organismo vivo, que se autorreferencia y autorreplica, de la misma fuente. La vida es la conciencia, alma, voluntad que est navegando en los seres vivos, es la memoria gnica o csmica, es la energa, el eros, el ergon. j . Existe solo una intencin mutua, memoria, arquetipos, creodas, modelos. Los sistemas son discontinuos. Las modemas teoras cientficas acerca del caos y orden as lo plantean. Los nuevos cientficos son generalistas, cmzan las fronteras de sus disciplinas, para elaborar super-teoras, las totalidades, teoras del todo, el holismo.
-i .

Es un viraje en la filosofa de la ciencia y de concebir el mundo, la era de los msticos, el final del reduccionismo. Estamos recapitulando el pensamiento aristotlico de las jerarquas del orden, sutiles y complejas matemticas no lineales. Los rizos de retroalimentacin de los sistemas descubiertos por Prigoguin, teniendo como resultado los estados disipativos, por lo cual le otorgaron el premio Nobel. Los hiperciclos del Rna nos muestran el inicio de lo que denominbamos vida, el universo es una totalidad fluida al igual que el gen. Las memorias, los atractores nos generan nuevos mapas para navegar, para cmzamos gnicamente, existen en el espacio de fases, los sistemas ecolgicos

133

La Salud PbUca Hoy

los ciclos lmites, el orden y el caos se repiten, se heredan permanentemente. Son las creodas, los fractales, el Holn las unidades; somos bolones, copias, el episteme es gnico, los loops, las turbulencias, las intermitencias son memorias. Las iteraciones son atractores peridicos, la iteracin es una realimentacin, que implica la continua reabsorcin del pasado, la iteracin en los humanos no lleva al caos sino a la iluminacin. Las paradojas o caos se dan con la iteracin o regreso al pasado; las paradojas o koans nos sirven para superar las etapas y paradigmas cientficos y trascender a un nuevo punto de vista. Siendo la muerte una paradoja, un regreso al pasado, a travs de los ciclos se regresa al presente del pasado. La memoria deltiempoel zeigest de Young, el inconsciente colectivo. La fisiologa del caos es modelo de la gentica. La vida se inicia por el pliegue o plegamiento de la molcula. La imprevisilidad es la base, el fundamento de la naturaleza, del todo. Los atractores y el fabuloso fractal, nos muestran un camino diferente para ver la reahdad, se inicia la era de la autosimilitud, la autorrphca, autorreferencia. Las olas y ondas forman solitones as viajan los impulsos nerviosos, el sohton es la partcula elemental del pensamiento, la comunicacin se da a travs de los rizos de realimentacin. La quiralidad o lateralidad de la molcula en sus cambios fundamentales realiza el giro sobre la izquierda. Dios es izquierdista. Gracias a Konrad Lorenz y el descubrimiento de la etologa como una disciplina cientfica que surgi en el siglo XX se estableci que la conducta es heredada; la Etologa ha dado lugar a nuevas ramas de la ciencia como la sociobiologa. Estas ciencias estudian en forma sistemtica los fundamentos biolgicos del comportamiento animal y humano, social, brindndonos las bases para comprender los sistemas de produccin Euiimal en forma integral, ya que la patologa conductual generada por manejos intensivos se refleja en la alteracin de otros sistemas, principalmente el reproductor. En cuanto a las especies de compaa, su antropomorfizacin ha generado graves anomalas conductuales, las cuales sin una base etolgica no sern comprendidas ni tratadas adecuadamente. Por ltimo, sin las bases cientficas para comprender el comportamiento de la fauna silvestre, no tendremos las herramientas para comprender los seres vivos.

134

Los nuevos paradigtruis cientficos frente al impacto ecolgico de la biotecnologa transgnica

Los avances cientficos a partir del Premio Nobel otorgado a Lorenz y sus colaboradores en 1973, lograron que la etologa pasara de la fase de paradigma a ciencia normal o bsica, segn Kuhn (1971). Esto permiti que se asocien en forma dinmica las diferentes disciplinas cientficas generando formas de pensamiento conceptuales en lugar de informacin bancaria, haciendo que se categorice el conocimiento adquirido y posteriormente se engrane con disciplinas donde el mtodo cientfico es lo fundamental para Uegar a un diagnstico integrado. Acerca de la biotica Surge el nuevo concepto biotico, tomando como base la hiptesis Gaia, del gmpo de mayor conceptualizacin de la naturaleza, Lindesfam y la comprensin de la palabra vida, vemos que todo est vivo: el cosmos es un organismo vivo, es creativo, la escuela holstica a nivel de filosofa de la naturaleza, la lucha entre lo etemo o el cambio evolutivo, leyes etemas o evolutivas, la era de comprensin de la naturaleza como viva, no solo energa, la realidad, dios, inteligencia universal, verdad absoluta alma, conciencia, espritu, ser, y el misterio, siguen siendo la piedra angular de la ciencia El hecho de aceptar que existimos, nos coloca frente al principio antrpico de aceptar tambin la existencia de fenmenos, energas superiores, fuerzas trascendentales. Este razonar producto de la evolucin de nuestro sistema nervioso nos fue diferenciado de los animales. Negar la existencia de esa fuerza trascendente, fue la estrategia del hombre en el siglo XX, La ganancia desbord la espirituafidad, la ciencia. La ideologa dominante y la religin aceptaron como realidad la teora ptolomica la cual vea al hombre como el centro del universo. Sin embargo, la conciencia humana sigue buscando esas verdades que guarda la naturaleza: el hombre, incluso, ha desarrollado metodologas para alterar la conciencia con el fin de vivenciar, esas energas trascendentes. Estos estados los denominamos estados msticos o alterados de conciencia: El hombre tiene esta bsqueda como fundamento de su esencia; el pensamiento cientfico es otro de los mtodos de acercarse a eUa y a esa energa que se ha caracterizado a lveles subcunticos y tiene diferentes propiedades, como las recin planteadas por Sheldrake, conocidas como agentes raciomorfos que nos demuestran, una vez ms, la imprevisibihdad y lo grande de la natiu'aleza.

135

La Salud PbUca Hoy

Existen grandes incgnitas sobre qu sucede luego de la muerte: se guardar la informacin?, se pierde la razn?, qu es la razn?, la tica? El episteme o verdad existe, a nivel de las ciencias fsicas y naturales existen diferentes teoras, una de las principales es la teora de los campos (cuantos), la cual revoluciona la ciencia reduccionista. Estos campos, incluyendo los morfogenticos, son el fundamento de la gentica del desarrollo. Las energas ontolgicas, tienen memoria e interactan y se heredan, son intehgentes, les colocamos nuevos nombres que son los morfogenes. Realmente somos inmortales, pero la naturaleza cada vez que la violentamos no perdona, por eso la ciencia debe ser pendulante y no lanzarse al precipicio con tecnologas que van en contra de la naturaleza. La muerte es un estado que permite el trnsito al estado totipotencial gnico. Por eso, nos aclaraba Rene Thom, todo es heredado, todo episteme es gnico. Venimos programados. Jugamos roles biolgicos. Genticamente somos el todo, las nuevas concepciones cientficas abordan la temtica. El nuevo pensamiento que se gesta en el Instituto de Esalen sustentado por hombres de la talla de Aldous Huxley, Maslow, Bateson y otros de la escuela de Lindesfam como Sheldrake, Lovelock, Cappra que sentaron las bases del nuevo pensamiento en ciencia, se dio luz al nuevo paradigma en ciencia, paralelamente David Steindl en teologa, creer que la tierra es nuestra gran madre es parte del paradigma. Nuestro antiguo paradigma en ciencia, llamado newtoniano, baconiano o cartesiano, ser reemplazado por el paradigma holistico o ecolgico o sistmico. La madre tierra - Gal La filosofa holstica (orgnica) considera que toda la naturaleza est viva El universo como un todo es un organismo en desarrollo. Desde el punto de vista del materialismo mecanicista esto no tiene sentido, no existe vida en el universo sino pautas complejas de interaccin fsica que obedecen a leyes etemas de la fsica. Definir la vida sigue siendo un punto lgido, una vitalidad intrnseca de los organismos es lo que no se acepta en la teora mecanicista o del caos. Propsitos intemos de gai y el embrin. Campo interno de gai. El nima de todos los niveles: gai esta en resonancia con otros planetas. Humanismo y animismo.

136

Los nuevos paradigmas cientficos frente al impacto ecolgico de la biotecnologa transgnica

Las sanciones religiosas sern cambiadas por cdigos ticos, se debe conquistar la biosfera por la ciencia; se est pasando de la visin antropocntrica del hombre a la visin de un mundo vivo animista, no somos superiores a nadie, ni a gai, ni a dios. Los ecologistas profundos abogamos, por una ecologa centrada en la vida, una biologa biocntrica. La crisis ecolgica para los eclogos profundos es la pobreza, es el militarismo, el patriarcado, el racismo y otras formas de dominacin social. El nuevo milenio, ya est tomando forma, gracias a la aceptacin de la crisis ambiental poltica, econmica y social Nos acercamos al final de una era y empiezan a sentirse y a palparse los valores de la nueva era. Nuestros sistemas econnucos y polticos, tendrn que cambiar radicalmente para poder vivir en armom'a con Gai. La tierta no padece una enfermedad terminal, la geopatologa y la geofisiologa son los nuevos paradigmas. La causa de la enfermedad es nuestra civilizacin tecnolgica moderna, antropocntrica. Las conexiones con la naturaleza son necesarias, la conciencia humana se desarroll a partir de los hbitos de los animales. Por eso amamos los animales. La observacin de la naturaleza es el mtodo fundamental para adquirir conocimiento, por eso el historiador natural es ms profundo que el cientfico profesional
.

.. i .

'

'

'

.'

'

-..

La experiencia intuitiva de la naturaleza es ms real y ms directa que las teoras puras. La experiencia mstica se considera rara, pero es ms comn de lo que se cree. Hay tab a creer en esas experiencias. Los recuerdos infantiles de esas conexiones son bsicas para la creacin. La oracin es un dilogo con el poder o poderes conscientes superiores. Las respuestas llegan en forma sorprendente. Otro de los grandes saltos en ciencia es el nuevo paradigma de la semiofsica fundamento de la embriologa modema, base de la gentica del desarrollo. Teniendo en cuenta la discusin del tema central, los transgnicos, es conveniente revisarla someramente La semiofsica La semiofsica es la fsica de los sentidos, ciencia que estudia los signos y smbolos de la naturaleza. Teora general de la inteligibilidad: geometrizar el pensamiento y el lenguaje. Crear la matemtica del continuo (Aristteles). Gentica pregnancial. Seales innatas, vectores de pregnancia, resonancia mrfica. La estmctura social de la especie es innata. Las seales, las catexias,

137

.La Salud Pblica Hoy

generan el carcter desencadenador, los rituales, produccin endoenvocada de emociones; la percepcin de una forma pregnante crea el efecto tnel, las fijaciones traen un recuerdo de placer o de dolor; la pregnancia despierta el proceso de satisfaccin y llega al acto consumatorio, estado de excitacin. El gen egosta, los genes nos dominan. La ley de la recapitulacin, "la ontognesis recapitula la filogenia". Los preprogamas y la morfognesis biolgica es ontognica. Las interacciones, superacin del obstculo preprograma, jerarquizado segn Timbergen se llama pauta motora, apetencia. La tcnica y el uso de instmmentos deben supeditarse a la naturaleza. No es la naturaleza la que imita el arte, el arte imita la naturaleza. Coacciones genticas, memoria del pasado La morfologa biolgica se funda en un aspecto de memoria. Es imposible la generacin espontnea. La inmunolgica. Gentica de poblaciones, todo s memoria. Embriologa animal La divisibilidad es el carcter ms importante del ser vivo. La fisiologa animal, irritabilidad de la materia o alma vegetativa de los animales. Alma apetitiva genera la dinmica celular, la caracteriza el ciclo de la mitosis. El plan general de la organizacin animal. Se da en los homeomeros (flujos lentos de energa) anhomeomeros son los soportes. La materia se transforma sin cesar por eso su eterna juventud. Mecnica cuntica dentificacin de partcula y el campo, la atraccin de la materia de s misma por s misma, ley de la recapitulacin y paisaje epigentico.

Riesgos ambientales de los cultivos transgnicos: una evaluacin agroecolgica El nuevo paradigma por sus cualidades transcendentes permitir desarrollar polticas adecuadas para solucionar los graves conflictos del planeta: guerra, pobreza, prdida de valores y pronunciada descentracin biolgica del ser o locura. Para Colombia es ineludible iniciar un anlisis del conflicto del pas con base en los nuevos paradigmas, incluyendo el uso de esas tecnologas del paradigma de la revolucin verde que tanto dao le hizo al pas. Para desarrollar esta temtica me basar en los planteamientos del eminente agro-eclogo doctor Altieri, de la Universidad de Berkeley, que

138

Los nuevos paradigmas cientficos frente al impacto ecolgico de la biotecnologa transgnica

nos advierte sobre los peligros de este viejo paradigma que ya no es cientfico, sino una tecnologa peligrosa que causa erosin gentica de nuestro germoplasma natural, base de la rica biodiversidad de Colombia y de su seguridad aliientaria. De acuerdo con Miguel Altieri de la Universidad de California, Berkeley: La ingeniera gentica es una aplicacin de la biotecnologa que involucra la manipulacin de ADN y el traslado de genes entre especies para incentivar la manifestacin de rasgos genticos deseados (OTA 1992). Corporaciones transnacionales (CTNs) como Monsanto, DuPont, Novartis, etc., quienes son los principales proponentes de la biotecnologa, ven los cultivos transgnicos como una manera de reducir la dependencia de insumos, tales como pesticidas y fertilizantes. De acuerdo con varios autores, los riesgos ecolgicos ms serios que presenta el uso comercial de cultivos transgnicos son (Rissler y Mellon 1996; Krimsky y Wmbel 1996): La expansin de los cultivos transgnicos amenaza la diversidad gentica por la simplificacin de los sistemas de cultivos y la promocin de la erosin gentica. La potencial transferencia de genes de cultivos resistentes a herbicidas (CRHs) a variedades silvestres o parientes semidomesticados pueden crear supermalezas. CRHs voluntarios se transforman'an subsecuentemente en malezas. El traslado horizontal vector-mediado de genes y la recombinacin para crear nuevas razas patognicas de bacteria. Recombinacin de vectores que generan variedades del vims ms nocivas, sobre todo en plantas transgnicas diseadas para resistencia viral con base en genes virales. Las plagas de insectos desarrollarn rpidamente resistencia a los cultivos que contienen la toxina de Bt.

139

La Salud Pblica Hoy

El uso masivo de la toxina de Bt en cultivos puede desencadenar interacciones potencialmente negativas que afecten procesos ecolgicos y a organismos benficos. Los impactos potenciales de la biotecnologa agrcola se evalan aqu dentro del contexto de metas agroecolgicas que apuntan hacia una agricultura socialmente ms justa, econmicamente viable y ecolgicamente apropiada (Altieri 1996). Tal evaluacin es oportuna dado que a nivel mundial ha habido ms de 1500 aprobaciones para pmebas de campo de cultivos transgnicos (el sector privado ha solicitado el 87% de todas las pmebas de campo desde 1987), a pesar del hecho que en la mayora de los pases no existen regulaciones estrictas de bioseguridad para tratar con los problemas medioambientales que pueden desarrollarse cuando plantas diseadas por ingeniera gentica son hberadas en el ambiente (Hmska y Lara Pavn 1997). La preocupacin principal es que las presiones intemadonales para ganar mercados y aumentar las ganancias estn empujando a las compaas a que liberen cultivos transgnicos demasiado rpido, sin consideracin apropiada de los impactos a largo plazo en las personas o en el ecosistema (Mander y Orfebre 1996). Actores y direcciones de la investigacin La mayora de las innovaciones en biotecnologa agrcola estn orientadas por la bsqueda de ganancias en lugar de la bsqueda de una respuesta a las necesidades humanas, por consiguiente el nfasis de la industria de la ingeniera gentica realmente no es resolver los problemas agrcolas, sino el incremento de la rentabilidad. Esta aseveracin es apoyada por el hecho que por lo menos 27 corporaciones han comenzado investigaciones sobre plantas tolerantes a los herbicidas, incluyendo a las ocho ms grandes compaas de pesticidas del mundo: Bayer, Ciba-Geigy, ICI, Rhone-Poulenc, Dow/Elanco, Monsanto, Hoescht y DuPont, y virtualmente todas las compafuas de semiUas, muchas de las cuales han sido adquiridas por compaas qumicas (Gresshoft 1996). En los pases industriahzados, de 1986 al 1992, el 57% de todos los ensayos de campo para probar cultivos transgnicos involucraron tolerancia a los herbicidas, y el 46% de sohcitantes al USDA para pmebas de campo fueron compaas qumicas. Cultivos actualmente diseados para la tolerancia gentica a uno o ms herbicidas incluyen: alfalfa, algodn, maz.

140

Los nuevos paradigmas cientficos frente al impacto ecolgico de la biotecnologa transgnica

avena, petunia, papa, arroz, sorgo, soja, remolacha, caa de azcar, girasol, tabaco, tomate, trigo y otros. Est claro que creando cosechas resistentes a sus herbicidas, una compaa puede extender los mercados de sus productos qumicos patentados. El mercado para CRHs se ha estimado en ms de $500 millones para el ao 2000 (Gresshoft 1996). Aunque algunas pmebas son conducidas por universidades y organizaciones de investigacin avanzadas, la agenda de investigacin de tales instituciones es cada vez ms influenciada por el sector privado. El 46% de empresas de biotecnologa apoyan la investigacin biotecnolgica en las universidades, mientras 33 de los 50 estados en USA tienen centros universidad-industria para la transferencia de biotecnologa. El desafo para tales organizaciones pblicas no slo ser el asegurar que los aspectos ecolgicamente apropiados de la biotecnologa se investiguen (tales como fijacin de N, tolerancia a la sequa, etc.), sino tambin supervisar y controlar cuidadosamente la provisin de conocimiento aphcado de libre propiedad al sector privado, para garantizar que tal conocimiento contine en el dominio pblico para el beneficio de toda la sociedad. Recientemente en el pas se legaliza con bombos y platillos el uso de estos alimentos , sin contar con gmpos ni tecnologas apropiadas para el seguimiento oportuno de un descalabro fitosanitario como en Mxico, luego del desmantelamiento del ICA. Esto hace parte de la improvisacin e irresponsabilidad del Estado colombiano. Biotecnologa y agrobiodiversidad Aunque la biotecnologa tiene la capacidad de crear una variedad mayor de plantas comerciales, las tendencias actuales de las CTNs son abrir amphos mercados intemadonales para un solo producto, creando as las condiciones para la uniformidad gentica en el paisaje mral. Adems, la proteccin de patentes y los derechos de propiedad intelectual apoyados por el GATT, inhiben a los agricultores de re-usar, compartir y almacenar sus semillas aumentando as la posibilidad de que pocas variedades lleguen a dominar el mercado de semiUas. Aunque un cierto grado de uniformidad de los cultivos puede tener ciertas ventajas econmicas, tiene dos inconvenientes ecolgicos. Primero, la historia ha mostrado que una gran rea cultivada con un solo cultivo es muy vulnerable a un nuevo patgeno o plaga. Y, segundo, el uso extendido de un solo cultivo lleva a la prdida de la diversidad gentica (Robinson 1996).

141

La Salud PbUca Hoy

Evidencias de la Revolucin Verde no dejan ninguna duda que la difusin de variedades modemas ha sido una importante causa de la erosin gentica, cuando las campaas gubemamentales masivas animaron a los agricultores a adoptar variedades modemas empujndoles a abandonar muchas variedades locales (Tripp 1996). La uniformidad causada por el aumento del rea de cultivo de un nmero ms pequeo de variedades es una fuente de riesgo para los agricultores, cuando las variedades modemas son ms vulnerables a enfermedades y al ataque de plagas y cuando estas se desarrollan pobremente en ambientes marginales (Robinson 1996). Resistencia a herbicidas ^
I

'

Est bien documentado que cuando im solo herbicida es usado repetidamente sobre un cultivo, las oportunidades de que se desarrolle resistencia al mismo en la poblacin de malezas se incrementa. (Holt y otros 1993). Las sulfonylureas y los imidazolinones son particularmente propensos a la evolucin rpida de malezas resistentes y se conocen hasta catorce especies de malezas que presentan resistencia a los herbicidas del sulfonylurea. Cassia obtusifolia una maleza agresiva en la soja y el maz en el sudeste de los EE.UU. ha exhibido resistencia a los herbicidas del imidazohnone (Goldburg 1992). El problema es que dada la presin de la industria para aumentar las ventas de herbicidas, la superficie tratada con herbicidas de ampho espectro se extender, exacerbando el problema de resistencia. Por ejemplo, se ha proyectado que la superficie tratada con Glyphosate aumentar a casi 150 millones de acres. Aunque el Glyphosate es considerado menos propenso para desarrollar resistencia, el aumentado en el uso del herbicida producir resistencia en malezas, aunque ms lentamente, como se ha documentado en poblaciones de ryegrass anual, quackgrass, birdsfoot trefoil y especies de Cirsium (Agalla 1995). Impactos ecolgicos de los herbicidas >

Las compaas afirman que el Bromoxynil y el Glyphosate, cuando son propiamente aplicados se degradan rpidamente en el suelo, no se acumulan en las aguas subterrneas, no tienen efectos en organismos y no dejan residuos en los alimentos. Hay, sin embargo, evidencia de que el Bromoxynil causa defectos de nacimiento en animales de laboratorio, es txico a los peces y puede causar cncer en humanos. Debido a que el Bromoxynil es

142

Los nuevos paradigmas cientficos freme al impacto ecolgico de la biotecnologa transgnica

absorbido por va dermatolgica, y porque causa defectos de nacimiento en roedores, es probable que presente riesgos a los agricultores y obreros del campo. Similarmente se ha reportado que el Glyphosate puede ser txico para algunas especies invertebradas que habitan en el suelo, incluyendo a predadores benficos como araas y carbidos y especies detritivoras como lombrices de tierra, y tambin para los organismos acuticos, incluso los peces (Pimentel y otros 1989). En la medida que estudios verifican la acumulacin de residuos de este herbicida en las fmtas y tubrculos, al sufrir poca degradacin metablica en las plantas, emergen tambin preguntas sobre la seguridad de los ahmentos con trazas de estos herbicidas.
r

Creacin de super malezas Aunque existe la preocupacin que los cultivos transgnicos se puedan convertir a su vez en malezas, el mayor riesgo ecolgico es que liberaciones a gran escala de cultivos transgnicos pueden resultar en el flujo de transgenes de los cultivos a otras plantas silvestres que entonces pueden transformarse en malezas (Darmency 1994). El proceso biolgico que preocupa aqu es la introgresin, es decir, la hibridacin entre especies de diferentes plantas. La evidencia indica que tales intercambios genticos entre malezas silvestres y cultivos ya ocurren. La incidencia de shattercane (Sorghum bicolor), una maleza emparentada con el sorgo y el flujo gentico entre el maz y el teosinte demuestran el potencial de los cultivos emparentados a volverse serias malezas. Esto es preocupante dado que varios cultivos en los Estados Unidos son cultivados en proximidad con sus parientes sexualmente compatibles. Hay tambin cultivos que crecen en las proximidades de malezas silvestres que no son parientes ntimos pero pueden tener algn grado de compatibilidad cmzada tales como los emees de Raphanus raphanistrum X R. sativus (rbano) y de Sorghum halepense X maz sorgo (Radosevich y otros 1996). Reduccin de la complejidad del agroecosistema La remocin total de malezas va el uso de herbicidas de ampli-espectro puede llevar a impactos ecolgicos indeseables, dado que se ha documentado que un nivel aceptable de diversidad de malezas en los alrededores o dentro de los campos de cultivo puede jugar un papel ecolgico importante, tal como la estimulacin del control biolgico de plagas, o la mejora de la cobertura protectora contra la erosin del suelo, etc. (Altieri 1994).

143

La Salud PbUca Hoy

Lo ms probable es que los CRHs refuercen el monocultivo al inhibir las rotaciones y los policultivos ya que la diversificacin es imposible si se usan cultivos susceptibles a los herbicidas combinados con los CRHs. Tales agroecosistemas empobrecidos en su diversidad vegetal proveen las condiciones ptimas para el crecimiento libre de malezas, insectos y enfermedades dado que muchos nichos ecolgicos no estn siendo ocupados por otros organismos. Es ms, los CRHs a travs del incremento de la efectividad del herbicida, podran reducir aun mas la diversidad vegetal, favoreciendo cambios en la composicin y abundancia de la comunidad de malezas, favoreciendo especies competitivas que se adaptan a un amplio espectro de tratamientos de post-emergencia (Radosevich y otros 1996). Impactos sobre otros organismos Conservando la poblacin de plagas a niveles sumamente bajos, los cultivos de Bt pueden hambrear a los enemigos naturales en la medida que estos insectos benficos necesitan una cantidad pequea de presa para sobrevivir en el agroecosistema. Los insectos parsitos seran los mayormente afectados porque ellos son ms dependientes de hospederos vivos para su desarrollo y supervivencia, mientras que algunos predadores podran tericamente alimentarse de presas muertas o agonizantes. Los enemigos naturales tambin podran afectarse directamente a travs de las interacciones a niveles intertrficos. Evidencias en estudios realizados en Escocia sugieren que los fidos son capaces de secuestrar la toxina del cultivo Bt y transferirla a sus predadores (coccinlidos), a su vez afectando la reproduccin y la longevidad de los coccinlidos benficos (Birch y otros 1997). El secuestro de sustancias qumicas secundarias de las plantas por herbvoros, quienes luego afectan el comportamiento de parsitos no es rara (Campbell y Duffey 1979). Existe la posibilidad de que las toxinas de Bt que se muevan a travs de las cadenas alimenticias presenten serias implicaciones para el control biolgico natural en agroecosistemas. Las toxinas de Bt pueden incorporarse al suelo a travs del material vegetal que se descompone, pudiendo persistir durante 2 o 3 meses, resistindose a la degradacin ligndose a las partculas de arcilla mientras mantienen la actividad de la toxina (Palm y otros 1996). Tales toxinas de Bt que terminan en el suelo y el agua proveniente de los desechos de cultivos transgnicos pueden tener impactos negativos en los organismos del suelo y en los invertebrados acuticos as como en el proceso de reciclaje de nutrientes (James 1997). Todos estos aspectos merecen una investigacin ms seria.

144

Los nuevos paradignujs cientficos frente al impacto ecolgico de la biotecnologa transgnica

Efectos ro abajo Una efecto medioambiental mayor, como resultado del uso masivo de la toxina de Bt en algodn u otro cultivo ocupando una inmensa superficie del paisaje agrcola, es que agricultores vecinos con cultivos diferentes al algodn, pero que comparten complejos similares de plagas, puede terminar con pobladones de insectos resistentes colonizando sus campos. Es posible que plagas de lepidpteros que desarroUan resistencia al Bt en algodn, se muevan a los campos adyacentes donde los agricultores usan Bt como un insecticida microbiano, dejando as a los agricultores indefensos contra tales plagas, en la medida que ellos pierden su herramienta de control biolgico (Gould 1994). Quin sera responsable por tales prdidas? El comportamiento de los cultivos transgnicos liberados Hasta principios de 1997, trece cultivos genticamente modificados haban sido desregulados por el USDA, apareciendo por primera Vez en el mercado o en los campos. En 1996 ms del 20% de la superficie cultivada de soja en los Estados Unidos fue sembrada con soja tolerante al Round-Up y cerca de 400.000 acres se sembraron con maz de Bt maximizado. Esta superficie se extendi considerablemente en 1997 (algodn transgnico: 3.5 millones de acres, maz transgnico: 8.1 millones de acres y soja: 9.3 millones de acres) debido a acuerdos de mercadeo y distribucin entre corporaciones y mercaderes (por ejemplo Ciba Seeds con Growmark y Mycogen Plant Sciences con CargiU). Dada la velocidad con que los productos se mueven del laboratorio a la produccin del campo, estn los cultivos transgnicos respondiendo a las expectativas de la industria de la biotecnologa? Segn evidencia presentada por la Union of Concemed Scientists, hay ya signos de que el uso a escala comercial de algunos cultivos transgnicos presenta riesgos ecolgicos serios y no responde a las promesas de la industria. El aparente comportamiento resistente del bellotero en el algodn, que se manifiesta en la capacidad del herbvoro de encontrar reas del tejido de la planta con bajas concentraciones de Bt, nos lleva a preguntamos hasta qu punto las estrategias de manejo de resistencia que se han venido adoptando son las adecuadas, pero tambin nos lleva a cuestionar la forma en que los biotecnlogos subestiman la capacidad de los insectos para sobreponerse en forma inesperada a la resistencia gentica.

145

La Salud PbUca Hoy

De la misma forma, rendimientos pobres en las cosechas de algodn resistente al herbicida a causa del efectofitotxico del Round-Up en cuatro a cinco mil acres en el Delta del Mississippi (New York Times 1997) apunta a la actuacin errtica de los CRHs cuando estn sujetos a condiciones agrochmticas variantes. Monsanto argumenta que esto es un caso muy pequeo y locahzado que est siendo usado por ambientalistas para obscurecer los beneficios que la tecnologa llev a un rea total de 800.000 acres. Sin embargo, desde un punto de vista agroecolgico este incidente es bastante significativo y merece una extensa evaluacin. Es incorrecto asumir que una tecnologa homogeneizante tendr un buen comportamiento en un rango de condiciones heterogneas. Conclusiones ^ ^

La historia de la agricultura nos ensea que las enfermedades de las plantas, las plagas de insectos y las malezas se volvieron ms severas con el desarrollo del monocultivo, y que los cultivos manejados intensivamente y manipulados genticamente pronto pierden su diversidad gentica (Altieri 1994, Robinson 1996). Dados estos hechos, no hay razn para creer que la resistencia a los cultivos transgnicos no evolucionar entre los insectos, malezas y patgenos como ha sucedido con los pesticidas. No importa qu estrategias de manejo de resistencia se usen, las plagas se adaptarn y superarn las barreras agronmicas (Green y otros 1990). Las enfermedades y las plagas siempre han sido amplificadas por los cambios hacia la agricultura homognea. El hecho que la hibridacin interespecfica, y la introgresin son comunes a especies tales como: girasol, maz, sorgo, arroz, trigo y papas, provee la base para esperar un flujo de genes entre el cultivo transgnico y sus famihares silvestres creando as nuevas malezas resistentes a los herbicidas. A pesar del hecho de que algunos cientficos argumentan que la ingeniera gentica no es diferente al mejoramiento convencional, los crticos de la biotecnologa reclaman que la tecnologa del RDNA permite la expresin de nuevos genes exticos en las plantas transgenticas. Estas transferencias de genes estn mediadas por vectores que se derivan de vims y plasmidos causantes de enfermedades, quienes pueden atravesar las barreras de las especies de tal forma que puedan transferir genes entre una gran variedad de especies, afectando as a muchos otros organismos en el ecosistema.

146

Los nuevos paradigmas cientficos frente al impacto ecolgico de la biotecnologa transgnica

Pero los efectos ecolgicos no estn limitados a la resistencia de las plagas y creacin de nuevas malezas o tipos de vims. Como se argumenta aqu, los cultivos transgnicos pueden producir toxinas medioambientales que se mueven a travs de la cadena alimenticia y que tambin pueden terminar en el suelo y el agua afectando a invertebrados y probablemente impactando procesos ecolgicos tales como el ciclo de nutrientes. Muchas personas han argumentado por la creacin de una regulacin apropiada para mediar la evaluacin y liberacin de cultivos transgnicos para contrarrestar riesgos medioambientales y demandan una mayor evaluacin y entendimiento de los temas ecolgicos asociados con la ingeniera gentica. Esto es cmcial en la medida que los resultados que emergen acerca del comportamiento medioambiental de los cultivos transgnicos liberados sugieren que en el desarrollo de los cultivos resistentes, no slo deben evaluarse los efectos directos en el insecto o la maleza sino tambin los efectos indirectos en la planta (ej. crecimiento, contenido de nutrientes, cambios metablicos), en el suelo y en otros organismos presentes en el ecosistema. Entre las varias recomendaciones para la accin que las ONGs, organizaciones campesinas y gmpos de ciudadanos deben adelantar en los foros a nivel local, nacional e intemacional incluyen: terminar elfinanciamientopblico a la investigacin en cultivos transgnicos / que promuevan el uso de agroqumicos y que presenten riesgos medioambientales; los CRHs y otros cultivos transgnicos deben regularse como pesticidas; todos los cultivos alimenticios transgnicos deben etiquetarse como tal; aumentar el financiamiento para tecnologas agrcolas alternativas; sostenibihdad ecolgica, tecnologas altemativas de bajos insumos, las necesidades de los pequeos agricultores y la salud y nutricin humana deben ser buscadas con mayor rigor que la biotecnologa; las tendencias desatadas por la biotecnologa deben ser equilibradas por polticas pblicas y opciones de los consumidores en apoyo de la sostenibihdad; las medidas deben promover la sostenibihdad y el uso mltiple de la biodiversidad al nivel de la comunidad, con nfasis en tecnologas que promuevan la autosuficiencia y el control local de los recursos econmicos como medios para promover una distribucin ms justa de los beneficios.

147

La Salud PbUca Hoy

148

Los nuevos paradigmas cientficos frente al impacto ecolgico de la biotecnologa transgnica

Referencias bibliogrficas ALTIERI, M.A. Biodiversity and pest management in agroecosystems. New York : Haworth Press, 1994. BUSCH, L., LACY, W.B., BURKHARDT, J. andLACY,L. Plants,power and profit. Oxford : Bas BlackweU, 1990. CRUCIBLE GROUP. People, plants and patents. Ottawa : IDRC,I994. FOWLER, C. and MOONEY, R Shattering: food, politics and the loss of genetic diversity. Tucson : University of Arizona Press, 1990. GRESSHOFF, P.M. Technology transfer of plant biotechnology. Boca Ratn: CRC Press, 1996. HINDMARSH, R. The flawed sustainable promise of genetic engineering. The Ecologist 21: 196-205.1991. JAMES, R.R. Utilizing a social ethic toward the environment in assessing genetcaUy engineered insect-resistance in trees. Agriculture and Human Vales 14: 237-249. 1997. KLEINMAN, D.L. and J. KLOPPENBURG. Biotechnology and university-industry relations: policy issues in research and the ownership of intellectual property at a land grant university. Policy Studies Journal 17:83-96.1988. KLOPPENBURG, J. and BURROWS, B. Biotechnology to tie rescue? Twelve reasons why biotechnology is incompatible with sustainable agriculture. The Ecologist 26: 61-67.1996. KLOPPENBURG, J.R. First the seed: the political economy of plant technology, 1492-2000. Cambridge : Cambridge University Press, 1988. KRIMSKY, S. and WRUBEL, R.P. Agricultural biotechnology and the environment: science, policy and social issues. University of Illinois Press, Urbana, 1996. LEVIDOW, L. and CARR, S. How biotechnology regulation sets a risk / ethics boundary. Agriculture and Human Vales 14: 29-43.1997. LEVINS, R. and LEWONTIN, R. The dialectical biologist. Cambridge : Harvard University Press, 1985. LIPTON, M. New seeds and poor people. Baltimore : The John Hopkins University Press, 1989. MAcDONALD, D.F. Agricultural biotechnology at the crossroads. NABC Report 3. Union Press of Binghamton. 1991. MAcDONALD, J.F. Agricultural biotechnology and the public good. NABC Report 6. laca, NY. 1994.

149

'

La Salud PbUca Hoy

MANDER, J. and GOLDSMITH, E. The case against the global economy. San Francisco : Sierra Club Books, 1996. MOLNAR, J.J. and KINNUCAN, H. Biotechnology and the new agricultural revolution. Boulder, CO.: Westview Press, 1989. NATIONAL RESEARCH COUNCIL. Ecologically based pest management. National Academy of Sciences. Washington D.C. 1996. OFHCE OF TECHNOLOGY ASSESMENT A new technological era for American agriculture. Washington. D.C.: U.S. Govemment Printing Office. 1992. PIMENTEL, D. et al. Environmental and economic costs of pesticide use. Bioscience Al: 750-760.1992. RISSLER, J. and MELLON, M. The ecological risks of engineered crops. Cambridge, MA.: MIT Press, 1996.

150

CAPTULO FV

LA PROMOCIN DE LA SALUD: TEORA Y PRCTICA. La promocin de la salud en el siglo XXI


RAMN GRANADOS TORAO

Introduccin Hace varios siglos que se comenz a hablar de la reladn entre sociedad y salud, y la influencia determinante de los procesos productivos y sociales sobre la enfermedad humana. En el siglo XVII se mencionan las contribuciones de Bemardino Ramazzini y J. Peter Frank, el primero, padre de la salud ocupacional por sus estudios de la relacin entre el medio laboral y determinadas patologas, y el segundo, considerado uno de los pioneros de la medicina social. Durante el siglo XIX, Virchow, Neumann y Villerme denuncian en Europa la relacin entre pobreza y deficientes condiciones de vida con las enfermedades de los pobres. En el siglo XX, Winslow hace contribuciones importantes al considerar el papel de la educacin comunitaria para la salud y pone nfasis en la importancia de la maquinaria social y la accin gubemamental sobre la salud de las personas y de la comunidad. Henry E. Sigerist' fue el primer salubrista en utilizar el concepto de promocin de la salud, en 1945. Defini que las cuatro tareas bsicas de la

"La salud se promueve proporcionando un nivel de vida decente, buenas condiciones laborales, educacin, cultura fsica y medios para la recreacin. Para la consecucin de este objetivo, es necesario coordinar los esfuerzos de grandes grupos: el de estadistas, los trabajadores de la industria, los educadores y los mdicos". Henry Sigerist. 1946.

153

La Salud PbUca Hoy

medicina eran la promocin de la salud, la prevencin de la enfermedad, el restablecimiento de los enfermos y la rehabilitacin de las secuelas, significando que tales reas de trabajo no solo son tareas de la medicina, sino de la buena salud pbhca. En las postrimeras del siglo XX surge el Informe Lalonde en 1974, la Carta de Ottawa de 1986, la Declaracin de Santa Fe de Bogot de 1992, y se desarrolla el movimiento de ciudades y municipios saludables, primero en Europa y despus extendido a otras latitudes, entre ellas Amrica Latina. En los albores del siglo XXI se comienza a hablar de la promocin de la salud como la nueva salud pblica. El devenir de la salud pblica "modema" Corriendo el riesgo de simplificar demasiado, podra decirse que en este devenir de la salud pblica modema y en funcin del desarrollo cientfico y tecnolgico, de las ciencias naturales y sociales, del desarrollo impetuoso de las fuerzas productivas, al calor y despus de la revolucin industrial, de las demandas impuestas por el emergente orden de produccin capitalista, de las exigencias del movimiento obrero industrial, entre otros, se identifican tres paradigmas. Cada uno de ellos, parte de un modelo conceptual explicativo de la salud-enfermedad humana y ello tiene consecuencias metodolgicas y operacionales para las intervenciones de salud propuestas. Figura 4.1
Modelos Conceptuales
Medicina Social

^'^'^^
Desarrollo de Responsabilidad Estatal en Salud

Ministros de Salud

Teora de le Grmtncs

Institutos de Seguridad Social

rcoas Gcrcnciaics y Ecmmica

154

La promocin de la salud en el siglo XXI

Mn primer paradigma, responde fundamentalmente al modelo explicativo basado en la teora de los grmenes que conduce al desarrollo de la bacteriologa primero y de la epidemiologa de las enfermedades transmisibles despus. Los desarrollos conceptuales se formalizan en la teora de la trada ecolgica inicialmente (que establece una relacin causal lineal entre agente, medio y husped) y con posterioridad en la teora de la multicausalidad, que extiende el campo de la epidemiologa a las enfermedades crnico degenerativas. Sobre su base se desarrollan las campaas sanitarias, as como los programas verticales de control y erradicacin de enfermedades, que dan cuerpo a la salud pblica modema (en su versin occidental) y a la medicina asistencial basada en los avances de las ciencias biolgicas; se desarrolla aceleradamente la tecnologa mdica y biolgica, la estadstica de salud y los mtodos matemticos de anlisis y sntesis de este complejo fenmeno. Un segundo paradigma responde a una ptica mdico social de la salud. Con el mismo se describe y analiza la muerte, la enfermedad, la discapacidad y la nutricin en la poblacin, y se identifican las relaciones de causalidad que sobre estas manifestaciones tienen las condiciones de vida de la pobladn y el acceso equitativo a los beneficios del desarrollo. Surge hace ms de dos siglos, como se mencion anteriormente, y se fue conformando todo el cuerpo terico y metodolgico de la medicina social, higiene social (en algunas partes de Europa, sobre todo del Este), sociologa mdica; y se impuls el desartollo de la investigacin de las causas sociales de la enfermedad, de la distribucin por clases sociales de los problemas de salud, del riesgo social de enfermar y morir y se fue conformando un aparato de intervenciones gubemamentales de carcter colectivo que se conoci como polica mdica inicialmente, y que no era ms que la generacin de polticas pblicas de salud y el desarrollo institucional de ministerios o secretaras de salud. Precisamente el desarrollo de la teora de los grmenes, de la bacteriologa, la epidemiologa y la bioestadstica, y de las ciencias naturales, tiene un doble impacto sobre esta corriente o paradigma de la salud: por un lado, la epidemiologa y su desarrollo metodolgico ayuda a establecer el perfil epidemiolgico por estratos sociales y evidencia las inequidades en la salud y en la atencin, y, por otro, la aparicin de la explicacin biolgico natural, retrasa el avance de explicaciones ms holsticas o comprehensivas de la salud, enfermedad humana y de las respuestas sociales sobre los pro-

155

La Salud PbUca Hoy

blemas de salud. En ocasiones, el desarrollo tecnolgico en una rama especfica del saber opaca, por un tiempo, a otras explicaciones ms hohsticas del objeto de estudio y de intervencin, al considerarse como la nica exphcacin posible de los procesos sometidos a investigacin. Un tercer paradigma se asocia a la emergencia de una versin hegemnica de la economa de la salud, las teoras gerenciales modemas y su expresin en la atencin gerenciada de los problemas de salud y de su cmce eclctico con la epidemiologa en la bsqueda de nuevas formas de describir, analizar, sintetizar y priorizar, con criterios de costo efectividad, las expresiones poblacionales de la muerte, la enfermedad, la discapacidad y la nutricin. La economa neoclsica de la salud hizo definiciones extremas acerca de bienes pblicos y privados en funcin de las extemalidades, en un contexto macro de ajustes estmcturales de la economa y de presiones por la disminucin del gasto pblico y la eficiencia fiscal. Estas corrientes pretendieron ignorar los desarrollos previos de los otros dos paradigmas de la salud pblica, utilizando de manera reduccionista aquellas herramientas de la epidemiologa que permitieran la definicin de las prioridades costo-efectivas, disminuyendo otras de tanta o mayor importancia para la salud pblica. Entre los aos noventa y la fecha ha sido el paradigma dominante. La emergencia de estos tres paradigmas no es cronolgicamente consecutiva, sino que se van desarroUando paralelamente en distintas etapas de la llamada poca modema. La preponderancia de uno u otro ha respondido ms a condiciones polticas, econmicas y sociales macro que a necesidades de desarrollo internas a los sistemas sociales de proteccin de la salud. Es por ello que puede identificarse como se han ido convirtiendo en hegemnicos uno u otros sin que ello signifique para los dems su total desaparicin. Esquemticamente podra decirse que el paradigma epidemiolgico responde ms a las primeras seis dcadas del siglo pasado; el paradigma social de los setenta hasta los ochenta (en general desde la oposicin al Estado) y el econmico gerencial a los noventa. Hay imbricaciones entre ellos en todas las etapas sealadas, expresin de lo macro, de la heterogeneidad del desarrollo y de los actores que se involucran en el mismo y de las contribuciones parciales de cada uno de los paradigmas a la explicacin del fenmeno salud-enfermedad y de las caractersticas de las respuestas sociales y sectoriales hegemnicas de cada perodo.

156

La promocin de la salud en el siglo XXI

Mucho tiempo pas para que las ideas de Sigerist sobre la salud pblica, la medicina social y concretamente sobre la promocin de la salud se retomaran -al menos tericamente- en los discursos acerca del desarrollo econmico y social, y en algunos casos formara parte de las agendas de los polticos encargados de conducir los procesos de desarrollo de la salud. De alguna manera, se empezaron a cuestionar las bases conceptuales, metodolgicas y operacionales de lo que se entenda por salud. Por muchos aos, los sistemas de proteccin social de la salud haban sido reducidos a un espectro institucional, cuyo referente emprico los constituan los ministerios de salud, u otras instituciones similares, que organizaban la respuesta frente a las enfermedades y a los riesgos de enfermar, morir o quedar discapacitado, a travs de recursos humanos calificados, organizados en establecimientos ms o menos sofisticados tecnolgicamente, que atendan las demandas de enfermos o personas con alguna dolencia o que perciban la necesidad de acudir en bsqueda de un criterio o ayuda profesional. Se fundamentaron estos desarrollos, muy incompletos en muchos pases de Amrica Latina, en los pilares bsicos del conocimiento cientfico dominante (toda vez que al discurso mdico social jug un papel contestatario, muchas veces) aplicado a la salud: la epidemiologa y la administracin de sistemas y servicios de salud. La salud era tema de los mdicos y otras profesiones y tcnicas afines, pues la salud se defina a travs de la enfermedad, la discapacidad y la muerte. La salud bajo estos paradigmas se propuso la tarea social de evitar y prevenir y cuando ello no fuera posible curar, y rehabilitar. De alguna forma, y a pesar de que los paradigmas dominantes pusieran el nfasis reduccionista en la enfermedad y no en la salud, en estos aos se conform la visin de la responsabilidad estatal con la salud, la salud como un derecho humano fundamental, los ministerios de salud e institutos de seguridad social de la Europa de posguerra, reforzaron su desarrollo, y lograron cobertura universal de muchas prestaciones. Ello tuvo una influencia determinante sobre Latinoamrica y el Caribe, e hizo que la salud tuviera una atencin ms dedicada en nuestros pueblos, que antes de 1945, preocupacin que se hizo un poco mayor a partir de 1960 con la Alianza para el Progreso.

157

La Salud PbUca Hoy

El Informe Lalonde Una de las primeras consecuencias polticas prcticas de la promocin de la salud fue el Informe Lalonde de 1974^, que se bas en las ideas de Sigerist y en los desartoUos tericos y metodolgicos de Thomas McKeown, herencia ambos del paradigma mdico social. Este ltimo autor planteaba que las mayores influencias para el cambio de la salud en Inglaterta y Gales provenan, en orden de importancia, de la reduccin del tamao de la familia, el incremento de la disponibihdad de alimentos, de un medio ambiente ms saludable y, por ltimo, de las medidas preventivas y teraputicas especficas'El Informe Lalonde identific, sobre la base de las ideas anteriores, lo que se denomin como el campo de la salud, con cuatro grandes determinantes: ambiente, estilos de vida, biologa humana y organizacin de los servicios de salud. Ello aunque constituy un avance en relacin con la visin mdico centrista de la salud enfermedad humana, deriv en algunos casos en culpabilizar a la vctima con su propia salud, al ponerse un nfasis primordial en los estilos de vida individuales, sobre todo por la lectura que se hizo de los estilos individuales de vida en los Estados Unidos. A pesar de las crticas que se le realizan hoy al Informe Lalonde, a partir del mismo se hace un reconocimiento de que salud es un proceso social complejo que trasciende a los servidos de salud, y que ello debe tener expresin poltica concreta en el accionar de los ministerios de salud y de otros actores gubernamentales y sociales. Otra contribucin importante es el lanzamiento pblico de la promocin de la salud, como pohtica pbhca saludable, de manera tal que estos conceptos comienzan a tener implicaciones para la adopcin de polticas de salud, y sin lugar a dudas se inicia un proceso de cambio en las actitudes en salud, la intersectorialidad y la participacin social. ' ( Dentro de las crticas que se realizan al Informe Lalonde y sus consecuencias polticas e institucionales, en los procesos nacionales de desarrollo de la salud estn que: '; " '.

^ '

Debe su nombre al Ministro de Salud, Maic Lalonde, bajo cuyo mandato se elabor el informe "Una Nueva Perspectiva sobre la Salud de los Canadienses ", conocido como Informe Lalonde. McKEON, T. The Rol of Medicine : Dream, Mirage orNemesis. Oxford: Basil BlackweU. 1976.

158

La promocin de la salud en el siglo XXI

1. El concepto de ambiente tal como se present en el campo de salud de Lalonde, funde lo fsico y natural con lo econmico y social, lo cual de hecho disminuye la importancia de los factores socioeconmicos y pohticos, que son preponderantes en la determinacin de la salud enfermedad humana, al situarlos al mismo nivel de determinacin causal que lo natural y lo fsico. 2. Los estilos de vida individuales no ponen un adecuado irfasis en la determinacin social de las conductas humanas, con lo cual no se permite visuahzar adecuadamente la importancia del acceso a los beneficios del desarrollo y a las oportunidades de vida, para la generacin de condiciones materiales y culturales, substrato innegable de muchas conductas individuales, familiares y colectivas. 3. Las consecuencias polticas del Informe fueron ms pertinentes para realidades del mundo industrializado que para las condiciones de nuestros pases en vas de desarrollo o emergentes, como se les denomina hoy. Debe partirse de que el acceso a servicios bsicos de educacin, salud e infraestmctura sanitaria es prcticamente universal en la mayora de los pases capitahstas industrializados, de manera tal que la promocin de la salud se nutre de contenidos diferentes, que los que demandan nuestras realidades econmicas, pohticas y sociales. No obstante lo anterior, algunas de estas crticas se le hacen a Lalonde, incluso, desde la visin de salubristas* procedentes de los pases econmicamente desarrollados, en el entendido que en la dimensin social y humana del desarroUo falta mucho por lograr y el aparato conceptual de Lalonde era insuficiente para disear plataformas polticas, tcnicas y sociales diferentes. A partir de 1974 se han venido sucediendo desartoUos que, sin negar las contribuciones del campo de la salud de Lalonde, han ido complementando vacos y preparando el camino para el surgimiento de un nuevo paradigma que algimos Uaman la Nueva salud pblica^ todava no muy bien definida en sus contomos y que otros prefieren denominar como Produccin social de la salud, en clara referencia a la salud como un producto y un proceso social.

* '

GLOUBERMAN, S. Towards a New Perspective on Health Pocy. Canadian PoUcy Research Networks. Inc., Ottawa, ON, 2001. ASHTON J ; H. La Nueva Salud Pblica. Masson S.A. Barcelona, 1990.

159

La Salud PbUca Hoy

Figura 4.2

1 Informe Lalonde
El campo de la salud

/^ / \

Estilos de Vida Ambiente

Biologa humana Cuidados de

^v \ J

salud

De tal manera los cuatro cuadrantes (o mbitos de trabajo) del campo de la salud se han sometido a varias consideraciones, adicionales a las anteriormente sealadas: 1. No son compartimentos estancos y existen vasos comunicantes entre ellos. Lo social no est aislado de los comportamientos individuales y entre lo biolgico, lo psicolgico y lo social se establece una relacin sistmica de carcter dialctico, que impide su caracterizacin aislada. 2. La complejidad de lo socio demogrfico que tiene dimensiones tnicas, de gnero, etreas, de ubicacin espacial de la pobreza, migraciones, tamao de la familia, entre otros. 3. La complejidad de lo socioeconmico, con sus dimensiones educativas, generacin de ingresos, ocupacin, vivienda, movihdad social, clases sociales, bienestar famihar y comunitario, marginalidad y exclusin, condiciones materiales y culturales de vida y distribucin de riqueza. 4. La complejidad del entomo social, atravesada por redes sociales de apoyo, constmccin de capital social, salud ocupacional, vivienda y urbanismo, rurahdad, violencia social y acceso a servicios de salud, entre otros.

160

La promocin de la salud en el siglo XXI

5. La complejidad de lo psicolgico, con sus dimensiones de conductas promotoras y destmctoras de salud, stress, personalidad humana y sus interrelaciones con las otras esferas. 6. La complejidad de lo poltico, que tiene que ver con la dinmica del poder en instancias nacionales, intermedias y locales, con el empoderamiento ciudadano con su salud y con la gestin y control social de la gestin de instituciones; con el trabajo de abogaca con parlamentos nacionales y asambleas departamentales y municipales, organismos intemadonales, y la inclusin de la salud en la agenda poltica. 7. La complejidad de lo sectorial de salud, con sus dimensiones de servicios de salud, docencia y formacin de talento humano, investigacin y desarrollo de dencia y tcnica y participacin social en salud. 8. La complejidad de lo intersectorial que involucra a distintas lgicas de desarrollo, el dilogo entre las mismas en pro de una mayor generacin de bienestar y calidad de vida de la poblacin. Otro hito en este camino es la Conferencia Intemacional de Ottawa sobre Promocin de la Salud^, en 1986. En ella se suscribi la conocida Carta de Ottawa que plante que la promocin de la salud proporciona a la gente los medios necesarios para mejorar su salud y adquirir mayor control sobre eUa. Asimismo, se plantean una serie de prerrequisitos para la salud tales como la paz, la educacin, la vivienda, los ingresos de la poblacin, un ecosistema estable, la justicia social y la equidad en el acceso a los beneficios del desarrollo. En esta misma Conferencia se plantearon como elementos clave para la implementacin de la Promocin de la Salud; la formulacin de polticas pblicas saludables, la creacin de ambientes fsicos, sociales y culturales favorables, el fortalecimiento de las acciones comunitarias y de la participacin social en las decisiones y las acciones de promocin de la salud, el desarrollo de aptitudes personales para tomar decisiones saludables y soportar presiones negativas para la salud y la reorientacin de los servicios de salud para hacer mayor nfasis en la promocin.

Carta de Ottawa para la Promocin de la Salud. 17-21 de noviembre de 1986. Ottawa, Ontario, Canad.

161

La Salud PbUca Hoy

Las ciudades y municipios saludables Surge este movimiento en Europa en 1986, centrado fundamentalmente en las ciudades''. Se inicia su introduccin en Latinoamrica y el Caribe ese propio ao, pero crecientemente se va adoptando con la cormotacin de municipios saludables, sobre todo a partir de los noventa. Este movimiento de los municipios saludables se inserta en un ambiente latinoamericano de descentrahzacin y sistemas locales de salud, primero, y luego tienen que acomodarse al de reforma de los sistemas de salud, muchas de ellas orientadas en los esfuerzos macropolticos y macroeconmicos de corte neoliberal, que impide, en muchos casos, que maduren los municipios saludables en toda su potencialidad, toda vez que los recortes de funciones pbhcas, la privatizacin, descentralizacin y asuncin de nuevas funciones, pusieron en tensin a los gobiemos municipales y les dej poco margen de actuacin para asumir los desafos del desarrollo municipal, con im enfoque de promocin de la salud. Algunos muy buenos esfuerzos tropezaron con los desafos de la debilidad gerencial para las nuevas funciones, con las coberturas insuficientes de servicios pblicos bsicos, con la insuficiencia de fondos y las pocas posibilidades de movilizar nuevos, sobre todo en municipalidades pequeas, lo cual hizo que quedaran como esfuerzos aislados, que con contadas excepciones, respondan a una dinmica local, de alcaldes o secretarios de salud comprometidos con el proceso, pero no suficientemente apoyados desde las instancias intermedias y nacionales de salud, ni adecuadamente empoderados en la sociedad civil organizada, que asegurara su sostenibihdad. Falt muchas veces, adems, una clara definicin, adaptada a las reahdades latinoamericanas, de lo que se entenda por municipio saludable. En ocasiones se estableci una competencia artificial entire enfoques de promocin de la salud y de desarrollo de servicios, de manera que se gener una confusin entre sistemas locales de salud y municipios saludables, que no facilit el desarroUo municipal de la salud. No puede pensarse que un municipio sea saludable mientras los servicios de salud, no funcionen adecuadamente. Aunque todos sabemos que la influencia de los factores extrasectoriales sobre la determinacin de la salud puede ser ms importan-

ASHTON, I. Ciudades sanas. Masson, S.A Barcelona, 1993.

162

La promocin de la salud en el siglo XXI

te sobre los resultados de salud que el propio desempeo de los servicios, es impresentable ante gran parte de los otros actores sociales que pretendamos generar procesos de producdn social de la salud que involucre a otros sectores del desarrollo econmico y social, a la sociedad civil y sus actores organizados, a los gobiemos locales y departamentales o provinciales (segn las realidades de que se trate), y que salud no sea capaz de cumplir con su deber de asegurar la atencin en los servicios de salud de la poblacin que tiene asignada. Si no somos capaces de asegurar la inmunizacin de todos los gmpos que deben estar vacunados, de asegurar la atencin adecuada del parto, la atencin prenatal de la gestante, y la postnatal para la parturienta y para el recin nacido, por solo poner unos pocos ejemplos, mal podremos convocar a otros actores del desarrollo, porque nos faltar poder de convocatoria basado en la credibilidad y la legitimidad. El poder de convocatoria del sector salud a otros sectores debe basarse en el cumplimiento de sus deberes sociales y ello lo mide la opinin pblica a travs de la satisfaccin de necesidades y demandas concretas de salud y de servicios de salud y de los resultados de salud obtenidos. Los pohticos locales, departamentales y nacionales son los lderes naturales de salud y, por tanto, los que tienen que convocar y negociar con los distintos sectores y actores del desarrollo, y su participacin ser mayor o menor en la medida en que tal gestin tenga credibilidad social y acreciente su legitimidad como polticos. Y los polticos miden el xito sobre la base de resultados, que son los que mantienen su vigencia como polticos. La implantacin de las polticas pblicas saludables y la promocin de la salud Las concepciones de la promocin de la salud basadas en la medicina social, implican la formulacin de polticas pblicas saludables, la intersectorialidad y la participacin social en las decisiones y las acciones de promocin de la salud. Pero precisamente en este campo conceptual se producen diferencias acerca de la promocin de la salud. Segn Helena Restrepo^, uno de los problemas presentados fue "el surgimiento de dos corrientes, cada una de las cuales privilegia una dimensin de la Promodn

RESTREPO, H., MLAGA, H. Promocin de la salud: cmo construir vida saludable. Editorial Mdica Panamericana. Bogot, 2001.

163

La Salud PbUca Hoy

de la Salud; una de las cuales, especialmente fuerte en Estados Unidos, prioriza los cambios de comportamientos o estilos de vida mediante intervenciones individuales; la otra defiende la accin socio-poltica que involucra ms actores y trasciende al sector salud; en esta corriente se han ubicado ms los canadienses y europeos, con el desarrollo de experiencias ms integradas y multisectoriales como las ciudades saludables". La formulacin de polticas pblicas saludables significa que se trasciende el mbito meramente institucional de salud, conformado por las redes de servicios pbhcas y privadas, que incluso se amplifica la accin ms aU del mbito sectorial para definir polticas pblicas ligadas al bienestar y la calidad de vida de la poblacin. Se involucra en las mismas a entes gubernamentales y no gubemamentales, de diferentes sectores del desarrollo nacional o subnacional, del Estado y la Sociedad Civil, pblicos y privados en el entendido que el mejoramiento, la promocin y la proteccin de la salud incluye al conjunto de acciones desartoUadas por distintos actores que tienen que ver con la produccin social de satisfactores de necesidades humanas y con el acceso a los beneficios del desarroUo poltico, econmico, social y cultural. La formulacin, ejecucin y evaluacin participativa de polticas pblicas saludables se produce en medio de procesos sociales, de naturaleza poltica, en los cuales se negocian y concertan objetivos y metas de desarrollo de naturaleza intersectorial. La ejecucin de polticas pbhcas saludables es la que permite concretar acciones tendientes a mejorar los ambientes fsicos, sociales y culturales, a empoderar a la poblacin con su salud y hacer realidad que los gmpos humanos e individuos desarrollen actitudes y aptitudes que favorezcan su salud y pongan nfasis en los factores protectores de la misma, humanicen sus relaciones interpersonales y sociales y se transite hacia modos y estilos de vida individual y social promotores y protectores de la salud, que a la vez que desarroUan niveles de salud superiores, constmyen ciudadana, potencian la cohesin social y fomentan la solidaridad. Un tema que levant la promocin de la salud ha sido el de la reorientacin de los servicios de salud hacia la promocin. Ello significa un cambio de cultura importante de los servicios, que tienen que poner ms nfasis en las necesidades de salud de la poblacin y en la determinacin compleja de la causalidad cultural, econmica y social de la salud-enfermedad humana y por tanto en las acciones mdicas, sanitarias, epidemiolgicas, culturales, econmicas y sociales necesarias para mejorar la salud humana.

164

La promocin de la salud en el siglo XXI

La declaracin de Santa Fe de Bogot Un hito latinoamericano importante lo constituy la Declaracin de Santa Fe de Bogot que trat de acomodar el discurso de la promocin de la salud a las realidades de Latinoamrica y el Caribe, el continente ms desigual e inequitativo del mundo. En esa memorable reunin celebrada en 1992 en Bogot, se hizo una declaracin pblica acerca de las inequidades en salud, como desigualdades innecesarias, evitables e injustas, y se plante la necesidad de movilizar los esfuerzos gubemamentales y sociales hacia la formulacin, ejecucin y evaluacin de polticas pbhcas saludables que permitieran eliminar o disminuir las inequidades en salud, a la vez que facilitaran un mayor acceso a las oportunidades de vida y al control ciudadano sobre la salud y sobre la gestin de las instituciones responsables de las polticas pblicas intersectoriales. Conclusiones a las que se va llegando a partir de los desarrollos anterores Como punto de partida de estos desarrollos se concibe a la salud pblica como una prctica social intersectorial que propende a lograr un desarrollo humano sostenible, en el cual la salud es vista como un eje o mdula del desarrollo y que slo es alcanzable si se vislumbra dentro de un pacto social negociado y concertado entre actores gubemamentales y no gubemamentales, entre el Estado y la sociedad civil organizada. Figura 4.3
Prctica social intersectorial y polticas pblicas saludables

Pacto social por la salud

165

La Salud PbUca Hoy

De esta manera, la promocin de la salud tiene relaciones intrnsecas con la poltica y el poder, de forma tal que los gmpos sociales e individuos logren un mayor control sobre los procesos polticos, econmicos y sociales a travs de los cuales se genera la vitalidad, como capacidad creadora de participacin y apropiacin de los productos y beneficios del desarroUo humano. Es por ello que en las concepciones modemas de la promocin de la salud, la misma se ve como un elemento fundamental de la agenda poltica a travs de la cual se deciden los procesos de produccin, reproduccin, consumo y apropiacin humana de los beneficios del desarrollo poltico, econmico, social y cultural en nuestras sociedades. Estos desarrollos requieren de la democracia participativa en todas las fases del proceso de definicin, ejecucin y evaluacin de las polticas econmicas y sociales. La nueva salud pblica .. , ..^ _ ....

Si seguimos la trayectoria del discurso altemativo que desde hace ms de dos siglos vincula a la salud con el desartollo y con los procesos econmicos, pohticos, sociales y culturales, podemos decir que una nueva salud pblica sera aquella que se concibiera como confomiada por el conjunto de medidas polticas, econmicas, sociales, culturales, epidemiolgicas, sanitarias y mdicas ^ dirigidas a proteger y mejorar el estado de saliui de la poblacin, a la vez que disminuyen las brechas existentes entre los distintos grupos sociales y fomentan la inclusin, la integracin y la cohesin social. Figura 4.4
Seguridad y Saciedad
Poder Poltico

<
^ArahiCTiie

Educacin ^ ^ ^ N u t r i c i n

^ ^ ^ ^ C o n v i v et>cia Q"

^ ^

--^ ^
\ivlciula

Procesos Sociales de Produccin. Distribucin y Consumo

S<rvrw deSdd

~' y

ParticipaciD Social

Las medidas "mdicas" incluiran a las de todos los trabajadores de la salud: mdicos, enfermeras, trabajadores sociales, educadores, odontlogos, administradores, agentes comunitarios y otros, que forman parte de los equipos de salud intramurales y extramurales que conforman las respuestas sectoriales de salud.

166

La promocin de la salud en el siglo XXI

La asuncin de estos desafos tiene dhnensiones conceptuales, metodolgicas y operacionales complejas de las que hay que dar adecuada cuenta, sin lo cual la amplitud que se le d a la promocin de la salud puede quedar reducida o mutilada. Los sistemas de salud usualmente son reducidos al espectro institucional de los reguladores, financiadores y proveedores de servicios de salud, es decir, los ministerios de salud, sus representantes territoriales, las instituciones financiadoras y aseguradoras y las redes de servicios de salud, que atienden las enfermedades y reahzan algunos programas de "salud pblica". Quedan por fuera de esta concepcin, todos aquellos sectores y actores que influyen de forma determinante en el bienestar social y la salud, tales como, instituciones relacionadas con promocin del empleo y seguridad social, vivienda, salud ambiental, cultura, deportes y recreacin, planes de desarrollo territorial, desarrollo vial, desarrollo cientfico y tecnolgico, comercio intemo y exterior, entre otros. Y, por supuesto, en esa concepcin la poblacin es un objeto de atendn o un usuario de servicios y programas. En el paradigma de la Nueva salud pblica basada en la promocin de la salud, los sistemas de salud son aquellos arreglos institucionales intersectoriales que permiten la formulacin, ejecucin y evaluacin de polticas pblicas saludables. Ello conlleva la generacin de capacidades para la conduccin y gerencia de polticas intersectoriales, de poder de convocatoria para la negociacin y concertacin interinstitucional, de abogaca por la salud, de inclusin de la salud en las agendas polticas, que permitan avanzar en la conformacin de ese "sistema de salud" de nuevo tipo, como subsistema funcional del todo social cuyo objetivo sea el mejoramiento y la proteccin social de la salud de la pobladn, concebida como vitalidad social. De tal forma, se concibe a la salud como un proceso social que produce y reproduce la vitalidad humana, colectiva e individual, con sus diferentes dimensiones econmicas, sociales, culturales, polticas, de comportamiento, epidemiolgicas y sanitarias, que determinan el nivel y las expresiones diferenciales del estado de salud. La promocin de la salud, entonces, es una herramienta para la estructuracin de las respuestas sociales ante los problemas de salud de la poblacin, con acciones locales, intermedias y nacionales, individuales, familiares, comunitarias e institucionales, sectoriales de salud e intersectoriales, polticas y tcnicas, estatales y no estatales.

167

La Salud PbUca Hoy

Con un enfoque de promocin de la salud como el que reseamos, la salud de la poblacin tampoco puede ser reducida a las manifestaciones clsicas de morbilidad, mortalidad y otros indicadores demogrficos, nutricin, crecimiento y desarrollo fsico y funcional y discapacidad, ni a indicadores sintticos elaborados estadsticamente, que resumen el nivel de salud de pases, regiones, localidades y gmpos sociales. Los elementos productores de salud o generadores de enfermedad son consustanciales a la vida social de los individuos y gmpos sociales y a la insercin diferencial de los mismos en los procesos productivos, mediante el cual se apropian los productos del trabajo y acceden a los beneficios del desarrollo, materiales o espirituales. Si la complejidad del objeto de estudio es esa, la promocin de la salud tiene que dar cuenta de esas dimensiones, al plantearse los problemas de salud, las prioridades y los objetivos de trabajo, estrategias de intervencin y modos operacionales de abordarlos. A este enfoque conceptual y metodolgico hay quienes lo llaman produccin social de la salud, pues en las distintas manifestaciones de la actividad vital de los individuos y gmpos sociales se constmye la vitalidad para participar en la vida social y realizarse en ella. Incluye esferas como la laboral, ideoespiritual, sociopoltica, cultural, familiar, relaciones interpersonales, uso del tiempo libre y otras, de vital importancia para la promocin de la salud. Por ello, las respuestas sociales ante problemas de salud no se restringen a las acciones de las instituciones de salud, sino que involucran el acceso a oportunidades de vida y a la distribucin equitativa de los beneficios del desarroUo con justicia social y solidaridad. Figura 4.5 Desarrollo econmico y social.

168

La promocin de la salud en el siglo XXI

La participacin social organizada: un enfoque metodolgico de sujetos de desarrollo Es concebida como la acumulacin de poder poltico para la negociacin y concertacin de acciones en salud, en la cual la misma no slo sea reducida a la atencin de las enfermedades, mediante el acceso y la utilizacin de servicios de salud y tecnologa mdica, sino a la generacin de procesos sociales de produccin social de la salud. La participacin social organizada cuenta con los gmpos sociales que ven representadas sus demandas e intereses en los procesos intersectoriales que apuntan a mejorar el bienestar social y la calidad de vida de la poblacin y, fX)r ende, la vitalidad individual y social. La participacin social organizada se diferencia de la manipulacin de la poblacin y su utilizacin como mano de obra barata para extensin de cobertura de servicios de salud y obras de saneamiento ambiental u otras acciones de ejecucin puntuales y pone el nfasis en la poblacin como sujeto de su propio desarrollo. Si la salud se integra en los planes de desarrollo local y los gobiemos municipales, sociedad civil y los gmpos sociales organizados conjugan esfuerzos y responsabilidades con el Estado y otros actores gubemamentales y no gubemamentales, para conducir, gerenciar y evaluar las acciones de salud'" y del desartollo humano, la pobladn crecientemente se empodera con su salud y acta como sujeto de desarrollo. La promocin de la salud que se proponga la bsqueda persistente de la salud para todos, no podr obviar este enfoque metodolgico que no es restrictivo a salud, sino a los esfuerzos por el desarrollo humano local sostenible e irteversible. Los sujetos sociales empoderados con salud defienden el derecho humano fundamental a la salud y al bienestar fsico, mental y social y promueven la democracia participativa en los sistemas de salud locales y nacionales. Slo as la poblacin transita el camino necesario para cerrar la brecha entre su actual condicin de objeto de atencin, sin derechos reales, y la de sujeto del desarrollo de la salud.

GRANADOS T.R. Las reformas neoliberales de los sistemas de salud. Tesis de doctorado en salud pblica, marzo del 2001 (En prensa).

169

La Salud PbUca Hoy

La reorentacin de los servicios de salud con enfoque de promocin de la salud Las concepciones microeconmicas de la atencin gerenciada, la competencia regulada y la definicin de paquetes bsicos y conversiones de subsidios de oferta en subsidios a la demanda y la focalizacin en los pobres, gener mucha confusin. La salud pblica se limit a algunas acciones colectivas dentro de planes de beneficios, se cosific o simplemente se redujo a una mercanca y se divorci lo individual de lo colectivo, la promocin y prevencin de la curacin, y el desarrollo local de salud se distanci de la finalidad sustantiva de obtencin de resultados de responsabilidad pbhca. La promocin de la salud se redujo en su espectro y'se concibi como intervenciones de educacin y comunicacin social, ante problemas de salud pblica con alta extemalidad positiva o negativa. Muchas veces, adems se extemaliz de los servicios de salud, como acciones que se podan contratar con instituciones pbhcas o privadas, fuera del sector salud. Por ello el tema de la reorientacin de los servicios de salud con enfoque de promocin de la salud no puede verse divorciado de los modelos de atencin regionalizados y descentraUzados", tema que toma nueva actualidad, ya que hay que retomar las acciones de promocin de la salud y de salud pblica en los niveles locales, integrar la atencin de salud, refundiendo momentos tcticos inseparables (promocin, prevencin, curacin y rehabilitacin), recuperar la atencin continuada y progresiva, el enfoque epidemiolgico activo ante problemas de salud y el trabajo comunitario, utilizando las bondades de la descentralizacin y la regionalizacin de la salud pblica. Los modelos locales tambin tienen que retomar el concepto de reas de responsabilidad, muy deteriorado en los esquemas de salud basados en la actuacin de leyes de mercado, que no respetan la divisin poltico administrativa, enfoque territorial indispensable para la promocin de la salud, la epidemiologa, la gerencia de los servicios de salud, la produccin social de la salud y la democracia participativa en salud. En las reas de responsabilidad debe existir la tecnologa adecuada organizada en redes locales de salud, de acuerdo a criterios tcnicos de organizacin en base a

GRANADOS T.R. Las reformas neoliberales de los sistemas de salud. Tesis de doctorado en salud pblica, marzo de 2001 (en prensa).

170

La pronwcin de la salud en el siglo XXI

problemas y al enfoque epidemiolgico; y esas redes locales tienen que prepararse para la negociacin y concertacin de polticas pblicas saludables, que mediante acciones intersectoriales que promuevan el bienestar y la calidad de vida permitan concretar enfoques de promocin de la salud, como la va ms eficaz y eficiente de mejorar el estado de salud de la poblacin con equidad. Los problemas de salud requieren soluciones integrales, muchas de ellas ligadas al desarrollo humano local, y no pueden ser resueltos por un solo nivel de atencin o escaln de complejidad, lo cual no niega que las soluciones con calidad, de los servicios de salud, deben estar lo ms cercanas posibles a la poblacin. El abandono de modelos que funcionen regionalizadamente, a nivel local, con el apoyo poltico, tcnico y logstico de los otros niveles de los sistemas de salud, y que aborden la problemtica intersectorial del desarrollo humano local, explican problemas de salud pbhca como malaria, clera, tuberculosis, rabia humana, ttanos neonatal, difteria y otros, epidmicos actualmente, en varios pases de la Regin. El enfoque de la gerencia social (produccin social de la salud): del discurso a la accin La promocin de la salud requiere de la formalizacin en la prctica de nuevas formas de gerencia social de la salud, que imphque a los nuevos hderes de salud'' en los procesos del desarroUo humano sostenible y rescaten a la salud como un derecho humano fundamental y finahdad sustantiva. La salud es una de las dimensiones del bienestar y la cahdad de vida de la poblacin. Figura 4.6 '^
Gerencia Social
Psa generar: -PoUticas pblicas saludables -Procesos inlerseclorales Para facilitar: -Convenios de cogestin -Control social de la gestin Para lograr: -Empoderamiento ciudadano -Sostenibilidad -Impacto

En esta concepcin, lderes de la salud no es restrictivo a los lderes sectoriales, nacionales o subnacionales, sino que fundamentalmente incluye a poUticos, legisladores y alos propios lderes sociales y comunitarios.

171

La Salud PbUca Hoy

El sector salud tiene que desarrollar el poder de convocatoria con polticos, otros sectores e instituciones de la sociedad civil para el dilogo, la negociacin, concertacin, produccin de consensos y la obtencin de compromisos intersectoriales. La produccin social de la salud significa la cogestin entre instituciones gubemamentales y no gubemamentales, entre el Estado y la sociedad civil y las organizaciones sociales representativas, para que salud y bienestar social sean parte de la agenda poltica del desarrollo humano. Ello implica nuevas formas de liderazgo de salud para la gestin intersectorial y la movilizacin de la voluntad poltica de las autoridades nacionales, intermedias y locales. La promocin de la salud de tal forma contribuye a la gobemabilidad de proyectos de gobiemo, al desartollo institucional y a la consolidacin de la democracia participativa mediante el logro de impacto en el mejoramiento del bienestar y la calidad de vida de la pobladn. Otra dimensin de la gerencia social es el control social y la peticin y rendicin de cuentas, de la'gestin del desartollo que hacen los actores polticos, las instituciones gubemamentales, no gubemamentales, pblicas y privadas sobre la produccin social de la salud'^. La produccin social de la salud es una construccin democrtico participativa en la cual, la poblacin como sujeto de su propio desarrollo, define, ejecuta y ejerce el control social de las pohticas pblicas saludables, enfocadas en el desartollo humano local solidario, cuya finalidad sea la justicia social distributiva, que permita el acceso a los beneficios del desartollo con equidad y se exprese en una mejor vitalidad individual y colectiva de la comunidad. Desafos de la promocin de la salud en el siglo XXI 1. Insertar la promocin de .la salud en las agendas polticas del desarrollo poltico, econmico, social y cultural de los pases y concretarlo en los procesos subnacionales y locales.

13

GRANADOS T.R. Las Reformas Neoliberales de los Sistemas de Salud. Tesis de doctorado en alud pblica, marzo de 2001 (en prensa).

172

La promocin de la salud en el siglo XXI

La lucha contra la pobreza y por la equidad del desarrollo nacional, regional y local, basada en una mayor justicia distributiva, que se exprese en resultados concretos en los modos y condiciones de vida cotidianos de la poblacin, los distintos gmpos sociales, familias e individuos, debe concebirse como un mbito de la promocin de la salud. 3. Que el discurso por la promocin de la salud y la generacin de pohticas pblicas saludables, democrtico participativas, se concrete de manera real en los procesos de desarrollo nacionales y subnacionales. 4. Que las acciones de promocin de la salud no se circunscriban a las redes de servicios de salud sino involucren a la totalidad del tejido social, de los actores estatales y no estatales, gubemamentales y no gubemamentales, a la sociedad civil organizada y a las distintas formas, modalidades e instancias, representativas y sustantivas, de la denriocracia participativa. 5. Que la promocin de la salud retome la lucha de la salud para todos, con todos y por todos, como una meta social irrenunciable, sin reducirla al alcance de una batera de indicadores de salud tradicionales, sino revistindola de toda la complejidad de la vitalidad individual y colectiva. 6. Que la produccin social de la salud sea concebida como acceso real y utilizacin efectiva de los satisfactores de necesidades humanas fundamentales, con equidad. 7. La promocin de la salud tiene que insertarse en la dinmica del desarrollo humano que involucra, de manera complementaria y sinrgica, procesos y responsabilidades globales con procesos y responsabilidades locales. 8. La promocin de la salud tiene que tener en cuenta la heterogeneidad del desarrollo regional y local, econmico y social, cultural y tnico y generar procesos que propendiendo a la armona e integridad del desarrollo nacional equitativo, tome en cuenta las diferencias y ajuste las propuestas polticas, sociales, culturales y tcnicas, a las caractersticas diferenciales del desarrollo. 9. La sohdaridad es un principio de la promocin de la salud que aborda el tema contemporneo de la desintegracin, promueve la cohesin social y convivencia ciudadana. 10. La promocin de la salud tiene que expresarse en resultados: los mismos tienen que ver con polticas pblicas saludables que aborden los problemas de salud de la poblacin, acuerdos o compromisos de gestin entre distintas instituciones y sectores, mecanismos concretos de

1.

173

La Salud PbUca Hoy

participacin social activa y de control social de la gestin de planes intersectoriales de salud y con evaluacin de impacto de polticas pbhcas sobre el estado de salud de la poblacin. 11. El empoderamiento ciudadano con la salud no se reduce a lograr mayor control sobre la salud individual, a travs de mejoramiento de estilos de vida y logro de hbitos y comportamientos ms saludables, sino, adems, a travs de un mayor control social y ciudadano de los procesos polticos, econmicos, sociales y culturales que hacen parte de la reproduccin y distribucin de los beneficios del desarrollo. 12. Por tanto, un desafo importante es lograr mayor control social sobre las polticas pblicas saludables y sobre las instituciones pblicas y privadas relacionadas con su formulacin, ejecucin y evaluacin, as como disear, poner en operacin y ajustar a las dinmicas de los procesos sociales, los mecanismos de peticin y rendicin de cuentas ciudadanos (accountability). 13. Las polticas y estrategias de promocin de la salud pueden y deben ser una contribucin social importante para la profundizacin de la democracia participativa nacional, regional y local.

174

Teoras y prcticas en promocin y prevencin


MERY CONSTANZA GARCA

1. Teoras en promocin y prevencin Los desarrollos tericos de promocin de la salud y prevencin de la enfermedad, han sido muy incipientes, realmente no hay formulaciones sistemticas y ordenadas que permitan aseverar la existencia de cuerpo terico riguroso que las identifique como tal. A nivel intemacional y nacional, existen definiciones, acuerdos, cartas, programas y hasta legislaciones que se han encargado de dar orientaciones de orden prctico y estratgico. Haciendo una lectura de esas propuestas, se pueden inferir los posibles enfoques tericos que existen en cada una de ellas. A continuacin propongo una clasificacin de las tendencias tericas que se han vislumbrado en promocin y prevencin (P y P ) : 1.1. El enfoque clnico Los principales exponentes de este enfoque son Leavell y Clark en sus estudios sobre la historia natural de la enfermedad, quienes proponen tres niveles de prevencin, que corresponden a las etapas que preceden la aparicin de la enfermedad.

177

La Salud PbUca Hoy

Este enfoque, adems, se caracteriza porque las acciones se desarrollan en el mbito hospitalario, son dirigidas a los individuos sospechosos de enfermar y la atencin es dada por el personal de salud. La concepcin de prevencin es evitar y diagnosticar a tiempo las enfermedades y las posibles complicaciones. Por eso se realizan todo tipo de exmenes chnicos, qumicos y fsicos para hacer diagnsticos, controles, seguimientos, terapias e inmunizaciones. Ejemplo de ello son los programas de vacunacin, la educacin al paciente sobre su enfermedad, los controles prenatales, los controles de crecimiento y desartollo, y los controles de hipertensos, diabticos etc. En este enfoque la prevencin esta ntimamente ligada al modelo clnico, por eso cuando se realizan evaluaciones de los logros en salud, se hace a travs de indicadores como el aumento de consultas, exmenes, controles y recursos. En este enfoque desaparece la promocin de la salud y toma relevancia la prevencin de la enfermedad. Por tanto, aspectos de interdisciplinariedad e intersectorialidad no tienen cabida en esta tendencia. Este enfoque, es el que ms ha influenciado los sistemas de salud y los modelos de atencin del mundo occidental. Los pases pobres han adoptado, sin mayor anlisis y coherencia con su realidad, esos modelos. 1.2 Enfoque funcional: La P y P son concebidas como funciones de la medicina Sigerist en 1941, propuso cuatro funciones de la medicina: prevencin de la enfermedad, promocin de la salud, restauracin y la rehabilitacin del enfermo. Tambin fue el primero en utilizar de manera explcita las palabras promocin de la salud y prevencin de la enfermedad. Este enunciado asocia en primera instancia la promocin a la salud y prevencin a la enfermedad. De esa asociacin terica se puede interpretar que Sigerist diferencia la promocin de la prevencin y les da el mismo tratamiento categorial.

178

Teoras y prcticas en promocin y prevencin

Sigerist, adems de concebir la P y P como funciones de la medicina, sugiere crticamente que " la salud no es meramente la ausencia de la enfermedad". Asocia de manera importante la salud con la vida y dice que "la salud es una actitud favorable hacia la vida, es una aceptacin entusiasta de la responsabilidad que la vida impone a las personas". Por tanto, se debe "promover y fomentar niveles de vida adecuados, buenas condidones de trabajo, ejercicio fsico y los medios para la recreacin". Para lograr esa meta, Sigerist, es consciente que se requiere de la participacin de grupos expertos en asuntos de salud, entre los cuales menciona a polticos, mdicos educadores e industriales. Los aportes de Sigerist para la P y P son estratgicos, en la medida que propone tener una visin ms amplia de la salud y de la medicina. Sigerist tambin asocia la salud con la promocin de niveles adecuados de vida; de esta manera, la promocin juega un papel vital en la dupla interdependiente salud-vida. Por eso Sigerist dice que en la promocin deben participar todos aqueUos gmpos que tengan algn compromiso con fomentar niveles de vida adecuados. El hecho de colocar P y P como funciones de la medicina hace que su desarrollo dependa de las interpretaciones y prcticas mdicas y estas, a su vez, dependern de los desarrollos que tenga la salud. 1.3. Enfoque colectivista Esta tendencia se observa en los planteamientos que subyacen en los programas que se dirigen hacia colectivos y en espacios extra hospitalarios. Los programas que mejor indican este enfoque son los de escuela saludable, barrio saludable, municipio saludable y otros dirigidos a poblaciones especiales como: ancianos, niez, adolescencia y familia. Como se observa, esta prctica se aleja de la idea de modelos de atencin de tipo individual, hospitalario y se aproxima de manera ms coherente a una prctica tipo programas o proyectos de cobertura masiva. El tiempo y el espacio se amplan de manera significativa, puesto que las intervenciones se hacen a mediano y largo plazo y en espacios extra hospitalarios.

179

La Salud PbUca Hoy

Este tipo de proyectos retoman aspectos de promocin y de prevencin. De todas maneras, se observa una fuerte tendencia de asociar la P y P con la educacin en salud para colectivos; la participacin comunitaria juega un papel importante y las acciones de p y p tendrn ms xito si la comunidad se identifica con este tipo de proyectos, entonces as podr apropiarse de ellos y hacerlos sustentables. A pesar de los grandes avances que hay para la P y P con esos proyectos, se contina bajo la tutela de los profesionales de la salud, quienes apenas empiezan a ceder y lo compartir su espacio con el sector educativo y a coordinar acciones entre instituciones. 1.4. Enfoque multisectorial e interdisciplinar

El hecho de abordar la salud con otros componentes como son: la salud ambiental, salud y desarrollo, la ingeniera sanitaria, la higiene y seguridad industrial, la salud ocupacional y la salud ecolgica, ha obligado a mirar la salud desde otras disciplinas diferentes a las ciencias biolgicas en las que reposa el saber mdico-clnico. De esta manera, hay una incipiente participacin de otras disciplinas y profesiones en el sector salud. Esos abordajes han permitido crear un germen de interdisciplinariedad al interior del sector salud y una ligera aproximacin entre ambiente, educacin y trabajo. Este enfoque tiene mucho por aportar a la promocin y prevencin tanto en lo prctico como en lo terico, pues el hecho de abordar las dimensiones ambiental, econmica y cultural obliga a repensar las prcticas sectoriales que han dominado en la promocin y la prevencin. Los aportes ms significativos se pueden valorar al incluir nociones de sustentabilidad y de lo pblico por parte de lo ambiental; esto se observa en los postulados que dicen: "Acabar con los recursos naturales de manera irracional es comprometer la salud y vida de las futuras generaciones" y "La contaminacin del medio ambiente afecta a los colectivos poblacionales". Es as como las nociones de tiempo y espacio se amplan, pues la idea de sustentabilidad induce a actuar en el tiempo a largo plazo y el medio ambiente se asume como espacio abierto, aproximndose a la nocin de espacio pbhco.

180

Teorias y prcticas en promocin y prevencin

Esta visin es una de la ms amphas en cuanto a la P y P, en gran medida porque esas otras disciplinas y sectores han estado por fuera del dominio y monopoho de la medicma y particularmente de la chuica. 1.5 Enfoque estratgico - poltico Este enfoque compromete aspectos de poltica pbhca, economa y salud, desarroUo y salud dentro de la P y P. Se ha enunciado en los lineamientos de salud intemacional y avalada por organismos mundiales como la OMS. Esta tendencia se percibe en los encuentros intemadonales realizados en Otawa (1986), Adelaida (1988), Sundsval (1991), Bogot (1992), Trinidad y Tobago (1993); Yakarta (1997) y las conferencias mundiales de promocin de la salud en Mxico 2000 y Pars 2001. En estos encuentros la promocin ha sido propuesta como estrategia fundamental para la proteccin de la salud pblica y la salud se considera una inversin que contribuye al desartoUo de las naciones. Este enfoque se caracteriza porque: a) identifica el papel y responsabilidades del Estado y de las organizaciones sociales y comunitarias, b) reconoce las causas estmcturales en el proceso salud-enfermedad como la pobreza, la inequidad y el desarrollo en el proceso salud-enfermedad, c) resalta el papel de los actores sociales como las organizaciones comunitarias, la academia, las ONGS, y las instituciones estatales, d) resalta la importancia de la participacin comunitaria, de la intersectorialidad e interdisciplinariedad, e) relaciona la promocin con calidad de vida, estos de vida y comportamientos, f) abarca lo colectivo y lo individual, f) ampla la nocin de espacio contemplando naciones, regiones, pueblos y localidades, g) incluye aspectos ticos (Derechos humanos), y h) asocia la P y P con la salud pbhca. La prevencin casi no es mencionada, le dan un tratamiento mnimo y pareciera que la subordinan a la promocin y educacin en salud. II. Prcticas en promocin y prevencin en el mundo y en Colombia En el ltimo congreso mundial de promocin en salud, se presentaron mas de 160 experiencias y alrededor de 30 temas de promocin de la salud. Esto demuestra que en la prctica hay un resurgimiento muy importante de proyectos sodales y acadmicos, movimientos, estrategias y enfoques que revindican la P y P y la salud pblica.

181

La Salud PbUca Hoy

Para tener una idea de la multiplicidad de prcticas que se estn o se han desarrollado recientemente a continuacin se enuncian algunas: a) Programas: Medio ambiente y salud (agua y salud; agricultura saludable), Hbitos saludables (alimentacin, actividad fsica y comportamientos de salud); Escuelas saludables; Jardn saludable. Universidad saludable, etc. b) Proyectos: contra el tabaquismo, alcohol y prevencin de las toxicomanas, saludbuco dental y prevencin de enfermedades contagiosas (con nfasis en SIDA). c) Propuestas de educacin y formacin en salud: nivel de conocimientos en salud, cualificacin profesional, formacin de profesionales en salud. Pmebas de eficacia en promocin de la salud. d) Otros proyectos: Etnocentrismo y salud, la salud de los iiunigrantes, refugiados, indgenas, desplazados. Salud y paz; salud y violencia, salud y equidad, pobreza y enfermedad, defensa de la salud pblica, papel de los medios de comunicacin en estilos y comportamientos en salud y alianzas estratgicas en salud. (Nota: los proyectos subrayados, se realizan en Colombia) De lo anterior se puede observar que hay una inmensa variedad de temas y proyectos que indican el ampho campo de acdn para la promocin, la prevencin y la salud pblica. Tambin hay un resurgimiento de proyectos con grmenes de interdisciphnariedad, de participacin social y con nfasis en lo colectivo. De todas maneras, a pesar de que existe ese gran campo de accin, se observa que an persisten prcticas conservadoras que presionan para que continen las tendencias reduccionistas dentro del marco de la medicina clnica. Estas tendencias se han visto reforzadas con las reformas neoliberales, las cuales conciben la salud, como un paquete de servicios para atender la enfermedad individual. La situacin de pobreza, violencia, e inequidades de la mayor parte de la poblacin de los pases en desartollo est obhgando a repensar en las prc-

182

Teoras y prcticas en promocin y prevencin

ticas y modelos de salud de tipo hospitalario, lo que a su vez conduce a valorar la promocin y la prevencin, como una estrategia de la dimensin social. Esto significa desligarlas del proceso salud-enfermedad. Conclusiones preliminares de este captulo: 1. A pesar de no existir un cuerpo terico propio para la P y P, se observa que hay grandes avances y fortalezas como por ejemplo: - Existe un enunciado de principios que rigen las propuestas de P y P como equidad, solidaridad, tica en salud, derechos humanos, universahdad y responsabilidad. - Hay un potencial de aportes tericos que provienen de los diferentes campos de accin en los que ha incursionado la P y P, como ambiente, cultura, economa y desarrollo. - Existe un amplsimo campo de accin que incluye aspectos de poltica pblica, programas y proyectos colectivos y de atencin individual. - Existen programas que comprometen a varios sectores como son educacin y trabajo, lo que conduce a pensar en la necesidad de trabajar intersectorialmente, ejemplo de ello son los programas de escuela saludable y la salud ocupacional. - Las nociones de espacio/tiempo se amplan significativamente, para las P y P, pues hay propuestas que comprometen naciones, regiones, localidades, municipios, barrios, jardines, escuelas, universidades y empresas. El tiempo se amplia hacia el largo plazo. - La poblacin colectiva se constituye en eje central de la P y P, por eso los gmpos etreos, la poblacin vulnerable como niez, preescolar, escolares, adolescentes, ancianos, desplazados son objeto central en la PyR - Propone e incursiona con estrategias como la interdisciplinariedad, la intersectorialidad, la participacin comunitaria, la educacin, la investigacin, la comunicacin y las alianzas para defender la salud pblica, entre otras. - Define responsabilidades y actores sociales como: el Estado, la comunidad, los padres, los maestros y los funcionarios. - Compromete diferentes instituciones, las que definen la poltica pblica y las ejecutoras, pblicas y privadas.

183

La Salud PbUca Hoy

2. Tambin existen amenazas y debilidades: Contina la dependencia terica de estudiar la promocin y la prevencin dentro de los enfoques del proceso salud-enfermedad. No existen equipos instituciones y acadmicos dedicados a constmir una unidad y un cuerpo terica propio para la P y P. Persisten confusiones e indiferenciacin terica entre la promocin y la prevencin. Hay debilidad en realizar investigaciones, redes y alianzas. Hay una fuerte tendencia a sobre-dimensionar la promocin y subordinar la prevencin. Hay enfoques reduccionistas que pretenden caracterizar la promocin de la salud slo por las acciones colectivas y la prevencin por acdones individuales. Contina una fuerte tendencia de monopohzar, o subsumir la promocin y la prevencin al enfoque clnico de tipo hospitalario, individual y sectorial. La promocin y la prevencin en razn a su dependencia con el proceso de salud-enfermedad, estn influenciadas por las tendencias polticoeconmicas que permearon las reformas de salud. Es as como la globalizacin y el neoliberalismo, interpretaron la salud como una mercanca privada, globalizada y bajo el dominio de los poderes financieros. El desartollo de teoras y prcticas de la p y p bajo la lgica neoliberal favorece el modelo clnico y descuida o elimina los avances logrados en los programas colectivos, extra-hospitalarios, pblicos, integrales, intersectoriales, interdisciplinares y participativos.

3. En los pases con altos problemas de pobreza, violencia, e inequidades, las prcticas de salud y de promocin y prevencin estn tomando un carcter de tipo social, intersectorial e interdisciplinar y con participacin comunitaria, mientras que los pases desarroUados centran sus prcticas en prevenir los problemas de tabaco, alcohol y de enfermedades degenerativas y cardiovasculares. ' Con este panorama queda un gran intertogante terico: La promocin y prevencin le pertenecen a las disciplinas biologicistas que sustenta el proceso salud-enfermedad?

184

Teoras y prcticas en promocin y prevencin

III. Propuesta desde la academia en la promocin y la prevencin Con el nimo de contribuir a la consti-uccin de un marco propio para la prevencin y promocin se hace la propuesta de integracin terica, metodolgica y prctica. En primer lugar se propone elevar la misin de la promocin y la prevencin hacia el plano de la proteccin de la vida digna de la pobladn que habita el planeta. La centralidad en el estudio de la P y P est alrededor de la vida digna de la poblacin humana y no humana. Esto implica que la promocin y prevencin debe hacerse con criterios que superen las prcticas antropocentristas que abrogan a los humanos el derecho de destmir y explotar la naturaleza para su nico beneficio. Lo anterior sirve para continuar con el enunciado de algunos lineamientos generales de tipo terico, metodolgico y operativo. 3.1 Lineamientos tericos: La vida digna implica tener una prctica cotidiana con altos niveles de conciencia en las relaciones humanas y con la naturaleza. Las reladones con la naturaleza son de respeto y buen trato a los animales y plantas, sustentables y ecolgicas con el medio ambiente. Las relaciones con los humanos se rigen por valores y actos de equidad, justicia, autonoma, responsabilidad, seguridad, sohdaridad, libertad, respeto, derecho, amor y participacin (econmica, social, ambiental y poltica). A continuacin se presentan algunos componentes de la promocin y la prevencin para contribuir a la proteccin de la vida humana en armona con la proteccin de la vida de la poblacin no humana. - La multidimensionalidad e integralidad: Se trata de aceptar que el ser humano es un todo que integra las tres dimensiones: fsica, mental y emocional. Entones el abordaje de p y p exige trabajar en esas dimensiones y no nicamente en lo fsico. - La individualidad y la colectividad: Se hace P y P en individuos y en colectivos.

185

La Salud PbUca Hoy

- El contexto y la multicausalidad: el individuo y los colectivos humanos tienen diferentes contextos: el ambiental, el econmico, el poltico y el cultural, en un tiempo y espacio determinado. Los riesgos y causas de enfermar, morir o tener un deterioro en la vida, dependen en un alto porcentaje de las relaciones y el tipo de contexto que se tengan. Cuando se determinan los riesgos, las causas y las posibles consecuencias se puede actuar estratgicamente en prevencin y cuando se identifican las condiciones y factores protectores para la vida, se puede actuar en promocin. - Lo relacional: Los individuos y colectivos estn en permanentes relaciones con el contexto y con otros seres. Hay relaciones de inclusin o exclusin, de calidad o no, de dominio, de sumisin, de reciprocidad y democrticas entre otras. El tipo y calidad de las relaciones determinan en gran medida las condiciones mentales, emocionales y afectivas de individuos y colectivos. La P y P concibe que los aspectos relacinales son de vital importancia. El tiempo/espacio: El tiempo y el espacio, sirven a la P y P para indicar las acciones oportunas, adecuadas y sustentables. Es en tiempo ex - ante que se hace prevencin pues se debe evitar el evento negativo. Las acciones de promocin se deben hacer oportunamente protegiendo todo aquello que favorece la vida digna.

- Lo estatal e institucional: Las polticas pblicas estatales y el comportamiento institucional definen en gran medida recursos, programas, acciones y cobertura y calidad. El papel que jueguen puede actuar ya sea como factor de riesgo o como condicin protectora para la vida digna. Aproximaciones conceptuales Promocin para la vida digna La promocin para la vida digna, es un proceso que nos invita a promover, asegurar, favorecer, mantener, fortalecer y proteger todo tipo de actividades, acciones, situaciones, relaciones, condiciones y entomos que conduzcan a que la poblacin tenga una vida con dignidad.

186

Teoras y prcticas en promocin y prevencin

Por tanto, en la promocin para la vida digna se debe intervenir integralmente en todos los factores y condiciones: individuales, sociales, institucionales, polticas, econmicas, culturales y ambientales de tal manera que se mantegan, potencien y perduren esas condiciones de favorabilidad y bienestar de la poblacin en el tiempo y en el espacio. Prevencin de una vida indigna Es el proceso de intervencin opormna en todo tipo de acciones, situaciones, relaciones, condidones y entomos que participan deteriorando la vida de la poblacin. Una intervencin oportuna, evita, contrarresta, elimina, disminuye el riesgo de enfermar, morir y vivir indignamente. Por eso es indispensable identificar con anticipacin las posibles causas y riesgos que existen tanto en la dimensin individual como en todo el contexto. En sntesis, se hace prevencin a los riesgos y factores que deterioran la vida de los individuos y comunidades, por ello se debe intervenir en lo individual, familiar, comunitario, cultural, econmico, poltico, social y ambiental, es decir, en combatir la inequidad econmica, la destmccin de la naturaleza, la contaminacin ambiental, la dependencia e injusticia social, la pobreza, el clientelismo y la cormpcin, entre otras. 3.2 Propuesta metodolgica: En correspondencia con los lineamientos tericos, se propone una metodologa que logre cualificarlos en los niveles de conciencia y en los comportamientos de los individuos y comunidades a travs de la sensibilizacin, el conocimiento y la reflexin. Estrategias: intersectorialidad, interdisciplinariedad, organizacin y participacin cualificada de gmpos poblacionales, alianzas estratgicas, investigacin, comunicacin e informacin masiva y cualificada, continuidad, coherencia y sustentabilidad. Propuesta operativa: Se sugieren las siguientes fases:

187

La Salud PbUca Hoy

a) Diagnstico y anlisis estratgico e integral: para intervenir en P y P. Consiste en identificar los procesos que intervienen en la vida digna y analizar las causas y los posibles impactos. Con la siguiente matriz se muestra como se puede hacer un diagnstico y un anlisis estratgico: en las filas se ubican todas las dimensiones y contextos que intervienen en mantener o afectar la vida, y las columnas sirven para separar las condiciones que protegen la vida y cuales actan negativamente. El anlisis, contina con las dos columnas siguientes, una sirve para analizar e identificar las causas que originaron esos estados de proteccin y de riesgo y la otra sirve para proyectar cules son los posibles impactos o escenarios en caso de continuar con las amenazas o factores de riesgo. De esta manera, se puede obtener un panorama, o una visin estratgica e integral de los factores de riesgos y de aquellos protectores. Con esta visin se induce a pensar y proponer estrategias, programas y proyectos integrales.

188

Teoras y prcticas en promocin y prevencin

Tabla 4.1 Diagnstico y anlisis estratgico e integral


Procesos que Protegen la salud y la vida Individual El ejercicio diario Procesos que alteran la S y V Causas Impactos negativos

Familiar

Alimentacin sana y casera Entidades eficientes

Dependencia a la TV Falta de consumo Desempleo de los de alimentos padres Entidades ineficientes y corruptas Polticas privatizadoras de la salud Burocracia Corrupcin Estado dbil, comprometido con intereses econmicos y no sociales

El sedentarismo

Institucional

Estatal

Tener Polticas Pblicas de P y P coherentes

Social

Crear y fortalecer organizaciones y participacin social

Pasividad social. Organizaciones baja capacidad de sociales y lderes, organizacin y amenazados, movilizacin violaitados. Actos rutinarios. sin descansos. actos violentos etc. Contaminacin y destruccin Desprecio a la cultura y a la recreacin Desprecio por la naturaleza anti-opocentrismo consumismo Modelo capitalista de predominio consumista y rentstico

Cultural

Tener espacios, tiempo de recreacin. Parques, conciertos etc. Tener ros, tierra y aire limpios.

Problemas de TA, Cardiacas. Angustias, desnutricin Alteracin E. F Desconfianza, Distancia y baja detnanda Deterioro de Las condiciones de S, A, 0 . Desconfianza y apata Fraccionamiento de las organizaciones individualismo. Relaciones paternalistas y autoritarias Sedentarismo, Neurosis, violencia Enfermedades hdricas, estrs. cansancio etc Enfermedades de la pobreza. alteraciones emocionales y familiares. Entidades estatales de salud manejadas por intereses politiqueros y no sociales. Bajas coberturas, ineficiencias e incoherencias

Ambiental

Econmico

Trabajo y empleo digno

Desempleo, subeii5)leo

PoUtico

P. Democrtica

Pohtiquera clientelismos

Intereses mezqumos. espacios democrticos reducidos

189

La Salud PbUca Hoy

b) Identificacin de estrategias: Con el panorama anterior, se pasa a proponer estrategias que logren sensibilizacin y profundizacin en el conocimiento de cada uno de los factores de riesgo y protectores para la vida. De manera simultnea de va haciendo el ejercicio de la reflexin y anlisis, y se van detectando los cambios necesarios a travs de programas, proyectos y actividades. Con la siguiente matriz se ejemplifica la propuesta:
-

Tabla 4.2 Identificacin de estrategias

Contexto o dimensin

Sensibilizacin

Conocimiento Profimdizar en los tipos de contaminacin del no y sus efectos en la salud y vida humana y no humana.

Reilexin Qu pasa con la vida del ro y de los dems pobladores de l si contina con ese grado de destmccin? ponqu sucede esto?. 0 se puede actuar?, como?, quines, para qu?

Cambio cualificado Trabajar en la organizacin social. en capacitacin y compromiso para ejecutar un programa para salvar el rio Bogot.

Ambiental

Recorrer, ver. oler tocar el ro Bogot y detectar el grado de destruccin.

Social

Ir a zonas de desplazados. observar y dialogar con la poblacin desplazada.

Porqu sucede, cules Saber y con las causas, cules profimdizar sobre con los impactos lo que es y lo que psicolgicos, sociales. implica el econmicos, quienes desplazamiento. son tos responsables, etc.

Participar en proyectos de organizacin y proteccin de la vida de los desplazados.

Las estrategias se identifican de tal manera que se pueda lograr sensibilizacin, cuahficacin y cambios prcticos en desarrollo de cualquier programa, proyecto o actividad. Por eso la organizadn, la capacitacin y la continuidad se constituyen en estrategias bsicas. C) Propuesta de programas, proyectos y acciones en P y P: Se propone que la intervencin en promocin y prevencin se d en todos los niveles posibles, tanto en el mbito individual, famihar y colectivo.

190

Teoras y prcticas en promocin y prevencin

Los programas y proyectos integrales se elaboran a partir de la relacin que hay entre los factores deriesgoso protectores con mnimo dos componentes, tres estrategias y tres actores. Con la siguiente matriz se ilustra una propuesta de programa integral: Programa integral Tabla 4.3 U.N colegio sabio, sabe vivir dignamente
Componentes Ambiental Proyectos Integrales Sabio: Recicla ya Poblacin Estudiantes y profesores

C ultur al-econmi ca

Caseta y restaurante escolar Sabe bien

Escolares Profesores Padres

Cultural

Hbitos saludables: sabio vive bien.

Escolares Profesores Padres

Tabla 4.4 Proyecto integral caseta y restaurante escolar: sabe bien


PoblacM Procoo AlbDcnUrhi EcoBmko: Vlabk y o U t r l a Ectrif^o: limpia vaDgteiriMe P A D R E S P R O D U

c c 1
N

limpia Nstunici. Fresca Casen Nutrmv* AjHi^vcchando la cosecha

Econmicamente viabl. Fottatecimionto ylod Apoyo a b i micro emprias

Produccin limpai y KEiienble

E S T U D I A N T E

C 0 N

s u

M O

Agradable SuficienK Oportuno

Accesible economtcamcntc A loda ta pobluin escolar

LTbicaciti de (ipicoics su&cioMCi y

UtilizMn de c o c e a s ytiosdediiposciB

P A D R E S

E S T U 0 1 A N T E

DcMcho

Evitar excen de desechos. Utiznr cn^aqua

RcutiliZBblcs en k. posible

Manejo adecuado de los desecboi RcciclibleenlaposMe

191

La Salud PbUca Hoy

Propuesta de comportamiento cotidiano El ejercicio que se propone tiene la pretensin de lograr que la P Y P sea una prctica cotidiana: Conjugacin del verbo poder en presente Tabla 4.5 Propuesta de comportamiento cotidiano
Promover, proteger, garantizar Yo T EUos Noso-os Puedo Puedes Pueden Podemos Prevenir, evitar, eUminar.

192

Teoras y prcticas en promtKin y prevencin

Referencias bibliogrficas CFES - Comit Francs de Educacin para la Salud. Textos sobre educacin en salud. Pars, 2001. Ministerio de Salud. Decreto N 1891. Bogot, agosto 3 de 1994, R 1-3. Ministerio de Salud. Promocin de la salud y la equidad. Declaracin de la Conferencia Internacional de Promocin de la Salud. Bogot; OPS/OMS, 1992. MINSALUD, OPS, OMS, Estrategia /UEPI. Atencin integral a enfermedades prevalentes de la infancia. OMS. Salud y bienestar social. Asociacin Canadiense de Salud Pblica. Carta de Ottawa para la promocin de la salud, 1986. OPS. Promocin de la salud: Una antologa. Pubhcacin cientfica. 1996. OPS; OMS. Salud y Medio ambiente, 2000. OPS-OMS-Divisin de Salud y Ambiente. Atencin primaria ambiental Washington D.C Septiembre 1998. GUHL, Nannetti Ernesto. Memorias seminario intemacional Universidad de Los Andes. Desarrollo y medio ambiente. Bogot : Ediciones Uniandes, marzo, 1990. PIEDROLA, Gil y otros. Medicina preventiva y salud pblica. Barcelona : Salvat editores, 8 ed.,1988. RESTREPO, Luz Elena; MLAGA, Hernn. Promocin de la salud: cmo construir vida saludable. Bogot : Editorial Mdica Panamericana, 2001. UIPES - CFES. Unin Internacional de Promocin de la Salud y Educacin para la Salud. La salud una inversin para una sociedad ms justa. XVIII Conferencia Mundial de Promocin de la Salud y Educacin para la Salud. Pars, julio 2001. Universidad Javeriana. La pobreza en tiempos de globalizacin. En : Poltica social desafos y utopas. Bogot, 1998.

193

La Salud PbUca Hoy

CLAO, Jess. Promocin y prevencin en el mundo del trabajo. Legislacin espaola y colombiana. Trabajo de grado para optar al ttulo de especialista en Instituciones Jim'dicas de la Seguridad Social. Facultad de Derecho, Ciencias Polticas y Sociales. Universidad Nacional de Colombia, Bogot, 2002. Cartas y declaraciones de: Alma Ata (Kazajstn, 1977); Carta de Otawa, (Canad, 1986); Conferencia de Adelaida (Australia, 1988); Conferencia de Sundsval (Suecia, 1991); Conferencia y Declaracin de Santa F de Bogot, (Colombia, 1992); Conferencia y Carta de Trinidad y Tobago, 1993; Conferencia y Declaracin de Yakarta 1997 y la V Conferencia Mundial de Promocin de la Salud (Mxico 2000).

194

Pobreza y corrupcin: dos obstculos difciles para la promocin de la salud


BENJAMN HERAZO ACUA

Para concederle un hilo conductor a ns comentarios quiero definir la promocin de salud como una poltica estatal o comunitaria o de la sociedad organizada que debe conducir al establecimiento de unas condiciones de vida biolgicas, sociales, econmicas y polticas positivas, con el fin de generar bienestar y, por tanto, salud. . . . Muchas entidades oficiales y privadas, entre ellas EPS e IPS, muchsimos profesionales del sector salud, dirigentes polticos, publicistas, lo mismo que profesionales y personas de toda ndole, presentan la promocin de la salud como la realizacin de programas de salud generales y especficos, que en su mayora sonde prevencin especfica y no de promocin de salud. Los servicios de salud, preventivos, curativos, rehabilitadores, docente asistenciales, en fin, como se llamen, son uno de los componentes de la promocin de salud, no son promocin de salud. Hay unas personas que consideran promocin de salud el salir a la calle o a los barrios y veredas a promover la salud como quien promociona artculos de uso diario o utensihos del hogar. Para que haya promocin de salud es necesario alcanzar los niveles ms altos de bienestar y/o riqueza, entendiendo por riqueza no nicamente la acumulacin de bienes capitales sino el disfrute de excelentes condidones de vida o de ima vida con calidad.

197

La Salud PbUca Hoy

Para sustentar la afirmacin y la definicin de Promocin de salud expresada en un prrafo anterior, se recuerda la reunin de la Asamblea General de la ONU en 1954, con posterior aceptacin de la la Asamblea General de la Organizacin Mundial de la Salud, en las que se determin que los factores condicionantes de vida, de calidad y de bienestar (y, por tanto, de salud) son los que se enumeran a continuacin: Trabajo y empleo dignos y remunerados adecuadamente Ingresos financieros adecuados para vivir digna y decorosamente Capacidad de consumir y de ahorrar Alimentacin y nutricin ptimas Vivienda higinica y ecolgica Vestido acorde con el chma Comunicaciones y transportes oportunos y rpidos Servicios de salud de calidad (con predominio de la prevencin) ,. Educacin general excelente . Seguridad social universal, justa y equitativa Recreacin y descanso Libertades polticas y rehgiosas. A esos doce factores condicionantes pueden adicionarse otros, que cada uno de ustedes considere sirvan para ampliar o aclararlos todos o cada uno de ellos. Es ms, cada uno de esos factores requiere de adiciones, como, a modo de ejemplo, la vivienda higinica y ecolgica: significa que disponga de agua potable, servicios sanitarios, alcantarillado, energa, telfono, vas, telecomunicaciones, recoleccin de basuras, arborizacin, aire puro y otros aspectos ms. As se puede hacer con cada factor. Quin o quines deben garantizar la realidad de los doce factores condicionantes de la salud, o de los quince o veinte o dncuenta que quiera considerar cada uno de los asistentes o lectores de este documento?, es el Estado, que es una de las mejores instituciones de la sociedad organizada, o las sociedades organizadas de otras maneras diferentes al Estado pero con poderes similares al mismo. El Estado es quien puede hacer realidad la existencia de los factores condicionantes de la salud a travs de la poltica, la cual se manifiesta en legislaciones generales y especficas, nadonales, departamentales, provin-

198

Pobreza y corrupcin: dos obstculos dificiles para la prorruxin de la salud

dales, regionales o municipales. La legislacin y la poblacin que la genera y aplica, debieran ser tan justas y equitativas que no se debera requerir de la fuerza institucional para su cumplimiento, pero como es casi imposible lograr la unaimidad poltica, econmica y social, entonces se necesita del poder o de la fuerza para el cumplimiento de las leyes y solamente el Estado debe estar en capacidad legal de hacerlo. Por eso es necesario que el Estado est administrado y dirigido por personas de una ptima formadn moral, tica y poltica, con altos grados de sensiblidad social y con un profundo y shdo criterio de justicia y equidad econmica. Por estos principios es que siguen vigentes pensadores y filsofos orientales y occidentales de hace miles de aos, pues desde los albores de la cultura humana actual se pens y estableci que las organizaciones colectivas humanas deben estar presididas por personas honestas, honradas y transparentes para que puedan conducir a sus congneres al disfrute del bienestar individual y colectivo. Los estudiosos de la salud pblica saben que no hay un solo acto de la vida que no est relacionado con la salud y que todos esos actos tambin estn mezclados o relacionados con los aspectos biolgicos, sociales, econmicos y polticos que rodean la vida total y cotidiana de las poblaciones y las personas. Desde cuando el ser humano nace hasta cuando muere y desde cuando se levanta hasta cuando se acuesta todo lo que hace se relaciona con su salud y con lo poltico, social y econmico. Todo lo positivo, biolgico, social, econmico y poltico, que reciba o disfrute una persona o la poblacin en general, se manifiesta tambin positivamente en la psiquis y en el soma de la misma. A este efecto positivo se le puede denominar bienestar, lo cual concuerda con la definicin de la Real Academia Espaola en su Diccionario de la lengua espaola, al definir bienestar de tres maneras: primero como conjunto de las cosas necesarias para vivir bien; segundo como vida holgada y abastecida de cuanto conduce a pasarlo bien y con tranquilidad y tercero, como el estado de la persona humana en el que se le hace sensible (o susceptible agregara yo) al buen funcionamiento de su actividad somtica y psquica. La misma Academia define el bien de variadas maneras y una de ellas dice que es buena salud, es el estar sano.

199

La Salud PbUca Hoy

Para que haya salud es previamente necesario el bienestar, pues este siempre tiene manifestaciones psquicas y somticas que se traducen finalmente en salud. La mnima sensacin de bienestar humano, que se produce en la psiquis, es somatizada aunque sea levemente con la produccin de sustancias que impactan positivamente una parte o la totalidad del organismo, que es un conjunto de lo psquico y lo somtico. Hasta hoy, despus de casi 30 aos de estar dedicado al estudio de la de la salud y la enfermedad, me es sumamente difcil entender la salud como un evento nicamente biolgico, aislado del contexto social, econmico y poltico. La salud, gran resultante de la promocin de salud, es un hecho fundamentalmente poltico, derivado de los conceptos biolgicos, filosficos, sociales y econmicos que los humanos han producido durante todos estos milenios de su actual cultura. Imitando al pensador o poltico que dijo que la guerra es algo muy complejo para dejrsela nicamente a los militares, podra decirse que la salud es algo tambin sumamente complejo para dejrsela nicamente a los dirigentes y profesionales de la salud. Si los dirigentes y profesionales de la salud quieren orientar y dirigir la salud tienen que entender la poltica o ser polticos, comprender no solamente las ciencias biolgicas, sino las polticas, sociales y econmicas. Si no se tiene esta preparacin integral humanstica entonces sern nicamente los dirigentes polticos, sociales y econmicos tradicionales quienes orientarn y manejarn la salud, sin el concurso de los profesionales de la salud, quienes sern simplemente operarios u obreros de la salud, siempre dirigidos y mandados por los otros dirigentes, como est sucediendo ahora. Por todo lo anteriormente expresado es que desde 1982, en clases, conferencias, en la mayora de los artculos y libros que he escrito, como por ejemplo los de Clnica del sano y El municipio sano, he definido salud como: La manifestacin psquica y somtica de las condiciones de vida, biolgicas, sociales, econmicas y polticas positivas.

200

Pobreza y corrupcin: dos obstculos difciles para la promocin de la salud

Esta deficin conlleva a que las polticas, planes y programas acadmicos e investigativos para formacin de los profesionales de la salud contemplen nuevamente la inclusin en ellos de reas del conocimiento que permitan una formacin humanstica integral, tica y biotica de los mismos. En caso contrario, la direccin, administracin y gerencia del sector salud la detentarn por siempre otros profesionales o las personas dedicadas a la dirigencia poltica, social y econmica. Como estamos en la Universidad es bueno preguntarse ?cundo en ella se acogern esos excelentes programas acadmicos que hacen de los profesionales de la salud personas integrales, humanistas, honestas, honradas, ticas, altamente sensibles a los problemas de su pas, de su poblacin, de sus pacientes y muy comprometidos con las soluciones de los mismos en todos eUos? Por todo lo anterior me es difcil entender cmo puede ser posible la salud en la pobreza y, lo que es peor, en la miseria. Esta ltima condicin la menciono porque en nuestro pas se sabe que hay un alto porcentaje de la poblacin que vive en la miseria o en la extrema pobreza. En este momento soy tajante, pero no dogmtico porque, como lo exphqu al principio, me acostumbr a hablar y escribir en borrador, pero para m la promodn de salud es muy difcil de realizar y alcanzar en la pobreza, porque pobreza es sinnimo de malestar y enfermedad constante. Hablo y escribo en bortador porque algunos autores e investigadores se han estado preguntando hace tiempo si es posible la salud en la pobreza. Ojal pudiera ser as, sera una bendicin de Dios o de la vida si esto se lograra. Claro que me preocupa que al avalar la salud en la pobreza se avale tambin la permanente expoliacin y explotacin de los pobres por parte de los ricos y los poderosos pues uno de los problemas de la pobreza es la enfermedad y en ese caso estara solucionado, lo cual podra dar una especie de salvoconducto para que se empobrezca ms a los pobres pues ya tendran salud, con lo cual sera suficiente para esos explotadores. Es que, apreciados lectores y oyentes, cualquier paso que se d en falso es aprovechado por aquellas personas interesadas nicamente en su beneficio y lucro personal y para ello son capaces de agarrrarse de cualquier concepto que se exprese aunque sea noblemente.

201

La Salud PbUca Hoy

Quizs el anterior logro podra ser positivo porque el sufrimiento de los pobres sera menor, mucho menor que el actual pues se reduciran al mximo las enfermedades tpicas de la pobreza. Sin embargo, quedara la preocupacin sobre de qu otras maneras psquicas y somticas se seguira manifestando la pobreza en los pobres, lo cual posiblemente se dara porque es sumamente difcil que haya bienestar en la pobreza y porque el bienestar y la salud son tan inseparables como el malestar y la enfermedad. Como la utilizacin de las palabras promocin y salud proviene del esquema de los niveles de prevencin de Leavell y Clark, entonces para hablar de lo antagnico o contrario parece conveniente seguir acudiendo al otro esquema de Leavell y Clark, el de la historia natural de la enfermedad y por eso es necesario hablar de la fase inespecfica de la enfermedad. En la fase inespecfica de la enfermedad se producen las condiciones de vida biolgicas, sociales, econmicas y polticas negativas que generan la enfermedad o las enfermedades. Para algunos tratadistas de la salud pblica, como Horwitz, el bienestar o riqueza son la principal causa de salud, y la pobreza o malestar, la principal causa de enfermedad. Personalmente, desde que lo conozco, me ha gustado este esquema, que yo he reproducido y adaptado en mi libro El municipio sano. Considero que no hay malestar superior al de la pobreza y peor que el de la miseria, en las que todo es oscuro, negativo y pesimista en la vida del pobre o de los pobres o de los miserables. As como la ONU y la OMS determinaron en 1954 las condiciones de vida biolgicas, sociales, econmicas y pohticas positivas necesarias para alcanzar el bienestar y la salud, tambin establecieron las condiciones de vida biolgicas, sociales, econmicas y polticas negativas requeridas para que se produzca la pobreza, el malestar y la enfermedad, sin necesidad de escribirlas porque basta solamente con negativizar, volver negativos, esos doce factores condicionantes del bienestar y la calidad de vida para saber y com probar que generan pobreza y enfermedad.

202

Pobreza y corrupcin: dos obstculos dificiles para la promocin de la salud

Si se revisan todas las estadsticas mundiales y los indicadores de los diferentes sectores biolgicos, econmicos, sociales y polticos, se observa que en los pases ricos son mayoritariamente positivos o los mejores y que en las naciones pobres son mayoritariamente negativos o los peores. Finalmente, si se tienen en cuenta todos las estadsticas e indicadores existentes, se pueden medir las condiciones de vida de los pases. Puede ser tan cierto esto que, en el caso de la salud, las estadsticas de morbimortalidad de los pases ricos y los pobres son diferentes. Tal vez puede decirse que hasta los ricos tienen sus propias enfermedades que no las sufren los pobres. Hasta en la biologa se manifiesta la inequidad y la injusticia humanas. En pases como el nuestro hay enfermedad porque hay pobreza, hay pobreza porque hay corrupcin e impunidad rampantes; hay corrupcin porque no hay tica ni biotica, ni honestidad ni honradez ni transparencia en quienes dirigen, orientan y operativizan al Estado, que es la mayor organizacin mundial existente, quizs la ica que supera a las organizaciones financieras, mihtares y religiosas. Entonces, quines producen la enfermedad? Los dirigentes sociales, econmicos y polticos corruptos que administran mal a los estados. Los Estados pueden tener constituciones hechas por y para angeles, pero si quienes se encargan de hacerlas cumplir son corruptos entonces no habr vigencia real de las mismas. Las profesiones de la salud tienen principios acadmicos e investigativos en su mayora cientficamente slidos y bien fundamentados. Sin embargo, stos de nada sirven si quien los debe utihzar, el profesional de la salud, los desconoce, los altera o adultera o yerra en su aplicacin. Exactamente sucede con los Estados que tienen unas excelentes o buenas constituciones o leyes, pero tienen unos psimos o corruptos administradores, que son los dirigentes del pas. La pobreza, el malestar y las enfermedades de los pases pobres han sido causadas por las corruptas administraciones de los mismos y sus corruptos administradores. La pobreza es una manifestacin o resultante de la corrupcin; la corrupcin es la resultante del desconocimiento, ausenda o alteracin negativa de los principios morales y ticos de justicia y equidad, de sensiblidad social y econmica y del respeto a los dems.

203

La Salud PbUca Hoy

En Colombia la corrupcin ha generado un 20% de poblacin de clase media estresada, angustiada y empobrecindose; un 40% de poblacin pobre; un 30% de poblacin en extrema pobreza o miseria; es decir, la corrupcin ha producido slo un 10% de poblacin rica que disfruta de los bienes y del bienestar biolgico, social, econmico y poltico. Desde hace tiempo me corroe una preocupacin y me invade un desaliento y pesimismo con relacin a la suerte de nuestro pas, pues, no avisoro la pronta solucin de sus problemas biolgicos, sociales, econmicos y polticos. Esa preocupacin se me vuelve un drama cuando pienso en el futuro tan incierto que le espera a nuestros hijos, todos ellos jvenes profesionales recin egresados de universidades privadas y oficiales. El desaliento aumenta cuando no vislumbro una clase dirigente que conduzca al pas hacia el progreso, el bien, el bienestar y, por tanto, a la salud. Con frecuencia me pregunto por qu no vislumbro dirigentes que conduzcan el pas hacia un mundo mejor? Tambin frecuentemente me respondo dicindome y dicindole a mis estudiantes que la gran mayora de los dirigentes sociales, econmicos y polticos de nuestros pases -porque no solo Colombia sino toda Iberoamrica est podrida de dirigentes corruptos- son egresados de nuestras universidades, ogase y lase bien, egresados de nuestras universidades. Es decir, son nuestros profesionales la mayora de los que han expoliado, explotado, lucrado, corrompido, empobrecido y arruinado a nuestras naciones, poblaciones y personas. Por ejemplo, produce angustia ver tanta gente buena en este y muchos lugares de Iberoamrica empobrecida y miserabilizada por la clase dhigente profesional que ha conducido a estos pases en estos aos. Si no hubiera impunidad para la corrupcin poltica y administrativa del Estado, los dehcuentes de cueUo blanco encarcelados superaran amphamente a los dehcuentes de la calle y del narcotrfico, que realmente son unos aprendices del dehto si se les compara con los mencionados de cuello blanco. Debe recordarse que muchos expertos y tratadistas de la problemtica nacional, profesionales de toda clase, militares, religiosos, industriales, sindicahstas y tantos ms, los nsmos guerrilleros y paramihtares, han sostenido y fundamentado hasta la saciedad que la principal causa de todos los males que sufre Colombia es la corrupcin, pues ella ha generado pobreza, miseria, enfermedad, narcotrfico, guerrilla, paramilitarismo, delincuencia organizada de cuello blanco y de la calle.

204

Pobreza y corrupcin: dos obstculos dificiles para la promocin de la salud

Entonces respetados lectores, la gran mayora de nuestra dirigencia poltica, social y econmica ha sido egresada de nuestras universidades, con ttulos de idoneidad profesional, supuestamente ticos, honestos, homados y transparentes. Sin embargo, ellos han sido los principales generadores de corrupcin, pobreza y enfermedad. Podra uno preguntarse, qu pasa en nuestras universidades?, qu pasa con los profesionales?, qu pasa con la formacin universitaria en nuestro pas, en Iberoamrica, en el mundo? Esa respuesta es y ha sido motivo de innumerables talleres y sesiones como este, de millares de artculos, centenares de libros y muchos programas de radio y televisin. No me detengo a elucubrar sobre este tema porque no es de nuestra competencia en el da de hoy y porque no tengo una fundamentacin acadmica e investigativa suficiente que me permita tratarlo con el respeto que merecen tanto el tema como los posibles lectores y oyentes. La corrupcin ha tocado todos los sectores y mbitos del pas, lo ha empobrecido hasta el peligro de una prxima argentinizacin, nunca habamos visto tanta corrupcin descarada como la existente y nunca haba estado Colombia en condiciones de pobreza y miseria como las que padecemos actualmente. Como ser que El Tiempo titul en la primera pgina de la edicin del pasado sbado 4 de mayo lo siguiente: "Pobreza: Colombia retrocedi 14 aos". El mismo diario El Tiempo, el mircoles 8 de mayo en la primera y la dcima pginas, public este titular: "Dice el Banco Mundial que el lo no es de plata sino de corrupcin" y "El problema no es de plata". En cuanto a enfermedades, estn apareciendo muchas que se haban logrado reducir a muy bajas prevalencias. Muchas EPS e IPS le niegan diariamente los servicios de salud a sus afiliados alegando preexistencias de enfermedades, o que no estn cobijadas por el Plan Obligatorio en Salud, obligando a las personas a morirse para despus demandar indemnizaciones que de nada sirven, o lo que es peor, sometiendo a la poblacin a una condicin de mendicantes y suplicantes de los servicios que cumplidamente pagan todos los meses o a que tienen derecho por ser subsidiados.

205

La Salud Pblica Hoy

Se han robado descaradamente muchas instituciones de salud, tanto hospitales como EPS e IPS oficiales y privadas, sin que le pase nada a la mayora de los que se las han robado y saqueado. Los dineros del SISBEN, segn todos los artculos y reportajes de la prensa nacional, capitalina y de los telenoticieros, se los han robado en cantidades superiores al 50% y aqu se est hablando de billones de pesos o de miles de millones de dlares y por eso es que a los subsidiados y pobres no los atienden y, si los atienden, lo hacen mal o los maltratan. j. . Excsenme al recordarles este panorama desolador, deprimente, desesperante y denigrante de la situacin Colombia, replicable para muchos pases de Iberoamrica, pero era necesario para fundamentar el pesimismo que me invade en reladn con las pocas esperanzas que se tienen para que aqu se pueda aplicar la promocin de salud, para que as haya salud en todos los habitantes, pues, no se vislumbran cambios radicales en la dirigencia nacional ya que las universidades siguen empecinadas en preparar a los profesionales con esquemas que impiden su humanizacin, sensiblizacin social, econmica y poltica, su formacin tica y su compromiso con el pas. Termino estos comentarios reafirmando que para promocionar la salud se necesita, primero que todo, promocionar el bienestar biolgico, social, econmico y poltico de la poblacin, es decir, producir vida con calidad para todos los colombianos. Si el pas sigue bajo el dominio de muchos dirigentes corruptos lo que habr y permanecer por siempre es la pobreza, la miseria, la enfermedad y jams habr salud; aunque se tiene la esperanza de que la biotecnologa, generada por el conocimiento del genoma humano, permita pensar en pobladones pobres sanas, lo que, repito, es sumamente difcil de entender, pero que sera una gran opcin para todo el mundo, por lo cual lo que pueden hacer los profesionales de la salud honestos, honrados y comprometidos con la bsqueda del bienestar de su pas, es volverse dirigentes nacionales o investigar cada vez ms para producir medidas de prevencin especfica con el fin de erradicar el mayor nmero de enfermedades que sea posible y as generar poblaciones cada vez menos enfermas, lo cual ya es mucho beneficio y ganancia.

206

CAPTULO V

SALUD EN CALIDAD DE VIDA: UN ENFOQUE INNOVADOR Repensar las relaciones entre calidad de vida y salud
RAFAEL MALAGN

Pareciera que la inquietud y las preguntas, por dems vigentes, sobre la calidad de vida estuvieran parcialmente resueltas en el panorama general del pas que muestran los indicadores econmicos y sociales. En los mbitos social y acadmico existe un consenso cada vez ms fierte acerca de los efectos negativos que han tenido los programas de ajuste estructural en la poblacin y, desde luego, en la economa. En sus diez aos de aplicacin han generado 3,5 millones de desempleados o 18% de desempleo oficialmente aceptado; 6.4 millones de sub-empleados o 32,8 % de subempleo; 64% de pobreza, es decir, 27 millones de pobres de los cuales el 23% vive en pobreza extrema; un dficit de vivienda de 1.5 millones de unidades; 34.000 homicidios al ao; el pago de deuda por capital e intereses que este ao alcanz los 23 billones de pesos que equivalen al 40% del presupuesto nacional; un dficit fiscal consolidado 3.3% del PIB que representa un descuadre de las finanzas pbhcas de 6.6 billones de pesos y un crecimiento econmico del 1.56%, muy inferior al 5% que se requerira para afrontar estos y otros problemas'. Por otra parte, el informe de DDHH de las Naciones Unidas del 2001 para Colombia habla de torturas, malos tratos y desapariciones como en los peores tiempos de los regmenes militares de la dcada de los aos ochenta en Amrica Latina. En Colombia la cifra de desaparecidos llega a 4.000, una de las ms altas del mundo; ASFADES, Asociacin de Farrliares de Desaparecidos, report la desaparicin de 20 de sus miembros, la entidad lucha

Fuente: El Tiempo. Edicin domingo 26 de mayo del 2002. Pgina 8. Seccin Primera.

209

La Salud Pblica Hoy

para que no la eliminen; en Colombia desaparecen a los que buscan a los desaparecidos. En el primer trimestre del presente ao asesinaron a 25 sindicalistas; en el informe de la Comisin Colombia Nunca Ms se afirma que la impunidad en los delitos polticos llega al 99%, se configura as un ciclo que va de la impunidad a la impotencia y de esta a la impunidad. Adems, se pierden 4.500 millones de dlares anuales entre gastos de guerta y corrupcin. En los ltimos 16 aos, en el perodo comprendido entre 1985 y 2001, se han desplazado por violencia poltica 17 colombianos y colombianas cada hora, es decir 408 diarios, cifra que aument a 1000 personas en el ltimo trimestre. El 80% de los desplazados son menores de 18 aos y el 53% son mujeres. En la actualidad la cifra de desplazados llega a 2'400.000 ciudadanos. Son colombianos y colombianas con necesidades que no pueden satisfacer y que deterioran gravemente o ponen en peligro su existencia: Necesidad de resolver el mnimo vital: ahmentacin, vivienda y vestido; Necesidad de reconocimiento e identidad; ' , ^ . Necesidad de seguridad ontolgica, es decir, de una certeza mnima de poder existir; Necesidades de pertenencia a un territorio y a un devenir comunitario; Necesidades de afecto y de amor; de reconstruir sus redes de solidaridad y sus soportes; Necesidad de participar en la vida comunitaria y de actuar en el espacio de lo pblico.

A los desplazados se les ha limitado al extremo el conjunto de dotaciones sociales, culturales y econmicas por lo que difcilmente pueden ejercer los derechos de ciudadam'a. Hoy los vemos en los semforos de las ciudades, protegidos con carteles, viviendo de la caridad pblica. Este caso doloroso hace visible lo invisible y actualiza las preguntas sobre la calidad de vida, la dignidad y la libertad humana. En estas situaciones extremas es difcil sealar tanto los lmites exactos de la enfermedad como los caminos para recuperar la salud. En este cuadro dramtico no est calculada la deuda social contrada con los millones de colombianas y colombianos cuyas existencias estn seriamente deterioradas por la guerra, la violacin a los derechos humanos, la

210

Repensar las relaciones entre calidad de vida y salud

pobreza y el desempleo; es una deuda que ya afecta a generaciones que an no han nacido. En Colombia hay dficit en la calidad de vida porque hay dficit de vida. Nos acostumbramos al horror de las cifras porque nos hemos acostumbrado al horror de la existencia, a la frustracin, a la ilegitimidad de las instituciones y a una vida sin dignidad humana; crecen la desconfianza y el individualismo; crece tambin un sentimiento de inseguridad ontolgica resultado de la incertidumbre social y que no se resuelve con gendarmera. La funcin pblica est amenazada por la accin del mercado y del capital producto del modelo de desarrollo; la poltica social es asistencial y apenas amortigua los efectos de las polticas ajuste; la focalizacin no es redistributiva y no alcanza ni para recoger a las vctimas de la guerta econmica y sodal. Los cambios polticos anunciados en la Constitucin del 91 se han desdibujado; asistimos a una crisis generalizada de la sociedad que se caracteriza por tal incremento de la violencia y del deterioro de las condiciones de vida que se modific el perfil de mortalidad en el pas; por el aumento del desempleo hasta lmites histricos, por el continuo debilitamiento de las instituciones, por la creciente ruptura del lazo social y la solidaridad y, finalmente, por el desarrollo de una cultura de la incertidumbre y la desconfianza. Segn el informe de Desarrollo Humano para Colombia (1999) dos son los problemas que impiden al pas alcanzar un mayor desarrollo humano: la violencia y la desigualdad en la distribucin de ingresos. "Los hombres tienen entre dos y casi seis aos menos de esperanza de vida por cuenta de la violencia y en el perodo comprendido entre 1985 y 1997, los aos de diferencia entre hombres y mujeres no se han modificado y son superiores a la diferencia promedio de los pases de nivel similar de desarrollo". El informe tambin seala que los logros alcanzados en el ndice de Desarrollo Humano no son homogneos sino que, al contrario, subsisten grandes inequidades regionales y que la desigualdad en la distribucin del ingreso aument en 1997. En el perfil de morbilidad de los colombianos y colombianas, por ejemplo, convergen entidades patolgicas propias de los pases desarroUados con otras como el clera, o el sarampin, eso muestra no slo la complejidad de

211

La Salud PbUca Hoy

la problemtica sanitaria, sino el deterioro generalizado de las expectativas de cahdad de vida. De otro lado, pero en directa relacin con los elementos mencionados, la reconversin del Estado y la nueva y reducida concepcin de lo social que se expresa en su poltica pbhca, establece una continua transmutacin de los derechos colectivos en servicios de acceso individual y estratificado lo cual ahonda an ms los procesos de inequidad social. Esta descripcin desalentadora debe propiciar discusiones acerca de los lmites y las consecuencias que se derivan de las diversos enfoques y miradas que tenemos sobre la cahdad de vida de las personas. A veces olvidamos que los conceptos son dmmicos porque son el resultado de confrontaciones en los terrenos poltico y cultural, no son un producto de la actividad mental ni se soportan slo en argumentaciones, en apariencia, puramente tcnicas. Asumir una concepcin de cahdad de vida, cualquiera que sea, es asumir una concepcin de sociedad y de sujeto. Los elementos que la constituyan, sus alcances, la forma como se evale o se rrda y el tipo de prcticas y disciursos que oriente acaban por determinar el tipo de sociedad a que se aspire. Entonces, la pregunta por las finalidades implcitas o supuestas en el concepto de calidad de vida podra ser el hilo de Ariadna para afrontar una discusin que de entrada se reconoce vasta y con tantas, complejas y sugestivas aristas que constituye por s misma un campo de anlisis transdisciplinar; ese hilo conductor permitir tambin precisar sus vnculos eventuales con el campo de la salud. El concepto de calidad de vida, como el de salud, connota planos axiolgicos y polticos; ambos implican un sentido tico y, al mismo tiempo, una praxis y una lexis (prctica y discurso) que describen lo que las sociedades han definido como "buena vida" o "buen vivir". En la "calidad de vida" est inscrito un reclamo sobre el ser, el tener y el hacer de los individuos. Por esa razn la discusin sobre las diversas maneras de evaluar, de enfocar o visualizar la calidad de vida de los individuos en una sociedad determinada, no puede sustentarse en sutilezas de observacin ni limitarse a precisar las bondades de uno u otro sistema. El anlisis debe derivarse de orientaciones polticas y ticas que, desde luego, adquieren su forma y potencialidad en el plano de la accin poltica y se manifiestan en los procedimientos tcnicopolticos de medicin que impone la racionalidad instrumental del Estado.

212

Repensar las relaciones entre calidad de vida y salud

Un enfoque de calidad de vida sustentado en la redistribucin de la riqueza social, el reconocimiento y ejercicio efectivo de los derechos sociales y culturales como condicin de libertad para los asociados, supone un ideal de sociedad y de vida muy diferente al que se sustenta sobre el principio de la utihdad y sobre el privilegio omnmodo del derecho de pertenencia. En consecuencia, el debate conceptual sobre la salud y la calidad de vida bien puede considerarse de tipo programtico respecto de las finalidades ticas y polticas que persigue. A continuacin presento un esbozo general de las principales corrientes filosficas y polticas que han orientado diferentes nociones, enfoques y desartoUos sobre calidad de vida y que, en correspondencia con lo ya dicho, son expresin de la confrontacin poltica contempornea. El liberalismo, el problema de la equidad social y la calidad de vida^ Para exphcar las dificultades que presenta la integracin legtima y diligente de los derechos cives e individuales con los derechos sociales o colectivos y sus implicaciones respecto a la calidad de vida, hay que considerar, en forma esquemtica y sucinta, las vertientes filosficas y pohticas del programa hberal modemo. Los derechos se fundamentan en la accin poltica de los actores en su discurrir histrico por la identificacin y satisfaccin de sus necesidades sociales. Aunque no todas las necesidades sociales tienen su cortespondencia con los derechos, es claro que el ejercicio efectivo de los mismos es la condicin que garantiza que ciertas necesidades bsicas no queden a merced de la contingencia social, lo cual afectara gravemente la existencia humana. Los derechos individuales y colectivos se vinculan con las necesidades sociales y la cahdad de vida de las personas en tanto aceptemos las siguientes consideraciones: que de su existencia emana una fuerza moral que toma cuerpo material en las reivindicaciones sociales y su capacidad transformadora; segimdo, que el mbito de los derechos expresa consensos

En esta parte seguir muy de cerca el captulo primero del trabajo del profesor Francisco Corts Rodas (1999).

213

La Salud PbUca Hoy

histricos y sociales respecto de la libertad y la dignidad humana, fines y fundamento, a su vez, de la calidad de vida y, tercero, que el ejercicio efectivo de los derechos y, en consecuencia, la ampliacin de la democracia, son determinantes de la calidad de vida de las personas^. La prescripcin social sobre las necesidades sociales tiende a fundamentar derechos que, como dice Hller, se constituyen en permisos si se valoran en su aspecto negativo, es decir, no obligan pero permiten hacer, ser o usar algo si se quiere. Pero los derechos tambin constituyen garantas para que ciertas necesidades sean consagradas como esenciales para la existencia humana so pena de afectar gravemente la existencia. Que haya un "permiso" para ser, hacer o usar no quiere decir, como ya se afirm, que en efecto el derecho pueda ser ejercido en funcin de mi ser, de mi hacer o de n usar. La existencia del derecho, e incluso de los bienes que se derivan de l, de la educacin por ejemplo, no asegura que el individuo pueda apropiarlo efectivamente si las dotaciones sociales, econmicas e incluso culturales no le permiten disfrutarlo, an si el bien puede, de hecho, incidir en su desempeo. Como lo sealamos en otro artculo (Malagn y Revern, 2002), a propsito de la controversia sobre el acceso a la educacin superior, la expresin acceso debe significar algo ms que la matrcula, la pensin el cupo; tener "un lugar" en la institucin educativa no garantiza la permanencia ni el xito posterior, hay que considerar variables relacionadas con las dotaciones sociales, culturales y econmicas. Como se ver ms adelante, la existencia o no de un mnimo de dotaciones determina el ejercicio pleno de los derechos. De esta afirmacin se deduce que la calidad de vida de las personas no depende nicamente de la existencia de los derechos, sino de qu dotaciones sociales y econmicas limitan el ejercicio pleno de los derechos y el acceso a los bienes que de ellos se derivan y, ms an, de lo que se haga para construir capacidades.

Amartya Sen ha puesto en evidencia las relaciones entre libertad y calidad de vida. A veces afirma- la falta de libertades fundamentales est relacionada directamente con la pobreza econmica que priva a los individuos de la libertad necesaria para satisfacer el hambre, para conseguir un nivel de nutricin suficiente, para poner remedio o enfermedades tratables, para vestir dignamente o tener una vivienda aceptable... (Sen, 2(X)1,20).

214

Repensar las relaciones entre calidad de vida y salud

'

Entre tanto, la equidad social, entendida como igualdad frente a la ley pero, sobre todo, como igualdad gracias a la ley, es piedra angular de una teora y de una prctica social de la justicia, por lo tanto, los dispositivos y mecanismos que adopte la sociedad para establecerla y garantizarla son fundamentales para comprender las dinmicas que impactan la existencia de los individuos y su calidad de vida. Entonces, una discusin sobre cahdad de vida imphca una reflexin sobre la equidad social y los derechos. El liberalismo individualista y la equidad social El modelo del liberalismo individualista est basado en el pensamiento de John Locke y fundamentado, a su vez, en dos tesis centrales. 1. La sociedad justa se constituye si se pueden garantizar las condiciones que permitan proteger los derechos y las libertades civiles y en particular el derecho a la propiedad privada. 2. El papel del Estado es asegurar los derechos y libertades civiles y, en consecuencia, debe garantizar la no interferencia y la no-coaccin. Segn estos presupuestos, si las libertades individuales estn protegidas los sujetos pueden desarroUar las concepciones de vida buena que quieran, siempre que no afecten el mbito privado de los otros individuos. Sin embargo, estas premisas ocultan el hecho de que el mbito de los derechos de unos es mayor que el de otros, sobre todo en cuanto al derecho a la propiedad. Si, adems, la funcin del Estado se limita a garantizar la no interferencia y la no coaccin el principio de igualdad de oportunidades queda negado y, por tanto, la riqueza social no se redistribuye de acuerdo con las necesidades que existen. En este modelo conceptual la satisfaccin de las necesidades y la igualdad social quedan subordinadas al crecimiento econmico que, en la prctica, equivale al grado de concentracin de la riqueza. Amartya Sen"* identifica en esta perspectiva una tendencia de los modelos de desarrollo del siglo XXI: la idea del "sacrificio necesario" ("sudor y lgrimas" en el caso colombiano) a corto plazo mediante la disminucin del consumo para propi-

Citado por Hemndez (2000).

215

La Salud PbUca Hoy

ciar la acumulacin del capital a largo plazo. El objetivo prioritario de este modelo es el crecimiento y de su desbordamiento o "irrigacin" (Corredor) se esperan beneficios para el resto de la sociedad. En apariencia los objetivos de crecimiento y equidad no son incompatibles porque la equidad sera consecuencia del crecinento. Sin embargo, la limitacin del principio de igualdad de oportunidades por las prertogativas concedidas al derecho a la propiedad privada, relega a la equidad como principio y, en consecuencia, la poltica social se convierte en amortiguadora de los efectos del modelo de desartoUo y adquiere un carcter asistencialista.
,' - I -

El liberalismo social, la justicia y la equidad La tesis centrEd del liberahsmo social o humanitarista afirma que una sociedad justa es la que asegura las condiciones elementales para que todos los seres humanos puedan considerarse y reconocerse como personas iguales. Ubres y autnomas. Dentro de esta tradicin John Rawls, cuya obra ms representativa es "Teora de la Justicia" (1997), propone la teora de un sistema de justicia social basado en una sociedad ordenada; a su juicio las corrientes hberales utihtarias o individualistas no distinguen criterios sobre justicia social porque su centro de atencin es la sumatoria de los desempeos exitosos de los individuos y, de esa forma, los desempeos sociales se reducen a la eficiencia de los procesos. Las tesis centrales de la teora de la justicia de Rawls pueden resumirse en dos postulados': 1. Cada persona tiene un derecho igual al ms extenso sistema de libertades bsicas compatible con un sistema similar de libertad para todos. 2. Las desigualdades sociales y econmicas deben ser artegladas de tal manera que ellas sean a la vez: a) para el mayor beneficio de los menos aventajados, y b) hgada a posiciones y funciones abiertas para todos bajo igualdad de condiciones. Mientras que el primer principio se mueve en la esfera poltica y es de la competencia del Estado, el segundo se relaciona con la esfera social y eco-

Citado por Bula (1995).

216

Repensar las relaciones entre calidad de vida y salud

nmica y compete a la sociedad civil. Para Rawls las desigualdades de riqueza e ingreso son admisibles siempre y cuando dicha desigualdad se traduzca en ventaja para cada uno de sus miembros. En el sistema de Rawls las desigualdades son toleradas siempre y cuando, primero, las expectativas de los menos "aventajados" se encuentren maximizadas y, segundo, un mejoramiento en las expectativas de los ms aventajados no signifique un desmejoramiento de las expectativas de los menos aventajados. El sistema sera injusto si teniendo los ms aventajados unas expectativas excesivas su disminucin se tradujera en un mejoramiento efectivo de las expectativas de los menos aventajados. Rawls define los bienes sociales primarios como los que un hombre racional desea para desarrollar sus planes de vida, independientemente de las otras cosas que l desee (Rawls, 1997, 360). Esos bienes son los siguientes*: 1. Derechos y libertades bsicas. 2. Libertad de movimiento y libertad de escoger ocupacin en un repertorio de oportunidades diversas. 3. Poderes y prerrogativas de oficios y posiciones de responsabilidad en instituciones polticas y econmicas. 4. Ingreso y riqueza. 5. Las bases sociales del autorrespeto. Estos bienes rigen el desarrollo de los planes de vida de los individuos, configuran un sistema abierto e interrelacionado de manera que ninguno se comprende sin la presencia de los otros. As rompe con la tradicin liberal, pues si bien Rawls tambin define como prioritarios los derechos individuales de la hbertad, los integra a dimensiones econmicas y sociales para asegurar un orden justo. Sin embargo, hay que sealar que en su sistema estas dimensiones no son derechos fundamentales. Las crticas al modelo conceptual de Rawls^ se concentran en la preponderancia que le otorga a las libertades bsicas pues eUas slo se fortalecen en un orden social con desigualdades limitadas. En im escenario de desigual-

Citado por Bula (1995). Una sntesis de las mismas se encuentra en CORTS RODAS, 1999,26.

217

La Salud PbUca Hoy

dades extremas, como el nuestro, por ejemplo, las libertades bsicas resultan puramente formales en el orden social, econmico y cultural. En sociedades muy desiguales el esfuerzo por redistribuir la riqueza social implica restringir derechos como el de la propiedad, eso resulta inadmisible para
Rawls. 1

Otra de las crticas se refiere al hecho de que Rawls se preocupa ms por el tipo de bienes primarios que las personas deben poseer para desartoUar su plan de vida, que por las capacidades efectivas que tienen para llevarlo acabo. Por esta razn un ndice sobre el acceso a los bienes sociales primarios termina por encubrir los mayores esfuerzos que una persona debe realizar por acceder a un bien respecto a otra con mejores condiciones sociales, econmicas e incluso naturales. Rawls no toma en cuenta como factor que lesiona la equidad a la desventajosa situadn no elegida de las personas enfermas, discapacitadas, ancianas o con dotaciones sociales y econmicas precarias para acceder a los bienes primarios. Hacia un enfoque que contemple igualdad y reconocimiento de las diferencias Una de las crticas fundamentales que se formula al liberalismo es que el carcter trascendente y abstracto que prevalece en su concepcin de individuo y de libertad, no considera las circunstancias de la vida prctica. El reconocimiento como iguales en la esfera pblica y la mayor participacin poltica requieren la disminucin de la desigualdad en el orden social, econnco y cultural. En otras palabras, se puede ser actor y participar de las transformaciones de la sociedad si existen las condiciones y recursos que garanticen un mnimo de capacidades para la participacin social y comunitaria entendida, a su vez, como ejercicio de la libertad y reconocimiento de la dignidad humana. ^ En el modelo liberal la libertad es una nocin negativa por cuanto el Estado garantiza las condiciones para el ejercicio de los derechos civiles y pohticos. Una concepcin positiva de libertad centrara el papel del Estado en asegurar las condiciones materiales, culturales y espirituales que permitieran a los individuos valorar la libertad.

218

Repensar las relaciones entre calidad de vida y salud

La calidad de vida de una persona, expresada en libertad y dignidad humana, tendra relacin directa con la superacin de las injusticias socioeconmicas -que incluyen la explotacin, marginacin econmica y la privacin de bienes indispensables para llevar una vida digna- y la superacin de las injusticias culturales que incluyen la dominacin cultural, el no reconocimiento y el irrespeto*. La superacin de estas injusticias implica un propsito social que invierte el orden de prioridades descrito por Rawls, en el sentido de reconocer que la participacin como agente en la esfera pblica depende de que se reduzcan las desigualdades, es decir, de que se potencien las capacidades de ser, de tener y de hacer. El hacer se refiere a la autonoma de los individuos y a su libertad, el ser a la vida y a la existencia humana (Bula, 1995, 47) y el tener a los mnimos indispensables para potenciar las capacidades del individuo. As se establece una relacin sistmica e indivisible entre los derechos colectivos fundamentales (los econnucos, los sociales y los culturales) y los derechos individuales fundamentales. Entender la justicia como la construccin de capacidades individuales y colectivas implica emprender acciones que no pueden resolverse en la lgica del mercado y que exigen nuevas relaciones entre el Estado, el mercado y la sociedad civil. La funcin pblica de la poltica debe ser el eje orientador de estas relaciones. En la medida en que el modelo liberal contemporneo se empea en reducir el Estado a la esfera de seguimiento y control su capacidad para orientar la funcin pblica de los agentes sociales queda restringida en beneficio de la accin del mercado. La crtica a utilitaristas y bienestaristas
"' r

Los diversos enfoques y perspectivas sobre calidad de vida que han propuesto los modelos descritos toman cuerpo en el terreno de la evaluadn de los desempeos sociales en esta materia.

Una descripcin detallada .se encuentra en FRASER (1997, 21). La explotacin se entiende como el usufructo del trabajo propio en beneficio de otros. Marginacin econmica es la imposibilidad de acceder al trabajo remunerado o verse confinado a trabajos mal remunerados o indeseables. El no reconocimiento es hacerse invisible a travs de prctica.s representativas, interpretativas y comunicativas de la propia cultura. El irrespeto es ser calumniado y menospreciado, de modo habitual en las representaciones pblicas estereotipadas o en las interacciones codianas.

219

La Salud PbUca Hoy

En el liberalismo clsico individuahsta los logros sociales se expresan, bien a partir de la opulencia como sinnimo de bienestar o bien en el desempeo exitoso de los individuos. Dentro de esta corriente el bienestar es la sumatoria de los estados subjetivos individuales (teoras subjetivas del bienestar o utilitaristas) y el logro social queda relativizado en funcin de la maximizacin del inters individual. El nivel de vida, a su vez, se expresa mediante indicadores econmicos que miden el bienestar econmico a travs de variables como la del crecimiento per-cpita (Fresneda, 1998). Desde esta perspectiva analtica el bienestar es funcin de los individuos y no se consideran criterios redistributivos. El utilitarismo asume dos tipos de definiciones con respecto al bienestar: 1. El bienestar como disfrute o como un estado deseable o agradable de conciencia (teora subjetiva). "Bienestar hedonista". 2. El bienestar como satisfaccin de preferencias que ordenan jerrquicamente los estados del mundo. La nocin rawlsiana de bienestar se basa en dos teoras objetivas: la nocin de bienes primarios y el principio Ubre y abierto de igualdad de oportunidades. Crticas respecto a la informacin que privilegian estas dos posturas: Una evaluacin de la poltica pblica y de los logros sociales sobre calidad de vida que se base en la percepcin que tiene la gente de su situacin, es limitada porque est reflejando sus estados mentales. Los seres humanos (Arendt, 1997, 23) son seres condicionados ya que todas las cosas con las que entran en contacto se convierten de inmediato en una condicin de su existencia (condiciones de vida internalizadas), de esa forma el juicio sobre el cumplimiento de sus deseos de individuos con grandes carencias, adaptados a su situacin, puede ser inverso a sus condiciones reales de existencia. El mundo adquiere el tamao de nuestros deseos y una voluntad resignada puede dar cuenta de la satisfaccin de sus deseos, an en condiciones difciles de existencia. Una crtica anloga, aunque dirigida a la posicin de Rawls respecto a los bienes, se refiere a que cuando se igualan los bienes primarios para elaborar im indicador de calidad de vida, se ocultan las variaciones interpersonales relacionadas con lo que la gente puede hacer con los bienes de acuerdo a diferencias biolgicas, culturales, econmicas y sociales.

220

Repensar las relaciones entre calidad de vida y salud

Para Sen comprender el problema de la calidad de vida no es medir el ingreso de una persona o la tenencia de bienes y servicios, aunque eso es importante, sino identificar las capacidades bsicas para la realizacin de los objetivos definidos en los planes de vida. Sen adopta un criterio objetivo que tiene en cuenta la informacin sobre las capacidades y la hbertad de las personas para vivir diferentes estilos de vida. Crticas relacionadas con la orientacin general de estas dos posturas Rawls critica a los utilitaristas por la inconsistencia en el sistema de los gustos que defienden a estos enfoques. Segn l habra que distinguir entre gustos ofensivos y gustos no ofensivos, una persona puede sentir placer en discriminar a otras o en limitar su libertad, gustos a simple vista condenables (ofensivos). Por esta razn, Rawls propone una medida de la justicia que parte de ndices derivados de los bienes primarios, su preocupacin por el bienestar est centrada en la igualdad de oportunidades para acceder a los bienes. Son claras las dificultades que tienen los planteamientos de Rawls, y en general del liberahsmo, respecto a la igualdad de oportuidades en sociedades con altos desequilibrios como la nuestra, en particular porque privilegian las libertades individuales y civiles y el derecho a la propiedad sobre cualquier otro derecho. Para Sen la informacin sobre los bienes primarios no dice nada respecto a lo que la gente es o hace, y esas son las coordenadas fundamentales de la calidad de vida. El nfasis en los bienes desconoce que personas conformadas de diferente manera y ubicadas en distintos lugares requieren distintas cantidades de bienes primarios para satisfacer las mismas necesidades. La postura de Sen no es slo el resultado de un criterio ms sensible de observacin; se origina en reflexiones filosficas y econmicas que develan que las desigualdades sociales se expresan en desequilibrios en las dotaciones sociales, culturales y econmicas de los individuos y que reconocen que la limitacin de esas dotaciones impide un ejercicio efectivo de los derechos que se traduce en el deterioro de la calidad de vida de las f)ersonas.

221

La Salud PbUca Hoy

Una crtica a los presupuestos de los utilitaristas y unas afirmaciones que muestran los lmites de la orientacin objetiva del bienestar (Rawls) En su texto "Los tontos racionales: una crtica de los fundamentos conductistas de la teora econmica", Sen critica la concepcin del hombre esgrimida por Edgeworth (1881), segn la cual cada agente est movido slo por su propio inters. Sen argumenta que la eleccin racional en la teon'a econmica, es decir, la que persigue el mximo de utilidad, es sobresimplificadora de las motivaciones que llevan a los individuos a tomar las decisiones. En muchos casos las decisiones obedecen a asuntos relacionados con el compromiso (por ejemplo, la lealtad, el deber, la solidaridad) de tal suerte que la triada motivaciones, medios y fines que describe la conducta del agente en procura de la calidad de vida, no se explica slo como la bsqueda de la eficiencia o como la racionahdad de medios y fines tal como fue caracterizada por Weber. Por ejemplo, la atencin en salud es un bien que se realiza no slo en sus aspectos materiales (la consulta, entendida como la accin tcnica sobre el paciente), sino sobre todo en el campo simblico de la sanacin. Este es un mbito muy complejo que pone en accin disponibilidades culturales, posibilidades tcnicas, el cuidado y el autocuidado, la informacin, la incertidumbre de la curacin, la experiencia biogrfica del agente, las lealtades y la confianza; por tanto, la maximizacin del beneficio se puede truncar de mltiples formas y un juego de eficiencias parece poco razonable. Cuando nos ocupamos de nuestras necesidades podemos constatar que el medio para la curacin del enfermo, que en este caso es la atencin en salud, no se comporta como una simple objetivacin sino que est cargado de valor y de significado de tal suerte que expresando un bien, en su relacin con el agente define dos tipos de circunstancias: lo que puedo hacer o no hacer con el acceso al bien, es decir, con la garanta de su tenencia y lo que la atencin en salud puede hacer por m en cuanto a mi ser y mi hacer en referencia a mis dotaciones sociales y culturales reales. De esta manera se puede constatar que la relacin que establecemos con los bienes se da en un doble sentido. Estas circunstancias denotan que la atencin en salud, en el caso de nuestro ejemplo, no es un instrumento pasivo; de eso se puede concluir que existen

222

Repensar las relaciones entre calidad de vida y salud

valoraciones sobre los satisfactores que definen en conjunto la modalidad dominante que una cultora le imprime a las necesidades', es decir, la manera social en que las necesidades han de ser enfrentadas. Estas dos ltimas consideraciones relacionadas con el papel activo de los bienes no son consideradas por Rawls en su teora de los bienes primarios. De acuerdo con los aspectos mencionados se desprenden dos consecuencias muy significativas: que existen bienes (y tambin servicios) que no slo tienen dificultades para "comportarse tpicamente en el mercado", sino que debido a que el mercado requiere formahzaciones e instrumentaciones que actan como hntes, termina por desnaturalizar de manera grave los bienes. El enfoque de las capacidades y los agentes Sen ehgi la palabra capacidad para representar las combinaciones altemativas que tiene una persona para "hacer" o "ser"; la capacidad explica las distintas reahzaciones o funcionamientos que la persona puede lograr. Cuando se enfocan las capacidades desde la perspectiva de las ventajas de una persona, lo que interesa es evaluarla en trminos de su habilidad real para lograr los funcionamientos vahosos como parte de la vida. Sen se diferencia de las posturas subjetivas y objetivas porque relaciona de manera directa la calidad de la vida con el poder de los individuos para elegir el estilo de vida que deseen, es decir, con el ser y el hacer de las personas. No se trata de la libre eleccin racional de los utilitaristas, sino de algo ms sustantivo referido a la capacidad de orientar nuestra existencia, de agenciar nuestra vida. El agente -en su acepcin ms antigua y elevadadefine en Sen a la persona que acta y provoca cambios y cuyos logros pueden juzgarse en funcin de sus propios valores y objetivos (Sen, 2002, 35). Como veremos ms adelante existe una cierta sinhtud entre el agente de Sen y el actor de Hannah Arendt. Los funcionamientos representan parte del estado de una persona, las cosas que logra hacer o ser al vivir (estar nutrido, tener buena salud, alcanzar niveles de felicidad), la capacidad refleja combinaciones altemativas de los funcionamientos que una persona puede lograr y entre los cuales puede

MAXNEEF.

223

La Salud Pblica Hoy

elegir una coleccin. A partir de estos trminos Sen considera que la Calidad de Vida debe evaluarse en trminos de la capacidad para lograr^c/onamientos valiosos. El trmino "valioso" es relativo a la persona o grupo social que se est teniendo en cuenta e imphca, por tanto, consideraciones y sensibihdades frente a las diferencias culturales, geogrficas e histricas. Sen tambin desarrolla el concepto de "capacidades bsicas" y lo cataloga como un subconjunto de capacidades al que se le asigna una importancia moral y poltica porque satisface demandas urgentes bien reconocidas. La finalidad principal del tmno "capacidades bsicas" es distinguir la habilidad para satisfacer ciertos fncionanentos crucialmente importantes hasta ciertos niveles adecuadamente mnimos. La identificacin de los niveles mnimos aceptables de ciertas capacidades bsicas, por debajo de los cuales se considera que las personas padeceran privaciones, proporciona un enfoque novedoso sobre la pobreza. Este es uno de los aspectos ms significativos de la propuesta de Sen pues, sin restarle importancia a la existencia de los bienes, muestra como juegan las dotaciones iniciales, sociales, econmicas y culturales, respecto a lo que los individuos pueden hacer con los bienes. De esta forma se pone al descubierto el conjunto lgico del planteamiento de Sen: en trminos generales la calidad de vida se refiere a las capacidades que tienen los individuos para decidir con amplia libertad el tipo de vida que desean. Estas capacidades, a su vez, estn en funcin de capacidades bsicas que se relacionan con las dotaciones sociales, culturales y econmicas que las personas deben tener para sus realizaciones (funcionamientos); por debajo de estas dotaciones las personas no pueden ejercer efectivamente sus derechos lo cual impide potenciar las capacidades, as se mantiene y profundiza la sitoacin de pobreza. Este enfoque de la pobreza se diferencia mucho del tradicional que tiene como eje el ingreso de las personas. El punto de vista de la pobreza que se concentra en el ingreso, a partir del cual se determina la llamada "lnea de pobreza" y que no vara entre las personas, puede ser inadecuado para identificarla y evaluarla; Sen, al contrario, sostiene que la conversin del ingreso en capacidades bsicas vara mucho entre los individuos y entre las distintas sociedades por lo que la posibilidad de adquirir niveles mnimos aceptables de las capacidades bsicas puede estar asociada con diferentes niveles de ingresos mnimos adecuados.

224

Repensar las relaciones entre calidad de vida y salud

Reconocer que la relacin entre el ingreso y las capacidades vara entre las comunidades y personas de la misma comunidad, exige considerar que el nivel de ingreso mnimo adecuado para alcanzar los mismos niveles de capacidad aceptables tambin es variable y depender de caractersticas personales y sociales, por eso lo importante es tener presentes las variaciones interpersonales e intersociales en la relacin entre los ingresos y las capacidades. Bajo estas consideraciones subyacen tres presupuestos bsicos que definen la ruptura de Sen con el liberalismo clsico. 1. La hbertad no es un bien abstracto y negativo, es concreto y positivo, responde a la pregunta quin puede hacer qu? 2. El individuo no es un ser trascendente y abstracto, es social e histrico y su condicin de libertad depende de las condiciones materiales y espirituales en su vnculo con el colectivo social. 3. Los derechos colectivos son derechos fundamentales (salud, educacin, trabajo, ambiente) para el ejercicio pleno de los derechos individuales y civiles. Una vez referida esta interesante discusin filosfica y poltica conviene volver al concepto de calidad de vida, en otras palabras, seguir el hilo de Ariadna. El concepto de calidad de vida A pesar de que el concepto sobre calidad de vida nos resulta ms bien famihar su uso no est hbre de ambigedades. Existen mltiples interpretaciones del concepto y en consecuencia diversidad respecto a los elementos que debe abarcar. Como ya se dijo, el concepto de calidad de vida tiene dimensiones polticas y ticas que entran en conflicto cuando se intenta dilucidar qu significa la buena vida; la calidad de vida no es una esencia o una sustancia revelada; se trata, por el contrario, de un debate de cuo poltico que exige acudir a diferentes vas de argumentacin y cuerpos tericos para sustentarse.

225

La Salud PbUca Hoy

La calidad de vida aborda la preocupacin por el ser, el tener y el hacer y por esta razn encierta dimensiones pohticas fundamentales relacionadas con los objetivos colectivos y con la orientacin que la sociedad define para s. La discusin sobre la calidad de vida no es propia del mundo contemporneo, la problemtica implcita en lo que significa la buena vida se encuentra ya en los tiempos de Aristteles. En la actuahdad tiene especial inters, tanto por su relacin con las pohticas sociales, el funcionamiento institucional y los desempeos colectivos en la sociedad, como porque la sociedad moderna ha cuantificado y, hasta derto punto, monetarizado las necesidades, como afirma Agnes Hller (1996). La pregunta por las finalidades o la razn de ser de la calidad de vida de las personas, genera discusiones relacionadas con lo que se considera el buen vivir y el vivir bien manifestaciones, a su vez, de concreciones culturales e histricas. Pero aun as, e independientemente de lo que una sociedad juzgue como vida buena, la finalidad que se persiga al satisfacer cierto tipo de necesidades est determinada por una posicin axiolgica o valorativa que expresa el tipo de individuo que el colectivo piensa que es o que puede llegar a ser. En esta direccin una reflexin sobre la calidad de vida implica una discusin sobre la condicin humana. Cualquiera que sea la consideracin acerca de los "fardos"'" de necesidades y satisfacciones que se ponen en juego en la distribucin social siempre existe una interpelacin relacionada con el reconocimiento o no de nuestra condicin como seres humanos. En la perspectiva desarroUada por Hannah Arendt (1993), la condicin humana est determinada por la labor, el trabajo y la accin, tres actividades fundamentales que corresponden a las condiciones bsicas bajo las que se ha dado la vida del hombre y la mujer en la tierta. Labor, trabajo y accin corresponden en Arendt, respectivamente, al mantenimiento del proceso biolgico del cuerpo y las necesidades vitales y cuya satisfaccin permite la permanencia de la vida y de la especie humana; a la mundardad creada por el hombre, el mundo de las cosas, su creacin artificial y a la pluralidad derivada del reconocimiento de los otros en

Expresin tomada de Agnes Hller.

226

Repensar las relaciones entre calidad de vida y salud

el mundo. En un sentido ms sinttico y definido la accin es el mbito donde los individuos asumen su autonoma, su capacidad de agentes para actuar y transformar el mundo. Constituye la esfera poltica por excelencia. Por ese motivo la cahdad de vida humana tiene como finalidad asegurar, preservar y reproducir los planes de vida de los individuos en condiciones humanas de libertad y digidad. Sin embargo, y tomando distancia del planteamiento de Hannah Arendt, las necesidades y las satisfacciones contempladas en un proyecto de tal naturaleza no quedan definidas en la superposicin jerrquica de cada una de ellas ni en suponer la libertad por fuera de las condiciones sociales, econmicas y cultorales; lo que interesa en la prctica social es la forma como necesidades y satisfacciones estn definidas y articuladas en una perspectiva de integralidad. Esto quiere decir, por ejemplo, que las necesidades y los satisfactores relacionados con la reproduccin y mantenimiento de la vida carecen de sentido, no se entienden sino cuando se consideran como condicin para el ejercicio poltico de los seres humanos. Esta es la diferencia que existe entre el "levante" de aimales y alimentar al ser humano. Independientemente del plano cultural e histrico, las condiciones de la vida deben satisfacerse en libertad y dignidad, esto es, para todas y cada una de las personas de la especie humana aunque participen o no de los fardos o los juegos de necesidades que determinen el carcter y el temperamento de las personas. La dignidad humana, entre tanto, se corresponde con el estar y permanecer vivo pero significa, en particular, que el ser humano sea considerado como un fin en s mismo, que no sea utihzado como medio o instrumentalizado y, por consiguiente, pueda vivir en condiciones que posibiliten ese logro. Por eso la dignidad humana se corresponde con los derechos humanos fundamentales: el derecho a la vida y el derecho a la salud, a la educacin, al trabajo creativo y a la participacin pohtica. La libertad significa, en principio, capacidad de actuar, de ejercer la autonoma y, como mnimo, de estar a cargo de nuestra propia vida para elegir el tipo de vida que queremos. En el marco de este enfoque normativo consideramos que la libertad y la dignidad humanas son fundamentales y que la calidad de vida de una sociedad particular debe valorarse mediante estos logros. Esta es la misma pos-

227

La Salud PbUca Hoy

tura asumida por Sen para criticar a las construcciones tericas que centran su atencin en la utilidad, la renta o los procedimientos para alcanzar la hbertad (Sen, 2002, 35). Consideraciones acerca de las necesidades Los vnculos entre la calidad de vida de la personas y sus necesidades parecieran ser directos y no requerir de explicacin. A primera vista parece haber una relacin negativa: a mayor nmero de necesidades insatisfechas menor es el luvel de vida de las personas. Sin embargo, una mirada ms aguda muestra aspectos ms dinmicos y complejos que se refieren a las motivaciones, los medios y las finalidades que se persiguen al suplir una u otra necesidad. El hecho de que la satisfaccin de una necesidad, por ejemplo comer, guarda relacin con la necesidad inmediata, saciar el hambre, es irrefutable; sin embargo, en la especie humana la satisfaccin de las necesidades tiene implicaciones finales en mi "ser" y en mi "poder hacer" -preservar la vida, por ejemplo- de ah se deriva una cadena de satisfacciones que le otorgan en conjunto sentido a la experiencia humana de ahmentarse, en aras del ejemplo, a partir de este hecho podra explicarse porqu algunas simaciones emocionales difciles deprimen por completo el apetito. Revisemos algunos de estos aspectos: Las necesidades no solamente han de ser tomadas como carencias, es decir, en su aspecto negativo, porque tambin hacen referencia a ciertas cualidades sociales por reahzar y, como lo seala Fresneda (1998, 16), adquieren una connotacin tica que hace obligatoria su satisfaccin mediante una prctica; en ese sentido tambin son potencia que impulsa a construir las capacidades para lograr lo que se quiere obtener. Por esta razn las necesidades se refieren siempre a valores y manifiestan un carcter social, es dech, adquieren sentido y contenido en la cultura. Como ejemplo se puede sealar la necesidad biolgica de la nutricin que requiere de la construccin cultural del ahmento; no nos vestimos por simple utihdad prctica sino que el vestido tiene una significacin cttural y social. Sin embargo, no todas las necesidades pueden remitirse a productos materiales y, por lo tanto, no todas estn hgadas a la produccin. Hay necesidades sociales que responden a lo que Hannah Arendt Uama la plurahdad y que estn determinadas por el hecho de que no andamos solos en el mundo.

228

Repensar las relaciones entre calidad de vida y salud

La necesidad de afecto es una de ellas, lo mismo que la seguridad ontolgica (la que da certezas sobre nuestra existencia y nuestras posibilidades de ser) y que las necesidades de libertad y de dignificacin humana. El carcter de las necesidades Como punto de partida parece conveniente afirmar que, en trminos generales, las necesidades constitoyen una categora abstracta que se manifiesta en momentos diferentes, como seala Agnes Hller (1996, 86). Esta distincin puede pasar inadvertida y generar controversias, de alguna manera innecesarias, en particular cuando se habla de las necesidades subjetivas y de las necesidades objetivas". Esta separacin tambin aparece siempre que se desconocen los tres momentos en que podran ser identificadas: a) el de las necesidades en cuanto a s mismas, b) la relacin subjetivo-psicolgica de las necesidades y c) la relacin social de las necesidades, es decir, aquellos requerimientos o exigencias instituidos en una sociedad y cuyo reconocimiento y cumplimiento expresa fines que se han fijado como esenciales en trminos de la existencia humana (Fresneda, 1998). Desde luego estos tres momentos son cualitativamente diferentes y no corresponden a aspectos singulares de un mismo proceso. Esta distincin ayuda a comprender que el sistema de valoracin de las necesidades que se expresan en los individuos, bien sea como placer (hedonismo) o como satisfaccin de preferencias, no siempre se corresponde con el sistema social de necesidades humanas, que es, en ltimas, un consenso histrico que refleja la clase de necesidades que la sociedad atribuye o asigna a sus miembros. Acerca de la nocin de salud Si en este momento asumiramos con Didier Fassin (1996) la tarea de hacer una reconstruccin etimolgica del trmino "Salud" podramos dar cuenta de la pluralidad de sentidos que contiene. La palabra salud es sntesis de

En las teoras sobre calidad de vida se identifican dos tendencias: las teoas subjetivas del bienestar que postulan la sati.sfaccin de las preferencias (utilitaristas) y las teoras objetivas del bienestar que afirman que lo importante son los bienes que controla una persona (bienestaristas).

229

La Salud PbUca Hoy

tres nociones que en latn correspondan a tres vocablos distintos: Salus, que se refiere al buen estado fsico y moral pero tambin a la preservacin de los bienes y derechos; Sanitas, que significa el buen estado del cuerpo y del espirito pero tambin el razonamiento justo y el buen gusto y Salubritas, que corresponde al buen estado de salud pero incluye, adems, las medidas para asegurar y favorecer ese estado. Detrs de estas palabras se encuentran las dimensiones individual y descriptiva, (conservacin de la propia integridad), moral y prescriptiva (en referencia a las normas de lo bueno y lo malo) y colectiva y poltica (a travs de medidas sanitarias). Esta reconstrucdn pone en evidencia la complejidad semntica de la nocin de salud, producto de una historia en la que se entreveran la experiencia subjetiva, los discursos de los expertos, los sistemas de valores y los dispositivos que toman a cargo los enfermos. Si admitimos la pluralidad de estos significados en el tiempo (distintas pocas), el espacio (distintas culturas) y en el interior de cada sociedad (entre distintos grupos sociales) podemos sugerir que la salud es una construccin social que integra, en su acepcin negativa y restringida, desde el punto de vista individual, signos fsicos y psicolgicos y, desde la perspectiva de los poderes pblicos, informaciones de tipo epidemiolgico, poltico o econmico. Pero desde un punto de vista positivo y abierto tambin articula las mejores condiciones sociales que existen para el desarrollo de los planes de vida de los individuos con la garanta y ejercicio efectivo del derecho a la salud, que puede entenderse como derecho a la vida y a la vida en condiciones dignas, derecho a la accin poltica y a la atencin sanitaria. Las acepciones de salud que se entrelazan tanto en la prctica clnica como en la intervencin de las polticas pblicas sanitarias, contemplan conocimientos reglados y normatizados que van mucho ms all del corpus de las tcnicas de curacin y de los saberes que lo sustentan. Foucault (1989) afirma que el discurso mdico desarrolla un saber sobre el hombre saludable en dos sentidos: el del hombre no enfermo y el del hombre modelo; el hombre de vida sana que es tambin el hombre de vida buena. De esta manera, el discurso mdico no se resigna a distribuir consejos sobre la manera de llevar una vida prudente, sino que asume una postora normativa que le permite reglar las relaciones fsicas y morales del individuo y de la sociedad en la que vive.

230

Repensar las relaciones entre calidad de vida y salud

No en vano algunos han llegado a afirmar que la alegra, la satisfaccin, la solidaridad y la autonoma personal son categon'as que sobresalen en los estilos de vida propios de los hombres con salud (Mart Tusquets, 1999). Las diferentes concepciones y definiciones de salud determinan un concepto especfico de calidad de vida y promueven un estilo de vida normatizado y congruente con esos conceptos y definiciones. Por consiguiente, las relaciones entre salud y calidad de vida no son novedosas y exigen hacer exphcito a qu tipo de salud y a qu concepto de calidad de vida nos referimos cuando hablamos de salud en calidad de vida, por ejemplo. Esta ser la discusin que abordaremos a continuacin. Definiciones de salud y concepciones de calidad de vida que toman a su cargo Definiciones de salud negativas y restrictivas: Es el conjunto de definiciones de orientacin biologicista y organicista en las que la salud aparece como una propiedad naturalmente definida de los organismos biolgicos individuales y a los que hay que entender como un todo orgnico. Las denomino restrictivas porque manifiestan un compromiso determinado y explcito con la dimensin unitaria y orgnica del individuo. En ese sentido, como afirma Kass, la finalidad de la medicina, y diramos nosotros por extensin la de las otras profesiones de salud, se circunscribe a intervenir cuando sea necesario para contribuir a la conservadn y funcionamiento de las diferentes partes que se interrelacionan como un todo orgnico en el individuo. "La salud, afirma de nuevo Kass, es el patrn natural o norma -no una norma moral, no un valor contrapuesto a un "hecho", no una obligacin-, un estado del ser que se revela a s mismo en la actividad como un patrn de excelencia corporal o buena condicin fsica". En estas concepciones la salud es un hecho objetivo, natural y biolgicamente determinado. Por su vnculo conceptual con la enfermedad biolgica, o ms exactamente con su ausencia, las llamamos definiciones negativas. El ncleo central de estas definiciones es lo que se conoce como "salud fsica". Su criterio de calidad de vida podra definirse como el cubrimiento de las necesidades que de no ser satisfechas implicaran que el individuo padezca de manera aguda y prolongada una o ms dolencias especficas.

231

La Salud PbUca Hoy

Segn esa lgica lo que ha de valorarse en una evaluacin de la calidad de vida es la satisfaccin de la salud fsica considerada como necesidad bsica humana porque para realizar una serie de actividades prcticas en la vida cotidiana los individuos deben contar con aptitudes manuales, mentales y emocionales que la mala salud deteriora. La salud fsica no deja de ser una abstraccin y, de cierta manera, un reduccionismo que oculta otras dimensiones de la esfera social y simblica que intervienen en la sanacin o en el padecimiento. Aunque toscas y equivocadas a nuestros ojos y amphamente refutadas por la hteratura, estas concepciones de la salud no dejan de tener cierta vigencia por cuanto en el orden conceptual y epistemolgico del modelo biomdico, hegemnico hoy da en el campo de la salud, lo sodal es objeto de un reduccionismo formal que lo confina al plano fenomnico de las actitudes, los comportamientos y los "factores de riesgo"'^. Prevalece una dicotoma insalvable entre lo biolgico y lo social.

Definiciones de salud positivas y restrictivas: Se rene aqu a las postoras sobre la salud que no se definen por oposicin a la enfermedad (positiva) y que, por lo tanto, involucran otras dimensiones de la vida humana. La ya clsica definicin propuesta en la carta fundacional de la O.M.S. (1948) segn la cual la salud es un estado de completo bienestar fsico, mental y social y no solamente la ausenda de enfermedad y de sufrimiento sera paradigmtica dentro de este grupo. Esta definicin, que signific en su momento un esfuerzo importante por sealar una responsabihdad y un papel al Estado en la consecucin de los objetivos prescritos en ella, reconoce la complejidad de las dimensiones que inciden sobre la salud y que estn ms all de lo puramente biolgico; sin embargo, no logra liberarse del reduccionismo (por eso es restrictiva) propio de su lgica de construccin y se pueden enumerar de la sigiente manera:
Desde los postulados de McMahon, las obras de LeaveU y Clark, Susser y Rolhman se intenta, como afirma Breilh, juntar lo social y lo biolgico por medio de una simple asociacin extema, razn por la cual en ellos prevalece una dicotoma entre lo social y lo biolgico en la que lo social constituye un ordenamiento causal con la enfermedad establecida por asociacin emprica. Esta discusin .se encuentra ampliada en Breilh, Jaime. "Nuevos ccmceptos y tcnicas de investigacin ", Ediciones Ceas, 1994.

232

Repensar ias relaciones entre calidad de vida y salud

1) En S prctica sanitaria persiste la nocin del cuerpo-mquina en su U versin energtico-material abstrada del mundo simbhco. 2) Preeminencia del individualismo metodolgico que sugiere un tratamiento de lo social y de lo cultural a partir de la identificacin de las creencias, hbitos y comportamientos como factores formales y discretos, medidos a nivel individual y, posteriormente, relacionados con la morbihdad y la mortalidad del grupo. 3) Idea de un individuo estrictamente racional y preexistente a las relaciones e interacciones sociales. Acoge el modelo biomdico, patrimonio heredado de la concepcin liberal-individualista segn la cual los sujetos no slo tienen preeminencia sino un carcter constitutivo frente a lo social. Las consecuencias de esta perspectiva se expresan en la valoracin de los procedimientos racional-instrumentales hegemnicos en el campo de la salud, y en otros campos sociales y que, desde luego, est determinada desde rdenes sociales ms amplios, inscritos en el proyecto modernizante de la sociedad capitalista. La inmanencia natural del individuo lo coloca en una sitoacin acultural y ahistrica. Esta estructura conceptual, que persiste en la orientacin bio-sico-social de la salud, tiene implicaciones directas sobre la concepcin de la calidad de vida de los individuos en cuanto a la manera de valorar y lo que se debe valorar. En primer lugar, en esta escala de atributos la salud se reduce a uno ms de los aspectos que pueden definirse en un enfoque evaluativo sobre calidad de vida; funcionalmente queda circunscrito a la atencin de la enfermedad, a pesar de que la salud, segn la definicin de la O.M.S, es un asunto de derechos y un ideal de bienestar. Desde luego que este reduccionismo en el concepto de salud no se puede comprender cabalmente por fuera de una prctica social, en la que predomina la lgica del mercado y en la que el bien salud pasa de ser un derecho a un servicio de adquisicin individual y de base contractual. La racionahdad instrumental del Estado es congruente con la del mercado y con las concepciones que privilegian perspectivas y condiciones instrumentales. En segundo lugar, los aspectos de la salud relacionados con la calidad de vida adquieren un carcter funcional y formal que, bajo una orientacin clnica, da cuenta bsicamente de las comportamientos y las funciones de los individuos afectados por la enfermedad. Esta es la lgica con la que se disean modelos de evaluacin como el perfil del efecto de la enfermedad

233

La Salud PbUca Hoy

(PEE) que mide aspectos como sueo, comer, trabajo, recreacin, paseos, movilidad, interaccin social, conducta alerta y emocional y comunicacin, entre otros (Nussbaum y Sen, 2000); el ndice de calidad de vida que nde la calidad de vida de los pacientes con cncer o el ndice de condicin de la salud que aborda tres categoras de funciones: movihdad, actividad fsica y actividad sodal. A pesar de que midenfimcionesprimarias muy amplias y de que tienen aceptacin y utihdad prctica en el medio mdico, estos diseos evaluativos armonizan perfectamente con la estmctora conceptoal que alimenta el modelo bio-clico que adopta un enfoque conductoal respecto a los pacientes. Describen comportamientos tan hmitados de la salud y de la cahdad de vida de las personas que no pueden llevar a contextos ms amplios los aspectos valorativos que destacan (movidad, actividad social, autonoma, interaccin social) y quedan estrictamente referidos al cuidado de la enfermedad. La pretensin de describir un mbito de salud ms amplio, que se conecte con el bienestar humano y con su proceso de vida se frustra cuando el modelo conceptual que se privilegia no logra superar el marco biologicista y fenomnico de la salud (el cuerpo humano como biologa y la accin humana como cmulo de comportamientos formahzables). Hacia una nocin de salud que se corresponda con la calidad de vida humana Hasta ahora hemos sealado que un concepto restrictivo de salud determina consideraciones restrictivas de la calidad de vida de las personas. En ese sentido, y respecto de la calidad de vida, la salud como ausencia de enfermedad constituye un sustrato fragmentario, funcional y limitado. Si asumimos que la salud forma parte integral de la experiencia vital de las personas, necesariamente hay que reconocer sus implicaciones en trminos de realizacin humana y en relacin con las finahdades mismas de la experiencia vital. Por esta razn, la nodn de salud tiene un vnculo profundo e irierente con los planes de vida individual y colectivos y con las mejores condidones y recursos socialmente definidos para la realizacin de dichos planes (Hemndez y Vega, 2001, 224).

234

Repensar las relaciones entre calidad de vida y salud

Seguir esta perspectiva tiene consecuencias sobre los sistemas lgicos conceptuales, los objetos de reflexin, las herramientas conceptuales, metodolgicas y prcticas y los marcos comprensivos que se apliquen a la enfermedad y cmo tratarla. Aunque por su complejidad y densidad el desartollo detallado de estos asuntos no es objeto del presente escrito, podemos sealar algunas consideraciones generales: 1. Cuando se asume la salud como la realizacin de los planes de vida individuales y colectivos en las mejores condiciones socialmente determinadas, se est sealando que los individuos han de ser considerados desde su nocin social, esto quiere dedr que no solo se reconoce que los individuos son y se socializan en la vida social y cultural y en la historicidad de los pueblos y de las comunidades a las que pertenecen, lmites y posibiUdades de su existencia, sino tambin que su condicin humana y de agentes sociales los dota de la capacidad de hacerse cargo de su propia vida construyendo interacciones sociales de convivencia; que como agentes morales pueden y deben participar de las decisiones que comprometen su existencia pues son fines en s mismos y no medios para los fines de los otros y que como actores sociales requieren condiciones para la realizacin de su vida comuitaria y social. 2. En el nsmo sentido, la enfermedad, el padecinento, la curacin, la sanacin y el cuerpo, aparecen como categoras sociales que generan informacin valiosa para repensar la actividad chuica en desarrollo de procesos teraputicos dialgicos. 3. Se exige igualmente un marco interpretativo ms integral y complejo que integre diferentes aspectos de la vida anmica, social y cultural de los individuos como explicacin de la enfermedad y la salud. La dimensin biolgica no preexiste a la consideracin social. El mbito social es el espacio de realizacin de lo biolgico y lo rco que se puede afirmar es su interdependencia con lo social humano. Toda la valoracin sobre "el cuerpo fsico" pone de presente una dimensin tica y poltica. 4. Pero finalmente, en funcin de un proyecto de salud para la poblacin, es imposible evadir compromisos con la libertad y la dignidad humana, razn de ser de la salud pbhca.

235

La Salud PbUca Hoy

Referencias bibliogrficas ARENDT, Hannah. La condicin humana. Barcelona : Editorial Paids, 1993. .. t :.;. BROCK, Dan. "Medidas de la calidad de vida en el cuidado de la salud y la etica mdica". En : NUSSBAUM, Martha y SEN, Amartya. Calidad de Vida. Ciudad de Mxico : Fondo de Cultura Econmica. Segunda Reimpresin, 2000. BULA, Jorge Ivn. En : Fundamentos econmicos de una teora de lajusticia,l995. ,. ... CORREDOR, Consuelo. "Es la pobreza un problema de exclusin? implicaciones de pohtica". En : Equidad y Poltica Social en Colombia. CORTES RODAS, Francisco. De la poltica de la libertad a la poltica de la igualdad. Bogot D.C. : Siglo del Hombre Editores, Universidad de Antioquia. la. edicin, 1999. FOUCAULT, Michel. El nacimiento de la clnica: Una arqueologa de la mirada mdica. Mxico : Siglo veintiuno editores. 13" ed. 1989. FRASER, Nancy. lustitia Interrupta, reflexiones crticas desde la posicin post-socialista. Bogot : Siglo del Hombre Editores, Universidad de Los Andes, 1997. FRESNEDA, scar. "ndice de Calidad para Bogot". En : Cuademos de Investigacin del Observatorio. Bogot : Observatorio de Cultura Urbana. I.D.C.T., 1998. . . HLLER, Agnes. Una revisin de la teora de las necesidades. Barcelona: Editorial Paids, 1996. HERNNDEZ, Mario. "El derecho a la salud en Colombia: obstculos estructurales para su realizacin". En : La Salud est grave: Una visin desde los derechos humanos. Bogot : Plataforma Colombiana de Derechos Humanos, Democracia y Desartollo. Primera reimpresin, 2000.

236

Repensar las relaciones entre calidad de vida y salud

HERNNDEZ, Mario y VEGA, Romn. En : Equidad?: el problema de la equidad financiera en salud. Plataforma Interamericana de Derechos Humanos, Democracia y Desarrollo. Bogot : Universidad Nacional de Colombia, Alames, 2001. MALAGN, Rafad y REVERN, Carlos. "Equidad en el sistema de educacin superior". En : Revista Estadsticas U.N. O.P.N. Uiversidad Nacional de Colombia, 2002. MARTI TUSQUETS, Jos Luis. "El descubrimiento cientfico de la salud". Barcelona: Anthropos, 1999. NUSSBAUM, Martha y SEN, Amartya. Calidad de Vida. Ciudad de Mxico : Editorial Fondo de Cultora Econmica. Segunda Reimpresin, 2000. RAWLS, John. Teora de la justicia. Mxico D.F.: Fondo de Cultura Econmica. Primera reimpresin, 1997. SEN, Amartya. Desarrollo y libertad. Editorial Planeta. Tercera reimpresin, 2001. SEN, Amartya. La desigualdad econmica. Mxico D.F.: Fondo de Cultora Econmica, la. ed., 2001.

237

y...

-1

. -.1

. .

->

Salud en calidad de vida un enfoque innovador


ISABEL CRISTINA RUIZ BUITRAGO

"Consideramos a todo ser humano vivo, como el mximo valor sobre la tierra. La conservacin de su vida, pero rio de una vida cualquiera, sino de la mejor vida posible para l es la empresa ms importante a que una sociedad debe dedicarse "
Hctor Abad Gmez

Ilatroduccn La salud piblica Para asumir un tema como el propuesto, se hace necesario revisar desde qu concepto de salud pbhca se realizar el anhsis propuesto. La salud pblica es la resultante de la interaccin armnica de las condiciones biolgicas, psquicas, sociales y cultorales del individuo, con su entorno y con la sociedad, que le permite acceder a un mejor nivel de bienestar como condicin esencial para la vida, es un servicio pblico, incluido en los derechos econmicos, sociales culturales y ambientales. Y tambin, como un deber de los ciudadanos en tanto sujetos de derechos y deberes, es adems una construccin poltica en la que necesariamente deben participar el Estado y la sociedad civil.

239

La Salud PbUca Hoy

Si asumimos esta definicin el papel del sector salud se ve francamente limitado para garantizar la calidad de vida y el bienestar de la poblacin y obliga a pensar en la interaccin de los otros sectores, y en la influencia de cada uno de los determinantes de la salud. La salud tiene que ver con el empleo, la vivienda, la recreacin, la educacin, la alimentacin, la disponibihdad de servicios pblicos, las condiciones de saneamiento ambiental, los servicios de salud, los estos de vida, el comportanrento humano y los factores protectores del entomo. La hntacin del papel del sector obliga con mayor seriedad a gestionar adecuadamente lo de su competencia, y a obtener los mejores resultados en cuanto al logro de metas en salud, y tambin a la mejor utilizacin y aprovechamiento de los recursos. La salud pblica en la Ley 100 Seguramente, en el contexto de los temas tratados en esta ctedra, la salud pblica en el SGSSS en Colombia ha sido ya un tema analizado, sin embargo, y con miras a colocar nuevos elementos de anlisis, me referir a este tema. Si se pudieran resumir en pocas palabras los problemas que rodearon la prdida de la visin de salud pblica, lo resumira en los siguientes aspectos; El papel del Ministerio de Salud como ente rector de la salud pblica en el pas se desdibuj evidencindose una crisis de gobemabilidad en salud. Se identifica una falla tcnica nacional para orientar la salud pblica con otros actores y en otros escenarios. Prdida del enfoque y orientacin hacia la salud pblica. Atencin bsicamente dedicada al cumplimiento de los planes de beneficios. Y una no gestin de las responsabilidades de todos los actores. Programas preventivos sin orientacin ni gestin en el SGSSS

Los contenidos en el desarrollo normativo del SGSSS, que hacen referencia a la salud pblica son los de promocin y prevencin conteidos en los planes de beneficios del rgimen subsidiado y contributivo y el Plan de

240

Scdud en calidad de vida un enfoque irmovador

Atencin Bsica, este ltimo dirigido a toda la poblacin independiente de la forma de aseguramiento en salud en el Sistema. Se han definido desde 1994 y para efectos de aplicar la normatividad expedida, grupos prioritarios de la poblacin a quienes se deben dirigir las acciones, se han sealado los contenidos, se han precisado responsables de la ejecucin de estas acciones y se han definido fuentes de financiacin. Despus de ocho aos de la reforma al sistema de salud en Colombia, los resultados podran resumirse: Se han realizado acciones aislados con muy pobre impacto poblacional, la inversin de los recursos de promocin y prevencin de los planes de beneficios se ha hecho ms con concepciones ldicas (talleres educativos y recreativos) que de impacto en salud pblica; una pobre gestin de los planes de atencin bsica en el pas, con diversos enfoques, con un evidente forcejeo de los diferentes actores para la realizacin de las mismas. Se perdi el control sobre la gestin de la infonnacin que d cuenta de la sitoacin salud del pas. La informacin disponible slo ha conducido a una mirada parcializada. La situacin de salud del pas se observa en un deterioro progresivo evidenciado en la disminucin de las coberturas de vacunacin; el recrudecimiento de problemas como la malaria, el dengue y la tuberculosis; el crecimiento sin medida de la infeccin por VIH-SIDA; el aumento de mortalidad por causas evitables; la violencia constitoye el principal problema de salud pblica del pas, no slo por las cifras de muertos, lesionados, secuestrados, desaparecidos y desplazados que sta representa, sino tambin por el impacto que tiene sobre la salud de los colombianos y sobre este sector De otro lado, las interpretaciones diversas y a conveniencia de cada uno de los actores del sistema frente a su responsabilidad y seguimiento de los hneamientos tcnicos, normativos y de ejecucin de los recursos; como el caso de las aseguradoras, los entes territoriales y los prestadores de servicios de salud. Confluyen aqu diversas problemticas: los entes territoriales en el ejercicio de los procesos de descentralizacin, reordenamiento y ajuste fiscal, perdieron un terreno ganado en el desarrollo tcnico y de gestin para cumplir con las funciones que frente a la salud pbhca les compete; actualmen-

241

La Salud Pblica Hoy

te las direcciones de salud departamental y murcipal no tienen una infraestructura tcnica de soporte que posibilite un espacio real a la Salud Pbhca. Esta sitoacin a su vez se ha cruzado con las demandas que desde el aseguramiento se hace a la gestin del mismo, especialmente en el rgimen subsidiado. En conclusin, pudiera decirse que han existido problemas de enfoque de gestin y operacin del sistema, que han influido negativamente sobre la salud de la poblacin. Los programas de salud pblica que tuvieron todo su desarrollo en el Sistema Nacional de Salud (sin que se legitime con ello acrticamente su existencia y forma de abordaje a los problemas de salud), se ven hoy enfrentados a su peor crisis, generando preguntas obligadas para el Sistema de Salud tales como: Son los programas una estrategia vlida para enfrentar problemas de salud pblica en el SGSSS hoy? Ser necesario reasumir programas verticales con directrices nicas desde el Ministerio de Salud?, Cul debe ser la alternativa ms clara para enfrentar el deterioro de la salud de la poblacin por problemas de salud pbhca para los que existen estrategias demostradas de intervenciones vlidas para su manejo? Obviamente la complejidad de los problemas de salud pbhca en Colombia no puede reducirse en su abordaje a los programas de salud pblica. Problemas como la violencia, la inequidad, la cobertura limitada del aseguramiento en salud, el volumen de poblacin no cubierta por subsidios a la demanda, la falta de acceso al saneamiento bsico de la poblacin de una cuarta parte de los colombianos exigen de definiciones ms profundas. Exigen la definicin de una verdadera poltica pblica que tenga como fundamento principal el derecho a la salud, englobando en ste el derecho de la poblacin a la asistencia sanitaria, al bienestar y a la calidad de vida, a la seguridad, al derecho a la vida y a la participacin ciudadana. La salud pblica hoy: posibilidades y limitaciones Hoy la salud pbhca est cruzada por una nueva ley de distribucin de competencias y recursos: la Ley 715 del 21 de diciembre de 2(X)1. Sin dejar de reconocer las limitaciones que tiene la Ley en muchos aspectos que no voy a mencionar para no desviar el tema que nos compet, tiene para la salud pblica un espado a mi modo de ver de grandes posibihdades.

242

Salttd en calidad de vida un enfocpie innovador

El municipio se ha convertido en el elemento ms rico en oportunidades para el desarroUo, la gestin y la consoUdacin de una poltica de salud pbhca en el pas y el mejoramiento de las condiciones de vida de la poblacin. En la definicin de las responsabilidades en salud pblica para el municipio, los compromisos del alcalde con la salud pblica son: El alcalde tiene la responsabilidad de dirigir el sector en el mbito municipal, le corresponde realizar los procesos de planificacin del desarrollo de su poblacin, definir los planes, programas y proyectos en funcin de un objetivo fundamental: garantizar el desarrollo social, un ambiente sano, la convivencia armnica, la participacin ciudadana. Adoptar, adaptar e implementar polticas. Es su funcin promover la coordinacin, cooperacin e integracin fincional de los diferentes sectores para la formulacin de los planes, programas y proyectos en salud pblica en el municipio. Le corresponde formular, ejecutar y evaluar el Plan de Atencin Bsica municipal. Igualmente, gestionar los recursos, el acceso a los servicios, realizar la vigilancia a las condiciones ambientales que afectan la salud humana, promover la participacin social y uno de las funciones ms importantes, garantizar el aseguramiento de la poblacin, aplicar el SISBEN, financiar y cofinanciar el rgimen subsidiado, vigilar y controlar la evasin y la elusin. Establecer la situadn de salud y adaptar, administrar e implementar el sistema integral de informacin. Todo lo anterior hace pensar que la Salud Pblica desde una mirada integral recobra en el municipio -espacio, poblacin- territorio que se haba perdido con la reforma a la seguridad social, promueve una necesaria articulacin en el sistema general de seguridad social, obligando a la articulacin de los planes de beneficios del rgimen contributivo y subsidiado desde sus acciones individuales y las colectivas del PAB, potenciando la utihzacin de los recursos y de las acciones. Promueve en el municipio la articulacin intersectorial en fincin de la salud pbhca.

243

La Salud PbUca Hoy

Esta nueva sitoacin obhga a redimensionar el papel del estado con los compromisos para con la salud pblica del pas, exige la definicin de una poltica nacional de salud pblica orientada a intervenir los problemas fundamentales, a fortalecer la gestin territorial, a promover el fortalecimiento del muiucipio y el empoderamiento de la pobladn en la gestin de su salud. Surgen dudas lgicas frente a los desarrollos diferenciales de los municipios, a sus condiciones socioeconmicas y polticas, desarrollo administrativo y todos los elementos que de una u otra forma pudieran afectar el proceso de gestin municipal de la salud pblica. i."' " A mi modo de ver sta nueva apertura hacia la salud pbhca tiene posibilidades tangibles desde una mirada integral del desarrollo, buscando potenciar el qu hacer de todos los sectores en un proyecto concreto de desarrollo municipal, que tendra resultados, transformadores de la realidad social. Diversos son los actores del desarrollo econmico y social y obviamente diferentes sus intereses: la clave est en buscar los puntos de acuerdo, buscar el compromiso en los logros de las metas nacionales. Ningn desarrollo hoy puede sustraerse del tema ambiental, lo que tambin implica un nuevo concepto de crecimiento econnco, un concepto que brinde justicia y oportonidad para todos. El plan de desarrollo municipal se convierte en una herranenta que permite articular el papel de cada uno de los sectores en funcin de transformar las condiciones de salud de la poblacin. Lgicamente se necesita un alcalde en pleno conocinento de las condiciones de salud de la poblacin, con clara evidencia de las posibihdades de intervencin, con capacidad de gestionar la participacin intersectorial y conducir a todos los actores en el municipio hacia la transformacin de las condiciones de salud de la poblacin. Es necesario comprender el papel de la comunidad y su participacin y empoderamiento de la gestin de sus condiciones de salud.

244

Salud en calidad de vida un enfoque irmovador

Cada uno de los sectores del desarrollo desde el municipio pueden potenciar logros para el sector salud, si existe claridad de su papel, de su contribucin con el desarrollo social y la conveniencia de garantizar mejores condiciones de bienestar y cahdad de vida para la poblacin. Figura 5.1 Plan de desarrollo
MUNICIPIO
p L A N D E D E S A R R 0 L L 0
Proyectos de desarrollo agropecuario, disponibilidad y seguridad alimentaria.

AGRICULTURA SALUD EDUCACIN Objetivo Comn

As^uramiento. prestacin de servicios Salud Pblica. Acceso proyectos educativos, infraestructura, dotacin tecnologa, recreacin y deporte. Desan-ollo infraestructura sanitaria y espacios pblicos. Proteccin y garanta doechos de! ciudadano.

OBRAS PBUCAS JUSTICIA DESARROLLO SGOAL CONSEJO MUNICIPAL ,

V ^^^^^~z'

-poblacin sana -ambiente sano -convivencia armnica -participacin

Organizacin y apoyo a redes.

Polticas pblica.s saludables Gestin municDal.

Se pretende integrar desde el muicipio el papel de todos los actores, es as como cobran sentido las acciones individuales de los planes de beneficios con metas de cumphmiento sobre los principales problemas de salud pbhca. Cortesponde al alcalde tener una mirada integral del municipio en el que se puedan monitorear todas las acdones de salud de la poblacin desarrolladas a travs de todos los planes de beneficios, con estrategias de monitoreo de la ejecucin de los recursos.

245

La Salud PbUca Hoy

Figura 5.2

PLANES DE B E N E F I C I O S V FINANCIACIN
Plan obligatorio de salud del rgimen contributivo UPC y recursos de promocin y prevencin, acciones individuales Plan obligatorio del rgimen subsidiado UPC- acciones individuales. NO ASEGURADOS No tiene definido tm plan- atencin por demanda de servicios subsidiados de oferta y prestacin de servicios a travs de la red pblica. DESPLAZADOS Plan integral a libre demanda, recursos de la subcuenta de eventos catastrficos. Plan de atencin bsica Objetivo toda la poblacin Sistema general de participaciones recursos departamentales y munic^jales Acciones colectivas de alto impacto

El SGSSS defini las normas de obUgatorio cumplimiento sobre las acciones de proteccin especfica y de deteccin temprana a fin de orientar su aplicacin y dar un mejor ordenamiento a los recursos de salud pblica en el sistema. Los desartoUos normativosfimdamentalesquetienenque ver con el tema son: Acuerdo 117 del 29 de diciembre de 1998 Por el cual se establece el obligatorio cumplinento de las actividades, procedimientos e intervenciones de demanda inducida y la atencin de enfermedades de inters en salud pblica. Este acuerdo ha sido uno de los logros ms importantes para garantizar las acciones de proteccin especfica y deteccin temprana de los eventos ms importantes en la salud pblica. Modific la forma de financiacin de las acciones de promocin y prevencin y el cruce de cuentas entre las entidades promotoras de salud. De forma complementaria, el Acuerdo 117 de 1998 consider que se deba buscar el concurso unificado de las acciones del Estado, las EPS, entidades

246

Salud en calidad de vida un enfoque innovador

adaptadas y transformadas y las administradoras del rgimen subsidiado, en el desarrollo de las actividades de prevencin y control de la morbhnortalidad evitable, a fin de alcanzar las metas propuestas para conseguir un cambio positivo en la salud de la poblacin. Recogi la responsabilidad de las EPS, entidades adaptadas y transformadas y las administradoras del rgimen subsidiado de adnnistrar el riesgo en salud individual de sus afiliados, procurando disminuir la ocurrencia de eventos previsibles de enfermedad o de eventos de enfermedad sin atencin. Adicionalmente reconoci que los servicios de proteccin especifica y de deteccin temprana no son demandados por los usuarios en forma espontnea y por lo tanto las EPS, entidades adaptadas y transformadas y las admilstradoras del rgimen subsidiado deban disear e implementar estrategias para inducir la demanda a estos servicios, de manera que se garantizaran las cobertiu-as necesarias para impactar la salud de la colectividad. En este sentido, con esta normatividad se busc mejorar la eficiencia y efectividad de las acciones de proteccin especfica y deteccin temprana existentes en los planes de salud contributivo y subsidiado, as como la utilizacin de los recursos per cpita disponibles para la proteccin integral de los afiliados, avanzando con un esfuerzo conjunto en el logro de metas en salud pblica. Resolucin 412 de 2000 Por la cual se establecen las actividades, procedinentos e intervenciones de demanda inducida y obligatorio cumplimiento y se adoptan las normas tcnicas y guas de atencin para el desartollo de las acciones de proteccin especfica y deteccin temprana y la atencin de enfermedades de inters en salud pbhca. Resolucin 3384 de 2000 Por la cual se modifican parcialmente las resoluciones 412 y 1745 de 1000 y se deroga la Resolucin 1078 de 2000. Enfermedades de inters en salud pblica: Son aqueUas enfermedades que presentan im alto impacto en la salud colectiva y ameritan ima atencin y seguimiento especial. Estas enfermedades responden a los siguientes criterios:

247

La Salud PbUca Hoy

Enfermedades infecciosas cuyo tratamiento requiere seguirrento de manera estricta y secuencial en el manejo de quimioterapia para evitar el desarrollo de qinoresistencia, con grave impacto sobre la colectividad. Enfermedades de alta prevalencia que de no recibir control y seguimiento constante y adecuado constituyen un factor de riesgo para el desarrollo de enfermedades de mayor gravedad, secuelas hreversibles, invahdez y muerte prematura. , -r; i f Actores y competencias Cada uno de los actores del sistema tienen competencias claramente defirdas para la planeacin, organizacin, administracin y ejecucin de las acdones de promocin y prevencin, deben realizar las acciones conducentes a reducir el riesgo de enfermar y morir por causas evitables, alcanzar mejora en los niveles de salud y garantizar la salud colectiva, buscando impactar positivamente las metas de salud pblica del pas. Los actores fundamentales son los siguientes: 1. Ministerio de Salud Define las polticas pblicas Le cortesponde expedir las normas tcnicas y administrativas de obligatorio cumplimiento para las entidades promotoras de salud, las institociones prestadoras de salud del Sistema General de Seguridad Social en Salud y para las direcciones seccionales, distritales y locales de salud. Define las normas tcnicas y los procedimientos para la ejecucin de las nsmas Define las formas de financianento y la forma como se articulan los recursos financieros para el desarrollo de las acciones Define las normas para el seguimiento y el control Realiza la evaluacin del cumplimiento de las acciones de promocin y prevencin y de la utilizacin de los recursos financieros Define los mecanismos de articulacin para la ejecucin de las acciones de importancia en salud pblica ^. Vigilancia y el control Los contenidos de las guas de atencin sern actuahzados peridicamente por el Ministerio de Salud de acuerdo con los cambios en la es-

248

Salud en calidad de vida un enfoque irmovador

tructura demogrfica de la poblacin, el perfil epidemiolgico, la tecnologa disponible en el pas, el desarrollo cientfico y la normatividad vigente. 2. Superintendencia Nacional de Salud: La Superintendencia Nacional de Salud, ejercer las funciones de vigilancia y control de confomdad con las normas vigentes y lo establecido en el artculo 18 del Acuerdo 117 del Consejo Nacional de Seguridad Social en Salud. 3. Entes territoriales (direcciones departamentales y distritales de salud) Semestralmente las direcciones departamentales y distritales de salud remitirn a la Direccin General de Promocin y Prevencin del Ministerio de Salud un informe sobre la gestin de las ARS de su departamento, presentando para cada una y por cada contrato el estado de los indicadores establecidos en el "Anexo de Indicadores de Gestin", contenido en las normas.

- Direcciones territoriales de salud ejercern las fundones de vigilancia y control de conformidad con las normas vigentes y lo establecido en el artculo 18 del Acuerdo 117 del Consejo Nacional de Seguridad 4. Empresas promotoras de salud (administradoras del rgimen contributivo) administradoras del rgimen subsidiado - Las EPS, entidades adaptadas y transformadas y las administradoras del rgimen subsidiado son responsables del obligatorio cumplimiento de actividades, procedimientos e intervenciones de demanda inducida y la atencin de enfermedades de inters en salud pblica de que trata el Acuerdo 117 en su poblacin afihada. - Las administradoras del rgimen contributivo y subsidiado tienen la obligatoriedad de prestar todos los planes de beneficios a su poblacin, incentivando las acciones de promocin y prevencin.

249

La Salud PbUca Hoy

Las EPS, entidades adaptadas y transformadas y las administradoras del rgimen subsidiado, adems de las sealadas, podrn desarrollar otras actividades de proteccin especfica y deteccin temprana y priorizar la atencin de otras enfermedades de inters en salud pblica, de acuerdo con los perfiles epidenolgicos de su poblacin y las metas en salud pblica territoriales.

- Todas las EPS, entidades adaptadas y transformadas y las admirstradoras del rgimen subsidiado, tienen la obligacin de contar como parte de la red asistencial, con una red de prestadores de servicios debidamente acreditada, propia o contratada, pbhca o privada que garantice las atenciones en salud conteidas en el Acuerdo 117. El listado de IPS que conforman la red y los servicios que prestan, deber ser entregado a cada usuario en el momento de su afiliacin. Las EPS, entidades adaptadas y transformadas y las administradoras del rgimen subsidiado, debern mantener una ficha actualizada, en la cual conste la informacin de las actividades, procedimientos e intervenciones de demanda inducida y obligatorio cumplimiento, reahzadas a cada uno de los afiliados.

- Es responsabihdad de las EPS, entidades adaptadas y transformadas y las administradoras del rgimen subsidiado, establecer los mecanismos necesarios para identificar los riesgos en su poblacin afiliada, con el fin de direccionar las acciones de proteccin especfica, deteccin temprana y la atencin de enfermedades de inters en salud pblica. Las EPS, entidades adaptadas y transformadas y las administradoras del rgimen subsidiado debern desartoUar estrategias para promover en sus afiliados la utilizacin de los servicios descritos en el Acuerdo 117, as como facilitar el acceso a programas permanentes de atencin de las enfermedades de inters en salud pblica.
] .! .. ' .

- -

Es responsabilidad de las EPS, entidades adaptadas y transformadas y las admirstradoras del rgimen subsidiado, reahzar la identificacin de los riesgos del ambiente que inciden sobre la salud de su poblacin afihada, notificar oportunamente la presencia de casos de enfermedades

250

Scdud en calidad de vida un enfoque innovador

objeto de vigilancia en salud pblica y coordinar las acciones a realizar conjuntamente con las autoridades locales, en el mbito del Plan de Atencin Bsica (PAB) Que de conformidad con el artculo 2 del Decreto 1485 de 1994 y el Decreto 2357 de 1995, el Sistema General de Seguridad Social, fija como responsabilidad de las EPS, entidades adaptadas y transformadas y las administradoras del rgimen subsidiado, administrar el riesgo en salud individual de sus afiliados, procurando disminuir la ocurrencia de eventos previsibles de enfermedad o de eventos de enfermedad sin atendn. EPS, entidades adaptadas y transformadas y las administradoras del rgimen subsidiado deben disear e implementar estrategias para inducir la demanda a estos servicios, de manera que se garanticen las coberturas necesarias para impactar la salud de la colectividad Las entidades promotoras de salud, entidades adaptadas y administradoras del rgimen subsidiado, no podrn dejar de efectoar las actividades, procedimientos e intervenciones contenidas en las normas tcnicas. Tampoco podrn disnnuir la frecuencia anual, ni involucrar profesionales de la salud que no cumplan las condiciones mnimas establecidas en la norma. i Responsabilidad de las EPS en el rgimen contributivo frente a los medicamentos NO-POS incluidos en las Normas Tcnicas y Guas de Atendn. De conformidad con lo establecido en el acuerdo 110 del Consejo Nacional de Seguridad Social en salud, para garantizar el derecho a la vida y a la salud de las personas, las EPS podrn formular medicamentos no incluidos en el manual de medicamentos adoptados a travs del acuerdo 83 del CNSSS Guias de Atencin Es el documento mediante el cual se establecen las actividades, procedimientos e intervenciones a seguir y el orden secuencial y lgico para el adecuado diagnstico y tratamiento de las enfermedades de inters en salud pblica establecidas en el Acuerdo 117 del Consejo Nacional de Seguridad Social en Salud y a cargo de las entidades promotoras de salud, entidades adaptadas y administradoras del rgimen subsidiado.

251

La Salud Pblica Hoy

- Las guas de atencin relacionadas con toberculosis, lepra, leishmaniasis y malaria contienen elementos normativos de obhgatorio cumplimiento. 5. Los usuarios Como ciudadanos objeto de las acciones de Salud Pblica y responsables del mantenimiento de salud, tienen las siguientes obligaciones: - Pagar oportunamente los aportes al SGSSS, si la afiliacin es al rgimen contributivo, - Mantener la adhesin a los programas de promocin de la salud y prevencin de la enfermedad sugeridos por las entidades promotoras de salud de acuerdo con sus riesgos, - Seguir las recomendaciones sobre el tratamiento prescrito, sobre el autocuidado y el de su familia, - Mantenerse informado sobre los servicios y actividades que desarrollan las EPS y las IPS para su atencin. Implicaciones para los diferentes actores en el desarrollo de las estrategias de demanda inducida La definicin de las estrategias de demanda inducida a cada una de las eps y administradoras del rgimen subsidiado, le hace una exigencia de anlisis integral de las demandas de cada una de las normas tcnicas que atraviesa todos los procesos de la organizacin: Tales como la planificacin, los procesos de aseguramiento, organizacin de la red de servicios, definicin de los lineamientos para la contratacin de las acciones de promocin y prevencin, las obligaciones de los contratistas etc.; contratacin con las IPS para la prestacin de servicios de salud, evaluacin y anlisis de la poblacin, anlisis de demanda, evaluacin de la oferta, capacidad resolutiva de la oferta y de la red de servicios, sistema de garanta de la cahdad, vigilancia epidemiolgica, sistema de informacin y sistema de evaluacin integral de la prestacin de servicios. Las IPS que contratan servicios para la atencin integral de la poblacin afiliada a las EPS Y ARS deben evaluar muy bien la capacidad resolutiva de los servicios constitutivos de su oferta de servicios, deben contar con los recursos humanos y tcnicos exigidos en las normas. Las IPS deben tener

252

Salud en calidad de vida un enfoque innovador

claros los compronsos adquiridos a travs de los contratos; deben garantizar la integraUdad del sistema de informacin y el flujo de la misma. Igualmente, deben establecer una clara comunicacin con la EPS o ARS a fin de conocer la red de servicios complementaria a las acciones que realiza. Los entes territoriales: Tambin deben garantizar la red de servicios complementaria que responda por las actividades exigidas en las normas y que no son objeto del Plan Obligatorio de Salud del rgimen subsidiado. Estas exigencias igualmente cruzan por los procesos de planeacin, organizacin de la red de servicios, procesos de contratacin y garanta de la calidad. Otra importante exigencia son las acciones de vigancia y control, asistencia tcnica y monitoreo permanente de las acciones de las ARS en las estrategias de demanda inducida. El Ministerio de Salud, tiene la obligacin de evaluar integralmente las acciones del sistema, en la programacin, ejecucin, cumplimiento de las normas, en el manejo integral de las acciones de demanda inducida, en la utilizacin adecuada de los recursos complementarios entregados a las EPS. Igualmente evala la gestin de los entes territoriales y de las ARS. Tal vez imo de los elementos ms importantes de las acciones de demanda inducida realizadas por las EPS es la claridad de para qu y para quin se deben realizar las acciones. Para todos debe ser transparente que se est trabajando en funcin de la poblacin del pas, de lograr metas tiles en funcin de la salud de la poblacin. El Plan de Atencin Bsica, se financia con los recursos del Sistema General de Participaciones, transferencias de vectores, lepra y tuberculosis, recursos propios del municipio. Todos los recursos son entregados a los murcipios en los primeros das del ao, y su ejecucin depende de la reahzacin de un plan, formulado con participacin comuitaria y dirigido por el Consejo Territorial de Seguridad Social (CTSS). El plan de atencin bsica est dirigido a problemas de salud pbhca, cuyas acciones tienen mayor impacto a nivel poblacional; las prioridades de intervencin son: Inspeccin, vigilancia y control de los factores del riesgo del ambiente, control integral de las enfermedades transmitidas por vectores, desartoUo de estrategias de informacin, educacin y comunicacin para la poblacin, vigilancia en salud pblica, y desartoUo de estrategias de promocin de la salud.

253

La Salud PbUca Hoy

Las acciones del plan de atencin bsica son complementarias de las dems reahzadas en los planes de beneficios. Un gran vaco se da en el abordaje a la pobladn pobre no cubierta con los subsidios de demanda, tienen garantizada su atencin a travs de recursos de subsidio a la oferta. Esta poblacin demanda espontneamente los servicios, no tienen definido un plan de beneficios. Se constituye en un reto reordenar la utilizacin de los recursos de subsidio a la oferta, definir un plan de beneficios en funcin del cubrimiento de las metas de salud pbhca Se constitoye en un reto para los alcaldes y los municipios, transformar las condiciones de salud de la pobladn, es claro que existen recursos, no todos los que se necesitan, pero creo que se pueden utilizar adecuadamente estos. El papel de la universidad La universidad se convierte en el mejor espacio para la discusin crtica de temas tan importantes como la salud pblica. Tal vez uno tendra que preguntarse, cul es el papel de la universidad en la formacin del recurso humano que se requiere para asumir el reto de la salud pbhca hoy, en la formulacin de polticas pblicas, en la investigacin, en la construccin de propuestas para la intervencin. Creo que en la formacin del recurso humano, la universidad ha sido esencialmente crtica con el SGSSS y ha enfrentado a los profesionales de las reas de salud a una lucha sin cuartel contra el sistema, obligando a mpturas irracionales, a enfrentamientos innecesarios, se puede formar a los profesionales con las exigencias del sistema para posibilitar su desartollo, su insercin no traumtica.

254

Salud en calidad de vida un enfoque innovador

Referencias bibliogrficas Ley 715 del 21 de diciembre de 2001. Acuerdo 117 de 1998. BERNAL, Jorge. Integracin y equidad, democracia, desarrollo y poltica social Corporacin S.O.S., Colombia, julio de 1994. Direccin Seccional de Salud de Caldas. Planes estratgicos. Maizales : enero de 2002 HERNNDEZ, Mario. Reforma sanitaria, equidad y derecho a la saluden Colombia. Ministerio de Salud. Promocin de la Salud y Prevencin de la Enfermedad en el SGSSS. Resoluciones 412 y 3384 de 2000. RESTREPO, Helena. Incremento de la capacidad comunitaria y del empoderamiento de las comunidades para promover la salud. Informe tcnico Mxico : junio de 2000. Unin Iberoamericana de Murcipios. Declaracin de Cuemavaca sobre calidad de vida y accin municipal Septiembre 24-27 de 1996 .

255

Salud y calidad de vida: hacia la conformacin del campo de accin institucional


CARMEN ALICL\ CARDOZO DE MARTNEZ

La Universidad Nacional de Colombia, como formadora de profesionales e investigadores, debe asumir el liderazgo que le corresponde en la creacin de cultora y en la defensa de los intereses del Estado concebido como expresin de una colectividad que comparte una historia, un territorio, una identidad cultural compleja y una dinnca de desarroUo y as lo han establecido las normas y mandatos que rigen su organizacin. Las facultades, institotos y programas de la Universidad cumplen una funcin pedaggica e influyen en el contexto en que se encuentran. Son capaces de aprender de su entomo, de multiphcar sus posibilidades de anlisis y de enriquecerse con las miradas de otros. Entienden la necesidad de crear vnculos con la ciudad y el pas para el cual se desarrolla y proyecta. La Universidad Nacional de Colombia se ha propuesto dentro del Plan de Desarrollo, como accin prioritaria, el impulso al trabajo de los ncleos acadmicos interdisciplinarios para el cumplimiento de las tareas estratgicas para el pas y ha definido los campos de accin institucional como ejes temticos en los cuales confluyen diferentes reas del conocimiento, disciplinas o saberes, con el fin de abordar en forma integral, problemas de diversos grados de complejidad especialmente aquellos ojal de los mas altos. Dentro de esos campos de accin y programas estratgicos, constnudos por consenso, se estableci el denominado Salud en Calidad de Vida el cual implica la generacin de acciones tendientes a analizar y proponer programas y proyectos que promuevan la salud y las mejores condiciones

257

La Salud PbUca Hoy

de vida de la poblacin colombiana. Se pretende entonces que aquellos ncleos de desarrollo acadnco que han venido impulsando el abordaje del estudio del hombre en todas sus dimensiones (biolgica, social, poltica, religiosa, cultoral, ambiental, afectiva, etc.) amplen su radio de accin. El trabajo de estos grupos debe contar mnimo con los siguientes atributos: Presencia nacional: toda actividad que se desarrolle en la Universidad debe contribuir a la solucin de los grandes problemas de la sociedad colombiana. De esta manera responde interdisciplinariamente por los procesos de construcdn y reconstruccin del pas en todos los sectores especialmente el agroalimentario, en los procesos de planeacin y ordenamiento territorial y en la promocin de condiciones mnimas de mejoramiento de la calidad de vida de la poblacin del pas azotada por la inequidad, la pobreza y la indigencia material. Excelencia: la investigacin, docencia y extensin deben ser de alta calidad y transparencia a partir de la conformacin y consohdacin de grupos en los que se desarroUen redes temticas, intergeneracionales, interinstitocionales, interregionales, que aprovechen y utihcen la infraestmctura humana dispoTble e impulsen la capacidad creativa de estodiantes y profesores hacia la conformacin de comunidades acadmicas dialgicas que recuperen a su vez el alto potencial acadmico que posee la Universidad. Internacionalizacin: la Universidad debe mantener relacin con el contexto intemacional sin perder su identidad. Gestin eficiente: la universidad es un bien pblico que maneja recursos pblicos lo que debe hacer de manera racional y transparente rindiendo cuentas a la totalidad de la sociedad. Sostenibilidad y visin de largo plazo: toda actividad en la que se comprometa la Universidad debe tener una mirada hacia el futoro. El desarroUo de la ciencia y la tecnologa solo sern posibles con estas proyecciones. En esta dinmica confluyen el trabajo acadmico con las necesidades de la comunidad mediante la creacin de escenarios de trabajo docente asistencial. En este mismo sentido se pretende caracterizar los modelos de servicio viables y deseables para las comunidades, terendo en cuenta que adems

258

Salud y calidad de vida: hacia la conformacin del campo de accin institucional

del hospital existen otros escenarios importantes para la construccin de la salud como el mismo hogar, el barrio, la escuela, el centro de salud, el lugar de trabajo, etc. La Direccin Acadmica de la sede Bogot de la Universidad Nadonal de Colombia, siendo coherente con los compromisos trazados en su plan y con miras a conformar los campos de accin institucional a partir de la construccin por consensos y de los desarrollos ya obterdos, tanto dentro como fuera de la Universidad, por las comunidades acadmicas, abri una convocatoria para presentar propuestas por parte de los grupos interdisciplinarios e intergeneracionales. El grupo Hacia la conformacin del campo institucional salud y calidad de vida bajo la coordinacin de Carmen Alicia Cardozo de Martnez, profesora Asociada de la Facultad de Odontologa, con el concurso de los profesores Pedro Amaya de la Facultad de Ciencias Econmicas, Emilio Quevedo de la Facultad de Medicina, Ramn Mantilla de la Facultad de Ciencias, Afife Mrad de Osorio del Instituto de Biotecnologa, Martha Naluz filsofa y pedagoga y los asistentes Mauricio Rodrguez estudiante de la maestra de Salud Ocupacional de la Facultad de Enfermera, Danilo Ariza, Nstor Garza, Carlos Hemndez, Juan Carlos Rodrguez y Angela Vsquez de la Facultad de Ciencias Econmicas, fuimos reconocidos como el grupo ganador y responsable del proceso inicial cuyos resultados fueron entregados y sern publicados prximamente. El proceso se dividi en varias partes: - Levantamiento de bases de datos de investigaciones e investigadores en el tema de la salud y la calidad de vida dentro de la Universidad y en las instituciones de educacin superior nacional. - Estado del arte y perspectivas a nivel mundial de las organizaciones relacionadas con el desarrollo de la salud. Caracterizacin segn documentos existentes de la salud en Amrica Latina. - Levantamiento de un inventario sobre los trabajos en la Umversidad en docencia investigacin y extensin en temas relacionados con la salud y la calidad de vida y las tendencias del trabajo que se pudieron percibir en ellas. - Anlisis prospectivo del trabajo en salud y cahdad de vida en la Universidad. - Aproximacin a la construccin del concepto salud y calidad de vida a partir de entrevistas y encuestas a acadmicos de la universidad Nado-

259

La Salud Pblica Hoy

nal. Universidad de La Sabana, Javeriana, El Bosque, pares acadmicos, Colciencias y ASCUN. - Realizacin de un Foro abierto para la puesta en comn y acuerdos sobre el concepto y tareas para adelantar por parte de la Universidad. Esta presentacin es una parte del proyecto acadmico que debe continuar su proceso de construccin pues sta apenas fue una etapa de iniciacin que se espera sea continuada por la denominada Red de Salud de la Universidad Nacional de Colombia bajo la coordinacin directa del Consejo de Sede que determin a la salud como un modelo de gestin universitaria como la prioridad de su trabajo por la consolidacin y reconformacin del rea de la salud en la Universidad Nacional de Colombia bajo un nuevo paradigma sustentado en el concepto de la salud y la calidad de vida. Por qu un nuevo concepto? "'

La tendencia en la salud y en la investigacin en salud especficamente en la Universidad Nacional de Colombia, y en las distintas institociones a nivel intemacional y nacional, sustentan sus programas en un concepto de ser humano integral y buscan y promueven la equidad, la igualdad y la democracia. La salud ya no slo es ausencia de enfermedad, por tanto, la tarea de los profesionales de la salud es formarse no slo para curar enfermedades sino para prevenirlas de manera integrada y contribuir con la cahdad de vida. La tarea de la Universidad es preocuparse de la formacin integral proponiendo pedagogas abiertas y flexibles, reconceptoalizando el desartollo de las ciencias de la salud para conformar equipos interdisciphnarios donde las ciencias humanas y la tecnologa coadyuven a conformar trabajos orientados hacia el bienestar y mejoramiento de la cahdad de vida de los colombianos fomentando la comunicacin y el dilogo indispensables para el respeto y la convivencia pacfica y democrtica en el reconocimiento de las diferencias. En las discusiones adelantadas tanto de la Umversidad como en el contexto intemacional, se percibe cmo el desarrollo debe estar estrechamente relacionado con el mejoramiento de la calidad de vida de las personas, lo cual depender de las posibihdades que tengan los sujetos de satisfacer adecuadamente sus necesidades humanas fundamentales y particularmente las relacionadas con la salud.

260

Salud y calidad de vida: hacia la conformacin del campo de accin institucional

Los contextos en los cuales se satisfacen las necesidades humanas se diferencian en intra-humanos o en relacin consigo nsmo, inter-hunmnos o en relacin con el grupo social y extra-humanos o en relacin con el medio ambiente'. El economista Amartya Sen trabaja igualmente el concepto de calidad de vida ntimamente relacionado con las categoras de libertad y desarroUo. El desarroUo no es concebido como algo exclusivamente econmico sino entendido como el proceso integral mediante el cual se produce la expansin de las hbertades reales de las que disfrutan los individuos. Estas son su fin y su medio. El desarrollo requiere entonces la eliminacin de las principales fuentes de privacin de estas ltimas: la pobreza y la tirana, la escasez de oportunidades econmicas y las privaciones sociales sistemticas, el abandono de los servicios pblicos, la intolerancia y el exceso de intervencin de los estados represivos. Este concepto posee entonces una dimensin individual y una dimensin social, pues en la medida en que la persona tiene mayor libertad, el Estado y la sociedad le ofrecen mayores oportonidades. Las necesidades humanas, al no ser satisfechas de manera adecuada, producen problemticas de salud tanto en el individuo como en el colectivo, es sabido que para las patologas individuales se han estodiado y se han desarrollado tratamientos para combatirlas, sin obtener transformaciones importantes. De otro lado, es necesario estodiar los problemas colectivos de tal manera que se apunte a la constmccin y conformacin de transdisciphnariedades efectivas, que recuperen la salud de los individuos y los colectivos en y para ambientes igualmente sanos. En tal sentido, se entiende la salud colectiva como el reconocimiento de la existencia de determinantes que propician o no sta y de que muchos de los problemas son derivados de la situacin de crisis socioeconmica y los acumulados histricos de inequidad, para los cuales es necesario pensar y desarrollar altemativas de solucin desde cada rea del conocinento. Esta mirada reconoce, igualmente, que la salud colectiva no es la sumatoria de las condiciones de salud de los individuos. Involucrar la salud desde la perspectiva medio ambiental implica abordar problemas tales como: el manejo de los desechos biolgicos, la salud y el trabajo, la biocompatibilidad, los aspectos relacionados con la contaminacin, la fluorizacin, entre otros, y las relaciones en y con la vida, superanMAX-NEEF, Manfred. "Economa, poltica y salud". En : La Economa descalza.

261

La Salud PbUca Hoy

do la visin de objetos aislados, abordndolos como una red de procesos y fenmenos interconectados, intertelacionados e interdependientes, en una trama que determina o posibilita la salud o la enfermedad. Lo anterior plantea la necesidad de definir algunos escenarios en los cuales es posible estudiar los procesos de desarrollo humano e intervenir positivamente en el campo de la salud, replanteando as la mirada tradicional y buscando altemativas en el estudio de ejes problema como lo plantea la conformacin de campos de accin, ellos pueden ser: - La vida cotidiana: entendida como el contexto en el cual se expresan y pueden estudiarse todas las dinmicas, interrelaciones e interacciones entre los sujetos que tienen que ver con la salud. - La ciudadana y civilidad: escenario en el cual se dan las relaciones sujeto-Estado, apropindose el sujeto, de sus deberes y derechos. Incluye a los diferentes actores sociales y comunitarios, gubemamentales y no gubernamentales del ente territorial, las instituciones y sectores. - Las polticas pblicas: desde las cuales es posible reorientar programas y proyectos en distintos mbitos territoriales, los cuales a su vez plantean modificaciones en las mismas. El conjunto normativo constitucional no ofrece un claro planteamiento del derecho a la salud como un derecho fundamental. La Ley 100 lo asume como un derecho contractual que supedita la titularidad del mismo a la capacidad de pago de todos los colombianos, excepto para los menores de un ao. La Constitocin Poltica de 1991 garantiza el derecho a la salud pero en la prctica es algo que no se ha implementado. Existe muy poca conciencia de la salud como derecho ciudadano universal. Las personas tienden a identificar los derechos relacionados con los contratos que establecen los planes de beneficios, debido a la estructura del actual sistema de salud, pero no se entiende la salud como un derecho de todos y todas. Por otra parte, el concepto de salud predominante en el actoal sistema y en la mayora de la poblacin es el de la ausencia de enfermedad, de manera que se confunde salud con servicios de atencin mdica. Esta perspectiva mdico-asistencial desconoce las relaciones entre la salud, la enfermedad y los factores econmicos, sociales y culturales que implican calidad de vida. Esta visin predominante tambin tiende a negar la subjetividad de las personas y la existencia de una gran diversidad tnica y cultoral en el campo de

262

Salud y calidad de vida: hacia la conformacin del campo de accin institucional

la salud en el pas. Calidad de vida, subjetividad y diversidad cultural requieren ser reconocidas en un pas como Colombia. Es inconveniente, como se ratific en el Congreso Nacional por la Salud, que la concepcin de seguridad social contine siendo el simple mecanismo de aseguramiento. ste tambin es un producto del sistema actoal y constitoye un serio obstculo para la comprensin de la seguridad social integral como derecho social uiversal. La salud no puede verse aislada. Ella est inmersa en la dinnca social poltica y econmica de la sociedad colombiana en el marco de la globalizacin. Superar una sitoacin de tal envergadura imphca, para la Universidad y para el pas, discutir el tipo de sociedad que queremos, para constmir nuevos pactos sociales y polticos que permitan consolidar la salud como un derecho esencial. Por ello se considera fundamental el dilogo permanente sobre los problemas nacionales, sobre las posibles altemativas y formas de interactoar con la comuidad. Los trminos salud y calidad de vida son de uso propio de la cotidianidad del ser humano y particularmente del mbito acadmico y profesional. Por ello, en primera instancia, aparece una tendencia a establecer paralelos que llegan a confundirlos y a requerir la rpida precisin de no considerarlos como sinnimos. ' La salud es considerada como un aspecto del ser humano indispensable de comprender -ms all de un fenmeno puramente sicosomtico- que debe rechazar cualquier asomo de individualidad o fragmentacin. Lo que se percibi en ste proyecto es que por lo menos para algunos docentes de la Universidad Nacional la dimensin trascendente del hombre radica en su ser social, comprendida en ocasiones esta dimensin social como la espiritoahdad en el sentido que la trabaja Foucault y la posibilidad de estar inmerso en una cultura y como creador del lenguaje aunque la vida comprenda tericamente slo el lapso entre el nacinento y la muerte. Otros docentes universitarios se acercan a una trascendencia desde una dimensin espiritoal ms referida al nous o la energeia en sentido griego y no necesariamente en sentido religioso. La dimensin de eternidad del ser humano est fundamentada por las preguntas sobre el ms ac y el ms all, el antes y el despus. De todas formas es indispensable acercar la discusin a una concepcin del hombre y del mundo donde a su vez se aclaren las concepciones que sobre la tcnica, la ciencia, la tecnologa, el arte y su relacin con el desarrollo institocional que tiene la comunidad acadmica.

263

La Salud PbUca Hoy

Sobre la calidad de vida existen varias concepciones, no en vano existen hoy por hoy ms de cien defirciones sobre este concepto, producto de investigaciones serias y profundas realizadas especialmente en las dcadas de los ochenta y noventa. El campo del conocimiento de la salud y la calidad vida se relaciona con la mayora de las reas del conocimiento generando un ampho espectro de interacciones simples y complejas pero que tiene como base y esencia el trabajo inter y tras disciplinario, pues la visin unidisciplinaria recorta considerablemente la realidad y puede ser hasta riesgosa. Si aceptamos que los estodios epidemiolgicos entienden lo social como un conjunto de factores de riesgo, y entre uno de esos factores para que aparezca determinada enfermedad estamos aceptando que lo social es igual que cualquier factor biolgico, esto nos lleva a una conceptoalizacin tradicional de las causas y de la enfermedad en s misma. Existe una corriente de pensamiento, cada vez ms en uso, que deduce que la sociedad y la cultura no son simples factores estadsticos sino, que actan como factores causales determinantes frente a la enfermedad. De acuerdo con esta concepcin se define el proceso salud enfermedad como un proceso social. Si se acepta esa conceptoalizacin tambin se debe aceptar que la prctica de las profesiones de la salud debe cambiar. Lo anterior implica darle un papel preponderante a las ciencias sociales en salud y requiere repensarlas para que puedan dar explicaciones ms integrales y dinmicas de los procesos. Aqu debera haber un nuevo papel interaccin e integracin de la sociologa, antropologa, sicologa, trabajo social, hngstica con la medicina, la enfermera, la odontologa, etc. La sociologa de la salud ha venido ganando espacio como campo de la investigacin y de la docencia al proporcionar nuevos elementos de anlisis de las causas y condiciones sociales de la salud de los colombianos as como las dinmicas culturales y sociales que la acompaan. Cada vez es ms aceptado que el concepto de salud es social y que se define como la gradacin de estados de satisfaccin o felicidad colectiva o excelencia gmpal, en el sentido de la delimitacin de los mbitos sociales donde ms fcilmente puedan optimizarse los equilibrios y minimizar los conflictos. En este campo los cientficos sodales trabajan para construir indicadores de sociometn'a que permitan evidenciar el rvel de salud social de una comuidad. Por otra parte, es necesario que el proceso de formadn de los profe-

264

Salud y calidad de vida: hacia la conformacin del campo de accin institucional

sionales de la salud se ligue a la comunidad a la cual se vincular profesionalmente lo cual le permitira superar la perspectiva biologista e individual acerca del paciente y as poder ubicarlo y comprenderlo en su ambiente social, en sus relaciones, las cuales definen y condicionan estados y procesos de salud-enfermedad no de manera individual sino colectiva. La antropologa al estudiar no slo los aspectos biolgicos del hombre sino tambin su comportamiento como ser social en el pasado, permite establecer con claridad qu somos, de dnde venimos y para dnde vamos. La antropologa social, la antropologa cultural y la etnologa son campos relacionados directamente con la salud y la cahdad de vida. La antropologa mdica, la medicina tradicional y popular, la etnobotnica, la etnofarmacologa son campos de acdn de la antropologa que estn perntiendo la recuperacin del conocimiento tradicional y en varias ocasiones su incorporacin a los servicios de salud. Los ltimos desarrollos de la antropometra han abierto un amplio campo de investigacin y desarrollo, con aplicaciones cada vez ms prometedoras en el rea de la salud. La psicologa de la salud ha dado paso a la conformacin de equipos interdisciplinarios en el campo de la salud que han mejorado los procesos de promocin, prevencin y tratamiento de diversas enfermedades. En colaboracin con otros profesionales tiene campo de aplicacin en el manejo del dolor crnico, prevencin primaria, mal comportamiento, tabaquismo, abuso del alcohol, obesidad, etc. El trabajo social como disciplina del saber est orientado hacia mejorar las condiciones de calidad de vida de la poblacin, principalmente de aqueUa ms desprotegida. A travs del diseo de estrategias de intervencin desarrolla su accin en la formulacin, administracin y evaluacin de proyectos destinados a mejorar las condiciones de bienestar. Contribuye en forma importante en la solucin de los problemas sociales que aquejan a la nacin colombiana. Especficamente, en relacin con el campo de la salud, las asignaturas que estmcturan el trabajo social en su totahdad estn relacionadas y enfocadas hacia el bienestar de salud emergente proactivo donde la mujer y el hombre son sujetos de deberes, derechos y responsabilidades. Algunas lneas de trabajo son: desartollo local y territorial en salud; proteccin del menor en condiciones de vida irregular; salud, trabajo y calidad de vida, atencin individual y familiar.

265

La Salud PbUca Hoy

Por su parte, la geografa y la historia hacen importantes aportes al campo de salud y calidad de vida: la primera, a travs del manejo del espacio y el territorio, dinmicas poblacionales y ubicacin espacial, organizacin urbano - regional, anlisis de riesgos naturales y sus potenciales impactos, entre otros temas; la segunda, aporta importantes conocimientos a travs de los trabajos que se realizan sobre la historia social de las ciencias y especficamente de la medicina y de las instituciones de la salud. La gestin de recursos financieros es un campo de suma importancia en el rea de la salud. De esta manera se requieren nuevas modalidades de gestin pblica y privada que permitan aumentar el nivel de financiamiento, principalmente por parte de las entidades pblicas, hacindolo ms progresivo y racional. Las entidades prestadoras de los servicios de salud (IPS) requieren de conocimientos que les permitan tomar adecuadas decisiones basadas en la medidn, evaluacin, rendimiento, anlisis e interpretacin de la informacin financiera. Este campo corresponde a los profesionales de la contadura pblica. Las disciplinas relacionadas con el arte como la arquitectura, el diseo industrial, la msica y las artes plsticas tienen una relacin directa con la calidad de vida y la salud dado que son las que permiten desarroUar contextos espaciales que hagan de las obras y paisajes creados elementos bsicos de esparcimiento, recreacin y solaz. Una arquitectura con enfoque social permite la integracin ente aspectos psico-sociales y aspectos fsicos, manejo de espacios, condiciones bsicas de habitabilidad (iluminacin, ventilacin), uso de materiales de construccin, ubicacin correcta (geobiologa), condiciones sanitarias adecuadas, son algunos de los aspectos que comprende esta disciplina del conocimiento. Igualmente, son de su atencin temtica los desarrollos urbansticos, paisajsticos, el manejo del espacio pblico y del comunal, la valoracin de espacios segn su uso, etc. Un campo nuevo en relacin con la salud es el de la msica. "El sonido trasciende al ser humano en todas las etapas vitales, ejerciendo influencia sobre sus estados fsicos y psicolgicos, y por eso puede ayudar en el tratamiento de diferentes enfermedades y en la rehabilitacin de personas con discapacidades". La msica ha venido jugando un papel importante como hertamienta en el manejo de los procesos salud-enfermedad en la prevencin y el tratamiento de problemas fsicos, emocionales y mentales. El impacto emocional de la msica, por dbil que sea, puede provocar respuestas

266

Salud y calidad de vida: hacia la conformacin del campo de accin institucional

fisiolgicas, as como influir en el aprendizaje de nios y adultos. En este sentido, los efectos de la musicoterapia se extienden a los planos: educativo -al corregir limitaciones del aprendizaje-, laboral -al favorecer procesos de salud ocupacional- y geritrico al lograr respuestas de autoestima y recuperacin de ancianos. En Colombia, como en otros lugares del mundo, ya se empiezan a conformar los equipos interdisciphnarios de docentes e investigadores aunque an se dificultan dichos procesos por carencias de actitudes poco abiertas y flexibles y sobre todo por la an incipiente capacidad de trabajo en equipo ante el establecimiento de normas incoherentes que promueven el trabajo intersectorial y que desde lo administrativo impiden que las iniciativas sigan su curso. En este trabajo de investigacin se pudo evidenciar que el cambio de mentahdad y la necesidad de actoar bajo nuevos paradigmas es algo imperante aunque ya se perciben nuevas generaciones con enfoques ms humaistas y mversales. El trmino de calidad de vida es mucho ms ampho que el concepto de salud la cual es slo una parte del todo. Antes de hablar de calidad de vida debera mirarse la posible construccin de nuevos modelos sin dejar los que se han venido usando en el rea de la salud pues al tratar de hacer un cambio de ellos en formacin e investigacin en salud se generan vacos que no se pueden llenar de manera arbitraria desconociendo las bases que dieron origen a ello. Es necesario entender y trabajar en el concepto de salud y lo que se entiende por ser sano. En general, los profesionales del rea de la salud se mantienen en un modelo positivo de la salud lo que no es gratoito, pues la sociedad ocddental desde el siglo XVIII ha concebido la salud como una realidad mundana igual a la muerte lo cual deba ser analizado desde el conocimiento cientfico. A mediados del siglo XX se miraba la reahdad biolgica y se construy durante el XIX y el XX una concepcin de la salud como la resultante del equilibrio y la homeostasis biolgica. Si los programas para la formacin en el rea de la salud no han sufrido cambios radicales es porque el problema sigue siendo la mirada excesivamente biologista en tomo al proceso salud enfermedad. Hemos visto de manera reiterada como se han intentado hacer cambios sustanciales conceptuales en los programas de formadn que pretenden dar una amplia formacin

267

La Salud PbUca Hoy

humana y social para luego en la prctica evidenciarse que stos conceptos slo llegan a nivel de la teora pues en los escenarios de trabajo sigue existiendo el enfoque de lo bsico y lo clnico y el equiUbrio biolgico sin poder articular aspectos correspondientes a las propias percepciones, miradas, creencias, mitos y realidades -principalmente- ante la impotencia de poder abordar lo interdisciplinario y lo multiproblmico. Ha existido por tradicin el enfoque nico y unicausal lo que ha Uevado a establecer casi en lnea directa una relacin causa efecto entre un cambio biolgico y una respuesta biolgica sin tener en cuenta que los problemas obedecen a mltiples razones y causas que no pueden verse de manera aislada. Se ha confundido la norma con la funcin, donde se evidencia -desde el modelo biolgico- el silendo de los rganos como la salud, mientras en el proceso salud y enfermedad las normas no son las mismas. La sociedad ha impuesto normas para la salud y normas para la enfermedad, situacin particular que debe abordarse si se quiere mirar la calidad de vida buscando interpretar con otros indicadores: qu se entiende por salud, y en salud, cual es la perspectiva de la calidad de vida, es slo saber que no hay sntomas clnicos? Es pensar que solamente la felicidad es salud? Es medir la calidad de vida buena si se puede caminar, correr y nutrirse aunque no se tenga libertad de expresin y pensamiento as como personalidad propia? Cul es la relacin entre lo bueno y lo sano? Entre el bien y la salud? Todo lo que es malo no es saludable? Ha sido tradicional mirar la salud desde la perspectiva biolgica y se ha llegado incluso a concebir, segn autores como el profesor Emilio Quevedo, el ser humano como un saco de rganos sin considerar sus aspectos humanos y sociales pues aunque casi por decreto en muchas facultades de salud del pas y el mundo se ha establecido la categora de lo biosicosocial en los planes de estodios, en la prctica se sigue mirando al paciente como potencial modelo de enfermedad que puede ser tratada con un protocolo farmacolgico o con diversas estrategias clnicas que desconocen totalmente los aspectos humanos que pueden ser los causantes de las mismas enfermedades. Aunque se percibe de manera sensible un cambio de mirada del profesional de la salud en tomo a los aspectos sociales y humanos, en general su tiempo no est dedicado al estudio de estos factores pues los sistemas de formacin y atencin estn diseados para que el nfasis sea fundamentalmente biol-

268

Salud y calidad de vida: hacia la conformacin del campo de accin institucional

gico tanto en la atencin como en el abordaje conceptoal. Los aspectos relacionados con lo humano, social, cultiu-al se ha dejado en manos de quienes por tradicin tambin han sido los expertos como los socilogos, filsofos y antroplogos con quienes no se mantiene un dilogo permanente sobre los cambios propios del ser humano. Se hace inclusive una diferenciacin en los indicadores y mtodos de evaluacin de los comportamientos sociales totalmente distantes de los procesos biolgicos. Siempre recordamos una cita del profesor Quevedo quien insiste en cmo los indgenas se enferman por cazar cuando no deben y cmo los soldados se moran de melancola y ahora mueren de otras enfermedades que no estn categorizadas en los textos mdicos. No se encuentra en una patologa cules son los sntomas y los signos del mal de ojo, pero la realidad es que mucha gente en nuestro pas an se enferma de ello. Existen entonces sanadores y curadores, preventores que solamente estodian como contrarrestar ciertos factores del medio pero que no saben qu van a promover. Los modelos de la salud pblica a travs de la historia muestra cuatro modelos: el de la higiene pblica donde se pensaba que la enfermedad se produca por miasmas y se trataba entonces de neutralizarlas; el del positivismo donde se afirm el conocimiento monocausal y por lo tanto el tratamiento era igual; la salud pblica que trat de asumir el problema del proceso salud enfermedad como multicausal y se le involucraron factores como el econmico y los estndares y factores de riesgo. Finalmente, la epidemiologa social donde nacieron las posibilidades de anlisis estructoral y problmico, pero que se han constitoido en un grupo minoritario que genera resistencia por los grupos tradicionales. Cmo llegar a construir un nuevo concepto? Como tarea del gmpo Hacia la conformacin del campo institucional salud y calidad de vida y con base en una estrategia propuesta y aprobada, se construy con la comunidad acadmica una lista de los 150 principales problemas que inciden en la salud y la cahdad de vida de los colombianos. Por una metodologa prospectiva, se establecieron los 79 principales y a partir de all se cmz la informacin del inventario de actividades adelantadas o por adelantar para superar estos problemas dando origen a una interesante matriz que debe ser analizada y ajustada por toda la comunidad a partir del trabajo de la Red de Salud, dentro de la cual se sealaron seis programas estratgicos que podn'an ser desarroUados dentro de la Universidad como

269

La Salud Pblica Hoy

prioritarios a partir de los 30 problemas principales. Present los avances del trabajo Salud y Calidad de Vida en una mirada desde las perspectivas de los actores no involucrados directamente en sta prctica. Miramos las actividades desarrolladas dentro de la estrategia presencia nacional como tarea muy importante de la universidad. Hemos hecho un mapa para identificar los profesores que trabajan el tema y desde qu actividades la desarrollan. Se mira desde la agronoma, la sociologa, la biologa, la economa, administracin, gestin, ciencias polticas y ambientales. Prima la caracterstica unidisciplinar aunque en la teora diga lo contrario. Para este caso, el listado de problemas se obtuvo a partir de la mirada que dio un gmpo de cuarenta profesores de ocho facultades de la Universidad (Agronoma, Artes, Ciencias, Ciendas Econmicas, Ciencias Humanas, Ingeniera, y Medicina Veterinaria y Zootecnia) que han intervenido e intervienen activamente en docencia, investigacin y extensin, con temas relacionados con la problemtica de salud y calidad de vida en Colombia'. Una relacin de los profesores entrevistados, los departamentos a los que pertenecen y las respectivas facultades. Con base en la informacin que se extrajo de las entrevistas, se establecieron 79 problemas de salud y calidad de vida en Colombia identificados por los profesores de la Universidad Nacional. Posteriormente se aplic un proceso de agrupacin segn el nivel de afinidad semntica' de los problemas enunciados por los profesores para obtener una segunda lista que fue ponderada de acuerdo con la frecuencia en su aparicin en las respuestas de los profesores. El resultado de ese trabajo de agrupacin y ponderacin fue el listado definitivo de variables con las cuales se construy la matriz de anlisis relacional para ser utilizada en la segunda parte de ejecucin del ejercicio de anlisis estructoral.

Para el caso de este estudio se prefiri la visin de personas que aunque relacionados con el tema de la salud, no pertenecan a las facultades de las ciencias de la salud. Se entiende por afinidad semntica, la coincidencia en los significados de las experiencias acuadas por cada uno de los integrantes de un grupo de reflexin prospectiva respecto a los problemas que consideran afectan su sistema societal.

270

Salud y calidad de vida: hacia la conformacin del campo de accin institucional

Listado definitivo de variables El listado definitivo de treinta variables (problemas) se present a profesores de todas las facultades de la Universidad, bajo la forma de un instructivo de diligenciamiento. Dicho instructivo presenta los treinta problemas de la salud y la calidad de vida en Colombia ordenados segn una serie de lneas de interaccin, lo cual permite una lectura ms fluida de los mismos; las lneas de interaccin son de gran importancia pues se encuentran fundadas en la exploracin temtica que acompa todo el desarrollo del ejercicio y fueron la base para definir los PRES del CA -Salud y Calidad de Vida- estas seis lneas se enumeran a continuacin: Alimentacin y medio ambiente en salud, Ciencia, educadn, cultura, sicologa y sociedad en salud, Institucionalizacin en salud, Gestin en salud, Promocin, prevencin y atendn en salud, Tecnologa en salud.

En la revisin que se realiz de las actividades de docencia, investigacin y extensin se establecieron vacos, no se encontr ninguna actividad que buscara incidir directamente sobre los siguientes problemas, los cuales han sido identificados como crticos en el tema de la salud y la calidad de vida en el pas: Sociedad anmica Tugurizacin de la educacin superior de la salud Corrupcin Burocratizacin del sector salud Pauperizacin de los profesionales de la salud Visin unidisciplinaria de la salud. La relacin de los puntos anteriores nos ratifican las debilidades encontradas en la estructuracin del CA salud y calidad de vida: Incipiente desarrollo de la investigacin en salud Desarticulacin acadmica Unidisciplinariedad e individualismo Baja socializacin de produccin cientfica Deficientes procesos de comunicacin Inadecuada pertinencia de la investigacin

271

La Salud PbUca Hoy

Ausencia de una comunidad cientfica Baja institucionalizacin de la investigacin. Desde el punto de vista positivo hay que pensar en lo que se ha logrado avanzar en cambios y modificacin de paradigmas. Hay dos ejemplos: odontologa y enfermera en la Localidad IV donde en los hechos se reconoce el cambio de paradigma en los modelos de trabajo con la comunidad. La relacin con el usuario ha cambiado; la enseanza aprendizaje en las dos vas ha cambiado. Tambin es importante el reconocimiento de los procesos de la comunidad donde hay estodios desde la perspectiva del oft-o en ciencias humanas, en odontologa, en enfermera donde los ltimos cinco aos se ha estudiado la familia del paciente crtico. Hace poco sali una recopilacin donde se evidenci que desde 1975 se habla desde el paciente y la familia y qu se entiende por salud y enfermedad. Por qu nos cuesta tanto trabajo entender la investigacin cualitativa? Nos hemos dedicado al debate y no a la operacionalizacin y por ello deberamos estar en movimientos nacionales e internacionales donde es evidente la bsqueda de la reconstruccin del mundo. Debemos integramos intersectorialmente en la universidad promoviendo an mas el trabajo de los Campos de Accin Institocional. Aqu debera haber representantes de la comunidad y mayor participacin de los estudiantes para mirar las diversas perspectivas para la construcdn del concepto que queremos. La Facultad de Odontologa ha promovido la generacin de un nuevo programa que impulsa la participacin de la nueva generacin de estudiantes que busca que el nuevo modelo de promocin sustentado en la calidad de vida construida por los estudiantes, los profesores, las madres, los indgenas, los nios impulsando nuevas polticas. Ha habido avances conjuntos con la comunidad. No le apunta al antiguo modelo. Se ha preocupado por la salud y la calidad de vida. Esta particular preocupacin existe en muchos otros sectores de la universidad y lo que se requerira es buscar que haya una puesta en comn de iniciativas, investigaciones, actividades de docencia y extensin en este campo para continuar en este proceso de construccin continua que permita que se cambie un paradigma que ha sido mantenido por mucho tiempo para el rea de la salud. Este trabajo no es ms que un punto de partida que servir de insumo al trabajo que sigue coordinando la red de salud. Les invito a participar de este proceso.

272

CAPTULO VI

LA SALUD EN LAS AGENDAS POLTICAS

La salud en la agenda de los organismos internacionales


EDUARDO LVAREZ

La mayor encuesta de opinin pbhca del mundo realizada por GaUup Intem ational en 1999 para el Informe del Milenio, presentado por el Secretario General de las Naciones Unidas, mostr que la buena salud y la vida en familia ocupaban el primer lugar entre las cosas valoradas por la gente, clasificacin que sobrepasa con creces la importancia dada a los bienes materiales. En esa reunin que congreg a 147 jefes de Estado y gobiemo y 191 naciones en total, se aprob la Declaracin del Milenio que incorpora ocho metas principales para ser alcanzadas en el 2015, tres de las cuales son especficas sobre salud, estando todas las otras directamente relacionadas con las primeras. Son ellas: la reduccin de la tasa de mortalidad infantil en dos tercios; la reduccin de la tasa de mortalidad materna a un cuarto; la detencin y cambio de la tendencia de la propagacin de VIH/ SIDA, malaria y otras enfermedades. De otra parte, es evidente que en los ltimos aos, los temas referidos a la salud han sido prioritarios en los debates sobre el desarrollo, siendo ello en parte el resultado del empeoramiento de la situacin del SIDA en frica y las amenazas que esto plantea para el desarrollo econmico de los pases pobres, para su seguridad nacional y para la seguridad mundial. As, los esfuerzos de las Naciones Unidas -especialmente la Organizacin Mundial de la Salud- por dar mayor relevancia a la salud en las discusiones polticas de alto nivel de los pases tanto desarrollados como en desarrollo y de los gmpos internacionales (G8, G77, UE, Asamblea General de las Naciones Unidas, entre otros), han conducido a la creacin de varios fondos e iniciativas especiales para abordar los problemas de salud en el mundo.

275

La Salud Pblica Hoy

Una de las primeras expresiones en este sentido fue la creacin, en 1996, del Programa Conjunto de las Naciones Unidas sobre VIH/SIDA (ONUSIDA), el cual est copatrocinado por el Banco Mundial, el programa de Naciones Unidas para el Desarrollo (PNUD), el Fondo de Poblacin de las Naciones Unidas (UNFPA), el Fondo de Naciones Unidas para la Infancia (UNICEF), la Organizacin de Naciones Unidas para la Educacin, la Ciencia y la Cultura (UNESCO), la Organizacin Mundial de la Salud (OMS) y recientemente por el Programa de Naciones Unidas para el control intemacional de la Droga (UNDCP). Posteriormente, en 1999, tovo lugar la creacin de la Alianza Mundial para Vacunas e Inmunizacin (GAVI). El nmero de miembros de la Junta de la Alianza ha aumentado, de los 12 iniciales a 15. Entre ellos figuran representantes de pases en desartollo (2), de gobiemos de pases industrializados (3), la OMS, Banco Mundial y UNICEF, un instituto de salud de carcter tcnico, la industria de las vacunas (tanto de pases industrializados como de pases en desarrollo), un instituto de investigaciones y la Fundacin Bill y Melinda Gates. Ms recientemente, en el 2001, se conform el Fondo Mundial para la lucha contra el SIDA, Malaria y Tuberculosis, el cual para mediados de ese mismo ao ya tena compromisos cercanos a los US$ 1.800 millones de dlares. De otra parte, la salud ha sido tema central en Sesiones Especiales de la Asamblea de las Naciones Unidas (UNGASS) como ocurri con la realizada sobre VIH/SIDA en junio de 2001 y lo ser en la que tendr lugar en mayo de 2002, durante la cual se analizarn los progresos en el cumplimiento de los acuerdos establecidos en la Cumbre Mundial en favor de la Infancia que tovo lugar en 1990. Las manifestaciones en tomo a la salud a nivel mundial han tenido eco en nuestro continente, figurando ella en las agendas de las tres Cumbres de las Amricas, instancia donde se renen los jefes de Estado y de gobiemo de los pases de la regin. En la primera (Miami 1994), la iniciativa 17 de la Declaracin de Principios denominada "Acceso equitativo a los Servicios Bsicos de Salud" enfatiza en la reduccin de la mortalidad matemo-infantil, la erradicacin del sarampin, la reforma del sector salud y los programas de prevencin contra la propagacin de enfermedades transmisibles, particularmente VIH/

276

La salud en la agenda de los organismos internacionales

SIDA. Aspectos relacionados con la salud tambin son destacados en la iniciativa 18 (fortalecimiento del papel de la mujer en la sociedad) e irciativa 19 (alianzas para la prevencin de la contaminacin). Todo ello dio lugar al lanzamiento "Salud del Nio: Meta 2002 " consistente en la prevencin de 100.000 muertes de nios menores de 5 aos en las Amricas para el 2002 utihzando la estrategia de Atendn Integral de la Niez, conocida como AIEPI. En la segunda (Santiago 1998), los lderes de gobiemo se comprometieron a avanzar en el logro de la equidad en salud para los grupos ms vulnerables mediante el desarrollo e implementacin de tecnologas efectivas y de bajo costo. Esto dio lugar a la iniciativa de OPS denominada "Tecnologa en Salud uniendo a las Amricas", mediante la cual se promueve el acceso a medicamentos y vacunas de cahdad, el fortalecimiento de los sistemas de informadn y vigilancia y el mejoramiento al acceso y de la calidad de agua para consumo humano y de la infraestructura sanitaria. En la tercera Cumbre, (Quebec, 2001) se estableci la meta de un "Acuerdo sobre libre comercio para las Amricas " en el marco de un amplio compromiso por la reduccin de la inequidad y pobreza y por un desarrollo equiUbrado; su plan de accin dedica un captulo completo a la salud (el 14) con especial referencia a las reas de reforma del sector orientado hacia la equidad y la lucha contra las enfermedades transmisibles y no transmisibles, mencionndose especficamente al VIH/SIDA, la salud mental, la biblioteca virtual en salud y la prevencin de enfermedades asociadas con el consumo de tabaco. Otro foro de alto nivel poltico lo constituyen las Cumbres Iberoamericaruis -siete hasta la fecha- en las cuales los jefes de Estado y de gobiemo se concentran en un tema particular. Las mismas, son precedidas de reuniones preparatorias relacionadas con un sector particular y en dos de ellas -las realizadas en Cuba y Panam- se incluy al sector salud donde se efectuaron discusiones sobre: salud como componente integral del progreso social y econmico; salud de la mujer en edad reproductiva y de la poblacin indgena; enfermedades transmisibles con nfasis en la prevencin y control del VIH/SIDA; se reafirm el compromiso por la erradicacin del sarampin hacia finales del 2000 y del incremento de la cobertura de vacunacin de enfermedades inmunoprevenibles, el envejecimiento de la poblacin, eliminacin de estilos de vida no saludables, violencia y accidentes y

277

La Salud Pblica Hoy

la cooperacin Iberoamericana en Salud. Este ao en Madrid, tendr lugar la octava Cumbre Iberoamericana y algunos gobiemos se han comprometido a que harn gestiones y propuestas para que la salud sea incluida en la agenda de la reunin. El 22 de junio de 2000 el Banco Mundial el Banco Interamericano de Desarrollo y la Organizacin Panamericana de la Salud firmaron la Agenda compartida para la Salud en las Amricas, como forma de institocionalizar esfuerzos a ser reahzados en forma coordinada o complementaria, aprovechando las ventajas comparativas que poseen cada una de esas organizaciones y sin perjuicio de las actividades que independientemente cada una de ellas continen realizando. La situacin de salud preocupa y hace parte de la Agenda por cuanto ella es un elemento propio del bienestar -como un bien en s mismo- y factor contributivo al crecimiento econmico, al facilitar la acumulacin de capital humano y aumentar la productividad. Si bien en nuestra regin durante las ltimas dcadas el estado sanitario ha mejorado sostenidamente como lo reflejan el aumento de la esperanza de vida al nacer -68.8 en 1980/1985 y 72.2 en 1995/2000- y la marcada disnnucin en el nmero de aos potenciales de vidas por mortalidad o discapacidad, la intensidad y rapidez en la modificacin de estos indicadores no han sido homogneos en los pases e incluso han subsistido y, en algunos casos se han ampliado las desigualdades entre ellos. Por otra parte, Amrica Latina y el Caribe tienen la distribucin del ingreso ms desigual del mundo: segn seala el Informe de Progreso Econmico y Sodal de 1998/99 del BID, "el 5% ms rico de la poblacin recibe el 25% del ingreso en tanto que el 30% ms pobre recibe slo el 7.5% del ingreso total" y un tercio de la poblacin es pobre, esto es, subsiste con ingresos inferiores a US$ 2 diarios. La pobreza asociada a peores condiciones de salud y las desigualdades en la distribucin de los ingresos provocan distorsiones en el acceso a servicios sociales de calidad; el BID, el BM y la OPS/OMS comparten preocupaciones en cuestiones relacionadas con la salud, abastecimiento de agua y eliminacin de residuos, la cual se manifiesta en la bsqueda de equidad y la reduccin de la pobreza.

278

La salud en la agenda de los organismos intemaciorudes

Igualmente comparten el objetivo de mejorar la eficiencia de las intervenciones en salud que realizan los pases, toda vez que los pases a fines de los 90 destinaban en promedio el 7.3% de su PBI, esto es unos US$ 114 billones anuales, al financiamiento de programas y servicios de salud los cuales deberan permitir que los habitantes de la regin disfruten de un mejor estado de salud en trmino de aos de vida preservados, libres de mortalidad y discapacidad en el nivel de salud y en el acceso a los servicios esenciales de ingresos. Un grupo de coordinacin interagencial fue establecido para supervisar la implementacin de la Agenda conformndose grupos de colaboracin en las siguientes cuatro reas principales: cuentas nacionales, medicamentos, vigilancia de las enfermedades y salud ambiental. Asimismo, despus de la sesin especial de la ONU sobre SIDA (2001) un subgrupo inter agencial sobre VIH/SIDA fue creado como parte del grupo de trabajo sobre vigilancia de las enfermedades. La agenda compartida ha sido bien recibida por la comunidad intemacional y hemisfrica habiendo diversos organismos, e incluso agencias del SNU, que han expresado exphcitamente su inters por sumarse a esta iniciativa que conlleva lograr que la comunidad intemacional, de una manera coordinada, contribuya al desarrollo del sector salud de un pas determinado. Parece conveniente -dado el papel cada vez ms decisivo que estn teniendo- referirse brevemente a la sociedad civil En el Anuario de Organizaciones Internacionales se indica que el nmero de organizaciones intemadonales no gubemamentales (ONG's) que en 1990 era poco mayor de 6.000 en el 2000/01 sumaban ms de 26.000. En los Estados Unidos solamente, en 1999 estaban registradas 773.934 organizaciones nacionales sin fines de lucro de las cuales 77.287 eran fundaciones privadas comparadas con 38.807 fundaciones reportadas en 1996. En Colombia las ONGs registradas, segn informacin verbal suministrada por la DIAN, superan las 50.000 mientras que las relacionadas con salud, conforme informacin de las reas de cooperacin tcnica de la OPS en el pas, se estima que sobrepasan las 100. Este incremento de las ONGs es una clara muestra de la expansin del papel de la sociedad civil, lo cual muchas veces se refleja en la estrecha solidaridad que se genera entre las ONGs de los pases donantes y sus contrapartes en los pases en desarrollo.

279

La Salud Pblica Hoy

La Organizacin de las Naciones Unidas en Colombia La Cooperacin del Sistema de las Naciones Unidas (SNU) en un pas se fundamenta en dos orientaciones bsicas: las polticas pblicas de desarrollo de la nacin y los mandatos que el sistema ha recibido de la comunidad internacional. En Colombia, el SNU adhiere a los principios de la Carta Constitocional y comparte los anhelos de cohesin, crecimiento y bienestar de los colombianos. El objetivo general de su cooperacin es "contribuir la construccin de una sociedad de convivencia, de crecimiento econmico sostenible y de equidad y bienestar colectivo, mediante el fortalecimiento del ejercicio de los derechos humanos ". Entre los objetivos especficos estn el avanzar en el respeto de la vida humana y de la integridad personal, el fortalecimiento del Estado sodal de derecho -participativo y democrtico- y la universalidad en el acceso a los servicios bsicos y a los beneficios del desarrollo. En este ltimo objetivo se inscribe el acceso universal a: la seguridad alimentaria, un asentamiento humano sosterble, un ambiente sano y al mejoramiento de la calidad de la prevencin y atencin de la salud mediante el pleno acceso a la salud pbhca, la afiliacin universal al Sistema de Seguridad Social en Salud y por consiguiente el acceso de toda la poblacin al Plan Obligatorio de Salud y la prevencin del VIH/SIDA, la atencin integral de personas enfermas o portadoras y la promocin del respeto a sus derechos. Los orgaismos del SNU representados en Colombia totalizan 16, de los cuales al menos 9 tienen iniciativas de cooperacin y asistencia directamente relacionadas con el sector salud. Volumen de recursos para la cooperacin tcnica intemacional y bilateral La asistencia oficial neta para el desarrollo procedente de los pases miembros del Comit de Asistencia para el Desarrollo (CAD) de la Organizacin de Cooperacin y Desarrollo Econmicos (OCDE) totahz en el 2000, US$ 53.100 millones lo que represent una disminucin del 6% frente a los US$ 56.400 alcanzados en 1999. Sin embargo, exceptuando la gran disnnucin de la ayuda exterior de Japn, en el 2000, 14 de los 22 pases donantes del CAD aumentaron su ayuda oficial en dlares constantes por encima de los

280

La salud en la agenda de los organismos intemacioruiles

aos previos, en algunos casos sobrepasando las tasas de su propio crecimiento econmico. Por ejemplo, el Reino Unido, Blgica, Grecia, Suecia y Luxemburgo aumentaron su ayuda en trminos reales en ms de 20%. Casi tres cuartas partes de los desembolsos netos de asistencia oficial para el desarrollo vinieron de los pases del G-7, principalmente de Japn y Estados Unidos. Sin embargo, al considerar el tamao de sus economas, Dinamarca, los Pases Bajos, Suecia y Noruega, han alcanzado sistemticamente la meta establecida por las Naciones Unidas de destinar a la asistencia oficial para el desarrollo un 0.7% de su PNB, meta tambin alcanzada en el 2000 por Luxemburgo. Por contraste, el porcentaje para el conjunto de los pases del G-7 fue slo del 0.19% de su PNB. La distribucin geogrfica de los mayores beneficiarios de la recaudacin neta para asistencia oficial para el desarrollo muestra que ellas son las regiones de fiica subsahariana y Asia -aproximadamente un tercio del total cada una en el 2000 -mientras que Amrica Latina y el Caribe recibieron aproximadamente un 10% del total (unos US$ 4.900 miUones). En cuanto a las ONGs, su aporte en trminos econnucos hacia los pases en desarrollo se incrementaron en un tercio entre 1997 y el 2000, al pasar de US$ 5.2 a US$ 6.9 billones. Asistencia oficial para el desarrollo sanitario La ayuda al sector salud incluyendo salud reproductiva proveniente de donantes bilaterales y las principales instituciones multilaterales promedi en el bienio 1999-2000 los US$ 3.3 billones de dlares. Sin embargo, esta cifra es probablemente cercana a los US$ 6 billones anuales cuando se incluyen los aportes para abastecimiento de agua y saneamiento, educacin bsica y servicios sociales que impactan en la salud como tambin los recursos provenientes de organizaciones no gubemamentales. Las contribuciones para la salud varan considerablemente entre los donantes. Estados Unidos continu siendo el mayor donante bilateral durante la dcada de los 90, tanto en trminos absolutos como relativos. (US$ 733 miUones en promedio en el perodo 1996-98, monto que represent el 17% del aporte efectoado a todos los sectores). Japn fue el segundo donante ms importante en trminos absolutos (US$ 242 millones si bien este mon-

281

La Salud PbUca Hoy

to representa slo el 2% de toda su ayuda, destacndose la contribucin que hace Espaa a la salud (17% del total de su contribuciones es hacia ese sector). Con respecto a las reas especficas del sector salud hacia donde convergen estos aportes, en el caso de Latinoamrica y el Caribe, son las relacionadas con pohticas de salud y administracin de programas (35% del total) seguido por los programas de atencin bsica de salud y planificacin famihar. El papel de las ONGs es especialmente fuerte en el campo de la salud y solo las donaciones otorgadas por fundaciones internacionales de USA a programas de salud y poblacin se incrementaron casi im 50% entre 1998 y 1999 al pasar de US$ 158 a 240 millones. As mismo, a fines de los noventa han emergido grandes fundaciones privadas establecidas por exitosos hombres de negocios como BiU Gates, Ted Turner y George Soros. En el 2000 la Fundacin Gates don subsidios por US$ 1 biUn y en el 2001 entregaron US$ dos billones adicionales de los recursos de Microsoft a la fundacin privada totalizando as sus aportes US$ 23.5 billones. A su vez Ted Tumer estableci un compromiso con las Naciones Uidas para aportar en diez aos US$ 1 bUln la mayora para programas de salud a travs de la Fundacin N.U. Si bien el apoyo de la asistencia oficial para el desarrollo de la salud ha aumentado en trminos reales, estos son an insuficientes para alcanzar las metas sanitarias internacionales. Por ejemplo, la Organizacin de Cooperacin y Desarrollo Econmico calcula que se necesitan como mnimo US$ 10.000 miUones anuales adicionales en concepto de Asistencia Oficial para el Desarrollo (AOD) para salud bsica y reproductiva y otra cifra similar para la educacin bsica, el agua y el saneanento, esto es 5 veces ms de lo que se est dedicando actualmente a esos servicios. . Por su parte, estodios preliminares del BM y UN sugieren que para dar soporte a las Metas del Milenio se requiere aumentar la AOD de los actoales US$ 53.7 billones anuales a unos 100 billones. Con respecto al sector salud el Informe "Macroeconoma y salud: invirtiendo en salud para el desarroUo econmico" que fuera auspiciado por la OMS pide aumentar la asistencia intemacional de sus actoales US$ 6 biUones a 27 billones hasta el

282

La salud en la agenda de los organismos internacionales

ao 2007 y a 38 billones de dlares hacia el 2015. Estas cifras representan slo el 0.1% del PBI de los pases desartoUados y con eUo se lograran salvar 8 millones de vidas humanas. El Consenso de Monterrey, recientemente celebrado (marzo, 2002) formalmente reconoce la relacin entre financiamiento del desarrollo y la obtencin de las metas intemacionalmente acordadas. A raz de ello, los pases miembros de la UE a la ODA se comprometieron para que hacia el 2006 su aporte como parte del PBI aumente del actoal 0.33% al 0.39 comprometindose avanzar hasta el 0.7% . Por su parte USA acord para los prximos tres aos 5 mil millones de dlares adicionales, lo cual significa incrementar su ayuda intemacional en trminos de su PIB del 0.11 0.16%, lejos an del 0.7 % que es lo propuesto en el marco de los compromisos de contribucin que permitira avanzar hacia el logro de las metas del milenio. Por lo tanto, siendo bueno que nosotros y nuestros semejantes seamos sanos, todava se est lejos de la aceptacin universal de la idea de que la salud es un bien pblico indispensable que exige un enfoque apropiado en materia de poltica.

283

SEGUNDA PARTE

LJ IJMIUI

y U U l i L i l v i l \..^UIUIIlulci

^'', r J

^-ci

^T>

^ S ^ ^ ^ r # e ^

CAPTULO I

EL DERECHO A LA SALUD EN COLOMBIA

La garanta del derecho a la salud en Colombia, a la luz del derecho intemacional de los derechos humanos
NATALLV PAREDES HERNNDEZ

En este documento, se considera la salud vinculada al concepto de bienestar, que recoge la dimensin individual y colectiva de este derecho, y va ms all de la definicin negativa de salud, entendida como ausencia de enfermedad. As considerada la salud est en la base del desarrollo humano, ya que el logro del bienestar pleno de las personas permite la expresin de sus capacidades creativas y productivas, desde esta perspectiva trabajar por la salud de las personas apunta a la realizacin del ser humano. Para la OMS, la salud "corresponde al estado de completo bienestar fsico, mental y social del individuo y no solamente a la ausencia de enfermedad o invalidez". Adopt la perspectiva de Naciones Unidas que considera el derecho a la salud como "un derecho al disfrute de toda una gama de facilidades, bienes, servicios y condiciones necesarios para alcanzar el ms alto rvel posible de salud"'. Este derecho exige para su plena realizacin una obligacin positiva, de "hacer" o proporcionar, las condiciones, bienes y servicios que hacen posible la conservacin y recuperacin de la salud. Dicha obligacin est en cabeza del Estado que deber definir, de acuerdo con cada contexto particular, cmo realizarla.

NACIONES UNIDAS, Comit Derechos Econmicos, Sociales y Culturales, Observacin General No. 14, El Derecho al disfrute del ms alto nivel posible de salud, 2000.

287

La Salud PbUca Hoy

Es aqu donde radica la discusin bsica sobre el derecho a la salud, que normalmente se entiende exclusivamente como la obligadn del Estado de prestar servicios curativos, pero que va mucho ms all, si se acoge el concepto ampho de salud. Considero que para examinar la garanta del derecho a la salud en Colombia, es necesario analizar las caracten'sticas y principios de este derecho con relacin a los resultados que ha tenido la implementacin de la poltica pbhca de salud, a travs de la aplicacin de la Ley 100 de 1993. Las caractersticas del derecho humano a la salud ' '

Existen algunas caractersticas comunes a todos los derechos humanos, y por lo tanto tambin al derecho a la salud, que le dan un significado general y especfico a la vez. ' ' La primera es la universalidad, que implica que el derecho a la salud es para todas las personas sin ningn tipo de distincin; para garantizar la universalidad el Estado debe respetar el derecho a la salud, lo que significa que las autoridades no pueden llevar a cabo acciones polticas o legislativas que afecten negativamente este derecho, la no discriminacin es un componente bsico de esta obligacin del Estado. Para que la universalidad sea una realidad, se requiere que pase de su consagracin constitucional y legal a un desarrollo prctico a travs de polticas pbhcas, donde se precisen los mecaismos indispensables para eliminar las barreras econmicas, sociales, culturales y de otro orden que permitan el acceso universal al derecho a la salud. El principio de universalidad consagrado en el artculo 49 de la Constitocin Poltica y desartoUado en la Ley 100 de 1993, entiende la universalidad como "la garanta de la proteccin para todas las personas, sin ninguna discriminacin, en todas las etapas de la vida". La Ley 100 de 1993 afirm que en el ao 2001 estara asegurado el 100% de la poblacin, sin embargo eUo no ha ocurrido, las cifras de cobertora demuestran que en el mejor de los estimativos, en el ao 2000, el 58% de la poblacin colombiana se encontraba afiliada al sistema, cifra preocupante si se compara con el crecinento de la cobertora que se tuvo de 1993 a

288

La garcmta del derecho a la salud en Colombia, a la luz del derecho intemacional de los derechos humanos

1997, que alcanz en ese ao al 57% de la poblacin, lo que quiere decir que del 97 al 2000 la cobertura del sistema prcticamente se estanc en 58%, segn la encuesta de Profamiha; disminuy segn la Encuesta Nacional de Hogares del 2000 a 52.6%, segn Fedesartollo a 56.5% y segn la Academia Colombiana de Medicina a 48%. Se han generado grandes desigualdades con la implementacin del nuevo sistema, porque ste se mueve entre personas que logran ser cubiertas con altos costos y niveles de tecnologa, y personas totalmente desprotegidas (aproximadamente el 45% de la poblacin, segn el Ministerio de Salud), que no acceden ni a las condiciones de vida mnimas para conservar la salud, ni a los servicios bsicos o de urgencias, agravada an ms la situacin con el abandono de las acciones de salud pblica que ofrecen grandes extemalidades positivas para la comunidad en general. Si examinamos la cobertora del rgimen subsidiado con relacin a la poblacin con Necesidades Bsicas Insatisfechas -NBI, por departamentos, se puede observar la discriminacin por procedencia geogrfica y condicin socioeconmica. A diciembre de 1999, segn el Ministerio de Salud, la mayor cobertura se concentraba en Cundinamarca (95.64%), Bogot (88.86%), Boyac (82.32%), y Santander (81.97%), y la menor en Guaviare (24.32%), Guaina (26.57%), Amazonas (27.96%), seguida por los departamentos de Vichada, Vaups, Magdalena. Crdoba, Sucre y Putumayo donde ms del 55% de la pobladn en pobreza medida por NBI, se encontraba sin ningn tipo de cobertura^. La segunda caracterstica del derecho humano a la salud es que ste es interdependiente e indivisible. Todos los derechos humanos son interdependientes entre s, cada vez es ms urgente la necesidad de reconocer la interrelacin que tienen unos derechos con otros, pues el ser humano es un todo integral que no puede disfrutar plenamente de unos derechos si ello implica la negacin de otros derechos. En el caso de la salud esta interdependencia es tan evidente que tiene expresiones fsicas inocultables como las infecciones diarreicas producto del consumo de aguas contaminadas; es claro que la conservacin de la salud exige niveles adecuados de nutricin, acceso a saneamiento bsico y agua potable, libertad para decidir sobre las intervenciones sobre el propio cuerpo, entre otros.
Informe anual del Consejo Nacional de Seguridad Social en Salud 1999-2000, Bogot, julio 2000.

289

La Salud PbUca Hoy

Ms que un predicado razonable para cualquier persona y por lo tanto aceptado comnmente, la interdependencia e indivisibilidad de los derechos humanos, y en particular del derecho a la salud tiene implicaciones econmicas, sociales y polticas que deben ser atendidas prontamente. La interdependencia del derecho a la salud con el derecho a la educacin, se puede observar claramente en los siguientes indicadores de mortalidad infantil, segn la Encuesta Nacional de Demografa y Salud, ao 2000 de Profamilia: mientras sta es de 14 por mil de hijos de madres con universidad, la de los hijos de madres sin educacin es de 42 por mil, tres veces superior; la prevalencia de la diarrea para los nios menores de 5 aos fue de 6.3% de madres con educacin universitaria frente a 22.7% de madres sin educadn, 3.6 veces superior. En trminos econnucos, es absolutamente irracional invertir recursos en recuperacin de la salud que tienen su causa en enfermedades que son evitables con intervenciones masivas de bajo costo y alta efectividad a largo plazo, como son la extensin del acueducto y alcantarillado a toda la poblacin, o la garanta de niveles mnimos de nutricin a los sectores ms vulnerables. Aunque no es deseable utilizar argumentos de tipo econnco para consideraciones cuya motivacin debera ser tica, es importante que el Estado reconozca en la intertelacin del derecho a la salud con otros derechos humanos una prctica rentable, una inversin con frutos seguros e irreversibles mienfras sea sostenida. La tercera caracterstica del derecho humano a la salud, es que tiene el doble carcter de ser individual y social, ello implica que la obligacin del Estado consiste en atender ambas dimensiones, debe responder tanto a las necesidades individuales como a los aspectos colectivos. El lnte entre una y otra dimensin no es estricto, al respecto PROVEA, ONG de derechos humanos venezolana permite adoptar algunos criterios de diferenciacin: , "En su dimensin social, el derecho a la salud est relacionado con las polticas de salud pblica. De esta manera, "el control de las enfermedades infecciosas, los servicios sartarios y la inspeccin de alimentos son mate-

290

La garcmta del derecho a la salud en Colombia, a la luz del derecho intemacional de los derechos humanos

rias de salud pblica, muchas de las cuales requieren medidas preventivas. No existe sociedad en que estas condiciones de salud pblica no hayan sido reconocidas como una funcin clsica del Estado, a la par de las funciones de mantenimiento de la paz y la seguridad. Como en el caso de cualquier otro derecho humano y fundamental, el Estado tiene la responsabihdad absoluta de proteger la salud". Vale acotar que, en el marco de las polticas pblicas de salud, recientemente se ha incorporado, adems, la proteccin del medio ambiente. En el plano individual, la salud se relaciona con la condicin de cada persona en relacin con la mayora de las enfermedades no transmisibles, el parto, la matendad, la atencin infantil y la atencin relativa al funcionamiento de ciertos rganos"^. La preocupacin en Colombia frente al carcter colectivo del derecho a la salud es creciente, pues las acciones de salud pbhca han sufrido un retroceso invaluable, que adems se toma irrecuperable, pues todas las acciones que se dejen de reahzar por varios aos tienen un impacto negativo en generaciones enteras sobre las cuales no se puede actuar posteriormente. La falta de control de enfermedades endmicas y epidmicas se refleja en los indicadores de ocurrencia de estas frente a los indicadores histricos, los cuales se han disparado en los ltimos aos de manera creciente. Esta falta de continuidad imphca adems inversiones ms costosas en el futoro, pues los pocos avances logrados se pierden con facihdad por la discontinuidad. Las acciones de salud pblica se caracterizan esencialmente por tener resultados acumulativos, es obvio que controlar una epidemia a largo plazo imphca estar alerta de manera permanente y actoar sobre cualquier brote aislado que se presente, si ello no se realiza durante algn tiempo este brote se desarrolla y se propaga perdiendo as los logros obtenidos en el control previo. Si se observa la evolucin del porcentaje de vacunacin de los de 12 a 23 meses, de 1990 a 1995, en todos los casos este disminuy: la vacuna contra la toberculosis BCG pas de 93,9% a 91.2%; la de difteria, tos ferina y

PROVEA. La salud como derecho. Marco nacional e intemacional de proteccin al derecho humano a la salud. Serie Aportes No. 3, Caracas : Provea, 1998, p.31.

291

La Salud Pblica Hoy

ttanos DDPT de 81 a 74.1; la de poho de 82.2 a 73.1; la de sarampin de 81.2 a 73.6%; en todas las vacunas el porcentaje disminuy en ms de 10 puntos, pasando de 67.5 a 56.2%. El porcentaje de nios con diarrea aument de 12.5 a 16.7, y el de nios con infeccin respiratoria aguda de 15.8 a24.3%''. ,. La sitoacin no mejor posteriormente, por el contrario, segn la encuesta de Profamilia, para el ao 2000, solamente el 52% de los nios recibieron todas las vacunas, mientras en 1995 el 66% y en 1990 el 68%. Ha aumentado de manera alarmante la tasa de enfermedades epidmicas como el dengue y su variedad hemorrgica, la malaria, el clera y la tuberculosis. La incidencia del dengue clsico en 1996 fue de 16.4 por 100.000 habitantes y para 1998 fue de 141.7 por 100.000 habitantes; la del dengue hemortgico para 1990 fue de O.l por 100.000 habitantes, mientras que en 1998 fue de 13.9. En el caso de la malaria, la incidencia en 1990 fue de 445.5 por 100.000 habitantes mientras que en 1997 ascendi a 712.2. En cuanto al clera, para 1995 la tasa fue de 3.9 por 100.000 habitantes y en 1997 ascendi a 11.3 por 100.000. Frente a la tuberculosis, en 1997 fueron reportados 8.042 casos nuevos que corresponden a una incidencia de 21.5 por 100.000 habitantes'. La progresividad e irreversibilidad es otra de las caractersticas que permite evaluar la garanta del derecho a la salud en Colombia. Los pases asumen una serie de compromisos para garantizar la vigencia de los derechos humanos en todo tiempo y lugar, por ello su situacin se constituye en un referente y un parmetro de medicin permanente sobre el cumplimiento de los estados. ste, como cualquier otro indicador, no es esttico, por el contrario tiene implcito un carcter dinmico y evolutivo, s realmente se quiere hablar de cumplimiento.

JARAMILLO, Ivn. El futuro de la salud en Colombia, Bogot : FESCOL, FES, FRB, F Corona, enero de 1999, p. 341. Plataforma colombiana de derechos humanos, democracia y desarrollo, informe alterno presentado al comit del pacto de derechos econmicos, sociales y culturales, Bogot : Noviembre 2001.

292

La garanta del derecho a la salud en Colombia, a la luz del derecho intemacional de los derechos humanos

En el caso de la salud ello implica que no se pueden presentar retrocesos en los logros alcanzados, reflejados principalmente en los indicadores de morbihdad, mortalidad, control de enfermedades endmicas y epidmicas, acceso a servicios de atencin en salud, entre otros, porque ello sera el reflejo de un retroceso en el goce y ejercicio del derecho a la salud. Lo anterior supone que no se admite ningn retroceso, ni por coyunturas econmicas o sociales o de otra ndole, pues estos son los indicadores bsicos del estado de salud de la poblacin, mucho menos se acepta que el retroceso o disminucin sea el resultado de cambios en las polticas pblicas o en los sistemas de salud. Con excepcin del aumento de cobertura en el aseguramiento, el resto de los indicadores bsicos mencionados muestran retrocesos en Colombia despus de la implementacin del nuevo sistema creado por la Ley 100 de 1993. Se han presentado retrocesos en indicadores de enfermedades prevenibles como la Infeccin Respiratoria Aguda - fRA, el indicador de causas de egresos hospitalarios, muestra para esta enfermedad, que en menores de un ao el porcentaje aument de 4.2 en 1993 a 7.4% en 1997, lo mismo ocurri con el de causas de consulta extema, que pas de 6.1 a 7.7 en todas las edades, de 14.9 a 20.6 en menores de un ao, y de 15 a 18.4% en nios de 1 a 4 aos, para los aos 1993 y 1997, respectivamente. Para el caso colombiano, no existe justificacin alguna en los retrocesos ya mencionados, pues para destacar solamente algunos puntos, la disponibilidad de recursos para el sector de la salud nunca antes haba sido tan grande. El gasto pblico en salud ha tenido una evolucin ascendente, al pasar de un 2.57% del PIB en 1993 a 4,74 en 1997 y a 3.6%^ en 1998, adicionalmente, la prioridad constitucional y legislativa es muy clara en sealar el nfasis preventivo de la salud y la atencin especial que merecen los grupos vulnerables; el desarrollo institocional traa un acumulado nada despreciable a nivel de salud pblica, que por lo menos en el planteamiento global de la reforma, se pretenda sostener y mejorar.

ESGUERRA, Mara del Pilar y otros, "Sistema de Seguridad Social en Salud en Colombia: principales costos sobre las IPS", Bogot : Fedesarrollo, 2000, p. 46.

293

La Salud PbUca Hoy

Segn Naciones Unidas: "Una asignacin inadecuada de recursos para la salud puede dar lugar a una discriminacin que tal vez no sea manifiesta. Por ejemplo, las inversiones no deben favorecer desproporcionadamente a los servicios curativos caros que suelen ser accesibles rcamente a una pequea fraccin privilegiada de la poblacin^, en detrimento de la atencin primaria y preventiva de salud en beneficio de una parte mayor de la poblacin". Para el caso colombiano, se puede observar que del 82.5% que se destina del subsidio en salud a hospitalizacin, el 39.5% favorece a los 5 deciles de ingresos ms bajos de la poblacin y el 43% a los otros 5 deciles de ms altos ingresos. Al respecto se seala: "La mayor parte del subsidio se destina a hospitalizaciones, y la distribucin de estos recursos no favorece la equidad. El decil 2 recibe el 16.3% de los subsidios de hospitalizacin, el decil 6 recibe el 13.7%, el decil 9 el 10.7%. Despus de la Ley 100 del 93 los servidos de alta complejidad se han ido concentrando en los hospitales pblicos (...), y all van tanto los ricos, como los pobres". Este es uno de los aspectos que ms se destaca en la implementacin de la reforma del sistema de salud, por el impacto negativo que ha tenido, pues contrario a la observacin de Naciones Unidas, su nfasis ha estado en los servicios curativos en detrimento de los preventivos, y aunque estos no suelen ser demandados de manera generalizada, s es uno de los factores que ha incidido de manera determinante en el deterioro de los indicadores bsicos de salud en los ltimos aos. La ltima caracterstica que nos permite observar el incumplimiento por parte del Estado frente a la garanta del derecho a la salud es la de la irrenunciabilidad. El derecho a la salud al igual que el resto de derechos humanos es krenunciable, lo que significa que a ninguna persona se le puede quitar o arrebatar, tampoco esta puede negarlo, cederlo o negociarlo a cambio de otro derecho

JARAMILLO, Jorge Ivn. "Imparcilaidad financiera y equidad. Otra lectura del informe de la Organizacin Mundial de la Salud -2000. Ponencia preparada para el seminario El derecho a la salud y la equidad en los servicos de salud, abril de 2001, p. 9.

294

La garcmta del derecho a la scdud en Colombia, a la luz del derecho interruicional de los derechos humanos

O de prebenda alguna as fuera su voluntad, porque al ser parte de la dignidad humana es esencial a la existencia misma del ser humano y por lo tanto es enajenable e irrenunciable. Existe cierto consenso en algunos sectores a aceptar que a cambio de la promesa de servicios de atencin ciu"ativos para la mayora de la poblacin va afihacin a una EPS, se ceda en las acciones propias de protecdn de salud por parte del Estado como las polticas de salud pblica, o en algunas necesidades para la atencin de la enfermedad, as se afecte la integralidad del derecho a la salud. Aunque no existen estadsticas en Colombia, que den cuenta de manera directa de la garanta de la irrenunciabilidad del derecho a la salud, las polticas de contencin de gastos de las EPS han afectado al 76% de los pacientes; las EPS le exigen al cuerpo mdico: lmites en la cantidad de exmenes (segn el 80% de los encuestados), en la prescripcin de medicamentos del POS (76%), un tope mnimo de pacientes al da (58%), y un lmite en la autorizacin de cirugas (39%)*. Es decir, que el sistema mercantil de la salud, genera unas reglas de funcionamiento que presionan a renunciar a beneficios sodales o individuales de la atencin en salud. Todo esto, sin tener la suficiente conciencia de los impactos negativos que ello conlleva sobre la conservacin de la salud de la comunidad y de los sectores vulnerables en particular, y de los costos econmicos que a largo plazo se van acumulando para el pas en general, para las posibilidades de desarrollo y para la disminucin de la desigualdad social. Adems de las caractersticas comunes a todos los derechos humanos mencionadas anteriormente, existen unos principios rectores especficos para cada derecho, en el caso de la salud estos son los principios de igualdad, accesibihdad, gratuidad y equidad. A continuacin voy a examinar cada de uno de ellos a la luz de lo que ha ocurrido recientemente en el pas.

Encuesta realizada a personal de salud de las EPS. Fuente: Peridico El Tiempo, 1 de octubre de 2001. p. 1-6.

295

La Salud PbUca Hov

Igualdad El principio de igualdad apunta directamente a la obhgacin inmediatamente aplicable de no discriminacin por motivo alguno, lo que implica que todas las personas tengan derecho a acceder al sistema de salud en igualdad de condiciones. El logro de la igualdad en el derecho a la salud no atraviesa al sistema en su conjunto, por el contrario, siguen existiendo discriminaciones mltiples empezando por la fragmentacin en los diferentes tipos de atencin, planes de servicios y niveles de tecnologa hasta la disparidad en el desarrollo del sistema por componentes, regiones, al interior de las mismas y entre las zonas rural y urbana. Muestra de ello es el comportamiento del indicador de mortalidad infantil en el ao 2000; mientras en Bogot y la regin central este es de 17 y 20 defunciones por mil, respectivamente, en las dos regiones costeras es de 29/1000 y en los departamentos de Guajira, Cesar y Magdalena de 36/1000, mientras en MedeUn es de 12. La mortalidad perinatal en el Pacfico es de 88 por mil, mientras en Cali es de 11, diferencia abrumadora entre zonas cercanas geogrficamente y con reladn al resto del pas'^. Esta desigualdad latente es para todos los componentes del sistema; no se puede afinnar que existen unos niveles bsicos de atencin donde s se aplica el principio de la igualdad, pues en atencin primaria y salud pblica que tienen en su definicin misma incorporada la atencin de todos los habitantes por igual, se presenta una discriminacin permanente por sectores y regiones, afectando a los grupos ms vulnerables que son los que presentan las ms altas frecuencias de todo tipo de enfermedades, de ah que se afirme en el informe de Desarrollo Humano para Colombia de PNUD y Misin Social: "en el 2000, la enfermedad tiende a concentrarse entre los ms pobres y la atencin en los ms ricos".

PROFAMILIA. Encuesta nacional de demografa y salud 2000, Bogot: Profamilia, 2000.

296

La garanta del derecho a la salud en Colombia, a la luz del derecho intemacional de los derechos humanos

Accesibihdad Otro de los principios del derecho humano a la salud es el de accesibilidad, que consiste en asegurar que todos los habitantes del pas tengan la posibihdad de disfrutar de los beneficios de las polticas, programas y sistemas de salud existentes, teniendo en cuenta las circunstancias de tiempo y distancia de cada grupo poblacional. La aplicacin del principio de accesibihdad, segn Naciones Unidas "... abarca el acceso a lo largo de las distintas etapas de la vida, a los conocimientos relativos a la forma de vivir de manera sana; el acceso a la proteccin contra los principales riesgos de la salud a causa de terceros, del medio ambiente o como resultado de los procesos de desarrollo propiamente dichos; y, por ltimo, el acceso a una buena atencin de promocin, preventiva, curativa y de rehabilitacin"'". Preocupa la sitoacin de los vinculados que en la prctica difcilmente acceden a los servicios de salud, segn el Informe de DesarroUo Humano para Colombia 2000: "El uso de los servicios de salud y, en especial, de la consulta mdica y odontolgica en caso de enfermedad o problema de salud, se ha visto reducido para el conjunto de vinculados entre 1997 y 2000 (...), ya que ha disminuido el porcentaje de personas vinculadas que consultaron en caso de necesidad, mientras en 1997 fue de 11%, en el 2000 se redujo a 5.39%". Hay regiones que no cuentan sino con un hospital de nivel II para la atencin de su poblacin, y sus hospitales permanecen en dficit y cierre inminente, como son el Hospital San Andrs de Tumaco que atiende a la Costa Pacfica de Nario, o el Hospital Sagrado Corazn de Cartago, nica institucin de este tipo en todo el Norte del VaUe. Tambin se aprecian diferentes lveles de accesibilidad entre las zonas rural y urbana, lo que de alguna manera es natoral en la medida en que las condiciones y el contexto son diferentes, sin embargo, en estos casos se requiere que los sistemas de salud y las polticas pblicas se adecen a las necesidades segn el caso, y ello no ha ocurrido con la implementacin de

NACIONES UNIDAS: Estado de preparacin de las pubcaciones, los estudios y los documentos destinados a la Conferencia Mundial sobre derechos humanos, 1993. Citado En : Provea: La salud conw derecho. Marco nacional e intemacional de proteccin al derecho humano a la salud. Serie Aportes No. 3, Caracas : Provea, 1998, p. 33.

297

La Salud PbUca Hoy

la Ley 100, pues se ha pretendido aplicar exactamente el mismo modelo para los habitantes del campo y de la ciudad, ello ha resultado en que slo el 47.4% de la poblacin mral se encuentre afihada al sistema, de sta el 76.6% est en el rgimen subsidiado. De ah surgen varias preocupaciones, la primera es que en el campo la cobertura del sistema no alcanza a cubrir ni a la mitad de la poblacin, de la afihada, la mayor parte solo puede acceder a servicios de primer nivel; la segunda, es que la distancia y el difcil acceso permiten que las personas hayan sido inscritas, en parte cametizadas, pero que los servicios no lleguen a sus zonas de vivienda y trabajo, y que por lo tanto exista un acceso poco efectivo, y simultneamente un despilfarto y desviacin de recursos por parte de las ARS y los entes territoriales, que reciben los subsidios de esta poblacin; desde 1998 hasta el 2001 fueron ccrtadas 126 ARS de 256 que existan. Esta situadn ha generado insatisfaccin en la poblacin campesina. Es as como las demandas del sector raral giran en tomo a la atencin primaria en salud, a la permanencia de los puestos de salud que anteriormente existan en estas zonas, a la sohcitod de brigadas mvUes de salud y formacin de promotoras de salud, y al adecuado funcionamiento de los sistemas de referencia. Gratuidad El tercer principio del derecho a la salud es el de la gratuidad, este principio est ligado al de accesibilidad, pues en algunos casos la poblacin que no est cubierta por la seguridad social o que carece de recursos, solamente puede acceder a los servicios cuando estos no implican ningn tipo de barreras, especialmente econmicas, es decir, cuando los servidos bsicos son gratuitos para aquella poblacin que no puede pagarlos. El Programa de Naciones Unidas para el DesarroUo - PNUD, plantea que, "la oferta gratuita de servicios de primera necesidad brinda una mayor igualdad de oportonidades y atiende la responsabilidad que tiene todo gobiemo por velar por los derechos humanos bsicos de sus ciudadanos (...) est demostrado que la implantacin de cobros de tarifas a los usuarios detemna una disminucin en la demanda de los servicios sanitarios"".

PNUD. Informe de Desarrollo Humano, Bogot : Tercer Mundo Editores, 1991, p. 280.

298

La garanta del derecho a la salud en Colombia, a la luz del derecho intemacional de os derechos humanos

En Colombia una de las razones ms frecuentes de la poblacin para no acceder a los servicios de salud es la falta de recursos econmicos, ya sea porque no cuenta con el monto de la cotizacin, porque no cuenta con los recursos para pagar copagos o cuotas moderadoras y por lo tanto disminuye la frecuencia y el uso de algunos servicios, an necesitndolos, o porque en caso de lu-gencias no cuenta con la cantidad exigida para la atencin iicial a los no afiliados. Aunque suene coloquial y a pesar de la ausencia de estadsticas, es frecuente que los pacientes se queden internados indefinidamente en los centros hospitalarios porque no tienen los recursos para saldar la deuda. Segn la Encuesta de Profanlia del ao 2000, la razn ms frecuente para no usar los servicios es la falta de dinero en todas las edades (51 %), en la zona urbana esta sitoacin afecta al 47.5% de la poblacin, y en la zona rural al 58.5%; por regiones, la ms afectada por esta causa es la Atintica (62.3%), seguida por la Pacfica (53.3%), con relacin a la actividad econmica, los ms afectados por esta situacin son los dedicados a los oficios del hogar (57.4%) y los desempleados (55.2%)'^. La eliminacin de las barreras de acceso, especialmente las econmicas, debe ser una prioridad para cualquier reforma del sistema de salud en Colombia, con mayor razn, cuando ms del 50% de la poblacin es pobre y ms del 20% se encuentra en situacin de miseria, en estos casos, es de suponer que los hogares solamente destinan recursos para las necesidades bsicas de sobrevivencia y, por lo tanto, cuando la salud no implica una lu-gencia, no est dentro de los consumos promedio de este gmpo poblacional. Para el caso colombiano, resulta particularmente preocupante lo que ha sido denominado por PNUD como la prdida acelerada de capital humano en los ltimos cuatro aos, que puede resumirse de manera muy esquemtica en lo siguiente: ante el creciente desempleo, el perceptor principal de ingresos y su familia se ven en la necesidad de recortar los consumos que en dicha sitoacin no resultan estrictamente necesarios para la sobrevivencia, como son el retiro del sistema escolar, la prdida de la vivienda y la disminucin del consumo de alimentos, medicamentos y servicios de salud, todo ello tiene un

PROFAMILIA. Encuesta nacional de demografa y salud 2000, Bogot: Piofamilia, 2000.

299

La Salud Pblica Hoy

impacto inmediato y a largo plazo sobre las posibiUdades de conservacin de la salud'^ Este tambin es un problema de salud pblica y hace parte de la obligacin del Estado de protecdn de la salud de la poblacin. Equidad Finalmente, el principio de equidad en el derecho a la salud, busca lograr que la oportunidad de conservar y recuperar la salud de las personas se garantice plenamente sobre la base de la justicia distributiva, es decir, parte del reconocimiento de las desigualdades existentes en el acceso a la salud, y pretende superarlas a partir de las necesidades diferenciadas de personas y comunidades, considerando que esta es la nica va posible para colocar a los grupos menos privilegiados en igualdad de condiciones que les permitan alcanzar un pleno desarrollo de su salud.
. '

<

"El concepto de equidad que se encuentra en la base del planteamiento de la meta de salud para todos se fundamenta en la nocin de necesidad. Esto implica que el acceso a recursos y servicios de salud atienda no a criterios 'neutros' de cuotas igualitarias, sino a consideraciones de diferenciacin que respondan a las necesidades especiales de los distintos grupos (...) La equidad en salud tratara, en general, de corregir diferencias que no slo son innecesarias y evitables, sino al mismo tiempo injustas e indebidas. Puede tratarse de diferencias en el nivel de la salud o la calidad de vida que a su vez implican variables socioeconmicas o de desarrollo ms amplias, o pueden ser diferencias de servicios o de acceso a la atencin de salud"'"*. El sistema de salud en Colombia ha entendido la equidad como la incorporacin de los gmpos no afiliados al sistema de aseguramiento, en particular, como el aumento de cobertura del rgimen subsidiado para la poblacin pobre, y por lo tanto el acceso de la misma a un plan estandarizado de servicios, sin reconocer que las diferencias en las necesidades de salud van ms all del acceso a la atencin de nivel I, que, inclusive, en la mayora de las ocasiones estas necesidades no estn asociadas de manera directa a este acceso, sino a condiciones de vida y, por lo tanto, a atencin primaria en salud.

MISIN SOCIAL - DNP - PNUD. Informe de Desarrollo Humano para Colombia, Bogot, 2000. Citado en PROVEA. La salud como derecho. Marco nacional e intemxicional de proteccin al derecho humano a la salud. Serie Aportes No. 3, Caracas : Provea, 1998, p. 34.

300

La garanta del derecho a la salud en Colombia, a la luz del derecho intemacional de los derechos humanos

En el Informe de DesarroUo Humano para Colombia 2000 de PNUD, se seala: La tendencia hacia la concentracin en la atencin en los grupos de mayores ingresos, entre 1993 y 1997, puede apreciarse analizando la demanda de servicios de salud discriminada por gnero y quintiles de ingreso. Entre 1993 y 1997, la tasa de crecimiento de la atencin de los hombres pertenecientes al 20% ms pobre fue de 1.4%, mientras que la del 20% ms rico fue de 26.8%. Las diferencias en crecimiento en la atencin entre las mujeres pertenecientes al primer y quinto quintil es un tanto menor que la presentada entre los hombres, pero de todas formas, amplia. La atencin aument en 6.6.% para las mujeres ms pobres frente a un 27.8% para las mujeres de la escala superior de distribucin de ingresos. Estos indicadores de crecimiento de la atencin por grupos de ingresos, nos indican que ha sido muy superior en los quintiles ms altos frente a los ms bajos, es decir, que en la distribucin de recursos del sector salud, se estn asignando ms recursos a los grupos ms ricos, y menos a los grupos de menores ingresos, totalmente contrario al prindpio bsico de la equidad que es redistributivo e implica dar menos a quien ms tiene, y ms a los que tienen menos. La aplicacin del principio de equidad exige que la poltica pblica de salud est atravesada por la consideracin permanente de realizar una planeacin basada en las diferentes necesidades que existen en salud, es decir, que parta del reconocimiento de los diferentes diagnsticos por regiones, edades, sexo, niveles de ingreso, condiciones de vida, y sobre esa base disee planes, programas y sistemas. Aunque hay algunos avances por sexo, edad y grupos tnicos, y en algunos municipios del pas planes participativos de salud, esta debe ser una poltica permanente de planeacin. Derivado de lo anterior, una poltica equitativa en salud implica una distribucin de recursos financieros, tcnicos y humanos basada en necesidades individuales y colectivas, y no necesariamente en promedios que se estandarizan para todo el conjunto de la poblacin. Todo esto remite a su vez a la obligacin del Estado de adoptar medidas deliberadas de "discriminacin positiva", es decir de acciones concretas que posibiliten que las polticas de salud beneficien adecuadamente a los grupos ms vulnerables de la sociedad.

301

La Salud Pblica Hoy

Preocupa bajo la lgica mercantil de la salud, la prdida de recursos, ya que a pesar de destinar grandes cantidades a la financiacin de los planes de servicios, al no reconocer las necesidades particulares de diferentes grupos, el sector salud no los est utilizando adecuadamente. stos no cumplen con el objetivo de la equidad y de colocar en condiciones cada vez ms igualitarias a los ms vulnerables, por lo tanto, la brecha no se va cerrando, sino que se va ampliando. En Colombia no se han reconocido las caractersticas y principios del derecho humano a la salud; ello se evidencia en que la poltica pblica limita sus acciones a la atencin de afecciones y enfermedades solamente de una parte de la poblacin, otra parte es excluida del sistema y sufre mltiples discriminaciones inaceptables, adems, est descuidada totalmente la prevencin, promocin y proteccin de la salud; no adopta un enfoque integral, excluyendo el mejoramiento de las condiciones de vida de sus objetivos. Existe un desconocimiento de la proteccin del derecho a la salud como un elemento fundamental del desarrollo. Si bien los aspectos constitucionales y legales del derecho a la salud son fundamentales para lograr su plena vigencia, la discusin poltica democrtica es la que en realidad determinar el futuro de la salud en el pas. Al tratarse de un aspecto esencial de la vida social, el debate pbhco y las decisiones de la sociedad deben definir a la salud como un derecho fundamental, pues el desarrollo del Estado social de derecho es la expresin de cada momento histrico de la sociedad, y corresponde a sta decidir sobre la prioridad de la salud en la vida colectiva. ,,

302

El derecho a la salud en el derecho constitucional colombiano*


CARLOS GAVIRIA DAZ

Lo primero es una reflexin sobre la definicin de Estado Social de Derecho. Tratar de exphcar de manera pedaggica en qu consiste. Explicar adems, por qu un Estado Social de Derecho constitoye un avance, respecto del Estado de Derecho, para que luego cada uno pueda advertir la importancia del derecho a la salud como un derecho social y econmico dentro de una constitocin como la nuestra y cules son los desarrollos jurisprudenciales que ha tenido. Analizar tambin las fallas que existen, no slo en la prctica, sino en la consagracin de ste derecho dentro de nuestro sistema jurdico. Qu es entonces un Estado de Derecho? Es un Estado donde las conductas, tanto de los gobernantes como de los gobernados, estn sometidas a regla. Trata de borrar una lnea divisoria odiosa que separaba a los gobernantes y gobernados: los gobernados como sometidos a la norma, y los gobernantes como quienes daban la norma, sin estar sometidos a ninguna norma. Ejemplo de ello es la monarqua absoluta francesa, contra la cual se levant la Revolucin Francesa. Qu persigue en primer trmino un estado de Derecho? La erradicacin de la arbitariedad, que es la posibilidad de actuar caprichosamente, a voluntad, sin sometimiento a ninguna regla previa. Tal es el caso del monarca absoluto y del dictador absoluto. Y es contra esto que surge el Estado de Derecho.
Es transcripcin de la presentacin oral.

305

La Salud Pblica Hoy

Podemos entonces preguntamos: por qu es bueno erradicar la arbitrariedad? Esta pregunta nos coloca ante las metas axiolgicas que persigue el Estado de Derecho. El por qu de la pregunta, es que cuando yo estoy sometido a un rgimen arbitrario no soy libre, en la medida en que no tengo nocin de cundo van a pedirme cuenta por una conducta ma ni en qu trminos van a hacerlo. No s si la conducta en que estoy incurriendo es o no una conducta antijurdica, es una conducta ilegtima que puede dar lugar a una represin por parte de la autoridad pblica. En cambio, en el Estado de Derecho, se trata precisamente de que yo sepa siempre por qu tipo de conductas pueden pedirme cuenta, en qu medida y quin puede pedirme cuenta de esas conductas. Solamente de esa manera puedo decir yo que soy libre, cuando existen reglas que me determinan el mbito de mi libertad. S hasta dnde puedo actuar sin esperar una consecuencia negativa de mi conducta, y s cundo actuando de otra manera puedo esperar una reaccin o una consecuencia negativa de mi conducta. Esto es lo que se conoce como libertad - seguridad. Voy a vincular precisamente sta breve reflexin sobre el Estado de Derecho y el Estado Social de Derecho, con los derechos. En 1789 se proclama la Declaracin de los Derechos del Hombre y del Ciudadano, en la que se establece que todos los hombres nacen iguales y deben ser tratados como tales ante la ley. Y que nacen libres. Todos los hombres nacen libres e iguales ante la ley. Y luego, al lado de esos derechos, se enuncian otros como la libertad de conciencia, la libertad de pensamiento, la libertad de expresin, el debido proceso, el derecho a la propiedad, etc. Esos derechos se enuncian como una deduccin de postulados morales, ticos, universales, inmutables, etemos. Y podemos preguntamos, qu es lo que le da fundamento a esa proclamacin de los Derechos del Hombre y del Ciudadano? Respondemos que ese tratamiento por el que claman los Derechos del Hombre y del Ciudadano, se refiere al hombre, al ser humano como un ser privilegiado dentro de la creacin. Se le estn fijando hmites al ejercicio del poder y esos hmites van a beneficiar a la persona humana. A esa primera forma de libertad se le llama libertad - seguridad, porque yo tengo la certeza, la seguridad de que en un detemnado mbito de mi persona, en una determinada rbita, el poder no puede ingerir. No es lcito, no es legtimo que el poder interfiera en una determinada rbita de mi persona. Justamente a esa lucha por la libertad se la ha llamado la lucha por la libertad - seguridad, dentro de los tericos. Y podemos decir que esa lucha corresponde a un primer paradigma de la dignidad humana.

306

El derecho a la salud en el derecho constitucional colombicmo

Voy a explicar qu es eso de un primer paradigma de la dignidad humana. Si nos preguntamos qu fundamento filosfico tienen los Derechos del Hombre y del ciudadano, que hoy llamamos Derechos Humanos, con una tabla mucho ms incrementada, y eso me interesa subrayrselos, la respuesta ms frecuente a sta pregunta, es que los derechos tienen su fundamento en la dignidad humana. Podemos decir entonces, que como la criatura humana es digna, entonces a ella hay que tratarla de un derto modo y se le reconoce el derecho a la libertad, a la igualdad, a la libertad de conciencia, a la libertad de pensamiento, de expresin, al debido proceso. Es el tratamiento adecuado a esa condicin digna del otro. La dignidad humana se fundamenta de distintas maneras, tanto en una filosofa de orden metafsico como teolgico. De acuerdo con el cristiano, el hombre es digno porque es el que ms se parece al creador y el creador es Dios. Para Kant, el hombre es digno porque es insustitoible y es, adems, un fin en s mismo y no un medio para un fm. Por tanto, los Estados que se fundamentan en la proteccin de la vida humana, lo que anuncian es que no van a tratar a las personas como recursos, como medios, sino como fmes en s mismos. Una marfestacin de sta natoraleza, que en principio tendra una connotacin eminentemente tica, resulta teniendo una connotacin poltica. Quiero hacer una reflexin en ste sentido que me parece muy til: los franceses de finales del siglo XVIII, cuando anuncian esta tabla de los Derechos del Hombre y del Ciudadano, no piensan que esos derechos correspondan a las aspiraciones, a los propsitos de esos franceses del siglo XVHI, sino que piensan que esos derechos se deducen por la mera consideracin racional y que rigen para todos los hombres en todo tiempo y en todo lugar. Constituyen entonces una suerte de verdades ticas tan inmutables como lo son las verdades lgicas y matemticas, tal como el teorema de Pitgoras, que no slo vaha en el siglo VI a.C, sino que sigue valiendo hoy. As mismo, la libertad y la igualdad son verdades ticas universales, absolutas, inmutables y todas las dems connotaciones que de all puedan seguirse. Recordemos entonces: el Estado de Derecho lucha contra la arbitrariedad, y la lucha por la libertad, es la lucha por la libertad humana, es la lucha por la hbertad humana dentro de una cierta concepcin, es la concepcin racionalista de finales del siglo XVin. Ya dentro de la Revolucin Francesa, se da la lucha por otra libertad, y esa lucha, a posteriori la han denominado los tericos la lucha por la libertad participacin. Podramos decir, que la hbertad-

307

La Salud PbUca Hoy

seguridad, simboliza bien lo que podramos Uamar, "la libertad hberal". La filosofa liberal est empeada en perseguir la libertad-seguridad, que la persona humana sea invulnerable al ejercicio del poder del Estado en ciertas rbitas como la conciencia, la igualdad, la libertad y dems. Deca que dentro de la misma Revolucin, se da una segunda lucha, casi podramos ordenarlas cronolgicamente. Y esa segunda lucha, es la lucha por la libertad participacin, la cual se puede llamar como la libertad tpicamente democrtica, esa en la que tengo la posibilidad de ser rgano del Estado, de elegir y ser elegido, de participar en las decisiones que a m van a afectarme y, por tanto, pudiramos decir que sta libertad es la tpica libertad democrtica; de all, que se hable de un sistema demo-liberal; lo liberal, requiere a la libertad-seguridad y lo democrtico, requiere a la libertad - participacin. Se habla de un sistema demo-liberal y se tiene la sensacin de que el sistema demo-liberal implica ambas cosas. Pero no es as. A pesar de que esas dos hbertades se requieren mutuamente, pueden pensarse aparte. Adems: dentro de la misma Revolucin Francesa se da una cierta dialctica, una lucha en que a veces prevalece la libertad - seguridad y a veces la libertad - participacin. Porque uno puede pensar un rgimen liberal, pero no participativo. Pensemos, por ejemplo, en los dspotas ilustrados, en Federico el Grande de Prusia. El le concede voluntariamente libertades a su pueblo. Dentro de ese pueblo se tendr una libertad-seguridad, pero esas libertades las concede graciosamente el monarca y no son una conquista de las personas. Ellas no participan en el reclamo de sus libertades. Entonces, la lucha por la libertad-participacin no slo consiste en que vamos a tener libertades, sino que vamos a participar como gobernantes en el Estado. , Vamos sacando algo en limpio para que nos quede claro para dnde vamos y por qu esta reflexin que estoy haciendo tiene que ver con el tema propuesto. Les deca que ese momento de la Declaracin de los Derechos del Hombre y del Ciudadano corresponde a un paradigma de la dignidad humana. Adems, se considera que esos derechos que se anuncian como inherentes a la persona humana, dentro de la perspectiva ius naturalista racionalista - que es la filosofa que triunfa en la Revolucin Francesa - no son histricos, sino ahistricos. Es decir, no estn limitados a los hombres de la Francia del siglo XVIII, sino que deben otorgarse a todos los hombres en todo tiempo y en todo lugar. Por eso deca que eran tan universales como las leyes de las matemticas, de la lgica.

308

El derecho a la salud en el derecho constitucional colombiano

Bien. Con posterioridad a la Declaracin de los Derechos del Hombre y del Ciudadano surgen varias observaciones pertinentes, como las provenientes de la filosofa marxista. Tal filosofa sostiene que esos derechos corresponden a libertades de carcter burgus, que son el triunfo de la burguesa y, por tanto, no pueden predicarse en abstracto a priori de todos los hombres. Hacen adems una observacin que a mi modo de ver es fundamental. Dicen: esas libertades, enunciadas en abstracto, sin una correspondencia en la infraestructora material y econmica, son libertades vacas, irreales. Por ejemplo: me dicen que tengo derecho a expresarme. Y si pregunto: qu medio tengo para expresarme?, me responden que si poseo un medio de comunicacin, entonces puedo expresarse. Me dicen que tengo libertad de movimiento, pero no tengo los recursos para desplazarme, para pagar un pasaje costoso. En principio usted se puede desplazar, pero si no tiene las condiciones materiales para ello, pues no puede hacerlo. La filosofa marxista no trata de hacer de eso un asunto distinto sino el mismo asunto. Es dech, yo tengo los derechos que mis condiciones materiales me pemtan ejercer. Entonces, las observaciones conenzan a abrirse paso y pueden ser pensadas incluso sin referencia al marxismo. Porque hay ah unas observaciones que son prcticamente de sentido comn y que son innegables. Para poderme erigir en titular de derechos, debo tener satisfechas mis necesidades ms esenciales. . Surge entonces una nueva inquietud. Cmo atender a esas necesidades que tiene el hombre y que parecen previas a las primeras? Surge entonces la nocin de derechos sociales y econmicos. A esto lo podemos llamar un segundo paradigma de la dignidad humana. Con eso quiero subrayar un hecho: que esos derechos que se enunciaban y se proclamaban a priori universales, parece que fueran tambin un producto histrico. Para los franceses del siglo XVIII, la dignidad humana quedaba satisfecha si al hombre se le daba un trato acorde con la tabla de la que les he hablado. Pero luego vienen entonces nuevas declaraciones, que incluyen los derechos que se han denominado de segunda generacin', configurndose as un segundo paradigma de la dignidad humana.

Tomado del libro de Angelo Papaquini. Los derechos humanos un desafo a la violencia. Donde se vinculan esos derechos de primera, segunda y tercera generacin, con los paradigmas de la dignidad humana.

309

La Salud PbUca Hoy

Si nos preguntamos cmo se trata al hombre de una manera acorde, de una manera armnica con su dignidad, entonces ya no quedaremos satisfechos con la tabla de los Derechos del Hombre y del Ciudadano de la Revolucin Francesa, sino que apuntaremos hacia la satisfaccin de ciertas necesidades materiales que le pemtan al hombre ser libre y por tanto tambin, proclamarse igual a los otros. Esto es importante porque rescata la historicidad de los derechos. No los derechos ahistricos, que se ganan a priori, o como las verdades matemticas que se descubren por el slo uso de la razn, y luego vamos deduciendo de esos derechos otros. Hay que verlos en cambio como necesidades histricas, cmo la historia va detectando a cada momento de qu manera debe ser tratado el hombre para que ese tratamiento est acorde con su dignidad. .. Podemos entonces aducir que, tal como ocurte entre la libertad-seguridad y la libertad-participacin, entre la democracia y el liberalismo, en la Revolucin Francesa tambin existe una confrontacin, se da una tensin entre dos metas, entre dos propsitos, entre dos valores: la libertad y la igualdad. Hay pocas de la Revolucin Francesa que son profundamente libertarias, individualistas y hay otras que son profundamente igualitarias, porque generalmente vinculamos a la Revolucin Francesa ms que todo con la libertad y no con otra cosa. Pero la revolucin de Gracco y sus iguales es una revolucin casi comunista que se da dentro de la Revolucin Francesa. Porque Gracco lo que acenta es la necesidad de que todos los hombres sean iguales. Y eso de que los hombres sean iguales va ms o menos dentro de esa segunda lnea, de que para que los hombres sean iguales es necesario que tengan suplidas ciertas necesidades bsicas. El Estado Social de Derecho surge dentro de ese paradigma. No basta con garantizarle en el papel a la persona el ejercicio de la libertad de pensamiento o el derecho a la libertad de pensamiento, a la libertad de conciencia, a la libertad de expresin. Hay que suministrarle los medios econmicos, materiales, que le permitan ser titular de esos derechos. Por tanto, esa tabla de derechos sodales y econmicos, responden a una segunda concepcin de la dignidad humana, lo que venimos llamando un segundo paradigma de la dignidad humana. Inclusive podemos incrementarlo, porque luego pensamos: no basta con que el hombre tenga sus necesidades esenciales satisfechas para que pueda realizarse plenamente como persona, es necesario que tenga adems tiempo libre. Y entonces, el derecho a usar el tiempo libre, el derecho al goce, el derecho a

310

El derecho a la salud en el derecho constitucional colombiano

lo ldico, se van perfilando como otras necesidades. Pero necesidades que se van detectando o que van surgiendo histricamente, en un proceso histrico, no deducibles de ante mano mediante un sistema axiomtico, como el que proponan los revolucionarios de 1779. Es claro que estoy simplificando mucho, pero quiero que vean por qu entonces se da en Colombia el paso de un Estado de Derecho, al menos en el papel, a un Estado Sodal de Derecho, qu significacin tiene eso y por qu entonces ahora el derecho a la salud puede ser afirmado como un derecho. Vamos a ver si su consagracin en la Constitucin es todava precaria o es suficiente, y qu es lo que se ha hecho para garantizar el derecho a la salud. El derecho a la salud hara parte de esa segunda tabla de derechos, de esa segunda concepcin, de ese segundo paradigma de la dignidad humana, en el que se considera que para que la persona sea titular y sujeto de derechos es preciso que algunas de sus necesidades estn satisfechas. Y ese es el caso, por ejemplo, del derecho a la salud. Nos podemos preguntar: qu fue lo que ocurri en Colombia en 1991?. Ocurri algo muy importante. Lo que ocurti fue realmente muy importante. En primer lugar, nos referimos a la Constitucin como un programa, como un pibote para alcanzar ciertas cosas que an no se han logrado, pero que constituyen un avance significativo con respecto a la Constitucin de 1886. Dicha Constitucin posea una tabla de derechos mucho ms magra, una tabla de derechos mucho menos ambiciosa que la de la Constitucin de 1991. Yo siempre he subrayado ste hecho como algo positivo, especialmente si pensamos en que lo que indujo a un gran sector de la opinin pblica nacional a pedir reforma constitucional o una nueva Constitucin fue la paz. Estamos abrumados por la violencia, estamos abrumados por lo que yo he llamado la anomia. Las normas no son suficientes para garantizar una conducta civilizada dentro de nuestra comunidad y el constituyente del 91 sigui un camino que para m es atractivo: en lugar de reaccionar de una manera estereotipada, acorde con ciertos sectores de opinin que cada vez que vivimos momentos dramticos dice: aqu lo que hace falta es ms autoridad, mano firme, ojal militar, etc. El constituyente del 91, a mi modo de ver muy sabiamente, lo que dijo es: aqu lo que debe hacerse es configurar un Estado de Bienestar, un Estado ms democrtico que el que tenamos, un Estado incluso ms liberal en materia de libertades pblicas que el que tenamos. Pero adems, un Esta-

311

La Salud PbUca Hoy

do comprometido con el bienestar. Y decimos: un Estado comprometido con el bienestar de quin? Pues de las personas que nunca han tenido bienestar, con los sectores de la pobladn que jams han tenido bienestar, y por eso se conforma el Estado Social de Derecho. Podramos decir que el Estado Social de Derecho corresponde entonces al segundo paradigma de la dignidad humana. Hay nuevos derechos sociales, nuevos derechos econmicos e incluso culturales. Y eso se plasma en parte - una vez ms advierto que estoy trazando un esquema de una manera muy apresurada y por tanto pude resultar impreciso el esquema - en que ahora estemos hablando del derecho a la salud y reclamando ese derecho y antes no lo reclambamos con tanto ahnco como hoy lo reclamamos. En la reforma de 1936 a la Constitucin de 1886 se introdujo algo de intervensionismo de Estado, lo que se llamaba socialismo de Estado. Desde entonces el Estado empez a tomar en cuenta las necesidades bsicas de las personas y a comprometerse con la satisfaccin de esas necesidades. Podramos decir entonces que el Estado Social de Derecho es un Estado comprometido con la satisfaccin de las necesidades bsicas de las personas. Por tanto no es sorprendente que si la Constitucin de 1991 configur, como lo dice desde su primer artculo, un Estado Social de Derecho, que podamos encontrar en ella un captolo segundo que ya no se refiere nicamente a los derechos de la libertad-seguridad, sino un captulo que se refiere a los derechos sociales, econmicos y culturales. Dentro de ese captulo encontramos el artculo 48 que se refiere a la seguridad social como un servicio pblico de carcter obligatorio y el artculo 49 que reconoce la atencin de la salud y el saneamiento ambiental, como servicios pblicos a cargo del Estado. No estn consagrados de manera tan radical como deberan estarlo. Pro ustedes saben que la Corte Constitucional que tom en serio la Constitucin del 91 lleg, mediante construcciones tericas que me parecen sumamente valiosas, a considerar en determinadas circunstancia el derecho a la salud como un derecho fundamental inmediatamente tutelable, es decir: inmediatamente protegible por la va de la tutela, cuando est conectado ntimamente con el derecho a la vida Porque es difcil pensar, separadas, la salud y la vida.

312

1 derecho a la salud en la jurisprudencia constitucional colombiana


RODRIGO UPRIMNY YEPES

Queda muy claro a partir de la exposicin de Carlos Gaviria en este seminario que el Estado social y democrtico de derecho, consagrado en la Constitucin de 1991, posee mltiples dimensiones. Es decir, es al mismo tiempo un Estado de derecho liberal, un Estado democrtico, un Estado social, y a ello habra que agregar, que es tambin un Estado que no slo reconoce, ampara y protege el pluralismo jurdico y cultural sino que incluso promueve algunas formas de multiculturalismo'. Por ello, a pesar de que el derecho a la salud es, como bien lo deca el profesor Gaviria, esencialmente uno de aquellos derechos que desarrollan la clusula social del Estado, y que corresponden a lo que l llamaba el segundo paradigma de los derechos humanos, en virtod del cual el Estado debe ofrecer ciertas prestaciones a los ciudadanos para garantizar condiciones materiales mnimas para su digrdad, tambin es claro que el derecho a la salud se inserta en un Estado que es tambin liberal, democrtico, social y pluralista. Por ello el derecho a la salud no tiene nicamente una faceta prestacional, sino que presenta mltiples dimensiones y plantea diversos y difciles problemas constitocionales en distintos campos. Debido a esa complejidad del derecho a la salud, la primera parte de esta exposicin intenta hacer una presentacin general de algunas de las mult-

para un desarrollo ms sistemtco de estas dimensiones del tipo de Estado adoptado por la Carta de 1991, ver mi trabajo "Constitucin de 1991, Estado social y derechos humanos: promesas incumplidas, diagnsticos y perspecvas" en W.AA El debate a la Constitucin. Bogot, ILSA, Universidad Nacional, 2001.

315

La Salud PbUca Hoy

pies dimensiones constitocionales de este derecho. Sin embargo, como no es posible estudiar en detalle todos esos aspectos, las siguientes partes, que son el centro de este trabajo, presentan la jurisprudencia de la Corte Constitucional sobre el derecho a la salud en algunos pocos temas, que son polmicos pero tambin muy importantes, porque ilustran la concepcin de la Corte sobre el alcance y significado del derecho a la salud en un Estado social y democrtico de derecho. El ltimo punto busca hacer un balance de estos desarrollos jurisprudenciales de la Corte Constitucional, y en particular intenta ver en qu medida y hasta qu punto esa jurisprudencia ha sido o no positiva para el desarrollo democrtico de la sociedad colombiana. 1. La multidimensionalidad del derecho a la salud Una lectura de la Constitucin, de la jurisprudencia de la Corte Constitocional, de los tratados internacionales en materia de derechos humanos, y de la doctrina intemacional sobre derechos sociales, permite concluir que el derecho a la salud tiene diversas dimensiones y est asociado a mltiples problemas constitucionales. Por ejemplo, el Comit de Derechos Econmicos, Sociales y Culturales de las Naciones Unidas, que es el intrprete autorizado del Pacto Internacional de Derechos Econmicos, Sociales y Culturales, ha realizado una veintena de ''observaciones generales" sobre el alcance del Pacto y de los distintos derechos, que representa en cierta medida una jurisprudencia intemacional en materia de derechos sociales. En su 22 perodo de sesiones de 2000, el Comit aprob la llamada "Observacin general No. 14, relativa al artculo 12, sobre el derecho a la salud\ la cual, en sus prrafos 8 a 11, resalta esa multidimensionalidad del derecho a la salud, que para el Comit es inclusivo y entraa desde el derecho al propio cuerpo, que incluye la libertad sexual y eugensica, hasta el derecho a una atencin mdica y asistencial adecuada y oportuna. Conviene pues comenzar por tener un panorama de esas distintas facetas del derecho a la salud. En ese contexto, y sin que mi enunciacin pretenda ser exhaustiva, sino simplemente ejemplificativa, creo que al menos podramos sealar siete distintas dimensiones constitucionales del derecho a la salud. Un primer aspecto es la proteccin del cuerpo y la salud de la persona contra injerencias ajenas. En este caso, el derecho a la salud prcticamente se confunde con el derecho a la integridad fsica y psquica pues implica una inmunidad frente a ataques de otras personas o del propio Estado, y su alcance puede formularse de la manera siguiente: ''nadie puede atentar con-

316

El derecho a la salud en la jurisprudencia constitucional colombiana

tra la salud de otro". Esta proteccin opera entonces en aquellos eventos en los que un juez constitucional u ordinario tiene que pronunciarse sobre ataques que una persona realiza contra la integridad fsica o psquica de otra, y se presenta, por ejemplo, en casos de maltrato fsico o psicolgico a menores' , a disminuidos fsicos', entre cnyuges^, o compaeros permanentes'. Un segimdo componente del derecho a la salud aparece cuando ste se conecta con problemas de salud colectiva. Es decir, no estamos frente a una problemtica individual de acceso a servicios sanitarios, o de proteccin de la salud personal contra un ataque de un tercero, sino que se trata de problemas de la colectividad, o de salubridad pblica, que pueden afectar gravemente la vida e integridad de las personas, como seran por ejemplo asuntos de recoleccin de aguas negras, tratamiento de aguas residuales, suministro de agua potable, recoleccin de basuras, contaminacin ambiental o auditiva, etc. Y en este campo, si bien la regla general es que la proteccin de los derechos colectivos y del ambiente debe promoverse a travs de las acciones populares, la Corte Constitucional ha admitido que de manera excepcional puede ejercerse la accin de tutela para proteger derechos colectivos y del ambiente, en aquellas situaciones en que la vulneracin de estos ltimos viole o ponga en peligro derechos humanos fundamentales, como la vida o la salud individual^. Un tercer tema tiene que ver con las tensiones que pueden surgir enfre los deberes estatales de proteccin a la salud y el reconocimiento de la autonoma individual, que en este campo implica lo que podra llamarse un derecho de la persona sobre su propio cuerpo. El problema surge cuando la pretensin estatal, o de la comunidad mdica, de proteger la salud entra en contradiccin con los deseos y voluntad de la propia persona, situacin que plantea interrogantes constitocionales supremamente complejos, como se ver posteriormente.
En sentencias de tutela como la T-116/95 y la T-181/95, la Corte Constitucional ha protegido la integridad personal del menor, quien por naturaleza se encuentra en situacin de debilidad e indefensin. En consecuencia, si bien los padres son libres en la forma de educar a sus hijos, no por ello tienen el derecho a di.sponer de su cuerpo para infligirles malos tratos, torturas, golpes o vejaciones, ni para privarlos de libertad, pues estn de por medio la dignidad y la integridad del menor, que son objeto de prevalente amparo constitucional. Ver. CORTE CONSTITUCIONAL. Sentencia T-012 de 1996. M.P Eduardo Cifuentes Muoz. Ver. CORTE CONSTITUCIONAL, Sentencia T - 557 de 1995. M.P, Hernando Hen^ra Vergara. CORTE CONSTITUCIONAL, Sentencias T - 382/94, T-487/94, T-522/94, T-098/95, T-181/95 y T- 436/95. Cfr. CORTE CONSTITUCIONAL, Sentencia T-1451 de 2000, M.P Eduardo Cifuentes Muoz.

317

La Salud PbUca Hoy

Muy vinculado al anterior aspecto, pero sin confundirse con l, tenemos los problemas asociados a los derechos de los usuarios del sistema de la salud en el propio acto mdico, es decir, los derechos del paciente frente al personal saitario. Esta relacin suscita tambin interrogantes complejos, como el siguiente:hasta dnde llega el deber de reserva del mdico en materia de datos clnicos?. As, si un paciente confiesa a su psiquiatra que va a cometer un asesinato al da siguiente, puede o no ese mdico divulgar esa informacin para evitar el homicidio, o est obligado a mantener la reserva mdica?^ Tambin podemos englobar en este aspecto el derecho del paciente a aceptar o no un tratamiento mdico*. Esta necesidad del llamado "consentimiento informado" ha generado tambin agudas discusiones en el campo jurdico y biotico, como las siguientes: hasta qu punto puede el mdico tomar determinaciones por su paciente? O por el contrario, el paciente tiene plena autonoma para tomar esas determinaciones, incluso si stas son contrarias a su salud? Pueden o no los menores de edad prestar este consentimiento, o corresponde esa decisin a sus padres y representantes? Una quinta dimensin del derecho a la salud surge cuando uno articula ese derecho al principio democrtico y participativo, pues imphca que los usuarios y la comunidad deben tener la posibilidad de participar en la formulacin, gestin y control de las pohticas de salud. Pero, hasta dnde llega ese derecho? Y en particular, a quien corresponde tomar las difciles decisiones acerca de cmo utihzar los recursos destinados a los programas de salud? El reconocimiento constitocional del pluralismo y de algunas formas de multicultaralidad^ plantea la discusin de si hay una salud, o por el confrario existen muchas saludes. Y en esta medida, como cortesponde al Estado regular las profesiones para controlar riesgos sociales, surge el siguiente problema: puede o no el Estado prohibir que, fuera de los mdicos que tienen ttolo profesional, puedan ejercer la profesin mdica otras personas como sera el caso de los chamanes en comuidades indgenas, con formas

Este punto fue abordado por la Corte Constitucional en sentencia C-264 de 1996, M.P. Eduardo Cifuentes Muoz, en la cual se determinan el alcance y los lmites del secreto profesional mdico. CORTE CONSTrrUCIONAL, Sentencia T-401 de 1994, M.P Eduardo Cifuentes Muoz. En este punto, asimilo sociedad multicultural y pluralismo, pero es obvio que muchos autores, como Sartori, se oponen, con buenas razones, a esa asimilacin. Ver su libro La sociedad multimca. Pluralismo, multiculturalismo y extranjeros. Madrid, Taurus, 2001, p. 61 y ss.

318

El derecho a la salud en la jurisprudencia constitucional colombiana

tradicionales de tratamiento de enfermedades? Este intertogante suscita diversos conflictos relacionadas con la concepcin del derecho a la salud, el pluralismo y la diversidad tnica y cultural'". Y una ltima perspectiva, es aqueUa que tiene que ver con el acceso a los servicios sanitarios, es decir el derecho a recibir atencin, tratamiento mdico y suministro de medicamentos en caso de enfermedad. La pretensin de esta breve presentacin era simplemente ejemplificar la complejidad de temas y discusiones constitocionales que se suscitan en torno al derecho a la salud, y mostrar como ste no se agota en el derecho a obtener un determinado tratamiento mdico, por ms de que este ltimo aspecto sea el que generalmente las personas llaman "derecho a la salud" y sea tambin el que mayores decisiones de totela ha provocado. Ahora bien, la inmensa variedad de conflictos en tomo al contenido, proteccin y satisfaccin del derecho a la salud ha sido objeto de examen y pronunciamientos por parte de la Corte Constitocional colombiana. No es pues posible en este breve espacio hacer una sntesis de la jurisprudencia constitocional en todos los temas relativos a la salud: el tiempo sera insuficiente y el ejercicio no resultan'a interesante pues no sera posible profimdizar en las discusiones que esta jurispmdencia genera. Me pareci entonces que podra ser ms sugestivo centrarse en algunos pocas decisiones, que han sido bastante polncas, pero que no slo son suficientes para mostrar la orientacin central de la jurispmdencia de la Corte Constitocional sino que adems tienen un inters intrt'nseco ya que, para bien o para mal, son novedosas en trnnos de derecho constitucional comparado, pues algunas de eUas no cuentan con precedentes a nivel inter-

La Corte Constitucional, al determinar que las disposiciones legislativas especiales, dirigidas a comunidades indgenas no eran en s mismas inconstitucionales, expres que "estas normas, en tanto que implican una distincin, deben basarse en razones suficientes que expliquen la diferencia de trato. En materia de salud, existen elementos cultiuiies (como la concepcin de la enfermedad y su tratamiento) y socioeconmicos (como la existencia de una economa colectiva por oposicin al mercado), que de no considerarse en su justa dimensin, hacen ms difcil el acceso y disfrute efectivo de los beneficios del sistema de seguridad social en salud. En tales condiciones, resulta justificado que, en trminos generales, se establezca un rgimen especial de seguridad social en salud para tales comunidades". Corte Constitucional C-088 de 2001, M.P. Martha Victoria Schica, Objeciones presidenciales al proyecto de Ley 67/99 Senado - 193/99 Cmara, "mediante el cual se reglamenta la participacin de los pueblos indgenas en el sistema general de seguridad social en salud".

319

La Salud PbUca Hoy

nacional. As, por ejemplo, la Corte despenaUz el consumo de drogas y la eutanasia, estableci estndares estrictos y nicos a nivel mundial para los casos de hermafroditismo, y desarroll una doctrina especial sobre el acceso a los servicios de salud, que la ha llevado a modificar el alcance de los planes gubemamentales de salud. Esas decisiones novedosas pueden ser englobadas en dos temas complejos y polmicos, que procedo a analizar en los siguientes apartes de esta presentacin: de un lado, la relacin autonoma - patemalismo en materia de salud, y de otro lado, el problema del acceso iguahtario a los servicios mdicos y asistenciales. 2. La dimensin liberal del derecho a la salud y la tensin autonomapaternalismo en la jurisprudencia de la Corte Constitucional La relacin entre la autonoma de la persona y los deberes de proteccin de la salud en cabeza del Estado y de la comunidad mdica se conecta muy directamente con un tema muy general de la biotica: la tensin entre el principio de beneficencia y el principio de autonoma. La biotica" ensea que los mdicos deben orientar su prctica por el Uamado principio de beneficiencia, en su doble dimensin: es deber de estos profesionales contribuir positivamente al bienestar del paciente (principio de benevolencia), o al menos abstenerse de causarle cualquier dao fsico o squico (principio de no maleficiencia o primun non nocere), principios que encuentran sustento en las normas intemadonales de derechos humanos y en el deber constitucional del Estado y de los profesionales de la salud de cuidar la vida y la mtegridad de las personas (CP art. 49). Sin embargo, al lado del principio de beneficencia, la biotica reconoce tambin el derecho de autonoma en las relaciones mdico-paciente, es decir que este ltimo, contrariamente a lo que sugerira semnticamente la palabra, no debe soportar pacientemente todo lo que los mdicos le hagan, sino que ms que un paciente, es una persona con derechos, dignidad y autonoma. En consecuencia, tiene el

Sobre la aplicacin de los principios de la biotica al campo mdico, pueden consultarse, entre muchos otros, y con obvias diferencias de enfoque: R.S Downie, K.C Calman. Healthy rsped. Ethics in health care. Oxford: Oxford University Press, 1994, captulos 3 y 4. H Tristam Engelhardt. Los fundamentos de la biotica. Barcelona: Paids, 1995, captulos 4 y 8. Tom.L Beauchamp, James.F Childress. Principies ofbiomedical ethics. New York : Oxford University Press. 1989.

320

El derecho a la salud en la jurisprudencia constitucional colombiana

derecho a decidir sobre su cuerpo, a definir el tratanento que desea, y el profesional de la salud no puede imponerle un procedimiento o medicina cualquiera, sin que medie su consentimiento libre e informado. En determinadas ocasiones, puede presentarse un fuerte conflicto entre el deber del Estado y la comunidad mdica de lograr el nivel ms alto de salud de las personas'^ y la proteccin constitocional a la autonoma y libertad de las mismas. Eso puede suceder, por ejemplo, cuando un mdico considera que el paciente ha tomado una decisin que es equivocada para su salud, pues surge el interrogante: debe el mdico aceptar la determinacin de la persona, aunque sta vaya contra su bienestar? O debe el mdico actoar de la manera que sea ms favorable a la salud de la persona, aunque desconozca la voluntad del paciente? O, por dechlo de otra manera, deben las polticas pbhcas en materia de salud orientarse por criterios patemahstas o autonncos? La jurispmdencia de la Corte Constitucional ha resuelto esta tensin en favor de la autonoma personal pues ha considerado que "en una sociedad fundada en el pluralismo y la dignidad humana, el principio de permiso o de autonoma tiene una prevalencia prima facie sobre los otros principios concurrentes'^". Dos tipos de argumentos sustentan esa prevalencia del principio de autonoma: de un lado, la Corte ha considerado que si la Constitucin reconoce que las personas estn dotadas de dignidad y son agentes morales libres y autnomos, entonces es obvio que es a ellas a quienes corresponde definir cmo entienden el cuidado de su salud, y por ende, los tratamientos mdicos deben contar con su autorizacin. La Corte ha dicho, de manera reiterada, que "del principio general de libertad emana el derecho especfico de la autonoma del paciente que le permite tomar decisiones relativas a su salud '"*". De otro lado, segn la Corte, el inevitable pluralismo tico de las sociedades contemporneas tambin justifica la prevalencia del principio de autonoma, pues implica que existen formas diversas, pero igualmente aceptables de entender y valorar la bondad de un tratamiento mdico, y por ello, la omisin del permiso del paciente implicara

El artculo 12.1 del Pacto Internacional de Derechos Econmicos, Sociales y Culturales PIDESC, establece: "Los estados partes en el presente Pacto reconocen el derecho de toda persona al disfrute del ms alto nivel posible de salud fsica y mental". Sentencia SU-337 de 1999, fundamento 10. Sentencia T-401 de 1994, fundamento No 3.1. En el mismo sentido, ver sentencias T-477 de 1995 y SU-337 de 1999.

321

La Salud Pblica Hoy

"que la concepcin de bienestar y salud del mdico se imponga a aquella del paciente, en detrimento de los propios intereses de este ltimo y de la proteccin constitucional al pluralismo "". Para ilustrar mejor la anterior doctrina constitocional, presentar en forma sinttica tres tipos de sentencias que abordan la relacin patemalismo-autonoma en materia de salud y que dan cuenta de la postora de la Corte Cons.titocional. % J >. 2.1 Sobre el consumo de la dosis personal'* " '

En el tema del consumo de la dosis personal de drogas, la cuestin que se plante es si el Estado poda o no imponer a una persona obligaciones de abstenerse de determinada conducta, an cuando ese comportamiento no daa a otros y eventualmente solo perjudica a la misma persona. La Corte estableci que el legislador no puede establecer limitaciones que no estn en armona con el espirito de la Constitocin, el cual se erige sobre la proteccin de la autonoma y la dignidad humanas. Por consiguiente, si la persona se reconoce como titular de esa autonoma, la misma no puede ser hmitada sino en la medida en que entra en conflicto con la autonoma de los otros. Lo contrario, segn la Corte, sera reducir la condicin tica de la persona y su esfera de decisin sobre el sentido de su existencia. Consider la Corte que una medida patemalista de este tipo imphca que el Estado se abroga la autoridad para decirle al individuo: "Oiga seor, oiga seora, usted es como un menor de edad, usted no sabe muy bien lo que quiere. Yo Estado, s que usted lo que quiere es proteger su salud, luego lo penalizo porque usted est haciendo algo en contra de ella". Para la Corte esta regla es claramente inconstitucional, porque invade esferas de la vida individual vedadas a la intervencin de otros. La persona puede disear sus propios planes de vida, sus modelos de reahzacin personal, y si en esos modelos, incluye el consumo de drogas, nada puede hacer el Estado

Sentencia SU-337 de 199, fundamento 11. CORTE CONSTITUCIONAL. Sentencia C-221 de 1994. M.P Carlos Gaviria Daz.

322

El derecho a la salud en la jurisprudencia constitucional colombiana

para impedrselo. Entonces, la Corte opone a una visin patemalista de la salud, la defensa de una visin autonmica. El deber de beneficencia y de proteccin del Estado no pueden pasar por encima de la autonoma de las personas. 2.2 El derecho a morir en forma digna'^ Un segundo ejemplo sobre el mismo punto es la sentencia sobre eutanasia. En el fondo el tema es exactamente el mismo. Qu sucede si una persona que padece una enfermedad tenrnal, que le genera sufrimientos muy intensos, ya no quiere vivir? El deber de proteccin del Estado de la salud y el principio de beneficencia que gobiema la actividad mdica implicaran que los mdicos deben hacer todo tipo de actuaciones, para prolongar la vida de las personas ms all de lo que la persona desea. Por el contrario, si reconocemos la autonorm'a de la persona y aceptamos que el derecho a una vida digna imphca tambin el derecho a una muerte digna, entonces debemos concluir que esa persona que ha decidido poner fin a sus sufrimientos, puede reclamar, solicitar y obtener del personal mdico, la asistencia en una muerte digna. En aqueUa ocasin, la Corte expres en lo fundamental que el ordenanento constitocional colombiano se basa en la consideracin de la persona como sujeto moral capaz de autodeterminarse y asumir en forma responsable y autnoma las decisiones sobre los asuntos que a ella le incumben. Por consiguiente, si la manera como los individuos asumen la muerte refleja sus propias convicciones, no pueden ser forzados a continuar viviendo cuando deciden conscientemente que las chcunstancias en que se encuentran, no resultan compatibles con su propia digidad. Entonces, la persona tiene derecho a ima muerte digna y no puede sancionarse al profesional de la salud que practique una eutanasia, cuando el paciente libre y suficientemente informado, sohcita ayuda y manifiesta que desea morir dignamente'*.

Cfr. CORTE CONSTITUCIONAL. Sentencia C-239 de 1997, por medio de la cual se decide la demanda de inconstitucionalidad contra el artculo 326 del decreto 100 de 1980-Cdigo Penal-. M.P. Carlos Gaviria Daz. "Por eUo la Corte concluye que el sujeto activo debe de ser t u mdico, puesto que es el nico profesional capaz no slo de suministrar esa informacin al paciente sino, adems, de brindarle las condiciones para morir dignamente". Ibdem.

323

La Salud Pblica Hoy

Este es un segundo ejemplo de proteccin a la autonoma personal, que se opone a la visin paternahsta clsica, heredada en alguna medida de una ertnea comprensin del cristianismo, segn la cual, los usuarios de la medicina son pacientes que deben soportar todo lo que los mdicos le hagan, con tal de que estos le aseguren una mayor prolongacin de la vida. La Corte ha sealado, que esto no es as. En un Estado pluralista, fundamentado en el respeto por la dignidad humana no pude afirmarse el deber absoluto de vivir, con el argumento de que la mayora lo juzga un imperativo religioso o moral. Por ello la Corte ha sealado que si bien la Constitucin protege la vida como un derecho y un valor del ordenamiento, el Estado no puede pretender cumplir la obligacin de proteger la vida desconociendo la autonoma y la dignidad de las propias personas. 2.3 El consentimiento informado en la relacin mdico-paciente Es pues claro que la Corte Constitucional colombiana reconoce la autonoma como fundamento del orden constitucional. Esto nos Ueva a un tercer campo, muy ligado a los dos anteriores, que tiene que ver con la exigencia de consentimiento informado en la relacin mdico-paciente, que es en el fondo una proyeccin de la autonoma personal en la forma como el sujeto asume su salud. En esta materia, existen numerosos pronunciamientos, en los que el conflicto es el siguiente: tiene el paciente el derecho a decidir si acepta o no, determinada intervencin mdica? En tales eventos, la Corte ha asundo que los tratamientos que determina el profesional de la salud, deben contar con la autorizacin del paciente. Si los individuos son libres y agentes morales autnomos, es obvio que es a ellos a quienes corresponde definir cmo entienden el cuidado de su salud, y por ende, los tratamientos mdicos deben contar con su consentimiento". En este punto, los jueces constitucionales se enfrentan a dile-

Ver, entre ofras, las sentencias T-548 de 1992, T-493 de 1993, C-221 de 1994, T-401 de 1994, T-477 de 1995, T-559 de 1995, C-264 de 1996. T-474 de 1996 y C-239 de 1997.

324

El derecho a la scdud en la jurisprudencia constitucional colombicma

mas muy complejos materializados, por ejemplo, en las calidades que debe reunir ese consentimiento^", si otras personas estn autorizadas para prestarlo en nombre del paciente, las condiciones que debe reunir ese consentimiento sustituto, etc. Un ejemplo ilustrativo de la clase de problemas que suscita la relacin mdico paciente se encuentra en la sentencia T-401 de 1994-'. Es el caso de un seor que padeca problemas renales y su mdico decidi cambiar el tratamiento de dilisis peritoneal a hemodilisis. Para el paciente, el nuevo tratanento era ms riesgoso, le demandaba ms tiempo y dinero, por lo cual interpuso una accin de tutela para que se reevaluara el cambio de tratamiento, ya que a su juicio ste no obedeca a criterios cientficos, sino a las malas relaciones interpersonales entre mdico y paciente. La Corte plante el problema jurdico en los siguientes trminos: en caso de disputa entre el mdico y su paciente, debida al tipo de tratamiento que debe ser llevado a cabo, puede aqul decidir y prescribir el sistema que considere ms adecuado, an en aquellos casos en los cuales el enfermo no est de acuerdo con la decisin tomada? La Corte determin que una respuesta negativa a esa pregunta, sera una violacin, por parte del mdico, a los derechos de libertad y autonoma del paciente. Conforme a la doctrina constitocional, todo tratamiento debe hacerse con el consentimiento del enfermo, y ms an en aquellos casos de intervenciones extraordinarias, que inciden de manera determinante en el espacio autonnco del enfermo. En consecuencia, la Corte determin que el paciente

En relacin con las caractersticas del consentinento, la Corte Constitucional ha expresado: "No cualquier autorizacin del paciente es suficiente para legitimar una intervencin mdica: es necesario que el consentimiento del paciente rena ciertas caractersticas, y en especial que sea libre e inforrtuido. Esto significa, en primer trmino, que la persona debe lomar su determinacin sin coacciones ni engaos. Por ello, en segundo trmino, la decisin debe ser informada, esto es, debe fundarse en un conocimiento adecuado y suficiente de todos los datos que sean relevantes para que el enfermo pueda comprender los riesgos y beneficios de la intervencin teraputica, y valorar las posibilidades de las ms importantes altemativas de curacin, las cuales deben incluir la ausencia de cualquier tipo de tratamiento. Finalmente, el paciente que toma la decisin debe ser lo suficientemente autnomo para decidir si acepta o no el tratamiento especfico, esto es. debe tratarse de una persona que en la situacin concreta goce de las aptitudes mentales y emocionales para tomar una decisin que pueda ser considerada una expresin autntica de su identidad personal". Ver CORTE CONSTFITICIONAL, Sentencia SU - 339 de 1999, M.P Alejandro Martnez Caballero. CORTE CONSTITUCIONAl, T-401 de 1994, M.P Eduardo Ciftientes Muoz.

325

La Salud Pblica Hoy

tena el derecho a elegir el tratamiento que ms se ajustara a sus condiciones. Y es que en un Estado fundado en la dignidad y en la autonoma de las personas, ni las autoridades ni la comunidad mdica pueden forzar a las personas a recibir tratamientos mdicos, ni pueden hacer que los reciban sin informarles adecuadamente sobre los riesgos de los mismos, sobre posibilidades altemativas, sobre las posibilidades de no-tratanento, para que la persona con esa informacin, decida si autoriza o no la intervencin^^. Esto plantea problemas muy complejos en el caso de menores. Referido a adultos conscientes, el tema es relativamente pacfico a nivel de la biotica y del derecho. Es decir, queda claro que un adulto tiene derecho a aceptar o rechazar un tratamiento y los mdicos tienen el correlativo deber de informarle todos los riesgos y todas las virtudes del tratanento para que l tome la decisin. Pero en el caso de los menores, quienes deberan decidir, seran sus representantes legales, o sea sus padres. Sin embargo, la Corte ha precisado esa posibilidad de consentimiento sustitoto no imphca "que los padres puedan tomar, a nombre de su hijo, cualquier decisin mdica relativa al menor, por cuanto el nio no es propiedad de nadie sino que l ya es una libertady una autonoma en desarrollo, que tiene entonces proteccin constitucional^^". , . . ,. . El interrogante que surge es entonces en qu eventos pueden los padres decidir por sus hijos y en qu casos dicha decisin no es posible. La Corte, en varias ocasiones^*, ha sealado que no es posible formular una regla simple aplicable a todas las situaciones, por lo que cada caso debe analizarse en concreto a la luz de varios criterios (i) la urgencia e importancia misma del tratamiento para los intereses del menor, (ii) los riesgos y la intensidad del impacto del tratamiento sobre la autonoma actual y futora del nio y (iii) la edad del paciente, lo anterior, con el fin de amparar la libertad y la autonoma en desarrollo del menor. Con esos elementos, la Corte ha indicado que existen situaciones en donde es evidente que el consentimiento patemo es vlido, incluso contra la voluntad del menor, como podra ser la

Ver, entre otras, la sentencia T-401 de 1994. MP Eduardo Cifuentes Muoz. Fundamento Jurdico No 3.2; sentencia T-477 de 1995. MP Alejandro Martnez Caballero. Fundamento Jurdico No 11. CORTE CONSTITUaONAL. Sentencia SU -337 de 1999, M.P Alejandro Martnez Caballero Ver en especial la sentencia SU-339 de 1999, que desarrolla en extenso el tema. Tambin pueden verse las sentencias T-477 de 1995 y T-474 de 1996.

326

El derecho a la salud en la jurisprudencia constitucional colombiana

autorizacin de una vacuna en un nio de pocos aos, Pero incluso con esos criterios, como lo reconoce la propia Corte, la sitoacin es compleja, como lo muestra el siguiente ejemplo: supongamos que un menor decide rechazar un tratamiento mdico muy invasivo, pero que es necesario para la vida. La Corte tuvo que enfrentar un caso difcil de un menor de diecisis aos, a quien le fue diagnosticado cncer y se negaba a ser tratado con quinoterapia en razn a que este procedimiento involucra transfusiones de sangre, situacin prohibida por el culto rehgioso al que perteneca. Su padre, interpuso accin de tutela, esgrimiendo que se deba dar prevalencia al deber de proteccin de la vida, frente a la autonoma del menor, que era una autonoim'a imperfecta^'. El caso es complejo, y no les expondr la solucin por la que opt la Corte, para que tengan la curiosidad de leer la jurispmdencia y traten de resolverlo primero en su cabeza. Esta es una primera lnea de jurispmdencia en salud, referida a los casos ms relevantes en el tema de patemalismo y autonoma, en la cual se evidencia que si bien la Corte Constitocional defiende la clusula social del Estado social de derecho, intenta armonizarla con la clusula clsica del Estado hberal y del Estado de derecho. Luego el Estado Social no puede vlidamente, erigirse en un Estado patemalista que tenga la facultad de imponer a las personas modelos de virtod, de visiones de mundo, o intervenir en las esferas de decisin personal que protege el Estado de derecho, so pretexto de satisfacer la salud. 3. La dimensin social y prestacional del derecho a la salud: el derecho de acceso a servicios mdicos y asistenciales Procede a continuacin a examinar una segunda lnea de jurispmdencia en salud y que tiene que ver con el acceso a los servicios sanitarios, esto es, el derecho a obtener detemrnadas prestaciones mdicas en caso de enfermedad y a recuperar hasta donde sea cientficamente posible la salud personal. Es lo que suele Uamarse, la dimensin prestacional del derecho a la salud. Ahora bien, cmo ha enfrentado la Corte Constitucional este tema? Inicialmente, los jueces de tutela y en especial el Consejo de Estado, asumieron una tesis restrictiva de los derechos fundamentales, excluyendo de la proteccin por va de totela los llamados derechos econmicos, sociales y

"

CORTE CONSTITUCIONAL. Sentencia T-474/96M.R Fabio Morn Daz.

327

La Salud PbUca Hoy

cultorales, enfre los que se encuenfra el derecho a la salud como derecho a acceder a prestaciones sanitarias. Lo anterior, con fundamento en una interpretacin segn la cual los derechos fundamentales son solamente aqueUos expresamente consagrados como tales en el captolo 1 del Ttolo II de la Constitocin, y en consecuencia, los derechos sociales y colectivos consagrados constitucionalmente, que se encuentran en otro captulo, no revisten aplicabilidad inmediata, sino que tienen el carcter de normas programticas, cuya efectividad depende del respectivo desartollo legislativo. Por consiguiente, nentras no sea desarrollado legislativamente, el derecho al acceso a prestaciones mdicas no sena exigible judicialmente. Desde sus primeras sentencias y de manera relativamente uniforme en estos diez aos, la Corte se ha distanciado de esa visin, expresando que si bien corresponde primariamente al legislador y a los rganos polticos, la definicin de las polticas pblicas en materia de salud y seguridad social, en aquellos casos en que la no prestacin de un servicio sanitario afecta un derecho de los que la Constitocin denomina fundamentales, procede la proteccin constitocional del derecho a la salud en conexidad -o por contagio como diran los mdicos- con el derecho a la vida, la integridad personal, la igualdad u otro derecho fundamental que resultare afectado^*. Otra de las situaciones en las que se ha aceptado la procedencia de la accin de totela para proteger el derecho a la salud, es el caso de los menores^^. Al

En la sentencia T-571 de 1992 la Corte Constitucional expres: "Los derechos fundamentales por conexidad son aquellos que no siendo denominados como tales en el texto constitucional, sin embargo, les es comunicada esta calificacin en virtud de la ntima e inescindible relacin con otros derechos fundamentales, de forma que si no fueron protegidos en forma inmediata los primeros se ocasionan'a la vulneracin o amenaza de los segundos. Es el caso de la salud, que no siendo en principio derecho fundamental, adquiere esta categora cuando la desatencin del enfermo amenaza con poner en peligro su derecho a la vida." M.P Jaime Sann Greiffenstein. Artculo 44 Constitucin Poltica. "Son derechos fundamentales de los nios: la vida, la integridad fsica, la salud y la seguridad social, la alimentacin equilibrada, su nombre y nacionalidad, tener tina familia y no ser separados de ella, el cuidado y el amor, la educacin y la cultura, la recreacin y la libre expresin de su opinin. (...) La familia, la sociedad y el Estado tienen la obligacin de asistir y proteger al nio para garantizar su desarrollo armnico e integral y el ejercicio pleno de sus derechos. Cualquier persona puede exigir de la autoridad competente su cumphmiento y la sancin de los infractores. Los derechos de los nios prevalecen sobre los derechos de los dems".

328

El derecho a la salud en la jurisprudencia constitucional colombiana

respecto la Corte Constitocional ha expresado que el derecho a la salud en el caso de los ros, en cuanto derivado necesario del derecho a la vida y para garantizar su dignidad, es un derecho fundamental prevalente y por tanto incondicional y de proteccin inmediata cuando se amenaza o vuhiera su ncleo esencial^*. Luego en aquellos casos en los que una entidad encargada de la prestacin del servicio de salud se niega a prestar la adecuada, eficiente y oportuna prestacin que un menor requiere, ste puede acudir a la accin de tutela cuando se den los presupuestos para ello, y sin que sea necesario acreditar que de la desatencin de su salud se derivaron riesgos graves para su vida, pues en el caso de los nios se trata de un derecho fundamental autnomo^'. Entonces, tenemos dos situaciones en las que el derecho a la salud es amparable por va de totela: el caso de los menores y, aplicando el criterio de conexidad, cuando se amenaza o vulnera un derecho que se considera fundamental. Retomando este criterio, a qu casos creen ustedes que se le podra aplicar? Imaginen la situacin de una persona que requiere un tratamiento mdico que de no suministrrsele pondra en peligro su vida, y que no se encuentra incluido en el Plan Obligatorio de Salud, POS, ejemplo clsico de ello, la dilisis. Para la Corte, la reglamentacin del Plan Obligatorio de Salud, establecido en la ley 100 de 1993 no puede desconocer derechos fundamentales de las personas. Esto ocurre cuando las empresas promotoras de salud EPS, aplicando de manera estricta dicha reglamentacin omiten el suministro de medicamentos y tratamientos necesarios para mantener la vida, la integridad personal o un mejor funcionamiento del organismo, con el argumento de que no se encuentran incluidos en el Plan Obligatorio de salud POS, casos en los que la Corte ha determinado que procede la proteccin por va de totela. Frente a situaciones similares, en el caso de negacin de medicamentos excluidos del POS, la jurispmdencia constitocional

La Corte ha considerado que el ncleo esencial del derecho a la salud de los nios, que lo hace amparable por va de mtela, exige (1) la existencia de un atentado grave contra la salud de los menores. (2) que la situacin que se reprocha no pueda evitarse o conjurarse por la persona afectada y, (3) que la ausencia de prestacin del servicio ponga en alto riesgo la vida, las capacidades fsicas o psquicas del nio o su proceso de aprendizaje o stKializacin. Ver, Corte Constitucional, Sentencia SU-225 de 1998, M.P Eduardo Cifuentes Muoz. Cfi-. CORTE CONSTITUCIONAL. Sentencia T-075/% M.P Carlos Gaviria Daz.

329

La Salud PbUca Hoy

ha sido enftica y reiterada, en el sentido de que procede la inaplicacin de la reglamentacin que excluye tales medicamentos, cuando se cumplan las siguientes condiciones: primera, que la exclusin amenace realmente los derechos constitocionales fundamentales del afiliado al sistema; segunda, que el medicamento no pueda ser sustituido por otro con la nsma efectividad y que sea previsto por el P.O.S.; tercera, que el paciente no pueda sufragar el costo del medicamento y cuarta, que la medicina haya sido prescrita por un mdico adscrito a la E.P.S. En tales eventos, con el fin de no alterar el equilibrio contractual de las EPS, la Corte ha admitido que stas pueden repetir contra la cuenta pertinente del Fondo de Sohdaridad y Garanta (FOSYGA). La Corte ha desarrollado, con algunas variaciones, una doctrina similar para las personas que hacen parte del rgimen subsidiado y reciben entonces los servicios de una ARS; igualmente, en determinados casos, en especial vinculados con personas que son portadoras del VIH, la Corte ha protegido incluso a personas que no hacen parte del rgimen subsidiado l del contributivo, y se encuentran, entonces, tan slo vinculadas al sistema por subsidios a la oferta. Pero la Corte Constitocional ha avanzado mucho ms. Aphcando un criterio ms amplio ha amparado el derecho a la salud en circunstancias en las que la amenaza a la vida biolgica no es inminente. Son situaciones que ponen de presente otro de los valores inherentes al Estado social de derecho, cual es la nocin de dignidad humana. Para la Corte, el derecho a la vida no se entiende como el mero hecho biolgico de existir, sino que involucra la posibilidad de llevar una existencia compatible con la dignidad humana. Entonces, pueden existir ciertas prestaciones en materia de salud que si bien no son necesarias en trnnos de una amenaza de muerte, lo son para que una persona pueda Uevar una vida digna. Lo que se pretende entonces, es respetar la situacin "existencial de la vida humana en condiciones de plena dignidad', ya que "al hombre no se le debe una vida cualquiera, sino una vida saludable^"." Un ejemplo sera un reemplazo de cadera. Una persona que tiene problemas para caminar por falta de esa operacin seguramente no se morir a causa de ello, pero en cierta medida se

"

Sentencia T-494 de 1993.

330

Et derecho a la salud en la jurisprudencia constitucional colombiana

puede morir de tristeza, y si esto ocurte, su vida ya no ser una vida digna, y su desarrollo como persona estar limitado. La Corte ha expresado que en esos casos, tambin procede la accin de tutela por conexidad, para proteger la dignidad humana de la persona, su integridad fsica y squica y su vida en condiciones dignas. A travs de esta jurispmdencia los jueces constitocionales y la Corte han desartoUado una doctrina muy rica y variada en materia de acceso a servicios sanitarios,ftindamentadaen una visin amplia del derecho a la salud, que ha llevado a una expansin de su mbito de proteccin constitucional". 4. Balance y conclusiones Las dos lneas jurispmdenciales que he presentado muestran que la Corte ha querido, en materia de salud, proteger tanto la autonorm'a de las personas como su derecho a acceder a ciertas prestaciones mdicas. Ahora bien, ambas lneas jurispmdenciales han recibido tanto apoyos como ataques. As, algunos consideran que la Corte es uno de los pocos rganos del Estado que ha tomado en serio la Constitucin de 1991 y por ello ha intentado que los derechos constitucionales no existan slo en el papel sino tambin en la realidad efectiva. Pero las crticas han sido tambin muy severas. As algunos califican las sentencias que han defendido la autonoma como inmorales, pues consideran que la Corte ha legitimado comportamientos lesivos de la vida, mientras que otros crticos argumentan que la jurispmdencia sobre el acceso a las prestaciones mdicas es populista y ha ocasionado graves desequilibrios financieros al sistema de seguridad social. Conviene, pues, abordar brevemente ese debate e intentar una evaluacin de las potencialidades democrticas de la jurispmdencia constitocional sobre el derecho a la salud. Mi visin del asunto es la siguiente: comparto plenamente la jurispmdencia constitocional sobre autonoma, pues considero que en un Estado plurahsta.

"

Para la Corte Constitucional colombiana el derecho a la salud comprende la facultad que tiene todo ser humano de mantener tanto la normalidad orgnica como la funcional, tanto fsica como psquica y psicosomtica, de restablecerse cuando se presente una perturbacin de la estabilidad orgnica y funcional de la persona, lo cual implica a su vez una accin de conservacin y otra de restablecimiento por parte del poder pbhco como de la sociedad, la familia y del nsmo individuo. Ver, por ejemplo, las sentencias T-204 de 2000 y T-494 de 1993.

331

La Salud PbUca Hoy

fundado en la dignidad humana, corresponde a las propias personas definir sus modelos de excelencia personal. En eso consiste el respeto al pluralismo y al libre desartollo de la personalidad. Por ello creo que la Corte acert al despenahzar el consumo de drogas y la eutanasia, y al exigir el consentimiento informado en los tratamientos mdicos. Por el contrario, frente a la jurispmdencia sobre acceso a servicios mdicos, en caso de que se encuentren en conexidad con la proteccin de la vida digna, tengo sentimientos encontrados: comparto la orientacin humanista de la jurispmdencia de la Corte, pero creo que tiene debilidades importantes, que minan su potencial democrtico. En una aclaracin de voto que redact cuando me desempe como magistrado encargado de la Corte exphqu con algn detalle mis reparos a la jurispmdencia actual^^. En lo que sigue, me baso esencialmente en esa aclaracin de voto. Las objeciones bsicas a esa jurispmdencia son esencialmente tres: de un lado, algunos cn'ticos argumentan que la concesin de tratamientos y medicamentos por va de tutela podra estar ocasionando efectos contraproducentes para la realizacin misma de los derechos sociales, y en particular del derecho a la salud, de aqueUas personas que no son beneficiadas por los fallos de los jueces constitocionales, en la medida en que las sentencias desequihbran el sistema de seguridad social en salud, al ordenar costosos tratamientos, que no fueron tenidos en cuenta por las autoridades polticas, que disearon los programas y obtovieron los recursos econmicos para desartoUarlos. De otro lado, y directamente ligado a lo anterior, algunos analistas objetan que esos tratamientos costosos para salvar unas pocas vidas drenan recursos, que podn'an ser utihzados ms eficientemente para ampliar la cobertura de la salud a los sectores ms pobres de la poblacin. De esa manera, segn esos crticos, la Corte estara produciendo decisiones inequitativas, pues beneficiaran a quienes ya hacen parte del sistema de seguridad social, en detrimento de quienes estn fuera de l, con lo cual las poblaciones ms vulnerables no se benefician sino que se perjudican con esta doctrina constitocional.

"

Ver sentencia T-1207 de 2001.

332

El derecho a la salud en a jurisprudencia constitucional colombiana

Finalmente, las sentencias de la Corte son cuestionadas por vaciar el debate democrtico sobre el alcance del derecho a la salud. Segn esta objecin, no es posible en una sociedad pobre, como la nuestra, que existan recursos suficientes para satisfacer todos los derechos sociales. Por ello, conforme a los tratados intemadonales sobre la materia, esos derechos slo pueden ser realizados progresivamente. Y mientras no pueda satisfacerse integralmente el contenido de todos los derechos sociales, la sociedad debe tomar decisiones trgicas, como reducir los recursos para enfermedades de alto costo a fin de amphar los programas de salud bsica. Y, concluyen estos analistas, como no existen criterios objetivos para determinar cul es el nivel ptimo y ms justo de reparto de los recursos para la realizacin de los distintos derechos, no corresponde a los jueces sino al proceso democrtico y a las autoridades electas tomar las decisiones sobre hasta qu punto satisfacer esos derechos. En general, la Corte ha respondido a esas objeciones con una defensa vigorosa de la clusula de inmunidad de los derechos fundamentales. Segn esa tesis, los derechos fundamentales son derechos subjetivos que la Constitocin reconoce, por su enorme importancia para amparar la dignidad de las personas y para proteger incluso el propio procedimiento democrtico. La Corte ha concluido entonces que la realizacin de esos derechos no puede estar sujeta a una negociacin poltica ni su satisfaccin puede depender de la disponibilidad de recursos. Y por ello, segn la Corte, la tarea del juez constitucional debe ser amparar esos derechos sin tomar en consideracin el eventoal impacto econmico de sus decisiones. Esta defensa de la Corte resulta, a primera vista, vlida, pues los derechos fundamentales son presupuestos de la dignidad y libertad de las personas, y precondiciones de la democracia, por lo cual, en principio, su realizacin no puede depender a su vez de las decisiones democrticas r de la disponibilidad de los recursos. Y por ello es cierto que en principio el razonamiento del juez constitucional debe ser deontolgico y no consecuencialista, esto es, el juez debe amparar los derechos de las personas, aphcando las normas constitocionales pertinentes, aunque tales decisiones tengan impactos financieros o polticos importantes. Sin embargo, en materia de derechos sociales prestacionales, como el acceso a servicios mdicos, o a vivienda o a la educacin, entre otros, esa tesis debe ser matizada, por la sencilla razn de que esos derechos, por ser

333

La Salud Pblica Hoy

prestacionales, imphcan erogaciones considerables. Es cierto que la realizacin de los derechos civiles y polticos tambin cuesta dinero a la sodedad, en la medida en que el Estado debe no slo respetar esos derechos sino tambin garantizar su goce, tal y como lo establecen los pactos sobre derechos humanos, conforme a los cuales deben ser interpretados los derechos constitocionales (CP art. 93). Pero de todos modos subsiste una diferencia decisiva entre la proteccin judicial de los derechos civiles y aquella de los derechos sociales, y es la siguiente: el contenido obligacional especfico de los derechos sociales es prestacional, e implica que el Estado debe suministrar un bien o servicio que la persona requiere para satisfacer sus necesidades bsicas. Y esos bienes pueden llegar a tener costos muy considerables, sobre todo en materia de salud. Ahora bien, como los recursos son limitados, no es posible pensar que hoy el Estado y la sociedad colombianos tengan la capacidad econmica de satisfacer en su integralidad todos esos derechos sociales. Los crticos aciertan entonces en sealar que el juez constitucional no puede ignorar las consecuencias financieras e institucionales de sus decisiones de amparar el derecho a la salud de una persona especfica, y extender el plan obligatorio de salud mas all de lo dispuesto por las autoridades polticas, por la sencilla razn de que esa sentencia supone un uso de recursos no proyectado, que se traducir en una hmitacin del derecho a la salud de otra persona. En tal contexto, la solucin de permitir que la EPS o la ARS repitan contra el Fosyga no soluciona el problema, por la sencilla razn de que los recursos de ese fondo no son infinitos, y su agotamiento implica una limitacin a la posibilidad de atender otras enfermedades catastrficas, o de extender la cobertura del rgimen subsidiado, que beneficia a los sectores ms pobres de la poblacin. ) ., .j Por todo lo anterior, aunque reconozco y comparto la vocacin humarsta de la jurispmdencia en salud de la Corte, es obvio que eUa tiene debihdades importantes, que minan su potencial democrtico. Y el principal defecto de la jurispmdencia de la Corte en la materia es la falta de anlisis del impacto de la proteccin de los derechos sociales sobre la realizacin de la igualdad. As, la concepcin de la salud como un derecho fundamental por conexidad ha llevado a la Corte a no tomar en consideracin la relacin que debe existir entre la proteccin de este derecho social y el respeto de la igualdad, tanto en su dimensin formal (igualdad de trato) como en su dimensin

334

El derecho a la salud en la jurisprudencia constitucioncd colombiana

sustantiva (igualdad material y efectiva). En efecto, la Corte ha considerado que siempre que una prestacin mdica sea necesaria para proteger la vida digna, entonces la persona puede obtener esa prestacin por medio de la tutela. Pero la Corte no se ha preguntado si esa prestacin mdica es o no universalizable, y si puede o no ser concedida a todas las personas que se encuentren en condiciones semejantes. Al no hacerse esa pregunta, la jurispmdencia de la Corte corre el riesgo de establecer una doctrina que, en nombre de la igualdad y de la realizacin de los derechos sociales, puede provocar profundas desigualdades, pues si la prestacin otorgada es tan costosa que no puede ser concedida por el sistema de salud a todos los que la requieren, entonces, la decisin judicial estara consagrando privilegios contrarios al principio de igualdad de trato, segn el cual, todas las personas que se encuentren en una misma sitoacin deben recibir un mismo tratamiento por las autoridades. De otro lado, incluso si la prestacin fuera universalizable, y su concesin por va de tutela fuera entonces compatible con la igualdad de trato, subsiste otro interrogante, y es el siguiente: hasta qu punto la adjudicacin de un tratamiento por fuera del POS afecta el principio de igualdad material, segn el cual el Estado debe esforzaise por lograr que la igualdad entre los colombianos sea real y efectiva? En efecto, incluso en eventos en que un medicamento por fuera del POS pueda ser concedido a todos los que lo requieren, sin embargo, su otorgamiento puede afectar la viabilidad financiera de otros programas de salud, que podran beneficiar a poblaciones ms vulnerables, que requieren una especial proteccin del Estado (CP art. 13). En tal caso, la concesin por tutela de esos medicamentos podra afectar el principio de igualdad material, que la Carta ordena a las autoridades realizar (CP art. 13). Creo entonces que una de las vas fecundas para desartoUar una jurispmdencia ms adecuada en materia de salud consiste en intentar una mayor articulacin entre la proteccin de esos derechos y el respeto de la igualdad. Esto es, la Corte debera no slo analizar si procede o no el amparo de un detemnado individuo en el caso concreto sino que tambin debera interrogarse sistemticamente sobre el impacto de esa decisin sobre la reahzacin de la igualdad en la sociedad colombiana. Y es que creo que en materia de derechos sociales, el juez slo puede tomar en serio los derechos sociales si tambin toma en serio la restriccin presupuestal y la limitacin de recursos que condicionan la realizacin de esos derechos.

335

La Salud Pblica Hoy

Esta mayor sensibilidad de la Corte hacia los efectos de sus decisiones en salud sobre la igualdad, que dicho sea de paso tiene expresiones interesantes en derecho comparado", le permitira enfrentar mejor muchas de las crticas que le han sido formuladas. . Una pregunta surge del anterior anlisis: cul es la doctrina constitucional concreta que surgira de una jurispmdencia sobre derechos sociales articulada en tomo al principio de igualdad? No tengo una respuesta totalmente clara sobre la materia, pero creo que dos aspectos deberan ser tomados en cuenta por la Corte en su desanoUo jurispmdencial en la materia. De un lado, los desarrollos de la doctrina intemacional sobre el tema, y de otro lado, la fuerza del principio democrtico en la materia. Ambos aspectos me parecen muy relevantes, como intentar mostrarlo a continuacin. As, el Comit de Derechos Econmicos, Sociales y Culturales de Naciones Unidas ha elaborado una doctrina sobre el derecho a la salud, que puede contribuir al desarrollo de la jurispmdencia constitocional en este campo. As, en su Observacin General No 14 relativa al disfrute del ms alto nivel de salud (art 12), el Comit destaca ciertos puntos que son importantes. De un lado, caracteriza a la salud como un derecho humano fundamental (Parr 1), que debe ser amparado a todas las personas, lo cual es un desarrollo de ese artculo 12 del pacto, que establece, entre otras cosas, que los estados deben crear condiciones que aseguren a todos asistencia mdica y servicios mdicos en caso de enfermedad. Luego el Cont establece ciertos elementos esenciales e interrelacionados que hacen parte del contenido de ese derecho a la salud, como la disponibilidad, accesibilidad,

Ver por ejemplo la notable jurisprudencia de la Corte Constitucional de Surfrica, que precisamente articula esas dos dimensiones. Adems, esta jurisprudencia puede ser ms interesante para el caso colombiano, que aquella de pases desarrollados como Alemania o Espaa. En efecto, tanto Sudfrica como Colombia son sociedades con altos niveles de pobreza y desigualdad, por lo que enfrentan dilemas constimcionales semejantes en materia de proteccin constitucional de los derechos sociales. Sobre la jurisprudencia en derechos sociales del tribunal surafricano, ver, entfe otros, Pierre de Vos. Some more equal than others? the right to equality and social and economic Rights in The South African Constitution. Budapest, mimeo, documento presentado a la Conferencia de Law and Society, 2001.

336

El derecho a la salud en la jurisprudencia constitucioruil colombicma

aceptabilidad y calidad de los bienes y servicios de salud. (Parr 12). Posteriormente el Comit desanoUa el alcance del principio de igualdad en salud, que supone no slo la prohibicin de discriminar en el acceso a esos servicios sino que adems las autoridades tienen el deber de favorecer especialmente a ciertas poblaciones (Parrs 18 a 27). Finalmente, en cuanto al alcance de la obhgacin estatal en la materia, el Comit reconoce que existen limitaciones de recursos que obstaculizan el pleno goce de este derecho, por lo cual, la obhgacin estatal es progresiva. Sin embargo, el Comit destaca que la progresividad no priva de contenido la obligadn estatal, al menos en los siguientes cuatro aspectos: (i) Existen medidas inmediatas que deben ser tomadas, como la prohibicin de la discriminacin en el acceso a los servicios de salud (Pan 30); (ii) en principio las medidas regresivas, que disminuyen una proteccin a la salud ya alcanzada, se presumen contrarias al Pacto, por lo cual el Estado tiene que demostrar que stas eran necesarias y que se han aplicado tras el examen exhaustivo de todas las altemativas posibles (Pan 32); (iii) el Estado tiene la obligacin concreta y constante de avanzar lo ms expedita y eficazmente posible hacia la plena realizacin de este derecho (Pan 31); y (iv) finalmente, existen unas obhgaciones bsicas en salud, que deben ser satisfechas en todo caso, sin importar los recursos de que dispone un Estado, como son el acceso no discriminatorio a los servicios de salud (Pan 43), y unas prioridades, que deben ser respetadas, como la inmunizacin contra las principales enfermedades infecciosas y la adopcin de medidas para combatir las enfermedades epidmicas y endmicas (Pan 44) Ntese que en todo este comentario, el Comit parte del supuesto de que el derecho a la salud es en s mismo fundamental, y que debe entonces ser satisfecho a todas las personas. Igualmente el Comit considera que ese derecho implica ciertas obligaciones directas y actuales para el Estado, pero que no puede exigirse la satisfaccin integral de todo el derecho en forma inmediata. El Comit confiere tambin una especial fuerza al principio de igualdad en la realizacin de ese derecho. Y, finalmente, el Comit no toma en consideracin el derecho a la vida como elemento para definir cules prestaciones deben ser obligatoriamente satisfechas por el Estado. La anterior visin doctrinal del Cont es entonces muy sensible al tema de la igualdad material y a la restriccin de recursos para satisfacer el derecho a la salud. Su consecuencia parecera ser que la mejor doctrina constitucio-

337

La Salud PbUca Hoy

nal en la materia no es la de considerar la salud como un derecho fundamental por conexidad sino como un derecho fundamental en s mismo, pero con un conterdo directamente amparable ms reducido que aquel que ha defendido la jurispmdencia constitucional colombiana. Esto es, conforme a la doctrina del Cont, el Estado tiene el deber de asegurar a todas las personas, y en especial a aquellas que se encuentran en situaciones de vulnerabiUdad (nios, ancianos, etc), unos servicios de salud bsicos. Pero, segn esa visin, la concesin de otras prestaciones es de desarrollo progresivo y depender de la disponibilidad de recursos. Por consiguiente, conforme a esta doctrina, no violara el derecho a la salud que el Estado no sunnistrara un tratamiento de alto costo, incluso si ste es necesario para preservar la vida de la persona, si ese servicio no ha sido incorporado al contenido progresivo del derecho a la salud. . . .. Una comparacin de la doctrina del Comit y aquella desanoUada por la jurispmdencia colombiana muestra tal vez dos extremos de lo que podran ser las visiones progresistas del derecho a la salud. As, la perspectiva del Comit tiene la virtud de estar muy bien articulada con el tema de la igualdad, pero tal vez no es lo suficientemente sensible frente a la proteccin a la vida digna de los peticionarios individuales. Por el contrario, la jurispmdencia constitocional colombiana protege vigorosamente la vida digna de los peticionarios uidividuales, pero no es adecuada en trminos de igualdad. Una obvia pregunta surge: es acaso posible articular ambas concepciones, de tal manera que podamos constmir una doctrina constitocional sobre el derecho a la salud, que sea al mismo tiempo vigorosa en la proteccin de la vida digna y sensible a la igualdad y a la existencia de restricciones de recursos? ,, , ^ .. i Creo que una posibilidad para responder a ese intenogante es asumir la visin del derecho a la salud como un derecho en s mismo fundamental, y por ende directamente totelable, como se desprende de la doctrina del Comit, pero conservando, en ciertos aspectos, la visin de la jurispmdencia colombiana de la importancia de su conexidad con la vida digna, en casos concretos. La integracin enfre ambas concepciones podra operar as: en principio, el derecho a la salud debe ser asumido como fundamental, y el Estado tiene entonces el deber de ampararlo a toda la pobladn. Esto significa entonces

338

El derecho a la salud en la jurisprudencia constitucional colombiana

que, contrariamente a una visin implcita en la jurispmdencia constitocional colombiana, es necesario distinguir con claridad entre el derecho a la salud y la seguridad social. As, la seguridad social es una de las formas posibles (y tal vez la ms adecuada) para satisfacer el derecho a la salud, pero eso no significa que el deber estatal de amparar ese derecho se reduce al desanoUo de un sistema de seguridad social. Por consiguiente, el hecho de que, por diversas razones, la seguridad social no cubra a toda la poblacin, no excusa al Estado para no proteger el derecho a la salud de todos los colombianos. Habra entonces que asumir que el derecho a la salud sera en s mismo totelable. Sin embargo, por limitacin de recursos, el deber dhecto del Estado no es proveer inmediatamente todos los servicios de salud que requieren las personas sino que se hmita a dos componentes bsicos: de un lado, las autoridades deben prestar los servicios sealados por los am'culos 12 del Pacto de derechos econmicos, sociales y cultorales de Naciones Unidas y por el artculo 10 del Protocolo de San Salvador, que definen las obhgaciones bsicas y prioridades elementales en este campo. As, por ejemplo, dice al respecto el ordinal 2 del artculo 10 Protocolo de San Salvador; "2. Con el fin de hacer efectivo el derecho a la salud los estados partes se comprometen a reconocer la salud como un bien pblico y particularmente a adoptar las siguientes medidas para garantizar este derecho: a. la atencin primaria de la salud, entendiendo como tal la asistencia sanitaria esencial puesta al alcance de todos los individuos y familiares de la comunidad; b. la extensin de los beneficios de los servicios de salud a todos los individuos sujetos a la jurisdiccin del Estado; c. la total inmunizacin contra las principales enfermedades infecciosas; d. la prevencin y el tratamiento de las enfermedades endmicas, profesionales y de otra ndole; e. la educacin de la poblacin sobre la prevencin y tratamiento de los problemas de salud, y / la satisfaccin de las necesidades de salud de los grupos de ms alto riesgo y que por sus condiciones de pobreza sean ms vulnerables ". Estas prestaciones podran ser eventoalmente consideradas como el contenido esencial de este derecho. A partir de ese mnimo, el Estado tiene en-

339

La Salud PbUca Hoy

tonces la obligacin de desanoUar progresivamente la satisfaccin de ese derecho, por medio de planes de salud asegurados a toda la poblacin. La extensin de esos planes depender de la disponibUidad de recursos y del propio debate democrtico, pero una vez establecidos, por el carcter fundamental del derecho a la salud, esos componentes de desanoUo progresivo seran tambin tutelables, en caso de que existan omisiones o retardos injustificados por parte de las institociones prestadoras de esos servicios. La idea es entonces que la definicin del alcance de los servicios de salud que hacen parte del contenido de desanoUo progresivo del derecho conesponde a las autoridades polticas, de confomdad con un proceso democrtico de deliberacin social. Sin embargo, la libertad de las autoridades y de las mayoras en el diseo de esos planes tiene dos hmitaciones: de un lado, toda restriccin a un grado de proteccin ya alcanzado por la sociedad colombiana debe presumirse inconstitucional, pues sera regresiva en vez de progresiva; y, de otro lado, y es en este aspecto que la tradicin jurispmdencial colombiana muestra toda su riqueza, en principio todas las prestaciones necesarias para proteger la vida digna de las personas deben ser incorporadas en esos planes, y por ello debe presumirse que la omisin de una prestacin de esa naturaleza es inconstitucional. Sin embargo, y sa es una diferencia importante con la actual jurispmdencia de la Corte, esa presuncin es denotable. Esto significa que la funcin del juez constitucional no sera la de aadir al POS todas aquellos servicios y medicamentos que pueden ser necesarios para preservar la vida digna del peticionario, sin importar su costo, pues esa jurispmdencia es problemtica en trminos de igualdad. Pero tampoco la definicin del alcance del POS puede estar librada totalmente a la discrecin de las autoridades polticas, ya que una tal jurispmdencia desprotege el derecho a la vida digna de las personas. Por ello, la solucin podra ser que cada vez que se constate que se encuentra excluida del POS una prestacin mdica, que es necesaria para amparar la vida digna del peticionario, entonces el juez constitucional debe exigir de las autoridades polticas encargadas del diseo de esos planes, que justifiquen claramente esa exclusin. En tales circunstancias, si la justificacin es insuficiente, la presuncin de inconstitocionalidad operan'a y la totela debera entonces ser concedida. La anterior visin debe ser complementada con una referencia especial a la sitoacin de las poblaciones potencialmente discriminadas. En efecto, una

340

El derecho a la scdud en lajurispnulencia constitucional colombiana

de las justificaciones contemporneas ms poderosas del control constitocional es aquella que considera que los tribunales constitocionales son un mecanismo para proteger la imparcialidad del proceso democrtico, a fin de evitar que ste se convierta en una tirana de las mayoras sobre las minoras. Y es que la democracia, para que conserve aquellos elementos por los cuales es un rgimen digno de ser respetado y obedecido, no puede ser pensada como un gobiemo de las mayoras en beneficio de las mayoras; la democracia utiliza como criterio de decisin el principio mayoritario, por cuanto, en materias complejas y en organizaciones numerosas, es imposible alcanzar el consenso, que parece ser el nico criterio de justicia aceptable en nuestras sociedades pluralistas. El principio de mayora opera entonces como una especie de consenso imperfecto, y por eso parece el mecanismo ms adecuado y justo de decisin. Pero esto no significa que las mayoras que controlan el Parlamento puedan gozar exclusivamente de los beneficios de las polticas que all se decretan, mientras que descargan sus costos en aquellas minoras que no pueden acceder al poder, puesto que la idea del consenso, que es la que justifica el principio de mayora, implica que es justa aquella decisin que toma en consideracin, de manera imparcial, los intereses de todos los eventuales afectados por esa determinacin. La democracia es entonces un rgimen basado en el principio de mayora pero que debe procurar satisfacer iguaUtariamente los intereses de todos. Las mayoras tienen el derecho de optar por determinadas polticas, siempre y cuando esas esti^ategias tomen en consideracin, de manera imparcial, los intereses de todos los gobemados. Por ende, el juez constitocional debe proteger especialmente a aquellas minoras susceptibles de discriminacin por las mayoras sociales y polticas'''. Ahora bien, en el campo de la salud, el anterior anhsis imphca que ameritan una particular proteccin por el juez constitocional aquellas personas que, por ciertas condiciones sociales, o por las enfermedades que padecen, estn sujetas a discrinnaciones sociales. En aquellos casos, la exclusin de los planes de salud de los tratanentos y medicamentos que esas personas requieren para llevar una vida digna estara cubierta por una doble presuncin de inconstitocionalidad, por lo cual las autoridades tendran que expli-

Ver al respecto HART ELY, John. Democracy and distrust. A theory of judicial review. Cambridge : Harvard Uiversity Press, 1982.

341

La Salud PbUca Hoy

car convincentemente no slo por qu esos tratamientos no pueden ser concedidos, sino, adems, que la decisin de excluirlos del plan no obedeci a motivaciones discriminatorias. Por ello considero que la Corte ha tenido razn en proteger especialmente a los portadores de VIH y a los enfermos de SIDA. La concepcin que propugno estimula entonces un dilogo creativo entre el juez constitocional y las autoridades polticas en el desanoUo progresivo de los derechos sociales en particular, y del derecho a la salud en particular. As, cortesponde al proceso democrtico defur el alcance de esos programas, pero el juez constitocional, al exigir una especial justificacin de ciertas omisiones o regresiones en el diseo de esos planes, racionaliza la deliberacin social y poltica sobre el derecho a la salud. Esta doctrina incita entonces una cooperacin entre el legislador, la ciudadana y el juez constitocional, que vigoriza la democracia, al mismo tiempo que protege los derechos individuales, y por ello me parece deseable. Y es que el juez constitucional, al proteger los derechos fundamentales, debe evitar adoptar frmulas demasiado rgidas, salvo que el texto constitucional se las imponga inequvocamente, por cuanto estara cenando las posibilidades de que exista una deliberacin democrtica, que permita encontrar distintas opciones a un determinado problema. Por ello, como bien lo destaca Nio, los jueces, al ejercer el control constitucional, no deben descartar polticas que resulten del debate democrtico, nicamente porque consideran que existen otras mejores, pero en cambio pueden, y deben, adoptar medidas que promuevan el proceso de deliberacin pblica o la consideracin ms cuidadosa por parte de los cuerpos polticos^^. Los jueces deben entonces preferir las decisiones que hagan ms vigoroso el debate democrtico, y en cambio deben rechazar aquellas determinaciones que anebatan, sin razones convincentes, la resolucin de un problema a la decisin ciudadana, pues una de las funciones decisivas del control constitocional es contribuir a mejorar la calidad del proceso de discusin democrtica y toma de decisiones, estimulando el debate pblico y promoviendo decisiones ms reflexivas^.

"

NIO, Carlos Santiago. La constitucin de la democracia deliberativa. Barcelona : Gedisa. 1997, p 292. Ibdem, p. 293.

342

CAPTULO II

PANORAMA DE LA SALUD PBLICA EN COLOMBIA

La situacin de salud en Colombia


MARA ESPERANZA ECHEVERRI LPEZ

1. Anlisis de la mortalidad Las cifras muestran que en Colombia la tasa de mortalidad general ha disminuido, pasando de 4.40 muertes x 100.000 habitantes en 1995, a 4.2 en el 2001, para una poblacin estimada en este ltimo ao, de 43.035.391 habitantes (Minsalud. OPS-OMS (2001); pero la informacin presenta varias limitaciones: los estudios analticos por lo general utilizan datos de 1995, el subregistro estimado es cercano al 25%, y la certificacin institucional de la muerte disminuye con el estrato socio-econmico. Con estas salvedades, la informacin ms desagregada muestra un perfil de la mortalidad, en el cual se destacan las muertes violentas como el principal problema de salud pblica del pas, con incalculables efectos socioeconmicos en trminos de aos de vida potenciales perdidos por la poblacin joven, en especial, la masculina, y la mortalidad temprana por SIDA. Por otra parte, la distribucin socio-econmica de la muerte -al igual que la de enfermedad- aunque muestra la heterogeneidad y simultaneidad de "enfermedades del desanoUo y de la pobreza", refleja ms las inequidades del desanoUo socio-econmico que la transicin epidemiolgica. Es necesario llamar la atencin acerca de algunos indicadores muy sensibles a las variaciones del desanoUo socio-econmico como la mortalidad matema, e infantil, pues aunque las cifras muestren disminucin, la prdida de calidad de vida en los ltimos aos en el pas, pone en riesgo los avances logrados.

345

La Salud PbUca Hoy

1.1.

Las muertes violentas:

- Los homicidios: Se observa una tendencia al incremento en el volumen de muertes por causas violentas (homicidios, accidentes y suicidios), en las cuales los homicidios representan el mayor peso porcentoal: entre 1986-1996 prcticamente se duplic la tasa al pasar de 45.1 a 86.1 homicidios por 100.000 habitantes (IDNP-PNUD 1999: 25), y el promedio anual para la dcada fue de 25.000 muertes por esta causa (Franco 2000: 5). Para 1998 -segn las estadsticas del Ministerio de salud- la tasa de homicidios descendi a 60.1 x 100. 000. Un estudio realizado en el pas, para el perodo 1985-1995 muestra, respecto a los homicidios, que la poblacin ms afectada han sido los hombres jvenes, pero la informacin desagregada sugiere adems una preocupante generalizacin de la violencia por esta causa que se extiende a las mujeres y a los nios: el mayor riesgo es para los hombres de 15 a 29 aos, seguidos por los de 30-44 aos, y aunque ellos "aportan" un milln de aos de vida perdidos ms que las mujeres -pues mueren 10 veces ms por esta causa que eUas- tambin en las mujeres jvenes, de 15 a 29 aos, el mayor riesgo de muerte es por homicidios, con un leve descenso a partir de 1994. A una edad tan temprana como la de 5-14 aos, aparece la mortalidad por homicidios , para hombres y mujeres, entre los cinco primeros gmpos de causas (Gallardo y Rodrguez 1999: 40-41, 72). - Otras muertes violentas: Adems de los homicidios, las muertes violentas incluyen los accidentes de trnsito, los suicidios, otros accidentes, y la violencia indeterminada. Se observa una tendencia al aumento: para 1999 ascendieron, en cifras absolutas, a 36.947, (lvarez 2001: 120) y para el 2000 a 38000 (Sarmiento 2001: 26). Por otra parte, se ha encontrado una relacin mversa entre el estrato socio-econmico y la muerte violenta, aunque se asocia a la inequidad, ms que a la pobreza: en las zonas urbanas la mayora de las muertes por esta causa provienen de los estratos 1 y 2 (Mlaga y col. 2000: 195). Varios trabajos sealan la heterogeneidad y complejidad de la violencia en Colombia. Si bien, no hay relaciones unvocas, coinciden en varios factores -estmcturales o coyunturales- propiciadores o potenciadores: la inequidad en la distribucin de la riqueza y las injustas desigualdades para disfmtar

346

La situacin de salud en Colombia

las oportunidades sociales y el bienestar; la exclusin de la vida poltica para amplios sectores de la poblacin, el recmdecimiento del conflicto armado, la impunidad; y el narcotrfico en su doble dimensin de negocio egal y de despojo de la propiedad agraria. En esa va, los datos sealan que en los departamentos con mayores tasas de homicidio (Antioquia, Caquet; Guaviare, Casanare, Arauca, Risaralda, Valle) hay tambin fuerte presencia de actores armados, cultivos ilcitos y cormpcin (DNP-PNUD 1999: 25-29). El saldo en rojo para la salud y el desanoUo social es desolador: el estudio citado de Gallardo y Rodrguez, encontr que los aos de vida saludable perdidos' por homicidio, explican "la ganancia prcticamente nula en la esperanza de vida al nacer, entre 1985-1995". Para el 2001, segn el Ministerio de Salud, la diferencia en la esperanza de vida al nacer, entre hombres y mujeres es de 6 aos, en stas es de 75.3 aos, mienfras que en aquellos es de 69.2 aos. 1.2. Mortalidad y estratificacin socio-econmica:

Algunos trabajos han planteado que en Colombia se asiste a un proceso de transicin epidemiolgica, puesto que de las causas de enfermedad y muerte tpicas de la pobreza, -infecciosas, transmisibles e inmunoprevenibles- se transita hacia las del desanoUo-tumores, enfermedades cardio-cerebro- vasculares, y otras crnicas. (Yepes 1990). Sin embargo, las evidencias sugieren un perfil de morbilidad y mortalidad, bastante heterogneo en el cual persisten simultneamente las enfermedades de la pobreza y las del desarrollo, para todos los estratos sociales, pero en el que tambin transmisibles e infecciosas afectan ms, y con mayor letalidad, a los ms pobres, develando las desigualdades estructurales del desarrollo socio-econmico.

Un AVISA, es un ao de vida saludable perdido por morir prematuramente -antes de la edad de esperanza de vida al nacer- o por vivir con discapacidad, aunque lo ms frecuente es que combine ambos. Es la metodologa propuesta por el Banco Mundial para las evaluaciones de costo-efectividad porque permite calcular el costo por ao de vida recuperado o ganado.

347

L-La Salud PbUca Hoy

Un estodio de mortalidad, realizado por el DAE y la OPS, clasific los municipios Colombianos por estratos, de acuerdo al porcentaje de poblacin pobre por necesidades bsicas insatisfechas^ y encontr que, a menor estrato socio-econmico, mayor mortalidad por infecciosas y transmisibles:-ms del doble que en los estratos ms altos-; la toberculosis es responsable del 15.3% de las muertes en el estrato 1, y solo del 6.8% en el 6; la dianea, lo es del 21.7% de la mortahdad del estrato 1, contra 10.2% en le estrato 6; y la desnutricin del 13.5% en el estrato I, mientras que en el 6, es del 3.3%. La distribucin de la muerte por regiones y por estas causas mantiene ese perfil de desigualdad, se concentra en los departamentos ms pobres: Choc, Crdoba, Sucre, Bolvar, Magdalena, Nario, y los de la Orinoquia y la Amazonia. En cambio, para las "enfermedades del desarrollo " hay una asociacin directa entre el estrato socio-econmico y la mortalidad: los tomores explican el 7.1% de las muertes en los municipios de estrato 1, y el 14.6% de las de las localidades estrato 6; las cardio-cerebro-vasculares el 17.4% de las del estrato 1, contra 27.6% en el estrato 6. De esta tendencia, se excepta el cncer de tero, asociado a la pobreza, y que ocasiona el 12.4% de las muertes por tumores en el estrato 1, y slo 6.5% de las del 6. Pese a esa heterogeneidad, la caracterstica ms relevante de la mortalidad por estrato socio-econmico en Colombia es la inequidad. As, la muerte en los municipios y regiones ms pobres, se comporta como hace medio siglo. El estudio citado concluye: "el perfil de mortalidad en los estratos 1 y 2, se parece al que caracteriz a Colombia en los aos 40 50" (DANE-OPS, 2000, citado por Mlaga y col.: 195). 1.3. La mortalidad por cncer:

El anhsis de la mortahdad en el pas entre 1985-1995,reahzadopor Gallardo y Rodrguez muestra que el cncer desde edades tempranas (gmpo de 5-14 aos), para los dos sexos y para todos los gmpos etreos, est dentro de los cinco primeros subgmpos de causas de muerte, aunque ocupando distinto lugar.

Los municipios colombianos se estratificaron segn el grado de pobreza, medido por Necesidades Bsicas Insatisfechas NBI (este indicador evala, por hogar, las condiciones de la vivienda, acceso a servicios pblicos, hacinamiento, inasistencia escolar y alta dependencia econmica) Se expresa en un porcentaje de 0-100%, que va del menor al mayor grado de pobreza. Para 1995, en el estrato 1, se ubicaban los municipios con NBI entre 84%-100%; en el 2, los de 69%-83%; en el 3, los de 53%-68%; en el 4, los de 39%-52%; en el 5, los de 22%-38%; y en el es^to 6, los de 0%-21 %.

348

La situacin de salud en Colombia

En las mujeres desde los 30 a los 59 aos el cncer en general tiene mucho ms peso como causa de muerte que entie los hombres. Para estos sobresalen, en la edad adulta, el cncer de estmago y el broncopuhnonar, y despus de los 70 aos, el de prstata. No obstante esa distribucin relativamente homognea, el estodio del DANEOPS destaca la conelacin entre pobreza y mortahdad por cncer de tero, sumando ms argumentos acerca de la asociacin entre salud y cahdad de vida. 1.4. La mortalidad temprana por SIDA:

Aunque todava la infeccin por VIH-SIDA no es muy representativa en el conjunto de la mortahdad, es preocupante por la alta letalidad -especialmente en hombres jvenes de 30-44 aos-pues es la ci4arta causa de muerte por enfermedades transmisibles; as como por las tasas de incidencia -20.5 por lOO.KK) habitantes para 1998- que ubicaban a Colombia en el cuarto lugar en Amrica Latina, en el total de casos reportados y, finalmente, por el generalizado deterioro de los programas de prevencin y vigilancia epidemiolgica en el pas, en los ltimos aos. Dos indicadores en ese sentido son la reduccin en casi un 80% del gasto del Plan de Atencin Bsica en prevencin de enfermedades de transmisin sexual (Gonzlez 1999. Citado en: DNP-PNUD 1999: 96-98) y el hecho de que la informacin actoahzada sobre incidencia, se reporte como "incompleta" en las cifras oficiales. 1.5. La mortalidad materna e infantil:

En la literatora sobre salud pbhca y en los estndares intemadonales, estos son dos de los indicadores trazadores del desartollo socio-econnco de un pas. Ambos estn relacionados y son muy sensibles a los cambios en la calidad de vida. Aunque en Colombia, las cifras muestran que las dos tasas de mortalidad han disminuido permanentemente en los ltimos 20 aos, habra que considerar tambin el subregistro, la variabilidad de los datos, segn las distintas fuentes y dos elementos del desanoUo: las condiciones y la calidad de vida en los ltimos aos se han deteriorado -visible en las cifras, especialmente a partir de 1998-; y persisten grandes inequidades entre regiones y entre zona urbana y mral. La mortalidad matema pas de 89.8 por 100.000 nacidos vivos, en el perodo 1992 -1996, a 71 en 1998, pero 16 departamentos superan el promedio nacional, y las tasas ms altas estn en la Orinoquia (14lx 100.000

349

La Salud PbUca Hoy

n.v.), la regin oriental (110.5), y la pacfica (105.6) (DNP-PNUD 1999: 95; Minsalud 2001). Similares desigualdades se observan en la atencin institucional del parto por mdico, cuyo promedio nacional aument de 71% en 1990, a 83% en 1999, pero en las mujeres sin educacin apenas llega al 60%, y es inferior al 50% en el litoral Pacfico (ENSD 2000: Encuesta Nacional de Demografia y Salud: 117). La mortalidad infantil tambin ha descendido: de 35 x 1000 nacidos vivos en 1995, a 21, en el perodo 1995 -2000. La Encuesta Nacional de Demografa y Salud del 2000, cuantifica la disminucin en un 50% en los ltimos 25 aos. Tambin aqu hay grandes desigualdades: mientras en la Zona Urbana es de 21 x 1000 n.v. , en la rural es de 31, y en Guajira, Cesar y Magdalena de 36. Diversos trabajos destacan la fuerte asociacin directa enfre el nivel educativo de la madre y la mortahdad matema e infantil: el Informe de DesanoUo Humano en Colombia para 1999, lo conobora: para el perodo 19921996, los municipios con mortahdad infantil superior a 51 x 1000 n.v., tuvieron mortalidad matema de 133.4 x 100.000 n.v., y esta ltima, lleg a 150, en mujeres con menos de 5 aos de educacin. Adems de las desigualdades, el deterioro de la calidad de vida en Colombia en los ltimos aos podra representar en el corto plazo un retroceso en estos dos indicadores tan sensibles a la desigual distribucin de los beneficios del desarrollo: la pobreza por ingresos pas del 50.3% en 1997, a 61.5%en el 2000 (Sarmiento 2001: 29), una de las consecuencias de la crisis econmica ha sido la restriccin en el consumo famihar de ahmentos (FedesanoUo 1999: 539), y aunque el acceso y desempeo de las mujeres en el sistema educativo ha mejorado, padecen mayor desempleo estmctoral y son ms vulnerables a las crisis econmicas. Del lado de los servicios de salud, tampoco hay razones para ser optimista con esta disminucin de las tasas de mortalidad matema e infantil Desde hace dos dcadas no se ha modificado la tasa de fecundidad temprana; con el actoal sistema de salud se han generado nuevas desigualdades en el acceso a los servicios, las cuales se suman a las no resueltas de tiempo atrs; hay un subregistro importante en la mortalidad matema e infantil, en especial en zonas mrales y en regiones pobres; y una gran disminucin en las cobertoras de vacunacin y en las acciones de promocin y prevencin.

350

La situacin de salud en Colombia

2. Enfermedad, vulnerabilidad y condiciones de vida La relacin entre enfermedad, vulnerabilidad, o riesgo de enfermar, y condiciones de vida se aborda aqu, mostrando en primer lugar, un perfil de los principales problemas segn su peso para la carga de enfermedad; y en segundo lugar, las condiciones de vida de los grupos ms desfavorecidos, en su doble dimensin de expresin de las inequidades sociales y de elemento determinante de la vulnerabidad frente a la enfermedad. 2.1. Los problemas de salud segn la carga de enfermedad Para mostrar un panorama de la morbilidad, se tom como base la carga de enfermedad expresada en los aos vividos con discapacidad, para el pen'odo 1985-1995 (Gallardo y Rodrguez (1999): 60-70). De este anlisis se destaca: - La invisibilizacin de las diferencias de morbilidad por gnero: Aunque las causas y su peso proporcional varan por sexo -en especial por losriesgosde la edad reproductiva en las mujeres- el anhsis general muestra que no hay diferencias sustanciales en la carga de enfermedad por gnero. Sin embargo, las condiciones de vida, muestran mayor vulnerabilidad y persistencia de injustas desigualdades de gnero para las mujeres. El gmpo de 60 y ms aos es el ms vulnerable a la enfermedad para hombres y mujeres. - La fecundidad temprana: En el gmpo de mujeres de 15-44 aos, la vulnerabihdad a enfermedades maternas aumenta, especialmente en las adolescentes de 15 a 19 aos y en zona mral, por las tasas de fecundidad temprana. Estas no se modificaron sustancialmente entre 1975-1995, e incluso se incrementaron en el quinquenio 1995-2000: segn la ENDS, en el 2000, el 19% de las adolescentes, ha estado embarazada o ha tenido partos, frente a un 17%, reportado en la Encuesta de 1995. - Los nuevos riesgos para la infancia: En el grupo de 0-4 ao s, la disminucin de los ndices de desnutricin

351

La Salud PbUca Hoy

protico-calrica, de afecciones perinatales y de enfermedades transmisibles y parasitarias, ha reducido la vulnerabihdad y la carga de enfermedad. Sin embargo, preocupa el efecto de las tendencias recientes -ya mencionadas en el anhsis de la mortalidad infantil-: la restriccin en el consumo familiar de alimentos, consecuencia de la crisis econmica; y el abandono o ejecucin asistemtica, a partir de la puesta en marcha de la ley 100-93, de las acciones de salubridad pblica, vigilancia epidemiolgica y programas de vacunacin, sumados al aumento de la pobreza y al hecho de que el ritmo de disnnucin de la tasa de mortalidad infantil del pas se ha hecho ms lento. Por ejemplo, en la tabla 1.1, se observa la prdida gradual de coberturas de vacunacin, las cuales -para algunas enfermedades inmunoprevenibles- hace una dcada alcanzaban cifras cercanas e incluso superiores al 90%. Tabla 2.1 TASAS Y COBERTURAS DE ENFERMEDADES INMUNOPREVENIBLES. COLOMBIA
Casos Sarampin (casos sospechosos) Rubola Meningitis por Haemophilus I Tos ferina 1 Hepatitis B 1 Parlisis Flaccida 1 Tuberculosis 1997 Tasa Cober Casos tura 1998 1 Tasa Cober Casos tura 1999 1 2000 1 Tasa 1 Cober Cober tura tura

667
1991

89%
4.7* 0.8**

709
1906

86%
4.7* 0.7**

1686

89%
2.3* 0.4** 79% 1

334

306

974 163

1.0** 80% 0.7** 73% 792 2.0** 79% 1354 3.3** 84% 1490 183 1.4*** 180 1.3*** 190 8042 21.5** 95% 9155 22.5** 1 76% 110429

0.8** 67% 78% 1 3.6** 70% 79% 1.4*** 125.1** 69% 1 90%

* Tasa por mil habitantes ** Tasa por cien nl habitantes *** Tasa por cien mil menores de 15 aos p Informacin disponible slo para menores de un ao FUENTE: Miisterio de Salud. Subdireccin de Promocin y Prevencin.

Las lesiones no intencionales y los trastomos neuro-siquitricos en adultos:

En los adultos, las lesiones no intencionales pesan ms en las mujeres y una quinta parte de la carga de enfermedad en ellas se debe a las patologas msculo-esquelticas. En el caso de los hombres los trastomos neuro-psi-

352

La situacin de salud en Colombia

quitricos, representan el doble de aos perdidos respecto a los de las mujeres por la misma causa. Los datos sugieren la importancia creciente de los problemas de salud mental como causa de enfermedad en el pas. , Este perfil pone de presente que las acciones de salud pblica, los programas de salud mental y el embarazo en adolescentes, son tres prioridades frente a las cuales poco se est haciendo en el pas y deberan en todo caso abordarse en el marco de reformas estmcturales de poUtica social. 2.2. Condiciones de vida de los grupos ms desfavorecidos Las desigualdades injustas y evitables develan la deuda social del desanoUo y las indignidades inadmisibles de las sociedades, y de alguna manera, la estatura moral de quienes nacional e intemacionalmente toman las decisiones polticas y econmicas que trazan el camino de la exclusin. Es bien sabida y documentada la relacin entre salud y condiciones de vida. En Colombia ser habitante de la zona rural ser joven, ser mujer y pertenecer a una minora tnica y si adems se es pobre, representa una clara desventaja ante la vida y probablemente -aunque no se dispone de informacin especfica y desagregada en salud- una mayor vulnerabilidad ante la enfermedad y la muerte evitables. Aqu se presenta una sntesis de las condiciones de vida de jvenes, mujeres y poblacin mral, como uno de los elementos de contexto de las desigualdades socio-sanitarias. - La poblacin rural: entre la guerra, la pobreza y la falta de oportunidades: Las condiciones de vida de la poblacin mral se enmarcan en la asociacin perversa entre pobreza-violencia e inequidad: la pobreza por ingresos en 1997 era del 78.7% sin variaciones positivas en los ltimos 25 aos (Sarmiento (1996): 81; Gmez (1998): 121-134) y de la poblacin colombiana en sitoacin de miseria, el 37% (proporcin que, adems, aument respecto a 1980, cuando era del 22%) est en zonas rurales y afecta principalmente a poblacin negra e mdgena y a los departamentos de Choc, Magdalena, Crdoba, Sucre y Cauca. Las desigualdades en las oportunidades educativas y en los ingresos profundizan la pobreza estructural: Segn el Informe de Desarrollo Humano en Colombia 1999, aunque la cobertura en educacin bsica y secundaria rural ha aumentado -a 83% (1998) y 43% (1997) respectivamente- y la

353

La Salud Pblica Hoy

desercin ha disminuido; entre las razones de inasistencia pesa mucho la falta de recursos econmicos: en un 38% para la primaria y en un 46% para la secundaria. Las oportonidades de movilizacin social ascendente son casi nulas porque la cobertura de educacin superior solo llega al 4%, las tasas de analfabetismo son cercanas al 20% y el P.I.B. de los habitantes mrales es apenas el 50% del de los urbanos y se incrementa menos. La posibilidad de ser propietario es restringida y para quienes lo logran es alto el riesgo de despojo: el coeficiente de Gir de distribucin de la tiena era de 0.71 en 1996 (Bemal, (1999):14) y el 1.3% de los propietarios posee el 48% de la tiena (Yepes, (2000): 155), Esta inequidad est asociada a la compra de tienas por narcotraficantes en el 42% de los municipios colombianos (Reyes, 1995) y al desplazamiento forzado pues del total de desplazados, el 61% eran propietarios y la expulsin ocune en zonas estratgicas de futoro desanoUo econmico o de disputa por el dominio territorial entre actores armados. Pero, adems, las mujeres mrales estn prcticamente excluidas de la propiedad y del acceso al crdito. Pero la poblacin mral no solo tiene precaria calidad de vida, vive menos: en 1997 la esperanza de vida era 1.8 aos menor que la urbana (DNP-PNUD (2000): 5). Nuevamente, intentar modificar esta situacin pasa necesariamente por una reforma agraria re-distributiva -proyecto aplazado sistemticamente en el siglo XX- y por los avances en la negociacin del conflicto armado, ambos asuntos pasan tambin por el mbito de la comuidad intemacional.

Los jvenes: entre la violencia, el desempleo y la fecundidad temprana:

La violencia, el desempleo o el empleo precario asociado al bajo nivel educativo y a la fecundidad y/o conformacin temprana de un nuevo hogar, y el consumo de drogas y alcohol son las principales caractersticas de las condiciones de vida de los jvenes: Mujeres, y con mayor magnitud, hombres entre 15 y 29 aos, ponen la cuota ms alta de mortalidad temprana por homicidios. Segn el IDH Colombia 1999, el desempleo urbano para los jvenes -hasta los 17 aos- que buscan trabajo, ascendi de 26% en 1991 a 33% en 1998, la edad promedio

354

La situacin de salud en Colombia

de los desocupados urbanos es de 27-29 aos y de los rurales es de 24 a 28 aos, y para quienes trabajan, la calidad del empleo ha bajado. Del conjunto de los jvenes los ms afectados son las mujeres y los pobres. La situacin laboral est asociada al bajo nivel educativo y al abandono de los estudios por presin socio-econmica y/o por fecundidad temprana y confortruicin de un nuevo hogar: 46% de los jvenes urbanos y 73% de los mrales no superan el nivel educativo de sus padres ni alcanzan "el capital educativo bsico" de 12 aos; as son muy hmitadas las posibilidades de movilidad social ascendente pese a que el pas ha avanzado en las coberturas de educacin primaria y secundaria. Por eso, en 1998, el gmpo ms joven de ocupados no perciba, en nmgn departamento salarios superiores al mnimo. La Encuesta Social de FedesanoUo, en 1999, para las cuatro principales ciudades colombianas, encontr que en los estratos de ingresos bajos, a diferencia de los altos, los jvenes tienden a conformar hogares ms rpido -recurdese las tasas estables de fecundidad temprana en el pas- y solo el 1.4% de los jefes de hogar tiene educacin superior completa. Por otro lado, tabaquismo y consumo de alcohol son problemas serios entre la poblacin de 12 a 17 aos: de los entrevistados en la Encuesta de calidad de vida del 97, el 72% haba consumido alcohol y el 19% haba fumado alguna vez en la vida, el 13% fumaba regularmente y el 10% consuma alcohol una vez al mes. Abuso de drogas y alcohol afectan al 7% de los hogares en el quintil ms pobre frente a un 3% de los del quintil ms rico. Nuevamente violencia, pobreza y desigualdad de oportunidades, aparecen como determinante para las condiciones de salud. - Las mujeres: la persistencia de la discriminacin: En Colombia, las mujeres viven ms, pero con menor calidad de vida y mayor discriminacin: han accedido ms a la educacin pero estn ms desempleadas, ganan menos que los hombres y en los ltimos 15 aos, empiezan a morir por homicidios y a sufrir el desplazamiento forzado producto de una violencia que ha sido esencialmente masculina.

355

La Salud PbUca Hoy

En salud, adems de la tasa de fecundidad en adolescentes y jvenes, la mortalidad matema contina siendo alta comparativamente con la de ottos pases de Amrica, subregisttada, con grandes desigualdades regionales, y fuertemente asociada al nivel educativo. Segn un estodio de Mauricio Perfetti (-1996- citado en DNP-PNUD 2000: 113-119), en el mbito educativo, hay mayor matrcula escolar, mejor rendimiento acadmico y menor desercin en las mujeres que en los hombres, sin embargo, padecen mayor desempleo estmctural y son ms vulnerables a las crisis econmicas. Cuando acceden al empleo, la discriminacin es evidente: los ingresos de los hombres superan en un 28% en promedio a los de las mujeres y slo entte un 11 y un 16% de esa diferencia puede ser explicada por el "capital humano acumulado", o sea que entte un 84% y un 89% del diferencial est asociado a factores de discriminacin. Pero adems, a pesar de que la participacin de las mujeres en el ingreso laboral urbano ha aumentado en casi nueve puntos porcentuales entte 1991 y 1997, los hombres continan recibiendo ms del 60% del total de dicho ingreso. Este pattn se mantiene e incluso se profundiza en las pocas de recesin y es ms desigual en la zona mral donde los hombres reciben cerca del 80% del total de ingresos, frente a una participacin del 72%. El nivel educativo -central en el enfoque de "capital humano" y en las polticas de ajuste- no ha representado proporcionalmente mejor ingreso o menor discriminacin: entte 1991-1998, el tiempo de educacin promedio urbana de las mujeres aument casi en un ao de escolaridad (0.82) pero el salario promedio slo lo hizo de 2 a 2.3 salarios mnimos. En el sector servicios, constituido en un 54% por empleo femenino, se observ entre 1991-1995, que stas a pesar de tener un nivel educativo por encima del promedio en rea urbana, perciban salarios inferiores a la media nacional. La superacin de la discriminacin requiere adems de un modelo de desanoUo diferente al actual, polticas con perspectiva de gnero y ttansformaciones culturales de largo atiento.

356

La sitttacin de salud en Colombia

3. 1 sistema de prestacin de servicios de salud Desde 1993 y respondiendo a una nueva concepcin de poltica social, inscrita en la transicin hacia un modelo de desanoUo neoliberal, se diseo en el pas el Sistema General de Seguridad Sodal en Salud, SGSSS, el cual se puso en marcha en los aos 95 y 96. Su estrategia central: el aseguramiento universal para acceder a un Plan Obligatorio de Servicios igualitario, pretenda resolver dos de los grandes problemas del sistema anterior: la segmentacin -sistemas diferenciales de servicios para los distintos gmpos de poblacin- y las desigualdades en el acceso a los servicios de salud, debidas principalmente a baeras econmicas. La perspectiva que ac se muestta es que el balance hoy es devastador, los objetivos no slo no se han cumplido, sino que no son viables porque las dificultades que enfrenta el SGSSS estn ligadas fundamentalmente a la concepcin de poltica social y de transformacin del mercado laboral, inherentes al nuevo modelo de desarrollo, el cual, pese a las alarmantes cifras oficiales de deterioro de la calidad de vida y de empobrecimiento de la poblacin, se ha profundizado en el actual gobiemo, tendencia que continuara a futuro. En ese orden de ideas, aqu se toman las coberturas de aseguramiento, el acceso a los servicios de salud, y el gasto de bolsillo en saliui, como indicadores de las inequidades en la prestacin de servicios de salud, y se plantea que las crnicas desigualdades en salud del pas no slo se mantienen en el SGSSS, sino que la generalizacin de una lgica mercantilista como criterio prioritario de atencin, ha generado nuevas desigualdades injustas. 3.1. Las coberturas de aseguramiento: retroceso, exclusin y negacin de la universalidad La meta del Sistema General de Seguridad Social era unlversalizar, en un perodo de 7 aos, y hacia el ao 2001, un seguro de salud que garantizara un paquete igual de servicios -Plan Obligatorio de Salud, POS- para toda la poblacin; para el efecto se crearon dos regmenes: el subsidiado para la poblacin ms pobre y sin capacidad de pago -estimada en un 30% para el 20(X3- financiado por el Estado y por los trabajadores cotizantes de ms altos ingresos; y el Contributivo, para la poblacin ttabajadora con capacidad de pago y su familia -un 70%, al ao 2000- En ambos regmenes, los

357

La Salud PbUca Hoy

usuarios -segn su clasificacin econmica y la frecuencia de uso- realizaran copagos por la utilizacin de los servicios del POS, para contribuir a la racionalidad y sostenibilidad financiera del sistema. En esos 7 aos de la ttansicin -entte 1994 y 2000- la poblacin se adscribin'a progresivamente a uno de los dos sistemas de aseguramiento, esto sera posible no slo por el aumento significativo de recursos financieros y de los aportes estatales para la salud, sino tambin por que se prevea un comportamiento macroeconmico de crecimiento positivo o de sostenibilidad de la economa, el empleo, la afiliacin y de los ingresos reales de los trabajadores. Mientras tanto, la poblacin no asegurada, recibira atencin pagando una parte de su propio bolsillo a tarifas establecidas y el resto con cargo a los recursos pbhcos (subsidio a la oferta) Estos ltimos, iran transformndose, a medida que la poblacinfuese incluida en el aseguramiento, en subsidio a la demanda. - El retroceso en la cobertura de aseguramiento: Se observa claramente a partir de 1999, y se expresa en disminucin para el rgimen contributivo y en estancamiento para el subsidiado. (Tabla 2.2). Para el rgimen subsidiado -adems de que las cifras de pobreza sobre la que se calcula la cobertora, "invisibizan" otros pobres-; los sistemticos recortes a los dineros para la salud, profundizados en este gobiemo -por ejemplo con el acto legislativo 01 y con la ley 715, ambos del 2001-; sumados a la poltica de ms recursos para la guena, y al incremento de la pobreza y el desempleo -61.5% de los colombianos son pobres por ingresos y la tasa de desempleo iniciando el 2002, es del 20%- sugieren que en el escenario ms optimista la cobertura de aseguramiento del rgimen subsidiado, a duras penas se mantendra, pero los hechos hoy, apuntan ms a la disminucin en el corto plazo. En el rgimen contributivo, las coberturas disminuan a medida que aumentaba el deterioro del mercado laboral: entte 1996 y 1999 todos los indicadores lo confirman: el desempleo de larga duracin (ms de 6 meses de bsqueda) pas de 44.4% a 56.4%, el subempleo de 17.3 a 28.3, los ocupados asalariados de 64.4% a 56.4%, y los ttabajadores independientes -la mayora de baja calificacin- aumentaron de 35.6% a 46.3% (Portafolio Econmico. Diciembre 1999),

358

La situacin de scdud en Colombia

El deterioro ha continuado, pues al terminar el 2000, la tasa de desempleo abierta era del 21%, la informalidad lleg al 60% de los ocupados, y el ingreso promedio anual descendi en ms de 100 dlares, de US $ 2,158 en 1994, a US $ 2043 en el 2000 (Sarmiento 2001: 29). No hay evidencias para pensar que la situacin se va a modificar. Tabla 2.2 EVOLUCIN DE LA POBLACIN ASEGURADA EN LOS REGMENES SUBSIDIADO Y CONTRIBUTIVO DE SALUD EN COLOMBIA.
1994 ^ \ ^ ^ AOS No. POBLACI^\ Poblacin total Afiliados al rgimen Subsidiado Afiliados al rgimen Contributivo TOTAL ASEGURADOS POBLACIN SIN ASEGURAR 3T849.150 (1) nd 12'070.536 (2) nd nd 1997 1999 2000 1

%
P,T No. 40'064.093 (1) 7'845,602 (2)

%
P.T No. 4r540.671 (3) 19.6

%
P.T No. 42-299.403 (3) 9'510.566 (3) 13745.836 (3) 22'756.402 19-543.001

%
P.T

9325.832 22.4 (3) %

22. 5% 31. 3% 54

14'969.278 37.4 13'652.878 32.9 % (2) (3) % 22'814.880 57% 22978.710 55.3

%
17'249.213 43% 18'561.961 44.7

%
46

FUENTES:

(1) DAE. Colombia Estadstica (2) Observatorio de la Seguridad Social. Centro de Investigaciones Econmicas. Universidad de Antioquia. Junio de 2001. (3) Informes del CNSSS a las Cotisiones Sptimas de Senado y Cmara. Ao 2000-2001 - nd - Informacin no disponible Todos los porcentajes se calcularon con base en la poblacin total.

La exclusin:

Se configura al menos por ttes vas: en primer lugar, la seleccin de la poblacin pobre beneficiaria del rgimen subsidiado no considera las reales cifras de pobreza del pas; en segundo lugar, y siguiendo la lgica de la focalizacin, no todos los que all estn asegurados, deberan estar, y en tercer lugar, los vinculados cada vez son ms numerosos y tienen menos posibilidades reales de aseguramiento.

359

La Salud PbUca Hoy

Las cifras muesttan que la pobreza por necesidades bsicas insatisfechas NBI -que ttaa una tendencia descendente continua- se ha estancado en el pas desde 1997, en una cifra cercana al 37%, mienttas que la pobreza por ingresos - o lnea de pobreza, LP^- se ha incrementado sistemticamente desde el mismo ao, hasta llegar en el 2000, al 61.5% (Sarmiento (2001): 29j. La poblacin base para cobertura de aseguramiento por el CNSSSConsejo Nacional de Seguridad Social en Salud es la poblacin NBI. Tabla 2.3 ASEGURAMIENTO POR DECILES DE POBLACIN. COLOMBIA 2000
ASEGURAMIEINTO POBLACIN POBRE POBLACIN POBRE AFIUADA (2000) NBI: Total poblacin: 15.905.560 (37.6%) R. Subsidiado: P. NBI. Asegurada: 9.510.566 (59%) LP. Total poblacin: 26.014.133 (651.5%) Poblacin Pobre por LP asegurada: 7 Diferencia LP/NBI: 10.108.573 Total 24J68.743 10.5076.410 13.792.333 | INCL USION / EXCL UStON POBL A ClON POBRE DECI L 1 2 3 4 5 6 POBLACIN 4.082.11 1 3.944.353 4.03 1.969 3.980.476 3.997.369 4.332.465 I

(2000) **

AFILIADOS 44% 36.85% 3 8% 45% 46.27% 49.78%

NO AFILIADOS 1 56% 63.15% 62% 55% 53.73% 50.22%

Fuente:

* Informe CNSSS y Libardo Sarmiento ** Desarrollo Humano Colombia 2000

Es as como para el 2000, el total de poblacin pobre por NBI, era de 15'905.560, de la cual slo 9'510.566, (59.8%) estaban afiliadas al rgimen subsidiado (Informe del Consejo Nacional de Seguridad Social en Salud a las comisiones Sptimas de Senado y Cmara 2001); mientras 26'014.133 personas estaban por debajo de la lnea de pobreza. La diferencia entre uno y otro mtodo de medicin de pobreza representa 10'108.573 de colombianos pobres e "invisibles" para la poltica de salud.

La pobreza por necesidades bsicas insatisfechas est asociada a la disponibilidad de servicios pblicos, calidad de la vivienda, hacinamiento, asistencia escolar de los nios y dependencia econnca. La pobreza por ingresos est asociada a la calidad del empleo, al desempleo y a la posesin de activos.

360

La situacin de salud en Colombia

Si bien, no es posible establecer cuantos de estos ltimos pudieran estar asegurados en el rgimen contributivo, lo que interesa sealar con las cifras es que la esttategia de focalizacin -implantada a ttavs del Sistema de Informacin y Seleccin de Beneficiarios- SISBEN- subestima la magnitud y heterogeneidad de la pobreza en Colombia, y esto deviene en polticas sociales reduccioistas y exduyentes. Esa es una de las razones por la cual en el rgimen subsidiado "no estn ni estarn todos los que son". "Tampoco son todos los que estn", pues diversos ttabajos, as como las denuncias de los usuarios, han sealado que algunos alcaldes han afiliado personas que no son tan pobres y con enfermedades de alto costo, para evadir su pago con los cada vez ms escasos dineros del municipio, o del subsidio a la oferta (CI Centto de Investigaciones Econmicas Universidad de Antioquia (2001); tambin los caciques polticos han utilizado con criterio clientelista la afiliacin al rgimen subsidiado. - La negacin de la universalidad: La situacin descrita, explica porqu el aseguranento universal no es viable, y no puede serlo en un contexto macroeconmico y de poltica pblica que ha profundizado el deterioro de la calidad de vida. Hoy, por lo menos, un 46% de la poblacin colombiana no est asegurada. Adems, aparece un gran interrogante acerca del que reiterativamente se ha sealado como el principal logro del SGSSS cual es el aseguranento de los ms pobres, ya que las propias cifras oficiales (DNP-PNUD (2001): 107) muestran que son ms los excluidos que los incluidos, pues el 56% y el 63.15% de la poblacin de los deciles 1 y 2, respectivamente, no est asegurada (Tabla 2.3). 3.2. El acceso a los servicios de salud: antiguas y nuevas inequidades

La equidad en salud, abarca un amplio campo que va desde la justicia social y los derechos y su expresin en el mbito saitario, los resultados en salud, el financiamiento y el acceso a los servidos. Aqu se analiza esta ltima dimensin por dos razones: porque uno de los argumentos ms fuertes de los idelogos de la reforma colombiana era el de que el aseguramiento removera las barreras de acceso a los servicios, especialmente las econmicas que histricamente caracterizaron a nuestto sistema de salud. Tam-

361

La Salud Pblica Hoy

bien porque aunque la literatura sobre el tema advierte que los servicios inciden en forma limitada -pero importante-, en los resultados en salud, ya que es ms determinante la relacin con las condiciones de vida- son aquellos los que concretan una de las dimensiones ms importante del derecho a la salud, cual es el derecho a la asistencia sanitaria. La equidad en el acceso a los servicios de salud, tradicionalmente se ha definido como la utilizacin efectiva de servicios, con base en la necesidad de atencin, e independiente de la capacidad de pago (Aday y Andersen (1980)). Paradjicamente, es el mismo concepto utilizado en los estudios de quienes han defendido el modelo de reforma colombiana (Castao y col. (2001); Cspedes y col. (2000)). Una revisin de investigaciones realizadas en el pas sobre los resultados de la Ley 100/93 (Echeverry 2001), muestta que la utilizacin efectiva de servicios -acceso real- no se ha modificado sustancialmente. Otras evidencias, entte ellas los testimonios de los usuarios (CE 2001), sealan que las barreras econmicas siguen siendo el mayor obstculo para obtener servicios, y que han aparecido nuevas barreras generadas por usuarios y prestadores. Antes de la reforma, los estudios nacionales ms representativos coinciden en que la razn ms importante para no utilizar servicios era econmica: en la Encuesta nacional de conocimientos, actitudes y prcticas en salud realizada entte 1986 y 1989- los motivos para no consultar al mdico eran el costo, la demora en la atencin y la inaccesibilidad geogrfica, y tanto en la Encuesta Nacional de Hogares, como en el estudio de Juan Luis Londoo y col. -ambos en 1992- las razones de no asistencia a los servicios ante una necesidad identificada varan entte el 50% y 55% de los casos. Despus de la reforma, las evidencias sugieren que las barreras econmicas se mantienen en primer lugar. Cerca de la mitad de (Al.5% de la poblacin de los esttatos 1 y 2, en nueve ciudades colombianas, no utiliza servicios, aduciendo en un 66% razones econmicas (Mineducacin-Universidad Javeriana, 1995). Cspedes y col., (2000) sugieren que los copagos y las cuotas moderadoras podran estar resttingiendo el acceso, y la ENDS (Profamilia, 2000) afirma que la falta de dinero es la razn de no uso de servicios en un 51% de los casos.

362

La situacin de salud en Colombia

La probabilidad de utilizacin de servicios para los ms pobres, tampoco se modific sustancialmente, entte 1993 y 1997 (Tablas 2.4) en el primer quintil de poblacin (Castao et .al. 2001: 29), mientras que la proporcin de no demanda de servicios para ese nsmo quintil y perodo, disminuy en 14% para el 97, pero tiende a aumentar en el 2000, ao en el cual el acceso se vuelve ms inequitativo, en tanto hay mayor declaratoria de enfermedad en la poblacin pobre, pero quienes reciben ms atencin son los ricos. (DNP-PNUD (2001): 114). Tabla 2.4 INDICADORES DE EQUIDAD EN EL ACCESO A LOS SERVICIOS DE SALUD ANTES Y DESPUS DE LA REFORMA. COLOMBIA.
INDICADOR *Declaraioria enfermedad Vs atencin 1993 Mayor enfermedad Pobres Ql 37.1% Q2 268% Q3 132% Ql 0541 Q2 0678 Q3 0812 AOS 1997 Mayor enfermedad y atencin en ricos Ql 23.3% Q2 25.5% Q3 20.8% Ql 0.587 Q2 0672 Q3 0822 2000 Mayor enfermedad pobres mayor atencin enrieos Ql 27..% Q2 23.4% Q3 19.18% ND

*No demanda servicios en caso deenf ennedad

** Probabilidad ulizacitn servicios

Total Fuente: * Desarrollo Humano Colombia 2000:PNUDM Social ** Castao, R.A et. al.: Evolucin de la equidad en el Sistema Colombiano de Salud

Los testimonios de los usuarios van en la misma va, pero adems plantean que han aparecido nuevas barreras de acceso a los servicios: los usuarios del rgimen subsidiado relatan negacin o trabas para recibir atencin, especialmente para enfermedades de alto costo, o para los niveles de mayor complejidad, y restriccin de uso -utilizacin parcial de servicios- por la falta de dinero para asumir los copagos en las consultas y exmenes especializados, y en los medicamentos. En otros casos, los aseguradores, desestimulan la utilizacin de servicios con la exigencia de trmites, o con la ubicacin de los prestadores en zonas distantes para el usuario (CI 2001). Todas estas evidencias demuestran que el aseguramiento no garantiza el acceso a los servicios, ni ha removido las barreras econmicas, histricamente las mayores generadoras de inequidad en el acceso a los servicios de salud en el pas, mcluso hoy hay otras nuevas, que posiblemente aumenten las desigualdades.

363

La Salud Piblica Hoy

Por otto lado, diversos trabajos (Defensora del Pueblo 2000; ENH 2000; DNP-PNU 2001) coinciden en sealar que la situacin de los vinculados es la ms crtica: deben asumir costos altos para obtener atencin, de all que la utilizacin que ellos hacen de la consulta mdica y odontolgica, haya disminuido entre 1997 y el 2000, mienttas su gasto de bolsillo se ha incrementado. 3.3. El gasto de bolsillo en salud >

Representa los pagos que los hogares reahzan directamente a los proveedores de servicios de salud, no mcluye los aportes obligatorios al sistema de salud, como son los impuestos a la nmina, ni los pagos por seguros privados de salud. Se le considera una de las fuentes ms inequitativas de financiamiento de un sistema de salud (Castao, ei. al., 2001: 6) Dos ttabajos recientes, estudiaron el gasto de bolsiUo en salud en Colombia, calculando la diferencia entre el coeficiente Gini de concenttacin del ingreso, y el coeficiente de concentracin del pago del servicio, para construir un indicador de progresividad del gasto de bolsillo en salud (ndice de Kakwani) y aunque los resultados difieren, ambos coinciden en el carcter regresivo porque los pagos directos promedio han aumentado para los hogares del quintil ms pobre (Castao et, al. 2001: 30) o porque la regresividad ha retomado a los niveles de 1993 (DNP-PNUD 2001: 119). Estos resultados representan una profundizacin de la inequidad en el derecho a la asistencia sanitaria: hoy, precisamente cuando los ndices de pobreza y desempleo alcanzan cifras aberrantes, la poblacin pobre -que se enferma ms- es la que paga ms por recibir menos servicios. Conclusiones 1

En las causas de enfermedad y muerte del pas, predomina, ms que la transicin epidemiolgica, un perfil de heterogeneidad estructural, en tanto se combinan desigualmente las "enfermedades de la pobreza", con "las enfermedades del desarrollo", pero en el cual es muy fuerte la expresin de las inequidades socio-sanitarias que de tiempo atrs han caracterizado al Sistema de Salud Colombiano.

364

La situacin de salud en Colombia

Los problemas ms relevantes hoy son la alta y temprana mortalidad por homicidios y violencia, que aunque afecta predominantemente a la poblacin masculina joven, empieza a aparecer con un peso importante en otros grupos etreos; la persistencia de desigualdades, entte regiones del pas, en la zona urbana y la mral, y de gnero; y el deterioro en las condiciones de vida -el cual se ha profundizado en los ltimos aos- y que podra ttaducirse en el corto plazo en prdida de lo que el pas ha construido durante aos en trminos de disminucin de indicadores tan sensibles como la mortalidad matema e infantil. La ltima reforma a la salud en Colombia, implantada en los aos 90, no logr superar las crnicas inequidades y exclusiones del Sistema de Salud Colombiano: hoy, concluido el perodo de transicin, la universalidad en el aseguramiento y la homologacin de los planes de beneficios, son promesas incumplidas, e imposibles de concretar en medio de polticas de ajuste, de mercantizacin de los servicios de salud, y de profundizacin de las polticas sociales de corte neoliberal. Hoy un gran interrogante se dibuja sobre el que se ha mostrado como el principal logro de la Ley 100/93, cual es el del aseguramiento de la poblacin pobre, pues las propias cifras oficiales indican que para el ao 2000, el 56% y el 63% de la poblacin de los deciles 1 y 2, respectivamente, no est asegurada. Por otta parte, aseguramiento en salud, no significa acceso real o utilizacin efectiva de servicios, ni remocin de las barreras econmicas, como lo plantearon los creadores e impulsores de la Ley 100/93. Hoy la poblacin, especialmente la ms pobre, gasta ms en salud; y los afiliados del rgimen subsidiado, reciben un Plan de Beneficios, con 30% menos servicios que los del rgimen contributivo (Hemndez, (2000)). Para la poblacin no asegurada -vinculada- las inequidades son mayores: son los que ms han disnnuido la utilizacin de servidos, y los que ms han aumentado el gasto en salud. Las evidencias muesttan que la segmentacin se ha profundizado, y sugiere que las inequidades en el acceso a los servicios se han incrementado, aunque en este ltimo aspecto se requieren estudios ms contundentes. Abordar integralmente la transformacin de la situacin de salud del pas, requiere actuar en doble perspectiva, la construccin de un modelo de desarrollo altemativo, y en ese contexto, de un nuevo sistema de Salud, ambos orientados a redimensionar las polticas sociales y la equidad, co-

365

La Salud Pblica Hoy

locndolas, en vez del crecimiento econmico, como ejes de la agenda del desarrollo. Equidad y poltica social entendidas como la igualdad de oportunidades para todos y la garanta de derechos universales, para desplegar las capacidades y libertades individuales que concreten los proyectos plurales de "vida buena" de los grupos humanos (Sen 2000), y no como acciones asistenciales, residuales y subsidiarias al crecimiento econmico, y con el criterio de sostenibilidad financiera. En esta va han empezado a debatirse desde hace un tiempo en el pas, en diferentes escenarios y espacios acadmicos y polticos (Cumbre contra la pobreza y por la equidad en 1998,1 Congreso Nacional por la salud en el 2000, por citar algunos ejemplos) propuestas alternativas que implican un reto tcnico significativo, pero sobre todo una tarea poltica sistemtica, compleja y de largo aliento, en el escenario nadonal, atravesado por la intolerancia, el autoritarismo, la negacin de la concertacin; y el miedo, el escepticismo, o la indiferencia frente a los asuntos pblicos; pero tambin en un escenario internacional interesado y solidario con los grandes problemas del pas, y que empieza crecientemente a movilizar y a concretar las propuestas para acercarse a ese horizonte al que le apuestan los dos foros sociales mundiales, celebrados en 2001 y 2002 en Porto Alegre, Brasil, y sintetizado en la consigna de "otro mundo es posible ". Sin duda, estas altemativas, devuelven fuerza y sentido a la accin poKtica y empiezan a acercar las utopas posibles a la realidad. ^vanzar en la perspectiva de este horizonte tico y poltico, requiere otras tareas nacionales ms cercanas e inmediatas, hacia la construccin de ciudadana en salud, o ms bien, hacer ms amplias las prcticas y los imaginarios de la ciudadana, incorporando la salud, en su dimensin ms integral, de calidad de vida. Es dedr convertir, o fortalecer el tema de la salud como asunto de inters pblico, de amplia convocatoria social, prioritaria en la agenda de los movimientos sociales, con posibilidades reales y comprometidas para un debate plural, y como Derecho Humano Fundamental. Acciones y proyectos como esta ctedra, como el I Congreso Nacional por la Salud, y como el Informe Alterno de Equidad en Salud para Amrica Latina son pasos concretos -que hay que mantener, fortalecer y multiplicar- hacia ese "otto mundo posible".

366

La situacin de salud en Colombia

Referencias bibliogrficas ADAY, Ann and ANDERSEN, Ronald. A Theoretical Framework for the study of access to medical care ln : Health Care in the United States: 2545, 1980. LVAREZ, C. Luz SteUa. La Situacin de Salud de la Poblacin Colombiana -Anlisis desde la perspectiva de la equidad-. Seminario Pensamiento en Salud Pblica: El Derecho a la Salud. MedeUn : Facultad Nacional de Salud Pblica, Universidad de Antioquia, 2001. BERNAL, Jorge. Nuevas polticas sociales. Escuela de Nutricin y Diettica. MedeUn : Universidad de Antioquia. Indito, 1999. CASTAO, R. A., ARBELEZ, J., GEIDIN, U., y MORALES L. G. Evolucin de la equidad en el Sistema Colombiano de Salud. Santiago : CEPAL. Serie financiamiento del desarroUo. Nmero 108, Chile, 2001. CSPEDES, Juan, E, et. al. Efectos de la Reforma de la Seguridad Social en Salud en Colombia sobre la equidad en el acceso y utilizacin de servicios de salud. Bogot: Revista Salud Pblica, Universidad Nacional, 2000, DANE-OPS. La mortalidad en Colombia segn condiciones de vida. Bogot : Estudios Censales. No. 16. Citado por Mlaga y col. En : Equidad y Reforma, op. cit.: 195, 2000. Departamento Administrativo Nacional de Estadstica-DANE. Salud y Seguridad Social en Colombia. Resultados del Mdulo de Salud, aplicado en la Encuesta Nacional de Hogares. Bogot, 2000. Departamento Nacional de Planeacin- Misin Social. Programa de Naciones Unidas para el Desarrollo. Bogot : Informe de Desarrollo Humano para Colombia 1999. p. 8, 2000. Una evaluadn de la Ley 100 como herramienta de cumplimiento del Derecho a la Salud. En : Desarrollo Humano. Colombia 2000. Alfaomega Ediciones. Mayo: 101-134, 2001.

367

La Salud Pblica Hoy

ECHEVERRY, L. Mara Esperanza. La salud en Colombia de cara al siglo XXI: entre la desigualdad y la violencia. Folleto publicado por la Corporacin "Viva la Ciudadana", como documento preparatorio del "Primer Congreso Nadonal por la Salud: el derecho a la salud, una va hacia la paz. Bogot. Agosto, 2001. La salud en Colombia: Balance a 10 aos de la Constitucin de 1991. Documento presentado en el Seminario Balance de los derechos econmicos, sociales y culturales a 10 aos de la Constitucin de 1991. Medellin : Plataforma Colombiana de Derechos Humanos, Democracia y DesarroUo. Captulo Antioquia. Agosto. Indito, 2001. Sntesis de los estudios de accesibilidad a los servicios de salud en Colombia, antes y despus de la Ley 100/93. Informe preliminar de investigacin en el marco del proyecto "Condiciones de acceso y sostenibilidad financiera del rgimen subsidiado de salud en Antioquia". MedeUn : Centro de investigaciones Econmicas CI. Universidad de Antioquia. Borrador. Indito, 2001. FRANCO, A. Sal. Violencia, salud y paz en Colombia. Documento preparado para el Dilogo Global "Salud: la llave del Desarrollo HumanoHannover 2000". Indito: 5, 2000. FEDESARROLLO. Encuesta social: resultados preliminares. Revista Coyuntura Social Bogot. Septiembre p. 53. La Encuesta se realiz en las cuatto principales ciudades: Bogot, MedeUn, Cali y Barranquilla que representan el 30.5% del total de habitantes del pas y el 43% de la poblacin urbana. 1999. GALLARDO, Henry M., RODRGUEZ, Jess. Mortalidad y aos de vida ajustados por discapacidad como medidas de la carga de enfermedad. Colombia 1985-1995, Bogot : Ministerio de Salud, agosto,1999. GMEZ, Alcides.La permanencia de la pobreza rural en Colombia. En: Equidad y poltica social en Colombia. Seminario pobreza y poltica social en Colombia. Bogot : Memorias, 121-134, 1998,

368

La situacin de salud en Colombia

GONZLEZ, ngela. La Situacin de la Salud Pblica: una visin. Ponencia en el Congreso Internacional "Salud para todos: Desarrollo de Pohticas de Salud Pblica para el Siglo XXI", 1999. MedeUn : Facultad Nacional de Salud Pblica. Universidad de Antioquia. Diciembre. Citado en el Informe de Desarrollo Humano para Colombia 1999. DNP- Misin socialPNUD p: 96-98, 2000. HERNNDEZ, Mario. El derecho a la salud en Colombia: obstculos estructurales para su realizacin. En : La salud est grave. Bogot : Plataforma Colombiana de Derechos Humanos, Democracia y Desarrollo. Mayo, 2000. MLAGA, Hemn et. al. Equidad y Reforma a la Salud en Colombia. Revista Salud Pblica. 1 (3). Bogot : Universidad Nacional de Colombia. Noviembre, p 195. 2000. Ministerio de Salud. OPS-OMS. Situacin de salud en Colombia. Indicadores bsicos 2001. Bogot : Folleto pleglable, 2001. PERFETTI, Mauricio. Diferencias salariales entte hombres y mujeres no asalariadas entte 1984-1994. En : Revista Planeacin y Desarrollo, vol. XXVII, (4) octubre-diciembre. Citado en el Informe de Desarrollo Humano..., op.cii.: 113-114, 1996. Primer Congreso Nacional por la Salud y la Seguridad Social: El Derecho a la Salud, una va hacia la paz. Relatora general. Bogot. Octubre, 2001. PROFAMILIA. Salud Sexual y Reproductiva en Colombia. Encuesta Nacional de Demografa y Salud 2000. Bogot, Octubre: 97-98, 117, 2000. RESTREPO Z., Jairo Humberto y col. Condiciones de acceso y sostenibilidad financiera del rgimen subsidiado de salud en Antioquia. Proyecto de investigadn en ejecucin. Enttevistas a los directores de la ARS. Grupo de Economa de la Salud. Medellin : Centto de Investigaciones Econmicas. Universidad de Antioquia, 2001. RESTREPO, Mara Ins. Se deteriora la calidad de vida. En : Portafolio Econmico. Bogot : Pubhcacin del peridico "El Tiempo". 1999.

369

La Salud Pblica Hoy

SARMIENTO, A. Libardo. Balance de la Constitucin de 1991. Desconocimiento, derechos y explotacin de necesidades. Revista Foro No. 41. Bogot : Ediciones Foro Nacional por Colombia, juho p, 26., 2001. SEN, Amartya. Desarrollo y libertad. Barcelona: Editorial Planeta, la. ed, 2000. SOLER, Julio Enrique. Colombia 1997: Globalizacin pobreza e inequidad. En : Palabras ms. No. 5. Estar atentos: Desarrollo Social y Conttol ciudadano en Colombia. MedeUn : Corporacin Regin: 43-64, 2000. VALENCIA, Juan Carlos. Primera Encuesta Nacional de Calidad en Salud percibida por los Usuarios. Bogot : Defensora del Pueblo, 2000. YEPES, Alberto. Colombia: cinco aos de retrocesos continuos. Control ciudadano. Social Watch. Uruguay, p.l55, 2000. YEPES, L., Francisco. La saluden Colombia. Ministerio de Salud. Departamento Nacional de Planeacin. Tomo I. 1990.

370

Aproximaciones a un concepto de hospital universitario y algunas consideraciones sobre la crisis hospitalaria en Colombia
JUAN CARLOS ESLAVA CASTAEDA

Pensar en la figura de un Hospital Universitario (HU), en el contexto de la sociedad actual, no es una tarea fcil. Ms an cuando su sola imaginacin implica articular dos complejas organizaciones, el hospital y la universidad, que a lo largo del siglo XX han ido redefiniendo sus funciones y principios y reorganizando sus estructuras y sus esquemas de administracin. De ser un lugar de paso, un albergue y un sitio de reclusin para los pobres y los menesterosos, el hospital del siglo XX se irgui como una colosal institucin cientfico-tcnica, escenario fundamental para el desarrollo de la accin teraputica. De ser una escuela de cultura para la formacin de la clase donnante, la universidad del siglo XX se ttansform en una institucin educativa de masas, productora de conocinentos y recreadora de prcticas profesionales. Tanto el hospital como la universidad han ido evolucionando y su dinmica es, hoy por hoy, de una complejidad impresionante. Es por ello que los esquemas organizativos que han articulado estas dos instituciones, a partir del modelo flexneriano de educacin mdica, han llegado a ser inadecuados o, por lo menos, insuficientes. Entre ottas razones porque aunque dicho modelo plante la exigencia de hospitales ntimamente vinculados a la labor de enseanza de las escuelas de medicina, termin favoreciendo en ellos, por un lado, una primaca de la lgica de los servicios asistenciales por sobre la lgica de la vida uiversi-

373

La Salud Pblica Hoy

taria y, por otto lado, un ejercicio acadmico sui generis donde no siempre existe una relacin directa con el perfil epidemiolgico de las poblaciones bajo su influencia. Se generaron as, en la prctica, dos tipos de distanciamiento: un distanciamiento en los ritmos, las funciones y los intereses del hospital y de la universidad y un distanciamiento entte la accin del hospital universitario y las redes pblicas de prestaciones de servicios de atencin mdica'. Esto ha conducido a una situacin paradjica: entte ms se estrecha el vnculo del hospital a la universidad en trminos de ttadicin, y mientras ms se estructura el hospital ligado a la universidad como un centro teraputico de alta tecnologa donde se logra realizar alguna investigacin e innovacin tecnolgica, ms se aparta, o mejor, se desentiende, de los horizontes de accin que los nuevos roles de la universidad estn generando. En ottas palabras, auque hgado por ttadicin a la universidad, el hospital difcilmente logra cumplir con las funciones que hoy tiene la urversidad. Y esta distancia de propsitos ha sido reforzada por las exigencias de una catica y algo mezquina realidad hospitalaria donde se le recortan posibilidades al hospital y se le obliga a que cumpla funciones eminentemente asistenciales en un ambiente de recesin y bajo el imperativo del conttol de costos. Esta situacin exige re-pensar el sentido que hoy adquiere un hospital universitario recogiendo las experiencias del pasado, pero ttascendindolas, para ir ms all de los viejos modelos y los hbitos adquiridos. Esto implica que si bien una Facultad de Medicina debe luchar por conservar y ampliar sus escenarios hospitalarios, las relaciones que entabla con ellos y las funciones que les corresponden no pueden ser pensadas desde las pautas con las cuales se haba venido actuando. Hoy en da pensar en un HU pasa por modificar las reglas de juego, tanto en el orden administtativo, como en el acadmico y asistencial^ .. ^

Al decir de Andr Cezar Mdici, los hospitales universitarios, aunque en muchos casos usaron recursos pblicos, crecieron a lo largo del siglo XX distantes de las necesidades de salud de las poblaciones y bajo los intereses econmicos y corporativos de los mdicos especialistas (MEDlCl, 2001). En Colombia habra que establecer matices aunque el enunciado general puede mantenerse. Esto implica, para el caso de la Universidad Nacional, que el esquema de Hospital Universitario no puede .ser el mismo que, desde aos atrs, ha sido implementado en los Hospitales San Juan de Dios, Materno Infantil y la Misericordia.

374

Aproximaciones a un concepto de hospital universitario y algunas consideraciones sobre la crisis hospitalaria en Colombia

Sin embargo, es necesario enfatizar que si bien los nuevos retos que se le plantean a la educacin del personal mdico ttascienden el horizonte del trabajo hospitalario, la figura del hospital sigue siendo centtal -aunque no excluyente, ni exclusiva- en la formacin de dicho personaP. Por esto, vale la pena hacer una pequea reflexin sobre la importancia del hospital como escenario de formacin profesional, para luego s detenemos en la nocin de hospital universitario y algunos de los obstculos que debe superar para posicionarse como propuesta viable en el escenario sanitario colombiano. Por qu es importante el hospital en la educacin mdica? La figura del hospital, como se mencion ms arriba, ha sufrido profundos cambios. Tan es as que lo que hoy consideramos como hospital modemo es una construccin relativamente reciente cuyos rasgos ms especficos se remontan hasta finales del siglo XIX y comienzos del XX. Antes de esta poca el hospital fue, en mucho, una institucin dedicada ms a la caridad que a la curacin. Claro est que desde la poca del Renacimiento empez una ttansformacin importante del escenario hospitalario que, paulatinamente, lo fue secularizando y colocando en un sitio de importanda para el saber mdico, pero debido a la poca eficacia teraputica de la medicina, el hospital no dej de ser un sitio donde entraban los pobres para morir. Slo hasta finales del siglo XIX y comienzos del XX, con el impulso de los desarrollos de la anatoma patolgica, la fisiologa, la bacteriologa, la antisepsia y la asepsia, con la tecnificacin de la cimga y la anestesia, la incorporacin de las enfermeras al rol asistencial y el aumento de la eficacia teraputica de la medicina, entte ottos factores, el hospital empez a cobrar importancia como real escenario de curacin, lo cual transform profundamente la imagen del hospital. Ya no fue ms el lugar donde los pobres iban a morir, sino que empez a concebirse como el sitio donde los enfermos podan curarse. La gente y los propios mdicos empezaron a considerar al hospital como un centto de salud (Arroyave & Isaza, 1989; COE, 1984).

La nocin de personal mdico que aqu se usa es incluyente, es decir, con esta denominacin se esta haciendo referencia tanto al profesional de la medicina, como de la enfermera, odontologa, nutricin y terapias. Esto significa que muchas de las consideraciones que se hacen en este documento no se restringen a la profesin mdica. Sin embargo, dada la cercam'a que se tiene con el mundo de la medicina y la centralidad que esta profesin tiene dentro de la estructura asistencial, las reflexiones toman como eje la situacin de la educacin del profesional mdico.

375

La Salud Pblica Hoy

Las repercusiones de estos cambios fueron enormes. Aparte del cambio de imagen institucional y de actitud de las personas que participaban de la vida hospitalaria, el hospital empez a ser elegido como el lugar idneo para realizar ttatamientos quirrgicos y, por supuesto, para desarroUar tecnologa acorde con las exigencias de estos ttatamientos. Tambin se empez a requerir un tipo de profesional mdico un poco diferente al que se formaba anteriormente para la prctica privada, es decir, ms pragmtico en su labor, ms cercano a la tecnologa que se empezaba a desarrollar y ms dispuesto a ttabajar bajo los ritmos de una sociedad industrial. La especializacin fue un resultado de todos estos procesos, pero tambin fue la causa de una ttansformacin mayor dentto del hospital. Todo esto, aunado a los cambios que se haban suscitado anteriormente con la paulatina enttada de los mdicos en el hospital'*, los cuales incluan cambios en la disposicin de las salas de observacin, la clasificacin de los enfermos por tipos de enfermedad y la organizacin de los servicios de asistencia segn esta clasificacin, llevaron a que el hospital no slo fuera adquiriendo un mayor prestigio ante el pblico sino tambin ante los nsmos profesionales quienes enconttaban que el hospital les proporcionaba un escenario idneo para la identificacin de las enfermedades y para la adquisicin de los saberes prcticos frente al tratamiento de enfermedades especficas. El modelo Flexner que se instaur en Norteamrica a partir de los aos 20 del siglo XX como pauta organizativa de las escuelas de medicina y que despus, en el contexto de ]as pocas de posguerras y el surgimiento de EEUU como potencia mundial, se extendi a los pases europeos y, ms tardamente, en toda Amrica Latina, recogi las ttansformaciones que se estaban llevando en el campo de la medicina y del hospital y propici un cambio en la lgica del proceso de formacin del profesional mdico y elev a enunciado bsico el vnculo estrecho e ntimo, indispensable, entre la escuela de Medicina y el Hospital (Andrade, 1978).

Proceso que Foucaidt ha llamado medicalizacin de los hospitales (FOUCAULT, 1978).

376

Aproximaciones a un concepto de hospital lamersilario y algunas consideraciones sobre la crisis hospitalaria en Colombia

Desde comienzos del siglo XX la medicina empez a tener un referente centtal y esencial para su labor prctica, tanto en la dimensin teraputica e investigativa como en la dimensin educativa: el hospital. Y desde alh, se reconoce que la enseanza de la medicina requiere de un hospital para llevar a cabo, de manera idnea, el proceso de formacin de un profesional mdico. El hospital brinda un escenario donde se centtaliza, en mucho, el conocimiento de la enfermedad. All se aprende a identificar casos tpicos de enfermedades especficas, all se posibihta sistematizar una informacin esencial sobre el proceso de enfermedad de las personas que buscan ayuda, all se conttasta el saber de los Ubros con la realidad que proporciona el enfermo. Pero tambin, el hospital brinda el escenario para adquirir las competencias bsicas del ejercicio de la clrca': el juicio diagnstico, el juicio pronstico, el juicio teraputico y la habilidad tcnica para llevar a cabo tanto el diagnstico como el ttatamiento. El hospital tambin posibilita una aproximacin concreta al aparataje tecnolgico que sirve de apoyo para la labor del mdico y constituye un laboratorio de interaccin social donde se moldean las relaciones entte los diversos profesionales que conforman el equipo mdico. Qu implica asumir la nocin de hospital universitario? Creo que lo fundamental al reformular la idea de un hospital universitario* es entender que lo que hace de una institucin hospitalaria un hospital universitario es el vnculo y el compromiso que dicha institucin adquiere con las funciones esenciales de la universidad. Lo cual le imprime -o le debe imprimir- un carcter especfico y particular frente a las dems instituciones asistenciales.

Hay que recordar que la palabra clnica hace referencia a aquella actividad que el mdico desarrolla a la cabecera del enfermo. Este documento ha sido construido pensando en la idea de hospital universitario, como nocin genrica, respetando as la discusin que se ha venido desarrollando dentro de la Facultad de Medicina de la Universidad Nacional. Sin embargo, habra que evitar identificar la idea de HU exclusivamente con referencia a un hospital de cuarto nivel. De hecho, un HU bien puede ser un hospital de primero, segundo o tercer nivel. Esto implica que para una Facultad de Medicina, lo ideal sera tener un sistema hospitalario universitario que incluya los diversos niveles de complejidad.

377

:\...

La Salud Pblica Hoy

Ahora bien, dichas funciones suelen formularse comnmente como docencia, investigacin y extensin. Sin embargo, desde mi perspectiva, es necesario hacer ms explcitas estas funciones y por ello las he desglosado en seis funciones esenciales: 1) construccin de conocimiento, 2) generacin de pensamiento crtico, 3) formacin profesional, 4) reflexin pedaggica, 5) cualificacin de la opinin pblica y 6) formulacin de soluciones a problemas prioritarios'. Esto quiere decir que al pensar en un HU es necesario plantearse la pregunta de cmo dicho hospital va a cumplir con las funciones que se acaban de enumerar, pero ms an, es necesario tener en mente que el HU debe cumplir, como proyecto, con todas estas funciones. De tal manera, que un HU debe concebirse como un escenario acadmico, cientfico-tcnico, que tiene como funciones esenciales construir conocimiento sobre la enfermedad humana; generar un pensamiento crtico frente al saber tcnico existente; brindar un escenario de formacin prctica para profesionales en las diferentes profesiones del rea de la salud (medicina, enfermera, terapias, odontologa, etc); generar propuestas pedaggicas que ayuden en los procesos educativos del personal sanitario en cada una de sus especialidades; capacitar a los usuarios de los servicios tanto en el uso adecuado de los mismos como en pautas de educacin sanitaria y en los derechos a la asistencia sanitaria y a la seguridad social y, por lthno, resolver los problemas patolgicos que afectan a las personas que asisten al hospital, es decir, atender a las personas enfermas*. Por supuesto que para cumplir con estas funciones la institucin hospitalaria tiene que adecuar su estructura y realizar innovaciones en sus procesos administrativos que le permitan desarrollar de manera eficaz, eficiente y con la mayor cahdad y calidez todas las actividades que se requieren. Esto

En un artculo publicado hace un par de aos formul las cuatro primeras funciones en el contexto de una reflexin sobre la misin de la Universidad y, ms especficamente, de la Facultad de Medicina (ESLAVA, 1999). Hoy le agrego otras dos por considerar que son funciones esenciales de una universidad modema y, por supuesto, de una facultad de medicina modema. Seguramente en la discusin se ampliarn y complementarn estas funciones. Lo importante es reconocer las especificidades que adquiere el trabajo en un HU el cual, por cierto, debe ser parte esencial de una Facultad de Medicina que tambin debe responder por el cumplimiento de las fimciones esenciales de la Universidad en un espectro an mayor que el del Hospital.

378

Aproximaciones a un concepto de hospital universitario y algunas consideraciones sobre la crisis hospitalaria en Colombia

imphca un ttabajo conjunto que involucra a personal de diferentes profesiones. Aqu queda abierta la puerta a los diversos proyectos multi e interdisciplinarios que se han venido sugiriendo, de tiempo atrs, como opciones de trabajo hacia futuro, y a todas las propuestas que surjan para la construccin de nuevos modelos de asistencia y formas alternas de vnculo docente-asistencial (Acua, 1977; Ferteira, 1981; Vidal & Quiones, 1986; UN, 2001) Todas las adecuaciones y especificidades organizativas que implica la propuesta de constmir un HU seguramente generarn costos y esfuerzos adicionales que es necesario contemplar y defender. Esto implica que el asumir la particularidad de un HU requiere la formulacin de indicadores de gestin y de impacto un poco diferentes al resto de las entidades prestadoras de servicios de salud en la medida en que el papel del HU tiene alcances diferentes a cualquier otto hospital. Estos indicadores tienen que construirse al mismo tiempo que se planean las esttategias de evaluacin de las acciones. Como se ve, plantear un HU es un asunto serio que requiere un enorme esfuerzo por parte de los proponentes, as como una inquebrantable voluntad poltica de los pattocinadores, quienes tendrn que ser generosos en la ayuda y el apoyo que brinden puesto que lo que est en juego es un enorme proyecto innovador que no tiene mayores referentes empricos con los cuales contrastar los logros o los yerros, Claro est que, a pesar de la particularidad y el esfuerzo excedente, los servicios asistenciales de un HU no pueden ser inferiores a los que realizan los ottos hospitales y las dinmicas financieras, los procesos contables y la transparencia en el manejo de los recursos deben estar a la altura de las ms shdas -y honestas- empresas prestadoras de servicios de salud. El reto es enorme y enorme ser la brega poltica para poder desarrollar -y ejecutar- una propuesta que, recogiendo lo planteado aqu frente a las caractersticas de un HU, se inserte en la dinmica hospitalaria nacional. Los obstculos generados por la crisis hospitalaria Aunque existen opiniones distintas y an conttadictorias frente a la valoracin de la situacin de los hospitales, se puede decir que hoy en da se vive una crisis hospitalaria a nivel nacional, no en el sentido de que la totalidad

379

La Salud Pblica Hoy

de la red hospitalaria est al borde del cierre sino, ms bien, en el sentido de que una buena parte de dicha red, a todo lo largo del territorio nacional, presenta grandes dificultades financieras y notorias insuficiencias admiisttativas lo que conlleva una debilidad general de la red de servicios'. Esta crisis se manifiesta en una grave iliquidez de las instituciones prestadoras de servicios de atencin mdica y, por tanto, sus causas estn en directa relacin con la recesin econmica que afecta a la economa del pas y los problemas en el flujo de recursos en el sector salud. Sin embargo, se reconoce que la crisis ttasciende el mbito financiero y toca lo concerniente a los aspectos administrativos, de gestin, tcnicos y laborales (Gamarra, 1999; Gmez, 2001; Serra & Gmez, 2001). Ahora bien, esta grave situacin que ha estado ahogando a los hospitales generales se toma an ms asfixiante para los hospitales universitarios en la medida en que a estos se les exige, por un lado, mayores logros debido a su condicin de centros de docencia, asistencia e investigacin y, por otto lado, iguales resultados a nivel financiero. Como quien dice, se les pide que hagan mucho ms con el mismo volumen de recursos. Esto se evidencia en la falta de legislacin especfica para los HU, lo que evidencia que se asume que ellos deben reglarse por las mismas lgicas de mercado que las dems instituciones hospitalarias'". Otto problema generado por la crisis hospitalaria y que tiene hondas repercusiones para los hospitales universitarios es el dbil desarrollo cientficotecnolgico en el mbito asistencial. La iliquidez de las instituciones ha llevado a que sea imposible invertir en desarrollo y adecuacin tecnolgica y, mucho menos, en investigacin. Ms an, la necesidad de sobrevivir en

Es importante resaltar que, en este tema lgido, existen diversas posiciones. Desde aquellas que asumen que no existe crisis hospitalaria hasta aquellas que sealan como nefasta la situacin actual de los hospitales, pasando por aquellas que ven en la crisis una gran oportunidad para consolidar los cambios efectuados en los ltimos aos (Henao, 1999; Cspedes, 1999; Prez, 1997; Uribe, 1999). Muy recientemente se formul la ley 735 de 2002 (febrero 27) donde se define, de manera explcita, qu es un hospital imiversitario. Habr que evaluar que implicaciones puede tener una norma como sta (COLOMBIA, 2002).

380

Aproximaciones a un concepto de hospital universitario y algunas consideraciones sobre la crisis hospitalaria en Colombia

las condiciones actuales ha replanteado las relaciones entte los hospitales y las universidades, donde estas ltimas son vistas por los primeros como una fuente de recursos adicionales, es decir, las universidades son asumidas como Chentes a quienes se les venden servicios. Un tercer problema que se ha presentado, tiene que ver con el desequihbrio en la financiacin de los hospitales segn los niveles de atencin. Como lo evidencia la informacin recopilada por el Ministerio de Salud, ha existido un crecimiento inequitativo de los ingresos de los hospitales pblicos o financiados por el Estado donde los hospitales de nivel 1 han conseguido incrementos muy superiores al de los hospitales de nivel II y III (Ministerio de Salud). Esto tiene un impacto dhecto en los HU en la medida en que ellos, por ttadicin, han sido instituciones de rvel III. Un cuarto problema que se ha generado es la difcil conciliacin que ha existido entte el conttol de costos y las funciones docentes. Debido a las grandes dificultades financieras, as como a los criterios adnnistrativos hoy en boga, se asume que el ttabajo docente y la formacin de estudiantes, especialmente de pregrado, son un costo que las instituciones no estn dispuestas a aceptar. Es por eUo que cada vez es ms difcil justificar la accin docente como funcin esencial de los servicios de salud. Por ltimo, el desequilibrio de poder que se ha instaurado entte las EPS y las IPS, a favor de las primeras, as como la visin mercantil de corto plazo que se ha erigido como hegemnica en el sistema hacen difcil convencer a las EPS de que exploren y ensayen, junto con las universidades, nuevos modelos de atencin a la poblacin as como hacer que ellas ayuden a concebir al HU como un proyecto universitario donde se articula la asistencia a la docencia e investigacin y donde se aunan las preocupaciones cienti'ficotcnicas, con las preocupaciones estticas, polticas, arquitectnicas y socioculturales. Los obstculos son inmensos y las propuestas aun brillan por su carcter absttacto. Sin embargo, es necesario seguir insistiendo en la necesidad de construir un hospital universitario, como proyecto acadmico-asistencial y como institucin viable dentto de una realidad hospitalaria crtica y por eUo mismo Uena de opormnidades por explorar.

381

La Salud PbUca Hoy

Referencias bibliogrficas ACUA, Hctor. "El papel del hospital en la formacin del mdico general para la atencin primaria". Boletn de la Oficina Sanitaria Paruxmericana 82(3): 191-196, 1977. ANDRADE, Jorge. "Marco conceptual de la educacin mdica en Amrica Latina". Educacin Mdica y Salud 12(2): 149-166, 1978. ARROYAVE, Mara Gilma; ISAZA, Pablo. "Una perspectiva histrica del hospital". Educacin Mdica y Salud 23(2): 182-191, 1989. CSPEDES, Juan Eduardo. "Qu lecciones deja la crisis financiera de las IPS?". Seguridad Social al Da 15: 23-25, 1999. COE, Rodney. "La evolucin del hospital modemo". Sociologa de la Medicina, Ahanza Editorial, Madrid: 271-302, 1984. Colombia-Congreso de la Repblica, Ley 735/2002 (febrero 27) "por la cual se declaran monumentos nacionales el Hospital San Juan de Dios y el Instimto Materno Infantil; se adoptan medidas para la educacin universitaria y se dictan ottas disposiciones". Material tomado del Diario Oficial versin en internet. Diario 44.726; 01/03/2002 (http:// aricaurte.imprenta.gov.co/diario/diario.nivel4), 2002. ESLAVA, Juan Carlos. "Reflexiones sobre la planeacin esttatgica en la Facultad de Medicina y algunos lineamientos para el futuro". Revista de la Facultad de Medicina U.N Col. 47(1): 107-110, 1999. FERREIRA, Jos Roberto. "La necesidad de colaboracin efectiva entte la educacin mdica y el servicio de salud". Educacin Mdica y Salud 15(2): 154-165, 1981. FOUCAULT, Michel. "Incorporacin del hospital en la tecnologa moderna". Educacin Mdica y Salud 12( 1): 20-34, 1978. GAMARRA, Luz Marina. "SOS hospitalario". Seguridad Social al Da 15: 17-19, 1999.

382

Aproximaciones a un concepto de hospital umversitario y algunas consideraciones sobre la crisis hospitalaria en Colombia

GMEZ VARGAS, Ins. "Sistema de Salud: en sala de recuperacin". Trabajo Seguridad Social 7(41): 6-9, 2001. HENAO, Elsa Victoria. "Radiografa de una crisis anunciada". Seguridad Social al Da 15: 14-16, 1999. MEDICI, Andr Csar. "Los Hospitales Uiversitarios: pasado, presente y futuro". Cuademos Mdico Sociales 79: 119-128, 2001. Ministerio de Salud, Direccin General de Financiamento y Gestin Financiera (sf). Tablas de composicin de los ingresos de hospitales de la red pblica 1993-1999 (material en fotocopia). PREZ CALLE, Francisco. "La autofinanciacin de los hospitales pbhcos". Va Salud 3 (septiembre): 4-10, 1997. SERRA, Mauricio; GMEZ, Luis Femando et. al. "Pertinencia de remisiones generadas en la red adscrita de la Secretaria Distrital de Salud de Bogot". Investigaciones en Seguridad Social y Salud 3: 47-74, 2001. Universidad Nacional. Red Salud. Taller Hospital Universitario: Relatoras. Noviembre, material indito, 2001. URIBE, Juan Pablo. "Crisis en el Sector Salud?". Va Salud!: 36-38, 1999. VIDAL, Carlos, QUIONES, Jos. "Integracin Docente-Asistencial". Educacin Mdica y Salud 10(1): 1-18, 1986.

383

La salud en las campaas presidenciales en Colombia


PEDRO ELAS GALINDO LEN

La poltica pbhca en salud como tema centtal en las campaas presidenciales en el actual debate electoral, expresa el significado que para cada uno de los candidatos a la Presidencia de la Repblica tiene la seguridad social de los ciudadanos, define la perspectiva que propone de la disnnucin de las condiciones existentes de equidad, establece la forma de consohdacin de la sociedad colombiana y presenta la opcin que considera factible para la solucin del chma de la situacin de inequidad existente. En primer trmino me referir a la relacin entte poltica y salud desde unos elementos tericos bsicos para la comprensin y el anhsis de las polticas pbhcas, y establecer la naturaleza de una poltica de Estado y luego de emitida la normatividad actual que regula el derecho a la salud, establecer la gestin pendiente de realizacin, planes que se estn desarrollando o en curso y finalmente presentar analticamente las propuestas de gobiemo de cada uno de los candidatos a la presidencia, segn las encuestas presentadas la semana que termina y tomando los cuatto de mayor opcin' en la encuesta realizada, sin importar el porcentaje establecido en eUa.

Los candidatos presidenciales a la fecha son ocho, pero solamente tomar las candidanuas presidenciales de Luis Eduardo Garzn, Noem Samn, Alvaro Uribe y Horacio Serpa quienes han venido sosteniendo un debate programtico en escenarios cerrados gremiales y acadmicos, compartidos por los cuatro, dadas las caractersticas de inseguridad de la acmal campaa para efectuar un debate pblico abierto.

385

La Salud Pblica Hoy

Para abordar el examen de la salud en las campaas presidenciales en Colombia, partiremos de ttes preguntas centtales que den respuesta a la problemtica de salud y nos presenten un panorama de cada programa de gobiemo, a saber: Cules son las polticas de Estado que estn establecidas? Cules son las polticas programticas que propone cada candidato y qu inttoducir como respuesta a las necesidades en salud? Qu va hacer el 8 de agosto de 2002 el da que est actuando como presidente, en relacin con los compromisos adquiridos por el pas y con la sociedad segn las prioridades de las necesidades sociales? Figura 2.1

Nivel de la Poltica Pblica

Valores

Programas

Gestin

Solidaridad Igualdad Libertad

Nios toman leche

Colas en Urgencias

En primer lugar tenemos que considerar la poltica pblica en su verdadera dimensin, ms all de entenderla como la accin u omisin de un gobierno, para colocarla en trminos de su propsito poltico. Considerarla solamente gestin es examinarla por la operacin burocrtica de un operador tecnolgico, como, por ejemplo, la solucin de las largas y consuetudinarias colas que vemos en el ISS, que son un problema que debe solucionar el jefe de urgencias o si el problema se hace crnico ocupara al director de la clnica. Es una prdida de eficiencia en la accin del Estado si el problema requiere la intervencin del director del Instituto o se convierte en el centto de una propuesta programtica electoral. Un segundo nivel de la poltica pblica es proponer la esttategia poltica a partir de simples programas que ttatan de suplir una necesidad social reconocida y que obliga ser satisfecha. Proponer como perspectiva programtica

386

La salud en las campaas presidenciales en Colombia

polticas de alcance operativo nos Uevara a propuestas demaggicas y de poco alcance sin una respuesta real en la construccin de una cultura poltica en la sociedad, como, por ejemplo, llegar a plantear aparentes soluciones a lo obvio y que muchas veces slo responde a vergenzas de la poltica y la economa. Decir que los nios toman leche es jugar con una ausencia de accin del Estado y colocarlo en el debate que podra inducir a pensar si este candidato o candidata no gana entonces, los nios no tomarn leche? El tercer nivel, el que nos mteresa en las pohticas pbhcas, es el que construye sociedad, l propone una forma de sociedad y se expresa en su organizacin. La propuesta que se expresa como valores articuladores como son: la libertad, la igualdad y la sohdaridad, cuyo desarroUo cumple con organizar una sociedad y contribuir en el afianzamiento de los valores que la constituyen y compensan los desequilibrios de acceso y ejercicio de esos valores. Figura 2.2 Estado y Gobierno

Polticas de Estado

Barco Gaviria

Samper Pastrana

????

1989

1990

1994

1998

2002

Las polticas establecidas como procedimientos de Estado, que corresponden al mbito de organizacin de la sociedad en una perspectiva de sentido con un propsito legtimo, que la acdn poltica interpreta desde la accin colectiva de los actores y los individuos, en la sociedad. Las polticas de gobiemo cumplen en condiciones de gobemabilidad, la accin del ejecutivo en el ejercicio pohtico para cumphr las polticas de Estado, en el marco de un determinado plan de desarrollo con arreglo a manejos de largo plazo que definan la organizacin futura de la sociedad. Puede un determinado gobiemo formular pohticas de Estado y debe disear polticas de gobiemo.

387

La Salud Pblica Hoy

La constitucin establece los elementos que deben ser tomadas en cuenta para defir la poltica de Estado en materia de salud y seguridad social. La ley 100 de 1993 establece la institucionahdad que el sistema de salud debe tener para el propsito constitucional y es a la vez la expresin de una poltica de Estado trazada para los prximos 50 aos. Su desartollo depende y debe ser evaluado desde el impacto que esa ley tiene en el desarrollo de la democracia participativa y en la solucin a condiciones de inequidad existentes. Podemos decir que existe una poltica de Estado en salud cuya esencia es la prevencin de la prdida de la salud y el establecinento de una condicin de vida digna para todas las personas por parte del Estado y con la participacin del capital privado. La poltica de Estado en salud est construida para un perodo que podramos considerar de 50 aos, dependiendo de la dinmica social que la legitime. La pohtica de Estado ha tenido diferentes esttategias de gobiemo. Durante el ao final del gobiemo del presidente Barco (1989-1990) se establecieron las condiciones para que el estado cediera al capital privado las actividades rentables que desarrollara. Durante el gobiemo Gaviria (1990-1994) se cambiaron las bases constitucionales y se establecieron las bases de la poltica pbhca de Estado en materia de seguridad social y a la vez se establecieron en la ley 100 de 1993 la naturaleza que tendra el sistema de seguridad en salud, los principios que lo regiran y los fines que alcanzara a cumplir, no pudo ir ms all de disear el sistema. Es durante el gobiemo Samper (1994-1998) que el sistema se organiza para su gestin e inicia su funcionamiento con la puesta en Marcha de la propuesta del Departamento Nacional de Planeacin, que elabora la encuesta para establecer el Sistema de Atencin a Beneficiarios (SISBEN), que a la postte se convierte en el documento definitivo para prestar el servicio de salud a quien no deriva sus ingresos del ttabajo asalariado o la ganancia sobre la renta gravable. Los impuestos de recaudo privado -cotizacin en salud- al ser distribuidos acumulan grandes propordones de dinero que repartidos a ttavs del SISBEN, permiten el acceso a cinco millones de colombianos que no haban tenido acceso a la salud hasta ese momento. Podramos decir que, Samper disfruta y reparte los recaudos establecidos por la ley, al punto tal que considero que es la base de la gobemabUidad que ante el proceso de acusacin en la Cmara de Representantes le permite mantenerse en el ejercicio de la presidencia.

388

La scdud en las campafias presidenciales en Colombia

Las necesidades de ajuste al funcionamiento del sistema y los problemas que se presenten en el desarrollo del instrumental necesario para la operacin del sistema es el programa de gobiemo del presidente Pasttana (1998 2002) y debe resolver sobre la crisis del sistema en su operacin y corregir los problemas que se estn generando en el flujo de los ros de dinero del sistema de salud, cuyos montos no se ven llegar a su destino l a sus destinatarios
1.(1

.^.

La poltica actual Provisin de servicios de salud a toda la poblacin mediante la implantacin del SGSS en salud y fortalecimiento de la gestin descenttaUzada y en salud pbhca. La poltica actual est establecida en documentos de planeacin nacional: "Las polticas actuales del sector se orientan fundamentalmente a la provisin de servicios de salud a toda la poblacin mediante la implantacin del Sistema General de Seguridad Social en Salud y el fortalecimiento de la gestin descenttalizada y en salud pbhca. Estas lneas de poltica son abordadas dentto del Plan Nadonal de Desarrollo 1998 - 2002. A travs de stas el sector pretende avanzar en la obtencin de mejores niveles de salud y bienestar para toda la poblacin, incorporando mecanismos solidarios en el financiamiento y adoptando esttategias para una gestin ms eficiente y eficaz"^. La poltica del actual gobiemo no deja claramente establecido, si la prioridad es una esttategia en salud o es parte de una poltica de descenttalizacin. Por otta parte define la reorientacin del sistema de salud desde otto problema, el de las finanzas. "La supervivencia del actual sistema de salud depende en gran medida. Los requerimientos financieros y organizativos no estn definidos y establecidos los trnnos financieros. Dados los principios planteados por la Ley sobre solidaridad, equidad, acceso y calidad, la viabilidad financiera del nuevo sistema recae en el uso eficiente que se haga de los reciu-sos del sistema y de los conttoles que permitan erradicar los problemas actuales de evasin y elusin". Esto coloca en relacin con

D E P A R T A M E N T O NACIONAL DE PLANEACIN: Informe Sectorial en Salud. Documento publicado en Pgina Web, vigente el 20 de abril de 2002

389

La Salud Pblica Hoy

los compromisos internacionales de Colombia, sobre el manejo de las finanzas pblicas y, por tanto, define y limita la accin del actual gobiemo en la planeadn establecida en el Plan de Desarrollo 1998 - 2002. La supervivencia del actual sistema de salud depende en gran medida de su sostenibilidad en tnrnos financieros, Pero los requirimientos financieros y organizativos no estn definidos y establecidos. Colocar el centto de la problemtica en salud en la gestin y en el financiamiento del sistema resuelve argumentalmente el problema de la cobertura del derecho a la salud y define la proyeccin del sistema segn su rentabilidad. El sistema adolece de una eficiente estructura organizativa y por tanto el conttol y la eficacia del sistema es an una expectativa. En trminos del ex presidente Lpez "Los requerimientos financieros y organizativos no estn definidos y establecidos". Por tanto estamos ante el problema de las finanzas pblicas para el sostenirrento del sistema de Salud, as como de la capacidad de la economa del pas para mantener el funcionamiento del sistema que est enttando en crisis. Los ingresos de la nacin juegan entonces en la compresin del problema y examinemos brevemente la capacidad del Estado para cumplir con las obligaciones en salud. Los ingresos ms grandes de la nacin para el ao 2002, cortesponden a: pettleo, 3.000 millones de dlares, caf 1.200 millones de dlares y el Hermano Lejano 800 millones de dlares. Sin embargo, para el ao prximo la situacin de ingresos en dlares cambiar: el pettleo se acaba el ao enttante, ya estaremos a la puerta de la importacin, el caf se est vendiendo a 0.68 centavos por debajo del costo de produccin de 0.74. El competidor lo produce a 0.21 centavos. El hermano lejano, 4 millones de colombianos, refugiados econmicos de Colombia en diversos pases, aumenta sus envos de dinero, en proporciones cada vez mayores que podran calcularse para el ao prximo en dos mil millones de dlares. Es la nica fuente de ingresos que en Colombia crece, porque el recurso de mayor exportacin, el pettleo tambin decaer como el caf. El recurso petrolero se explot aceleradamente sin que en el perodo exportador se enconttara un nuevo yacimiento que supliera la velocidad de exportacin, y de enconttarlo en el momento actual, ese campo slo sera

390

La salud en las campaas presidenciales en Colombia

productivo en un perodo entte seis y diez aos. La cada en la curva de produccin en dos aos no alcanzar para cumplir con las necesidades de la refinacin y el consumo intemo lo que nos colocara en el escenario como importadores de petrleo por valor equivalente, superior a la actual deuda extema pblica y privada. Pero el pettleo tambin aporta el 11% del PIB, y las ttansferencias a la nacin son superiores al 25 % de los gastos del gobiemo, por tanto la crisis en el pettleo generar un problema en los ingresos del gobiemo. No podemos entonces confiar en esta otta fuente de ingresos en el presupuesto de la nacin y por el conttario se percibe una situacin de crisis cuya solucin afectar los gastos de salud, segn la dinmica que en la poltica de salud se plantea. La cuarta forma de nuesttos ingresos en dlares est determinada por las buenas realizaciones con el Fondo Monetario Internacional y depende del cumplimiento de los acuerdos realizados ya sea por sohcitud nuestra o por monitoreo de acuerdos. El 20 de diciembre de 2001 el Ministto de Hacienda, Juan Manuel Santos, dirigi una carta al FMI^, con relacin al cumplimento del Acuerdo de Intencin firmado entre el pas y el fondo. En la que podemos dar cuenta del manejo de la salud y de las esperanzas que la salud tiene desde esos compromisos, i En cuanto a las reformas estmcturales realizadas el ministro Santos le informa al Fondo:
20. La agenda de reforma estructural del gobiemo incluye medidas ambiciosas dirigidas a aumentar la eficiencia de la economa, estimular el crecimiento econmico e impulsar el progreso social Con tales fines, se ha puesto en marcha hasta el momento un amplio nmero de reformas, dentro del programa a tres aos...

Ministerio de Hacienda y Crdito Pblico. Banco de la Repblica. Carta al FMI el 20 de diciembre de 2001, firmada por Juan Manuel Santos Ministro de Hacienda y Crdito Pblico y Miguel Urrutia gerente general del Banco de la Repblica. Disponible en pgina Web del Banco de la Repblica, Documentos Econmicos.

391

La Salud Pblica Hoy

El gobiemo central en conjunto con los gobiemos territoriales, tambin ha estado implementando la ley de ajuste fiscal de las entidades territoriales (Ley 617) de la cual se espera la generacin de ahorros fiscales pennanentes, la mejora del perfil de la deuda de las entidades territoriales al tiempo que se previene la aparicin de obligaciones contingentes sin financiamiento, y el refuerzo de la capacidad administrativa de los gobiemos locales. El gobiemo tambin ha presentado al Congreso un proyecto para mejorar el control y la asignacin de los fondos provenientes de las participaciones en los recaudos, especialmente mediante el fortalecimiento de los controles sobre los gastos en educacin y salud (reforma de la Ley 60).

De igual manera, le informa en el numeral 22 de la carta qu gestiones estn pendientes sobre el ISS: , .22. Se han adoptado medidas para revertir el deterioro financiero del servicio de salud del Instituto de los Seguros Sociales (ISS). Con tal propsito, se ha adoptado un plan de reestructuracin de amplia cobertura el cual se est implementando. Los principales elementos del plan incluyen una renegociacin sin precedentes de la convencin colectiva con los trabajadores de la salud terminada en octubre de 2001, la cual reduce beneficios salariales y pensinales; un conjunto de medidas para aumentar la eficiencia de las operaciones del ISS y la reestructuracin de la deuda del ISS. Se ha decidido reducir an ms los costos del ISS a travs de una distribucin ms equitativa de la carga financiera relacionada con enfermedades cuya atencin es muy costosa, entre los proveedores de seguros de salud. Adems, recientemente la Superintendencia de Salud levant la sancin que impeda al ISS el aumento del nmero de sus afiliados; esta determinacin le permitir al ISS incrementar su ingreso y contribuir adicionalmente a la reduccin de su dficit. Estas reformas incorporan ahorros significativos que reducirn el dficit de caja del sistema de salud en 0,2 por ciento del PIB anual a partir de 2002, y eliminarn su dficit operativo antes defines de 2005.

Y en el numeral 23 establece las restricciones a que ser sometido el gasto en salud:


23. La reforma del sistema de transferencia de recaudos a los gobiemos territoriales que fue adoptada a travs de una enmienda constitucioruil en junio, ser complementada con la modificacin de la Ley 60. Los cambios propuestos en esta ley, presentados al Congreso en septiembre, mejorarn la eficiencia en el uso de fondos provenientes de participacin en los recaudos y fortalecern el control sobre el uso de estos recursos.... En el rea de la salud, las funciones de cada jurisdiccin estn siendo clarificadas; algunas instituciones intermediarias sern elim-

392

La scdud en las campaas presidenciales en Colombia

nadas; y tambin se establecern indicadores basados en el desempeo. Aunque no se espera que esta ley genere ahorros fiscales, contribuir a generar ganancias significativas en eficiencia que permitirn urm ampliacin de la cobertura en la prestacin de estos servicios.

Para la nueva revisin que debera reahzarse en febrero 2002, pero que dadas algunas dificultades sohcitan la siguiente visita del Fondo en septiembre de 2002:
34. Las autoridades Colombianas reafirman sus compromisos de poUtica bajo el programa apoyado por el acuerdo extendido aprobado por el Fondo en diciembre de 1999, y solicitan la terminacin de la tercera revisin bajo los trminos acordados. Al mismo tiempo, las autoridades solicitan una exencin por el exceso tcnico menor sobre el techo del dficit del sector pblico combinado afinles de junio de 2001. En vista de las demoras en concluir la discusin para la tercera revisin del programa, no se fijaron criterios de desempeo para septiembre y diciembre de 2001; las autoridades solicitan que los desembolsos correspondientes al cumplimiento de los criterios de desempeo para esas fechas se hagan disponibles en 2002. En vista de la demora en concluir la tercera revisin del programa, las autoridades tambin proponen que la fecha para la cuarta revisin sea cambiada para septiembre 15 de 2002.

Sin embargo, a cuatto meses de la finalizacin del perodo presidencial actual, y ya concluidas las sesiones del congreso y el pas en proceso electoral, el ministto Santos dio su pronto informe al pas de las gestiones realizadas en la columna de su autora, publicada en el nico peridico de circulacin diaria nacional, all presenta las siete mediadas ms importantes de su administtacin en el Ministerio": 1. 2. 3. 4. Reforma tributaria que aumenta el ingreso en 1.8 del PIB, Reforma constitucional que modific el sistema de transferencias, Ley sobre indisciplina fiscal territorial y control al gobiemo, Cambio en la ley 60 que corrige la deficiencia del gasto en salud y educacin, 5. Reforma pensional que haga viable el sistema a largo plazo.

SANTOS, Juan Manuel. Se ha hecho mucho pero falta. El Tiempo, 7 de abril de 2002 pg. 1-22.

393

La Salud PbUca Hoy

6. Pendiente y avanzado el proceso de elaboracin de la Ley de responsabihdad fiscal para evitar la borrachera presupuestal de los prximos gobiemos y, 7. La prxima elaboracin de presupuestos austeros para la reduccin del dficit acordado con el FMI. En lo que respecta a la salud, las medidas 2, 3, 4, 6 y siete afectan el gasto en salud. Estn an pendientes de definicin las leyes de responsabilidad fiscal y la reforma pensional que sern discutidas en el prximo perodo de sesiones del siguiente gobiemo, que deber presentar los proyectos respectivos. A pesar de la falta de las dos leyes, las condiciones establecidas en la dems legislacin obligan a su aphcacin como por ejemplo el acto legislativo 01 de 2001 y la ley 715 de 2001. Retos del Prximo Gobierno Hasta este punto nos hemos ocupado a propsito de las campaas presidenciales de los usos y las fuentes del dinero de la nacin y el Estado. No estamos haciendo un anlisis de las fuentes de financiamiento en salud como son: presupuesto nacional, recursos de la seguridad social del FOSYGA, recursos pblicos del orden territorial, ttansferencias a las entidades territoriales, rentas cedidas, recursos propios, regahas, juegos locahzados o crditos porque cortesponden a la forma como el gobiemo articula las herramientas disponibles para su programa de gobiemo con arteglo a la pohtica de Estado. Tampoco nuestto anhsis se centta en la funcin de los departamentos, muicipios y distritos en lo que corresponde a la direccin y organizacin de los servicios de salud para garantizar, la salud pblica y la oferta de servicios de salud a ttavs de instituciones pblicas, por conttatacin de servicios o mediante la entrega de subsidios a la demanda o rgimen subsidiado, porque corresponde al modelo de gestin del gobiemo segn los mecanismos de gestin disponibles para su propsito gubemamental. Al igual no nos hemos ocupado, analticamente, de las particularidades relativas al SGSSS a nivel territorial de la integracin por Instituciones de direccin, la autoridad territorial, las direcciones departamentales, distritales y municipales de salud, las entidades aseguradoras (EPS, ARS y ESS) y las entidades de prestacin de servicios (IPS). Como tampoco la accin colee-

394

La salud en las campaas presidenciales en Colombia

tiva y pbhca en relacin con el conjunto de acciones en salud y conttol de los factores de riesgo, por corresponder a las habilidades instrumentales de quienes reahzan la gestin de pohtica pbhca en el desartoUo de su funcin y su capacidad de concertacin con los actores, acorde a sentido y propsito de la accin social. El acto legislativo 01 de 2001, reduce el crecimiento de ttansferencias que debe hacer el gobiemo centtal a las regiones y por medio de la ley 715 de 2001, crea el Sistema General de Participaciones, constituido por los recursos que la nacin ttansfiere por mandato de los artculos 356 y 357 de la Constitucin Poltica a las entidades territoriales, para la financiacin de los servicios con base a un monto de diez punto novecientos sesenta y dos (10.962) billones de pesos de 2001, que crecer segn lo establecido en el artculo 357 de la CN. Al igual, esa ley establece que de ese monto se descontar el 4% para ottas obUgaciones constitucionales y que la participacin con destinacin especfica para el sector salud, que se denonnar participacin para salud, le cortesponder el 24.5% del monto restante. Le corresponder a cada municipio una proporcin establecida segn la capitacin, o sea la cantidad de personas beneficiarias establecidas para el municipio en cuestin. La bolsa establecida de 74 biUones de pesos crecer anualmente segn el procedimiento establecido constimdonalmente, y se destinar para la salud en el ao 2003 la suma de $ 3,2 biUones, en el 2004 la suma de $ 3,8 billones, en el 2005 la suma de $ 4,7 billones, en el 2006 la suma de $ 5,8 biUones. Es decir, est definido por ley de la repbhca el monto de las ttansferencias a los municipios y la cantidad de dinero que se destinar a salud. El presidente nombrado dispondr de un total de $17.4 billones de pesos para salud. Cualquier propuesta adicional en salud ya ha sido conttolada por la pohtica de ajuste de las finanzas pbhcas. La salud en la ley 715 qued definida segn unas asignaciones de dinero, segn polticas de ajuste del gasto. Esto significa que el servicio de salud en las regiones depender de los agmpamientos que efecten los municipios para poder garantizar servicios de salud, y que las regiones de baja densidad de pobladn sufiirn las consecuencias de su alejamiento de los centtos urbanos, como por ejemplo, los departamentos del oriente colombiano: Arauca, Guaim'a, Guaviare, Vichada, Meta, Caquet, Putumayo y Amazonas.

395

La Salud Pblica Hoy

La ley 715 resuelve el problema que generaba para el conttol del dinero la multiplicidad de fuentes de financiacin y modifica el sistema de asignacin de los recursos, que segn los expertos del manejo de la ley 100 era el principal escollo para su cortecto funcionamiento y pemta la elusin y desviacin de los dineros de la seguridad en salud. Queda pendiente despus de esta ley resolver las dificultades de las EPS y el ajuste del ISS. Por tanto, en el ao inicial de la ley se deber "definir, implantar y evaluar la Pohtica de Prestacin de Servicios de Salud. En ejercicio de esta facultad regular la oferta pbUca y privada de servicios, estableciendo las normas para conttolar su crecimiento, mecanismos para la hbre eleccin de prestadores por parte de los usuarios y la garanti'a de la caUdad; as como la promocin de la organizacin de redes de prestacin de servicios de salud, entte ottos'". La ley 715 establece dos tareas principales: afiliar a la poblacin pobre y acelerar el subsidio a la demanda en la prestacin de servicios de salud. El artculo 43 establece: gestionar la prestacin de los servicios de salud, de manera oportuna, eficiente y con calidad a la poblacin pobre en lo no cubierto con subsidios a la demanda, que resida en su jurisdiccin, mediante instituciones prestadoras de servicios de salud pblicas o privadas. En definitiva la ley se refiere a una clase distinta de salud, la salud para los pobres, y as toda la ley va a expresar esa poltica discriminatoria que define como objeto de atencin en salud a lo catalogado bajo el criterio econmico de "los pobres", y a ellos se les destina segn agmpamiento en cabeceras y un dinero congelado de los ingresos de la nacin, bajo supuestos criterios de racionalizacin del gasto. Igualmente como lo estableciera el expresidente Lpez: "Enttegar a los municipios la responsabihdad de atender la salud de la poblacin pobre, ajena al rgimen contributivo, consolida la tendencia a estatizar el sector, sin que se llegue a una solucin, puesto que tampoco las entidades territoriales tienen la capacidad tcnica, cientfica, administtativa y econmico-financiera para asumir la asistencia pblica. Lo lgico sera reservar la gestin estatal a munidpios donde no existe cubrimiento de entidades del sistema".

Artculo 4214 de la U y 715 de 2001.

396

La salud en las campaas presidenciales en Colombia

Tambin estn en curso y limitan las propuestas de las campaas electorales, los planes ya definidos con arreglo a la consin de reestmcturacin del gasto pblico y que el Departamento Nacional de Planeacin, ha puesto en marcha. Que en su "Proyecto de reestmcturacin de Hospitales Pblicos de nivel 11 y n i de Complejidad", establecen las metas contempladas en los convenios de desempeo suscritas en cada uno de los hospitales tanto en su parte administrativa y financiera y la evaluacin de cada uno de los componentes. El supuesto de ttabajo establece que "El inadecuado flujo de recursos y el incremento en los volmenes y tiempos de la cartera, amenazan en forma importante la liquidez y sostenibilidad de las instituciones, especialmente aquellas que han hecho esfuerzos por incrementar sus ventas de servicios, dependiendo cada vez menos de los recursos oferta". La primera fase de este programa establece la reestmcturacin y adecuacin institucional de 27 hospitales pblicos de rvel 2 y 3 de complejidad cuyo financiamiento es de $146.288 nUones. El objetivo es, en primer lugar, adecuar la estractiu^a de recurso humano, administtativa y de prestacin de servicios para aumentar la productividad y, en segundo lugar, hacer posible el autofinanciamiento de estos hospitales mediante la venta de sus propios servicios. Pero, para planeacin nacional un problema de gran importancia en la "ineficiencia de los hospitales pblicos", es la atencin de los pobres de que habla la ley 715: "Otto factor que se suma, para aqueUos hospitales que facturan ms de lo que reciben, y hace an ms serio el problema, es que el 58% de los servicios prestados corresponden a vinculados, seguidos por el rgimen subsidiado que a su vez es donde tiene mayor concenttacin la cartera con un 43,98% en promedio". La situacin de los hospitales parece ya estar predeterminada. Finalmente, segn la comisin de racionalizacin del gasto y el acuerdo de intencin con el FMI establecen el futuro del Seguro Social con base a cinco medidas de gestin: 1-Adecuar las 35 clnicas al Esquema de ESE, 2Separar la EPS de la IPS, 3- Cumplir la funcin de ARP para empresas de bajo capital, 4- Centrarse en el rgimen conttibutivo y 5- Establecer alternativas que lo garanticen.

397

La Salud Pblica Hoy

Establecidos los compronsos adquiridos por el pas, las restricciones que operan desde las polticas de Estado y los programas en curso podemos, entonces abordar las propuestas que hacen los candidatos a la presidencia de la repbhca y podremos sopesar la justeza y alcances de sus propuestas para solucionar las demandas en salud de la sociedad. Agendas polticas en la campaa electoral Horacio Serpa Cules son las responsabilidades del Estado? \ Asegurar el acceso a la educacin, a la salud, a una vivienda digna, a los servicios pblicos, a la recreacin y a las oportunidades de progreso fanhar. 1) Equidad es proteccin a la infancia - Programas de alimentacin para los nios pobres y las mujeres jvenes desnutridas. -Objetivo: cubrir a cinco millones de nios y nias menores de cinco aos en Colombia con los programas de salud, nutricin, atencin, cuidado y aprestamiento escolar. 2) Equidad es salud universal sin privilegios a) Reforma a la Ley 100 de 1993 - amphar y mejorar la capacidad de direccin del Sistema de Seguridad Social en Salud, - lograr la cobertura universal y - romper la inequidad que hoy existe en la prestacin de los servicios de salud. b) Garantizar el funcionamiento de los hospitales pblicos. - Rescatar la red pblica, -constituir un Fondo de Recuperacin Hospitalaria. - Ningn hospital pblico ser cerrado - ni permanecer posttado como ocurre actualmente con muchos de ellos. c) El ISS es una conquista social que debe modenzarse y depurarse como instmmento al servicio de la gente, - Fortalecer el Instituto de Seguros Sociales - en lo administtativo.

398

La scdud en las campaas presidencUdes en Colombia

-institucional, - financiero y tecnolgico; d) La contribucin de los profesionales y ttabajadores de la salud volver a tener el valor social que merece. Alvaro Uribe Tenemos 14.5 millones de personas en el Rgimen Contributivo de Salud, 9.5 millones en el Subsidiado, pero faltan 7.5 millones de pobres por ingresar a esta forma de aseguramiento. 1) No permith que contine la politiquera en la asignacin de carnets del SISBEN. 2) Las universidades ayudarn a la Superintendencia de Salud a garantizar la ttansparencia en la distribucin 3) Exigir la atencin prioritaria de ttes gmpos poblacionales pobres y vulnerables: - madres cabeza de familia, i - discapacitados y -ancianos. 4) Ayudar a crear las empresas solidarias de salud y las proteger de muchos pohticos que las distorsionaron con una indebida apropiacin. 5) Propondr que el Rgimen Subsidiado lo administten de muiera exclusiva empresas con cobertura grande, eficientes, sin nimo de lucro, que correspondan a sociedades de cajas de compensacin familiar y hospitales pblicos. Habr aseguramiento y no intermediarios. 6) Es inaceptable que nenttas lo privado se administta con eficiencia, lo pblico se haga fiesta. Los hospitales del Estado son las clnicas privadas ms importantes porque pertenecen a toda la comurdad.

399

La Salud Pblica Hoy

-"Protegeremos a los hospitales pblicos pero sern tan bien manejados como las buenas clnicas privadas". 7) Vigilar celosamente que las diferentes entidades de la salud no abusen de los profesionales mdicos, odontlogos o afines. Tarifas equitativas que permitan que los tiempos y modalidades de atencin a los pacientes se ajusten al apostolado mdico. El xito de la salud en muy buena parte depende del xito de las polticas de empleo. El desempleado no puede pagar la cotizacin, tambin se pierde su punto de conttibucin al sistema solidario que adems es incapaz de acogerlo. El ministto de Salud no estar condicionado a negociaciones pohticas, su continuidad depender de sus resultados y de su honradez, deber tener vocacin para ttabajar los 4 aos

8)

9)

10) Investigacin y tecnologa - El futuro de la investigacin biogentica, combinada con la farmacutica, para prevenir enfermedades, prolongar la vida, aplazar el envejecimiento, es mucho ms promisorio que la informtica. - Incrementar el presupuesto de ciencia y tecnologa a fin de convertir en medicamentos, alimentos, y en ms vida, los recursos de biodiversidad. - Integracin de la comunidad cientfica, la universidad, el sector privado y el Estado, como pilares de centtos de desartollo tecnolgico. Noem Sann La salud es el corazn del pas: con seguridad en la salud, la vivienda y ottos servicios bsicos, las famihas tendrn un verdadero amortiguador frente al desempleo. El pas est en deuda con los desplazados por la violencia. No puede ser que an no sepamos si son 400.000 como dice el gobiemo o 1.200.000 como dicen las organizaciones de derechos humanos. En cualquier caso estamos teniendo el mayor ejrcito de desplazados del mundo, que por abo-

400

La salud en las campaas presidencices en Colombia

ra enfrenta su ttagedia con sus propias carencias y una accin muy frgil del Estado. Con subsidios directos o con crditos blandos y a largo plazo hay que ayudar a la relocalizacin y reinsercin social de estas familias. Es un deber de humanidad. Sistema nacional de garanta de calidad en la atencin de la salud: gerencia pblica y privada; salvar de verdad al ISS; programa nacional de recuperacin de los hospitales pbhcos de cahdad; defensa y desarrollo de las profesiones de la salud; incentivos de la inversin ordenada en salud; promocin activa de la investigacin en salud; ehnnacin radical de la cormpcin. En el sistema de salud no se avanz nada en los ltimos cuatto aos. Hay un mltiple colapso: Financiero, porque con la crisis econmica los recursos han crecido menos de lo esperado. tico, porque la cormpcin y la politiquera se han apropiado de muchos de los recursos que deberan llegar a las poblaciones ms pobres. De gestin, porque el Ministerio de Salud ha perdido el norte, la gestin de muchos hospitales y la ARS ha fallado y los sistemas de conttol no han funcionado. Los grandes damrficados han sido los colombianos ms necesitados y el personal de salud. Qu haremos? 1) Precipitaremos la ttansformacin del sistema de salud para recuperar el tiempo perdido. Fortaleceremos la salud pblica, aceleraremos el desarrollo del sistema general de seguridad social en salud y fortificaremos la capacidad de los prestadores de servicios de salud 2) Salud pblica Fortalecer la capacidad municipal de lograr el Plan de Atencin Bsica, como instmmento esencial de prevencin de riesgos de la salud. Mejoramiento de la cobertura y calidad del agua potable. Asegurar la cobertura de la vacunacin al 100% de los nios. DesartoUar un gran programa nacional de conttol del embarazo adolescente y ttatamiento del aborto como un verdadero problema de salud pbUca.

401

La Salud Pblica Hoy

Fortalecimiento de las acciones de nutricin infantil y del binomio madre-hijo, 3) Seguridad social Vamos a expandir la cobertura del seguro solidario de salud a 20 miUones ms de colombianos, para llegar prcticamente a la universalidad al fin de mi gobiemo. Cobertura del rgimen contributivo llegar a 20 millones de colombianos. Cobertura del SISBEN alcanzar a los 15 millones de colombianos pobres. DesartoUo de un nuevo sistema sohdario para ttabajadores independientes del campo y la salud con una contribucin de mil pesos diarios. Fortalecinento de las entidades promotoras de carcter abierto y solidario. La capacidad de prestacin de servicios.

Luis Eduardo Garzn Planteamiento central: la garanta del derecho a la salud 1) La salud es un bien pblico y una necesidad fundamental indivisible de todas las personas. - los servicios individuales y colectivos relacionados con la salud debrn estar integrados y ser garantizados por el Estado, mediante una esttategia de desmercantilizacin. La salud entonces requiere de un pacto poltico, para garantizar el derecho a la salud. - Propiciar la participacin efectiva de la sociedad en las decisiones individuales y colectivas en salud. 2) El derecho a la salud como derecho humano fundamental. - Uiversalidad o accesibihdad para todos por el hecho de ser humano, - Carcter individual y social, - Irrenunciabihdad.

402

La scdud en las campaas presidencices en Colombia

3) Reorganizar el sistema de prestacin de servicios de salud por medio del fortalecinento de la funcin pblica: Para lograr su objetivo propone cinco esttategias: Estrategia 1: Debate pbhco sobre el derecho a la salud. - El derecho a la salud como bien pbhco y derecho fundamental a cargo del Estado. Estrategia 2: Universalizacin de los servicios de salud. - Abandonar el esquema de subsidio a la demanda, por un sistema de recaudo pbhco, segn la capacidad, con oferta de servicios abierta y segn la necesidad de las personas, - Articulacin de salud con un sistema de seguridad social integral que haga la confluencia de recursos, pblicos y privados, fiscales y parafiscales, para lograr universalidad en un contexto de baja salarizacin, - Fondo Pblico nico Descenttalizado de Salud (FOPUDS), de recaudo nico, con conttol social y alimentado por recursos pbhcos de destinacin especfica para salud, - Desaparicin de los regmenes especiales, excepto el de las fuerzas armadas con conttol cvico-estatal, en razn de sus riesgos especficos. Estrategia 3: Gestin territorial de la salud hacia la equidad y la integralidad Gestin territorial de la salud, articulada a planes de desarrollo socioeconmico orientados por la bsqueda de condiciones y medios para el bienestar de las personas. - Equidad de la atencin integral, - Promocin de la salud, - Reglas claras de democratizacin de las decisiones pblicas en salud en el mbito territorial y en las instituciones pbhcas. Estrategia 4: Poltica de desarrollo cientfico y tecnolgico en salud. - Definir ciertas lneas prioritarias de investigacin y desarrollo tecno lgico. Estrategia 5: Poltica de medicamentos y de equipos de diagnstico y ttatamiento.

403

La Salud Pblica Hoy

- Identificacin de necesidades de medicamentos y eqipos mucho ms reahstas que las de la simple demanda. Estrategia 6: Cahdad del ttabajo en salud, - Condiciones laborales de buena calidad. Estrategia 7: Articulacin entte poltica educativa y poltica de salud. - Superar deliberadamente grandes inequidades sodales acumuladas. 4) Sobre la ley 100/93 Requiere vigilancia y conttol; mediante ajustes es posible solucionar las deficiencias procedimentales de los servicios de atencin inclusive, paliando las inequidades propias del mercado para quienes no tienen igualdad en el ingreso. La crisis en salud est determinada por las causales econmicas y de flexibihzacin del empleo y el conflicto est entte la tica hipocrtica y la mercantilizacin de la salud que genera inequidad.

Principal problema de salud: La guerra

En un pas en guerta lo que se impone es dar fin a la guerra. - Transformar las condiciones econmicas, polticas y sociales y, desde luego, acordar los mecanismos que pemtan cesar las hostilidades y eliminar el conflicto. - La salud debe pensarse como un elemento constmctor de la paz y por lo tanto uno de los aspectos a ttabajar es la solucin a las secuelas de la guerra. Conclusiones 1. Tres de las campaas anahzadas mantienen polticas de gobiemo en cumplimiento de la poltica de Estado. 2. Sus programas responden a leves matices que tienen el mismo modo de resolucin.

404

La scdud en las campaas presidenciales en Colombia

3. Reforma a la ley 100, reduccin del gasto, y gerencia a todo el sistema de salud. 4. Una campaa se plantea como constmctora de propuesta concertadora para variar polticas de Estado.

405

Panorama de la investigacin sobre salud pblica en Colombia. Realidad o... utopa?


JOHN HAROLD ESTRADA MONTOYA

I. Prolegmenos Realizar una presentacin sobre el panorama de la investigacin sobre salud pblica en Colombia tiene tanto de quijotesco como de utpico. Conenzo parafraseando a Maryluz Resttepo, profesora de la Facultad de Artes de esta Universidad, quien no define el trmino utopa como aquello imposible de alcanzar, sino como lo que an no tiene espacio y se encuentra ms bien en proceso de constmccin. Y hago referencia a esa definidn, porque intentar una caracterizacin del panorama de la investigacin sobre Salud Pblica en nuestto pas es una tarea tan ambiciosa como necesaria, que rebasa ns posibihdades actuales de dedicacin y destteza, pero que me invita a dar un primer paso en la constmccin de esa utopa (en la acepcin ya sealada), y a someter a su consideracin esta presentacin no como algo acabado sino como una provocacin e invitacin a la reflexin y la discusin en los mejores trminos acadncos, finahdad ltima de cursos como el que aqu nos convoca y que boma el nombre de Manuel Anczar (1812-1882) primer rector de la Universidad Nacional de Colombia entte 1868 y 1871. En primer trmino, me remitir a una ubicacin contextual e histrica del panorama de la Salud Pbhca en la esfera internacional (en particular latinoamericana) y, luego, a una caracterizacin inicial del panorama de la investigacin sobre salud pblica en nuestto pas tomando dos fuentes de circulacin peridica para el anlisis, como son las revistas de salud pblica de las Universidades de Antioquia y Nacional de Colombia.

407

La Salud Pblica Hoy

II. Orgenes y estructuracin del campo disciplinar El primer esbozo de lo que luego conoceremos como salud pblica lo enconttamos en las motivaciones y reivindicaciones de los movimientos revolucionarios europeos de 1848 en Francia y Alemania, ms concretamente en los escritos de Jules Guerin y de Rudolf Virchow, este ltimo considerado el padre de la medicina social, quien lleg a la conclusin de que las epidemias tenan causas sociales y econmicas y por tanto su ttatamiento se basaba en la prosperidad econmica, la educacin y la libertad. Dadas las condiciones pohticas imperantes en estos aos y debido al sUencianento de que fue objeto el movimiento, los postulados de Virchow cayeron en el olvido y solo fueron retomados casi al finahzar el siglo XX, cuando la medicina social alcanz estatuto de legitindad entte los acadmicos y estudiosos del tema. Pero en este lapso, otros conceptos amparados bajo otros nombres e investidos de diferentes ropajes conceptuales vieron la luz y se posicionaron en los discursos y prcticas de los estudiosos de los temas de las ciencias sociales en salud. ' John D. Rockefeller (1839-1937) hacia finales del siglo XIX y principios del XX cre el mayor emporio pettolero del mundo y posteriormente para asegurar la salud de sus empleados a lo largo y ancho del mundo constituy en 1901 el Instituto Rockefeller para la investigacin mdica, y en 1910 la fundacin Rockefeller, cuyas investigaciones y programas de erradicacin de enfermedades tropicales les permitieron participar en la organizacin de los servicios nacientes de salud pblica en los pases latinoamericanos donde tenan negocios los norteamericanos. Durante estos aos, ttes enfermedades, la anquilostonasis, la fiebre amarilla y la malaria, captaron la atencin de la fundacin como foco de sus acciones ertadicatorias y permitieron que actuara como catalizadora de lo que Emilio Quevedo ha llamado "el trnsito desde la higiene hacia la salud pblica en Amrica Latina". Igualmente en la dcada de los 20, la fundacin Rockefeller decidi apoyar la creacin de un Instituto-Escuela de Salud Pblica en la Universidad Johns Hopkins bajo la direccin del doctor William Welch y asesorada por el doctor Abraham Flexner, gestor de la reforma de la educacin mdica en Norteamrica. Dicha escuela contribuy a la naturahzacin del discurso de la salud pbhca en el continente americano as como a la inttoduccin y

408

Panorama de la investigacin sobre scdttdpblica en Colombia. Recdidad o... utopa?

fortalecinento de modelos orientados por enfoques emprico-analticos o de corte positivista', razn por la cual el nuevo modelo de salud pbhca naci ligado a la perspectiva biomdica y reemplaz los modelos de higiene francesa, inglesa y norteamericano vigentes hasta ese momento. G. Rosen y Henry Sygerist contribuyeron en la dcada de los cuarenta a la definicin y conformacin del marco conceptual de la salud pbhca, toda vez que en palabras de Sygerist, las cuatto tareas de la medicina deban ser: 1. 2. 3. 4. Promocin de la salud, Prevencin de la enfermedad, Restablecimiento de los enfermos, y Rehabilitacin.

Hada finales de la dcada y coincidiendo con las profundas ttansformaciones de la posguerta y sus planes de recuperacin econmica y social se produce la conformacin de dos organismos internacionales que liderarn durante aos las discusiones en tomo a la salud pblica; se ttata de la Organizacin Mundial de la Salud, OMS (creada en 1946) y la Organizacin Panamericana de la Salud, OPS (creada en 1947). La investigacin de los aos 20, 30 y 40, en particular en los pases latinoamericanos, estuvo marcada por las reflexiones en tomo al crecimiento hospitalario, la atencin mdica y la ya mencionada medicina ttopical, utilizada como hertamienta del neocolonialismo expanslonista, toda vez que las enfermedades ttopicales afectaban los intereses econnucos del naciente imperio neocolonial norteamericano en Amrica Latina. m . Hegemona de los positivismos sociolgico y biolgico En la dcada de los 50, se produjo una convergencia de las ciencias sociales y las de la salud, situacin que inttodujo formalmente los discursos de la anttopologa y la sociologa a las escuelas de formacin de profesionales en salud, en ctedras como "antropologa mdica " y "sociologa de la salud", y que detemnaron un dominio hegemrco del positivismo sociolHago referencia a la enumeracin propuesta por Jurgen Habermas en su escrito "Conociiniento e inters", donde clasifica la produccin investigativa en tres niveles: a. Emprico analticos, b. Histricos hermeneticos y c. Crticos sociales

409

La Salud Pblica Hoy

gico en los currculos de las distintas facultades. Como resultado de esta convergencia, en 1952 y 1953 se realizaron conferencias regionales y mundiales de educacin mdica en EE,UU., Francia, Inglaterta y Suecia, de donde salieron los lincamientos y directrices para las reformas curriculares de la gran mayora de programas de formacin en salud del mundo y en particular de Amrica Latina. Uno de los cambios ms visibles y concretos de estas reformas fue la sustitucin de los departamentos de 'Higiene' por los de 'Medicina Preventiva', ms acordes con los desartoUos terico-conceptuales de los estudiosos de entonces. La investigacin en estos aos continu con los avances obtenidos en medicina ttopical y aadi el inters por las llamadas medicinas ttadicionales, en un afn por caracterizar los saberes de los diferentes gmpos tnicos, comunidades o sectores populares, con las herramientas de investigacin derivadas de la anttopologa. La dcada de los 60 enmarcada por la revolucin cubana al principio y el Mayo Francs al final, fue testigo del cambio de orientacin en la enseanza y produccin acadmica del rea social en salud y en particular de la salud pblica, toda vez que se produjeron desarrollos tericos en la epidemiologa clsica que condujeron a un posicionamiento hegemnico del modelo biomdico, gracias a la difusin y aceptacin casi universal de los postulados de causalidad de Me Mahon, los de historia natural de la enfermedad, niveles de prevencin y trada ecolgica de Leavell y Clarete, y los criterios de causalidad de Hill El final de la dcada estuvo matizado por el desartollo e implementacin de la metodologa de planeacin elaborada por el Centto de Estudios del DesarroUo de la Urversidad Central de Venezuela (CENDES) con el apoyo tcnico y financiero de la OPS, metodologa que pretendi apUcar las nociones y principios de la economa en el manejo de insumos relacionados con los problemas de salud, con el fin de racionahzar el uso de los pocos recursos para la atencin en salud con que contaban las naciones latinoamericanas. De la medicina preventiva, se pas al concepto de salud comunitaria, la cual en la mayora de los pases de Latinoamrica fue mal asunda, parcialmente implementada y fuertemente ideologizada con detrimento de las potencialidades y bondades que nadie, incluso hoy deja de reconocerle. Las tendencias en investigacin estuvieron orientadas a la formacin del recurso humano en salud, a la salud como factor de desarrollo social y a la extensin y amphacin de la cobertura de los servicios de salud.

410

Panorama de la investigacin sobre scdud pblica en Colombia. Realidad o... utopa?

rv. Emergencia de posturas altemativas frente al proceso salud-enfermedad La dcada de los 70 estuvo marcada por las repercusiones de los debates entte el funcionalismo positivista y el estmcturalismo, donde se inscriben hitos como el clsico texto de la investigacin de Juan Csar Garca sobre educacin mdica en Amrica Latina, la publicacin en 1974 del informe del ministto de salud de Canad (conocido posteriormente como el informe Lalonde), los primeros ttabajos de Asa Cristina Laurell en Mxico sobre salud de los ttabajadores y los de Jaime Breilh y Edmundo Granda en Ecuador sobre las contradicciones del proceso de produccin y la constmccin de la categora "reproduccin social" como catalizadora del perfil epidemiolgico de clase. Se destac tambin en esa dcada, la asamblea mundial de la salud de 1977 y la declaracin de Alma Ata (antigua Unin Sovitica) de 1978, donde se ratifica la salud como derecho y se adopta la atencin primaria en salud como estrategia para alcanzarla. Se asiste con todo esto a la legitimacin del discurso de la medicina social y a su diferenciacin de la medicina preventiva, de la salud comunitaria y de la salud pbhca. La investigacin de esta dcada estuvo marcada por el intento de establecer y caracterizar las condiciones bajo las cuales se desarrolla, produce y difunde el proceso salud / enfermedad.
1

V. Expansin y diversifcacin temtica La dcada de los 80, con la crisis de la deuda extema agobiando a la mayora de naciones de Amrica Latina, fue testigo en dos de nuestros pases del surgimiento y posterior desarrollo de dos tendencias que se fortalecieron y permitieron la amphacin del campo de discusin de la salud pbhca; me refiero en primer lugar a la definicin y desarroUo conceptual de lo que se conoce como salud colectiva en BrasU por J.S. Paim y, en segimdo lugar, al desarrollo de la epidemiologa crtica en Ecuador por Jahne Breilh y Edmundo Granda desde el Centto de Estudios y Asesora en Salud (CEAS) de Cuenca. La Organizacin Panamericana de la Salud por su parte, cre y difundi la esttategia de los Sistemas Locales de Salud (SILOS) y, en Canad, en la reunin de Mirsttos de Salud de 1986, se suscribi la carta de Ottawa por delegados de tteinta y ocho pases, quienes coordinaron sus esfuerzos para

411

La Salud Pblica Hoy

apuntar a alcanzar la meta de salud para todos en el ao 2000. Los conceptos derivados de la conferencia, "Promocin de la salud" y "Ciudades saludables" sealaron el avance hacia un nuevo concepto de salud pblica y se posicionaron sobre todo en Europa y Norteamrica como esttategias para mejorar el nivel de vida de los ciudadanos y ciudadanas. Sin embargo, fue hacia el final del periodo, con el dermmbamiento del socialismo real, cuando se produjo el mayor de los cambios estmcturales, el cual permiti el desbordamiento de los modelos de libre mercado y maximizacin de ganancia en un mundo cada vez ms globalizado y sin el equihbrio que la conformacin bipolar resultante de la segunda posguerra le confera hasta entonces. La investigadn de esta dcada estuvo marcada por el inters hacia las polticas pblicas y el mejoramiento en la prestacin de los servicios de salud. VI. Recomposicin ideolgica y temtica .

La dcada de los 90 con su avalancha de reformas de los sistemas nacionales de salud, con el pretexto de la disnnucin del tamao del Estado, de la optimizacin de recursos y el desmonte del concepto de bienestar, se denomina, en palabras del historiador Mario Hemndez, la dcada de la recomposicin ideolgica y temtica y se caracteriza por la reflexin e intento de constmccin de un marco terico o conceptual para enmarcar las prcticas de salud de un lado y las reflexiones y profundas crticas sobre la teora y prctica de la salud pblica por el otro. De estas reflexiones iniciales se pueden perfilar las tendencias en investigacin en Salud Pbhca en Amrica Latina en seis grandes reas as: 1. Reformas a los sistemas de seguridad social y sus imphcaciones en las condiciones de salud de la poblacin. 2. Violencia. 3. Salud y trabajo o salud de los ttabajadores. 4. El proceso salud/enfermedad desde la perspectiva de gnero, 5. Reflexiones en tomo al quehacer de la salud pblica y la epidemiologa. 6. Equidad en el acceso a los servicios de salud. Es a la luz de este marco de reflexin que la ctedra Manuel Anczar nos ba convocado este semestte y me sirve de pretexto para la configuracin iicial del panorama de investigacin en salud pblica en nuestto pas.

412

Panorama de la investigacin sobre salud pblica en Colombia. Realidad o... utopa?

V n . Intento de caracterizacin Para este intento de caracterizacin del panorama de la investigacin en salud pbhca, me limit a las publicaciones peridicas especiahzadas en el tema editadas en dos de las ttes universidades que tienen programas de formacin de maestra en salud pblica (me refiero a las revistas de salud pbhca de las umversidades de Antioquia y Nacional de Colombia), con el nimo de intentar cubrir -si no en amphtud al menos en profundidad- la produccin investigativa disponible de examen peridico por parte de la comurdad acadmica y los interesados en los debates actuales sobre la salud pblica. Esta esttategia, de enttada, deja por fuera toda la investigacin en salud pbhca que realizan ottos gmpos y cuyos resultados, o no se publican, o son pubhcados en otras revistas o ediciones nicas, orientadas a temas econnucos, sociales o de salud, pero sin la connotacin de "pblica". As mismo deja por fuera las investigaciones realizadas y pubhcadas por instituciones del sector pblico o privado como Ministerio de Salud, Instituto Nacional de Salud, secretaras de salud. Instituto del Seguro Social, asociaciones de facultades, asociaciones cientficas y gremiales y organizaciones no gubemamentales interesadas en la problemtica de la salud pblica. Con esta salvedad, que inttoduce ms dudas y preguntas que certezas y respuestas, intento presentar las reas temticas exploradas por los investigadores en los ltimos aos y a las que los editores de las mencionadas revistas han dedicado las pginas de sus pubhcaciones y sus reflexiones editoriales. A. Universidad de Antioquia La Revista de la Facultad de Salud Pblica, de la Urversidad de Antioquia, circula desde hace 28 aos de manera intermitente sobre todo al principio, pero gracias al esfuerzo de sus editores por alcanzar el reconocimiento de publicacin apoyada por COLCIENCIAS, chcula con regularidad desde el ao 1995 renovando su formato desde enero del ao 2000. Al revisar los ar'culos pubhcados se puede apreciar que en los volmenes ildales disponibles para examen (desde el volumen 12) los artculos publicados co-

413

La Salud Pblica Hoy

rtespondan a ensayos, opiniones o comentarios sobre la situacin de Salud pblica mundial o nacional. Al pasar el tiempo, se observa una cualificacin en el tipo de artculos publicados, que cada vez ms incorporan investigaciones originales y las intercalan con revisiones tericas, reflexiones en tomo a problemticas especficas y ensayos. El total de revistas disponibles (14 en total) agmpa 105 artculos, ms los editoriales y notas breves de informacin relativa a congresos o celebraciones acadmicas. Los 105 artculos se pueden agmpar en 12 categon'as temticas as: 1. Seguridad social: Incluye aquellas publicaciones que se ocupan de reflexionar o investigar los tpicos de la seguridad social en salud, reformas sanitarias, en particular la ley 100 de 1993 y temas relacionados con pensiones y cesanti'as. 23 artculos. Salud y trabajo: Se incluyen aqu las reflexiones o investigaciones en salud ocupacional, salud ambiental y salud mental. 20 ttabajos. Teora y prctica de la salud pblica y la epidemiologa: Se incluyen aqu aquellos artculos que reflexionan sobre el quehacer y las orientaciones de la salud pblica y de su disciplina auxiliar, la epidemiologa. 19 ttabajos. Estudios epidemiolgicos: En este apartado estn aquellos estudios con diseos epidemiolgicos de cualquier tipo, a excepcin de los que se ocupan de las exposiciones ocupacionales o medioambientales que estn en la categora salud y ttabajo. Ocho ttabajos. Salud, sociedad y cultura: Bajo este apartado se agmpan las reflexiones o estudios que vinculan directamente las ciencias humanas y sociales a la Salud pblica. Seis ttabajos. Promocin de la salud: Esta categon'a incluye aquellos artculos que explcitamente en su ttulo y resumen se orientan a discutir sobre aspectos conceptuales u operativos de la promocin de la salud. Cuatto ttabajos. Modelos de desarrollo y su impacto en la salud pblica: Se agmpan aqu los artculos que hacen referencia explcita a las consecuencias que la implementacin de los modelos de desartollo tiene para la salud pblica en el continente o nuestto pas. Cuatto trabajos. Administracin y gestin: En este gmpo enconttamos los ttabajos orientados a temas de gerencia en salud, financiacin del sector saludo aquellos relacionados con la planificacin de reciu'sos humanos, fsicos o financieros. Cuatto ttabajos.

2. 3.

4.

5.

6.

7.

8.

414

Panorama de la investigacin sobre salud pblica en Colombia. Realidad o... utopa?

'

9.

Violencia: A pesar de lo que pudiera esperarse, los artculos relacionados con la violencia, en una publicacin proveniente de un escenario cuyos protagonistas han sido tan duramente golpeados por sus efectos, son slo cuatto ttabajos pubhcados. 10. Educacin: Recoge temas relacionados con la enseanza de la Salud Pblica o la formacin de talento humano en salud. Dos trabajos. 11. Perfiles biogrficos: Reconocimiento a personalidades de la Salud Pbhca de nuestto pas. Se ttata de dos ttabajos dedicados a exaltar la memoria de dos defensores incansables de la salud para todos y todas, Hctor Abad Gmez y Leonardo Betancur. 12. Estadstica: Se encuentta un artculo dedicado exclusivamente a la presentacin y desartollo de un modelo matemtico de anhsis.

B. Universidad Nacional de Colombia Tenemos en segundo tmno a la joven publicacin de la maestra en salud pblica de la Urversidad Nacional, dirigida por el profesor Carlos Agudelo, cuyo primer ejemplar vio la luz en 1999 y circula inintermmpidamente desde entonces con tres nmeros al ao. Al igual que la publicacin anterior, en sus pginas se da cabida a artculos originales, actuahzaciones o ensayos relacionados con los debates en salud pblica. Las 9 revistas disporbles para examen, agmpan 61 artculos en 14 categon'as as: 1. 2. Salud y trabajo: Se incluyen aqu las reflexiones o investigaciones en salud ocupacional, salud ambiental y salud mental. Diez ttabajos. Seguridad social: Incluye aquellas publicaciones que se ocupan de reflexionar o investigar los tpicos de la seguridad social en salud, reformas sanitarias, en particular la ley 100 de 1993 y temas relacionados con pensiones y cesantas. La revista de la Universidad Nacional hace particular nfasis en este apartado en el tema de la equidad en niveles de salud y en el acceso a los servicios pblicos o privados luego de la implementacin de la ley 100. Nueve ttabajos. Violencia: Nueve trabajos. Modelos de desarrollo y su impacto en la salud pblica: Se agmpan aqu los artculos que hacen referencia explcita a las consecuencias que la implementacin de algn modelo de desarrollo tiene para la Salud Pblica, a nivel nacional o latinoamericano. Ocho ttabajos.

3. 4.

415

La Salud PbUca Hoy

5. 6.

7. 8. 9. 10.

11.

12. 13. 14.

Salud matemoinfantil: Se agmpan aqu los ttabajos que se ocupan de la salud de las madres y de nios o nias pequeos. Seis trabajos. Salud, Sociedad y Cultura: Bajo este apartado se agmpan las reflexiones o estudios que vinculan directamente las ciencias humanas y sociales a la Salud pblica. Tres ttabajos. Salud pblica veterinaria: Tres ttabajos. Temas de actualidad: Tres ttabajos . Polticas pblicas: Dos ttabajos. Promocin de la salud: Esta categora incluye aquellos artculos que explcitamente en su ttulo y resumen se orientan a discutir sobre conceptos relacionados con la promocin de la salud. Dos ttabajos. Administracin y gestin: En este gmpo encontramos ttabajos orientados a los temas de gerencia en salud, financiacin del sector o lo relacionado con la planificacin de recursos humanos, fsicos o financieros. Dos ttabajos. Historia: 1 ttabajos que presentan miradas sistemticas a eventos de inters histrico para la Salud Pblica colombiana. Epidemiologa: Un ttabajo. Educacin: Temas relacionados con la enseanza de la Salud Pblica y la formacin de talento humano en salud. Un ttabajo.

V n i . A Manera de eplogo Como se aprecia en las categoras presentadas, en Colombia se reproducen parcialmente las tendencias de investigacin latinoamericanas, en particular en lo tocante a seguridad social, violencia, salud y ttabajo y en menor medida, en las reflexiones sobre el objeto de estudio de la salud pbhca. Se destacan ottos temas particulares y la ausencia, al menos de manera explcita, de ttabajos con o desde la perspectiva de gnero, tpico que se ha veido posicionando en los discursos de los profesionales de las ciencias sociales y de salud desde los cursos, investigaciones y publicaciones de las escuelas de estudios en gnero que poseen ambas universidades y que est en mora de ocupar las pginas de estas revistas especializadas. Al hacer una mirada comparativa al grado de desarrollo de la produccin y pubhcacin en salud pblica de nuestto pas, se puede ver que no estamos al nivel, ni alcanzamos la visibilidad intemacional de pases como Mxico, Brasil, Cuba o Ecuador, pero que la labor investigativa de las ttes maestras

416

Panorama de la investigacin sobre salud ptiblica en Colombia. Realidad o... utopa?

del pas, as como la de los estudiosos de la salud pbhca, hace presencia en los congresos o en las pginas de memorias o revistas especializadas y hacen esfuerzos ingentes por alcanzar la visibilidad y reconocimiento tan necesarios en pocas donde el conocimiento circula y se desactualiza vertiginosamente, un mundo donde predomina la cultura de la imagen, de lo simultneo y de lo inmediato; en fin un mundo donde, parafraseando a Carlos Marx, ''''todo lo slido se desvanece en el aire ".

417

La Salud Pblica Hoy

Referencias Bibliogrficas ALMEIDA FILHO, Naomar y PAIM, Jaimilson. La crisis de la Salud Pblica y el movimiento de la Salud Colectiva en Latinoamrica. En : Cuademos Mdico Sociales; 75: 5-30. Mayo 1999. APEZECHEA, Hctor. Problemas metodolgicos de la investigacin en ciencias de la salud. En : DUARTE, Everardo. Ciencias sociales y salud en la Amrica Latina. Tendencias y perspectivas. Organizacin Panamericana de la Salud (OPS). Organizacin Mundial de la Salud (OMS). CIESU. 1986. BERMAN, Marshall. Todo lo slido se desvanece en el aire. La experiencia de la modemidad. Siglo XXI Editores. 5a ed, 1991. BREILH, Jaime. Epidemiology's role in the creation of a human world: convergences and divergences among the schools. Soc Sci Med.; 41 (7): 911-4.1995. BREILH, Jaime y GRANDA, Edmundo. Los nuevos rumbos de la epidemiologa. En : Duarte, Everardo. Ciencias sociales y salud en la Amrica latina. Tendencias y perspectivas. Orgaizacin Panamericana de la Salud (OPS). Organizadn Mundial de la Salud (OMS). CIESU. 1986. CENDES/OPS. Problemas conceptuales y metodolgicos de la programacin de la salud. Washington : pubhcacin cientfica No. 111. Abril. 1965. DUARTE, Everardo, Tendencias y perspectivas de las investigaciones en ciencias sociales en salud en Amrica Latina: una visin general. En : DUARTE, Everardo. Ciencias sociales y salud en la Amrica Latina. Tendencias y perspectivas. Organizacin Panamericana de la Salud (OPS). Organizacin Mundial de la Salud (OMS). CIESU. 1986. . Trayectoria de la medicina social en Amrica Latina: elementos para su configuracin. En : FRANCO, Sal y ottos. Debates en Medicina Social. Organizacin Panamericana de la Salud (OPS). Quito: Asociacin Latinoamericana de Medicina Social (ALAMES), 1991.

418

Panorama de la investigacin sobre salud ptiblica en ColombicL Realidad o... utopa?

GARCA, Juan Csar. Medicina y sociedad: las corrientes de pensamiento en el campo de la salud. En : Pensamiento social en Salud en Amrica Latina. Mxico : McGraw Hill, 1994. GRANDA, Edmundo. Formacin de salubristas: algunas reflexiones. En: Curso intemacional itinerante. La saliui colectiva a las puertas del siglo XXI. Medellin : Memorias. Volumen II. Universidad Nacional de Colombia (Sede Medellin). Universidad de Antioquia. 2000. LAURELL, Asa Cristina. Salud y ttabajo: los enfoques tericos. En : DUARTE, Everardo. Ciencias sociales y salud en la Amrica Latina. Tendencias y perspectivas. Organizacin Panamericana de la Salud (OPS). Organizacin Mundial de la Salud (OMS). CIESU. 1986. QUEVEDO, Emilio. El proceso salud-enfermedad: hacia una clnica y una epidemiologa no positivistas. En : Sociedad y salud. Zeus asesores. QUEVEDO, Enlio, Historia de la salud pblica. El ttnsito desde la higiene hacia la salud pbhca. En: Curso intemacional itinerante. La salud colectiva a las puertas del siglo XXI. MedeUn : Memorias. Volumen I. Universidad Nacional de Colombia (Sede MedeUn). Universidad de Antioquia. 2000. QUEVEDO, Emiho, y ottos. La salud en Colombia. Anlisis socio-histrico. En : La salud en Colombia. YEPES, Francisco Jos. Editorial Presencia. 1990. Revista Facultad Nacional de Salud Pblica. Universidad de Antioquia. Vol. 12 (1,2). Vol 13 (1,2). Vol 14 (1,2). Vol 15 (1,2). Vol 16 (1,2). Vol 17 (1,2). Vol 18 (1,2). Vol 19(1). Revista de Salud Pblica. Universidad Nacional de Colombia. Vol 1, Nos. 1-3. 1999. Vol. 2. Nos. 1-3. 2000. Vol 3. Nos, 1-3. Suppl 1-2. 2001, ROTHMAN, Kenneth, Modern epidemiology. 1"^ edition. LippincottRaven.1998. SUSSER, Mervyn. Conceptos y estrategias en epidemiologa. El pensamiento causal en las ciencias de la saliui. Mxico : Fondo de Cultura Econmica. 1991.

419

''O'

Podemos comprender las problemticas de salud pblica? Notas metodolgicas para el anlisis situacional
CARLOS ALBERTO AGUDELO CALDERN

Cmo examinar la situacin, estado o rvel de salud de una poblacin? ste es un problema complejo, ya sea que se ttate de interpretar eventos recientes, como un brote epidmico o un desastte natural, o se trate de un momento o circunstancia dentto de un proceso, o como una tendencia de mediano o largo plazo. La ubicacin temporal y la duracin de los eventos introducen problemas conceptuales y metodolgicos en el anlisis situacional. Pero el asunto no es slo de temporalidades. Una gran parte de la complejidad del anlisis situacional de la salud de la poblacin, proviene de ottas dos dimensiones: de un lado, los vacos tericos y metodolgicos para deliirtar la salud y la enfermedad; de otto lado, las profundas diferencias que existen entre la experiencia y vivencia cotidiana de la salud de la gente y los indicadores utihzados para identificar los fenmenos que ocurten o que experimenta la poblacin -usualmente desde el campo de la epidenologa, la salud pblica convencional, la administtacin y ottos enfoques sanitarios-. Si bien estos mtodos y hertanentas permiten una aproximacin al anlisis de situadn, carecemos de hertanentas para el anlisis situacional con un nivel equivalente al que han logrado ciencias como la economa, la poltica y la historia cuando abordan el anlisis de coyuntura o de perodo. Por tanto, con respecto a "problemticas de salud pblica", nuestta ttadicin analtica es intrnsecamente dbil, debido a la insuficiencia de los marcos tericos, el predomiio de la visin diacrica, y la desarticulacin en-

421

La Salud Pblica Hoy

tte el anlisis del "momento", con respecto a las estmcturas y los procesos. La nocin de temporahdad de los hechos resulta, en consecuencia, amphamente sacrificada. As mismo, la relacin momento-tendencia. Con frecuencia los hechos estn ah (unas cuantas cifras), pero su significado permanece oculto. El anlisis situacional debe contemplar algunos requisitos o componentes. Estos pueden ser considerados tambin como momentos de anhsis, cuya relacin podra representarse como un diagrama complejo de flechas antes que como una secuencia lineal de pasos. Cabe mencionar: 1. El marco conceptual desde el cual se comprende la salud y la enfermedad. Este marco opera como un conjunto de teoras que interpretan la salud como ausencia de enfermedad o que intentan constmir un objeto autnomo de salud, social y adaptativo; teoras que se enlazan con enfo' ques axiolgicos y no han delimitado de manera suficiente los planos en que emerge la salud: biolgico, social, poltico e ideolgico (Almeida Filho, N., 2001). 2. Los procesos y estmcmras de la sociedad, as como su temporalidad histrica. Una manera de articular estmctura y procesos en una temporalidad propia diacrnica y sincrnica- consiste en relacionar situacin y estado de salud con modelos de desarrollo. Estos ltimos son mucho ms que los modelos econnucos. Es ms, el abordaje de estos temas debe marcar fronteras de manera explcita con el reduccionismo econmico, sin olvidar la estmctura y los modelos econmicos. Esto imphca considerar la poca histrica, la cultura modema, los contextos global e intemacional, y el contexto nacional. Y en este ltimo es necesario retomar las estmcturas y procesos, la modemizacin y su relacin con la constmccin de modemidad, y sus efectos sobre la sociedad, la cultura, las instituciones, la salud y la enfermedad. Los problemas de las desarticulaciones Cuando el anlisis situacional de la salud se aborda sin establecer previamente su conexin con los modelos y procesos de desarrollo se presentan

422

Podemos comprender las problemticas de salud pblica? Notas metodolgicas para el anlisis situacional

los siguientes problemas: distorsin del alcance histrico del anlisis y, por tanto, de su nocin de temporalidad, inadecuada interpretacin de tendencias, pobre valoracin de la articulacin de los fenmenos de la salud con las estmcturas de la sociedad y sus dinmicas e, imposibilidad para proyectar la situacin. Para superar estos problemas es necesario identificar la relacin entte salud y desartollo, conceptos que tienen una significacin compleja (Agudelo C , 1999). Algunos enfoques permiten establecer un cierto tipo de relacin entte salud y desarrollo. A continuadn reseamos algunos de ellos, 1. Teora de la comprensin de la morbilidad En 1980 Fries plante la teora o hiptesis de comprensin de la morbilidad. En el resumen se expresaban las siguientes ideas: "La duracin promedio de la vida se ha incrementado de 47 a 73 aos en este siglo, pero la duracin mxima de la vida no se ha incrementado. De esta manera, las curvas de sobrevivencia han asumido una forma cada vez ms rectangular. Ocho por ciento de los aos de vida perdidos por muerte prematura no ttaumtica se han eliminado y la mayora de las muertes prematuras son ahora debidas a enfermedades crnicas en edades avanzadas. Los datos actuales permiten calcular la duracin promedio de vida, aproximadamente en 85 aos. Las enfermedades crnicas probablemente sern pospuestas por cambios en los estilos de vida, y se ha demostrado que los marcadores fisiolgicos y psicolgicos del envejecimiento pueden ser modificados. As, la edad promedio de la primera enfermedad puede incrementarse, haciendo la curva de morbilidad ms rectangular. La extensin del vigor adulto cerca del lmite fijo de la duracin de la vida, comprime el perodo de senescencia hacia el fin de la vida. Las esttategias de investigacin en salud para mejorar la cahdad de vida requieren un cuidadoso estudio de la variabilidad del fenmeno de envejecimiento y como puede ser modificado" (Fries, J.F., 1980). Desde este enfoque Fries exttae unas consecuencias en poltica, en trnnos de un "envejecinento exitoso" que sera posible si el sistema de atencin se concentta en la prevencin antes que en sofisticados medios para identificar y ttatar las enfermedades.
)

Este modelo no ha sido sometido a un conttaste suficiente con evidencias empricas, y los supuestos de los que parte no son necesariamente ciertos

423

La Salud Pblica Hoy

(Lpez-Moreno y ottos, 1998). La esperanza de vida se incrementa por muchas razones y vas, una de las cuales, ciertamente no la ms importante, es el desplazamiento de la edad promedio en que se inician las enfermedades crnicas. Entte ottas razones la esperanza de vida puede incrementarse por un mejor ttatamiento de las enfermedades crnicas, sin que se haya logrado evitar su aparicin temprana, lo que conducira a una expansin de la morbilidad. Esta relacin entte esperanza de vida y comprensin de la morbilidad, sera luego tomada por la teora de la ttansicin epidemiolgica y aplicada a las enfermedades infecciosas de manera unilateral. En la mayor parte del mundo la morbilidad ttanscurri de una manera diferente a la predicha inicialmente por la teora de la transicin epidemiolgica, ya que las enfermedades agudas han permanecido o se han expandido, al tiempo que se incrementan las enfermedades crnicas. Sin embargo, la posibilidad de evaluar la capacidad explicativa o predictiva a travs del comportamiento de la morbilidad en grandes gmpos de poblacin, es una ventaja del modelo, que le permite prescindir de hiptesis cul hoc para atenuar los vacos tericos y metodolgicos. 2. Enfoques de la transicin Los enfoques de ttansicin de la morbilidad y la mortalidad son mltiples y diversos. En los ltimos 30 aos, estos planteamientos han pasado de uno a ttes procesos diferentes de ttansicin, cuyo centro sigue siendo la ttansicin epidemiolgica. Los fenmenos demogrficos y en particular las ttansiciones demogrficas, han sido ampliamente estudiadas, conceptualizadas y documentadas, as como sus interacciones con la fecundidad y mortalidad, hasta conformar modelos de apreciable capacidad explicativa y predictiva. No puede afirmarse lo mismo de la ttansicin epidemiolgica. En sus primeras versiones se entenda por esta el "...complejo cambio en los pattones de salud y de enfermedad y en las interacciones entte estos pattones y sus determinantes y consecuencias demogrficas, econmicas y sociales" (Omram, A.R., 1971). Este y otros enfoques de los aos 70 (Frederksen, H. 1969; Lerner, M., 1973) sufran de un evidente determinismo evolutivo, que ubicada a los pases en una mta de desarroUo lineal y unidireccional, en la que todos los pases iban ttas las huellas de los pases desarrollados. En ese sentido, la mta del progreso pasaba por la ttansicin

424

Podemos comprender las pnMemticas de salud piblica? Notas metodolgicas para el anlisis situacional

epidemiolgica -desplazamiento de las pandemias de infeccin por las enfermedades degenerativas y causadas por el hombre, en palabras de Omrany al final del camino debera producirse el encuentto fehz entte desarrollo y mortaUdad. A finales de la dcada de los 80 se dio a conocer un conjunto de estudios que revivieron la teora de la ttansicin epidemiolgica con un nuevo ropaje (Olsansky S.J., 1986; Frenk, J., Bobadilla J.L., y ottos, 1989). Estas propuestas se consolidaron en la dcada de los 90, hasta convertirse en los enfoques dominantes en muchos pases, ampliamente utilizados por las agencias intemadonales (Frenk J., Frejka T, 1991); (Frenk, J., BobadiUa J.L., Stem, C. 1991); (BobadUla, J.L., Frenk, J., Lozano, R., Frejka, T, Stem, C , 1993);(Mosley, W.h., Bobadilla, J.L., Jamison, D.T., 1993); (Kjelsttom, T, Rosenstock, L., 1990). La nueva conceptualizacin se refiere a la "ttansicin en salud" que incluye la ttansicin demogrfica, la ttansicin epidemiolgica, el cambio en los factores de riesgo y la polarizacin epidemiolgica. De manera resumida esta teora plantea lo siguiente: "Se consideran incluidos en el concepto de ttansicin de la salud dos procesos interrelacionados: la ttansicin de la atencin sanitaria y la ttansicin epidemiolgica. Esta ltima abarca ttes procesos bsicos: a) la sustitucin entte las primeras causas de muerte de las enfermedades infecciosas comunes por enfermedades no ttansmisibles y lesiones; b) el desplazamiento de la mayor carga de morbilidad desde los gmpos ms jvenes y los grupos de edad avanzada; y c) el cambio de una situacin de predominio de la mortahdad en el panorama epidemiolgico y otta en la que la morbilidad es lo dominante. En Amrica Latina se observa un perfil de salud de gran heterogeneidad en el que los distintos pases se encuenttan en distintas etapas de la transicin epidemiolgica. No obstante, la mayor parte, a diferencia de los pases desarrollados, pueden estar attavesando por una nueva experiencia de ttansicin, caracterizada por: a) alta incidencia simultnea de enfermedades de ambas etapas, pre y posttansicional; b) resurgimiento de algunas enfermedades infecciosas que ya haban sido conttoladas : c) irtesolucin del proceso de ttansicin, de manera que los pases parecen estancados en un esta-

425

La Salud Pblica Hoy

do de morbilidad mixta; d) desarrollo de una polarizacin epidemiolgica peculiar, no solo entte los pases, sino dentro de ellos en distintas zonas geogrficas y entre las diversas clases sociales. Esta experiencia se denomina "modelo polarizado prolongado" (Frenk J., Frejka T, 1991). En este enfoque se entiende por "condiciones de salud" los procesos de salud y enfermedad que definen el perfil epidemiolgico de una poblacin, equivalente a la transicin epidemiolgica; o sea, los cambios de frecuencia, magnimd y distribucin de las condiciones de salud, expresados en trminos de muerte, enfermedad e invalidez. La ttansicin epidemiolgica tambin se describe como los "... cambios a largo plazo en los pattones de muerte, enfermedad, invalidez y que, por lo general, se presentan junto con las transformaciones demogrficas, sociales y econmicas ms amplias". As mismo, "... se centta en la evolucin del perfil predominante de mortahdad y morbilidad" (Frenk J., Frejka T 1991). A partir de esta conceptualizacin se ocupa del anlisis del estado de salud en Amrica Latina y del modelo de transicin. En el primer aspecto interpreta que "... los gradientes de las causas seleccionadas de muerte por infecciones y enfermedades crnicas muesttan que los diversos pases de la regin se encuenttan en diferentes etapas de la transicin epidemiolgica". En el segundo aspecto, presenta un nuevo modelo de transicin que denomina polarizado y prolongado: "Entte los pases que han llegado a una etapa avanzada y los que apenas se ubican en una etapa inicial, se encuentta un tercer gmpo,.una nueva experiencia de ttansicin, diferente a la de los pases desarrollados" (Frenk J,, Frejka T, 1991). Las caractersticas centtales de este modelo son la superposicin de etapas, la contta ttansicin, la ttansicin prolongada, y la polarizacin epidemiolgica. Esta ltima remite a las desigualdades sociales y econmicas y "..parece obedecer a procesos histricos que han conducido a la divisin entte una poblacin mral cuya economa es principalmente agrcola y una poblacin urbana basada en una econoim'a industrial y de servicios" (Frenk J., Frejka T, 1991). Dentto de esta escuela, sin embargo, existen por lo menos dos enfoques de la ttansicin, cuyas consecuencias son diferentes. El primero de ehos, ya expuesto, est centtado en el perfil epidemiolgico. El segundo enfoque combina la ttansicin demogrfica con los dems factores ya sealados. La propuesta de Mosley ((Mosley, W.h., Bobadilla, J.L., Jamison, D.T., 1993))

426

Podemos comprender las problemticas de salud pblica? Notas metodolgicas para el anlisis situacional

matiza la versin anterior, al plantear una visin ms clara de la transicin demogrfica y sus efectos sobre la mortalidad y la morbihdad. En este enfoque se reduce de manera significativa la capacidad exphcativa de la ttansicin epidemiolgica dejndola nicamente como expresin de los cambios en los perfiles de morbilidad y mortahdad, provocados en gran parte por los cambios demogrficos. As mismo, inttoduce la categora de "cambio en los pattones de riesgo" (Kjelsttom, T, Rosenstock, L., 1990) para retomar "las tendencias econmicas y sociales globales que estn ttansformando los factores de riesgo de las diferentes enfermedades". Este enfoque, sin embargo, conserva del anterior la nocin de polarizacin epidemiolgica y ubica las enfermedades como pre y posttansicionales. Consideran la fase posttansicional como idntica a la fase ttes de Omram (enfermedades degenerativas y originadas por el hombre). Cabe mencionar, una ltima variante, que alude al hecho de que las etapas no slo se superponen, resurgen viejos problemas y persisten ottos, sino que tambin se produce un fenmeno de acumulacin epidemiolgica. Esta concepcin se aproxima, sin reconocerlo, a la completa negacin de la ttansicin epidemiolgica. La teora de ttansicin epidemiolgica es un producto del duahsmo de las ciencias sociales. La ttansicin se convierte en una categora independiente del punto de partida y de llegada. El modelo de desarrollo de Uegada es el de los pases industriaUzados, o es slo la fase epidemiolgica de las enfermedades degenerativas y originadas por el hombre, independientemente de aquel? Qu es pre y qu es post con respecto a la ttansicin? Qu sigifican de manera concreta con respecto al proceso de modemizacin y de constmccin de la modemidad de un pas especfico? Significa algo ms que la nocin de que todo lo que existe sobre la tierra tiene un pasado y un fumro? Si estos enfoques se observan desde los aspectos tericos y metodolgicos, que es necesario tener en cuenta para examinar la relacin entte salud y desarrollo y viceversa (Agudelo C , 1999), es posible identificar los problemas que presentan. A continuacin se resean algunos de ellos: 1. El concepto de ttansicin entte dos puntos o momentos histricos, que no se conocen, est pobremente definido. Parece sugerir que se artanca

427

La Salud Pblica Hoy

2.

3. 4.

5.

6.

7.

8.

de un pasado de attaso para Uegar a un futuro similar al de los pases desarroUados. Ante la ausencia de evidencias que permitan documentar los procesos histricos se ttabaja con modelos generales y absttactos. Las escasas especificaciones del modelo de ttansicin se ttabajan nicamente en trminos econmicos y sociales, dando lugar a interpretaciones cargadas de economismo. Las estmcturas nacionales se mencionan pero no se examinan ni hacen parte de los modelos, como no sea por sus resultados o manifestaciones, Se utilizan como prototipos modelos de desarrollo "ideales", ideolgicos o basados en juicios de valor: "..muchas de las circunstancias emergentes en la ttansicin no son en absoluto un signo de progreso, sino ms bien una expresin de modos deficientes de industriahzacin"(Frenk J., Frejka T, 1991). En consecuencia, los modelos no se toman por lo que son y lo que debe ser explicado y documentado, sino por un hipottico proceso de cambio en la fase de desarrollo que nunca se hace exphcito, que tan slo acompaa al modelo de ttansicin epidenolgica, sin que sea clara la relacin causal del primero sobre el ltimo, Un perfil epidemiolgico no dice nada, sin el anlisis especfico del pas. En ottos trminos, dos perfiles epidemiolgicos similares pueden ser consecuencia de reahdades, procesos y modelos de desartollo muy diferentes, y viceversa. En la escala de anlisis de grandes poblaciones, como ocurre con Amrica Latina, es arbittario el paso de la heterogeneidad (diversidad de experiencias nacionales) a la homogeneidad interpretativa del modelo global, Reconoce slo formalmente las relaciones entte caractersticas demogrficas y perfil epidenolgico, pero no se exttaen l se incluyen en la interpretacin las consecuencia de estas relaciones. El resultado es que gran parte de las caractersticas de la ttansicin epidemiolgica, corresponden a los efectos poblacionales de la ttansicin demogrfica. As, incluso sin un cambio en las tasas de morbihdad y mortahdad especficas por edad, la declinacin proyectada de la fecundidad tendr un efecto significativo en la estmctura por edades y, de esta manera, en la frecuencia relativa de las diferentes causas de muerte simplemente porque la poblacin est envejeciendo. Aunque se critica la visin lineal y unidireccional de los enfoques previos, el modelo polarizado prolongado no supera este problema, ya que mantiene la visin del proceso de desarrollo en el marco de unas ttansi-

428

Podemos comprender las problemticas de salud pblica? Notas metodolgicas pam el anlisis situacional

dones cuyos principio y fin, lo pre y lo pos, son indefinidos pero necesarios y casi fatales. En ottas palabras, no bastan la superposicin de etapas -y su cortelato la acumulacin- l las contta ttansiciones para superar el enfoque evolucionista, si se mantiene una caracterizacin que conecta mecicamente el pasado con el futuro. As nsmo, no hay una concepcin explcita del tiempo histrico. La nocin de ttansicin prolongada no es definida, ni conceptualizada, ni documentada. Parece referirse a un proceso que dura en el tiempo. As, reconociendo que tambin los pases industrializados experimentaron la superposicin de etapas -lo que indicara que esta categora sera un rasgo comn, dbil como herramienta para identificar y clasificar- se sostiene que "El rasgo distintivo de muchos pases latinoamericanos es el carcter prolongado de dicha coexistencia..." (Frenk J,, Frejka T., 1991). Cmo encajar este concepto dentro del proceso tricentenario de estmcturacin del capitahsmo en los pases hoy industrializados, frente a los 150 aos de los pases de Amrica Latina? Cunto tiempo coexistieron las enfermedades infecciosas y crnicas en el primer caso y cunto coexistirn en el segundo? 9. La polarizacin epidemiolgica remite a una nocin bsica de justicia distributiva y equidad, atada a la versin econmica que por largotiempoha interpretado nuestras problemticas como resultados de una sociedad dual. Estos problemas advierten sobre la necesidad de reconocer dos dimensiones diferentes del modelo de ttansicin en salud y epidemiologa, si se desea utilizarlo de manera pragmtica: el componente morfolgico que representa las tendencias de las enfermedades y la mortalidad, o sea, los perfiles epidemiolgicos, desde los cuales es posible examinar el sistema de salud y las relaciones entte prevencin, promocin y ttatamiento. De otto lado, se deben considerar los determinantes estmcturales y los procesos de la salud y la enfermedad que son especficos de cada pas y que difcilmente pueden ser exphcados por un modelo de ttansicin genrico. En Colombia, el modelo de ttansicin epidemiolgica, como ottos modelos y modas, se ha asumido de manera acrtica, reproduciendo uno ttas otto, sus problemas metodolgicos y conceptuales (RODRGUEZ, J., GALLARDO, H.M., 1999; COLCIENCIAS, 1999). Incluso, se ha utilizado de manera extensa para definir polticas pblicas (COLCIENCIAS, 1999), mienttas son aisladas las voces que convocan a un anlisis de mayor profundidad (ORTIZ F,J.,1999).

429

La Salud Pblica Hoy

3. Determinantes de la salud Un gmpo amplio y heterogneo de investigaciones y propuestas conforman este campo de anlisis. Sus acepciones ms frecuente son los "factores condicionantes", las "condiciones de vida" y "trabajo y salud", Dentto de este gmpo se ha venido acumulando evidencia lentamente sobre la manera como operan los determinantes sociales, econmicos, polticos y culturales sobre la salud. De este gmpo hacen parte, entte ottos, las propuestas de FRENK J FREJKA T., y ottos, 1991.; OPS-OMS., 1994; LALONDE, M1996; MCKEOW, MT.,1990; BLUM, H.L.,1976, y la Carta de Ottawa. Algunos de estos enfoques no logran mantener su independencia terica y metodolgica con respecto a las teoras de la ttansicin. En medio de un conjunto amplio y creciente de aportes para la comprensin de la salud, y por tanto para el anlisis situacional, es posible identificar algunos de los problemas que se manifiestan en estos enfoques: 1. Los determinantes especficos de la salud con frecuencia se enmarcan en un esquema simplista de efectos agregados o sumatoria aritmtica. 2, Los determinantes suelen articularse o estmcturarse en el mbito de pequeos espacios humanos, pero no logran igual resultado frente a los procesos sociales globales. Esto podra indicar un pobre desarrollo de mtodos para articular estmcturas, instituciones y procesos, lo que dificulta su aplicacin al anlisis situacional. El alcance de la rearticulacin El abordaje del contexto nacional debe ser realizado desde la relacin modemizacin-modemidad y sus manifestaciones y efectos en la cultura nacional y los procesos de la vida material, demogrficos, econmicos, laborales, ambientales y ottos similares. Desde all es posible caracterizar algunos de los principales factores detemnantes, es decir, aquellos factores que pueden explicar porqu hay gente sana y otta enferma, delimitando algunos aspectos de la salud positiva de la poblacin, as como las tendencias principales de la enfermedad. Entonces, con alguna certeza, esteremos en condiciones de examinar problemticas especficas de salud pblica.

430

Podemos comprender las problemticas de salud pbUca ? Notas metodolgicas para el anlisis situaronal

Referencias bibliogrficas ALMEIDA FILHO, N. For a general thoery of health: preliminary epistemological and anthropological notes. Cademos de Sade Pblica; 17(4):753-799, 2001. AGUDELO C. Desarrollo y salud. Revista Salud Pblica. 1(1): 17-28, 1999. BLUM, H.L. From a concept of health to a national health policy, Am. J. ol Health Planning. 1:3-22, 1976. BOBADILLA, J.L., FRENK, J., LOZANO, R., FREJKA, T., STERN, C. The epidemiologic transition and health proiorities. In : JAMISON, D., MOSLEY, W.H., MEASHAM, A.R., BOBADILLA, J.L. Disease control priorities in developing countries. Oxford University Press, World Bank, 1993. CSPEDES, J.E. Proceso de transicin en salud en Colombia e implicaciones para el prximo milenio. Santaf de Bogot: Mimeogrfico, 1989. COLCIENCIAS. Ciencia y tecnologa de la salud. Plan Estratgico 19992004. Programas Nacionales de Ciencia y Tecnologa . Santaf de Bogot, octubre de 1999. EVANS, R., BARER, M.L., MARMOR, T.R. Por qu alguna gente est sana y otra no? Madrid : Editorial Daz de Santos, 1996. FREDERKSEN, H. Feedbacks in economic and demographic ttansition. Science. 166:837-847,1969. FRENK, J., BOBADILLA, J.L., et. al. Health ttansition in middle-income countries: new challenges for health care, Health Policy and Planning. 4 (l):29-39, 1989. FRENK, J., BOBADn:.LA J.L., STERN, C , et. al. Elements for a theory of health transition.//ea///i Transition Review. l(l):21-38, 1991.

431

La Salud Pblica Hoy

FRENK J., FREJKA T, y ottos. La transicin epidemiolgica en Amrica Latina, Bol OfSanitPanamlll(6):4S5-496, 1991. FRES, J.F. Aging,natural death, and the compression of morbidity. The New England Journal of Medicine. 303 (3),july 17: 130-135, 1980. GONZLEZ, A., VELANDIA M. La situacin de la salud pbhca en Colombia: una visin. Informe Quincenal Epidemiolgico Nacional. Vol. 4 (14).: 362-375; 30 diciembre de 1999. KJELSTROM, T ROSENSTOCK, L. The role of environment and occupational hazards in the adult health ttansition. World health Statistics Quarterly.43(3):lSS-l96, 1990. LALONDE, M. El concepto de "campo de la salud": una perspectiva canadiense. En : OPS. Promocin de la salud: una antologa. Washington, D.C: Publicacin Cientfica 557, 1996. LERNER, M. Modemization and health: a model ofthe health ttansition. San Francisco : American Public Health Association, 8 november 1973. LPEZ-MORENO, S., CORCHO-BERDUGO A., LPEZ-CERVANTES, M. La hiptesis de la comprensin de la morbilidad: un ejemplo de desarrollo terico en epidemiologa. Salud Pblica de Mxico. 40 (5): 442449,1998. MCKEOW, M T, Los orgenes de las enfermedades humanas. Barcelona : Editorial Crtica S.A. 1990. MOSLEY, W.H., BOBADILLA, J.L., JAMISON, D.T. The health ttansition: implications for the health policy in developing countries. In : JAMISON, D., MOSLEY, W.H., MEASHAM AR, BOBADILLA, J.L, Disease control priorities in developing countries. Oxford University Press, World Bank, 1993. OLSANSKY, S.J., AULT, B.A. The fourth stage of the epidemiologic ttansition: the age of delayed degenerative diseases. Milbank Q. 64 (3):355391,1986.

432

Podemos comprender las problemticas de salud pblica? Notas metodolgicas pam el anlisis situacional

OMRAN, A.R. The epidemiologic ttansition. Milbank Q. 49(4):509-538, 1971. OPS-OMS. Las condiciones de salud en las Amricas. Volumen I. Washington, D.C. 1994. Publicacin Cientfica No. 549, edicin de 1994 OPS-OMS. La salud en las Amricas. Volumen I. Edicin de 1998. Washmgton, D.C. : Publicacin Cienti'fica No. 569.1994. ORTIZ F.J. Transicin epidemiolgica: hacia la bsqueda de un modelo. Informe Quincenal Epidemiolgico Nacional. Vol 4 (14).30: 361-362, diciembre de 1999. RODRGUEZ, J,, GALLARDO, H.M. La ttansicin epidemiolgica en Colombia, 1985-1995. Informe Quincenal Epidemiolgico Nacional. Vol 4 (14).30 :209-2ll,juhode 1999.

433

CAPTULO I I I

PASADO, PRESENTE Y FUTURO DE LA LEY 100 DE 1993

Qu sigue despus de la Ley 100?*


JUAN LUIS LONDOO DE LA CUESTA

Tesis bsicas. Esta presentacin intenta sustentar ttes tesis bsicas, a saber el modelo de aseguramiento social de los servicios de salud en Colombia ha dado muy buenos resultados; la ttansicin institucional y fmanciera (prolongada y ambigua) ha sido el problema principal; el pas est listo para unlversalizar el aseguramiento en salud y extender el modelo de aseguramiento ms aU de salud. Gua de la presentacin I. Evaluacin de la Ley 100 -Susprincipios .. - Sus logros

. .

n . Polmicas acerca de la Ley 100, nueve aos despus n i . Qu sigue? - En la salud - En la seguridad social en el siglo XXI I. Evaluacin de la Ley 100 La Ley 1(X) tiene ttes principios y ttes esttategias fundamentales. Los ttes principios son: universalidad, solidaridad y eficiencia. Las ttes esttategias se refieren a: socializacin del financianento, integracin funcional de los servicios y empoderamiento de la demanda.

^Transcripcin de la presentacin oral

435

La Salud Pblica Hoy

Una evaluacin de la Ley 100 debe incluir como mnimo la valoracin de los instmmentos, los micro resultados y los macro resultados. I. Los instrumentos: el aseguramiento El intmmento fundamental ha sido el aseguramiento. Como puede verse en la grfica 3.1, ste se ha incrementado significativamente, pasando de 13.4% de la poblacin en 1993 a 58.1% en el ao 2000. La grfica 3.2 muestta el aseguramiento por edad. Grfica 3.1

La cobertura de la seguridad social en salud

lucitv ) v ^ Lge lo^Oun, M0v>i<:vCun>ixlMi 0 liUMCv rkaiji1utM' KlOO

Grfica 3.2 El aseguramiento por edad

65 60 55 50

o.
CD

45 40 o- 9

01

MI
10-19 20-29

30-39 40-49

50-59

60-69

70-79

80-i-

Fuente: Profamilia. Encuesta de Demografia y Salud 2000.

436

Qu sigue despus de la Ley 100?

2. Microresultados En siete aos, las hospitalizaciones han aumentado en un 40% y el nmero de consultas en un 240%, en consecuencia, el total de servicios de salud individuales se dobl en un perodo de siete aos. Ninguna industria, ningn sector pbhco, ninguna actividad tuvo tanto crecimiento en un perodo tan corto que, adems, coincidi con un perodo de crisis econmica. La encuesta de Profamilia hizo la siguiente pregunta a la gente: Est Usted contento con su servicio de salud? El 85% de los usuarios estn satisfechos, el 10 % dice que el servicio es regular y el 3% que es malo. La Defensora del Pueblo le pregunt a la gente acerca de cmo calificara de uno (1) a cinco (5) su sistema de salud, evaluando la atencin, los mdicos, las especializaciones y la farmacia, entte ottos. La respuesta de 4000 personas enttevistadas, dio como resultado un promedio de cahficacin de cuatto (4) sobre cinco (5) (ver Grfca 3.3). Al respecto, hay ttes elementos que quiero destacar: Primero: la gente se encuentta ms contenta en el rgimen subsidiado. Segundo: las personas estn ms contentas con los mdicos generales y con los especialistas que con el resto del sistema, es decir las personas aprecian la calidad del servicio mdico que estn recibiendo. Tercero: los usuarios estn descontentos con la atencin farmacolgica y con los servicios de promocin y prevencin de la salud, que estn fallando en el rgimen contributivo. Me parece que es una evaluacin que muestta los avances y hmitaciones del sistema. Grfica 3.3 Nivel de satisfaccin con los servicios
5.00

Rgimen contributivo Rgimen subsidiado


Fuefite:Defen8Dr)a del pueblo. Primera encuesta nadonal de calidad en salud. 2002

437

La Salud Pblica Hoy

Al analizar el grado de calificacin del sistema por parte de la gente segn su grado de educacin (sin escolaridad, primaria, secundaria, pregrado y posgrado), se observa que todos estn igualmente contentos, pero llama la atendn que las personas con educacin primaria estn ms contentas que el resto. As mismo, no hay grandes diferencias en la apreciacin de la calidad a travs de diferentes encuestas. Grfica 3.4 Hay diferencias sociales con la satisfaccin?

EPS o ARS

H Atencin general D

I Total

Fuente: Defensoria del pueblo. Primera encuesta Nacional de Calidad en Salud. 2000

En los ltimos 17 aos, debido al progreso econmico y a la atencin sanitaria, haba estado descendiendo la mortalidad infantil. Nosottos en los aos noventa nos comprometimos a lograr una meta del veintinueve por mil (29 X 1000) de mortalidad infantil. En aquella poca, aos ochenta, habamos enconttado un descenso en la mortalidad mfantil y proyectamos este ejercicio con base en la poltica de aquel entonces. Qu nos pas? Que nos equivocamos, Y por qu? Porque la mortalidad infantil descendi dos veces ms rpido de lo previsto y se logr una tasa de mortalidad infantil de veintiuno por mil (21 X 1000) en este perodo (ver grfica 3,5). El gran descenso de la Mortalidad Infantil ocurri en la zona mral debido a la expansin de los servicios en las zonas donde no exista antes (ver Grfica

438

Qu sigue despus de la Ley 1(X)?

3.6). La Ley 100 disminuy la mortalidad infantil como tambin la mortahdad peri-natal debido a que se mejor la atencin prenatal (ver Grfica 3.7). La mortalidad peri-natal en una mujer con conttoles prenatales es del catorce por mil (14 X 1000) mienttas que en la mujer que no tiene estos controles es de cuarenta y cinco por mil (45 X 1000), es decir: ttes veces ms alta. Si se hace el ejercicio de expansin de coberturas de aseguranento y expansin de coberturas en atencin a partos, se encuentta buena parte de la exphcacin de la evolucin del sistema. stos son mis resultados basados en investigaciones y evidencias.

Grfica 3.5 Evolucin de la Mortalidad Infantil

1984

1987

1989

1992

1996

II
2000

Meta para el 2000

fuente: 1984-1996: Web Site de la Organizacin Mundial de ta Salud. 2000: Encuesta de Demografia y Salud de Profamlla

439

La Salud PbUca Hoy

Grfica 3.6 Mortalidad Infantil por Zonas


35

30

25

V)
Q)

D O

15

fuente: Tono con DHS-PrafamWa

Grfica 3.7 Nivel de contro prenatal

440

Qu sigue despus de la Ley 100?

3. Macro-resultados de la Ley 100 Equidad Estuve en una presentacin de Juan Eduardo Cspedes, donde hizo una exposicin detallada sobre la evaluacin de los ndices de desigualdad en cuatto componentes: la desigualdad en la afiliacin, en la utilizacin, en la atencin del parto y en la mortalidad infantil. La grfica 3.8 muestta las tendencias de los cuatto indicadores entte 1995 y el 2000. En el ao 1993, el 40% de la poblacin ms pobre reciba un subsidio equivalente al 8% de sus ingresos; la clase media el equivalente al 4% y la clase alta al 2%. Cinco aos despus pas lo siguiente: el subsidio de la clase baja pas al 24%, de la clase media al 5% y la clase alta pas de recibir un subsidio a pagar un impuesto neto. Esto gener un aumento del ingreso real efectivo del 40% ms sobre la poblacin, es decir, se aument un sptimo en la capacidad efectiva de consumo y se gener una disminucin del coeficiente Gini de la desigualdad en ttes puntos. La Organizacin Mundial de la Salud realiz una evaluacin para ttatar de mirar la equidad en ttes dimensiones en los pases de Amrica Latina: equidad en los resultados, la capacidad de respuesta del Sistema y la equidad financiera, y constmye un ndice global (Tabla 3.1), Nosottos tenemos en cuanto a resultados el tercer mejor puesto de Amrica Latina, despus de Chile y Cuba. En la capacidad de respuesta del sistema tenemos un ndice ms o menos bueno. Y en equidad financiera, medida como la capacidad de aseguramiento cuando hay gastos altos, tenemos el mejor ndice de Amrica Latina. En conjunto despus de la Ley 100, segn las entidades internacionales, tenemos la equidadfinancieraen salud ms alta de Amrica Latina.

441

La Salud Pblica Hoy

Grfica 3.8 La reduccin de la inequidad

0.5 0.4 0.3 0,2 0.1


i . ^ _ ^ ^ _ ^

****"*^^^,

~*-**.^
'*~**^

1
-0.2 IMS
- - Aimaelon Tono - o - utilbaclon C p l M
" : . ' : ' . :

2000
^ mortalidad Infantil Tono

AHndoii el parto Tono

lomte: Tono con DHS.Protnitl.

Tabla 3.1 Informe mundial sobre equidad


Orden 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 Equidad de resultados Chile Cuba Colombia Costa Rica Paraguay Argentina Mxico Uruguay Venezuela Jamaica Panam Nicaragua R. Dominica Peni Guatemala Brasil El Salvador Bolivia Honduras Ecuador Hait Equidad de respuesta Argentina Uruguay R. Dominicana Jamaica Brasil Costa Rica Panam Venezuela Colombia Cuba Chile R. Dominicana Mxico El Salvador Paraguay Nicaragua Guatemala Peni Honduras Hait Bolivia Equidad Financiera Colombia Cuba Uruguay Costa Rica Bolivia Panam Ecuador Argentina Venezuela Jamaica Mxico R. Dominica Guatemala Hait Nicaragua Chile El Salvador Paraguay Honduras Peni Brasil Equidad Global Colombia Cuba Costa Rica Chile Uruguay Argentina Venezuela Mxico Panam Jamaica R.Dominicana Paraguay Guatemala El Salvador Bolivia Nicaragua Per Ecuador Honduras Hait Brasil
Fuente. Word Heitlh Repon

442

Qu sigue despides de la Ley 100?

Eficiencia Para mirar la eficiencia, se analizan los resuhados en trnnos de AVISAS, los insumos (mdicos, financieros y tecnolgicos) y se hace una razn o clculo sofisticado. Con base en esto, uno puede evaluar la eficiencia como la capacidad de producir resultados con los recursos que hay en los pases de Amrica Latina. Se observa que la eficiencia tiende a crecer en relacin con el ingreso de los pases. Hay pases que estn por encima del ingreso, son los ttes pases que en la universidad se estudian como pases exttemos del continente, Cuba, Costa Rica y Chile.

Grfica 3.9 Eficencia en los sistemas de salud en Amrca Latina 1


Colombia

0.9 0.8 0.7 0.6 0.5 0.4. 650


'''"eajjf

t^uba

Costa Rica

'

y*^____.-'

Nicaragua

^_^,,,

Jamaica R.Dom Venezuela 9^'^^^^ Mexico jjfagoSy" _,^'-ASentina Guatemala TTJmedio "^ * Panam ^__^.-ETslvador Ecuador I Brasil Honduras g ^^'^^

m
1

Bolivia

1100

1800

3000

4900

8100

13400

22000

Ingreso per capIta (in PPP dollars)


Fuente: Grfica con base en ei anexo estadstico dei Worfd Health Report

Segn la Organizacin Mundial de la Salud, Colombia hoy en da, a pesar de la crisis en que se encuentta, tiene el sistema que est produciendo ms resultados con base en los insumos que genera. No quiero enttar en las discusiones de los crticos del proceso de la Ley 100. Me parece que se trata de discusiones filosficas.

443

La Salud Pblica Hoy

n Las polmicas acerca de la Ley 100 Las polmicas filosficas Es la Ley 100 un modelo neoliberal? El verdadero libre mercado es el modelo que haba antes de la Ley 100. Cada cual sacaba de su dinero y pagaba la atencin en salud o bien a ttavs de su mdico o bien porque cubra la prepagada. Eso s era un verdadero modelo hberal. Cuando uno moviliza los recursos pblicos, obliga a la gente a abortar cierto porcentaje de sus ingresos para dedicarlo a la salud y ese dinero se redistribuye a ttavs de un Fondo de Solidaridad, eso no es un modelo hberal. Es un modelo bastante socialista. Yo dira que esta es la verdadera clasificacin. Que adems de ser un libre mercado, es el modelo ms intervencionista de Amrica Latina porque el financiamiento no establece competencia sobre precios, que es la esencia de malas competencias. Aqu no hay competencias de dinero porque estn intervenidos por la base de unos indicadores globales; porque buscamos la integracin de los servicios a ttavs del paciente; porque hay instmmentos tcnicos incluidos en la Ley para cortegir las fallas del mercado. Por supuesto, cuando la gente puede escoger y elegir, se dan fallas, esto es natural en humanos. La evidencia demuestra que como qued la estmctura en capitacin y los mecanismos de pago se corrigieron en su gran mayora. El 70% de las instituciones aseguradoras son entidades sin imo de lucro. Eso significa que en 8 aos logramos expandh cinco veces lo que el Seguro Social demor 50 aos. A esto le llaman neoliberalismo? Histricamente -dado el difcil equilibrio de fuerzas en el Congreso- la Ley 100 result un modelo de centto. Los bancos multilaterales estaban en ottos asuntos en 1993 y recomendaron el modelo slo despus de haber sido inventado en Colombia. Es la Ley 100 inequitativa y excluyente? Uno se pregunta si en los resultados la iiquidad aument. Es un punto muy importante. La evidencia que he presentado es que la iniquidad intema del sistema en salud disminuy. La equidad aument en medio de una iniquidad extema en aumento en el conjunto de la sociedad. En el conjunto de la economa tambin aument la corriente de la desigualdad de la sociedad, por fuera del sistema de salud.

444

Qu sigue despus de la Ley IOO?

En los procedimientos hay, adems, dos elementos que les quiero plantear. Si hay un proceso excluyente de decisiones, hay libertad en el uso, que es muy importante. La hbertad es un elemento esencial de la igualdad. Todos aquellos que creen que la libertad es un proceso neoliberal, estn muy equivocados. La hbertad es un concepto elemental de los colombianos. Es culpable la Ley 100 de la crisis de la salud pblica? Tengo que decir que los resultados son mixtos. Es cierto que las vacunaciones bajaron, los ndices de enfermedades de ttansmisin son mixtos ya que han aumentado, pero no estoy seguro de sus causas. Puede ser que se estn midiendo mejor que en ottas partes o que estn reincidiendo eventos como la tuberculosis con el SIDA, fenmeno que ocurre igualmente en pases que no tienen Ley 100. Las coberturas de saneamiento aumentaron fuertemente en los ltimos 7 aos, como producto de la expansin de la Ley 60, que fue una Ley paralela a la Ley 100. El conttol de los medicamentos mejor. La pregunta es: entonces dnde est el problema? Est en la Ley 100? Yo dira que en parte porque las responsabihdades sobre la vacunacin se dispersaron entte las secretaras de salud, las E.P.S y las A.R,S, y cuando los