Вы находитесь на странице: 1из 7

FULL PAPER

FULL PAPER w w w . a f m - j o u r n a
FULL PAPER w w w . a f m - j o u r n a

www.afm-journal.de

www.MaterialsViews.com

A Graphene Nanoprobe for Rapid, Sensitive, and Multicolor Fluorescent DNA Analysis

By Shijiang He, Bo Song, Di Li, Changfeng Zhu, Wenpeng Qi, Yanqin Wen, Lihua Wang, Shiping Song, Haiping Fang,* and Chunhai Fan*

Coupling nanomaterials with biomolecular recognition events represents a new direction in nanotechnology toward the development of novel molecular diagnostic tools. Here a graphene oxide (GO)-based multicolor fluorescent DNA nanoprobe that allows rapid, sensitive, and selective detection of DNA targets in homogeneous solution by exploiting interactions between GO and DNA molecules is reported. Because of the extraordinarily high quenching efficiency of GO, the fluorescent ssDNA probe exhibits minimal background fluorescence, while strong emission is observed when it forms a double helix with the specific targets, leading to a high signal-to-background ratio. Importantly, the large planar surface of GO allows simultaneous quenching of multiple DNA probes labeled with different dyes, leading to a multicolor sensor for the detection of multiple DNA targets in the same solution. It is also demonstrated that this GO-based sensing platform is suitable for the detection of a range of analytes when complemented with the use of functional DNA structures.

1. Introduction

Biomolecular detection has found widespread applications in molecular diagnostics, industrial and environmental monitor- ing, and civil defense, [1,2] which has motivated intense interest in developing rapid, simple, and cost-effective biosensors for proteins, nucleic acids, and small molecules. [37] Nanomaterials have proven of particular utility in this regard due to their unique optical, electronic, and catalytic properties. Significantly, much recent attention has been drawn toward the design of nanomaterial-based biosensors based on interactions between biomolecules and nanomaterials of different compositions, dimensions, and shapes. [814] For example, Mirkin and others developed a series of sensitive DNA assays by coupling DNA hybridization events with unique plasmonic properties of gold nanoparticles (AuNPs). [6,1517] Exciton–plasmon interactions of different nanostructures were also exploited by Kotov and co-

[*] Prof. C. Fan, Prof. H. Fang, S. He, Dr. B. Song, Dr. D. Li, C. Zhu, W. Qi, Y. Wen, Dr. L. Wang, Prof. S. Song Laboratory of Physical Biology Shanghai Institute of Applied Physics Chinese Academy of Sciences Shanghai 201800 (China) E-mail: fchh@sinap.ac.cn; fanghaiping@sinap.ac.cn

DOI: 10.1002/adfm.200901639

workers to monitor specific protein bind- ing events. [18] In this work, we report a new mix-and-detect strategy for simultaneous fluorescent detection of multiple DNA targets by exploring interactions between graphene and DNA oligonucleotides. Homogeneous detection of nucleic acids with fluorescent DNA probes pos- sesses several inherent advantages, such as operation convenience, rapid hybridiza- tion kinetics, and potential compatibility with real-time polymerase chain reaction (PCR) and in situ cellular imaging. [4,7,19] Such probes usually consist of fluorophore- quencher pairs and rely on Fo¨ rster reso- nance energy transfer (FRET), for which distance-dependent fluorescence quench- ing is elaborately designed to be closely

associated with DNA hybridization events (e.g., via stem-loop structures in fluores- cent molecular beacons). More recently, in order to increase the signal-to-noise ratio of such DNA probes, traditional organic fluorophores and quenchers were replaced with highly bright quantum dots and organics with highly efficient nanoquenchers such as AuNPs and single-walled carbon nanotubes (SWNTs), respectively. [2023] Graphene is an one-atom- thick 2D nanomaterialwith extraordinary electronic,thermal, and mechanical properties, [24,25] which, along with its water-soluble derivative, graphene oxide (GO), has become extremely popularin nanoelectronics and nanocomposites. [2628] However, biological applications of graphene and GO remain to be explored. [29,30] Of our particular interest, graphene was recently predicted through theoretical calculations to be a superquencher with the long-range nanoscale energy transfer property, [31,32] which, in combination with the unique DNA/GO interactions, forms the basis of a convenient and versatile strategy for multicolor fluorescent DNA analysis. Very recently, and during the preparation process of the current work, Lu et al. reported that GO could bind and quench a dye-labeled single-stranded DNA (ssDNA) probe; the fluorescence was recovered when the probe formed a duplex with its target, which released the probe from GO. [33] We herein report a new graphene-based strategy that allows multicolor DNA analysis in the same solution and a mix-and-detect assay format with significantly improved sensi- tivity and speed (Scheme 1), and explore the mechanism underlining GO–DNA interactions via both theoretical and experimental studies.

Adv. Funct. Mater. 2010, 20, 453–459

2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

experimental studies. Adv. Funct. Mater. 2010 , 20, 453–459 2010 WILEY-VCH Verlag GmbH & Co. KGaA,

453

w w w . a f m - j o u r n a l

www.afm-journal.de

w w w . a f m - j o u r n a l .

www.MaterialsViews.com

FULL PAPER
FULL PAPER

Scheme 1. Scheme for the GO-based multicolor DNA analysis. Fluorescence spectra of mixture probes (P5, P6, P7) in the presence of different targets T5 (blue), T6 (red) and T7 (orange) with the excitation wavelengths of 494, 643, and 587 nm.

with the excitation wavelengths of 494, 643, and 587 nm. Figure 1. a) Fluorescence quenching of

Figure 1. a) Fluorescence quenching of FAM of 50 nM in the absence (black) and presence of GO with a series of concentrations (top to bottom: 5, 10, 15, 20, 25, 30, 35 mg/mL). b) Fluorescence quenching of 6-ROX of 50 n M in the absence (black) and presence of GO with a series of

concentrations (top to bottom: 2.5, 5, 7.5, 10, 15, 20, 25 mg/mL).

2. Results and Discussion

The chemically synthesized GO was readily water-dispersible due to the presence of suspended hydroxyl and carboxylic groups at the surface. We first characterized as-prepared GO samples to confirm their exfoliation. Importantly, tapping-mode atomic force micros- copy (AFM) studies revealed that the thickness of GO was of

1 nm, characteristic of a fully exfoliated GO sheet (see Supporting Information (SI):

Fig. S1a), [34] and the lateral size of GO was fairly polydisperse. Also, GO showed the clearly visible honeycomb structure of graphene in high-resolution transmission electron micros- copy (HRTEM; see SI: Fig. S1b). The fluorescence quenching ability of GO was evaluated via fluorescent measurements of dyes in the presence of GO. Consistent with the previous theoretical prediction, [31,32] we found that fluorophores, such as FAM (carboxy fluorescein) and ROX (6-carboxy-X-rhoda- mine), were almost nonfluorescent in the presence of GO (Fig. 1), which possibly arose from strong hydrophobic adsorption of these dyes at the GO surface and highly efficient long-range energy transfer from the dye to GO. [31,32] Interestingly, while both GO and DNA are negatively charged, the fluores- cence of the FAM-tagged ssDNA probe (P1, see Table 1 for the sequence) was rapidly quenched by GO as well, with the fluorescence quenching dependent on the ratio between P1 and GO (Fig. 2). The quenching kinetics were fairly fast, with nearly 100% fluorescence quenching within only several minutes after the addition of GO in a DNA solution of 10 n M (Fig. 2e). Also of note, the quenching kinetics was dependent

on the length of the oligonucleotide; that is, longer sequence led to slower kinetics (Fig. 2e). In direct contrast, when P1 was hybridized with its comple- mentary target T1 to form a duplex, the FAM fluorescence largely remained in the presence of GO (Fig. 2c), which suggested that the interactions between double-stranded DNA (dsDNA) and GOwere rather weak. In the presence of T1 at fivefold excess (50 nM), the fluorescence intensity was increased by approximately 50 times as comparedtothat ofthe ssDNAprobe (‘‘post-mixing’’ strategy). As a

Table 1. DNA sequences employed in this work.

Oligonucleotide

Sequence

P1: FAM-tagged probe T1: target for P1

5 0 -FAM- TCGTTGGAGTTTGTCTG-3 0 5 0 -CAGACAAACTCCAACGA-3 0 5 0 -GCAGAGCCAGTTCCAAG-3 0

R1:

random sequence

M1: single-base mismatched target for P1 M2: single-base mismatched target for P1 M3: single-base mismatched target for P1 T2: long target for P1 (complementary part in the middle)

T3: long target for P1 (complementary part at the 5 0 -end) T4: long target for P1 (complementary part at the 3 0 -end)

P5: FAM-tagged P16 probe T5: target for P5 P6: Cy5-tagged P21 probe T6: target for P6 P7: ROX-tagged P53 proebe

T7: target for P7 P8: MSO probe for Hg 2 þ P9: Adenosine probe (Underlined part is the anti-adenosine aptamer sequence)

5 0 -CAGACA 5 0 -CAGACA 5 0 -CAGACA

5 0 -ATTTCACTGACAGTTCAGACAAACTCCAAC GACTAGCTACGTGCCGA-3 0 5 0 -CAGACAAACTCCAACGACTAGCTATG TGCCGAATTTCAAGGACAGTT-3 0 5 0 -CTAGCTATGTGCCGAATTTCAAGGACAGTT CAG ACAAACTCCAACGA-3 0 5 0 -FAM- CAGAGGCAGTAACCA-3 0 5 0 -TGGTTACTGCCTCTG-3 0 5 0 -Cy5 -CCCTAATCCGCCCAC-3 0 5 0 -GTGGGCGGATTAGGG-3 0 5 0 -ROX -CCTGGTGCCGTAGAT-3 0 5 0 -ATCTACGGCACCAGG-3 0

5 0 -FAM -TTCTTTCTTCCCCTTGTTTGT T-3 0 5 0 -FAM -TAATT ACCTGGGGGAGTATTGCGGAG GAAGGTTAT -3 0

0

AA TTCCAACGA-3 AA A TCCAACGA-3 AA GTCCAACGA-3 0

0

454

AA T TCCAACGA-3 AA A TCCAACGA-3 AA G TCCAACGA-3 0 0 454 2010 WILEY-VCH Verlag GmbH

2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Adv. Funct. Mater. 2010 , 20, 453–459

FULL PAPER

FULL PAPER w w w . a f m - j o u r n a
FULL PAPER w w w . a f m - j o u r n a

www.afm-journal.de

www.MaterialsViews.com

f m - j o u r n a l . d e www.MaterialsViews.com Figure 2.

Figure 2. a) Scheme for the fluorescent DNA detection based on the ssDNA/dsDNA discrimi-

nation ability of GO. b) Scheme for the target hybridization-induced probe liberation from GO.

c) GO-based fluorescence DNA assay. Fluorescence spectra of P1 in the absence (black) and

presence of the complementary target T1 of 50 n M (red), and random sequence R1 of 50 nM (blue). d) Fluorescence spectra for P1 in the presence of GO before (black) and after (red)

incubation with T1. e) Kinetic study for the fluorescence change of the FAM-tagged probes (20 n M) with different lengths in the presence of GO: 17 base pairs (bp; black); 34 bp (red); 51 bp (blue).

f) Kinetic study for the fluorescence change of the GO-bound P1 in the presence of T1 of various

amounts (10, 20, 30, 40, 50 pmol). The excitation and the emission wavelengths are 494 and

526 nm, respectively.

comparison, we also performed a ‘‘premixing’’ protocol similar to the previous report. [33] We first mixed P1 with GO and then challenged the P1/GO complex with T1. Importantly, the prequenched fluorescence in P1/GO was slowly recovered (up to several hours) in the presence of excess T1 and in a concentration-dependent manner (Fig. 2b,d,f), suggesting that P1 was liberated from the GO surface during its hybridization with T1. These results imply that GO possesses significantly different adsorption affinity for ssDNA and dsDNA; that is, ssDNA binds to GO with significantly higher affinity than dsDNA. Also, ssDNA binds to GO in a noncovalent manner, which can be readily separated under external competition (e.g., sequence-specific hybridization). Of note, the latter approach (‘‘premixing’’) is slow

in kinetics due to the presence of competition between P1/GO adsorption and the P1/T1 hybridization; thus, we favor the use of a new ‘‘postmixing’’ strategy in the following DNA detection studies. We carried out a molecular dynamics (MD) simulation to interrogate the observed large discrepancy for interactions between ss- and dsDNA with GO. As shown in the snapshot, all of the nucleobases lie nearly flat at the GO surface, and ssDNAwere stably adsorbed bythe

GO (see Fig. 3a). We attribute this strong adsorption to the p-stacking interaction [35,36] between the ring structures in the nucleobases and the hexagonal cells of the graphene. To characterize the degree of the adsorption, we computed the distance between the atoms of the nucleobases and the surface of graphene. As shown in Fig. 3c, there was a very sharp peak

˚

at 3.5 A . This distance is fairly close to the van

deWaals distance between a carbon atomin GO and a carbon/oxygen/nitrogen atom (the main elements of nucleobases). This suggests that most of the atoms in the nucleobases are directly adsorbed at GO. In contrast, dsDNA could not be stably adsorbed on GO in our MD simulation and retained its helical structure (shown in Fig. 3b). This is because nucleobases were effectively shielded within the densely negatively charged phosphate backbone of dsDNA. While hydroxy groups on GO might interact with phosphate groups of dsDNA, we only observed minimal hydrogen bonding between them, which could not survive at room temperature and in aqueous solution (see Fig. 3b). We reason that this GO-based fluorescence quenching might serve as a sensing platform for quantitative DNA analysis. We first hybri- dized P1 with T1 of various concentrations for 10 min, to which an aliquot of GO was added (postmixing).We foundthatthe fluorescence of unhybridized P1 was efficiently quenched by GO while the hybridized P1/T1 duplex led to

observable fluorescence that formed the basis of a ‘‘signal-on’’ DNA sensor. As shown in Fig. 4a, the fluorescence was intensified along with the increase of the target concentration. This DNA sensor had a linear range of 0 25 n M, with a detection limit of 100 p M DNA as estimated from the derived calibration curve ( > 3 standard deviations (SD)), which excels previously reported molecular beacons [4,20] and nanomaterials-based DNA detection [16,23,33] (typically in the nanomolar range) by at least an order of magnitude (see performance comparison in Table 2). Also of note, even when the whole assay time was reduced to only several minutes (in contrast to hours using either SWNTs or graphene in the previous work [23,33] ), we could obtain signals that were readily distinguish- able from the background, which makes it particularly suitable for mix-and-detection of DNA.

Adv. Funct. Mater. 2010, 20, 453–459

2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

of DNA. Adv. Funct. Mater. 2010 , 20, 453–459 2010 WILEY-VCH Verlag GmbH & Co. KGaA,

455

w w w . a f m - j o u r n a l

www.afm-journal.de

w w w . a f m - j o u r n a l .

www.MaterialsViews.com

FULL PAPER
FULL PAPER

Figure 3. Representative snapshots from MD simulation showing that a) FAM-tagged (red)

ssDNA is tightly adsorbed at the surface of GO; b) dsDNA does not adsorb at the surface of GO.

The FAM, DNA, and GO are shown in purple, green and cyan, respectively. c) Probability of the

atoms in nucleobases at a distance from the GO surface.

We then interrogated the hybridization between a probe and targets of different lengths (17 bp versus 47 bp). In orderto evaluate the perturbation of the unpaired region of the target that might interact with GO, the complementary regions for P1 in the 47-bp target were designed to be in the middle (T2), at the 5 0 - (T3), or the 3 0 - (T4) end. We observed that all these long targets led to smaller

fluorescence signals than T1, which was of the same length as P1. However, we observed that the fluorescence signal for T4 was significantly larger than those of T2 and T3, and distinctly distinguishable from the background (Fig. 4b). This position effect was attributed to the location of FAM and its interaction with GO. When FAM wastagged atthe 5 0 end of P1, it was located right at the duplex region after hybridization with T4; in contrast, FAM was located at the interface of the ss and ds regions for T2/T3. As a result, FAM was more likely to be detached from the GO surface in the case of P1/T4, while it tended to be partially adsorbed due to the presence of ss regions in P1/T2 and P1/T3 at the surface of GO. Consequently, it is possible to employ the GO-based assay in practical DNA detection with long sequences, provided that the probe sequence is well designed. The GO-based DNA detection exhibited high sequence specificity. We only observed a minimal fluorescence increase in the presence

of excess noncognate DNA (Fig. 2c). More importantly, this DNA sensor was of sufficient selectivity to easily differentiate single mis- matches, which offered the opportunity to allow single-nucleotide polymorphism (SNPs) analysis. As shown in Fig. 4b, the fluorescence signal for that target T1 was approximately three times higher than those for the 1-base mismatched targets (C is mutated to T, A or G in the middle). Given that the fully com- plementary duplex (P1/T1) and the mismatched duplexes (P1/M1,

duplex (P1/T1) and the mismatched duplexes (P1/M1, Figure 4. a) Representative fluorescence spectra for P1

Figure 4. a) Representative fluorescence spectra for P1 (10 n M) in the presence of various concentrations of T1 (0, 0.5, 4, 6, 15, 30, and 50 n M, respectively). Inset: calibration curve for the fluorescence intensity versus P1 concentration. The data are recoded with the excitation and emission wavelength of 494 and 526 nm, respectively, and from at least three independent experiments. b) Fluorescence spectra for P1 (10 n M) in the presence of 10 nM of the fully complementary target T1 (black) and single-base mismatched target M1 (red), M2 (blue), and M3 (green). c) Fluorescence spectra for P1 in the absence (black) and presence of the fully complementary target T1 (red), or long targets T2 (cyan), T3 (blue), and T4 (green). d–f) Fluorescence spectra for multicolor detection. Probe mixture in the presence of different targets T5 (blue), T6 (red), and T7 (orange), with the excitation/emission wavelen gths of d) 494/526 e) 643/666, and f) 587/609 nm/nm.

456

gths of d) 494/526 e) 643/666, and f) 587/609 nm/nm. 456 2010 WILEY-VCH Verlag GmbH &

2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Adv. Funct. Mater. 2010 , 20, 453–459

FULL PAPER

FULL PAPER w w w . a f m - j o u r n a
FULL PAPER w w w . a f m - j o u r n a

www.afm-journal.de

www.MaterialsViews.com

Table 2. Performance comparison between homogeneous fluorescent DNA sensors.

Type

Sensitivity

Assay time

Multicolor analysis

Probe synthesis

Ref.

Molecular beacons

 

n

M

Rapid (minutes) Rapid (minutes) Slow ( 1 h) Rapid (minutes)

Yes

Difficult (dual labeling) Difficult (dual labeling) Difficult (dual labeling) Convenient (single labeling) Convenient (single labeling) Convenient (single labeling) Convenient (single labeling)

[4,37]

AuNP–DNA–dye conjugates (stem loop probe)

n

M

Yes

[20]

AuNP–DNA–dye

conjugates

(linear probe)

NR

[a]

NR

[22]

Unmodified AuNP-based DNA detection SWNT-based DNA detection

10 n M 4 nM 10 n M 100 p M

NR

[16]

Slow (several hours)

NR

[23]

GO-based

DNA

detection

(premixing)

Slow

(0.5 h)

NR

[33]

GO-based

DNA

detection

(postmixing)

Rapid (minutes)

Yes

TW [b]

[a] NC stands for ‘‘Not reported’’. [b] TW stands for ‘‘this work’’.

P1/M2, and P1/M3) have relatively small thermodynamic difference, and that sequences were not elaborately designed (e.g., stem-loop structures with inherent stringency), this high sequence specificity for single mismatches was fairly impressive. We attribute this high stringency to the competition between GO/ probe adsorption and probe/target hybridization; i.e., GO possibly competitively destabilizes mismatched duplexes. Simultaneous detection of multiple targets in a homogeneous solution brings about new opportunities for molecular diagnos- tics. [37,38] For example, it is important to detect multiple tumor- suppressor genes in order to identify early-phase cancers in asymptomatic individuals. [39] The large planar surface of GO possesses the ability to interact with multiple DNA strands, which motivated us to explore methods of simultaneous detection of

multiple DNA targets (Scheme 1). We employed three probes (P5, P6, and P7) for three types of tumor-suppressor genes (exon segments of p16, p21 and p53 genes) were labeled with FAM, Cy5 (cyanine 5), and ROX at the 5 0 end, respectively. The selection of these three dyes avoided significant dye-to-dye energy transfer, which were individually excited at 494, 643, and 587 nm, emitting blue (520 nm), red (670 nm) and orange (608 nm) colors, respectively. Upon the addition of specific targets to the probe mixture containing P5, P6 and P7, we observed the emission from the corresponding wavelength. As shown in Figure 4d–f, the p16 target (T5) led to the specific emission of the blue color (FAM), while minimal emission of the other two colors. Similarly, the addition of the p21 target (T6) and the p53 gene produced the red (Cy5) and orange (ROX) colors, respectively. Therefore, this

(Cy5) and orange (ROX) colors, respectively. Therefore, this Figure 5. a) Fluorescence spectra of the MSO

Figure 5. a) Fluorescence spectra of the MSO (P8) in the presence of various concentrations of Hg 2 þ (0, 40, 60, 80, 100, 180 nM). Inset: calibration curve for Hg 2 þ detection. b) Selectivity of the GO-based Hg 2 þ sensor over a spectrum of interference metal ions (120 n M Hg 2 þ , all other ions are of 1 mM). c) Fluorescence spectra of the anti-adenine aptamer (P9) in the presence of various concentrations of A (0, 10, 50, 200, 800, 1200, 2000 m M). Inset:

calibration curve for A detection. d) Selectivity of the GO-based A sensor over G, C, and T (all of 100 mM). The excitation wavelength was 495 nm.

Adv. Funct. Mater. 2010, 20, 453–459

2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

wavelength was 495 nm. Adv. Funct. Mater. 2010 , 20, 453–459 2010 WILEY-VCH Verlag GmbH &

457

FULL PAPER

458

FULL PAPER 458 w w w . a f m - j o u r n

www.afm-journal.de

458 w w w . a f m - j o u r n a l

www.MaterialsViews.com

GO-based multicolor DNA analysis provides a promising approach for challenging applications such as allele discrimination. The ability of GO to differentiate ss- and dsDNA not only offers a new approach to detect DNA, but may find applications in detecting a wide spectrum of analytes when complemented with the use of functional nucleic acid structures (e.g., aptamers). As a proof of concept, we herein demonstrated the detection of mercuric ion (Hg 2 þ ) and adenine (A) with a T-rich mercury- specific oligonucleotide (MSO) and an anti-adenine aptamer. [40] Without Hg 2 þ , the FAM-labeled MSO (P8) was in the single- stranded state and not fluorescent inthe presence of GO. However, the introduction of Hg 2 þ led to the formation of the stem-loop structure that could not be quenched by GO. Therefore, the fluorescence ofMSOwas dependent onthe concentration of Hg 2 þ . This sensor had a linear range of 30–180 n M and a detection limit of 30 n M, which compared favorably with previously reported Hg 2 þ fluorescent sensors. [41] Also importantly, this Hg 2 þ sensor was selective enough to distinguish a range of interference metal ions (Fig. 5a). The anti-adenine aptamer is an in vitro selected short oligonucleotides targeting the adenine molecule with antibody- like specificity and affinity. [42] When a FAM-tagged anti-adeonsine aptamer (P9) was incubated with GO, the fluorescence was largely quenched. The observed small background fluorescence might arise from the secondary structure of this sequence. In the presence of adenosine, the probe P9 was converted to a rigid tertiary structure. Similarly, GO could not quench the fluorescence of the rigid aptamer structure. Based on the difference in fluorescent intensity, we could detect adenosine with a detection limit as low as 10 mM (Fig. 5b). Of note, analogous molecules, such as cytosine (C), guanine (G), and thymine (T), only led to weak responses, suggesting the high selectivity of this adenine sensor.

3. Conclusions

In summary, we have demonstrated that GO possesses high fluorescence quenching ability as well as different affinities toward ss- and dsDNA using both theoretical calculations and experi- mental studies. Based on these findings, we designed a new homogeneous sensor for multiplex, sequence-specific DNA detection. This GO-based DNA sensor has several important advantages. First, GO can be readily synthesized in large quantities, and in contrast to dually labeled molecular beacons, the probe is only labeled with a single dye, which reduces the cost for DNA assays. Also, this is a homogeneous, mix-and-detect assay method that can be finished within minutes. Therefore it provides opportunities to develop low-cost and rapid molecular diagnostic tools. Second, the availability of large planar surfaces of GO makes it possible to detect multiple molecular targets in the same solution. Particularly, the compatibility of GO with different DNA structures provides great versatility to develop sensors for a spectrum of analytes with relatively convenient design. Third, the GO-based DNA detection improves the sensitivity by at least an order of magnitude as compared to conventional molecular beacons, [4,20] which reflects the superquenching ability of GO that minimizes the background fluorescence. Given the convenience to perform calculations and modeling on GO, it is also possible to predict and engineer GO/biomolecular interactions and further

optimize the sensor performance with computer-aided rational design. The present study represents our first attempt to connect the highly promising nanomaterial GO with DNA sensing, and we expect that GO and other graphene materials will find important and widespread applications in biology.

4. Experimental

Materials: DNA oligonucleotides were synthesized and purified by TAKARA Biotechnology (Dalian, China). The sequences of these oligonucleotides are shown in Table 1. Adenine (A), cytidine (C), guanine (G) and thymine (T) were purchased from Sigma. Graphite powder was purchased from China National Pharmaceutical Group Corporation (Shanghai, China). Other chemicals were of analytical grade. Water was purified using a Millipore filtration system. Preparation of GO: GO was synthesized from graphite powder based on the Hummer’s method [43]. Briefly, graphite power (4 g) was oxidized in a hot solution (80 8C) of concentrated H 2 SO 4 (24 mL) containing K 2 S 2 O 8 (8 g), and P 2 O 5 (8 g). The resulting dark blue mixture was thermally isolated and slowly cooled to room temperature over a period of 6 h. The mixture was diluted to 300 mL, and then filtered with a membrane of 0.22 m m (Generay Biotech Co., Ltd., Shanghai, China) and dried overnight at 60 8C. These pre-oxidized graphite powder (2 g) were added to 92 mL of cold H 2 SO 4 (0 8C), to which KMnO 4 (12 g) was gradually added under continuous stirring in an ice-bath. After 15 min, NaNO 3 (2 g) was added to the mixture. The solution was further stirred for 2 h at 35 8 C, and distilled water (200 mL) was added. The reaction was stopped with the addition of a

mixture of 560 mL of distilled water and 10 mL of H 2 O 2 (30%). The product was washed with HCl (1:10), and then with water, and then suspended in distilled water. The brown dispersion was extensively dialyzed to remove residual metal ions and acids, and then exfoliated via sonication for 1.5 h (300 W). Unexfoliated graphite oxide was removed by centrifugation (3000 rpm, 5 min) using Centrifuge himac-CF 16RX (Hitachi, Japan). The as-prepared GO samples (0.47 mg/mL) was then characterized with tapping-mode AFM [26,29] and TEM [44]. Instrumentation: The HRTEM was performed with a Philips CM-120 transmission electron microscope operating at 120 kV (Philips, Netherlands). Samples for TEM were prepared by drop casting 20 mL of

˚

the as-prepared GO onto a standard carbon-coated (200–300 A ) formvar film on a copper grid. AFM measurements were carried out on Nanoscope IIIa (Digital Instrument, USA) under tapping mode, with a Pt/Ti coated tip (force constant of 4 N/m, MicroMasch). A droplet of GO dispersion was cast onto a freshly cleaved mica surface, and the sample was maintained at room temperature for several minutes to allow water evaporation. The image was obtained at 20 8C at a humidity of 30%. All fluorescence spectra were collected with a Hitachi F-4500 spectrophotometer equipped with a Xenon lamp excitation source. Fluorescent DNA Assays: In a typical DNA assay, the fluorescent probe P1 (10 pmol) was hybridized with the target in a 0.1 M phosphate buffer of 980 mL (7.7 mM Na 2 HPO 4 , 2.3 m M NaH 2 PO 4 , 100 m M NaCl, pH 7.4) for 10 min, to which GO of 20 m L (235 mg/mL) was added. After 1-min incubation, fluorescence measurements were performed with a quartz cuvette to monitor the hybridization process. In multicolor DNA assays, 5 pmol of FAM-tagged P16 probe P5, 10 pmol of ROX-tagged P21 probe P6, and 20 pmol of (Cy 5)-tagged probe P7 were mixed in a solution. We employed different amounts of probes in order to optimize the detection performance. All other conditions were similar to those in the single target detection. In mercury assays, 10 pmol of FAM-tagged mercury specific oligonucleotide (P8) was incubated with Hg 2 þ of a series of concentrations in a 3- N-morpholinopropanesulfonic acid (MOPS) buffer (10 mM with 50 mM NaNO3, pH 7.2) for 10 min. A GO solution (235 m g/mL) of 20 mL was added to this mixture. Fluorescence measurements were performed after 1 min. In adenosine triphosphate (ATP) assays, 10 pmol of FAM- tagged anti-ATP aptamer probes (P8) was incubated with ATP in 0.1 M phosphate buffer of 980 m L for 30 min. Fluorescence measurements were

of 980 m L for 30 min. Fluorescence measurements were 2010 WILEY-VCH Verlag GmbH & Co.

2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Adv. Funct. Mater. 2010 , 20, 453–459

FULL PAPER

FULL PAPER w w w . a f m - j o u r n a
FULL PAPER w w w . a f m - j o u r n a

www.afm-journal.de

www.MaterialsViews.com

performed after the addition of 20 mL 1 min. Computational Methods: A piece of

carbon atoms and an ssDNA segment (with the sequence of P1) labeled with a FAM molecule were immersed in a periodic water box with dimensions of 10 nm 10 nm 6 nm. In the box, there were approxi- mately 10 700 water molecules and 16 or 32 sodium ions that neutralized the ss- and dsDNA, respectively. In GO, the carbon atoms were modeled as uncharged Lennard–Jones particles with a distance parameter of s ¼ 0.3400 nm, and a potential well depth of e ¼ 0.3598 kJ mol 1 . The carbon bond length of 0.14 nm and the bond angle of 1208 were maintained by harmonic potentials with spring constants of 393 and 960 kJ mol 1 and 527 kJ mol 1 rad 2 before relaxation [45,46]. In addition, a weak dihedral angle potential was applied to the bonded carbon atoms of GO [45,46]. The conformation and the parameters of the FAM molecule were obtained from PRODRG [47], while the parameters for other components (e.g., ssDNA and hydroxy groups in GO) were directly obtained from the AMBER03 force field [48]. The TIP3P water model [49] was employed in our simulation. All simulations were carried out at a constant pressure 1 bar with a constant temperature (300 K) via Gromacs 3.3 [50] and with the PME method [51] for full electrostatics with a cut-off of 1 nm. A time step of 1 fs was employed and data were collected every 1 ps. First, we performed MD simulation for 1 ns for the system of the DNA segment on the GO to obtain the initial conformation. Then a 20-ns MD simulation were done for the whole system including DNA, GO, counter ions and water. The final 10-ns simulations were employed for analysis.

of GO solution (235 mg/mL) for

GO (7.3 nm 8.4 nm) with 2400

Acknowledgements

Shijiang He, Bo Song, and Di Li contributed equally to this work. This work was supported by National Natural Science Foundation (20725516, 20873175, 20805055, 90913014, 10825520), Ministry of Science and Technology (2006CB933000, 2007CB936000, 2007AA06A406, 2010CB934504), Ministry of Health (2009ZX10004-301), Shanghai Municipal Commission for Science and Technology (0952nm04600) and Chinese Academy of Sciences. Supporting Information is available online from Wiley InterScience or from the author.

Received: September 1, 2009 Revised: September 30, 2009 Published online: January 4, 2010

[1] M. J. Heller, Annu. Rev. Biomed. Eng. 2002 , 4 , 129. [2] R. C. McGlennen, Clin. Chem. 2001 , 47 , 393. [3] S. J. Park, T. A. Taton, C. A. Mirkin, Science 2002 , 295 , 1503. [4] S. Tyagi, F. R. Kramer, Nat. Biotechnol. 1996, 14 , 303. [5] C. Fan, S. Wang, J. W. Hong, G. C. Bazan, K. W. Plaxco, A. J. Heeger, Proc. Natl. Acad. Sci. USA 2003, 100 , 6297.

[6] R. Elghanian, J. J. Storhoff, R. C. Mucic, R. L. Letsinger, C. A. Mirkin, Science 1997 , 277 , 1078. [7] W. Tan, K. Wang, T. J. Drake, Curr. Opin. Chem. Biol. 2004 , 8 , 547. [8] H. Yang, Y. Xia, Adv. Mater. 2007 , 19, 3085. [9] E. Katz, I. Willner, Angew. Chem. Int. Ed. 2004 , 43 , 6042.

H. Li, J. Huang, J. Lv, H. An, X. Zhang, Z. Zhang, C. Fan, J. Hu, Angew.

Chem. Int. Ed. 2005, 44 , 5100. [11] J. Zhang, S. P. Song, L. H. Wang, D. Pan, C. Fan, Nat. Protoc. 2007 , 2 , 2888. [12] U. Feldkamp, C. M. Niemeyer, Angew. Chem. Int. Ed. 2006 , 45 , 1856. [13] Z. Liu, S. Tabakman, K. Welsher, H. Dai, Nano Res. 2009 , 2 , 85.

[10]

[14] P. W. Barone, S. Baik, D. A. Heller, M. S. Strano, Nat. Mater. 2005 , 4 , 86. [15] N. L. Rosi, C. A. Mirkin, Chem. Rev. 2005 , 105, 1547. [16] H. Li, L. Rothberg, Proc. Natl. Acad. Sci. USA 2004 , 101 , 14036. [17] J. Liu, Y. Lu, Nat. Protoc. 2006 , 1 , 246. [18] J. Lee, P. Hernandez, J. Lee, A. O. Govorov, N. A. Kotov, Nat. Mater. 2007, 6 ,

291.

[19] J. J. Storhoff, A. D. Lucas, V. Garimella, Y. P. Bao, U. R. Muller, Nat. Biotechnol. 2004, 22 , 883. [20] B. Dubertret, M. Calame, A. J. Libchaber, Nat. Biotechnol. 2001 , 19, 365. [21] D. S. Seferos, D. A. Giljohann, H. D. Hill, A. E. Prigodich, C. A. Mirkin, J. Am. Chem. Soc. 2007 , 129 , 15477. [22] D. J. Maxwell, J. R. Taylor, S. Nie, J. Am. Chem. Soc. 2002 , 124 , 9606.

[23] R. Yang, J. Jin, Y. Chen, N. Shao, H. Kang, Z. Xiao, Z. Tang, Y. Wu, Z. Zhu,

W. Tan, J. Am. Chem. Soc. 2008 , 130 , 8351.

[24] K. S. Novoselov, A. K. Geim, S. V. Morozov, D. Jiang, Y. Zhang,

S. V. Dubonos, I. V. Grigorieva, A. A. Firsov, Science 2004 , 306 , 666.

[25] D. Li, R. B. Kaner, Science 2008 , 320 , 1170. [26] D. Li, M. B. Muller, S. Gilje, R. B. Kaner, G. G. Wallace, Nat. Nanotechnol. 2008 , 3 , 101.

[27] S. Stankovich, D. A. Dikin, G. H. B. Dommett, K. M. Kohlhaas, E. J. Zimney,

E. A. Stach, R. D. Piner, S. T. Nguyen, R. S. Ruoff, Nature 2006 , 442 , 282.

[28] D. D. Dikin, S. Stankovich, E. J. Zimney, R. D. Piner, G. H. B. Dommett,

G. Evmenenko, S. T. Nguyen, R. S. Ruoff, Nature 2007 , 448 , 457.

[29] X. Sun, Z. Liu, K. Welsher, J. T. Robinson, A. Goodwin, S. Zaric, Nano Res. 2008 , 1 , 203. [30] N. Mohanty, V. Berry, Nano Lett. 2008 , 8 , 4469. [31] R. S. Swathi, K. L. Sebastian, J. Chem. Phys. 2008 , 129 , 054703. [32] R. S. Swathi, K. L. Sebastian, J. Chem. Phys. 2009 , 130 , 086101. [33] C. Lu, H. Yang, C. Zhu, X. Chen, G. Chen, Angew. Chem. Int. Ed. 2009 , 48 ,

4785.

[34] X. Dong, Y. Shi, Y. Zhao, D. Chen, J. Ye, Y. Yao, F. Gao, Z. Ni, T. Yu, Z. Shen,

Y. Huang, P. Chen, L.-J. Li, Phys. Rev. Lett. 2009 , 102, 135501.

[35] P. W. Carter, S. G. DiMagno, J. D. Porter, A. Streitwieser, J. Phys. Chem. 1993 , 97 , 1085. [36] G. B. McGaughey, M. Gagne, A. K. Rappe, J. Biol. Chem. 1998 , 273 , 15458. [37] S. Tyagi, D. P. Bratu, F. R. Kramer, Nat. Biotechnol. 1998 , 16 , 49. [38] S. Song, Z. Liang, J. Zhang, L. Wang, G. Li, C. Fan, Angew. Chem. Int. Ed. 2009 , 48 , 8676. [39] D. Sidransky, Science 1997 , 278 , 1054. [40] A. Ono, H. Togashi, Angew. Chem. Int. Ed. 2004 , 43 , 4300. [41] X. Liu, Y. Tang, L. Wang, J. Zhang, S. Song, C. Fan, S. Wang, Adv. Mater. 2007 , 19 , 1471. [42] A. D. Ellington, J. W. Szostak, Nature 1990 , 346 , 818. [43] W. Hummers, J. R. Offeman, J. Am. Chem. Soc. 1958 , 80 , 1339. [44] X. Li, G. Zhang, X. Bai, X. Sun, X. Wang, E. Wang, H. Dai, Nat. Nanotechnol. 2008 , 3 , 538. [45] X. J. Gong, J. Y. Li, H. J. Lu, R. Z. Wan, J. C. Li, J. Hu, H. P. Fang, Nat. Nanotechnol. 2007 , 2 , 709.

[46] J. Y. Li, X. J. Gong, H. J. Lu, D. Li, H. P. Fang, R. H. Zhou, Proc. Natl. Acad. Sci. USA 2007 , 104 , 3687. [47] A. W. Schuettelkopf, D. M. F. van Aalten, Acta Cryst. D 2004, 60 , 1355. [48] E. J. Sorin, V. S. Pande, Biophys. J. 2005 , 88 , 2472. [49] W. L. Jorgensen, J. Chandrasekhar, J. D. Madura, R. W. Impey, M. L. Klein, J. Chem. Phys. 1983 , 79 , 926. [50] E. Lindahl, B. Hess, D. van der Spoel, J. Mol. Mod. 2001 , 7 , 306. [51] T. A. Darden, D. M. York, L. G. Pedersen, J. Chem. Phys. 1993 , 98 ,

10089.

Adv. Funct. Mater. 2010, 20, 453–459

2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

1993 , 98 , 10089. Adv. Funct. Mater. 2010 , 20, 453–459 2010 WILEY-VCH Verlag GmbH

459