A STUDY ON

PCR AMPLIFICATION OF emm GENE FOR THE CONFIRMATION OF DRUG RESISTANCE

GROUP A STREPTOCOCCUS PYOGENES(DR - GAS).

A project report submitted to Periyar University in partial fulfillment for the requirement of the award of degree of MASTER OF SCIENCE BY ONDARI NYAKUNDI ERICK REGD NO: 09 BBG 1122

Under The Guidance Of R. RAJALAKSHMI.. M.Sc., M. Phil, FACULTY GUIDE

DEPARTMENT OF BIOTECHNOLOGY AVS COLLEGE OF ARTS & SCIENCE. (Affiliated to Periyar University) SALEM-636106 1

ACKNOWLEDGEMENT

In pursuit of this academic endeavour, I feel that I have been singularly fortunate, inspired, guided and directed. In cooperation, love and care which came along my way in abundance and it seems almost an impossible task to acknowlegde the same. In the name of God, the Compassionate and Merciful, I Recite, in the name of God who created: Created man from dust, made the heaven and the earth, uttered and all forms of the living and non living things made. The most Gracious, Who taught by the pen, Taught man what he knew not. To the Almighty God who has granted me support, blessings and whose power and mercy abode for the realization of my inspiration. The heavenly grace have defined and given meaning to my existence. To Him I extend and accredit my heart felt special thanks. I would like to thank Principal Dr. K.A Murugesan M. A, M.Phil., PhD and the entire management for providing the necessary facilities and good infrastructure on which I found treasure and all I needed for my course. I am grateful to Miss. R. Rajalakshmi M.Sc., M.Phil., Head of dept, Department of Biotechnology AVS College of Arts and Science Salem 636-106, for her vast understanding, everlasting moral support and continuous encouragement. My gratitude also extends to all faculty members for their kind support and undying cooperation for extending a hand of help for their motivations, recommendations and for imparting to me a very precious knowledge throughout the study period. Yes, I shall be failing in my duty if I do not record my profound sense of indebtedness and heart felt gratitude to my guide, Dr. R. Saravanan, M.Sc., PhD who guided and inspired me in pursuance of this work. His association will remain a beacon light to me throughout my career. I am obliged to Dr. Damodharan for providing the samples at convenience and providing vast valuable informstion that was of paramount use. In the same regard I thank Dr. E. Rani for her profound sense of humour, immense guidance and peace of mind all through. I am grateful to Miss. Preeti P for a wonderful co-ordination all through tirelessly and offering me necessary support not forgetting the entire BMERF scholars. I am also thankful those who could not find a separate name but helped me directly or indirectly. Equally I am indebted whole heatedly to the support, encouragement and good wishes of my parents and family members, without whom I would not have been able to complete my academia.

DECLARATION I do hereby declare that the dissertation entiltled as PCR AMPLIFICATION OF emm GENE FOR THE CONFIRMATION OF DRUG RESISTANCE GROUP A STREPTOCOCCUS PYOGENESsubmitted to Periyar University in partial fulfillment of the requirements for the award of degree Master of Science in Biotechnology is a record of original research done by me under the supervision and guidance of Dr. Saravanan, The Director Biomedical Engineering Research Foundation, The Gene Tech Administrative block Udayapatti, Salem 636 140, M.Sc, PhD,Miss. Rajalakshmi, M.Sc, M.Phil, Head in Biotechnology Department, AVS College of Arts and Science, Salem 636-106 and it has not formed for the award of any degree/diploma/associate/fellowship or other similar title to other candidate of our university.

Date:

Signature of the candidate.

Place:

(ONDARI NYAKUNDI ERICK)

I would like to dedicate this work in honor of my family. They blazed a path so bright that all I had to do was to follow. They not only gave me the opportunity to dream, but to realize those dreams. It is on their backs and because of their prayers and strength that I have arrived at this point. For them and everything I am and will be, I give all thanks and praise to God. My beloved family, all that I do and that I am is a direct reflection of your love and is always dedicated to you, thanks for the peace of mind in knowing that you are always there.

Abstract
Introduction: The endeavor of the current research aimed at amplifying emm gene for the drug resistant Streptococcus pyogenes which causes a spectrum of diseases devastating the health and the economy. GAS (Group A Streptococcus) is responsible for supurative diseases i.e. pharyngitis, impetigo, cellulitis, necrotizing fasciitis, scarlet fever, otitis media and sinusitis among many others and non-supurative diseases i.e. STSS,ARF,RHD,AGN and its sequelae which is uncertain is overwhelming. Dreadful about GAS is the report of flesh eating bacteria. The heterogeneity of emm gene, infectivity of the multivalent drug, increased number of emm types and high M protein non-typeabililty challenges the globe in coming up with the efficacy drug for therapy of the carriers, new infections and vaccination and this points specifically to the developing countries and indigenous populations of the developed nations. To accomplish all needs, faster, accurate, cheap and efficient epidemiology is of paramount to ensure complete custody of this important pathogen. In mind with such vast problems, the present work provides useful information for a reliable method for diagnosis and vaccine development. Keywords: GAS, supurative and nonsupurative diseases, sequelae, M protein, emm gene. Materials and methodology: Totally 5 samples were collected for processing in BMERF, The Gene Tech Research Admnistrative Block. NBA plates were used for hemolysis test. Presumptive tests included: Gram staining, Catalase test and Bacitracin which was used as a confirmatory test for GAS. DNA isolation by Modified Jeffreys method was adopted. PCR amplicons of the emm gene was done as per CDC protocols. Primers used: the forward primer CAGTATTCGCTTAGAAAATTAAAA, and reverse primer CCCTTACGGCTTGCTTCTGA. The control parameters: denaturation at 94c for 2min 30 sec, annealing at 58c for 30 sec (as calibrated from Finnzymes software) and extension at 72c for 1 min 30 sec repeated for 30 cycles.PCR products were run (AGE) at 0.8% agarose at 50 volts for 45 min. DNA bands were observed under UV trans-illuminator and photos taken for analysis. Results and discussion: One type of primer was used to amplify the emm gene, the sample showed consistence of the emm PCR product. Strongly this proves that same species is infectious as samples were collected from one place as opposed from the previous findings of heterogeneity which differ from place to place. Conclusion: Data indicate that the relationship between emm type and genetic background is similar from the samples collected, and selection pressure acting on emm appear to be strongest for the ENT specialists. The PCR findings may have important implications for aboriginal vaccine design and vaccination strategies and advantageous method of diagnosis in developing nations.

Abbreviations
AAFP - American Academy of Family physicians AAP American Academy of pediatrics AGE Agarose Gel Electrophoresis AGN Acute Glomerulonephritis AMI Antibody-mediated Immunity AOM Acute otitis Media APC - Antigen-presenting Cell ASO Anti-streptolysin O CA-MRSA community-acquired methicillin resistant staphylococcus aureus CHF Congestive heart Failure CMI Cell-mediated Immunity DC Direct Current ddNTPs - Dideoxyribonucleoside triphosphate precursors dNTPs Deoxyribonucleoside triphosphate precursors ECG Electrocardiogram ELISA Enzyme Linked Immuno-sorbent Assay ESR Erythrocyte Sedimentation Rate ESRD End-stage renal disease F protein Fimbrial protein GABHS Group A Beta Hemolytic Streptococcus GFR Glomerular filtration Rate HLA Human Leukocyte Antigen IL Interleukin LTA Lipoteichoic acid M protein Myocardial protein MEE Middle ear effusion 10

MHC Major histo-compatibilty molecule or complex MPGN Membrano-Proliferative GN MSSA Methicillin sensitive NETs Neutrophils Extarcellular Traps NF Necrosis Fever OME Otitis Media with effusion PCR Polymerase Chain reactions PSGN Post Streptococcal Glomerulonephritis PYR Pyrolidonyl arylamidase RADTs Rapid Antigen Detection Tests RF Rheumatic fever RHD - Rheumatic heart disease SDS Sodium dodecyl sulphate SPEs Streptococcal pyrogenic exotoxins SSA Streptococcal superantigen STSS Streptococcal Toxic Shock Syndrome TAE Tris Acetate EDTA TE Tris EDTA TSST -1 TSS toxin type-1 URI Upper Respiratory Infection

11

List of tables
Numbering Outline 2.1 Outline 2.2 Table 2.1 Table 2.2 Table 3.1 Table 3.2 Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Title heading Cell surface structure of GAS Pathogenesis pathways Summary of virulence factors Forms of impetigo Summary of amplification steps PCR reaction mixture Hemolysis test Bacitraccin test Finnzymes Tm calculator Mastercycler PCR PCR amplification of emm gene from GAS

12

13

CONTENT TABLE Abbreviations Abstract 1.0 Introduction Aims and objectives8 2.0 Literature review 2.1 General characteristics of GAS 2.2 Historical perspectives 2.3 classification of GAS 2.4 Spectrum of diseases due to GAS 2.5 Pathophysiology 2.6 a) Interaction between host and pathogen b) Bacterial adherence factors c) Extracellular products and toxins d) Pyrogenic exotoxins e) Nucleases f) Other enzymes 2.7.1 Pathogenesis 2.7.2 Host defenses 2.8 Suppurative diseases spectrum I. Pharyngitis II. Impetigo III. Cellulitis IV. Necrotizing fasciitisV. Scarlet fever VI. Otitis media and sinusitis 2.9 Non suppurative complications a. Streptococcal toxic shock syndrome 40 b. Acute rheumatic fever 14

c. Acute glomerulonephritis 49 d. Rheumatic fever e. Rheumatic heart disease 2.9.1 Identification of GAS 1) Throat culture 2) Lancefield group 3) Serological diagnosis 4) Molecular approaches 2.9.2 2.9.3 3.0 Materials and methodology 3.1 Hemolysis test 3.2 Gram stain 3.3 Catalase test 3.4 Bacitracin test 3.5 emm typing A. Lysate preparation B. Polymerase chain reaction C. Resolution of PCR products on AGE Results and discussion Conclusion Bibliography Vaccination

15

16

1.0 INTRODUCTION
Streptococcus pyogenes (Group A streptococcus) is a Gram-positive, non-motile, nonspore forming coccus that occurs in chains or in pairs of cells. Individual cells are round-toovoid cocci, 0.51.2 micrometer in diameter. Streptococci divide in one plane and thus occur in pairs or chains of varying lengths. The metabolism of Streptococcus pyogenes is fermentative; the organism is a catalase-negative aero tolerant anaerobe (facultative anaerobe), and requires enriched medium containing blood in order to grow. Group A streptococci typically have a capsule composed of hyaluronic acid and exhibit beta (clear) hemolysis on blood agar (Schottmueler et al., 1919).

GAS
Group A streptococci (GAS) are strict parasites of humans, and Streptococcus pyogenes is one of the most frequent pathogens of humans. It is estimated that between 515% of normal individuals harbor Streptococcus pyogene, usually in the respiratory tract, without signs of disease and children of age between 515 years are vulnerable. When the host defenses are compromised, or when the organism is able to exert its virulence, or when it is introduced to vulnerable tissues or hosts, an acute infection occurs. For more than four score years, extensive clinical, epidemiological and laboratory research efforts have focused on understanding group A streptococcal infections and their sequelae. Despite these many decades of research, a complete understanding of the pathogenetic mechanisms of Streptococcus pyogenes (GAS) remains elusive. Both laboratory research and epidemiological studies will continue to be crucial for understanding the role of unique microbial properties along with human susceptibility factors in pathogenesis (Dwight et al., 2005). In the last century, infections by Streptococcus pyogenes claimed many lives especially since the organism was the most important cause of puerperal fever (sepsis after childbirth). Scarlet fever was formerly a severe complication of streptococcal infection, but now, because of antibiotic therapy, it is little more than streptococcal pharyngitis accompanied by rash. 17

Similarly, erysipelas (a form of cellulitis accompanied by fever and systemic toxicity) is less common today (Edward et al., 2003; Gonzalez et al., 2003). However, there has been a recent increase in variety, severity and sequelae of Streptococcus pyogenes infections, and a resurgence of severe invasive infections, prompting descriptions of "flesh eating bacteria" in the news media. A complete explanation for the decline and resurgence is not known. Today, the pathogen is of major concern because of the occasional cases of rapidly progressive disease and because of the small risk of serious sequelae in untreated infections. These diseases remain a major worldwide health concern, and effort is being directed toward clarifying the risk and mechanisms of these sequelae and identifying rheumatogenic and nephritogenic strains of streptococci (Bisno et al., 2000).

SIGNS AND SYMPTOMS

Topical increase in variety, severity and sequelae of Streptococcus pyogenes infections and resurgence of severe invasive infections, may present as pharyngitis (strep throat), scarlet fever (rash), impetigo (infection of the superficial layers of the skin) or cellulitis (infection of the deep layers of the skin). Invasive, toxigenic infections can result in necrotizing fasciitis, myositis and streptococcal toxic shock syndrome. Patients may also develop immunemediated post streptococcal sequelae, such as acute rheumatic fever, rheumatic heart disease and acute glomerulonephritis, following acute infections caused by Streptococcus pyogenes.

DIAGNOSIS
With the necessity of better understanding this important pathogen several methods have been proposed to enhance effective, economical, accurate and rapid identification Streptoccocus pyogenes for diagnosis, development of vaccine to combat the streptococci infections whose sequelae remains uncertain.

Throat culture (Gold Standard) This depends on susceptibility on bacitracin and the positive PYR test (Facklam et al., 1997).

18

Lancefield Group Serotyping Lancefield typing is based on immunological differences of the cell wall polysaccharides. Groups A, B, C, F and G, lipoteichoic acid group D (Koneman et al., 1997). Lancefield capillary precipitin technique and slide agglutination tests are carried out. However, these methods utilize standardized grouping antisera that is difficult to prepare and costlier making it unyielding. Serological diagnosis The host responds immunologically to streptococcal infection with a plethora of antibodies against many streptococcal cellular and extracellular components. Host responses against the M protein serotype protect against re-infection with that particular serotype. Routinely, serotype specific antibodies are measured only for research purposes only and not for diagnosis. Responses against other cellular components are observed which includes: antibodies against cell wall mucopeptide, carbohydrate moieties N-acetylglucosamine and rhamnose, R and T cell wall protein antigens. Serological diagnosis is based on the extracellular products i.e. Anti-streptolysin O (ASO) (Todd et al.., 1932), Anti- DNase B, Anti-Hyaluronidase and Anti Streptokinase which induce a strong immune response in the infected host (Stollerman et al., 1975). Serological diagnosis also has limitations in that none of the cell wall antigens are used in the routine diagnosis of GAS infections, ASO test does not demonstrate a detectable rise in the 13 years old that have had few previous GAS infections (Markowitz et al., 1972)., and all the extracellular streptococcal enzymes may become significantly elevated over normal levels of infection and to enhance a confirmed test; titers of antibodies against extracellular products parallel each other. Exceptions noted: pyoderma or nephritogenic strains. Anti- DNase B titers have been found to be reliable streptococcal infection indicators (Stollerman et al., 1975). Infection of the skin does not always elicit a strong ASO response, Rheumatic fever confirmation is imperative since streptococci cannot be cultured from pharynx (Bison et al.., 1995). Most acute rheumatic fever demonstrates an elevated ASO titer with some exceptions which require more than one antibody test to detect previous GAS infections.

19

To overcome the barrier of extracellular products Streptozyme test was developed as a heamagglutination assay for the detection of multiple antibodies against the extracellular products (Bison et al.., 1995). Molecular biology approaches With the vast need to develop a more efficient accurate, reliable and faster technique for analysis of streptococci organism, several molecular approaches have been adopted which includes; M protein serotype has been developed recently by rapid PCR analysis (Beall et al., 1996). This technique has advantages over hybridization techniques, where problems arise in the identification of new genes or hybrid M protein molecules which results from inter-strain recombination, Enzyme electrophoresis polymorphism (Musser et al., 1992; Haase et al., 1994; Bert et al., 1995)., Rapid Amplification of Polymorphic DNA (RAPD) (Sappala et al., 1994)., Restriction Fragment Length polymorphism (RFLP) (Patric et al., 1988; Bingen et al., 1992 ; Desai et al., 1998 & 1999), Vir typing (Gardiner et al., 1995&1996). DNA hybridization using N-terminal sequences of the M protein gene (emm) as oliginucleotide probes (Kaufhold et al., 1994; Penny et al., 1995)., Polymerase Chain Reaction-Enzyme Linked Immunosorbant Assay (PCR-ELISA) (Saunders et al., 1997)., PCR M typing using specific oligonucleotide primers for PCR amplification of N-terminal region of emm gene (Vitali et al., 2002)., Polymerase Chain Reactions-Restriction Fragment Length Polymorphism (PCR-RFLP and it has overcome technical problems such as it only requires one pair of primer and the PCR products can be discriminated using standard PAGE which is easy to perform, interpret and less time consuming. In addition, compared with M protein typing PCR-RFLP is technically less demanding and more economical (Nonglak et al., 2005; Stanley et al., 1996; Dicuonzo et al., 2001; Beall et al., 2001; Perea-Mejia et al., 2002)., Multilocus Sequence Typing (MLST) and can be used on any bacterial analysis (Enright et al., 2001; Urwin et al., 2003)., N-terminal sequencing of the M protein gene (emm), however, is the conclusive method for typing of GAS. Conversely, it is not an option in developing countries laboratories (Beall et al., 1996; Brandt et al., 2001). In addition, various problems have been encountered such as ambiguity in the results, time consuming, discovery of new M types making it hard for M-specific serotype preparation 20

demanding high costs (Facklam et al., 1997)., difficult in obtaining high tittered antisera against opacity factor and lipoproteinase which causes various types of mammalian serum to increase in opacity (Widdowson et al., 1970-71).

VACCINATION
In soughting long-term immunity for therapy, to cater new infections and the carriers, different strategies have been incorporated for efficacious drugs against invasion, colonization and sequelae. M protein targets type specific N-terminal region (shown to induce protective bactericidal and opsonic antibody against specific M protein serotype) and or the highly conserved carboxy-terminal region of the M protein molecule (has protected against multiple serotypes and prevented colonization at mucosal surfaces) (Bessen et al., 1990 & 1997; Fischetti, 1989; Medaglini et al., 1995). The following problems must be overcome for development of the vaccine. First, it should not exacerbate the given disease that the vaccine would be designed to prevent. M proteins sites associated with tissue cross reactivity or tissue infiltrates should be avoided, and selected sites should be thoroughly tested in animals. Second, the immune response should provide lasting protection. Third, because more than 80 different M serotypes cause infections, only a limited number of M serotypes are practical for a type specific vaccine (aboriginal vaccine). In addition it has been observed that M serotypes which cause infection are cyclic in populations and also that different M serotypes are responsible for rheumatic fever in different parts of the world (Hauser et al., 1991; Kaplan, 1991). Multivalent vaccine though it appears to be effective, it is not applicable to all regions of the world due to heterogeneity of the M serotypes which differ from place to place (Dale et al., 1996). Recombinant vaccines containing many M type sequences have shown to be effective against multiple serotypes and prevention of colonization, mucosal immunity administered has too been observed as effective (immunization with synthetic peptides corresponding to conserved epitope found in the carboxyterminal region of M protein) and on the contrary peptides from conserved region given intranasally did not induce an opsonic antibody response or protect against systemic infection, they reduced colonization at the nasopharyngeal mucosal surface (Dale et al., 1996). C5a peptidase is another promising vaccine. It is antigenically stable and 95 to 98% identical among different types that would presumably produce protection against all serotypes. Other 21

vaccine candidates include antigens such as streptococcal proteinase (pyrogenic exotoxin B), carbohydrate protein conjugates (Ji et al., 1997). The decline and resurgence of GAS is not yet ascertained necessitating major concern because of the occasional causes of rapidly progressive disease and risk paused to humans by sequelae in untreated infections. More than 225 emm types have been identified by the Centers for Disease Control and Prevention (CDC) thus far in addition to the new ones which are being reported continuously causing an obstacle for development of effective vaccines. Accurate identification and typing of GAS is essential for epidemiological, pathogenesis studies and vaccine development owing to infectivity of multivalent drug in the tropicals and developing countries. Though M typing and emm concurs almost 1:1, M typing however is limited to supply of antisera and high nontypeability (Benard et al., 1996; Pruksakorn et al., 2000). For this reason, emm (N-terminal hypervaraiable region of M protein gene) based on sequence analysis of PCR products is employed which will serve as a basis for information for long the term evolutionary study of the local Streptococcus pyogenes strains and development of specific N-terminal (emm gene) based vaccines to combat the streptococcal infections especially acute rheumatic fever and rheumatic heart disease which have no drug and resistance due to mutations and genetic background (Debra et al., 2008). In quest of a resolution keeping in mind the drawbacks mentioned above the present research work has been entitled as emm gene amplification for the confirmation of Drug Resistance Group A Streptococcus (DRGAS).

22

23

AIMS AND OBJECTIVES OF STUDYING STREPTOCOCCUS PYOGENES.

The purpose of this study was therefore: (i) To isolate and identify the prevalent Streptococci of the pharynx of Salem children. (ii) To become familiar with the principle characteristics used for the classification of various groups of the important Streptococci. (iii) To amplify the emm (N-terminal region of M protein) gene for the confirmation of drug resistance GAS.

24

25

2.0 LITERATURE REVIEW

2.1 General characteristics of GAS
Kingdom: Bacteria Phylum: Firmicutes Class: Bacilli Order: Lactobacillales Family: Streptococcaceae Genus: Streptococcus Species: S. pyogenes Streptococci are a large group of gram-positive, non-motile, Nonspore-forming cocci that usually form irregular clusters, They often grow in pairs or chains, are oxidase- and catalase-negative. Chain forms due to division in one plane and failure of daughter cell to separate completely, About 0.5-1.2 m in size with low G+C content, Require enriched media with blood, serum or ascitic fluid for their growth, Facultative anaerobes(aerobes) with beta hemolytic, Ferments lactose, glucose, salicin, sorbitol, maltose, dextrin, and produce acid only, no gas , do not ferment mannitol Colonize the upper respiratory tract and is highly virulent as it overcomes the host defense system. 26

 Cause pyogenic infections with characteristic tendency to spread, The most common forms of Streptococcus pyogenes disease include respiratory and skin infections, with different strains usually responsible for each form. The cell wall of Streptococcus pyogenes is very complex and chemically diverse. The antigenic components of the cell are the virulence factors. The extracellular components responsible for the disease process include: invasins and exotoxins. Also it produces hemolysins, erythrogenic, streptokinase, deoxyribosenuclease and protease toxins, The outermost capsule is composed of hyaluronic acid, which has a chemical structure resembling host connective tissue, allowing the bacterium to escape recognition by the host as an offending agent. Thus, the bacterium escapes phagocytosis by neutrophils or macrophages, allowing it to colonize, Lipoteichoic acid and M proteins located on the cell membrane traverse through the cell wall and project outside the capsule, Resistant to crystal violet, susceptible to sulfonamide, Destroyed by heat at 56c, Survives in dust for several weeks if protected from sunlight. Streptococcus pyogenes (Group A streptococcus) is a Gram-positive, nonmotile, non-spore forming coccus that occurs in chains or in pairs of cells. Individual cells are round-to-ovoid cocci, 0.6-1.0 micrometer in diameter. Streptococci divide in one plane and thus occur in pairs or in chains of varying lengths. The metabolism of Streptococcus pyogenes is fermentative; the organism is a catalase-negative aero-tolerant anaerobe (facultative anaerobe), and requires enriched medium containing blood in order to grow. Group A streptococci typically have a capsule composed of hyaluronic acid and exhibit beta (clear) hemolysis on blood agar (Schottmueller et al., 1919).

27

Streptococcus pyogenes is beta-hemolytic bacterium that belongs to Lancefield serogroup A, also known as group A streptococci (GAS). GAS, a ubiquitous organism, causes a wide variety of diseases in humans and is the most common bacterial cause of acute pharyngitis, accounting for 15%-30% of cases in children and 5%-10% of cases in adults (Schroeder et al, 2003). During the winter and spring in temperate climates, up to 20% of asymptomatic school-aged children may be GAS carriers (Bisno et al., 2002). GAS usually causes pharyngitis or impetigo but, in rare cases, can also cause invasive diseases such ascellulitis, bacteremia, necrotizing fasciitis, and toxic shock syndrome (TSS). Along with Staphylococcus aureus, GAS is one of the most common pathogens responsible for cellulitis.

2.2 Historical perspectives

Streptococcus pyogenes was first described by Billroth in 1874 in patients with wound infections. In 1883, Fehleisen isolated chain-forming organisms in pure culture from perierysipelas lesions. Rosebach named the organism Streptoccocus pyogenes in 1884. Studies by Schottmueller in 1903 and J.H. Brown in 1919 led to knowledge of different patterns of hemolysis described as alpha, beta, and gamma hemolysis. A later development in this field was the Lancefield classification of beta-hemolytic streptococci by serotyping based on M-protein precipitin reactions. Lancefield established the critical role of M protein in disease causation. In the early 1900s, Dochez, George, and Dick identified hemolytic streptococcal infection as the cause of scarlet fever. The epidemiological studies of the mid 1900s helped establish the link between GAS infection and acute rheumatic fever (ARF) and acute glomerulonephritis (Graziella et al., 2001). The traditional Lancefield M-protein classification system, which is based on serotyping, has been replaced by emm typing. This gene-typing system is based on sequence analysis of the emm gene, which encodes the cell surface M protein. Approximately 200 emm types have been identified by the Centers for Disease Control and Prevention (CDC) thus far. 28

2.3 Classification of Streptococci

Hemolysis on blood agar The type of hemolytic reaction displayed on blood agar has long been used to classify the streptococci: a) Beta hemolysis - is associated with complete lysis of red cells surrounding the colony, b) Alphahemolysis - is a partial or "green" hemolysis associated with reduction of red cell hemoglobin. c) Gamma-hemolytic Non-hemolytic colonies. Hemolysis is affected by the species and age of red cells, as well as by other properties of the base medium. Group A streptococci are nearly always beta-hemolytic; related Group B can manifest alpha, beta or gamma hemolysis. Most strains of S. pneumoniae are alpha-hemolytic but can cause -hemolysis during anaerobic incubation. Most of the oral streptococci and enterococci are non hemolytic. The property of hemolysis is not very reliable for the absolute identification of streptococci, but it is widely used in rapid screens for identification of Streptococcus pyogenes and Streptococcus pneumoniae. Antigenic types The cell wall structure of Group A streptococci is among the most studied of any bacteria. The cell wall is composed of repeating units of N-acetyl glucosamine and N-acetylmuramic acid, the standard peptidoglycan. Historically, the definitive identification of streptococci has rested on the serologic reactivity of cell wall polysaccharide antigens as originally described by Rebecca Lancefield. Eighteen group-specific antigens (Lancefield groups) were established. The Group A polysaccharide is a polymer of N-acetyl glucosamine and rhamnose. Some group antigens are shared by more than one species.

2.4 Spectrum of diseases due to group A streptococcal infections

29

In the pre-antibiotic era, streptococci frequently caused significant morbidity and were associated with significant mortality rates. However, in the post-antibiotic period, diseases due to streptococcal infections are well-controlled and uncommonly cause death. GAS can cause a diverse variety of both suppurative diseases and nonsuppurative postinfectious sequelae. The suppurative spectrum of GAS diseases includes the following: Pharyngitis with or without tonsillopharyngeal cellulitis or abscess, Impetigo (purulent honey-colored crusted skin lesions), Pneumonia, Necrotizing fasciitis, Streptococcal bacteremia, Osteomyelitis, Otitis media, Sinusitis, Meningitis or brain abscess (a rare complication resulting from direct extension of an ear or sinus infection or from bacteremic spread). The nonsuppurative sequelae of GAS infections include the following: Acute rheumatic fever (ARF; defined by Jones criteria), Rheumatic heart disease (chronic valvular damage, predominantly mitral valve), Acute glomerulonephritis (AGN). Superantigen-mediated immune response may result in the following entities: Streptococcal TSS (STSS) characterized by systemic shock with multi-organ failure, with manifestations of respiratory failure, acute renal failure, hepatic failure, neurological symptoms, hematological abnormalities, and skin findings, among others. This is predominantly associated with M types 1 and 3 that produce pyrogenic exotoxin A, exotoxin B, or both (Stevens et al., 1995), Scarlet fever (characterized by upper-body rash, generally following pharyngitis).

2.5 Pathophysiology
Streptoccocus pyogenes tends to colonize the upper respiratory tract and is highly virulent as it overcomes the host defense system. The most common forms of Streptococcus pyogenes disease include respiratory and skin infections, with different strains usually responsible for each form. The cell wall of Streptococcus pyogenes is very complex and chemically diverse. The antigenic components of the cell are the virulence factors. 30 The extracellular components

responsible for the disease process include invasins and exotoxins. The outermost capsule is composed of hyaluronic acid, which has a chemical structure resembling host connective tissue, allowing the bacterium to escape recognition by the host as an offending agent. Thus, the bacterium escapes phagocytosis by neutrophils or macrophages, allowing it to colonize. Lipoteichoic acid and M proteins located on the cell membrane traverse through the cell wall and project outside the capsule.

2.6 Interaction between the host and pathogen

a. Bacterial virulence factors The cell wall antigens include capsular polysaccharide (C-substance), peptidoglycan and lipoteichoic acid (LTA), R and T proteins, and various surface proteins, including M protein, fimbrial proteins, fibronectin-binding proteins (e.g., protein F), and cell-bound streptokinase. The C-substance is composed of a branched polymer of L-rhamnose and N -acetyl-D-glucosamine. It may have a role in increased invasive capacity. The R and T proteins are used as epidemiologic markers and have no known role in virulence. M protein, the major virulence factor, is a macromolecule incorporated in fimbriae present on the cell membrane projecting on the bacterial cell wall. More than 50 types of Strepoccocus pyogenes M proteins have been identified based on antigenic specificity, and the M protein is the major cause of antigenic shift and antigenic drift among GAS (Musser et al., 1991). The M protein binds the host fibrinogen and blocks the binding of complement to the underlying peptidoglycan. This allows survival of the organism by inhibiting phagocytosis. Strains that contain an abundance of M protein resist phagocytosis, multiply rapidly in human tissues, and initiate disease process. After an acute infection, type-specific antibodies develop against M protein activity in some cases. In addition to M protein, Streptococcus pyogenes possesses additional virulence factors, such as C5A peptidase, which destroys the chemo-tactic signals by cleaving the complement component of C5A.

31

b. Bacterial adherence factors At least 11 different surface components of GAS have been suggested to play a role in adhesion. In 1997, Hasty and Courtney proposed that GAS express different arrays of adhesins in various environmental niches. Based on their review, M protein mediates adhesion to HEp-2 cells in humans, but not buccal cells, whereas FBP54 mediates adhesion to buccal cells, but not to HEp-2 cells. Protein F mediates adhesion to Langerhans cells, but not keratinocytes. The most recent theory proposed in the process of adhesion is a two-step model. The initial step of overcoming the electrostatic repulsion of the bacteria from the host is mediated by LTA rendering weak reversible adhesion. The second step is firm irreversible adhesion mediated by tissue-specific M protein, protein F, or FBP54, among others. Once adherence has occurred, the streptococci resist phagocytosis, proliferate, and begin to invade the local tissues (Courtney et al., 1997). GAS show enormous evolving molecular diversity, driven by horizontal transmission among various strains. This is also true when compared with other streptococci. Acquisition of prophages accounts for much of the diversity, conferring not only virulence via phage-associated virulence factors but also increased bacterial survival against host defenses. c. Extracellular products and toxins Various extracellular growth products and toxins produced by GAS are responsible for host cell damage and inflammatory response. Streptolysin S, a 28 residue peptide, is an oxygenstable leukocidin toxic to polymorphonuclear leukocytes, RBCs, and platelets. Streptolysin S is responsible for RBC lysis observed on sheep blood agar. Streptolysin O is an oxygen-labile leukocidin that is toxic to neutrophils and induces a brisk antibody response. Measurement of antistreptolysin O (ASO) antibody titer in humans is used as an indicator of recent streptococcal infection. Other extracellular products include NADase (leukotoxic), hyaluronidase (which digests host connective tissue, hyaluronic acid, and the organism's own capsule), streptokinases (proteolytic), and streptodornase A-D (deoxyribonuclease activity) ( Stevens et al.,1997) 32

d. Pyrogenic exotoxins GAS produces 3 different types of exotoxins (A, B, C) (Musser et al., 1991). These toxins act as super antigens and are responsible for inciting systemic immune response and acute disease caused by the sudden and massive release of T-cell cytokines into the blood stream. The superantigens bypass processing by antigen presenting cells and cause T-cell activation by binding class II MHC molecules directly and nonspecifically. The streptococcal pyrogenic exotoxins (SPEs) are responsible for causing scarlet fever, pyrogenicity, and STSS. The mechanism is similar to that of staphylococcal TSS (Fraser et al., 2008). e. Nucleases Four antigenically distinct nucleases (A, B, C, and D) assist in the liquefaction of pus and help to generate substrate for growth. f. Other enzymes In addition, streptococci produce proteinase, nicotinamide adenine dinucleotidase, adenosine triphosphatase, neuraminidase, lipoproteinase, and cardiohepatic toxin. The table below represents summary of virulence factors.

Name

Description An exotoxin that is one of the bases of the organism's beta-hemolytic property. A cardiotoxic exotoxin that is another beta-hemolytic component. Streptolysin S is not immunogenic and O2 stable. A potent cell poison affecting many types of cell including neutrophils, platelets, and subcellular organelles, streptolysin S causes an immune response and detection 33

Streptolysin O

Streptolysin S

of antibodies to it; antistreptolysin O (ASO) can be clinically used to confirm a recent infection. Streptococcal pyogenic exotoxin A (SpeA) Streptococcal pyogenic exotoxin C (SpeC) Enzymatically activates plasminogen, a proteolytic enzyme, into plasmin, which in turn digests fibrin and other proteins. It is widely assumed hyaluronidase facilitates the spread of the bacteria through tissues by breaking down hyaluronic acid, an important component of connective tissue. However, very few isolates of S. pyogenes are capable Hyaluronidase of secreting active hyaluronidase due to mutations in the gene that encode the enzyme. Moreover, the few isolates that are capable of secreting hyaluronidase do not appear to need it to spread through tissues or to cause skin lesions. Streptodornase Most strains of S. pyogenes secrete up to four different DNases, which are sometimes called streptodornase. The DNases protect the bacteria from being trapped in neutrophil extracellular traps (NETs) by digesting the NET's web of DNA, to which are bound neutrophil serine proteases that can kill the bacteria. C5a peptidase C5a peptidase cleaves a potent neutrophil chemotaxin called C5a, which is produced by the complement system. C5a peptidase is necessary to 34 Superantigens secreted by many strains of S. pyogenes. This pyrogenic exotoxin is responsible for the rash of scarlet fever and many of the symptoms of streptococcal toxic shock syndrome (STSS).

Streptokinase

minimize the influx of neutrophils early in infection as the bacteria are attempting to colonize the host's tissue. Patients with severe cases of necrotizing fasciitis are devoid of neutrophils. The serine protease ScpC, which is released by S. pyogenes, prevents the Streptococcal chemokine protease migration of neutrophils spreading infection. ScpC degrades the chemokine IL-8, which would attract neutrophils to infection site. C5a peptidase, although required to degrade the neutrophil chemotaxin C5a in the early stages of infection, is not required for S. pyogenes to prevent the influx of neutrophils as the bacteria spread through the fascia. Table 2.1 Summary of virulence factors.

Outline 1.1 Cell surface structure of Streptococcus pyogenes and secreted products involved in virulence.

35

2.7 Pathogenesis
Streptococcus pyogenes owes its major success as a pathogen to its ability to colonize and rapidly multiply and spread in its host while evading phagocytosis and confusing the immune system. Acute diseases associated with Streptococcus pyogenes occur chiefly in the respiratory tract, bloodstream, or the skin. Streptococcal disease is most often a respiratory infection (pharyngitis or tonsillitis) or a skin infection (pyoderma). Streptococcocus pyogenes is the leading cause of uncomplicated bacterial pharyngitis and tonsillitis commonly referred to a strep throat. Streptoccocus pyogenes infections can also result in sinusitis, otitis, mastoiditis, pneumonia, joint or bone infections, necrotizing fasciitis and myositis, meningitis or endocarditis. Streptoccocus pyogenes also infects the skin. Infections of the skin can be superficial (impetigo) or deep (cellulitis). Scarlet fever and streptococcal toxic shock syndrome are systemic responses to circulating bacterial toxins. Two post streptococcal sequelae (rheumatic fever following respiratory infection and glomerulonephritis following respiratory or skin infection), occur in 13% of untreated infections. antigens. In Group A streptococci, the R and T proteins are used as epidemiologic markers and have no known role in virulence. The M proteins are clearly virulence factors associated with both colonization and resistance to phagocytosis. More than 50 types of Streptococcus pyogenes M proteins have been identified on the basis of antigenic specificity, and it is the M protein that is the major cause of antigenic shift and antigenic drift in the Group A streptococci. The streptococcal M protein, peptidoglycan, N-acetylglucosamine, and group-specific carbohydrate portions of the cell surface all have antigenic epitopes that mimic those of mammalian muscle and connective tissue. The cell surface of recently emerging (flesh-eating) strains of streptococci is distinctly mucoid (indicating that they are highly encapsulated) and rich in M protein. Protein F, thought involved in attachment to fibronectin, is presumably a non fimbrial adhesin located on the bacterial cell surface. These conditions and their pathology are not attributable to dissemination of bacteria, but to aberrent immunological reactions to Group A streptococcal

36

The capsule of Streptococcus pyogenes is non antigenic since it is

composed

of hyaluronic acid, which is chemically similar to that of host connective tissue. This allows the bacterium to hide its own antigens and to go unrecognized as antigenic by its host. The cytoplasmic membrane of Streptoccocus pyogenes contains some antigens similar to those of human cardiac, skeletal, and smooth muscle, heart valve fibroblasts, and neuronal tissues, resulting in molecular mimicry and a tolerant or suppressed immune response by the host. Colonization of tissues by Streptoccocus pyogenes is thought to result from a failure in the innate defenses (normal flora and other nonspecific defense mechanisms) which allows establishment of the bacterium at a portal of entry (often the upper respiratory tract or the skin) where the organism multiplies and causes an inflammatory purulent lesion. Some strains of streptococci show a predilection for the respiratory tract and others, for the skin. Generally, streptococcal isolates from the pharynx and respiratory tract do not cause skin infections. There is abundant evidence that Streptococcus pyogenes utilizes lipoteichoic acids in the cell wall as adhesins. The lipoteichoic acid (LTA) is anchored to proteins on the bacterial surface, including the M protein. Both the M proteins and lipoteichoic acid are supported externally to the cell wall on fimbriae and appear to mediate bacterial adherence to host epithelial cells. It has been proposed that both LTA and the M protein are needed for attachment to mucosal surfaces and that this explains the role of the M protein as a determinant of virulence (Nonetheless, the M protein is a proven determinant of virulence since it inhibits phagocytic ingestion of non-opsonized streptococci). A nonfimbrial protein (Protein F) has also been shown to mediate streptococcal adherence to the amino terminus of fibronectin on mucosal surfaces. Colonization of the upper respiratory tract and acute pharyngitis may spread to other portions of the upper or lower respiratory tracts resulting in infections of the middle ear (otitis media), sinuses (sinusitis), or lungs (pneumonia). In addition, meningitis can occur by direct extension of infection from the middle ear or sinuses to the meninges or by way of bloodstream invasion from the pulmonary focus. Bacteremia can also result in infection of bones (osteomyelitis) or joints (arthritis). During these aspects of acute disease the streptococci bring into play a variety of secretory proteins that mediate their invasion. 37

For the most part, streptococcal invasins and protein toxins interact with mammalian blood and tissue components in ways that kill host cells and provoke a damaging inflammatory response. The soluble extracellular growth products and toxins of Streptococcus pyogenes, have been studied intensely. Streptolysin S is an oxygen-stable leukocidin; Streptolysin O is an oxygen-labile leukocidin. NADase is also leukotoxic. Hyaluronidase (the original spreading factor) can digest host connective tissue hyaluronic acid as well as the organism's own capsule. Streptokinases participate in fibrin lysis. Streptodornases A-D possesses deoxyribonuclease activity; Streptodornases B and D possess ribonuclease activity as well. Protease activity similar to that in Staphylococcus aureus has been shown in strains causing soft tissue necrosis or toxic shock syndrome. This large repertoire of products is important in the pathogenesis of Streptoccocus pyogenes infections. Even so, antibodies to these products are relatively insignificant in protection of the host. Three pyrogenic exotoxins (formerly known as Erythrogenic toxin) of Streptoccocus pyogenes (SPEs) are recognized: types A, B, C. toxins which act as superantigens by a mechanism similar to those described for staphylococci. As antigens, they do not require processing by antigen presenting cells. Rather, they stimulate T cells by binding class II MHC molecules directly and nonspecifically. With superantigens about 20% of T cells may be stimulated (vs 1/10,000 T cells stimulated by conventional antigens) resulting in massive detrimental cytokine release. SPEs A and C are encoded by lysogenic phages; the gene for SPE B is located on the bacterial chromosome. Re-emergence in the late 1980's of these exotoxin producing strains has been associated with a toxic shock-like syndrome similar in pathogenesis and manifestation to staphylococcal toxic shock syndrome and other forms of invasive disease associated with severe tissue destruction.

38

Outline 2.2 Pathogenesis of Streptococcus pyogenes infections. (Adapted from Baron's Medical Microbiology Chapter 13, Streptococcus by Maria Jevitz Patterson).

Host defenses
Streptoccocus pyogenes is usually an exogenous invader following viral disease or disturbaces in the normal bacterial flora. In the normal human the skin is an effective barrier against invasive streptococci, and nonspecific defense mechanisms prevent bacteria from penetrating beyond the superficial epithelium of the upper respiratory tract. These mechanisms include: mucociliary movement, coughing, sneezing and epiglottal reflexes. The host phagocytic system is a second line of defense against streptococcal invasion. Organisms can be opsonized by activation of the classical or alternate complement pathway and 39

by anti-streptococcal antibodies in the serum. Streptoccocus pyogenes is rapidly killed following phagocytosis enhanced by specific antibody. The bacteria do not produce catalase or significant amounts of superoxide dismutase to inactivate the oxygen metabolites (hydrogen peroxide, superoxide) produced by the oxygen-dependent mechanisms of the phagocyte. Therefore, they are quickly killed after engulfment by phagocytes. The hyaluronic acid capsule, of course, allows the organism to evade opsonization. The capsule is also an antigenic disguise that hides bacterial antigens and is non antigenic to the host. Actually, the hyaluronic acid outer surface of Streptoccocus pyogenes is weakly antigenic, but it does not result in stimulation of protective immunity. The only protective immunity that results from infection by Group A streptococcus comes from the development of type-specific antibody to the M protein of the fimbriae, which protrude from the cell wall through the capsular structure. This antibody, which follows respiratory and skin infections, is persistent. Presumably, protective levels of specific IgA are produced in the respiratory secretions while protective levels of IgG are formed in the serum. Sometimes, intervention of an infection with effective antibiotic treatment precludes the development of this persistent antibody. This accounts, in part, for recurring infections in an individual by the same streptococcal strain. Antibody to the erythrogenic toxin involved in scarlet fever is also long lasting. The occurrence of cross-reactive antigens in Streptoccocus pyogenes and various mammalian tissues possibly explains the autoimmune responses that develop following some infections. The antibody mediated immune (AMI) response (i.e., level of serum antibody) is higher in patients with rheumatic fever than in patients with uncomplicated pharyngitis. In addition, cell-mediated immunity (CMI) seems to play a role in the pathology of acute rheumatic fever.

2.8.1 Suppurative Disease Spectrum

40

I.

Pharyngitis

Streptococcus pyogenes causes up to 15%-30% of cases of acute pharyngitis (Maltezou et al., 2008). Accurate diagnosis is essential for appropriate antibiotic selection. Common respiratory viruses account for the vast majority of cases and these are usually selflimited. Bacteria are also important etiologic agents, and, when identified properly, may be treated with antibacterials, resulting in decreased local symptoms and prevention of serious sequelae. The most common and important bacterial cause of pharyngitis is Streptococcus pyogenes. When suspected, bacterial pharyngitis can be confirmed with routine diagnostic tests and treated with various antibiotics. If left untreated, GAS pharyngitis may lead to local and distant complications. Pathophysiology Beta-hemolytic streptococci have the ability to cause large zones of hemolysis on blood agar, aiding in microbiological identification. Lancefield antigens, carbohydrates in the cell wall, provide further differentiation of streptococci. Streptoccocus pyogenes, which contains group A antigens and displays beta-hemolysis, is the most common species referred to as a group A betahemolytic streptococci (GABHS). Perhaps the most important virulence factor of GABHS is the M protein. This protein, located peripherally on the cell wall, is required for invasive infection. T cells exposed to this M protein are postulated to cross-react with similar epitopes on human cardiac myosin and laminin, contributing to the pathogenesis of rheumatic heart disease. This protein provides a potential target for a GABHS vaccine, although successful widespread implementation of such a vaccine remains elusive. More than 100 M-protein serotypes have been described. Although individuals often develop lifelong immunity to one serotype, re-infection with a different serotype may cause disease (Kumar et al., 2007). GABHS contains a hyaluronic acid capsule, which also plays an important role in infection. Bacteria that produce large quantities of this capsule exhibit a characteristic mucoid appearance on blood agar and may be more virulent.

41

Certain

GABHS

exotoxins

act

as

superantigens

by

up-regulating

cells

(Abbas et al., 2004). These superantigens can prompt a release of proinflammatory cytokines and may synergize with lipopolysaccharide. It has been speculated that these superantigens evade the pharyngeal immune response, resulting in proliferation of GABHS while permitting immune-mediated elimination of commensal organisms. Adhesins enable GABHS attachment at sites such as the pharynx. This attachment allows for colonization and competition with normal host flora. Some strains produce erythrogenic toxins, which cause the rash of scarlet fever in susceptible hosts. GABHS is spread from person to person through large droplet nuclei. Consequently, close quarters (e.g., barracks, daycares, and dormitories) facilitate transmission. In temperate regions, the prevalence of GABHS infection increases in the colder months, presumably because of the tendency of people to congregate indoors. Spread within families is common. The risk of acquiring GABHS from an infected family member is 40%, and nearly one in four of infected individuals eventually exhibit symptoms. Twenty-four hours after appropriate antibiotics are initiated, the patient is no longer considered contagious. GABHS is also a common cause of erysipelas, cellulitis, and necrotizing fasciitis and has been reported as a cause of pneumonia, toxic shock syndrome, and lymphangitis. The vast majority of these manifestations do not occur in the setting of pharyngitis. Frequency United States Acute pharyngitis accounts for approximately 12 million annual ambulatory care visits in the United States. It ranks within the top 20 most-common primary diagnosis groups.

International An estimated 616 million cases of GABHS pharyngitis occur annually worldwide. Rheumatic heart disease, which may be a consequence of GABHS pharyngitis, is estimated to cause about 6 million years of life lost annually. 42 The burden of rheumatic heart disease

disproportionately affects populations from developing countries. In terms of estimated global mortality, GABHS is one of the top 10 pathogens, behind HIV infection and malaria and ahead of tetanus and pertussis. Mortality/Morbidity Although GABHS pharyngitis is usually a self-limited entity, on average, a single episode in a child results in 1.9 days absence from school and a parent missing 1.8 days from work to care for the child. Children with GABHS pharyngitis experience symptoms for an average of 4.5 days. In addition to symptoms localized to the oropharynx, GABHS pharyngitis may also cause the following suppurative and nonsuppurative complications:

Invasion of nearby structures may cause suppurative complications such as otitis media, sinusitis,peritonsillar abscess, retropharyngeal abscess, and cervical adenitis. Nonsuppurative complications of bacterial pharyngitis include rheumatic heart disease andpoststreptococcal glomerulonephritis. These entities are discussed in Complications.

Race GABHS pharyngitis affects all races. Sex GABHS pharyngitis has no sexual predilection. Age GABHS pharyngitis is most common in individuals aged 5-15 years, although both infants and adults may also acquire the disease.

Clinical The signs and symptoms listed below may be seen with many non-GABHS etiologies. Furthermore, individuals with GABHS pharyngitis may have only a few or mild features listed. Conjunctivitis, cough, hoarseness, coryza, diarrhea, anterior stomatitis, discrete ulcerative lesions, and a viral exanthem are all more consistent with an etiology other than GABHS.

Sore throat, usually with sudden onset Odynophagia Headache 43

Nausea, vomiting, and abdominal pain

Physical

Fever Tonsillopharyngeal erythema Exudates (patchy and discrete) Beefy red swollen uvula Lymphadenopathy (tender anterior cervical nodes) Petechiae on the palate Scarlatiniform rash (In susceptible hosts, this usually manifests within the first two days of symptoms and causes a finely papular, blanching, and erythematous rash. The neck is often first affected and then spreads along the trunk and limbs. Resolution, often at 3-4 days, occurs in roughly the same order of appearance and often results in desquamation of the involved areas.)

Predictive models can help determine the likelihood of GABHS pharyngitis based on the presence of fever, swollen tender anterior cervical lymph nodes, and tonsillar exudates and the absence of cough. Scores have been used to distinguish which patients merit further laboratory evaluation or treatment. The use of such clinical algorithms has been the source of much debate.

Causes

GABHS accounts for 15%-30% of pharyngitis cases in children and 5%-10% of cases in adults (Bisno, 2001). The following are bacteria other than GABHS that may cause pharyngitis: Group C and G streptococci: Like GABHS, these pathogenic bacteria cause betahemolysis, form large colonies, and produce an M protein, yet neither are detected with rapid antigen detection tests (RADTs). Pharyngitis caused by either of these non-GABHS streptococci have a clinical presentation similar to that of GABHS pharyngitis and should be considered in patients with worsening symptoms and an initial negative RADT result. Diagnosis can be achieved with a normal bacterial throat culture and identification based on Lancefield antigens. These bacteria are an uncommon cause of acute pharyngitis in pediatric patients. 44

II.

Impetigo

Impetigo is an acute, contagious, superficial pyogenic skin infection that occurs most commonly in children, especially those who live in hot humid climates. Clinically, physicians recognize two separate forms of impetigo: bullous and nonbullous. Bullous impetigo is caused almost exclusively by Staphylococcus aureus, whereas nonbullous impetigo is caused by Staphyloccocus aureus, group A Streptococcus (Streptococcus pyogenes), or a combination of both. The bacterial toxins cause proteolysis of epidermal and sub-epidermal layers, allowing the bacteria to spread quickly along the skin layers, thereby causing blisters or purulent lesions. Pathophysiology Impetigo most often develops at a site of minor trauma or insult in which the integrity of the skin is disrupted. Causative organisms enter the epidermis. Alternatively, scratching may directly inoculate bacteria beneath the skin surface, causing impetiginization.

The sequence of spread of the two causative organisms differs. Streptoccocus pyogenes is spread from a person who is infected or colonized with the bacteria onto the skin of another individual, where it may cause impetigo. where it may cause impetigo. Race Impetigo can affect people of all races. The organism then colonizes the nose and throat. Staphylococcus aureus, in contrast, spreads first to the nose. It then spreads to the skin,

Sex In adults, impetigo is more common in men. Age Non-bullous impetigo can affect all ages, but it most commonly affects children aged 2-5 years. Bullous impetigo affects all ages, but, historically, it occurs more often in newborns and older infants. Clinical 45

Patients with impetigo may report a history of minor trauma, insect bites, scabies, herpes simplex, varicella, or eczema at the site of infection, and any history of preexisting skin disease should raise the clinician's index of suspicion.

Physical Nonbullous impetigo Bullous impetigo

Lesions first begin as thin-walled vesicles or Lesions may form on grossly normal or pustules on an erythematous base. The previously traumatized skin. lesions promptly rupture, releasing their The vesicles do not rupture as easily or serum, which dries and forms a light brown, quickly as in nonbullous lesions, but they do honey-colored crust. enlarge into bullae that are usually 1-2 cm in Multiple lesions generally occur at the same diameter. The bullae initially contain a clear site, often coalescing. The affected area of yellow fluid that subsequently turns cloudy skin may enlarge as the infection spreads and dark yellow. peripherally. After 1-3 days, the lesions rupture and leave a Skin on any part of the body can be involved, thin, light brown, varnish like crust. but the face and extremities are affected most Central healing results in circinate lesions. commonly. excoriations due to scratching. or after antibiotic treatment, the crusts slough from the affected areas and heal without scarring. If the course of disease is prolonged and patients do not seek treatment, as many as 90% will develop regional lymphadenopathy. Caused by both Staphyloccocus aureus and Streptoccocus pyogenes. In contrast to nonbullous impetigo, bullous membranes, but regional lymphadenopathy is Pruritus of infected areas may result in impetigo may involve the buccal mucous As the lesions resolve, either spontaneously rare. Caused by Staphyloccocus aureus.

46

Table 2.2 Forms of impetigo disease.

III.

Cellulitis

Cellulitis refers to an inflammatory process caused by bacterial infection of the dermis and underlying subcutaneous tissues of the skin. A local and systemic host immune response leads to signs of inflammation in the affected tissue. Pathophysiology The human integument provides a very effective barrier against environmental pathogens. Squamous epithelial cells, with their tight intercellular bonds, are the first line of defense against the outside environment. When this barrier is breached owing to trauma or underlying dermatitis, bacteria are able to penetrate to the deeper dermis, where infection occurs. Bacteria commonly found on the skin are most often the cause of cellulitis, although bacteria from the environment may also cause disease. Frequency United States Recent evidence suggests that the incidence of cellulitis is increasing in the United States. Outpatient visits for cellulitis increased from 32 to 48 per 1000 population from 1997 to 2005 (Ludlam et al., 1986).

Mortality/Morbidity The vast majority of cellulitis and soft-tissue infections can be treated on an outpatient basis with oral antibiotics and do not result in lasting sequelae. However, just as the incidence of cellulitis is increasing, so is the severity. Although the exact reason for this is unknown, certain host and pathogen factors play a role in increasing the risk of severe infection. Perhaps the most important contribution to the increasing severity of cellulitis is the emergence of community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA), specifically the USA 300 clone, as a leading pathogen in cellulitis and soft-tissue infections associated with 47

purulence (Cunha et al., 2005). Infections caused by CA-MRSA tend to be more severe and are resistant to many of the antibiotics commonly used to treat cellulitis. Certain strains of bacteria, most notably group A beta-hemolytic Streptococcus (GABHS) and Staphyloccocus aureus, produce toxins. These toxins may mediate a more severe systemic infection, leading to septic shock and death (Dajani et al., 1972; Dajani et al., 1973). Certain host factors predispose to severe infection. Individuals with comorbid conditions such as diabetes mellitus, immunodeficiency, cancer, venous stasis, chronic liver disease, peripheral arterial disease, and chronic kidney disease appear to be at a higher risk for both recurrent and more severe infection owing to an altered host immune response. Concurrent intravenous or subcutaneous skin popping drug use also predisposes to cellulitis. Infections in this setting are most often polymicrobial, but CA-MRSA is also a common pathogen.

Race Cellulitis has no predilection for any race or ethnic group. Sex Cellulitis has no predilection for either sex.

Age

In general, no specific age group is at a higher risk for cellulitis but more common in adults older than 50 years. Perianal cellulitis, usually with GABHS, occurs in children younger than 3 years. Group B Streptococcus cellulitis occurs in infants younger than 6 months. Elderly patients with cellulitis are predisposed to thrombophlebitis.

Clinical Cellulitis develops several days after the inciting trauma; this intervening period often means that the patient does not recollect any trauma, which is often minor, at the time of presentation. Rapid progression is concerning sign of a more severe infection, such as necrotizing fasciitis, and should be managed promptly. 48

Physical The physical examination should first focus on the area of concern. Most skin and soft-tissue infections have the four cardinal signs of infection: erythema, pain, swelling, and warmth. Several physical examination findings may help the clinician to identify the most likely pathogen and to assess the severity of the infection, facilitating appropriate treatment.

Skin infection without underlying drainage, penetrating trauma, eschar, or abscess is most likely caused by streptococci. On the other hand, Staphylococcus aureus, often CAMRSA, is the most likely pathogen when these factors are present (Elias et al., 1976). Lymphangitic spread (red lines streaking away from the area of infection), crepitus, and hemodynamic instability are indications of severe infection, requiring more aggressive treatment. Circumferential cellulitis or pain that is disproportional to examination findings should prompt consideration of more severe soft-tissue infection.

Causes The most common cause of cellulitis is infection with gram-positive cocci, specifically GABHS and Staphylococcus aureus, whether it is MRSA or methicillinsensitive Staphylococcus aureus (MSSA).

IV.

Necrotizing Fasciitis

Necrotizing fasciitis (NF) is an insidiously advancing soft tissue infection characterized by widespread fascial necrosis. A number of bacteria in isolation or as a polymicrobial infection can cause necrotizing fasciitis (Kihiczak et al., 2006). The organisms most closely linked to necrotizing fasciitis are in group A beta-hemolytic streptococci, although the disease may also be caused by other bacteria or different streptococcal serotypes. A few distinct necrotizing fasciitis syndromes should be recognized. streptococcal; and type III gas gangrene, or clostridial myonecrosis. Pathophysiology Organisms spread from the subcutaneous tissue along the superficial and deep fascial planes, presumably facilitated by bacterial enzymes and toxins. This deep infection causes 49 The 3 most important are type I (saltwater containing a Vibrio species), or polymicrobial; type II or group A

vascular occlusion, ischemia, and tissue necrosis. Superficial nerves are damaged, producing the characteristic localized anesthesia. Septicemia ensues with systemic toxicity. Important bacterial factors include surface protein expression and toxin production. M-1 and M-3 surface proteins, which increase the adherence of the streptococci to the tissues, also protect the bacteria against phagocytosis by neutrophils. Streptococcal pyrogenic exotoxins (SPEs) A, B, and C are directly toxic and tend to be produced by strains causing necrotizing fasciitis. These pyrogenic exotoxins, together with streptococcal superantigen (SSA), lead to the release of cytokines and produce clinical signs such as hypotension. The etiological agent may also be a Staphylococcus aureus isolate harboring the enterotoxin gene cluster seg, sei, sem, sen, and seo but lacking all common toxin genes, including Panton-Valentine leukocidin (Morgan et al., 2007). Single-nucleotide changes are the most common cause of natural genetic variation among members of the same species. They may alter bacterial virulence; a single-nucleotide mutation in the group A Streptococcus genome was identified that is epidemiologically associated with decreased human necrotizing faciitis (Olsen et al., 2010). Mortality/Morbidity The mortality rate for necrotizing fasciitis can be as high as 25%. Cases of necrotizing fasciitis with sepsis and renal failure have a mortality rate as high as 70%. Age Approximately half of the cases of streptococcal necrotizing fasciitis occur in young and previously healthy people. Clinical Necrotizing fasciitis tends to begin with constitutional symptoms of fever and chills. After 2-3 days, erythema is noted, and supralesional vesiculation or bullae formation ensues. Sero-sanguineous fluid may drain from the affected area. Necrotizing fasciitis may develop after skin biopsy; at needle puncture sites in those use illicit drugs; and after episodes of frostbite, chronic venous leg ulcers, open bone fractures, insect bites, surgical wounds, and skin abscesses. However, in many cases, no association with such factors can be made. Necrotizing

50

fasciitis may also occur in the setting of diabetes mellitus, surgery, trauma, or infectious processes. Causes Group A beta-hemolytic streptococci is not the only cause of necrotizing fasciitis. Haemophilus aphrophilus and Staphyloccocus aureus are also associated with the condition, and some patients have mixed infections involving multiple species of bacteria, including mycobacterium, or fungi (Tang et al., 2000; Sendi et al., 2009).

V.

Scarlet Fever

Scarlet fever is an infection caused by toxin-producing group A beta hemolytic streptococci (GABHS) found in secretions and discharge from the nose, ears, throat, and skin. Scarlet fever may follow streptococcal wound infections or burns, as well as upper respiratory tract infections, but food-borne outbreaks have been reported (Dong et al., 2008 ; Yang et al., 2007). Pathophysiology As the name scarlet fever implies, an erythematous eruption is associated with a febrile illness. The circulating toxin, often referred to as erythemogenic toxin, causes the rash as a consequence of local production of inflammatory mediators and alteration of the cutaneous cytokine milieu. This results in a sparse inflammatory response and dilatation of blood vessels, leading to the characteristic scarlet color of the rash (Cunningham et al., 2000). Mortality/Morbidity Historically, scarlet fever resulted in death in 15-20% of those affected. Since the advent of antibiotic therapy, the mortality rate for scarlet fever is less than 1%. Although uncommon, case reports describe patients, including adults, who are severely affected (Sandrini et al., 2009). Morbidity and mortality associated with scarlet fever is usually minimal. Known complications, such as septicemia, vasculitis, hepatitis, or rheumatic fever, should be considered on a case-bycase basis as determined by the presence of clinical history and examination findings suggestive of those diseases (Gomez-Carrasco et al., 2004; Guven et al., 2002). Localized soft tissue 51

infections may suggest the presence of underlying osteomyelitis, but scarlet fever may occur from cellulitis alone (Lau et al., 2004). When scarlet fever has been determined to be due to a soft tissue infection over or near bone, evaluation for bony involvement should be considered. Race No racial or ethnic predilection is reported for group A streptococcal infection. Age The infection usually occurs in children, with the peak age incidence from 110 years. However, it can occur in older children and adults. As depicted from a case study that antecedent streptococcal infection can increase the likelihood of children developing certain neuropsychiatric disorder including Tourette syndrome, attention- deficit/hyperactivity disorder, and major depressive disorder (Leslie et al., 2008).

Clinical The cutaneous eruption of scarlet fever accompanies a streptococcal infection at another anatomic site, usually the tonsillopharynx. Abrupt onset of fever, headache, vomiting, malaise, chills, and sore throat occurs. Rash appears 1-4 days after the onset. Physical The mucous membranes usually are bright red, and scattered petechiae and small red papular lesions on the soft palate are often present. Causes The overwhelming majority of cases of scarlet fever are caused by beta hemolytic Lancefield group A streptococcus (GABHS). Differential diagnosis includes other causes of fever accompanied by erythematous eruptions. Other bacteria that cause pharyngitis and similar rash include: Staphylococcus aureus, Haemophilus influenza, Arcanobacterium haemolyticum and Clostridium species (Gaston et al., 2007). Recurrent cases of scarlet fever have been reported from reinfection with strains unrelated to Streptococcus pyogenes (Sanz et al., 2005).

VI.

Otitis media and sinusitis

52

The American Academy of Pediatrics (AAP) and the American Academy of Family Physicians (AAFP) define acute otitis media as an infection of the middle ear with acute onset, presence of middle ear effusion (MEE), and signs of middle ear inflammation. Acute otitis media most commonly occurs in children and is the most frequent specific diagnosis in children who are febrile. Clinicians often over diagnose acute otitis media. They are caused by spread of organisms via the eustachian tube (otitis media) and direct spread to sinuses (sinusitis). Distinguishing between acute otitis media (AOM) and otitis media with effusion (OME) is important. Otitis media with effusion is more common than acute otitis media. When otitis media with effusion is mistaken for acute otitis media, antibiotics may be prescribed unnecessarily. Otitis media with effusion is fluid in the middle ear without signs or symptoms of infection. Otitis media with effusion is usually caused when the eustachian tube is blocked and fluid becomes trapped in the middle ear. Signs and symptoms of acute otitis media occur when fluid in the middle ear becomes infected. Recurrent acute otitis media is defined as 3 episodes within 6 months or 4 or more episodes within 1 year. Pathophysiology Acute otitis media usually arises as a complication of a preceding viral upper respiratory infection (URI). The secretions and inflammation cause a relative obstruction of the eustachian tubes. Normally, the middle ear mucosa absorbs air in the middle ear. If this air is not replaced because of obstruction of the eustachian tube, a negative pressure is generated, which pulls interstitial fluid into the tube and creates a serious effusion. This effusion of the middle ear provides a fertile media for microbial growth. If growth is rapid, a middle ear infection develops. Frequency United States Acute otitis media is the most frequent diagnosis made by pediatricians, second only to the common cold. Two thirds of all American children have had at least one episode of AOM prior to 1 year of age, and 80% have had one by 3 years of age (Teele et al., 1989). Despite advances in public health and medical care, middle ear infections are still prevalent around the world, and the incidence in the United States has actually increased 53

over the past 10-20 years. AOM is the most common indication for antimicrobial therapy in children in the United States (American Academy of Pediatrics 2004; McCaig et al., 2002). In 2006, 9 million children aged 0-17 years were reported to have an ear infection or AOM of those, 8 million children reported visiting a physician or obtaining a prescription drug to treat the condition. As such, the diagnosis and management of AOM has a significant impact on the health of children, the direct cost of health care, and the overall use of antibacterial agents (Soni et al., 2008).

Mortality/Morbidity

Mortality is rare in countries where treatment of complications is available, and it is not frequent in countries where treatment is not available. Morbidity may be significant for infants in whom persistent middle ear effusion (MEE) develops. Chronic MEE may lead to hearing deficits and speech delay. After an episode of acute otitis media (AOM), as many as 45% of children have persistent effusion at 1 month, but this number decreases to 10% after 3 months. Most spontaneous perforations eventually heal, but some persist. Cholesteatoma formation with destruction of the ossicles is a serious but infrequent complication. AOM is not considered a major source of bacteremia or meningeal seeding, but local brain abscess and mastoiditis are potential sequelae, demonstrating that it is possible for AOM to extend.

Race Otitis media is more frequent in certain racial groups (e.g., Inuit and American Indians); this is likely due to anatomic differences in the eustachian tube. Sex Boys are affected more commonly than girls, but no specific causative factors have been found. Male sex is a minor determinant of infection. 54

Age Ear infections occur in all age groups, but they are considerably more common in children, particularly those between ages 6 months to 3 years than in adults. This age distribution is presumably due to immunologic factors (e.g., lack of pneumococcal antibodies) and anatomic factors (e.g., a low angle of the eustachian tube with relation to the nasopharynx). Children with significant predisposing factors (e.g., cleft palate, Down syndrome) acquire infections so frequently that some authors advocate the routine placement of polyethylene tubes in their tympanic membranes to maintain aeration of the middle ear.

Clinical Patients who can communicate usually describe feelings of pain or discomfort in the affected ear. However, most cases occur in children who are unable to communicate specific complaints. History alone is a poor predictor of acute otitis media, especially in young children. Observations include:

Accompanying or precedent upper respiratory infection (URI) symptoms (very common) Earache/fullness Decreased hearing Fever (not required for the diagnosis) Otorrhea Infants may be asymptomatic or irritable. Infants may present with pulling/tugging of the ear.

Physical If the ear canal is clean and if the patient is cooperative, physical examination is generally easy. If the ear canal is occluded with cerumen or debris, if the canal is anatomically small, or if the patient is unable to cooperate, examination may be difficult.

2.8.2 Nonsuppurative Complications

a) Streptococcal toxic shock syndrome (STSS) 55

STSS is a severe systemic immune response mediated by superantigens. Toxic shock syndrome (TSS) is a toxin-mediated acute life-threatening illness, usually precipitated by infection with either Staphylococcus aureus or group A Streptococcus (GAS). It is characterized by high fever, rash, hypotension, multi-organ failure (involving at least 3 or more organ systems), and desquamation, typically of the palms and soles, 1-2 weeks after the onset of acute illness. The clinical syndrome can also include severe myalgia, vomiting, diarrhea, headache, and non focal neurologic abnormalities. TSS was first described in children in 1978 (Odd et al., 1980). Subsequent reports identified an association with tampon use by menstruating women (Shands et al., 1989; Davis et al., 1980; Ellies et al., 2009). Menstrual TSS is more likely in women using highly absorbent tampons, using tampons for more days of their cycle, and keeping a single tampon in place for a longer period of time. Over the past two decades, the number of cases of menstrual TSS (1 case per 100,000) has steadily declined; this is thought to be due to the withdrawal of highly absorbent tampons from the market. An increasing number of severe GAS infections associated with shock and organ failure have been reported. These infections are termed streptococcal TSS (Lappin et al., 2009). Pathophysiology Toxic shock syndrome (TSS) is caused from intoxication by one of several related Staphylococcus aureus exotoxins. The most commonly implicated toxins include TSS toxin type-1 (TSST-1) and Staphylococcal enterotoxin B. Almost all cases of menstrual TSS and half of all the non-menstrual cases are caused by TSST-1. Staphylococcal enterotoxin B is the second leading cause of TSS. Other exotoxins such as enterotoxins A, C, D, E, and H contribute to a small number of cases. Seventy to 80% of individuals develop antibody to TSST-1 by adolescence, and 90-95% have such antibody by adulthood. Apart from host immunity status, host-pathogen interaction, local factors (pH, glucose level, magnesium level), and age all have a direct impact on the clinical expression of this toxin-mediated illness. M protein is an important virulent determinant of GAS; strains lacking M protein are less virulent. M protein is a filamentous protein anchored to the cell membrane, which has 56

antiphagocyte properties. M types 1, 3, 12, and 28 are the most common isolates found in patients with shock and multi-organ failure; furthermore, 3 distinct streptococcal pyrogenic exotoxins (i.e., A, B, C) also have been identified. pyrogenicity and enhance the lethal effects of endotoxins. Recently, the streptococcal super antigen, a pyrogenic exotoxin, has been isolated from an M-3 strain. In some studies, strains producing exotoxins B and C have been implicated in this syndrome, to a lesser extent. These toxins induce cytotoxicity and

Mechanism of shock and tissue destruction Colonization or infection with certain strains of Staphyloccocus aureus and GAS is followed by the production of one or more toxins. These toxins are absorbed systemically and produce the systemic manifestations of TSS in people who lack a protective antitoxin antibody. Possible mediators of the effects of the toxins are cytokines, such as interleukin 1 (IL-1) and tumor necrosis factor (TNF). Pyrogenic exotoxins induce human mononuclear cells to synthesize TNF-alpha, IL-1-beta, and interleukin 6 (IL-6). TSS likely relates to the ability of pyrogenic exotoxins of GAS and enterotoxins of Staphyloccocus aureus to act as superantigens. Superantigens are molecules that interact with the T-cell receptor in a domain outside of the antigen recognition site and hence are able to activate large numbers of T cells resulting in massive cytokine production. Normally, an antigen has to be taken up, processed by an antigen-presenting cell and expressed at the cell-surface along with class II major histo-compatibility complex (MHC). By contrast, superantigens do not require processing by antigen-presenting cells but instead interact directly with the class II MHC molecule. The superantigen-MHC complex then interacts with the T-cell receptor and stimulates large numbers of T-cells to cause an exaggerated, dysregulated cytokine response. In the case of TSS, the implicated exotoxins and several staphylococcal toxins (e.g., TSST-1) can stimulate T-cell responses through their ability to bind to both the class II major histocompatibility complex (MHC) of antigen-presenting cells (APC) and T-cell receptors. These toxins simultaneously bind to the beta chain variable region (V-beta) elements on T-cell receptors and the class II major histo-compatibility antigen-processing cells. This mechanism bypasses the 57

classical antigen-processing procedures and results in excessive T-cell proliferation. The conventional antigens activate only about 0.01% to 0.1% of the T-cell population, whereas, the superantigens set in motion 5-30% of the entire T-cell population. The net effect is massive production of cytokines that are capable of mediating shock and tissue injury. As part of this T cell response, interferongamma is also produced, which subsequently inhibits polyclonal immunoglobulin production. This failure to develop antibodies may explain why some patients are predisposed to relapse after a first episode of TSS. Frequency United States Estimates from population-based studies have documented an incidence of invasive GAS infection of 1.55.2 cases per 100,000 people annually (Lappin et al., 2009). Approximately 8-14% of these patients also will develop TSS (Davies et al., 1996). A history of recent varicella infection markedly increases the risk of infection with GAS to 62.7 cases per 100,000 people per year. Severe soft tissue infections, including necrotizing fasciitis, myositis, or cellulitis, were present in approximately half of the patients. STSS is much more common, although data on prevalence do not exist. In the United States, from 1979-1996, 5296 cases of STSS were reported. The number of cases of menstrual STSS is estimated at 1 per 100,000. The incidence of non-menstrual STSS now exceeds menstrual STSS after the hyper-absorbable tampons were removed from the market. Mortality/Morbidity Mortality rates for streptococcal TSS are 30-70%. Morbidity also is high; in one series, 13 of 20 patients underwent major surgical procedures, such as vasectomy, surgical debridement, laparotomy, amputation, or hysterectomy (Eriksson et al., 1998; Stevens et al., 1992). The case fatality rates for menstrual-related STSS have declined from 5.5% in 1980 to 1.8% in 1996. Race

58

TSS has occurred in all races, although most cases have been reported from North America and Europe.

Sex STSS most commonly occurs in women, usually those who are using tampons. Age STSS have no predilection for any particular age for either the streptococcal TSS or STSS. However, studies have reported STSS to be more common in older individuals with underlying medical problems. In a Canadian survey, STSS accounted for 6% of cases in individuals younger than 10 years compared with 21% in people older than 60 years. Furthermore, menstruation-associated STSS occurred in younger women who were using tampons. Clinical Although the clinical manifestations of TSS can be diverse, the possibility of toxic shock should be considered in any individual who presents with sudden onset of fever, rash, hypotension, renal or respiratory failure, and changes in mental status (Demers et al., 1993). Common presenting symptoms and frequency of STTS are as follows : pain (44-85%), vomiting (25-26%), nausea (20%), diarrhea (14-30%), and influenza like symptoms (14-20%), headache (10%) and dyspnea (8%). The following risk factors have been reported to be associated with STSS:
o o o

Patients with HIV, diabetes, cancer, ethanol abuse, and other chronic diseases Patients with a recent history of varicella infection (chicken pox) Patients who used nonsteroidal anti-inflammatory drugs (NSAIDs)

Physical

Fever is the most common presenting sign, although patients in shock may present with hypothermia. Shock is apparent at the time of hospitalization or within 4-8 hours for all patients. Patients become severely hypotensive and do not respond to intravenous fluid administration.

59

Renal dysfunction progresses or persists in all patients, precedes shock in many patients, and is apparent early. Acute respiratory distress syndrome occurs in 55% of patients and requires mechanical ventilation.

Confusion is present in 55% of patients, and coma or agitation may occur. Alteration in mental status disproportionate to the degree of hypotension can occur with or without seizures. Persistent neuropsychiatric sequelae manifested by memory loss, and poor concentration have been reported. Common presenting symptoms and frequency of STTS are as follows: tachycardia (80%), fever (70-81%), hypotension (44-65%), confusion (55%), localized erythema (44-65%), localized swelling and erythema (30-75%) and scarlatini form rash (0-4%).

Causes Risk factors for the development of STSS are tampon use, vaginal colonization with toxinproducing Staphylococcus aureus, and lack of serum antibody to the staphylococcal toxin (Matsuda et al., 2008). STSS also has occurred following use of nasal tampons for procedures of the ears, nose, and throat.

b) Acute Rheumatic Fever

The incidence of acute rheumatic fever (ARF) has declined in most developed countries, and many physicians have little or no practical experience with the diagnosis and management of this condition. Occasional outbreaks in the United States make complacency a threat to public health. Diagnosis rests on a combination of clinical manifestations that can develop in relation to group A streptococcal pharyngitis. These include chorea, carditis, subcutaneous nodules, erythema marginatum, and migratory polyarthritis. Because the inciting infection is completely treatable, attention has been refocused on prevention.

Pathophysiology The earliest and most common feature is a painful migratory arthritis, which is present in approximately 80% of patients. Large joints such as knees, ankles, elbows, or shoulders are typically affected. Sydenham chorea was once a common late-onset clinical manifestation but is 60

now rare. Carditis (with progressive congestive heart failure, a new murmur, or pericarditis) may be the presenting sign of unrecognized past episodes and is the most lethal manifestation. Genetics may contribute, as evidenced by an increase in family incidence. No significant association with class-I human leukocyte antigens (HLAs) has been found, but an increase in class-II HLA antigens DR2 and DR4 has been found in black and white patients, respectively. Evidence suggests that elevated immune-complex levels in blood samples from patients with ARF are associated with HLA-B5 (Yoshinoya et al., 1980). Frequency United States The incidence of an acute rheumatic episode following streptococcal pharyngitis is 0.53%. The peak age is 6-20 years. Although the incidence of ARF has steadily declined, the mortality rate has declined even more steeply. Credit can be attributed to improved sanitation and antibiotic therapy. Several sporadic outbreaks in the United States could not be blamed directly on poor living conditions. New virulent strains are the best explanation. International Most major outbreaks occur under conditions of impoverished overcrowding where access to antibiotics is limited. Rheumatic heart disease accounts for 2550% of all cardiac admissions internationally. Regions of major public health concern include the Middle East, the Indian subcontinent, and some areas of Africa and South America. As many as 20 million new cases occur each year. The introduction of antibiotics has been associated with a rapid worldwide decline in the incidence of ARF. The incidence continues to be 13.4 patients per 100,000 hospitalized children per year (Chun et al., 1987).

Mortality/Morbidity

Mortality rates are steadily improving because of better sanitation and health care. The current pattern of morbidity is difficult to measure because the first attack of rheumatic fever follows an unpredictable course. As many as 90% of episodes are clinically contained within 3 months.

61

Carditis causes the most severe clinical manifestation because heart valves can be permanently damaged. The disorder also can involve the pericardium, myocardium, and the free borders of valve cusps. Death or total disability may occur years after the initial presentation of carditis.

Race An association between certain class-II HLA antigens (DR2 in blacks and DR4 in whites) and ARF has been reported. Sex No general clear-cut sex predilection for the syndrome has been reported, but its manifestations seem to be sex variable. For example, certain clinical manifestations (i.e., chorea and tight mitral stenosis) are predominant in women, while men are more likely to develop aortic stenosis.

Age

The initial attack of ARF occurs most frequently in persons aged 6-20 years and rarely occurs in persons older than 30 years. The disease may cluster in families. In some countries, a shift into older groups may be a trend.

Clinical Diagnosis is challenging for several reasons, as follows:

o

Approximately 70% of older children and young adults recollect pharyngitis. However, only approximately 20% of young children recollect pharyngitis. Therefore, younger children who present with signs or symptoms consistent with acute rheumatic fever (ARF) merit a higher index of suspicion. The rate of isolation of group A streptococci from the oropharynx is extremely low in all populations. Usually, a latent period of approximately 18 days occurs between the onset of streptococcal pharyngitis and ARF. This latent period is rarely shorter than 1 week or longer than 5 weeks.

62

Typically, the first manifestation is a very painful migratory polyarthritis. Often, associated fever and constitutional toxicity develop. Acute attacks usually resolve within 12 weeks. Guidelines for diagnosis published more than 50 years ago by T. Duckett Jones has been slightly revised by the American Heart Association (AHA) (Jones, 1944). Prior history of a preceding group A streptococcal infection is helpful but not required (Digenea et al., 1993). In addition, 2 major manifestations or 1 major and 2 minor manifestations must be present.

o o

Major manifestations include carditis, polyarthritis, chorea, erythema marginatum, and subcutaneous nodules. Minor manifestations include arthralgias and fever. Laboratory findings include elevated levels of acute-phase reactants (erythrocyte sedimentation rate [ESR] and C-reactive protein) and a prolonged PR interval. A prolonged PR interval is not specific and has not been associated with later cardiac sequelae. The utility of echocardiography is also controversial. The Jones criteria should be viewed as a guide to determine who is at high risk but cannot be used to define diagnosis with absolute certainty. An exception includes chorea, which can present as the sole manifestation of ARF, in spite of negative laboratory results. Another possible exception is indolent carditis. A throat culture with results positive for Streptococcus is found in approximately 25% of patients at the time of presentation.

o o

Physical Suspicious signs for carditis include new or changing valvular murmurs, cardiomegaly, congestive heart failure, and/or pericarditis. When present, Sydenham chorea is seldom evident at the time of initial presentation. Causes

63

Although the mechanism by which streptococcal organisms cause disease is not entirely clear, overwhelming epidemiologic evidence suggests that ARF is caused by streptococcal infection, and recurrences can be prevented with prophylaxis. Strains of group A streptococci that are heavily encapsulated and rich in M protein (signifying virulence in streptococcal strains) seem to be most likely to result in infection. Group A Streptococcus is thought to cause the myriad of clinical diseases in which the host's immunologic response to bacterial antigens cross-react with various target organs in the body, resulting in molecular mimicry. In fact, autoantibodies reactive against the heart have been found in patients with rheumatic carditis. The antibody can cross-react with brain and cardiac antigens, and immune complexes are present in the serum. The problem has been the uncertainty of whether these antibodies are the cause or result of myocardial tissue injury.

c) Acute Glomerulonephritis Acute glomerulonephritis (AGN) was initially described by Bright in 1927. Acute poststreptococcal glomerulonephritis (PSGN) is the archetype of acute GN. Acute nephritic syndrome is the most serious and potentially devastating form of various renal syndromes. Acute GN is characterized by the abrupt onset of hematuria and proteinuria, often accompanied by azotemia (i.e., decreased glomerular filtration rate [GFR]) and renal salt and water retention. Pathophysiology Acute GN has 2 components: structural changes and functional changes. Structural changes

Cellular proliferation: This leads to an increase in the number of cells in the glomerular tuft because of the proliferation of endothelial, mesangial, (Jones, 1944) and epithelial cells. The proliferation could be endocapillary (i.e., within the confines of the glomerular capillary tufts) or extracapillary (i.e., in the Bowman space involving the epithelial cells). 64

In extracapillary proliferation, proliferation of parietal epithelial cells leads to the formation of crescents, a feature characteristic of certain forms of rapidly progressive glomerulonephritis.

Leukocyte proliferation: This is indicated by the presence of neutrophils and monocytes within the glomerular capillary lumen and often accompanies cellular proliferation. Glomerular basement membrane thickening: This development appears as thickening of capillary walls using light microscopy. Using electron microscopy, this may appear as the result of thickening of basement membrane proper (e.g., diabetes) or deposition of electron-dense material, either on the endothelial or epithelial side of the basement membrane. Hyalinization or sclerosis: These conditions indicate irreversible injury. Electron-dense deposits: Such deposits could be subendothelial, subepithelial, intramembranous, or mesangial, and they correspond to an area of immune complex deposition. These structural changes could be focal, diffuse or segmental, and global.

Functional changes Functional changes include proteinuria, hematuria, reduction in GFR (i.e., oligoanuria), and active urine sediment with RBCs and RBC casts. The decreased GFR and avid distal nephron salt and water retention result in expansion of intravascular volume, edema, and, frequently, systemic hypertension. Frequency United States AGN comprises 25-30% of all cases of end-stage renal disease (ESRD). About one fourth of patients present with acute nephritic syndrome. Most cases that progress do so relatively quickly, and end-stage renal failure may occur within weeks or months of acute nephritic syndrome onset. Asymptomatic episodes of PSGN exceed symptomatic episodes by a ratio of 3-4:1. International 65

Geographic and seasonal variations in the prevalence of PSGN are more marked for pharyngeally associated GN than for cutaneously associated disease (Anochie et al., 2009; Becquet et al., 2010; Wong et al., 2009). Race Postinfectious GN has no predilection for any racial or ethnic group. A higher incidence (related to poor hygiene) may be observed in some socioeconomic groups. Sex Acute GN predominantly affects males (i.e., 2:1 male-to-female ratio).

Age Postinfectious GN can occur at any age but usually develops in children. Outbreaks of PSGN are common in children aged 6-10 years. Clinical Identify a possible etiologic agent (e.g., streptococcal throat infection (pharyngitis), skin infection (pyoderma): Recent fever, sore throat, joint pains, hepatitis, travel, valve replacement, and/or intravenous drug use may be causative factors. Rheumatic fever rarely coexists with acute PSGN. Physical

Signs of fluid overload

o o o o o

Periorbital and/or pedal edema Edema and hypertension due to fluid overload (in 75% of patients) Crackles (i.e., if pulmonary edema) Elevated jugular venous pressure Ascites and pleural effusion (possible)

Rash (i.e., vasculitis, Henoch-Schnlein purpura) Pallor Renal angle (i.e., costovertebral) fullness or tenderness, joint swelling, or tenderness. 66

Causes The causal factors that underlie this syndrome can be broadly divided into infectious and noninfectious groups.

Infectious
o

Streptococcal: Poststreptococcal GN usually develops 1-3 weeks following acute infection with specific nephritogenic strains of group A beta-hemolytic streptococcus. The incidence of GN is approximately 5-10% in persons with pharyngitis and 25% in those with skin infections. Nonstreptococcal postinfectious glomerulonephritis

Bacterial - Infective endocarditis, shunt nephritis, sepsis, pneumococcal pneumonia, typhoid, secondary syphilis, meningococcemia, and infection with methicillin-resistant Staphylococcus aureus (MRSA) Viral - Hepatitis B, infectious mononucleosis, mumps, measles, varicella, vaccinia, echovirus, parvovirus, and coxsackievirus Parasitic - Malaria, toxoplasmosis

Noninfectious
o

Multisystem systemic diseases - Systemic lupus erythematosus, vasculitis, Henoch-Schnlein purpura, Goodpasture syndrome, Wegener granulomatosis Primary glomerular diseases Membranoproliferative GN (MPGN), Berger disease (i.e., immunoglobulin A (IgA) nephropathy), "pure" mesangial proliferative GN (Wen et al., 2010). Miscellaneous - Guillain-Barr syndrome, radiation of Wilms tumor, diphtheriapertussis-tetanus vaccine, serum sickness

d) Rheumatic Fever
Acute rheumatic fever (ARF) is an autoimmune inflammatory process that develops as a sequela of streptococcal infection. ARF has extremely variable manifestations and remains a clinical syndrome for which no specific diagnostic test exists.

67

Persons who have experienced an episode of ARF are predisposed to recurrence following subsequent (rheumatogenic) group A streptococcal infections. The most significant complication of ARF is rheumatic heart disease, which usually occurs after repeated bouts of acute illness. Pathophysiology ARF is characterized by nonsuppurative inflammatory lesions of the joints, heart, subcutaneous tissue, and central nervous system. An extensive literature search has shown that, at least in developed countries, rheumatic fever follows pharyngeal infection with rheumatogenic group A streptococci (Abbas et al., 2004). The risk of developing rheumatic fever after an episode of streptococcal pharyngitis has been estimated at 0.3-3%. More recent investigations of rheumatic fever occurring in the aboriginal populations of Australia suggest that streptococcal skin infections might also be associated with the development of rheumatic fever. In Oceania and Hawaii, streptococcal strains that are not typically associated with rheumatic fever have been found to cause the disease. Molecular mimicry accounts for the tissue injury that occurs in rheumatic fever. Both the humoral and cellular host defenses of a genetically vulnerable host are involved. In this process, the patient's immune responses (both B- and T-cell mediated) are unable to distinguish between the invading microbe and certain host tissues. The resultant inflammation may persist well beyond the acute infection and produces the protean manifestations of rheumatic fever. Frequency United States The incidence of ARF has declined markedly in the past 50 years in both the United States and Western Europe. Most Western physicians see only the late sequelae of rheumatic heart disease; the diagnosis of an acute case is usually reason enough for a ground rounds presentation. This remarkable decline of rheumatic fever likely reflects improved socioeconomic conditions, as well the decline in prevalence of the classically described rheumatogenic strains of group A streptococci.

International

68

In developing countries, the magnitude of ARF is enormous. Recent estimates suggest that 15.6 million people worldwide have rheumatic heart disease and that 470,000 new cases of rheumatic fever (approximately 60% of whom will develop rheumatic heart disease) occur annually, with 230,000 deaths resulting from its complications. Almost this entire toll occurs in the developing world. The incidence rate of rheumatic fever is as high as 50 cases per 100,000 children in many areas. Areas of hyper-endemicity (e.g., indigenous populations of Australia and New Zealand) see an incidence of 300-500 cases per 100,000 children, while the rates are approximately 50-fold lower in their nonindigenous compatriots. Rheumatic fever in the 21st century appears to be largely a disease of crowding and poverty.

In India Rheumatic fever in India accounts for 27-100 people in 100,000 yearly (Chopra et al., 2007).

Mortality/Morbidity Cardiac involvement is the most serious complication of rheumatic fever and causes significant morbidity and mortality. As stated above, about 60% of the approximately 470,000 patients diagnosed with ARF annually eventually develop carditis, joining the approximately 15 million worldwide with rheumatic heart disease. Those with rheumatic heart disease are at a high risk for additional cardiac damage with subsequent bouts of ARF and require secondary prophylaxis. Morbidity due to congestive heart failure (CHF), strokes, and endocarditis is common among individuals with rheumatic heart disease, and about 1.5% of persons with rheumatic carditis die of the disease annually. Race ARF is predominantly a disease of developing countries and is concentrated in areas of deprivation and crowding. It is rampant in the Middle East, in sub-Saharan Africa, in the Indian subcontinent, in certain areas of South America, in Polynesia, and among the indigenous populations of Australia and New Zealand. Although a genetic predisposition to ARF clearly exists, the disease does not seem to have a major racial predisposition, as

69

it was once common in the United States and Europe and seems to decline in any locale where living conditions improve. Sex Rheumatic fever does not have a clear-cut sexual predilection, although certain clinical manifestations, such as mitral stenosis and Sydenham chorea, are more common in females who have gone through puberty. Age ARF is most common among children aged 515 years. It is relatively rare in infants and uncommon in preschool-aged children. ARF occurs in young adults, but the incidence of first episodes of ARF falls steadily after adolescence and is rare after age 35 years. The lower rate of ARF in adults may represent a decreased risk of streptococcal pharyngitis in this cohort. Recurrent episodes, with their predisposition to cause or exacerbate valvular damage, occur until middle age. Clinical Rheumatic fever manifests as various signs and symptoms that may occur alone or in various combinations.

Sore throat: Although estimates vary, only 35%-60% of patients with rheumatic fever recall having any upper respiratory symptoms in the preceding several weeks. Many symptomatic individuals do not seek medical attention, go undiagnosed, or do not take the prescribed antibiotic for acute rheumatic fever (ARF) prevention. Polyarthritis: Overall, arthritis occurs in approximately 75% of first attacks of ARF. The likelihood increases with the age of the patient, and arthritis is a major manifestation of ARF in 92% of adults.
o

The arthritis of ARF is usually symmetrical and involves large joints, such as the knees, ankles, elbows, and wrists. Tenosynovitis is common in adults and may be severe enough to suggest a diagnosis of disseminated gonococcal disease. The evolution of arthritis in individual joints tends to overlap; therefore, multiple joints may be inflamed simultaneously, causing more of an additive than a migratory pattern. 70

In most instances, the entire bout of polyarthritis subsides within 4 weeks without any permanent damage. If not, a different diagnosis should be entertained.

Carditis: Of first attacks of ARF, carditis occurs in 30%-60% of cases. It is more common in younger children but does occur in adults (Steven et al., 2007).
o o

Severe inflammation can cause congestive heart failure (CHF). Patients with carditis may present with shortness of breath, dyspnea upon exertion, cough, paroxysmal nocturnal dyspnea, chest pain, and/or orthopnea. Carditis may also be asymptomatic and may be diagnosed solely by auscultation or, perhaps, echocardiography.

Sydenham chorea: This occurs in up to 25% of ARF cases in children but is very rare in adults. It is more common in girls. Sydenham chorea in ARF is likely due to molecular mimicry, with auto-antibodies reacting with brain ganglioside.
o

Sydenham chorea may occur with other symptoms or as an isolated finding. It typically presents 1-6 months after the precipitating streptococcal infection and usually has both neurologic and psychological features. In the isolated form, laboratory evidence of a preceding streptococcal infection may be lacking. Like the polyarthritis, Sydenham chorea usually resolves without permanent damage but occasionally lasts 2-3 years and be a major problem for the patient and her family.

Erythema marginatum: In first attacks of ARF in children, erythema marginatum occurs in approximately 10%. Like chorea, it is very rare in adults.
o

Patients or parents may report a non-pruritic, painless, serpiginous, erythematous eruption on the trunk. It is usually noted only in fairskinned patients. The lesions may persist intermittently for weeks to months.

Subcutaneous nodules are rarely noticed by the patient. Other symptoms may include fever, abdominal pain, arthralgia, malaise, and epistaxis.

Physical

Polyarthritis: Joint involvement in ARF may range from arthralgia to frank polyarthritis characterized by swelling, redness, warmth, and joint tenderness. 71

Carditis is the only manifestation of ARF with significant potential to cause long-term disability and/or death. It is usually a pancarditis involving the pericardium, myocardium, and endocardium. The signs of carditis include the development of new murmurs, cardiac enlargement, CHF, pericardial friction rub, and/or pericardial effusion. Sydenham chorea: This is a neurological disorder characterized by emotional lability, personality change, muscular weakness, and uncoordinated, involuntary, purposeless movements. The average duration of an untreated ARF attack is 3 months. Chronic rheumatic fever, generally defined as disease persisting for longer than 6 months, occurs in less than 5% of cases.

Causes

Group A beta-hemolytic streptococcal infection may lead to rheumatic fever. The overall attack rate after streptococcal pharyngitis 0.3-3%, but certain genetically predisposed individuals, comprising perhaps 3%-6% of the population, account for those who develop rheumatic fever. Studies in developed countries have established that rheumatic fever followed only pharyngeal infections and that not all serotypes of group A streptococci cause rheumatic fever. For example, some strains (e.g., M types 4, 2, 12) in a population susceptible to rheumatic disease do not result in recurrences of rheumatic fever. The classic rheumatogenic serotypes are thought to include 3, 5, 6, 14, 18, 19, and 24. More recent data, largely from studies of the indigenous peoples of Australia, suggest that skin infections (pyoderma) can predispose to ARF and that various other serotypes may be involved. Two basic theories have been postulated to explain the development of ARF and its sequelae following group A streptococcal infection: (1) a toxic effect produced by an extracellular toxin of group A streptococci on target organs such as the myocardium, valves, synovium, and brain and (2) an abnormal immune response to streptococcal components. Increasing and compelling evidence now strongly favors the autoimmune explanation. It seems clear that an exaggerated immune response in a susceptible individual leads to rheumatic fever. This probably occurs through molecular mimicry, in 72

which the immune response fails to differentiate between epitopes of the streptococcal pathogen and certain host tissues.

e) Rheumatic Heart Disease (RHD)

Rheumatic heart disease is the most serious complication of rheumatic fever. Acute rheumatic fever follows 0.3% of cases of group A beta-hemolytic streptococcal pharyngitis in children. As many as 39% of patients with acute rheumatic fever may develop varying degrees of pan-carditis with associated valve insufficiency, heart failure, pericarditis, and even death. With chronic rheumatic heart disease, patients develop valve stenosis with varying degrees of regurgitation, atrial dilation, arrhythmias, and ventricular dysfunction. Chronic rheumatic heart disease remains the leading cause of mitral valve stenosis and valve replacement in adults in the United States. Acute rheumatic fever and rheumatic heart disease are thought to result from an autoimmune response, but the exact pathogenesis remains unclear. Although rheumatic heart disease was the leading cause of death 100 years ago in people aged 5-20 years in the United States, incidence of this disease has decreased in developed countries. Worldwide, rheumatic heart disease remains a major health problem. Chronic rheumatic heart disease is estimated to occur in 5-30 million children and young adults; 90,000 individuals die from this disease each year. The mortality rate from this disease remains 1-10%. A comprehensive resource provided by the World Health Organization (WHO) addresses the diagnosis and treatment (WHO et al., 2004). Pathophysiology Rheumatic fever develops in some children and adolescents following pharyngitis with group A beta-hemolytic Streptococcus (i.e., Streptococcus pyogenes). The organisms attach to the epithelial cells of the upper respiratory tract and produce a battery of enzymes allowing them to damage and invade human tissues. After an incubation period of 2-4 days, the invading organisms elicit an acute inflammatory response with 3-5 days of sore throat, fever, malaise, headache, and an elevated leukocyte count. In 0.3-3% of cases, infection leads to rheumatic fever several weeks after the sore throat has resolved. Only infections of the pharynx initiate or reactivate rheumatic fever. The organism

73

spreads by direct contact with oral or respiratory secretions, and spread is enhanced by crowded living conditions. Patients remain infected for weeks after symptomatic resolution of pharyngitis and may serve as a reservoir for infecting others. Penicillin treatment shortens the clinical course of streptococcal pharyngitis and, more importantly, is effective in decreasing the incidence of major sequelae. Rheumatogenic strains are often encapsulated mucoid strains, rich in M proteins, and resistant to phagocytosis. These strains are strongly immunogenic, and anti-M antibodies against the streptococcal infection may cross-react with components of heart tissue (i.e., sarcolemmal membranes, valve glycoproteins). M protein is felt discriminating due to increased number (Pickering et al., 2009). Acute rheumatic heart disease often produces a pancarditis characterized by endocarditis, myocarditis, and pericarditis. Endocarditis is manifested as valve insufficiency. The mitral valve is most commonly and severely affected (65-70% of patients), and the aortic valve is second in frequency (25%). The tricuspid valve is deformed in only 10% of patients and is almost always associated with mitral and aortic lesions. The pulmonary valve is rarely affected. Severe valve insufficiency during the acute phase may result in congestive heart failure and even death (1% of patients). Whether myocardial dysfunction during acute rheumatic fever is primarily related to myocarditis or is secondary to congestive heart failure from severe valve insufficiency is not known. present, rarely affects cardiac function or results in constrictive pericarditis. Chronic manifestations due to residual and progressive valve deformity occur in 9-39% of adults with previous rheumatic heart disease. Fusion of the valve apparatus resulting in stenosis or a combination of stenosis and insufficiency develops 2-10 years after an episode of acute rheumatic fever, and recurrent episodes may cause progressive damage to the valves. Fusion occurs at the level of the valve commissures, cusps, chordal attachments, or any combination of these. Rheumatic heart disease is responsible for 99% of mitral valve stenosis in adults in the United States. Associated atrial fibrillation or left atrial thrombus formation from chronic mitral valve involvement and atrial enlargement may be observed. Pericarditis, when

Frequency 74

United States At this time, rheumatic fever is uncommon among children in the United States. Incidence of rheumatic fever and rheumatic heart disease has decreased in the United States and other industrialized countries in the past 80 years. Prevalence of rheumatic heart disease in the United States now is less than 0.05 per 1000 population, with rare regional outbreaks reported in Tennessee in the 1960s and in Utah, Ohio, and Pennsylvania in the 1980s. In the early 1900s, incidence was reportedly 5-10 cases per 1000 population. Decreased incidence of rheumatic fever has been attributed to the introduction of penicillin or a change in the virulence of the Streptococcus. International In contrast to trends in the United States, the incidence of rheumatic fever and rheumatic heart disease has not decreased in developing countries. Retrospective studies reveal developing countries to have the highest figures for cardiac involvement and recurrence rates of rheumatic fever. Estimations from Guilherme et al., 2007 worldwide are that at least 15.6 million children and young adults have rheumatic heart disease, and 233,000 patients die from this yearly. A study of school children in Cambodia and Mozambique with rheumatic fever showed that rheumatic heart disease prevalence when echocardiography is used for screening is 10 fold greater compared with the prevalence when clinical examination alone is performed (Marijon et al., 2007). Mortality/Morbidity Rheumatic heart disease is the major cause of morbidity from rheumatic fever and the major cause of mitral insufficiency and stenosis in the United States and the world. Variables that correlate with severity of valve disease include the number of previous attacks of rheumatic fever, the length of time between the onset of disease and start of therapy, and sex. (The disease is more severe in females than in males.) Insufficiency from acute rheumatic valve disease resolves in 60-80% of patients who adhere to antibiotic prophylaxis.

Race Native Hawaiian and Maori (both of Polynesian descent) have a higher incidence of rheumatic fever (13.4 per 100,000 hospitalized children per year), even with antibiotic 75

prophylaxis of streptococcal pharyngitis. Sex

Otherwise, race (when controlled for

socioeconomic variables) has not been documented to influence disease incidence. Rheumatic fever occurs in equal numbers in males and females, but the prognosis is worse for females than for males. Age Rheumatic fever is principally a disease of childhood, with a median age of 10 years, although it also occurs in adults (20% of cases). Clinical A diagnosis of rheumatic heart disease is made after confirming antecedent rheumatic fever. The modified Jones criteria (revised in 1992) provide guidelines for the diagnosis of rheumatic fever (Jones, 1992). The Jones criteria require the presence of 2 major or one major and two minor criteria for the diagnosis of rheumatic fever. The major diagnostic criteria include carditis, polyarthritis, chorea, subcutaneous nodules, and erythema marginatum. The minor diagnostic criteria include fever, arthralgia, prolonged PR interval on ECG, elevated acute phase reactants (increased erythrocyte sedimentation rate ESR, presence of C-reactive protein, and leukocytosis. Additional evidence of previous group A streptococcal pharyngitis is required to diagnose rheumatic fever. One of the following must be present:

Positive throat culture or rapid streptococcal antigen test result. Elevated or rising streptococcal antibody titer. History of previous rheumatic fever or rheumatic heart disease.

These criteria are not absolute; the diagnosis of rheumatic fever can be made in a patient with chorea alone if the patient has had documented group A streptococcal pharyngitis. After a diagnosis of rheumatic fever is made, symptoms consistent with heart failure, such as difficulty breathing, exercise intolerance, and a rapid heart rate out of proportion to fever, may be indications of carditis and rheumatic heart disease.

Physical

76

Physical findings in a patient with rheumatic heart disease include cardiac and noncardiac manifestations of acute rheumatic fever. Some patients develop cardiac manifestations of chronic rheumatic heart disease. Other cardiac manifestations include congestive heart failure and pericarditis.

Heart failure may develop secondary to severe valve insufficiency or myocarditis. The physical findings associated with heart failure include tachypnea, orthopnea, jugular venous distention, rales, hepatomegaly, a gallop rhythm, edema, and swelling of the peripheral extremities. Increased cardiac dullness to percussion and muffled heart sounds are consistent with pericardial effusion. A paradoxical pulse (and accentuated fall in systolic blood pressure with inspiration) with decreased systemic pressure and perfusion and evidence of diastolic indentation of the right ventricle on echocardiogram reflect impending pericardial tamponade. In this clinical emergency, the pericardial effusion should be evacuated by pericardiocentesis. Common noncardiac (and diagnostic) manifestations of acute rheumatic fever include polyarthritis, chorea, erythema marginatum, and subcutaneous nodules. Other clinical, noncardiac manifestations include abdominal pain, arthralgias, epistaxis, fever, and rheumatic pneumonia. Causes Rheumatic fever is thought to result from an inflammatory autoimmune response. Rheumatic fever only develops in children and adolescents following group A beta-hemolytic streptococcal pharyngitis, and only streptococcal infections of the pharynx initiate or reactivate rheumatic fever. Genetic studies show strong correlation between progression to rheumatic heart disease and human leukocyte antigen (HLA)-DR class II alleles and the inflammatory protein-encoding genes MBL2 and TNFA (Guilherme et al., 2007). Furthermore, both clones of heart tissueinfiltrating T cells and antibodies have been found to be cross-reactive with betahemolytic streptococcus. Interferon (IFN)-gamma, tumor necrosis factor (TNF)-alpha, and interleukin (IL)-10-(+) cells are consistently predominant in valvular tissue, whereas IL-4 regulatory cytokine expression is consistently low. The proposed pathophysiology for development of rheumatic heart disease is as follows: Cross-reactive antibodies bind to cardiac tissue facilitating infiltration of streptococcal-primed 77

CD4+ T cells, which then trigger an autoimmune reaction releasing inflammatory cytokines (including TNF-alpha and IFN-gamma). Because few IL-4producing cells are present in valvular tissue, inflammation persists, leading to valvular lesions.

2.9.1 Identification of GAS

For better treatment of GAS infections diagnosis plays a major role. This pauses an alarm to lab technicians to ensure that the specific and exact pathogen is identified for proper prescription for medication for complete elimination of the organism. Throat culture (gold method) Streptococcus species in a positive throat culture, group A streptococci appear as betahemolytic colonies among other normal throat flora which are usually alpha- or nonhemolytic on 5% sheep blood agar. Streptoccocus pyogenes may appear as highly mucoid to nonmucoid; colonies are catalase negative. Optimal recovery of group A streptococci may be achieved by use of blood agar plates containing sulfamethoxazole-trimethoprim to inhibit some of the normal flora and growth under anaerobic conditions to enhance streptolysin O activity. Throat culture is still recognized as the most reliable method for detecting the presence of group A streptococci in the throat. Presumptive identification of the beta-hemolytic group A streptococci relies on susceptibility to bacitracin or a positive pyrrolidonylarylamidase test. Lancefield group The Lancefield serological grouping system for identification of streptococci is based on the immunological differences in their cell wall polysaccharides (groups A, B, C, F, and G) or lipoteichoic acids (group D). The group A carbohydrate antigen is composed of N-acetyl-bDglucosamine linked to a polymeric rhamnose backbone. Confirmation of Streptoccocus pyogenes is done by highly accurate serological methods, such as the Lancefield capillary precipitin technique and the slide agglutination procedure, which utilize standardized grouping antisera. These methods, including Streptex on primary plates (24 hours) or subculture (48 hours), would confirm group A streptococci. For this reason, rapid tests which screen for the presence of group A streptococci in the throat have been developed.

78

It is beyond the scope of this review to describe the many tests available f or identification of group A streptococci from throat swabs. However, the most rapid tests take 5 to 30 min and use some form of nitrous acid or enzymatic extraction of the group A carbohydrate. Fluorescent-antibody and genetic probe tests can be performed directly on throat swabs but are not easily adapted to the clinical setting. Once extracted, the group A carbohydrate antigen is detected by one of four methods, including slide agglutination, enzyme-linked immunosorbent assay (ELISA), optical immunoassay, and a modified one-step ELISA procedure (Facklam et al., 1997; Koneman et al., 1997).

Serological Diagnosis of Streptococcal Infection (Anti-Streptolysin O, Anti-DNase B, and Other Diagnostic Antibodies) The host responds immunologically to streptococcal infection with a plethora of antibodies against many streptococcal cellular and extracellular components. Host responses against the M protein serotype protect against re-infection with that particular serotype. Routinely, serotype-specific antibodies are measured only for research purposes and not for diagnosis of streptococcal infection. Responses against other cellular components are observed, including antibodies against the cell wall mucopeptide, the group A streptococcal carbohydrate moieties N-acetylglucosamine and rhamnose, and the other protein cell wall antigens R and T. None of the cell wall antigens are used in the routine diagnosis of group A streptococcal infections. Serological diagnosis of group A streptococcal infections is based on immune responses against the extracellular products streptolysin O, DNase B, hyaluronidase, NADase, and streptokinase, which induce strong immune responses in the infected host (Stollerman 1975). Anti-streptolysin O (ASO) is the antibody response most often examined in serological tests to confirm antecedent streptococcal infection (Todd 1932). An increase in the ASO titer of $166 Todd units is generally accepted as evidence of a group A streptococcal infection. In previous studies it has been shown that infants are born with maternal levels of antistreptococcal antibodies and that infants develop streptococcal infections after the first year of life. ASO antibodies may not demonstrate a detectable rise in 1- to 3-year-olds, who have had few previous group A streptococcal infections. At 2 years of age, .50% of the patients had ASO titers of, 50 79

Todd units, and none of the patients had titers above 166 (Markowitz et al., 1972). In the same study, older school-age children developed higher ASO titers. All five of the extracellular streptococcal enzymes may become significantly elevated over normal levels during a streptococcal infection. Although the ASO titer is the standard serological assay for confirmation of a group A streptococcal infection, assay of several of the enzymes enhances the chance for a positive test if the patient did not produce high levels of antibody against one or more of the extracellular enzymes. In general, the titers of antibodies against the extracellular products parallel each other; however, exceptions maybe seen in infections with pyoderma or nephritogenic strains, when the anti-DNase B titers have been found to be a reliable indicator of streptococcal infection (Stollerman 1975). Infection of the skin does not always elicit a strong ASO response. Confirmation of a group A streptococcal infection is imperative for the diagnosis of rheumatic fever, since most often streptococci cannot be cultured from the pharynx. In rheumatic fever, approximately 80% of the patients will have an elevated ASO titer (.200 Todd units) at 2 months after onset (Bisno 1995). If an anti-DNase B or antihyaluronidase assay is performed on sera from these patients, the number of patients with at least one positive antistreptococcal enzyme titer rises to 95%. Thus, most acute rheumatic fever cases demonstrate an elevated ASO titer with some exceptions which require more than one antibody test to detect previous group A streptococcal infection. The streptozyme test was developed some years ago as a hemagglutination assay for the detection of multiple antibodies against extracellular products such as anti-streptolysin O, anti-DNase B, antihyaluronidase, antistreptokinase, or anti-NADase, and it is used clinically in some laboratories as an additional diagnostic test (Bisno 1995). PCR (molecular) approach (M protein, T typing and emm gene) Streptococcal M protein, which extends from the cell membrane of group A streptococci, has been used to divide Streptoccocus pyogenes into serotypes. Quite a number of years ago, Lancefield designed a serotyping system for the identification of the M protein serotypes (Lancefield, 1928). The method consisted of treating group A streptococci grown in Todd-Hewitt broth with boiling 0.1 N HCl. This method extracted the group A carbohydrate, M protein, and cell wall, and the clarified extract was used in capillary precipitin tests to determine the M protein serotype with standardized typing sera. 80

The N-terminal region of the M protein has been demonstrated to contain the type specific moiety and is recognized by specific typing sera in the precipitin test (Beachey, et al., 1976; Fischetti, 1989; Jones et al., 1988; Lancefield 1962). There were several difficulties with M serotyping, including ambiguities in the results, discovery of new M types, difficulty in obtaining high-titered antisera against opacity factor-positive strains, and the availability and high cost of preparing high-titered antisera for all known serotypes. Currently, more than 80 different serotypes of M protein have been identified (Facklam et al., 1997). Because of the difficulty in preparation of M-typing antisera, an alternative to the preparation of M-typing antisera has been developed. Approximately half of group A streptococci produce opacity factor, a lipoproteinase which causes various types of mammalian serum to increase in opacity. Antibodies against the opacity factor are type specific and correlate with the M type. streptococcus can By using an opacity factor inhibition test, the M type of a group A be determined by determining the type of opacity factor

(Widdowson et al., 1970 & 71). The T protein antigen is present at the surface of the group A streptococci along with the M and R protein antigens. Although the genes for the M and T protein (Jones 1944; Schneewind et al., 1990) have been investigated, the R protein sequence has not been elucidated. Although there is homology between tee genes, there is a much greater diversity among them compared with emm genes. Unlike the M protein, the most conserved region appeared to reside in the amino terminal half of the T protein molecule. These observations were made from comparison of 25 different T types (Jones 1944). In addition, the T protein was not present in streptococcal groups C and G. In the laboratory, the T typing assay is performed as an agglutination test. The T typing of group A streptococci has been important in the investigation of epidemiology of group A streptococcal infections and has identified strains associated with outbreaks when the M type was not identifiable. Because certain M and emm types are associated with certain T types, testing for M or emm type can be shortened by knowledge of the T type. Most (95%) group A streptococci have well defined T-type antigens, and certain T serotypes are associated with each of the specific M protein serotypes (Beall et al., 1997 & 98). The use of T typing in addition to emm gene sequence analysis allows the identification of strain diversity. This type of characterization of group A streptococcal isolates is extremely important in the current climate of emerging invasive disease and sequelae. Recently, a 81

molecular biology approach has been developed for the identification of M protein serotypes (Beall et al., 1996). In this study, the emm types of 95 known M serotypes (reference strains) and 74 of 77 clinical isolates were identified by rapid PCR analysis. A nucleotide primer pair was used for amplification and identification of the emm allele. Of the 95 reference strains analyzed, 81 closely matched sequences in GenBank, in general, a good correlation was seen between the known serotype and the identification by emm gene sequencing by the rapid PCR technique. This technique has advantages over hybridization techniques, where problems arise in identification of new genes or hybrid M protein molecules which result from interstrain recombination (Whatmore et al., 1994). Recently, rapid hybridization techniques utilizing emmspecific oligonucleotide probes have been shown to be useful in identification of M protein serotypes (Kaufold et al., 1994). Enzyme electrophoresis polymorphism (Musser et al., 1992; Haase et al., 1994; Bert et al., 1995)., Rapid Amplification of Polymorphic DNA (RAPD) (Sappala et al., 1994)., Restriction Fragment Length polymorphism (RFLP)(Patric et al., 1988; Bingen et al., 1992 ; Desai et al., 1998 & 1999), Vir typing (Gardiner et al., 1995&1996), DNA hybridization using N-terminal sequences of the M protein gene (emm) as oliginucleotide probes (Kaufhold et al., 1994; Penny et al., 1995)., Polymerase Chain Reaction-Enzyme Linked Immunosorbant Assay (PCR-ELISA) (Saunders et al., 1997)., PCR M typing using specific oligonucleotide primers for PCR amplification of N-terminal region of emm gene (Vitali et al., 2002)., Polymerase Chain Reactions-Restriction Fragment Length Polymorphism (PCR-RFLP and it has overcome technical problems such as it only requires one pair of primer and the PCR products can be discriminated using standard PAGE which is easy to perform, interpret and less time consuming. In addition, compared with M protein typing PCR-RFLP is technically less demanding and more economical (Nonglak et al., 2005; Stanley et al., 1996; Dicuonzo et al., 2001; Beall et al., 2001; Perea-Mejia et al., 2002)., Multilocus Sequence Typing (MLST) and can be used on any bacterial analysis (Enright et al., 2001; Urwin et al., 2003)., N-terminal sequencing of the M protein gene (emm), however, is the conclusive method for typing of GAS. Conversely, it is not an option in developing countries laboratories (Beall et al., 1996; Brandt et al., 2001). In addition, various problems have been encountered such as ambiguity in the results, time consuming, discovery of new M types making it hard for M-specific serotype preparation demanding high costs (Facklam et al., 1997)., difficult in obtaining high titered antisera against 82

opacity factor and lipoproteinase which causes various types of mammalian serum to increase in opacity (Widdowson et al., 1970-71).

2.9.2 Vaccination
Therapy of Streptococus pyogenes involves use of Penicillin or Amoxicillin is still uniformly effective in treatment of GAS sequelae and the duration of treatment is well established as being 10 days minimum (Falagas et al., 2008). There is no reported instance of penicillin-resistance reported to date; although since 1985 there have been many reports of penicillin-tolerance (Kim et al., 1985). It is important to identify and treat Group A streptococcal infections in order to prevent sequelae. No effective vaccine has been produced. Certain strains have developed resistance to macrolides, tetracyclines and clindamycin though they may be used if the strain isolated has been shown to be sensitive, but resistance is much more common.

Preventive habits: Educate and create awareness to people. Good hand washing, especially after coughing and sneezing and before preparing foods or eating Diagnosis of patients and if the test result shows strep throat, the person should stay home from work, school, or day care until 24 hours after taking an antibiotic. All wounds should be kept clean and watched for possible signs of infection such as redness, swelling, drainage, and pain at the wound site. A person with signs of an infected wound, especially if fever occurs, should seek medical 83

84

3.0 MATERIALS REQUIRED AND METHODOLOGY

1. Hemolysis 2. Grams staining 3. Catalase test 4. Bacitracin test 5. Amplification of emm gene by PCR

3.1 Hemolysis
Principle The hemolytic reaction is particularly useful in the differentiation of the Streptococci. The hemolytic reaction is determined on agar media containing 5% animal blood. The most commonly used base medium is trypticase soy agar and the most commonly used blood is sheep blood. Other base media may be substituted if control strains of all genera are tested for growth. Sheep blood is used because of the convenience in testing throat swabs for -hemolytic streptococci. Sheep blood does not support the growth of Haemophilus haemolyticus which appears similar to streptococci on agar containing rabbit, horse, or human blood. Materials 1. Inoculum 2. Petri plates 85

3. Laminar chamber 4. Loop 5. Bunsen burner 6. CO2 incubator Reagents Peptone 0.5 g Beef extract 0.5 g NaCl 1 g Agar 1.5 g Distilled water 100 ml pH 7.4 Human blood 5% Procedure 1. Measure the required quantity for preparation of the nutrient agar media. 2. Check the pH 7.4 3. Sterilize the media in autoclave at 121c 15 pounds for 15 minutes 4. When the media has reached hand bearable temperature pour blood 5. Mix gently and pour into the sterile grease free plates 6. Allow for solidification 7. Streak culture for isolation on NBA plate with 5% human blood. 8. Incubate plate at 35C in CO2 for 24 hours.

3.2 Gram Stain

Principle The gram stain is used to differentiate between gram-positive and gram-negative bacteria. Cellular morphology can also be determined. Gram-positive and gram-negative bacteria are both stained by crystal violet. The addition of iodine forms a complex within the cell wall. Addition of a decolourizer removes the stain from gram-negative organisms due to their increased lipid content. These cells are stained pink with the counter stain safranin. 86

Material (Stored at room temperature) 1. Slides 2. Inoculating loop 3. Microscope with Immersion Objective 4. Culture

Reagents 1. Methyl Violet Stain (Huckers ammonium oxalate crystal violet) Crystal violet - 2g Ethyl alcohol- 120ml Dissolve the dye completely Ammonium oxalate - 0.8 g Mix both the solutions 2. Grams Iodine Potassium iodide 2g and dissolved in 10ml of distilled water. Add 1g of iodine and dissolve completely. Make up the volume to 300ml with distilled water. 3. Decolourizer Solution 4. Methanol or ethanol- 95% 5. Safranin 1 g is dissolved in 100ml of distilled water. Procedure 1. Prepare smear by spreading single loop of culture from the nutrient broth to a microscope slide over 1/3 to to the total area of the slide. 2. The smear was set for air drying. 3. The slide was held slightly above the flame for fixation. 4. The bacterial smear was flooded with crystal violet stain and allowed to stand for 1 minute then stain was washed gently off with a stream of cool tap water. 87

5. The smear was covered with grams iodine and allowed to stand for 1 minute. The stain is washed off gently. 6. The bacterial smear was rinsed with decolourizer solution for 10 seconds and gently rinsed with water. 7. The bacterial smear was then covered with safranin stain, and allowed to stand for 1 minute and then the stain washed gently. 8. Blot air-dried with absorbent paper and examined under oil immersion lens.

3.3 Catalase Test

Principal Hydrogen peroxide is used (H 2O2) to determine if the bacteria produce the enzyme catalase. 2 H2O2 2 H2O + O2 (responsible for bubbling)

Materials and Reagents 1. Overnight culture or colony 2. 3% H2O2 (Hydrogen peroxide) 3. Pipette 4. Slides 5. Tubes 6. Overnight cultures or colony that is grown on a blood free media Procedure 1. Flood the growth of the bacteria with 1 ml of 3% hydrogen peroxide (usually on an agar slant but blood free agar plates can be used) or take a slide with colony and pour the reagent. 2. Observe for effervescence.

3.4 Bacitracin Test

Principle 88

The bacitracin disk is sensitivity test used to differentiate the beta- hemolytic Streptococcus. Materials 1. Bacitracin disk 2. Nutrient agar 3. An overnight culture

Procedure 1. Select a beta-hemolytic colony and heavily inoculate a quadrant of a 5% human blood agar 2. Drop the disk in the heaviest zone of inoculation. 3. Tap disk lightly to ensure that it adheres to the agar. 4. Incubate plate overnight in CO2 at 35C.

3.5 emm typing

A. Lysate preparation Principle The DNA purification is generally to homogenize the cells and to isolate the nucleic acid from which the DNA is extracted. The purpose of TE buffer is to protect DNA or RNA from degradation. It is the buffer for storage of DNA and RNA. Removal of proteins from the membrane normally regulates the use of detergent such as the ionic (charged) detergent SDS (which denature the proteins) lyse the nucleic and release DNA which causes the solution viscosity to increase noticeably. The detergent also inhibits any nuclease activity in the preparation. The major goal of subsequent purification step is to separate the DNA from the contaminating materials such as RNA and proteins. Deproteinisation is usually accomplished by shaking the mixture with a volume of phenol. Phenol and chloroform is an active protein denaturant that causes protein preparation etc lose their solubility and precipitation from solutions. 89

The DNA precipitation ammonium acetate and ethanol is used. Ethanol is a hydrating agent. DNA is used by precipitating it. At last ethanol is evaporated and DNA concentration observed. Material required 1. Streptococcus pyogenes culture with Optical density more than 0.7 2. Cooling centrifuge 3. Eppendorff 4. Micropipettes and microtips 5. Distilled water 6. Discarding tray Reagents A. TE buffer 1M Tris Hcl 7.85g 0.1M EDTA 1.86g Distilled water 50 ml B. 10% Sodium dodecyl sulphate (SDS) 1g in 10 ml of distilled water C. Phenol: chloroform at ratio 1:1 D. 3M ammonium acetate E. 70% ethanol pH 8

Protocol
Harvesting Bacterial cells 1.5 ml bacterial culture was taken in 4 eppendorffs Centrifuge at 5000 rpm for 2 minutes at 4c

90

Discard supernatant. Lysis of the cell To the pellet add 460l of TE buffer and 30l of 10% SDS Mix gently Keep it at 37C for one day (overnight).

Deproteinisation To the tube 500l of phenol: chloroform was added ratio 1:1 Centrifuge at 8000 rpm for 10 minutes at 4c Transfer the aqueous phase to a sterile eppendorff tubes DNA precipitation To the aqueous phase add 40l of 3M ammonium acetate and 250l of 70% ethanol Keep for incubation at 37c for 5c

Centrifuge at 10000 rpm for 10 minutes a 4c

Observe the pellet

DNA concentration Airdry the residual with ethanol

91

Suspend the pellet in 10l of TE buffer and store at 4c till use

Quantification of DNA Isolated DNA was quantified by measuring the absorbance at 260nm and at 280nm. The ratio of absorbance was used to determine the quality of the isolated DNA. The concentration was calculated using the following formula (Concentration of DNA= OD260 x 50 x dilution factor=g of DNA/ml) Quantified DNA was diluted to 150 ng/l and used for polymerase chain reactions.

B. Polymerase chain reaction (PCR) PCR stands for Polymerase Chain Reaction, a process to replicate DNA and it was invented by Karry Mullis in 1985 and Noble prize winner in 1993. It allows exponential amplification of short DNA sequences (usually 100 to 600 bases) within a longer double stranded DNA molecule. PCR is extremely a sensitive method as it can detect a single DNA molecule in a sample. PCR makes it possible to quickly and accurately obtain large quantities of DNA needed in carrying out research in molecular biology, in clinical diagnosis, in criminal investigations, forensic analysis and in viral disease research e.g. in the ongoing battle against AIDS. The PCR entails the repetition of a single cycle. Each cycle involves three steps: Template denaturation > 90C Primer annealing 55C to 65C Extension of DNA from annealed primers 68C to 72C Each step is controlled by different incubation temperatures, each cycle results approximately doubling of DNA fragment of interest. The above steps are achieved by incubating the samples at three different temperatures: 92

 The three cycles form a cycle, whereby each cycle should amplify the target DNA sequence two-fold.the amount of amplified product will be 2n number of copies of target DNA, where n is the number of cycles.

Thermal profile Denaturation In the first step, the target DNA is denatured by incubation at 94C. Denaturation of the DNA causes the two strands to separate and remain in solution until the temperature is lowered for the second step. However, if the GC content is extremely high, the denaturation temperature Annealing may need to be raised. During annealing step, the temperature is lowered to 37C to 65C which allows the target DNA and the primers to anneal (hybridize) to complimentary sequences. There is a wide range in temperature at which annealing occurs. This is because the annealing temperature is dependent on the length and the GC Extension content of the primers. The DNA is extended from annealed primers in a 5-3 direction. This step requires the DNA polymerase, the four deoxyribonucleoside triphosphate precursors (dNTPs), and an incubation temperature of about Amplification 68C to 72C.This is the optimal temperature for Taq DNA polymerase The three steps are repeated over and over again for 25-30 cycles until the efficient DNA is significantly produced. Newly synthesized DNA fragments serve as templates for the next cycle which amplifies the template DNA exponentially. Table 3.1 Summary of amplification processes. 93

Ingredients 1. DNA template 2. Primers 3. Taq polymerase 4. dNTPs 5. Buffer 6. Mgcl2

Template DNA: The template DNA is a single-stranded polynucleotide (or a region of polynucleotide) that directs synthesis of a complementary polynucleotide (a specific sequence of the DNA which is amplified). Recommended amount of template DNA Mammalian genomic DNA Bacterial DNA Plasmid DNA Yeast DNA 100-200ng 50-100ng 10-50ng 10ng

Primer (oligonucleotide): Primers are synthetically produced oligonucleotides which are around16-24 bases long. Primes should be chosen very carefully. Poorly chosen primers can lead to amplification of non-target sequences and primer artifacts, such as primer, dimers etc Concentration of primers should be 10 picomoles/reaction. Taq DNA polymerase

94

 The PCR technique was dramatically improved with the introduction of thermostable polymerase, taq DNA polymerase isolated from the thermophilic microorganism, Thermus aquaticus which can grow at temperatures of above 70C Taq DNA polymerase lacks 3-5 exonuclease activity but has 5-3 exonuclease activity and 5-3 polymerase activity. For most amplification reactions, 1-2 units of enzyme is recommended as higher enzyme concentration leads to non-specific amplifications. Deoxynucleotide triphosphatases (dNTPs) They are the major source of phosphate groups in the reaction mixture and any change in their concentration effects concentration of available Mg2+. 10X PCR buffer: (100mM Tris-HCl pH 8, 500mM KCl, 15mM MgCl2 or 25mM MgCl2) MgCl2 All thermo stable DNA polymerase require free divalent cations, usually Mg 2+ which influence enzyme activity and increase Tm (melting temperature) of double stranded DNA. Excess of Mg2+ in the specific reaction can increase non-specific primer binding and increase background of the reaction. Preparation of 1X TAE buffer: Take 20ml of 50X TAE in a measuring cylinder and make up the volume to 1000ml with sterile autoclaved water. Procedure All the components should be kept on ice before setting up of the PCR reaction. To amplify the template DNA, add the following reaction components to a PCR tube in the given order. Place the tube on ice and add enzyme as the last component. 95

Reaction mixture Nuclease free water (deionized water) PCR Assay buffer DNA template Forward primer Reverse primer dNTP mixture Taq DNA polymerase Total reaction volume 10l 10l 30l 10l 10l 10l 10l 90l

Mix the contents gently and carry out amplification using the reaction parameters required. Parameters Initial denaturation - 94C, 2 min Denaturation - 94C, 30sec. Annealing - 58C, 30sec. Elongation - 72C, 1 min 30sec. Number of cycles 29 PCR products are stored at -20C until use

C. Resolution of PCR products on standard agarose gels Materials Electrophoresis buffer(1X TAE) Ethidium bromide solution (0.5mg/ml) Electrophoresis-grade agarose 6X loading buffer DNA molecular weight markers Gel electrophoresis apparatus Gel casting platform Gel combs(slot formers) 96

 DC power supply

Preparation of gel 1. Weigh 260 mg of agarose (0.8%) and dissolve in a mixture of 15ml of distilled water and 15ml of TAE buffer. 2. Boiled at 100- 110c till it becomes a clear liquid (Avoid making bubbles in the molten agarose. This creates electrical seepage during the run which results in deformed DNA banding pattern). 3. Once it becomes a clear liquid it is allowed to cool down to temperature of about 50-60c (hand bearable) 4. 8l ethidium bromide was added (Ethidium is a carcinogen hence should be handled with care). 5. Mix the molten agarose with ethidium bromide. 6. The gel is poured to the platform which has already been covered at the periphery with cellophase tape with the comb for wells formation. 7. Allow it to solidify for 10-15 minutes. 8. Once the solidified agarose is ready remove the cello-tape and keep the agarose platform in the gel tank. 9. Pour the tank buffer 1X TAE (pH 8) 10. Allow the gel to sink in the tank buffer. 11. Keep the wells near the cathode side since the DNA carries negative charge. 12. Take the sample by micropipette 30-40l and fill it gently by pressing the micropipette. 13. Connect the apparatus to DC and run the gel at 50 volts for 40 minutes. 14. By seeing the tracking dye front on the gel, switch off when it has reached th of the agarose. 15. Remove the gel from the platform 16. Observe the gel under UV transilluminator. 97

98

RESULTS AND DISCUSSION

Hemolysis test
Majority of the samples collected from the infected patients were beta-hemolytic as exhibited by complete clearing around the colony and presumptively categorized as GAS.

Gram staining
Gram positive cocci are observed in a form of grape structure showing pairs (tetrads) in chains which are attached to each other. The gram stain aids in the differentiation of the gram positive cocci for negative organisms. The arrangement of the cells is what helps to differentiate the genera. This test confirms GAS nature.

Catalase test
Bubbling was observed which is interpreted as a positive test. Presence of bubbles shows that catalase enzyme is produced which hydrolyses down the hydrogen peroxidase thereby releasing water and oxygen responsible for bubbling confirming presence of GAS nature.

Bacitracin test
Zone of inhibition is seen which is considered a positive test (sensitive test). No organism grows around the bacitracin antibiotic disk. Bacitracin test positivity confirmated GAS strains nature as they are the most sensitive.

Amplification of emm gene and AGE analysis.

99

Single pair of primers was used to amplify the emm gene. The PCR products achieved indicates presence drug resistance GAS. The consistency of the DNA bands strongly indicates same infectious streptococcus since the samples were collected from the same location as opposed from the earlier findings of heterogeneity differing from one place to another. This implication may have significance in aboriginal drug designing for the control of this important pathogen. There is need for drug development to cater the infections, carriers and vaccination. The sequelae is uncertain and more dreadful is the report of flesh eating bacteria in the news media today. The modern and molecular findings especially the emm gene will pave away for drug development and its accuracy is advantageous as the diagnostic tool that can be adopted by the developing nations.

100

101

102

103

104

CONCLUSION
PCR could be a powerful and rapid technique for the confirmation of GAS to manage the problem successfully. The emm gene is a possible candidate for aboriginal drug designing for eradication of GAS. The emm gene analysis also provides information the could determine any heterogeneity due to envinornemtal and biological stresses.

105

106

BIBLIOGRAPHY
Abbas and Lechtman (2004). Immune System. American Academy of Pediatrics. Diagnosis and management of acute otitis media. Pediatrics. May 2004; 113(5):1451-65. Anochie I, Eke F, Okpere A. Childhood acute glomerulonephritis in Port Harcourt, Rivers State, Nigeria. Niger J Med. Apr-Jun 2009; 18(2):162-7. Beall B, Facklam R, Thompson T: Sequencing emm-specific PCR products for routine and accurate typing of group A streptococci. J Clin Microbiol 1996, 34:953-958. Beall B, Facklam RR, Elliott JA, Franklin AR, Hoenes T, Jackson D, Laclaire L, Thomson T, Viswanathan R: Streptococcal emm types associated with T agglutination types and the use of conserved emm gene restriction fragment patterns for subtyping group A streptococci. J Clin Microbiol 2002, 40:278-280. Becquet O, Pasche J, Gatti H, et al. Acute post-streptococcal glomerulonephritis in children of French Polynesia: a 3-year retrospective study. Pediatr Nephrol. Feb 2010; 25(2):275-80. Bert F, Picard B, Lambert-Zechovsky N, Goullet P: Identification and typing of pyogenic streptococci by enzyme electrophoretic polymorphism. J Med Microbiol 1995, 42(6):44251. Bingen E, Denamur E, Lambert-Zechovsky N, Boissinot C, Brahimi N, Aujard Y, Blot P, Elion J: Mother-to-infant vertical transmission and cross-colonization of Streptococcus pyogenes confirmed by DNA restriction fragment length polymorphism analysis. Infect Dis 1992, 165:147-50. Bisno AL (January 2001). "Acute pharyngitis". N Engl J Med 344 (3): 20511. 107 J Basic Immunology: Functions and Disorders of the

Bisno AL, Gerber MA, Gwaltney JM Jr, Kaplan EL, Schwartz RH. Practice guidelines for the diagnosis and management of group A streptococcal pharyngitis. Infectious Diseases Society of America. Clin Infect Dis. Jul 15 2002; 35(2):113-25. Bisno AL: Group A streptococcal infections and acute rheumatic fever. N Engl J Med 1991, 325:783-793. Brandt CM, Spellerberg B, Honscha M, Truong ND, Hoevener B, Lutticken R: Typing of Streptococcus pyogenes strains isolated from throat infections in the region of Aachen, Germany. Infection 2001, 29:163-165. Chopra P, Gulwani H. Pathology and pathogenesis of rheumatic heart disease. Indian J Pathol Microbiol. Oct 2007; 50(4):685-97. Chun LT, Reddy DV, Yamamoto LG. Rheumatic fever in children and adolescents in Hawaii. Pediatrics. Apr 1987; 79(4):549-52. Courtney HS, Ofek I, Hasty DL. M protein mediated adhesion of M type 24 Streptococcus pyogenes stimulates release of interleukin-6 by HEp-2 tissue culture cells. FEMS Microbiol Lett. Jun 1 1997; 151(1):65-70. Cunningham MW. Pathogenesis of group A streptococcal infections. Clin Microbiol Rev. Jul 2000; 13(3):470-511. Davies HD, McGeer A, Schwartz B. Invasive group A streptococcal infections in Ontario, Canada. Ontario Group A Streptococcal Study Group. N Engl J Med. Aug 22 1996; 335(8):547-54. Davis JP, Chesney PJ, Wand PJ. Toxic-shock syndrome: epidemiologic features, recurrence, risk factors, and prevention. N Engl J Med. Dec 18 1980; 303(25):1429-35. Demers B, Simor AE, Vellend H. Severe invasive group A streptococcal infections in Ontario, Canada: 1987-1991. Clin Infect Dis. Jun 1993; 16(6):792-800;discussion 801-2. Desai M, Efstratiou A, George R, Stanley J: High-resolution genotyping of Streptococcus pyogenes serotype M1 isolates by fluorescent amplified-fragment length polymorphism analysis. J Clin Microbiol 1999, 37(6):1948-1952. Desai M, Tanna A, Wall R, Efstratiou A, George R, Stanley J: Fluorescent amplifiedfragment length polynorphism analysis of an outbreak of group A streptococcal invasive disease. J Clin Microbiol 1998, 36(11):3133-3137. 108

Dicuonzo G, Gherardi G, Lorino G, Angeletti S, De Cesaris M, Fiscarelli E, Bessen DE, Beall B: Group A streptococcal genotypes from pediatric throat isolates in Rome, Italy. J Clin Microbiol 2001, 39:1687-1690. Digenea AS, Ayoub EM. Guidelines for the diagnosis of rheumatic fever: Jones criteria update 1992. Circulation 87. Circulation. 1993; 87:302. Dong H, Xu G, Li S, et al. Beta-haemolytic group A streptococci emm75 carrying altered pyrogenic exotoxin A linked to scarlet fever in adults. J Infect. Apr 2008; 56(4):261-7. Dwight R. Johnson, Edward L. Kaplan, Amy VanGheem, Richard R. Facklam and Bernard Beall. Characterization of group A streptococci (Streptococcus pyogenes): correlation of M-protein and emm-gene type with T-protein agglutination pattern and serum opacity factor. Ellies E, Valle F, Mari A, Silva S, Bauriaud R, Fourcade O, et al. [Toxic shock syndrome consecutive to the presence of vaginal tampon for menstruation regressive after early haemodynamic optimization and activated protein C infusion]. Ann Fr Anesth Reanim. Jan 2009; 28(1):91-5. Enright MC, Spratt BG, Kalia A, Cross JH, Bessen D: Multilocus sequence typing of Streptococcus pyogenes and the relationships between emm type and clone. Infection and Immunity 2001, 69(4):2416-2427. Eriksson BK, Andersson J, Holm SE. Epidemiological and clinical aspects of invasive group A streptococcal infections and the streptococcal toxic shock syndrome. Clin Infect Dis. Dec 1998; 27(6):1428-36. Facklam, R. R. 1997. Screening for streptococcal pharyngitis: current technology. Infect. Med. 14:891898. 171. Fast, D. J., P. M. Schlievert, and R. D. Nelson. 1989. Toxic shock syndromeassociated. Fischetti VA: Streptococcal M protein: molecular design and biological behavior. Clin Microbiol Rev 1989, 2:285-314. Fraser JD, Proft T. The bacterial superantigen and superantigen-like proteins. Immunol Rev. Oct 2008; 225:226-43. Gardiner D, Hartas J, Currie B, Mathews JD, Kemp DJ, Sriprakash KS: Vir typing: a long-PCR typing method for group A streptococci. PCR Methods Appl 1995, 4:288-293. 109

Gardiner DL, Sriprakash KS: Molecular epidemiology of impetiginous group A streptococcal infections in aboriginal communities of northern Australia. Microbiol 1996, 34:1448-1452. Gaston DA, Zurowski SM. Arcanobacterium haemolyticum pharyngitis and exanthem. Three case reports and literature review. Arch Dermatol. Jan 1996; 132(1):61-4. Gomez-Carrasco JA, Lassaletta A, Ruano D. [Acute hepatitis may form part of scarlet fever]. An Pediatr (Barc). Apr 2004; 60(4):382-3. Graziella O, Roberto N, Christina VH. Nevio Cimolai, ed. Laboratory Diagnosis of Bacterial Infections. Informa Healthcare; 2001:258. Guidelines for the diagnosis of rheumatic fever. Jones Criteria, 1992 update. Committee on Rheumatic Fever, Endocarditis, and Kawasaki Disease of the Council. on Cardiovascular Disease in the Young, the American Heart Association; JAMA 1992 Oct 21; 268(15):2069-73. Guilherme L, Ramasawmy R, Kalil J. Rheumatic fever and rheumatic heart disease: genetics and pathogenesis. Scand J Immunol. Aug-Sep 2007; 66(2-3):199-207. Haase AM, Melder A, Mathews JD, Kemp DJ, Adams M: electrophoresis. Epidemiol Infect 1994, 113(3):455-62. Jones TD. Diagnosis of rheumatic fever. JAMA. 1944; 126:481-85. Kaufhold A, Podbielski A, Baumgarten G, Blokpoel M, Top J, Schouls L: Rapid typing of group A streptococci by the use of DNA amplification and non-radioactive allelespecific oligonucleotide probes. FEMS Microbiol Lett 1994, 119:19-25. Kihiczak GG, Schwartz RA, Kapila R. Necrotizing fasciitis: a deadly infection. J Eur Acad Dermatol Venereol. Apr 2006; 20(4):365-9. Kim KS, Kaplan EL (1985). "Association of penicillin tolerance with failure to eradicate group A streptococci from patients with pharyngitis". J Pediatr 107 (5): 6814. Kumar, Vinay; Abbas, Abul K.; Fausto, Nelson and Mitchell, Richard N. (2007). Robbins Basic Pathology (8th ed). Saunders Elsevier. pp. 403-406 ISBN 978-1-41602973-1. Clonal diversity of Streptococcus pyogenes within some M-types revealed by multilocus enqyme J Clin

110

Lappin E, Ferguson AJ. Gram-positive toxic shock syndromes. Lancet Infect Dis. May 2009; 9(5):281-90. Leslie DL, Kozma L, Martin A, et al. Neuropsychiatric Disorders Associated With Streptococcal Infection: A Case-Control Study Among Privately Insured Children. J Am Acad Child Adolesc Psychiatry. Aug 21 2008. Maltezou HC, Tsagris V, Antoniadou A, Galani L, Douros C, Katsarolis I, et al. Evaluation of a rapid antigen detection test in the diagnosis of streptococcal pharyngitis in children and its impact on antibiotic prescription. J Antimicrob Chemother. Sep 30 2008; Marijon E, Ou P, Celermajer DS, et al. Prevalence of rheumatic heart disease detected by echocardiographic screening. N Engl J Med. Aug 2 2007; 357(5):470-6. Matsuda Y, Kato H, Ono E, Kikuchi K, Muraoka M, Takagi K, et al. Diagnosis of toxic shock syndrome by two different systems; clinical criteria and monitoring of TSST-1reactive T cells. Microbiol Immunol. Nov 2008; 52(11):513-21. McCaig LF, Besser RE, Hughes JM. Trends in antimicrobial prescribing rates for children and adolescents. JAMA. Jun 19 2002; 287(23):3096-102. Minich LL, Tani LY, Pagotto LT, Shaddy RE, Veasy LG. Doppler echocardiography distinguishes between physiologic and pathologic "silent" mitral regurgitation in patients with rheumatic fever. Clin Cardiol. Nov 1997; 20(11):924-6. Morgan WR, Caldwell MD, Brady JM, Stemper ME, Reed KD, Shukla SK. Necrotizing fasciitis due to a methicillin-sensitive Staphylococcus aureus isolate harboring an enterotoxin gene cluster. J Clin Microbiol. Feb 2007; 45(2):668-71. Musser JM, Gray BM, Schlievert PM, Pichichero ME: Streptococcus pyogenes pharyngitis: characterization of strains by multilocus enzyme genotype, M and T protein serotype, and pyrogenic exotoxin gene probing. J Clin Microbiol 1992, 30(3):600-603. Musser JM, Hauser AR, Kim MH, Schlievert PM, Nelson K, Selander RK. Streptococcus pyogenes causing toxic-shock-like syndrome and other invasive diseases: clonal diversity and pyrogenic exotoxin expression. Proc Natl Acad Sci USA. Apr 1 1991; 88(7):2668-72.

111

National Center for Immunization and Respiratory Diseases: Division of Bacterial Diseases. Group A Streptococcal (GAS) Disease. April 3, 2008. Odd J, Fishaut M, Kapral F. Toxic-shock syndrome associated with phage-group-I Staphylococci. Lancet. Nov 25 1978; 2(8100):1116-8. Olsen RJ, Sitkiewicz I, Ayeras AA, et al. Decreased necrotizing fasciitis capacity caused by a single nucleotide mutation that alters a multiple gene virulence axis. Proc Natl Acad Sci U S A. Jan 12 2010; 107(2):888-93. Patric Cleary P, Kaplan EL, Livdahl C, Skjold S: DNA fingerprints of Streptococcus pyogenes are M type specific. J Infect Dis 1988, 158(6):1317-1323. Penney TJ, Martin DR, Williams LC, de Malmanche SA, Bergquist PL: A single emm gene-specific oligonycleotide probe does not recognise all members of the Streptococcus pyogenes M type 1. FEMS Microbiol Lett 1995, 130(23):145-9 Perea-Mejia LM, Inzunza-Montiel AE, Cravioto A: Molecular characterization of group A Streptococcus strains isolated during a scarlet fever outbreak. J Clin Microbiol 2002, 40:278-280. Pickering LK, et al. 2009 Red Book: Report of the Committee on Infectious Diseases. 28th ed. Elk Grove Village, IL: American Academy of Pediatrics; 2009: 616628. Pruksakorn S, Sittisombut N, Phornphutkul C, Pruksachatkunakorn C, Good MF, Brandt E: Epidemiological analysis of non-M-typeable group A Streptococcus isolates from a Thai population in northern Thailand. J Clin Microbiol 2000, 38:1250-1254. Sandrini J, Beucher AB, Kouatchet A, Lavigne C. [Scarlet fever with multisystem organ failure and hypertrophic gastritis]. Rev Med Interne. May 2009; 30(5):456-9. Sanz JC, Bascones Mde L, Martin F, Saez-Nieto JA. [Recurrent scarlet fever due to recent reinfection caused by strains unrelated to Streptococcus pyogenes]. Enferm Infecc Microbiol Clin. Jun-Jul 2005; 23(6):388-9. Saunders NA, Hallas G, Gaworzewska ET, Metherell L, Efstratiou A, Hookey JV, George RC: PCR-enzyme-linked immunosorbent assay and sequencing as an alternative to J Clin Microbiol 1997, serology for Mantigen typing of Streptococcus pyogenes. 35:2689-2691. 112

Schroeder BM. Diagnosis and management of group A streptococcal pharyngitis. Am Fam Physician. Feb 15 2003; 67(4):880, 883-4. Sendi P, Johansson L, Dahesh S, et al. Bacterial phenotype variants in group B streptococcal toxic shock syndrome. Emerg Infect Dis. Feb 2009; 15(2):223-32. Seppala H, Qiushui H, Osterblad M, Huovinen P: Typing of group A streptococci by random amplified polymorphic DNA analysis. J Clin Microbiol 1994, 32(8):1945-1948. Shands KN, Schmid GP, Dan BB. Toxic-shock syndrome in menstruating women: association with tampon use and Staphylococcus aureus and clinical features in 52 cases. N Engl J Med. Dec 18 1980; 303(25):1436-42. Soni A. Ear Infections (Otitis Media) in Children (0-17): Use and Expenditures, 2006. Rockville, MD: Agency for Healtcare Research and Quality; December 2008. Stanley J, Desai M, Xerry J, Tanna A, Efstratiou A, George R: Highresolution genotyping elucidates the epidemiology of group A streptococcus outbreaks. J Infect Dis 1996, 174:500-506. Stanley J, Linton D, Desai M, Efstratiou A, George R: Molecular subtyping of prevalent M serotypes of Streptococcus pyogenes causing invasive disease. J Clin Microbiol 1995, 33(11):2850-2855. Steven J Parrillo, DO, FACOEP, FACEP. "eMedicine Rheumatic Fever". Retrieved 2007-07-14. Stevens DL, Tanner MH, Winship J. Severe group A streptococcal infections associated with a toxic shock- like syndrome and scarlet fever toxin A. N Engl J Med. Jul 6 1989;321(1):1-7. Stevens DL. Invasive group A streptococcus infections. Clin Infect Dis. Jan 1992; 14(1):2-11. Stevens DL. The toxins of group A streptococcus, the flesh eating bacteria. Immunol Invest. Jan-Feb 1997; 26(1-2):129-50. Stevens DL. Streptococcal toxic-shock syndrome: spectrum of disease, pathogenesis, and new concepts in treatment. Emerg Infect Dis. Jul-Sep 1995; 1(3):69-78.

113

Tang WM, Ho PL, Yau WP, Wong JW, Yip DK. Report of 2 fatal cases of adult necrotizing fasciitis and toxic shock syndrome caused by Streptococcus agalactiae. Clin Infect Dis. Oct 2000; 31(4):E15-7. Teele DW, Klein JO, Rosner B. Epidemiology of otitis media during the first seven years of life in children in greater Boston: a prospective, cohort study. J Infect Dis. Jul 1989; 160(1):83-94. Vitali LA, Zampaloni C, Prenna M, Ripa S: PCR m typing: a new method for rapid typing of group a streptococci. J Clin Microbiol 2002, 40:679-681. Wen YK, Chen ML. The significance of atypical morphology in the changes of spectrum of postinfectious glomerulonephritis. Clin Nephrol. Mar 2010; 73(3):173-9. WHO. Rheumatic Fever and Rheumatic Heart Disease. 2004. WHO technical report series. Wong W, Morris MC, Zwi J. Outcome of severe acute post-streptococcal glomerulonephritis in New Zealand children. Pediatr Nephrol. May 2009; 24(5):1021-6. Yoshinoya S, Pope RM. Detection of immune complexes in acute rheumatic fever and their relationship to HLA-B5. J Clin Invest. Jan 1980; 65(1):136-45.

114

Erick Nyakundi Ondari was born in 1987 and is a native and resident of Nyamira, Nyanza, Kenya. He received his high school education in the year of 2005 from Sameta High School, Box 500 Kisii, Kenya. He achieved his Diploma programs in Medical Laboratory Technology and Computer Applications respectively in 2007 and 2009 and on the same year, he obtained a Bachelor of Science degree in Biotechnology from KSR Arts and Science College Tiruchengode, Periyar University, Salem 636-011 Tamilnadu, India. In the fall of 2009, Erick enrolled M.Sc. Biotechnology at AVS Arts and Science College Periyar University in Salem, and M.Sc. Psychology Tamilnadu University, Tamilnadu, India. He is currently pursuing Master of Science in Biotechnology and M.Sc. Psychology alongside P.G. Diploma in Bioinformatics. Upon receiving his M.Sc., Erick plans to expand his knowledge in the field of molecular biology and medical microbiology by enrolling in a Ph.D. program and other related programs in order to realize his dreams in the developed countries. His main interests focuses on molecular biology and biomedicine. During his spare time he enjoys reading novels, writing, watching movies and listening music and adventure to meet new friends. His long vision aspiration is to educate the sciences by opening research centre to benefit the underprivileged and all mankind regarding our motherland.

115

This earth is His, to Him belong those vast and boundless skies;Both seas within Him rest, and yet in that small pool He lies.

Believes in positive thinking for destiny, Beautiful hands are those that do Work that is earnest and brave and true, Moment by moment all The long day through. 116

117