Вы находитесь на странице: 1из 21

GUA DE ESTUDIO N 1: GENTICA MOLECULAR

Profesor David Santibez Gmez

I.

En busca del soporte fsico de la herencia

Si bien el perodo entre principios de siglo y la Segunda Guerra Mundial (1900 a 1940) ha sido considerado la edad de oro de la gentica, los cientficos an no haban determinado que, en el ADN y no en las protenas, se encontraba el material hereditario. Sin embargo en esa poca se realizaron muchos descubrimientos genticos y se estableci la relacin entre gentica y evolucin. El ADN fue aislado por Friedrich Miescher en 1869 de esperma de salmn y de pus de heridas abiertas. Dado que la encontr solamente en los ncleos, Miescher denomin a este compuesto nuclena. Posteriormente se lo cambi a cido nucleico y por ltimo a cido desoxirribonucleico (ADN). Robert Feulgen, en 1914, describi un mtodo para revelar por tincin el ADN, basado en el colorante fucsina. Se encontr, utilizando este mtodo, la presencia de ADN en el ncleo de todas las clulas eucariotas, especficamente en los cromosomas. Durante los aos 20, el bioqumico P.A. Levene analiz los componentes del ADN. Encontr que contena cuatro bases nitrogenadas: citosina, timina, adenina, y guanina; el azcar desoxirribosa; y un grupo fosfato. El concluy que la unidad bsica (nucletido) estaba compuesta de una base pegada a un azcar y que el fosfato tambin estaba pegado al azcar y, lamentablemente tambin concluy errneamente que las bases estaban en cantidades iguales y, que un tetranucletido era la unidad repetitiva de la molcula. Sin embargo queda su idea de la estructura del nucletido el cual es realmente la unidad fundamental (monmero) del cido nucleico (polmero). Existen cuatro nucletidos que integran el ADN: uno con citosina (C), uno con guanina (G), uno con adenina (A), y uno con timina (T), y se muestran aqu tal como se organizan al interior de la molcula de ADN, como monofosfatos de adenosina, timina, guanina y citosina.

Figura 1. Nucletidos del ADN A comienzo "del ao 1900", el estudio de la gentica comienza a dar frutos: la relacin entre el trabajo de Mendel y el de los bilogos celulares result en la teora cromosmica de la herencia; Garrod propuso la relacin entre los "errores innatos del metabolismo" y los genes. La pregunta qued planteada: que es un gen? . El fenmeno de la transformacin bacteriana: una pista hacia el ADN En 1928, un bacterilogo britnico llamado Frederick Griffith intentaba desarrollar una vacuna contra el neumococo, la bacteria causante de la neumona. Este investigador trabaj con dos cepas para este propsito: una de las cepas forma colonias lisas y cada bacteria est encapsulada por una cubierta de naturaleza glucosdica. La otra cepa forma colonias rugosas y las clulas carecen de cpsula envolvente. La presencia o ausencia de cpsula es un rasgo hereditario. Lo ms curioso en el trabajo de Griffith era el hecho de que las bacterias encapsuladas causaban la muerte a las ratas a las cuales se les inyectaba. Las bacterias de tipo "sin cpsula" no les causaban dao. 1 Figura 2. Experimento de Griffith

Un resultado inslito se produjo cuando las ratas fueron inyectadas con una mezcla de neumococo sin cpsula y con neumococo encapsulados, estos ltimos muertos por accin del calor. Las ratas enfermaron y murieron, y lo ms sorprendente de todo fue que de las ratas muertas se recuperaron bacterias vivas encapsuladas. Griffith explic el fenmeno de la "transformacin bacteriana" afirmando que "algo" de las clulas encapsuladas muertas haba convertido a las clulas inofensivas vivas, en clulas encapsuladas vivas; y este algo pasaba de generacin en generacin. En 1943, un grupo de cientficos norteamericanos que trabajaba en el Instituto de Investigaciones Mdicas Rockefeller de Nueva York, investig la causa de la transformacin bacteriana. Los cientficos Oswald T. Avery, Colin Mac Leod y Maclyn McCarty reprodujeron los experimentos de Griffith en "tubos de ensayo", usando slo bacterias, sin ratones. Sus observaciones permitieron, en primer lugar, demostrar que extractos de bacterias encapsuladas muertas, agregados a cultivos de bacterias inocuas vivas, convertan a estas ltimas en la forma virulenta con la propiedad de elaborar la cpsula. Como se podra esperar, estos extractos celulares contenan una gran variedad de sustancias como polisacridos, protenas, lpidos, cido ribonucleico (ARN) y cido desoxirribonucleico (ADN). Cul de todos ellos era el "principio transformador" causante de la transformacin bacteriana? Si el principio transformador es el ADN, qu propiedad hay que atribuir a esta sustancia considerando el experimento de Griffith? El experimento de Hershey y Chase A pesar del cuidadoso trabajo de Oswald T. Avery y colaboradores en la identificacin del ADN como material gentico, muchos bilogos no aceptaron el hecho de que este cido nucleico pudiera contener la compleja informacin gentica. As, hasta los comienzos de los aos cincuenta (1950) muchos todava continuaban creyendo que las protenas podran ser el material gnico. En 1952, los genetistas Alfred Hershey y Martha Chase, del Instituto Carnagie, efectuaron una serie de experimentos que demostraran, en forma concluyente, que el material de los genes es el ADN. Estos investigadores trabajaron con la bacteria intestinal Escherichia coli y un cierto tipo de virus denominados bacterifagos (fagos en forma abreviada). Estos virus infectan y destruyen a las clulas de E. coli. Se saba que los bacterifagos tenan una forma definida, y en particular, que estaban compuestos slo por una envoltura proteca y ADN. Era conocido, adems, el modo como los fagos invaden a las bacterias, adhirindose a la clula bacteriana y luego de alrededor de 25 minutos, la bacteria explota, liberando cientos de nuevos bacterifagos. Adems, este equipo de investigadores tena un dato muy interesante: conoca que el ADN contiene fsforo, mientras que las protenas no lo tienen. Por otra parte, las protenas contienen azufre, en tanto que el ADN no. Hershey y Chase "marcaron" a los virus con material radiactivo para seguir sus huellas. Los bacterifagos cultivados en un medio con fsforo radiactivo, incorporaron el elemento radioactiva, exclusivamente en el ADN, porque slo ste contiene tomos de fsforo. Luego, cuando se permiti que bacterifagos "radiactivos" infectaran a bacterias no radiactivas, stas se hicieron radiactivas. Dado que es el ADN la sustancia que penetra en la clula, es tambin el material gentico.

II.

La estructura qumica del ADN

Aunque los experimentos de Hershey y Chase demostraron que el material gnico es el ADN, la estructura molecular de esta molcula todava era un misterio. El anlisis bioqumico, sin embargo, haba revelado que: 1. La molcula de ADN est compuesta por tres sustancias qumicas diferentes: Una pentosa (azcar con 5 carbonos): la desoxirribosa. Un grupo fosfato. Cuatro bases nitrogenadas: adenina (A), guanina (G), citosina (C) y timina (T). 2. Estos componentes bsicos de la molcula de ADN se unen formando unidades llamadas "nucletidos". Cada nucletido se forma, entonces, por una pentosa (desoxirribosa), un grupo fosfato y una base nitrogenada. Como hay cuatro bases nitrogenadas se pueden formar cuatro tipos de nucletidos. 2

3. Estos nucletidos pueden unirse entre s para formar largas cadenas de polinucletidos. 4. Las proporciones de las cuatro bases nitrogenadas son constantes en todos los tipos celulares en un organismo individual. 5. Las proporciones de las bases nitrogenadas tambin son constantes en una determinada especie. 6. Las proporciones de adenina son iguales a las de timina, y las proporciones de guanina son iguales a las de citosina. (A=T y G=C) El modelo de la rnolculo de ADN: Watson y Crick (1953) En 1953, James D. Watson y Francis H.C. Crick, dos cientficos que trabajaban en la Universidad de Cambridge, Inglaterra, propusieron el modelo que hoy se acepta para la estructura de la molcula de ADN, sobre la base de todos los datos disponibles. Las principales caractersticas de la molcula de ADN, de acuerdo con el modelo Watson - Crick, se pueden resumir en los siguientes puntos: 1. La molcula se compone de dos barras torcidas entre s, configurando una doble hlice. 2. Cada barra se compone de una cadena de nucletidos, las que se disponen de manera antiparalela, es decir, una cadena va en direccin 5' 3' y la otra 3' 5'. 3. Los nucletidos de cada barra se unen entre s por los grupos fosfatos. 4. Las cuatro bases nitrogenadas se encuentran apareadas con slo dos posibles combinaciones: A =T y G = C. 5. Las bases nitrogenadas estn unidas entre s por dbiles enlaces de hidrgeno, los que son fciles de romper. 6. Como la secuencia de nucletidos es el nico elemento variable en la molcula, es evidente que debe ser tambin la propiedad que se utiliza para codificar las instrucciones genticas.

Figura 3: Modelo de la molcula de ADN de Watson y Crick; A: detalle en que se muestra la disposicin de los nucletidos formando enlaces de hidrgeno entre los pares de bases (flecha); B: esquema ms general, en que se muestra la organizacin general de las dos fibras antiparalelas; C: morfologa general de la molcula de ADN, la doble hlice.

III.

El flujo de la informacin gnica

En los aos veinte se encontr una molcula similar al ADN, tambin un cido nucleico, que tena unidades similares pero con diferencias en el azcar y en una de sus bases nitrogenadas, que se llam cido ribonucleico (ARN). Esta molcula apareca en mayor concentracin en aquellas clulas que mostraban una alta actividad de sntesis de protenas. Lo interesante del ARN era que a diferencia del ADN exclusivamente nuclear, pareca encontrarse tanto en el ncleo como en el 3 Figura 4

citoplasma de la clula. Teniendo presente que las protenas se sintetizan justamente en el citoplasma, se postul que podra servir de mediador entre el ADN y la sntesis proteica. En base a esta hiptesis, un grupo de investigadores ide un experimento que aprovecha la composicin particular que tiene el ARN: en vez de la base nitrogenada timina, posee uracilo. En el experimento se incubaron clulas con uracilo marcado radiactivamente con tritio (un istopo del hidrgeno) durante 60 minutos, lo que se llama "un pulso". Luego de retirar el nucletido radiactivo, se reemplaz con uracilo normal, incubando por dos horas ms. Las clulas se observaron mediante autoradiografa, una tcnica que permite localizar marcas radiactivas, en dos momentos: inmediatamente tras el pulso radiactivo y luego de las dos horas de incubacin con los nucletidos normales. En la figura 4 se muestran los resultados. Tal como muestran las autoradiografas, el uracilo (y por tanto el ARN) migra desde el ncleo hacia el citoplasma. Con esto se confirma la posibilidad que el ARN sirve de intermediario entre el gen del ADN y la sntesis de protenas. Con posterioridad, a esta molcula se le llam ARN mensajero o ARNm. De esta manera, el flujo de la informacin gnica se podra representar de la siguiente manera: Figura 5. El modelo de la accin gnica: el dogma central de la biologa molecular: El ADN contiene la informacin gentica en forma de un cdigo de cuatro letras (A,T,G,C) Un tipo de cido ribonucieico llamado ARN mensajero toma esta informacin de la molcula de ADN (transcripcin) y la transporta hasta los ribosomas. C. En estos organelos el mensaje portado por el ARN mensajero es traducido expresndose en forma de polipptidos (traduccin). El modelo de la accin gnica, esquematizado en la figura 5, llamado el dogma central de la biologa molecular, contiene varias ideas importantes que es necesario subrayar. El ADN controla el fenotipo de cada individuo a travs de la formacin de protenas que actan desencadenando las reacciones bioqumicas propias de la especie a la que pertenece el ADN. La formacin de determinada protena implica la ordenacin de los aminocidos que la constituyen en una secuencia determinada. La informacin codificada en la molcula de ADN se transmite al ARN mensajero (transcripcin) que la lleva al sitio de sntesis proteicas (ribosomas). Una vez en los ribosomas, el cdigo es traducido fielmente, formndose la protena indicada (traduccin). Observa cuidadosamente la figura 6 que seguramente te resulta familiar. Ella te permitir relacionar el proceso de transcripcin y traduccin con las estructuras celulares en que ocurren (temas tratados en 2 medio). Transcripcin del cdigo Conocido el flujo de la informacin gnica, explicaremos ahora cmo de produce el proceso de transcripcin ADN ARN y luego cmo el ARN es ledo para fabricar protenas especficas. La formacin del ARNm, a partir de la molcula de ADN, empieza cuando sta se abre y, sobre una de las dos bandas, se va construyendo la barra nica del ARN m. Este proceso de transcripcin est catalizado por una enzima, la ARN polimerasa y empieza precisamente cuando esta enzima se combina con una porcin de la molcula de ADN conocida como promotor. Luego continua con el "apareamiento" de las bases complementarias: guanina con citosina; adenina con timina; y uracilo frente a adenina. El Figura 7. producto de la transcripcin Transcripcin 4

AR Nm

Figur a6

es el ARNm que deja el ncleo y transporta la informacin al citoplasma, especficamente, a los ribosomas donde tiene lugar a traduccin del cdigo. Traduccin del cdigo En 1908, el mdico ingls sir Archibald Garrod dict una serie de conferencias en las que estableca un nuevo concepto de las enfermedades humanas que denomin "errores innatos del metabolismo". Se adelant en casi medio siglo al postular que ciertas enfermedades, debido a la incapacidad del organismo para realizar determinados procesos qumicos, son hereditarias. Garrod estudi la enfermedad llamada alcaptonuria; en ella los enfermos excretan un compuesto llamado cido homogentsico que vuelve oscura a la orina. Este compuesto puede generar problemas visuales y artritis. Garrod supuso que las vctimas de esta enfermedad excretaban esta sustancia debido a que la reaccin enzimtica necesaria para transformarla estaba bloqueada. El doctor Garrod fue el primero en sugerir que los genes y las enzimas estaban relacionados y, por lo tanto, que los genes estaban ligados a las reacciones qumicas del organismo. En la dcada 1940-1950, G.W. Beadle y E.L. Tatum de la Stanford University, en California, trataron esporas de un hongo Neurospora con rayos X o rayos ultravioleta para ver si las esporas expuestas a la accin de estos agentes haban mutado de algn modo. Estos investigadores mostraron particular inters por comprobar si la capacidad de sintetizar sustancias haba sufrido alteracin. Sobre la base de los resultados experimentales, Beadle y Tatum propusieron la teora "un gen - una enzima", conocida en la actualidad como teora "un gen - un polipptido". Esta postula que los genes ejercen su accin controlando la formacin de polipptidos. Al considerar la accin gnica que controla el fenotipo de los individuos segn los descubrimientos mencionados, conviene preguntarse de qu manera el ADN controla y regula la sntesis proteica. Para abordar esta pregunta es necesario recordar los siguientes hechos: a) Las protenas son molculas que desempean mltiples y tiles funciones en nuestro organismo. Son necesarias para el crecimiento y reparacin de tejidos daados, incluyendo la cicatrizacin de Figura 8. Modelos 3D de heridas, reparacin de la piel y elaboracin de cuatro protenas anticuerpos. Las protenas son importantes componentes de todas las membranas celulares y funcionan como molculas transportadoras y receptoras. Otras protenas, fuera de la clula, como el colgeno y la elastina, proporcionan al tejido conjuntiva su resistencia, ayudando as a soportar todo el cuerpo. Un grupo amplio e importante de protenas acta como enzimas, algunas de las cuales funcionan extracelularmente, en tanto que muchas otras actan en el interior de las clulas. b) Las protenas son molculas complejas compuestas por secuencias determinadas de aminocidos. Existe una veintena de aminocidos que pueden combinarse en innumerables formas, constituyendo protenas de variada estructura (Ver figura 8) c) Los genes controlan la sntesis de protenas. Qu es exactamente un gen? Un gen es un segmento de una molcula de ADN que lleva la informacin gentica codificada para la sntesis de una protena particular. d) Un gen debe portar un cdigo para que se puedan unir ciertos aminocidos en una secuencia determinada. Un cdigo es un sistema de smbolos utilizados para transferir informacin de una forma a otra. El lenguaje escrito es un tipo de cdigo inventado por el hombre para expresar ideas y comunicarse entre s. Nuestro abecedario consta de 28 smbolos, que son las letras; con ellas se pueden formar muchas palabras, simplemente, combinndolas. Evidentemente, cualquier persona que desconozca el cdigo representado por el abecedario del idioma castellano es incapaz de interpretarlo. La mayor parte de las palabras se forman con 2 ms letras. Por ejemplo pala, casa, casado, ramo. Palabras diferentes se pueden construir a partir de las mismas letras con una simple reordenacin. As tenemos: pala/lapa, casa/saca, casado/sacado, ramo/amor. El trabajo realizado para descifrar el cdigo gentico ha sido uno de los captulos ms interesantes en la historia de la investigacin biolgica. En 1961, Marshall W. Nirenberg y J. Heinrich Matthaei que investigaban en el Instituto Nacional de Salud de Bethesda, Mariland, realizaron exitosamente los primeros experimentos tendientes a averiguar qu secuencia de bases codifican cada uno de los 20 aminocidos.

El problema de fondo con la sntesis de protenas es que se trata de construir secuencias de polmeros de 20 tipos de aminocidos distintos a partir de un plano entregado por el ARNm que posee secuencias de slo 4 tipos de bases nitrogenadas. Evidentemente no puede existir una relacin uno a uno entre bases nitrogenadas y aminocidos, sencillamente porque slo hay 4 bases para 20 aminocidos. Si, por el contrario, la "traduccin" se hiciera a partir de pares de bases nitrogenadas, las combinaciones posibles seran: AA, AT, AC, AG, TT, TA, TC, TG, CC, CT, CA, CG, GG, GT, GA, GC = 16 combinaciones. Es decir, tampoco sera posible pues an sera necesario traducir otros 4 aminocidos. Finalmente, si se usan tros o tripletes de bases nitrogenadas, como por ejemplo, AAA, ATC, CGT, etc. las combinaciones posibles sobrepasan ampliamente los 20 aminocidos que debe codificarse. En efecto, los 20 aminocidos estn representados en el cdigo gentico por la agrupacin de tres letras (triplete) de las cuatro existentes. Si uno considera las posibilidades de arreglo de cuatro letras Figura 9 agrupadas de a tres resulta que tenemos 64 posibilidades de palabras a codificar, o 64 posibles codones (secuencias de tres bases en el ARNm que codifica para un aminocido especfico o una secuencia de control). El cdigo gentico se descubri en base a experimentos como el siguiente. Se fabric un ARNm construdo exclusivamente con guaninas, el que se "puso a trabajar" en un sistema de sntesis de protenas in vitro. En la medida que las guaninas eran "ledas", se formaron polmeros de aminocidos o polipptidos formados exclusivamente por el aminocidos leucina. Es decir, si el codon posee tres guaninas, el cdigo apunta "leucina" y lee el siguiente codon. Con distintas combinaciones de bases en ARNm sintticos, fue posible conocer el cdigo completo. (figura 9) En la tabla de la figura 10 se resume el cdigo que permite traducir los codones en aminocidos. En la traduccin del cdigo, es decir, en el proceso mismo de la sntesis proteica, interviene una variedad de sustancias y organelos: ribosomas, ARNm, ARN de transferencia (ARNt), nucletidos del medio y adems, una serie de protenas y enzimas citoplsmicas. El ARNt es una molcula de una barra, torcida sobre su eje como una horquilla para el pelo. Al final de la molcula se encuentra un triplete de bases de citosina y guanina. Es aqu donde acta una enzima activante para enlazar el aminocido apropiado. La energa para la unin del aminocido al ARNt proviene de la conversin de ATP (adenosn-trifosfato) a AMP (adenosnmonofosfato). Es decir, es un proceso que requiere energa. En el extremo, el ARNt tiene tres bases no apareadas (el anticodn). Estas tres bases encajan en el triplete complementario a lo largo del ARNm (el codn). As, por ejemplo, un ARNt con triplete AGU encaja en el punto del ARNm donde se encuentra la secuencia de las bases ACU. Un ARNt con un triplete de bases ACU se orientar en la molcula de ARNm en el lugar donde aparece el triplete AGU (figura 11) Los ribosomas son los organelos citoplasmticos que sirven de sustrato fsico para la traduccin, es decir, es "donde" se produce la sntesis proteica. Cada ribosoma est formado por una subunidad liviana y una pesada. La subunidad liviana tiene una hebra de ARN ribosomal y 21 protenas Figura 11 diferentes. La subunidad pesada consiste en dos hebras de ARN ribosomal y 34 protenas diferentes. La subunidad liviana tiene el sitio para que se pegue el ARNm. Tiene un rol crucial en la decodificacin del ARNm pues monitorea el apareamiento de bases entre el codn del ARNm y el anticodn de ARN t. La subunidad pesada tiene dos sitios para el ARN t. Cataliza la formacin de la unin entre dos aminocidos contiguos (enlace peptdico).

Figura 12. Modelos de ribosomas

Figura 13. Los 3 tipos de ARN

Cabe sealar que tanto el ARN t como el ARNr tienen origen en genes especficos del ADN, por lo que ambos provienen del ncleo, al igual que el ARNm. (figura 13) De esta manera la secuencia de bases Figura 14. Traduccin del ARNm existentes en la molcula de ARNm, originalmente determinada por la secuencia de bases de la molcula de ADN, determina el tipo de ARNt. Por supuesto, esto representa una seleccin indirecta del tipo de aminocido que formar parte de la cadena proteica. A medida que el ribosoma se mueve a lo largo de la molcula del ARNm, el cdigo es ledo por las molculas de ARNt, formndose una cadena creciente de polipptidos; cuando sta se completa, se libera. (figura 14)

IV.

Replicacin del ADN

El modelo propuesto para la estructura de la molcula de ADN no slo satisface las propiedades fsicas y qumicas observadas de la molcula y los procesos conducentes a la sntesis de protenas. Tambin, como modelo cientfico, permite explicar la autoduplicacin o replicacin normal de la molcula, es decir, la formacin de dos molculas idnticas de ADN a partir de una. Cabe recordar que este proceso resulta imprescindible para que la clula pueda realizar mitosis y ocurre durante la etapa S de la interfase. De no existir una duplicacin previa del ADN de la clula madre, al momento de dividirse, cada clula hija recibira slo la mitad del material 7

hereditario, lo que las hara inviables. De esta manera, la perpetuacin de la vida -va divisin celular- se debe a la capacidad del ADN para autoduplicarse. De acuerdo con el modelo de Watson y Crick, la duplicacin del ADN comienza con la separacin de la molcula en dos bandas debido al rompimiento de los enlaces de hidrgeno que unen las bases complementarias. Una vez expuestas, las bases de cada una de las mitades separadas pueden atraer a los nucletidos libres existentes en el medio. Cada citosina expuesta se unir a un nucletido de guanina; cada timina a un nucletido de adenina, etc. De esta manera, resultan dos molculas hijas, cada una de las cuales est conformada por una barra parental y otra nueva. Este modelo de replicacin o autoduplicacin de la molcula de ADN se conoce como "replicacin semiconservativa". (figura 15) El conocimiento bioqumico actual sobre el proceso de replicacin de la molcula de ADN es, bsicamente, el propuesto por Watson y Crick. Al igual que en todas las reacciones biolgicas se requieren enzimas especiales. Una de stas, la ADN polimerasa, une a los nucletidos de la nueva cadena de ADN a lo largo del molde de la cadena vieja. Junto con estas enzimas, en el proceso de replicacin del material gnico acta todo un complejo de protenas y otras enzimas que desempean variadas funciones. Esto, sin mencionar los nucletidos de adenina (ATP), de guanina (GTP), etc. que aportan la energa para el proceso.

V.

Alteraciones en la lectura

Tal como se seal, el modelo de ADN de Watson y Crick sugiere que se forma una copia exacta de esta molcula cada vez que se autoduplica. Sin embargo, debido a "accidentes moleculares" se producen "errores" en el mensaje gentico con su correspondiente expresin anormal en el fenotipo. Las variaciones en el mensaje hereditario llevado por el ADN reciben el nombre de mutaciones; stas pueden aparecer debido a cambios en un gen -segmento de la molcula de ADN- o a cambios en el nmero o en la estructura de los cromosomas. Se habla entonces de mutacin gnica y mutacin cromosmica. Un gen puede resultar alterado por una reordenacin accidental de las bases nitrogenadas que constituyen el mensaje. Una analoga puede explicar esto: la palabra 'tren" tiene un significado claro para todo el mundo de habla hispana. Cuando t vez esta palabra la interpretas correctamente. Supn ahora que se produce una reordenacin de letras que conforman esta palabra de modo que resulta "en rt". Claramente, esto no tiene ningn significado y no podemos interpretarlo. La mutacin gnica tambin puede resultar por sustraccin o adicin de una 8

base del cdigo. Volviendo a nuestro ejemplo, si a la palabra "tren" se quita la letra "t" o se le agrega la letra "a" resultan palabras carentes de significado. Lo mismo sucede con el cdigo gentico; la reordenacin de las bases nitrogenadas, la prdida o ganancia de un nucletidos, la prdida o ganancia de un triplete de bases alteran el cdigo gentico y la clula es incapaz de interpretar el mensaje alterado. Esto significa que no se producir la o las protenas de accin enzimtica correspondientes, por lo cual la secuencia de reacciones bioqumicas no se producir, resultando un individuo anormal. Una cadena "mutante" del ADN puede diferenciarse de la cadena normal por un slo nucletido. Sin embargo, este pequeo cambio en el mensaje hereditario tiene un efecto en la clula. Podra causar slo una pequea variacin en la estructura de una tena como una enzima. Como resultado de este cambio podra verse afectada la actividad o la eficacia de esta enzima en la reaccin que cataliza.

VI.

Biotecnologa

1. Generalidades y usos A menudo se le equipara con la ingeniera gentica, como sinnimo de una modificacin dirigida de la sustancia gentica de las clulas vivas. Pero la biotecnologa es muchsimo ms. La ingeniera gentica tan slo representa uno de sus muchos sectores. La biotecnologa significa tres cosas: en primer lugar, el aislamiento de clulas vivas de microorganismos, o a partir de tejidos animales o vegetales. En segundo lugar, la obtencin de productos metablicos partiendo de estas clulas vivas que han sido aisladas. Este punto corresponde tambin a la ingeniera gentica, puesto que su labor principal consiste en sintetizar productos valiosos para el ser humano, como la hormona del crecimiento o los interferones, a partir de clulas que han sido manipuladas genticamente. En tercer lugar, reacciones bioqumicas con clulas vivas o con sustancias que stas contienen, principalmente con enzimas. Como recordaremos ms adelante, las enzimas con protenas producidas por el organismo, que trabajan como mquina del metabolismo celular, pues facilitan reacciones de unin o de disociacin de otras molculas, que sin su accin se efectuaran muy lentamente. De este modo, desempean el papel de catalizadores, haciendo posibles ciertas reacciones qumicas a niveles eficientes, sin sufrir en s cambio alguno. As definida, la biotecnologa no es ninguna invencin reciente, sino que forma parte del repertorio de la civilizacin humana, desde hace ya muchos miles de aos. Por citar un ejemplo, en la produccin de alimentos para el ser humano y los animales intervienen procesos de fermentacin microbiana: El hongo de las levaduras (Saccharomyces) y las familias de lactobacilos hacen "subir" las masas en la produccin del pan Las levaduras convierten, por fermentacin, los cocimientos de cereales en cerveza, los jugos de manzana en chicha y el jugo de uvas, en vino Los estreptococos y algunas especies de lactobacilos convierten leche en yogurt o en queso Las acetobacterias y bacterias de la especie Erwinia dissolvens hacen fermentar a los granos de caf o a las hojas de t Los lactobacilos convierten durante el ensilado plantas verdes y frescas en forraje para animales As tambin, desde comienzos del siglo XX, se obtienen de las bacterias y levaduras (que son hongos unicelulares, no bacterias), un sinnmero de elementos orgnicos. Por ejemplo: Disolventes orgnicos, como el etanol o la acetona cidos orgnicos, como el cido ctrico o el cido lctico Polisacridos como el dextrano Aminocidos, como el cido L-glutmico o la L-lisina Nuclesidos, como el 5'-IMP y nucletidos como el 5'-GMP Vitaminas, como la B-12 o la vitamina C Antibiticos, como los betalactmicos o la tetraciclina Alcaloides de uso clnico Enzimas para la industria qumica, como las lipasas (usadas en detergentes) y para la industria alimenticia, como las amilasas Hormonas peptdicas y esteroides, como la 1-hidroxiprogesterona o como la insulina humana, producida mediante ingeniera gentica

Adems, se hace uso de varias especies de bacterias en lixiviacin de minerales, esto es, minerales de baja calidad se enriquecen tras ser procesados metablicamente por bacterias. Parte importante del trabajo realizado por biotecnlogos especialistas en gentica molecular, utiliza tcnicas relativamente recientes, entre las que destaca la recombinacin del ADN. 2. La tcnica del ADN recombinante Una revolucin en el campo de la biologa, que comenz a mediados del decenio de 1970 con el desarrollo de la tecnologa del ADN recombinante, llev a mtodos de investigacin por completo novedosos. Esta tecnologa se ha aplicado no slo a estudios genticos, sino tambin ha tenido un efecto importante en reas que van desde el desarrollo hasta la evolucin. Las tcnicas del ADN recombinante se desarrollaron inicialmente como herramientas que permitiran a los cientficos obtener una gran cantidad de copias de cualquier segmento de ADN especfico, de manera que ste pudiera estudiarse desde el punto de vista bioqumico. Ello puede hacerse ahora de varias maneras, pero la mayor parte de los mtodos irnplican la introduccin de ADN ajeno en las clulas de microorganismos. En las condiciones apropiadas, este ADN se duplica y transmite a las clulas hijas cuando la clula original se divide. De esta manera, una secuencia especfica puede ser amplificada, o clonada, para producir millones de copias idnticas que pueden aislarse en forma pura. Tambin se han desarrollado mtodos para clonar ADN in vitro. Los estudios con secuencias de ADN clonadas han sido de inmenso valor para comprender la organizacin de los genes y la relacin entre los genes y sus productos. De hecho, la mayor parte de nuestro conocimiento sobre las complejidades de la estructura y el control de los genes eucariticos proviene de la aplicacin de estos mtodos. La tecnologa de ADN recombinante tambin tiene muchas aplicaciones prcticas. Una de las reas de estudio que avanzan con mayor rapidez en la actualidad es la ingeniera gentica, o sea la modificacin del ADN de un organismo para producir nuevos genes con nuevas caractersticas. Como ya citbamoses gracias a esta disciplina cientfica que se han logrado avances sin precedente en campos como farmacia, medicina y gentica humana, as como en agricultura. La tecnologa del ADN recombinante comenz con los primeros estudios sobre la gentica de algunas bacterias y los virus que las infectan, los bacterifagos. Slo despus de decenios de investigacin bsica y de la acumulacin de amplios conocimientos se hizo factible la tecnologa actual, y qued disponible para los muchos cientficos que ahora utilizan estos mtodos. Entre otras cosas, las bacterias han proporcionado a los investigadores enzimas especiales, conocidas como enzimas de restriccin, las cuales cortan las molculas de ADN slo en lugares especficos (Figura 17). Adems, las molculas de ADN recombinante se introducen con mayor frecuencia en clulas bacterianas o bacterifagos Figura 17. Mecanismo de accin de las enzimas de restriccin para que sean amplificadas (o clonadas), y algunos aspectos de sus sistemas genticos facilitan este proceso. Una enzima de restriccin puede reconocer y cortar una molcula de ADN en la secuencia de bases 5'-AAGCTT-3', en tanto que otras slo cortan la secuencia 5'-ATC-3'. Normalmente, las bacterias slo utilizan estas enzimas como mecanismo de defensa, para atacar ADN de bacterifagos que entran en la clula. La bacteria protege su propio ADN contra el ataque modificndolo de alguna manera despus de su sntesis. La purificacin de dichas enzims permiti a los cientficos cortar ADN cromosmico en fragmentos ms cortos de manera controlada.

10

Muchas de las enzimas de restriccin utilizadas para estudios con ADN recombinante cortan secuencias palindrmicas, lo cual significa que la secuencia de bases de una cadena se lee igual que su complemento pero en sentido opuesto. (Figura 18) (As, el complemento de nuestro ejemplo, 5'-AAGCTT-3' se lee 3'TTCGAA-5'.) Al cortar del ADN ambas cadenas de manera asimtrica, estas enzimas dejan fragmentos con extremos de cadena sencilla complementarios, que se les denomina extremos adhesivos o pegajosos, porque pueden aparearse (por enlaces de hidrgeno) con los extremos monocatenarios (de una sla Figura 18. Tipos de cortes de enzimas de cadena) complementarios de otras restriccin molculas de ADN que han sido cortados por la misma enzima. Una vez que dos molculas se han unido entre s de esta manera, pueden tratarse con ADN ligasa, una enzima que une en forma covalente los dos fragmentos para formar una molcula de ADN recombinante estable. Las enzimas de restriccin varan sobremanera respecto al nmero de bases en las secuencias de ADN que reconocen, que va desde apenas 4 hasta 23 bases. Slo por clculo de probabilidades se espera que en promedio la secuencia de restriccin de un "cortador de cuatro bases" se presente en una molcula de ADN una vez cada 44 = 256 bases, en tanto que una enzima que reconoce seis bases cortar fragmentos con un promedio de 46 = 4.096 bases. Las enzimas de restriccin que reconocen secuencias con un nmero grande de bases son en particular adecuadas para estudiar molculas de ADN muy largas como las que constituyen cromosomas enteros. La mayor parte de las molculas de ADN recombinante se aislan y amplifican introducindolas en clulas de la bacteria Escherichia coli. Para aislar un fragmento especfico de ADN (despus de que ha sido cortado por una enzima de restriccin), ese fragmento debe ser incorporado Figura 19. Incorporacin de un gen a antes en un portador adecuado, o un plsmido molcula vectora. Como vector suele emplearse el ADN de bacterifagos o molculas de ADN especiales llamadas plsmidos, que consisten en una pequea molcula de ADN circular que puede duplicarse dentro de una clula bacteriana (Figura 19). Estos plsmidos pueden aislarse de clulas bacterianas en forma pura, y despus introducirse en otras clulas por un mtodo denominado transformacin, lo cual implica modificar la pared celular bacteriana para hacerla permeable a las molculas de ADN del plsmidio. Despus de que un plsmido entra en una clula, se duplica y distribuye entre las clulas hijas durante la divisin celular. Los plsmidos no portan genes esenciales para las clulas de E. coli, pero a menudo llevan usos que son tiles en determinadas condiciones ambientales como los que confieren resistencia a antibiticos especficos.
11

Los plsmidos que se utilizan en la actualidad en el trabajo con ADN recombinante han sido "manipulados" extensamente para que incluyan varias caractersticas tiles en el aislamiento y el anlisis del ADN clonado (Figura 20). Sin embargo, una propiedad limitante de cualquier plsmido es el tamao del fragmento de ADN que en efecto puede transportar. La longitud de un segmento de ADN a menudo se expresa en kilobases. Una kilobase (kb) es igual a 1.000 bases. De manera anloga a la capacidad de un disquete, se pueden insertar fragmentos de menos de 10 kb en los plsmidos para su empleo en E. coli. Sin embargo, fragmentos mayores requieren el uso de bacterifagos como vectores; stos pueden manejar hasta 15 kb de ADN. Tambin se puede introducir ADN recombinante en clulas de organismos superiores. Por ejemplo, en clulas de mamfero se utilizan virus reconstruidos como vectores. Estos virus han sido incapacitados (atenuados) y por ende ya no matan a las clulas que infectan; su ADN, y cualquier ADN ajeno que porten, se incorpora en los cromosomas de la clula por el proceso de infeccin normal. Actualmente se han desarrollado otros mtodos que no requieren un vector biolgico. En ellos, el ADN se inyecta directo en el ncleo celular, o se permite que las clulas incorporen ADN que se ha adsorbido en la superficie de cristales de fosfato clcico. En el esquema de la Figura 21 - visto en clases - se pueden apreciar las etapas mediante las cuales es posible conseguir insulina humana haciendo uso de ADN recombinante en la bacteria E. coli . En la tabla se mencionan otros usos que tiene la tcnica del ADN recombinante en la medicina. Figura 20. Ejemplo de
plsmido

Productos

Ejemplos y usos

Anticoagulantes Activador de plasmingenos de tejido (TPA), activa a la plasmina, una enzima involucrada en ..disolver cogulos, efectivo tratamiento en vctimas de ataques cardacos. Factores Factor VIII promueve coagulaciones y es deficiente en hemoflicos. El uso del Figura 21. Obtencin de insulina sanguneos factor VIII ..producido por tecnologa de DNA recombinante elimina riesgos de mediante ADN recombinante infeccin asociados con ..transfusiones sanguineas. Factores Factores de crecimiento del Sistema Inmune que estimulan la produccin de estimuladores de leucocitos, ..usados para tratar deficiencias inmunes y para combatir colonias infecciones. Estimula la produccin de eritrocitos; usado para tratar anemia en pacientes Eritropoyetina con ..enfermedades al rin. Factores de Estimula la diferenciacin y crecimiento de varios tipos celulares. Se utiliza crecimiento para promover la cicatrizacin. Hormona de Usada para el tratamiento del enanismo. crecimiento humana Insulina humana Usada para el tratamiento de la diabetes. Interferones Interfieren con la produccin viral; usados para tratar algunos cnceres. Activan y estimulan diferentes clases de leucocitos; posibles usos en Interleuquinas cicatrizacin de ..heridas, infeccin con VIH, cncer, y deficiencias inmunes. Extraordinaria especificidad de unin que es usada en: test de diagnsticos; Anticuerpos transporte ..dirigido (drogas, toxinas, o compuestos radiactivos para tumores monoclonales como una terapia para ..cncer); muchas otras aplicaciones. Extraordinaria especificidad de unin que es usada en: test de diagnsticos; Superoxido transporte ..dirigido (drogas, toxinas, o compuestos radiactivos para tumores dismutasa como una terapia para ..cncer); muchas otras aplicaciones. .Las protenas derivadas de cubiertas virales son tan eficientes para iniciar una Vacunas respuesta inmune como los virus muertos, pero son ms seguros; la primera vacuna desarrollada fue ..para la hepatitis B.

3. Organismos transgnicos Los organismos superiores que han incorporado genes extraos se denominan transgnicos; este trmino suele reservarse para plantas y animales.
12

Se estn utilizando diversos mtodos para insertar genes extraos o ajenos en clulas vegetales o animales. Con frecuencia se utilizan virus como vectores, aunque tambin se han empleado otros mtodos, como inyeccin directa de ADN en las clulas Una manera de reconstruir genticamente las protenas animales consiste en utilizar animales vivos que han incorporado un gen extrao para producir la protena recombinante. Estos animales transgnicos suelen obtenerse por microinyeccin del ADN de un gen especfico en el ncleo de un vulo fecundado. Los vulos se implantan despus en el tero de una hembra y se permite que se desarrollen. En un estudio de este tipo, el gen para la hormona del crecimiento se aisl de una biblioteca de ADN genmico de rata y se combin con la regin promotora de un gen de ratn que en general produce metalotionena, una protena cuya sntesis es estimulada por la presencia de metales pesados como zinc. Se utilizaron las secuencias reguladoras para la metalotionena, como un interruptor que permitiera activar y desactivar a voluntad la hormona del crecimiento de la rata. Despus de que se inyect el gen manipulado en vulos de ratn fecundados, stos se implantaron en el tero de una hembra de ratn y se permiti que se desarrollaran hasta embriones. Los embriones en los cuales el trasplante de genes fue exitoso crecieron con rapidez cuando se expusieron a pequeas cantidades de zinc. Un ratn que se desarroll a partir de un vulo que haba recibido dos copias del gen para la hormona del crecimiento alcanz una talla de ms del doble de la normal. Como podra esperarse, tales ratones a menudo son capaces de transmitir a la descendencia su mayor capacidad de crecimiento. Ya se ha demostrado que la descendencia transgnica tiene valiosas aplicaciones de investigacin en una amplia gama de estudios. Entre stos se incluyen regulacin de la expresin gnica, funcionamiento del sistema inmunitario, enfermedades genticas y virales, y genes causantes del desarrollo de cncer. Se han utilizado animales transgnicos para desarrollar cepas que secreten protenas importantes en la leche. Por ejemplo, se ha introducido en ratones transgnicos el gen para el activador del plasmingeno tisular, una protena que disuelve los cogulos que causan los ataques cardiacos, y en forma semejante el gen para un factor de la coagulacin sangunea humana, en ovejas. Estos genes recombinantes se han fusionado en las secuencias reguladores de los genes para las protenas lcteas y, por lo tanto, slo se activan en tejidos mamarios que tienen relacin con la produccin de leche. La ventaja de producir la protena en la leche es que se obtiene en grandes cantidades y puede obtenerse sirnplemente al ordear al animal. La protena se purifica despus de la leche. Los animales no son daados por la introduccin del gen y, dado que la progenie del animal transgnico suele producir tambin la protena recombinante, es posible Figura 22. Estructura de un establecer cepas transgnicas simplemente criando a los retrovirus animales. Recordemos que tambin se utilizan virus como vectores para ADN recombinante. Los virus de ARN, llamados retrovirus, hacen copias en ADN de s mismos por transcripcin inversa (Figura 22). Algunas veces tales copias en ADN se integran a los cromosomas del husped, donde se duplican junto con el ADN de ste. Por ejemplo, los virus de la leucemia murina genticamente alterados son retrovirus que pueden utilizarse como vectores para incorporar genes recombinantes en clulas cultivadas. En determinadas condiciones, genes portados por los virus modificados por ingeniera gentica pueden expresarse en las clulas animales para producir protenas reconstruidas en forma gentica. Una desventaja importante de introducir genes en clulas animales cultivadas es que el rendimiento de las protenas codificadas por el ADN ajeno portado por los virus suele ser bajo. Sin embargo, estos tipos de vectores son promisorios como medios de terapia gnica de algunos trastornos hereditarios del ser humano. 4. Plantas transgnicas en la agricultura Las plantas han sido cruzadas en forma selectiva durante miles de aos. El xito de tales trabajos depende de la presencia de rasgos deseables en la variedad de planta que se selecciona o en plantas silvestres o domsticas estrechamente relacionadas cuyos rasgos pueden ser transferidos por cruzamiento. Las variedades primitivas, o especies estrechamente relacionadas, de plantas cultivadas a menudo tienen rasgos, como la resistencia a enfermedades, que pueden introducirse de manera ventajosa en variedades ms adecuadas para las necesidades modernas.
13

Si en una planta se introducen genes de cepas o especies con las que ordinariamente no se cruza, las posibilidades de mejoramiento se elevan en gran medida. Los genetistas de vegetales ahora disponen de fondos de investigacin debido al potencial econmico de los rendimientos mejorados. Adems, es posible que estos especialistas tengan mayor libertad de experimentar con nuevas tcnicas que quienes trabajan con Figura animales, debido a que la manipulacin de genes 23 vegetales no suele implicar el mismo tipo de consideraciones ticas. Por desgracia, ha sido muy difcil encontrar un vector adecuado para introducir genes recombinantes en muchos tipos de clulas vegetales. En el sistema vector ms utilizado se recurre a la bacteria formadora de agallas Agrobacterium tumefaciens. Esta bacteria por lo general produce tumores o "agallas" en los vegetales al introducir un plsmido especial, llamado plsmido inductor de tumores o Ti (por su nombre en ingls: tumorinducing), en las clulas de su husped. El plsmido induce crecimiento anormal forzando a las clulas de la planta a producir grandes concentraciones de una hormona de crecimiento vegetal, la citocinina; tambin desva el metabolismo de las clulas del husped a producir sustancias conocidas como opinas, derivados sencillos de aminocidos y cetocidos que son nutrimentos preferidos por la bacteria. Es posible "desarmar" al plsmido Ti de manera que no induzca la formacin de tumores y utilizarlo como vector para insertar genes en clulas vegetales (Figura 23). Las clulas en las que se introduce el plsmido alterado de hecho son normales, excepto por los genes que se han insertado. Los genes colocados en el genoma de la planta de esta manera pueden transmitiese en forma sexual por semillas a la siguiente generacin, pero tambin pueden propagarse asexualmente si se desea. Un problema importante con el vector Ti es que, con pocas excepciones, slo plantas dicotiledneas pueden ser infectadas por A. tumefaciens. Por desgracia, las gramneas, que constituyen la principal fuente de alimento para el ser humano, son monocotiledneas y por ello salen de la gama de huspedes de la bacteria. Se est realizando intensa investigacin encaminada a desarrollar sistemas vectores para monocotiledneas. Un mtodo ha sido el desarrollo de una "escopeta" gentica. Fragmentos microscpicos de metal se cubren de ADN y se disparan contra clulas vegetales para que atraviesen las paredes celulares. Algunas de las clulas retienen el ADN y son transformadas por ste. Tales clulas pueden cultivarse y utilizarse para regenerar una planta completa Una complicacin ms de la ingeniera gentica de plantas es que varios genes vegetales importantes se localizan en el ADN de los cloroplastos; estos ltimos son esenciales en la fotosntesis, que es la base de la productividad de las plantas. Es obvio que sera til desarrollar mtodos para modificar la porcin del ADN vegetal que reside dentro del cloroplasto. En la actualidad, los mtodos de ingeniera del cloroplasto son el centro de intensa investigacin. Problemas: 1. Por qu la tcnica se llama se "ADN recombinante"? 2. Por qu se llaman "extremos pegajosos" si la unin que permite reconstituir al plasmidio se basa en los mismos puentes de hidrgeno que forman el resto de la doble hebra de ADN? 3. Las clulas de E. coli que se usan en ingeniera gentica son "deficientes". Es decir, no pueden sintetizar componentes escenciales de su pared celular, por ejemplo o cierta base nuclear como la timina. Por lo tanto, slo pueden sobrevivir en medios enriquecidos con estas sustancias. Por qu crees que los bilogos moleculares han tomado estas precauciones?
14

4. Completa el siguiente cuadro acerca de enzimas utilizadas en recombinacin del ADN:


Origen Enzimas de restriccin Ligasas Transcriptasa inversa Funcin original Uso en gentica ingeniera

5. Si fueses agricultor, qu genes te interesara insertar en un plsmido Ti? 6. Qu situaciones estara limitando el uso de recombinacin gnica en especies vegetales?

VII.

Enzimas1

1. Generalidades Todas las reacciones qumicas, tanto las endergnicas como las exergnicas, requieren, para iniciarse, que los reactantes superen una cierta barrera de energa. Esta barrera se denomina energa de activacin, y se define como la energa cintica mnima requerida por una sistema de partculas para que se produzca una reaccin qumica. El nivel energtico de los reactantes determina la velocidad con que stos se mueven y chocan entre s para reaccionar. Este movimiento est directamente relacionado con la temperatura, de modo que, a temperaturas bajas, es nfimo el numero de molculas reactantes que tienen suficiente energa como para pasar al estado activado. Al aumentar la temperatura, los movimientos se, incrementan y la velocidad de la reaccin se hace apreciable. Pero, por otro lado, la mayor parte de las reacciones celulares, si bien requieren una energa de activacin considerable, debe realizarse a las temperaturas moderadas y estables propias del medio celular. Por lo tanto, la clula debe utilizar una solucin diferente para el problema de la barrera energtica. Est solucin consiste en el uso de ciertas sustancias denominadas catalizadores. Estas sustancias tienen un gran espectro de accion: digestiva, circulatoria, excretora, regulacin de presin arterial, reproduccin, etc. Un catalizador es una sustancia que reduce la energa de activacin que requiere una reaccin, acelerando as la misma. Esto sucede porque aumenta la probabilidad de que las molculas de reactantes, puedan llegar al nivel de energa mnimo necesario para la reaccin, con lo cual se aumenta su velocidad.

La mayor parte de las descripciones acerca de las enzimas, de una u otra manera, ya se han visto en aos anteriores. La idea es recordar, ordenar y recontextualizar en el nuevo mbito de la gentica molecular. 15

La disminucin de la barrera de energa se observa en los grficos comparativos de la Figura, que se refieren a la misma reaccin, sin catalizar y catalizada. Observa que el valor de la energa liberada en el cambio neto reactantes a productos es el mismo, tanto en la reaccin no catalizada como la catalizada. La clula presenta catalizadores especiales sintetizados por ella misma, llamados enzimas. Estas sustancias afectan la velocidad de las reacciones qumicas dentro de las clulas o en los espacios intercelulares 2. Propiedades de las enzimas Las enzimas presentan las mismas propiedades que los catalizadores no biolgicos (utilizados en los laboratorios y en la industria, por ejemplo Mn02 ). Estas son: a) Son eficientes en cantidades muy pequeas b) No son alterados qumicamente por la reaccin, es decir, se recuperan por completo al finalizar sta (con el consiguiente ahorro de energa) c) No afectan las concentraciones de equilibrio de la reaccin; slo hacen que este equilibrio se alcance ms rpidamente d) Adems, a diferencia de los catalizadores no bilgicos: e) Ms eficientes que los catalizadores no biolgicos..Esto se puede medir por el nmero de recambio (cantidad de sustrato Cataliza Origen N de transformado por unidad de sustancia) Ej: dor recambio f) Presentan una especificidad muy alta para una Hierro Inorgn 10-5 reaccin en particular ico Catalasa Orgni 1010 g) Pueden estar sujetas a regulacin de su actividad co h) Tienen una composicin qumica especfica (son protenas) 3. Composicin qumica de las enzimas Sin excepcin, las enzimas son protenas. En algunas enzimas, la accin cataltica depende exclusivamente de su estructura proteica. En otros casos, en cambio, se necesitan adems otras sustancias para que la enzima acte. La enzima activa recibe el nombre de holoenzima, y est constituida por una protena sin actividad (apoenzima) y un factor adicional - que nunca es una protena - llamado cofactor enzimtico. Los cofactores enzimticos pueden ser: a) Iones inorgnicos: Mg2+, Mn2+, Cu2+, Zn2+, Cl-, Na-, K-, y otros b) Molculas orgnicas no proteicas, denominadas coenzimas, que frecuentemente derivan de vitaminas hidrosolubles. Por ejemplo: FMN, FAD, NAD, NADP, CoA c) Coenzimas unidas muy estrechamente a la protena, denominadas grupos prostticos. Por ejemplo, el grupo hem (un conjunto de cuatro heterociclos con un in Fe3+ central), es el grupo prosttico de la enzima catalasa (este grupo es muy semejante a la protena hemoglobina de los glbulos rojos) 4. Nomenclatura de enzimas La forma de nombrarlas se basa en la adicin del morfema "asa" al nombre del sustrato sobre el cual acta. Por ejemplo, la sacarosa (sustrato) se degrada (disminuir gradualmente) mediante la enzima sacarasa, para formar sustancias ms simples: glucosa y fructosa; las lipasas actan sobre los lpidos; las proteinasas o proteasas rompen los enlaces peptdcos de las protenas y, las amilasas actan sobre los almidones. 5. Trabajo en equipo de las enzimas Las enzimas trabajan generalmente en equipo; por ejemplo el producto de una reaccin enzimticamente regulada sirve de sustrato para la siguiente. As, el interior de la clula puede representarse cmo una fbrica, con muchas lneas distintas de ensamblaje (y desensamblaje) en funcin simultnea. Cada una de estas lneas se compone de diversas enzimas, y cada una realiza una accin sobre una molcula, convirtiendo la molcula A en molcula B, para despus pasarla a una nueva enzima que se convierte la molcula B en molcula C, y as sucesivamente. Por ejemplo, dos enzimas pueden extraerse de las semillas germinadas de cebada, las cuales convierten el almidn en glucosa. La primera la amilasa, hidroliza el almidn en,
16

maltosa; la segunda, maltasa, separa la maltosa en glucosa. Para convertir la glucosa en cido lctico se requiere la accin consecutiva de 11 enzimas. La misma serie de estas 11 enzimas se encuentran en el ser humano, hojas verdes y en las bacterias. 6. Teoras sobre actividad enzimtica El primer paso en el desarrollo de la actividad enzimtica es la unin de la enzima al reactante, que tambin es llamado sustrato. En toda enzima existe un rea, denominada sitio activo, que est determinado por un pequeo nmero de aminocidos, con un ordenamiento particular en el espacio. Este es el lugar especfico de unin del sustrato. La interaccin del sitio activo y el sustrato podra deberse a un complementariedad entre la forma de ambos. Esta es la base de la teora de "llave y cerradura", una de las primeras propuestas para explicar la actividad enzimtica. Ms recientemente, se ha sugerido que la interaccin no es tan rgida como sugiere el nombre de la teora, sino que la enzima es relativamente flexible, con capacidad para moverse de una conformacin a otra diferente, acomodando de manera perfecta al sustrato en el sitio activo. Esta teora se denomina de "ajuste inducido" Los mecanismos por los cuales se produce la catlisis enzimtica, es decir, la transformacin de sustrato en producto, se explican por: que hay una mayor eficiencia de los choques entre las sustancias que reaccionan, resultado de la proximidad y de la orientacin ptima para la.interaccin de los sustratos; que se produzcan cambios en la conformacin de la enzima, ocasionados al unirse al sustrato, crendose tensiones que rompan al sustrato para dar las molculas de producto o que se debiliten algunos enlaces favoreciendo la formacin de otros Ciertas reacciones se explican satisfactoriamente por algunos de los mecanismos expuestos, solos o combinados, y otras reacciones an permanecen sin aclaracin.

7. Inhibidores Muchas cadenas metablicas mediadas por enzimas poseen mecanismos regulatorios de retroalimentacin - anlogos a los mecanismos de regulacin hormonal - en que
17

las enzimas pueden ser inhibidas temporalmente por molculas inorgnicas u otras de naturaleza tambin enzimtica. Ciertos inhibidores entran en el sitio activo de la enzima impidiendo que se unan los sustratos. Son llamados inhibidores competitivos. Otros, en tanto, se unen en regiones de la enzima que provocan una distorsin en la forma del sitio activo, lo cual repercute tambin en un impedimento para la unin de sustratos o para que ocurra la catlisis: son los inhibidores alostricos. Muchas toxinas son inhibidores de enzimas. Existen inhibidores que tienen utilidad mdica en el tratamiento del cncer y de infecciones virales y bacterianas. 8. Factores que afectan a las enzimas Factores importantes para la funcin de las enzimas son: la temperatura el pH la concentracin de los sustratos Las enzimas tienen una temperatura y un pH ptimos. Generalmente se desnaturalizan sobre 40 C y pierden abruptamente su actividad.

Problemas:
1. Las siguientes imgenes corresponden a una enzima activa (1) y a un mutante de la misma enzima, pero inactiva (2). Abajo estn sus correspondientes secuencias aminoacdicas Cul de las alternativas a continuacin es incorrecta? la protena 2 tiene una alteracin en su estructura que afecta la funcin de su sitio activo La protena 2 presenta cambios estructurales debido a mutaciones que hicieron cambiar la.secuencia de uno de los codones mientras otro codn se perdi (delecin) en su gen Las mutaciones que afectan a la protena 2 podran ser hereditarias El cambio de estructura se debe a mutaciones que cambiaron el marco de lectura de la secuencia del gen

a) b)

c) d)

2. Selecciona la sentencia incorrecta sobre las protenas: a) Son molculas que ejecutan la informacin gnica b) Realizan las reacciones qumicas que ocurren en el organismo c) Constituyen estructuras que dan forma a las clulas d) Tienen todas formas semejantes debido a que su secuencia es parecida e) La forma y funcin de las protenas est determinada por la secuencia de aminocidos que se especifica en los genes 3. Con respecto a las enzimas, es incorrecto decir que: a) Son una categora especial de protenas que aumentan la velocidad de las reacciones qumicas en los organismos b) Operan en un rango de temperatura compatible con la vida c) Son catalizadores biolgicos de baja especificidad en sus acciones y substratos d) Su actividad contribuye fundamentalmente a la realizacin del fenotipo e) Su forma y funcin est determinada por la secuencia de aminocidos especificada en el ADN

18

4. En el hombre, la hormona de crecimiento es una protena producida por la hipfisis. Para el tratamiento del retardo del crecimiento en los nios que carecen de esta hormona slo se puede utilizar hormona de crecimiento humana. De qu manera se podra obtener la hormona si actualmente se dispone del ADN que la codifica? 5. Un enzimlogo (bilogo molecular especialista en enzimas) ha intervenido genticamente la enzima G. La enzima G es una enzima relacionada con el metabolismo respiratorio y su secuencia gentica es ampliamente conocida. Esta enzima trabaja en rangos de acidez muy estrictos, lo que ha impedido que cierto tipo de cultivo vegetal sobreviva en ambiente levemente cido del sur de Chile. De esta manera, se han diseando dos nuevos tipos de enzima G: G1 y G2, que poseen mejor rendimiento en ambientes de mayor acidez. La nica diferencia entre G1 y G2, es que sta ltima funciona mejor a bajas temperaturas. Respecto a lo anterior, resuelve: a) Cmo podra modificarse tericamente la eficiencia de una enzima, en general? b) Cmo podra modificarse tericamente la eficiencia de una enzima a un ambiente ms cido? c) Cmo podra medirse la eficiencia de la enzima G para saber si posee mayor o menor rendimiento? d) Dibuja un grfico de rendimiento v/s pH en que aparezcan las curvas de las enzima G, G1 y G2

Trabajo prctico 1: Sntesis de un pptido - la insulina


A partir de las instrucciones entregadas por el profesor acerca del plegamiento de protenas tras la sntesis de la cadena aminoacdica y considerando la informacin contenida en esta gua, debers obtener la estructura de una molcula de INSULINA (hormona relacionada con la regulacin de la glicemia) a partir de la secuencia simplificada de su gen. Datos: I. Gen de la insulina (ubicado en el cromosoma n 11) Se han omitido las bases que originan tripletes de inicio y final Los espacios disponibles bajo la secuencia son para anotar el cdigo del ARNm correspondiente (lnea superior), as como el orden de los aminocidos (lnea inferior)

AAGCAGTTGGTTGTGGATACGCCGAGCGTGGATCAGCTCCGTGATATGGATCAGACGCC GCTCGCCCCG ____________________________________________________________________________________ ____ ____________________________________________________________________________________ ____ AAGAAGATGTGTGGTTTCCGTTGTGCCGCCCTCCGTCTCCTGGATGTTCAGCCGGTTCAG CTCGATCCG ____________________________________________________________________________________ ____ ____________________________________________________________________________________ ____ CCGCCGGGTCGTCCGAGCGATGTTGGTGATCGTGATCTCCCGAGCGATGTTTTCGCCCC GTATCAGCTC ____________________________________________________________________________________ ____ ____________________________________________________________________________________ ____ GTTACGACGTGTAGCTAGACGAGCGATATGGTTGATC TCTTGATGACGTTG
19

____________________________________________________________________________________ ____ ____________________________________________________________________________________ ____


II. Especificaciones de terminacin y plegamiento:

a) Nmero de cadenas peptdicas independientes = 3, de las cuales slo dos terminan formando la insulina. Cadena B: Fenilalanina 1 hasta Alanina 30 Cadena C: Treonina 1 hasta Arginina 35 (cadena que es cortada y perdida) Cadena A: Glicina 1 hasta Asparagina 21 b) Puentes dislfuro (entre cistenas): Cys6 - Cys11 en la cadena A Cys7 cadena A con Cys7 cadena B Cys20 cadena A con Cys19 cadena B c) Nmero de segmentos que forman alfa-hlice = 3 Dos segmentos en la cadena A entre lo aminocidos Gly1 - Ile10, Ser12 - Glu17 Un segmento en la cadena B entre los aminocidos Ser 9 - Gly20 Tener presente que los aas hidrofbicos (Gly, Ala, Val, Leu, Ile, Trp, Pro, Met, Phe) se orientan hacia el interior de la protena, mientras que los hidroflicos (Asn, Gln, Tyr, Cys, Ser, Thr) lo hacen hacia fuera III. Especificaciones de diseo: Los aminocidos pueden representarse como crculos u otro dibujo simple. Cada cadena (A y B) debe representarse de un color distinto Los 3 puentes dislfuro deben quedar destacados y las secuencias que forman hlices alfa pueden representarse como un espiral simple Es preferible realizar varios borradores hasta disear un modelo que cumpla con todas las especificaciones. Basndose en el diseo REVISADO Y APROBADO por el profesor, construir un modelo 3D de la insulina, utilizando alambre, plasticina y/o pelotitas de plumavit. Anexo: Clasificacin y abreviaturas de los 20 aminocidos: Polares Con carga elctrica No polares Triptfano: Trp Prolina: Pro Cistena: Cys Asparagina: Asn cido asprtico: Asp Glicina: Gly Glutamina: Gln cido glutmico: Glu Alanina: Ala Tirosina: Tyr Arginina: Arg Valina: Val Serina: Ser Lisina: Lys Leucina: Leu Metionina: Met Treonina: Thr Histidina: His Isoleucina: Ile Fenilalanina : Phe

Trabajo Prctico 2: Extraccin de ADN desde tejidos vegetales


Materiales: Cebollas, coliflor, arvejas, etc. Tubos de centrfuga Embudo de vidrio 2 Vasos precipitados de 500 ml Pipeta Pasteur Termmetro Pipetas graduadas Esptula Papel filtro Soporte universal Licuadora Hielo Sal Etanol al 95% Detergente lquido Ablandador de carne (proteasas)

Mtodo: 1. Preparar una pipeta Pasteur como un gancho o protuberancia, haciendo uso del calor de un mechero. 2. Preparar un bao Mara a 65C 3. Moler 100 g de coliflor (u otro organismo) usando la licuadora con unos 100 ml de agua. Se pretende que la solucin tenga pedazos finos de tejido sin alcanzar la consistencia de pur. 4. Verter unos 5 ml de la solucin anterior en un tubo de centrfuga. Agregar 2 g de sal y 1 ml de detergente lquido. Revolver. 5. Colocar el tubo con la mezcla anterior en el bao con agua a 65C durante 10 minutos. 20

6. Colocar el tubo con la mezcla en hielo. Este proceso debe ser rpido, para conseguir un enfriamiento brusco. Dejar durante 5 minutos. 7. Filtrar la solucin y recoger el filtrado en otro tubo de centrfuga, hasta completar 4 ml. 8. Agregar 1 g de ablandador de carne a los 4 ml de filtrado. 9. Inclinar el tubo y cuidadosamente, verter el etanol fro (ojal 0C), escurrindolo por la pared. No agitar el tubo, pues la idea es permitir la formacin de fases de distinta densidad. 10. Las fibras de ADN aparecern en la interfase alcohol-filtrado. 11. Revolver el ADN con la pipeta Pasteur previamente preparada para tal efecto, levantando las fibras, como si se tratara de un bocado de tallarines. 12. El ADN rpidamente comenzar a desintegrarse. Botar las soluciones, lavar y limpiar. 13. Anotar los resultados comparativos de otras parejas de trabajo, evaluando el efecto que tuvo utilizar distintas concentraciones o cantidades de detergente, ablandador, etc.

Trabajo prctico 3: Noticia biotecnolgica: Fuentes actualizadas al 15 de agosto de 2007 http://www.biotecnologica.com/

21

Похожие интересы