BIO4320 Midterm Examination (March 8, 2000) Dr.

Fung’s Part (16 marks)

Name: Student ID:

1. A scientist has isolated a new protein from a mouse cell line and determined the N
terminal amino acid sequence of this protein.

Met-Arg-Leu-Cys-Tyr-His-Trp-His-Ile.

The scientist has also constructed a cDNA library of this mouse cell line. Would you
help him to design a primer with 17 nucleotides long as a probe to identify the
corresponding cDNA clone from the library? Explain your answer. (8 marks)

-1-
BIO4320 Midterm Examination (March 8, 2000) Dr. Fung’s Part (16 marks)
Name: Student ID:

2. In E. coli there are three genes making Glycine-tRNAs as shown in the following
table.

gene tRNA Anti-codon

produce
glyU tRNA1 Gly 3’-CCC-5’
glyT tRNA2 Gly 3’-CCU-5’
glyV tRNA3 Gly 3’-CCA-5’

An E. coli strain has a mutated glyT gene which has an anti-codon 3’-UCU-5’. Write
down all the possible amino acid sequences of the proteins that will be translated from
the following mRNA in this mutated E. coli strain. Explain your answer.

Coding sequencing of the mRNA: ….. AUG GCC GGG AGA GGC UAA….

The starting codon is underlined.

(4 marks)

3. Draw a diagram to illustrate the structure of a typical eukaryotic gene. (2 marks)

4. Name two factors that will affect the forms of the DNA structure. (2 marks)

-2-
BIO4320 Midterm Examination (March 8, 2000) Dr. Fung’s Part (16 marks)
Name: Student ID:

-3-
BIO4320 Midterm Examination (March 8, 2000) Dr. Lam’s Part (32 marks)
Name: Student ID:
(1) Plasmid BIO was transformed into bacterium X or bacterium Y. The plasmid was then
isolated and digested with restriction enzyme A and/or restriction enzyme B. The
following restriction patterns were obtained:

Plasmid BIO X X Y X X X Y
prepared from:
Restriction A A A B B A+B A+B
enzyme used:
Restriction I II I I II I I
buffer used:

Wells

1 2 3 4 5 6 7
(a) How many cutting site of restriction enzyme A and restriction enzyme B are found on
the plasmid BIO? (1 mark)

(b) Suggest one reason to explain the minor bands observed in lane 2. (1 mark)

(c) Suggest one reason to explain the difference between lane 1 and lane 3. (1 mark)

(d) Suggest two possible relationships between the restriction sites of enzyme A and
enzyme B on the plasmid BIO. (3 marks)

(e) Suggest two possible differences between the restriction enzyme A and restriction
enzyme B. (3 marks)

-1-
BIO4320 Midterm Examination (March 8, 2000) Dr. Lam’s Part (32 marks)
Name: Student ID:
(2) A RAP-PCR experiment was carried out using RNAs from normal (lane 1) and tumor
(lane 2) cells. The pattern of electrophoresis is shown in the left panel below. Fragment
H was cloned into the multiple cloning site (MCS) of a plasmid vector as shown below.
The MCS region of this plasmid is flanked by T3 and T7 promoter sequence running in
opposite orientation.

Wells
H

A G T3 T7
H
B I
C J

D K

E
F L

1 2

(a) Name the possible cDNA band(s) that is/are related to (i) tumor induction, and (ii)
tumor repression. (2 mark).

(b) RNA probes (riboprobes) were synthesized from the recombinant plasmid using either
T3 or T7 RNA polymerase. It was found that probes synthesized by the T7 RNA
polymerase can give signals in both Southern blot and Northern blot experiments
while probes synthesized by the T3 RNA polymerase can give signals only in
Southern blot experiment. Explain this observation. (4 marks)

-2-
 BIO4320 Midterm Examination (March 8, 2000) Dr. Lam’s Part (32 marks)
Name: Student ID:
(c) Fragment H was sequenced and found to be coming from a part of the coding region
of an unknown mRNA. DNA sequencing experiments were performed using T7 and
T3 primers. Sequencing information at both ends of the fragment was shown below:

T3 5’aaactcccagtaccataccgatccatcaacccttcgattcaagcctcttcagctctggactgggcccaat. . . . 3’

3’. . . aaactcccagtaccataccgatccatcaacccttcgattcaagcctcttcagctctggactgggcccaat 5’ T7

To obtain sequencing information of the 3’ end of the unknown mRNA, 3’ RACE

experiment is one possible approach. Write out the possible sequence of a gene specific
primer (GSP) and a nested primer for this experiment. (6 marks)

Remark 1: you should know the answer for part (b) in order to give the correct answer.
Remark 2: if you are not sure about your answer, explain your design so that partial score
can be given.

-3-
BIO4320 Midterm Examination (March 8, 2000) Dr. Lam’s Part (32 marks)
Name: Student ID:
(3) To obtain the full-length cDNA clone of the unknown mRNA described in question (2),
the cloned fragment H was used to generate RNA probes (riboprobes) to screen a λZAP
cDNA library. The hybridization was performed at 65°C or 50°C. The signals on
duplicated filters were shown in the left and right panel below, respectively.
Anchor marker to orient
the duplicate filters

Filter A (65°C) Filter B (50°C)

(a) Referring to the recombinant plasmid in question (2), will you use T7 or T3
polymerase to generate RNA probes (riboprobes) for your library screening
experiment. Explain your answer. (2 marks)

(b) Explain why extra signals were observed in Filter B. (2 marks)

(c) What is the significance of the extra signals found in Filter B? (2 marks)

(d) Give two advantages of λ phage libraries as compared to plasmid libraries. (2 marks)

(e) When attempting to excise the plasmid portion with the λZAP clones, SOLR cells are
normally used. If XL1BlueMRF’ cells are used instead, what will happen? (3 marks)

-4-