Вы находитесь на странице: 1из 15

UNIVERSIDADE DE SO PAULO Escola Superior de Agricultura Luiz de Queiroz Curso de Cincias Biolgicas Biol Biolgicas

Anlise Diagnstica de OGMs CEN 0333 An OGM Anlise Diagn Diagnstica OGMs

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR

Aline Borges Aline Borges Felipe Augusto Gasparotto Felipe Augusto Gasparotto Viviane Piccin dos Santos Viviane Piccin dos Santos

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR

PCR

Reao que faz cpias de um fragmento da dupla fita de DNA Rea que faz c Reao cpias de um fragmento da dupla fita de DNA

Vantagem Produz in vitro uma grande quantidade de cpias de um Vantagem Produz in vitro uma grande quantidade de c cpias de um fragmento especfico em um curto espao de tempo fragmento espec especfico em um curto espa de tempo espao

Possibilitou o desenvolvimento de muitas outras tcnicas: clonagem, Possibilitou o desenvolvimento de muitas outras t tcnicas: clonagem, seqenciamento, etc. seq seqenciamento, etc.

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR

Determinao do fragmento feita pelos Primers Oligonucleotdeos Determina do fragmento feita pelos Primers Oligonucleot Determinao Oligonucleotdeos Fragmento a ser amplificado Fragmento a ser amplificado

DNA dupla fita DNA dupla fita

Primers Primers

17 a 30 nucleotdeos 17 a 30 nucleot nucleotdeos

Complementares a uma fita (idnticos outra) Complementares a uma fita (idnticos outra)

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR

Trs fases da PCR Trs fases da PCR

Desnaturao Desnatura Desnaturao ~ 94C ~ 94 94C

Anelamento Anelamento ~ 45/60C ~ 45/60 45/60C

Extenso Extenso ~ 72C ~ 72 72C

5 Taq-polimerase TaqTaq-polimerase 3

3 5

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR

Taq-polimerase TaqTaq-polimerase 5 3

Nucleotdeos Nucleot Nucleotdeos

aquaticus aquaticus

Isolada de uma bactria termfila: Thermus Isolada de uma bact bactria term termfila: Thermus resistente a altas temperaturas resistente a altas temperaturas (no precisa ser reposta a cada ciclo) (no precisa ser reposta a cada ciclo) Temperatura tima: 72 C Temperatura tima: 72 C

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR


Nmero terico de cpias geradas a partir de 1 molcula de DNA Nmero te terico de c cpias geradas a partir de 1 mol molcula de DNA

1 ciclo

2 ciclo

3 ciclo

4 ciclo

Fim

Incio

2 fitas iniciais 2 com 5 determinado e 3 indeterminado 2 fitas iniciais 4 com 5 determinado e 3 indeterminado 2 com 5 e 3 determinados

2 fitas iniciais 6 com 5 determinado e 3 indeterminado 8 com 5 e 3 determinados 2 fitas iniciais 8 com 5 determinado e 3 indeterminado 22 com 5 e 3 determinados

Depois de 30 ciclos: 60 no determinadas e 1.073.741.764 determinadas !

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR

Resultado no gel de agarose Resultado no gel de agarose

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR Condies da PCR Condi Condies da PCR Uma reao tpica de PCR necessita: Uma rea t reao tpica de PCR necessita: DNA (0,01 0,1 g) DNA (0,01 0,1 g) Kit Kit

primer 1 (20 pmol) primer 1 (20 pmol) primer 2 (20 pmol) primer 2 (20 pmol)
Tris-HCl (20mM, pH 8,0) TrisTris-HCl (20mM, pH 8,0) MgCl2 (2mM) MgCl2 (2mM) KCl (25 mM) ou KCl (10 mM) e KCl (25 mM) ou KCl (10 mM) e (NH4)2SO4 (NH4)2SO4 Desoxinucleotdeo trifosfato (50 M Desoxinucleot Desoxinucleotdeo trifosfato (50 M cada: dATP, dCTP, dGTP, dTTP) cada: dATP, dCTP, dGTP, dTTP) DNA polimerase termoestvel DNA polimerase termoest termoestvel (2 unidades) (2 unidades) Volume total Volume total 50 100 L 50 100 L Magnsio: funcionamento da Magn Magnsio: funcionamento da polimerase e especificidade da polimerase e especificidade da reao rea reao KCl: polimerase mais tempo KCl: polimerase mais tempo ligada fita ligada fita (fragmentos maiores) (fragmentos maiores)

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR Condies da PCR Condi Condies da PCR Tpico ciclo de temperaturas: Tpico ciclo de temperaturas:

Termociclador Termociclador
Desnaturao Desnatura Desnaturao Desnaturao Desnatura Desnaturao inicial inicial Anelamento Anelamento Extenso Extenso

94 94 94 2 2

94 94 94 30 30 30 60 60 60 30 30 30 20-30x 2020-30x 72 72 72 1 1

Final Final 72 72 72 5 5

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR

DNA polimerase termoestvel DNA polimerase termoest termoestvel

Bactria Thermus aquaticus Bact Bactria


Descoberta em fontes termais em Yellowstone National Park Descoberta em fontes termais em Yellowstone National Park (Thomas D. Brock) (Thomas D. Brock) Tolera temperaturas entre 50 80 C Tolera temperaturas entre 50 80 C

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR DNA polimerase termoestvel DNA polimerase termoest termoestvel

Taq DNA POLIMERASE


Enzima monomrica com peso molecular de 94 KDa Enzima monom monomrica com peso molecular de 94 KDa Replica o DNA a 74 C Replica o DNA a 74 C Atividade polimerase 5 Atividade polimerase 5 5 3 e exonuclease 5 3 e exonuclease 5 5 5 5 3 3

No realiza atividade exonuclease 3 No realiza atividade exonuclease 3

mutaes no muta mutaes no produto de PCR produto de PCR

Adio de uma base deoxinucleotdeo (geralmente adenosina) Adi de uma base deoxinucleot Adio deoxinucleotdeo (geralmente adenosina) no terminal 3 no terminal 3 3

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR DNA polimerase termoestvel DNA polimerase termoest termoestvel

Pyrococcus furiosus (Pfu)


DNA polimerase dimrica e com forte atividade exonuclesica 3 DNA polimerase dim dimrica e com forte atividade exonucle exonuclesica 3 3 Mais termoestvel que a Taq (meia-vida de 6,7 h a 95 C) Mais termoest termoestvel que a Taq (meia(meia-vida de 6,7 h a 95 C) Sntese de fragmentos de at 13 kpb Sntese de fragmentos de at 13 kpb at 5 5

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR Eficincia na reao de PCR Eficincia na rea de PCR reao Hot Start PCR e anticorpo anti Hot Start PCR e anticorpo anti PCR DNA polimerase DNA polimerase Vantagem: Vantagem: Evitar amplificao de produtos Evitar amplifica de produtos amplificao inespecficos inespec inespecficos aumento da aumento da especificidade e do rendimento da especificidade e do rendimento da reao de amplificao rea de amplifica reao amplificao

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR Eficincia na reao de PCR Eficincia na rea de PCR reao Contaminantes na amostra de DNA Contaminantes na amostra de DNA inibio da reao inibi da rea inibio reao

Reconhecimento correto da seqncia complementar na fita molde Reconhecimento correto da seq seqncia complementar na fita molde

Composto por 17 a 30 nucleotdeos de tamanho e 50 % de GC Composto por 17 a 30 nucleot nucleotdeos de tamanho e 50 % de GC Temperatura de anelamento do par de primers aproximadamente iguais Temperatura de anelamento do par de primers aproximadamente iguais Evitar primer com seqncia complementar Evitar primer com seq seqncia complementar
5-GAGATCGATGCATCGATCTC-3 GAGATCGATGCATCGATCTC5-GAGATCGATGCATCGATCTC-3

Ex: Ex:

5-GATCGATCGATACGTGATCC-3 Primer 1 GATCGATCGATACGTGATCC5-GATCGATCGATACGTGATCC-3 Primer 1 Primer 2 3- GCACTAGGTCGATCGATGC -5 Primer 2 3- GCACTAGGTCGATCGATGC -5 PCR PCR 5-GATCGATCGATACGTGATCCAGCTAGCTACG-3 GATCGATCGATACGTGATCCAGCTAGCTACG5-GATCGATCGATACGTGATCCAGCTAGCTACG-3 3-CTAGCTAGCTATGCACTAGGTCGATGCATGC-5 CTAGCTAGCTATGCACTAGGTCGATGCATGC3-CTAGCTAGCTATGCACTAGGTCGATGCATGC-5

5-GAGATCGATGCATCGATCTC-3 5-GAGATCGATGCATCGATCTC-3 GAGATCGATGCATCGATCTC-

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR Sntese de primers Sntese de primers

G-

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR Pareamento dos primers Pareamento dos primers

Amplificao especfica Amplifica espec Amplificao especfica


5 3 5 3 3 5 3 5

Amplificao inespecfica Amplifica inespec Amplificao inespecfica


5 3 5 3 3 5 5 3

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR Utilizao dos primers inespecficos Utiliza dos primers inespec Utilizao inespecficos

Procura de genes homlogos Procura de genes hom homlogos

Insero de stios Inser de s Insero stios de reconhecimento de reconhecimento de enzimas de de enzimas de restrio restri restrio

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR

PCR no diagnstico de doenas genticas PCR no diagn diagnstico de doen gen doenas genticas

Vantagem Vantagem
Sangue Sangue

Pouca quantidade de DNA Pouca quantidade de DNA requerida para o diagnstico requerida para o diagn diagnstico

Clulas da bochecha Clulas da bochecha

Membrana corinica Membrana corinica

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR

Vrias tcnicas baseadas em PCR para deteco de mutaes Vrias t tcnicas baseadas em PCR para detec de muta deteco mutaes

Mutaes de Muta Mutaes de insero/deleo inser o/dele insero/deleo

Mutaes de ponto Muta Mutaes de ponto

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR

Mutaes de Muta Mutaes de insero/deleo inser o/dele insero/deleo

Sndrome de Waardenburg doen heredit Sndrome de Waardenburg doena hereditria caracterizada por perda de doena hereditria caracterizada por perda de audio e pigmentao anormal (cabelo e pele) audi e pigmenta anormal (cabelo e pele) audio pigmentao

Tipo I: deleo de 18 pb no gene PAX-3 Tipo I: dele deleo de 18 pb no gene PAXPAX-3 (codificante de um fator de transcrio regulatrio do desenvolvimento embrionrio) (codificante de um fator de transcri transcrio regulat regulatrio do desenvolvimento embrion embrionrio)
Normal Mutante

156 pb 138 pb

PCR utilizando primers que flanqueiam a PCR utilizando primers que flanqueiam a regio gnica que contm a deleo regio gnica que cont a dele contm deleo Resultados visualizados em gel de Resultados visualizados em gel de poliacrilamida ou agarose poliacrilamida ou agarose

10

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR

Mutaes de ponto Muta Mutaes de ponto

PCR alelo-especfico PCR alelo- espec alelo-especfico

Deteco de mudanas em Detec Deteco de mudan mudanas em um nico nucleotdeo um nico nucleot nucleotdeo

Exemplo: anemia falciforme Exemplo: anemia falciforme (mudana no gene da -globina) (mudan no gene da -globina) (mudana

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR

Clonando os produtos de PCR Clonando os produtos de PCR

11

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR

RT-PCR RTRT-PCR Amplificao de molculas de cDNA (DNA complementar) a partir do mRNA Amplifica de mol Amplificao molculas de cDNA (DNA complementar) a partir do mRNA Enzimas Transcriptase Reversa e Taq-polimerase / Primer oligo-dN Enzimas Transcriptase Reversa e TaqTaq-polimerase / Primer oligooligo-dN

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR

RT-PCR RTRT-PCR

RT-PCR pode ser usado para clonagem, construo de bibliotecas RTRT-PCR pode ser usado para clonagem, constru de bibliotecas construo de cDNA e sntese de sondas nucleotdicas de cDNA e s sntese de sondas nucleot nucleotdicas

12

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR

Real-time PCR RealReal-time PCR PCR em tempo real realiza a quantificao de DNA ou RNA de maneira precisa e com PCR em tempo real realiza a quantifica de DNA ou RNA de maneira precisa e com quantificao maior reprodutibilidade (valores determinados na fase exponencial) maior reprodutibilidade (valores determinados na fase exponencial) exponencial)
3

2 1

Ponto CT: permite a Ponto CT: permite a quantificao exata quantifica quantificao exata baseada na fluorescncia baseada na fluorescncia

1 linha basal (sem produtos de PCR suficientes para detectar fluorescncia) 1 linha basal (sem produtos de PCR suficientes para detectar fluorescncia) fluorescncia) 2 fase log (quantidade de produtos de PCR dobra a cada ciclo) 2 fase log (quantidade de produtos de PCR dobra a cada ciclo) 3 fase plat (nmero de produtos no aumenta mais) 3 fase plat (n (nmero de produtos no aumenta mais)

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR

Real-time PCR RealReal-time PCR A emisso dos compostos fluorescentes gera um sinal que aumenta na proporo A emisso dos compostos fluorescentes gera um sinal que aumenta na propor proporo direta da quantidade de produto da PCR direta da quantidade de produto da PCR Instrumentao: termociclador com sistema tico para excitao de fluorescncia e Instrumenta Instrumentao: termociclador com sistema tico para excita de fluorescncia e excitao coleta de emisso + computador para aquisio e anlise dos dados coleta de emisso + computador para aquisi e an aquisio anlise dos dados

Fluorforos Fluor Fluorforos

molculas que absorvem e emitem luz em comprimentos de onda mol molculas que absorvem e emitem luz em comprimentos de onda especficos (SYBR Green / TaqMan ) espec especficos (SYBR Green / TaqMan )

13

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR

Real-time PCR RealReal-time PCR SYBR Green SYBR Green

Emite fluorescncia verde aps ligao entre a fita dupla de DNA Emite fluorescncia verde ap liga entre a fita dupla de DNA aps ligao Vantagens Vantagens facilidade de uso, baixo custo e sensibilidade facilidade de uso, baixo custo e sensibilidade

Desvantagem Desvantagem superestimativa da [ ] do fragmento alvo superestimativa da [ ] do fragmento alvo (ligao em todas as molculas de DNA presentes) (liga em todas as mol (ligao molculas de DNA presentes)

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR

Real-time PCR RealReal-time PCR TaqMan TaqMan

Sonda (fragmento nucleotdico que hibridiza em molculas de DNA ou RNA) que Sonda (fragmento nucleot nucleotdico que hibridiza em mol molculas de DNA ou RNA) que detecta seqncias especficas nas regies amplificados por PCR detecta seq seqncias espec especficas nas regies amplificados por PCR F F fluorforo (molcula que emite fluorescncia) fluor fluorforo (mol (molcula que emite fluorescncia)

Q Q quencher (molcula que recebe energia do fluorforo na forma de luz e a quencher (mol (molcula que recebe energia do fluor fluorforo na forma de luz e a dissipa na forma de calor) dissipa na forma de calor)

Fluorescncia gerada aps a atividade exonuclease 5 Fluorescncia gerada ap a atividade exonuclease 5 aps 5

3 da Taq-polimerase 3 da TaqTaq-polimerase

14

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR

Real-time PCR RealReal-time PCR TaqMan TaqMan

REAO EM CADEIA DA POLIMERASE - PCR REA REAO EM CADEIA DA POLIMERASE - PCR

Aplicaes da tcnica de PCR Aplica Aplicaes da t tcnica de PCR


A Reao em Cadeia da Polimerase revolucionou a Biologia Molecular e pode ser usada em: A Rea Reao em Cadeia da Polimerase revolucionou a Biologia Molecular e pode ser usada em: pode

Clonagem molecular Clonagem molecular Seqenciamento de DNA Seq Seqenciamento de DNA Arqueologia Arqueologia Gentica forense Gen Gentica forense Patologia clnica Patologia cl clnica Diagnstico de doenas genticas Diagn Diagnstico de doen gen doenas genticas Anlises de fingerprint de populaes e comunidades An Anlises de fingerprint de popula populaes e comunidades Anlises genmicas An Anlises genmicas

15