THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 282, NO. 13, pp.

9358 9363, March 30, 2007 2007 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

STAT3 Regulates Cytokine-mediated Generation of Inflammatory Helper T Cells*

Received for publication, December 28, 2006, and in revised form, January 16, 2007 Published, JBC Papers in Press, February 3, 2007, DOI 10.1074/jbc.C600321200

Xuexian O. Yang, Athanasia D. Panopoulos1, Roza Nurieva2,3, Seon Hee Chang3, Demin Wang, Stephanie S. Watowich, and Chen Dong4 From the Department of Immunology, M.D. Anderson Cancer Center, Houston, Texas 77030 and the Blood Research Institute, Blood Center of Wisconsin, Milwaukee, Wisconsin 53226
Interleukin-17 (IL-17)-producing helper T (TH) cells, named as THIL-17, TH17, or inflammatory TH (THi), have been recently identified as a novel effector lineage. However, how cytokine signals mediate THi differentiation is unclear. We found that IL-6 functioned to up-regulate IL-23R and that IL-23 synergized with IL-6 in promoting THi generation. STAT3, activated by both IL-6 and IL-23, plays a critical role in THi development. A hyperactive form of STAT3 promoted THi development, whereas this differentiation process was greatly impaired in STAT3-deficient T cells. Moreover, STAT3 regulated the expression of retinoic acid receptor-related orphan receptor -T (ROR t), a THi-specific transcriptional regulator; STAT3 deficiency impaired ROR t expression and led to elevated expression of T-box expressed in T cells (T-bet) and Forkhead box P3 (Foxp3). Our data thus demonstrate a pathway whereby cytokines regulate THi differentiation through a selective STAT transcription factor that functions to regulate lineage-specific gene expression.

CD4 helper T (TH)5 cells are essential organizers in immune responses. Upon activation, naive TH cells differentiate into effector cells that have been historically classified into two lineages, TH1 and TH2, based on their cytokine secretion and immune regulatory function (1, 2). TH1 cells secret IFNand regulate cellular immunity, whereas TH2 cells produce IL-4, IL-5, and IL-13 and mediate the humoral response. The cytokine microenvironment during TH activation determines TH effector differentiation through selective signal transducer

* This work was supported by research grants from the National Institutes of
Health (to C. D. and D. W.), American Cancer Society (to D. W.), and M. D. Anderson Cancer Center (to S. S. W.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 Supported by an National Institutes of Health training grant and an American Legion Auxiliary Award. 2 Recipient of a scientist development grant from the American Heart Association. 3 Recipients of postdoctoral fellowships from the Arthritis Foundation. 4 A Cancer Research Institute Investigator and an M. D. Anderson Cancer Center Trust Fellow. To whom correspondence should be addressed. Fax: 713563-0604; E-mail: cdong@mdanderson.org. 5 The abbreviations used are: TH, CD4 helper T cells; THi, inflammatory TH; STAT, signal transducer and activator of transcription; IL, interleukin; TGF- , transforming growth factor ; TNF- , tumor necrosis factor ; IFN- , interferon ; ROR t, RAR-related orphan receptor -T; RAR, retinoic acid receptor; T-bet, T-box expressed in T cells; GATA3, GATA-binding protein 3; FoxP3, Forkhead box P3; FACS, fluorescence-activated cell sorter; GFP, green fluorescent protein; MSCV, murine stem cell virus; IRES, internal ribosome entry site; CFA, complete Freunds adjuvant; WT, wild type.

and activator of transcription (STAT) proteins (3, 4). TH1 differentiation and IFN- production is promoted by IL-12, a heterodimeric cytokine produced by activated antigen-presenting cells that signal through STAT4. The IFN- -STAT1 pathway in turn sustains TH1 development, leading to the induction of transcription factor T-bet. On the other hand, IL-4, secreted by activated T cells, drives TH2 polarization in a STAT6-dependent manner, resulting in activation of the transcription factor GATA3. Recently, a third subset of TH cells, named as THIL-17, TH17, or inflammatory TH (THi), which produce IL-17, was identified by us as well as other investigators to mediate a pathogenic inflammatory response (57). THi cells were also found to produce IL-17F and IL-22 (5, 79). IL-23, sharing a p40 unit with IL-12, has been first found to regulate IL-17 expression and the development or expansion of THi cells in vitro (57). More recently, several groups showed that TGF- in the context of IL-6 and other inflammatory cytokines supports THi differentiation in vitro, independent of IL-23 (10 12), possibly at least in part by regulating the chromatin remodeling of the IL-17-IL17F locus (13). IL-1 and TNF- may also be involved in promoting THi development or in regulating expression of IL-17 at the effector phase (11, 14). The downstream signaling pathways, such as STAT, that selectively mediate THi generation are unclear. STAT1 appears to negatively regulate THi differentiation (7), whereas STAT4 or STAT6 were not involved (6). Recently, Socs3-deficient T cells were found to exhibit enhanced IL-17 expression; this effect was associated with enhanced activity of STAT3 in response to IL-23 that could bind to IL-17 and IL-17F promoters (15). STAT3 has critical functions in the immune system, including control of dendritic cell production, inhibition of macrophage inflammatory signaling, and regulation of steady state and emergency granulopoiesis (16 18). However, the precise physiological function of STAT3 in THi lineage differentiation has not been directly addressed. Whether STAT5, another STAT protein that has been shown activated by IL-23R (19), has any function in THi differentiation is also unclear. In this study, we show that IL-6 up-regulates expression of IL-23R and that IL-23 synergizes with IL-6 in promoting THi differentiation. Retroviral expression of a hyperactive STAT3 enhances THi cell development. STAT3 deficiency in CD4 T cells results in impaired THi development and a deficiency in ROR t, a THi-specific transcription factor recently identified (20). These data indicate that STAT3 is a cytokine-activated essential regulator in THi development.
VOLUME 282 NUMBER 13 MARCH 30, 2007

Downloaded from www.jbc.org at Nagasaki University Library, on December 2, 2011

9358 JOURNAL OF BIOLOGICAL CHEMISTRY

STAT3 Regulates Generation of IL-17-expressing T Cells

MATERIALS AND METHODS
Mice and ImmunizationIl-6- and Ifng-deficient mice were purchased from Jackson Laboratories. Stat3 fl and Tie2-Cre mice were generously provided by Drs. Takeda and Koni (21, 22) and were bred to yield fl/ Cre and Cre littermates as described (18). Mice were housed in the specific pathogen-free animal facility at M.D. Anderson Cancer Center, and the animal experiments were performed using protocols approved by the Institutional Animal Care and Use Committee at M.D. Anderson Cancer Center. For immunization, Il-6 knock-out and C57BL/6 mice were inoculated with MOG3555 peptide in CFA. 57 days later, splenocytes were collected from the immunized mice and restimulated with MOG peptide for 3 days. In the final 5 h, Golgi-stop (BD Biosciences) was added, and IL-17- and IFN- -producing cells were analyzed using a BD CytoFix/CytoPerm intracellular staining kit (BD Biosciences) following the manufacturers instructions. TH DifferentiationNaive CD4 T cells were isolated from spleen and lymph nodes of various strains of mice by AutoMACS (Miltenyi Biotec) selection of CD62L or FACS sorting of CD4 CD62L CD44loCD25 T cells after enriching CD4 T cells by negative selection using rat anti-mouse antibodies for CD8, B220, and I-A/I-E and Qiagen BioMag goat anti-rat IgG beads. T cells were activated with plate-bound anti-CD3 (2 g/ml) and anti-CD28 (2 g/ml) and 50 units/ml IL-2 in the presence or absence of 20 ng/ml IL-6 (Peprotech), 50 ng/ml IL-23 (R&D systems), 2 ng/ml TGF- (Sigma-Aldrich), 10 g/ml anti-IL-4 (11B11), or 10 g/ml anti-IFN- (XMG1.2), 10 ng/ml TNF- , 10 ng/ml IL-1 , or cocktails of these stimuli, as indicated. 4 days after activation, cells were restimulated with 500 ng/ml ionomycin and 50 ng/ml phorbol 12-myristate 13-acetate (Sigma-Aldrich) in the presence of Golgi-stop for 5 h, after which IL-17- and IFN- -producing cells were analyzed using intracellular staining as described above. Intracellular staining for FoxP3 was performed by using a FoxP3 staining kit (eBioscience). Retroviral TransductionSTAT3C (a gift from J. Darnells laboratory) (24) was cloned into the bicistronic retroviral vector pGFP-RV (25). Stat5A and Stat5A 1*6 sequences were cloned into a bicistronic retrovirus MSCV-IRES-GFP vector (26). The expression of the cloned gene and green fluorescent protein (GFP) is under murine stem cell virus (MSCV) promoter control. The ecotropic virus-producing cells GP E86 (27) were generated as described previously (28). Naive CD4 T cells were activated under the indicated conditions for 2 days and infected with viral supernatants produced by the stable lines as described previously (25). 2 4 days after infection, the cells were tested for IL-17 and IFN- expression using intracellular staining. In some experiments, GFP cells were sorted by FACS and subjected to analysis for gene expression. Quantitative Real-time PCRTotal RNA was prepared from T cells using TRIzol reagent (Invitrogen). cDNA was synthesized using SuperScript reverse transcriptase under priming of oligo(dT) (Invitrogen), and gene expression was examined in a Bio-Rad iCycler optical system using the iQ SYBR green realtime PCR kit (Bio-Rad Laboratories, Inc.). The data were normalized to -actin reference. The primers used were (5 to 3 ):
MARCH 30, 2007 VOLUME 282 NUMBER 13

IFN- , forward, GATGCATTCATGAGTATTGCCAAGT, and reverse, GTGGACCACTCGGATGAGCTC; T-bet, forward, CAACAACCCCTTTGCCAAAG, and reverse, TCCCCCAAGCAGTTGACAGT; GATA3, forward, AGAACCGGCCCCTTATGAA, and reverse, AGTTCGCGCAGGATGTCC; and -actin, forward, GACGGCCAGGTCATCACTATTG, and reverse, AGGAAGGCTGGAAAAGAGCC. The primers for IL-12R 2, IL-23R, IL-17, IL-17F, ROR t, Foxp3, and IL-22 were synthesized as described previously (7, 8, 20, 29, 30).

RESULTS AND DISCUSSION IL-6 Induces IL-23 Responsiveness during THi Differentiation IL-6 and IL-23 are both induced in innate immune responses to infectious agents. IL-23 was previously shown to be important in the development or expansion of THi cells in vivo (5), whereas IL-6 is potent in THi development in vitro and has recently been shown to be necessary in ROR t-dependent IL-17 expression in the lamina propria (20). To further examine whether IL-6 is required for THi differentiation in vivo, C57BL/6 and Il-6 knock-out mice were immunized with MOG peptide and CFA. 57 days later, splenocytes collected from the immunized mice were restimulated with MOG peptide and stained for CD4, IL-17, and IFN- . In Il-6 knock-out mice, THi cells were greatly reduced relative to WT mice, whereas IFN- -producing TH1 cells were only moderately affected (Fig. 1A). IL-6 and IL-23 are thus both important in regulation of THi cells in vivo. We attempted to analyze their functional relationship during THi differentiation. Because IFN- has been shown as a potent inhibitor of THi differentiation (6, 7), we next isolated naive TH cells from IFN- -deficient mice and activated them with plate-bound anti-CD3 and anti-CD28 in the presence of different cytokines and/or cytokine-neutralizing antibodies. 4 5 days after activation, the differentiated cells were analyzed by intracellular staining. IL-6 increased the number of IL-17-expressing THi cells, which was more pronounced in the presence of anti-IL-4 or, even more dramatically, TGF- (Fig. 1B). Although IL-23 was a poor inducer of THi differentiation by itself, the combination of IL-6 and IL-23 led to greatly enhanced development of THi cells (Fig. 1B). To substantiate the synergy between IL-6 and IL-23, we purified CD4 CD25CD62LhiCD44lo naive TH cells from C57BL/6 mice and activated them with anti-CD3 and anti-CD28 in the presence of IL-6 and/or IL-23 for 5 days and analyzed THi differentiation by intracellular staining. IL-6 weakly induced THi differentiation (Fig. 1C). Although IL-23 had no effect on its own, it synergized with IL-6 in promoting generation of IL-17-expressing TH cells (Fig. 1C). We also observed synergy of IL-6 and IL-23 in THi differentiation of naive OT-II cells activated with antigen-presenting cells in the presence or absence of TGF- (data not shown). Our data thus not only support a unique function of IL-6 in initiating THi differentiation but also, more importantly, demonstrate a synergistic action of IL-6 and IL-23. To further understand why IL-23 only functions in IL-6treated cells, we stimulated naive TH cells with anti-CD3 and anti-CD28 for 48 h in the presence of IL-6 and/or IL-23 and examined expression of IL-23R by real-time RT-PCR analysis. Interestingly, whereas T cells after activation moderately upregulated IL-23R mRNA in the presence or absence of IL-23,
JOURNAL OF BIOLOGICAL CHEMISTRY

Downloaded from www.jbc.org at Nagasaki University Library, on December 2, 2011

9359

STAT3 Regulates Generation of IL-17-expressing T Cells

Downloaded from www.jbc.org at Nagasaki University Library, on December 2, 2011

FIGURE 1. IL-6 and IL-23 synergize in regulating THi cell development. A, Il-6 knock-out (IL-6 KO) or B6 mice were immunized with MOG/CFA. 57 days after immunization, splenocytes were harvested from the immunized mice and restimulated with MOG peptide for 3 days. Cells expressing IL-17 and IFN- were accessed using intracellular staining. Unimmunized B6 control is shown as B6 noim. The experiments were repeated twice with similar results. B, CD4 CD62Lhi T cells isolated from Ifng knock-out mice using AutoMACS were activated with plate-bound anti-CD3 and anti-CD28 in the presence or absence of indicated cytokines and/or cytokine-neutralizing antibodies. IL-17-producing cells were tested using intracellular staining. The experiments were repeated twice with similar results. NO, medium. C, FACS-sorted CD4 CD25-CD62LhiCD44lo naive T cells from C57BL/6 mice were activated with plate-bound anti-CD3 and anti-CD28 in the presence of indicated cytokines, and IL-17-producing cells were assessed using intracellular staining. D, naive T cells isolated as in C were activated with plate-bound anti-CD3 and anti-CD28 in the absence or presence of IL-23 or IL-6 for 24 h, and IL-23R mRNA expression was examined by real-time PCR. The data shown were normalized to expression of a reference gene -actin, and the expression level in naive T cells was referred as 1.

IL-6 increased the expression of IL-23R in activated T cells by 120-fold (Fig. 1D). Our above results altogether indicate that THi differentiation is initially mediated by IL-6, which induces IL-23 responsiveness to enhance this differentiation STAT3 Hyperactivation Enhances THi Differentiation STAT proteins are key factors mediating cytokine signals during TH1 and TH2 differentiation. Although STAT3 is an important target of IL-6, IL-23 has been shown to activate STAT1, STAT3, STAT4, and STAT5 proteins (19). Since STAT1 and STAT4 are not involved in THi differentiation (6, 7), we first examined STAT5. We overexpressed WT (STAT5A WT) or a constitutively active form (STAT5A 1*6) (31) of STAT5A using the bicistronic retroviral vector MSCV-IRESGFP during TH differentiation. Naive CD4 T cells isolated from C57BL/6 mice were activated with plate-bound anti-CD3, anti-CD28, and IL-2 in the presence of various polarizing cytokines or cytokine blockers, infected on day 2, and subsequently further differentiated under the polarizing conditions. On day 5, IL-17 expression was analyzed in transduced CD4 cells. Under neutral or THi favorable conditions, neither WT STAT5A nor STAT5A 1*6 had any effect on THi development when compared with cells infected with a control virus (data not shown).

We next went on to determine the role of STAT3, which could be activated by both IL-6 and IL-23 (18, 22), by overexpressing a hyperactive STAT3 form (STAT3C) (24). Naive CD4 T cells isolated from Ifng knock-out mice were activated as above and infected with STAT3C and control viruses. Under neutral conditions or in the presence of TGF- or anti-IL-4, STAT3C increased IL-17-expressing cells when compared with those infected with a control vector. Since the activation of STAT3C still requires cytokine-mediated phosphorylation, in the presence of IL-6 and IL-23 or under THi differentiation conditions, STAT3C greatly increased the numbers of IL-17producing cells (Fig. 2A). Similarly, when we infected wild-type CD4 T cells, STAT3C also enhanced THi differentiation under THi but not neutral condition (Fig. 2B). THi cells were also reported to produce IL-17F (5, 7). In wild-type cells transduced with STAT3C, when compared with those infected by a control virus, IL-17F expression was also greatly enhanced (Fig. 2C) when we used an antibody specific for IL-17F.6 To further assess the effect of STAT3C during TH cell differentiation, expression of TH lineage-specific genes was exam-

S. H. Chang and C. Dong, unpublished data.

9360 JOURNAL OF BIOLOGICAL CHEMISTRY

VOLUME 282 NUMBER 13 MARCH 30, 2007

STAT3 Regulates Generation of IL-17-expressing T Cells

Downloaded from www.jbc.org at Nagasaki University Library, on December 2, 2011

FIGURE 2. STAT3 hyperactivation promotes THi differentiation in vitro. CD4 CD62Lhi naive T cells from Ifng-deficient (A) or WT (B) mice were purified by AutoMACS and activated under indicated conditions for 2 days and infected with STAT3C or control viruses. 2 days after infection and culture under the indicated differentiation conditions, the cells expressing IL-17 were examined by intracellular staining. The analysis was gated on CD4 GFP cells. The experiment was repeated at least three times with consistent results. C, naive CD4 T cells were activated under THi conditions and infected with STAT3C or control viruses, and the cells expressing IL-17F were analyzed using intracellular staining on gated CD4 GFP cells. D, naive CD4 T cells were activated under THi conditions and infected with STAT3C or control viruses under THi conditions. After infection, CD4 GFP cells were sorted by FACS, and gene expression was measured by quantitative real-time RT-PCR. The data shown are -fold changes of STAT3C versus vector control normalized to expression of a reference gene -actin.

ined in wild-type TH cells that were transduced with vector or STAT3C virus and differentiated under THi conditions. Using quantitative real-time PCR, when compared with vector control, STAT3C transduction resulted in up-regulation of IL-23R and THi cytokines IL-17 and IL-17F and suppression of TH1specific IL-12R 2 and IFN- (Fig. 2D). Remarkably, IL-22, a cytokine expressed in THi cells that may synergize with IL-17 in inflammation (8, 9), was highly up-regulated in STAT3C-transduced TH cells. Moreover, STAT3 overactivation also reduced GATA3 and T-bet expression but increased the expression of ROR t, a transcription regulator of THi differentiation (20). Thus, STAT3 promotes the THi program and inhibits TH1 and TH2 programs. THi Differentiation Is STAT3-dependentOur data indicate a potential role of STAT3 in regulating cytokine-mediated THi development. We further examined the role of STAT3 in THi development by using Stat3-deficient CD4 T cells. Mice with hematopoietic and endothelial-specific Stat3 deletion were generated by breeding floxed STAT3 (fl) (22) and Tie2-Cre (21) strains. Deficiency of STAT3 expression in hematopoietic cells from these mice was confirmed by Western blot (data not shown). Naive CD4 CD25-CD62LhiCD44lo T cells isolated
MARCH 30, 2007 VOLUME 282 NUMBER 13

from fl/ Cre (Stat3 KO) and Cre (WT) mice were differentiated in vitro in the presence of TGF- , IL-6, IL-23, antiIFN- , and anti-IL-4 or TGF- , IL-6, IL-1 , and TNF- as described previously (11). Consistently in both systems, expression of IL-17 by Stat3-deficient T cells was greatly impaired, and expression of IFN- was moderately increased (Fig. 3A), indicating an essential role of STAT3 in THi differentiation in vitro. In addition to the above cytokine measurement, we also performed real-time RT-PCR analysis on Stat3-sufficient and -deficient TH cells that were activated under conditions favoring THi differentiation. Consistent with the previous data, we observed greatly reduced IL-17 as well as IL-17F and IL-22 expression and moderately elevated IFN- expression in Stat3deficient TH cells (Fig. 3C). IL-23 receptor mRNA expression was down-regulated, whereas IL-12R 1 was up-regulated in the absence of STAT3 (Fig. 3C). Most importantly, expression of ROR t was greatly reduced in Stat3-deficient TH cells, indicating that STAT3 is necessary for ROR t expression during THi differentiation. Moreover, expression of T-bet and Foxp3 was increased (Fig. 3C), suggesting that STAT3 may repress TH1 and inducible regulatory T cell differentiation. Indeed,
JOURNAL OF BIOLOGICAL CHEMISTRY

9361

STAT3 Regulates Generation of IL-17-expressing T Cells

Downloaded from www.jbc.org at Nagasaki University Library, on December 2, 2011

FIGURE 3. THi differentiation is dependent on STAT3. AC, FACS-sorted CD4 CD25-CD62LhiCD44lo T cells from Stat3 fl/ Tie2-Cre mice (STAT3 KO) or littermate Cre mice (WT) were differentiated under THi conditions. 4 days after polarization, the differentiated cells were assessed for IL-17 or IFN- production (A) or FoxP3 expression (B) using intracellular staining. Some cells were restimulated with plate-bound anti-CD3, and messenger RNA expression was analyzed by quantitative real-time RT-PCR (C). The data shown are -fold changes of STAT3 KO versus WT control normalized to expression of the -actin reference. D, memory CD4 T cells were isolated from Stat3 KO mice or WT littermate controls were activated with plate-bound anti-CD3 for 24 h, and the cells producing IL-17 or IFN- were assessed by intracellular staining. The data represent at least two independent experiments with consistent results.

there was a greater number of Foxp3-expressing TH cells in the absence of STAT3 after T cell activation (Fig. 3B), suggesting that the ability of IL-6 to suppress inducible regulatory T cells generation is dependent on STAT3. To understand whether STAT3 affects THi generation in vivo, CD62LloCD4 memory T cells were analyzed for expression of IL-17 and IFN- . In memory T cells, THi and TH1 populations exhibited a similar pattern as those from in vitro differentiation, i.e. impaired IL-17 expression and enhanced IFN- expression in Stat3 knock-out versus wild-type (Fig. 3D). In addition, expression of IL-17 by T cells was also impaired in the absence of STAT3 (data not shown). Thus, STAT3 may be necessary for THi differentiation in vivo. THi cells have been recently identified as a novel lineage of TH cells that mediate inflammatory responses. The molecular programs underlying THi differentiation are largely unclear. In our current study, we find a synergistic function of IL-6 and IL-23 in THi differentiation. STAT3, activated by IL-6 and IL-23, is both necessary and sufficient for THi differentiation. Therefore, STAT3 may serve as a selective STAT protein in cytokine-mediated THi cell differentiation. It is important to determine how STAT3 specifically regulates this process. An earlier report found STAT3 binding to the promoters of Il-17

and Il-17F genes, which was enhanced in Socs3-deficient T cells (15). This observation suggests that STAT3 may function downstream of IL-23 by directly activating Il-17 and Il-17F gene transcription. Although this may be the case for effector/ memory cells, our current study reveals another, perhaps more critical, function of STAT3 during early T cell differentiation in regulating the expression of ROR t, a THi-specific transcription regulator. Since ROR t overexpression promoted THi differentiation and its deficiency greatly impaired this process (20), it may serve as a lineage-specifying master regulator in THi development. STAT3 may function, analogous to STAT4 for TH1 and STAT6 in TH2, to regulate lineage-specific expression of ROR t, which then in turn results in terminal differentiation of THi cells. Taken together, our observations suggest that STAT3 is an upstream regulator of ROR t. In addition, Foxp3 expression was elevated in the absence of STAT3, correlating with a crucial role of IL-6 in suppressing TGF- induced regulatory T cell differentiation (12). The inhibitory function of STAT3 or its downstream target-ROR t in Treg cells remains to be further examined in the future. In conclusion, we show that STAT3 is an essential regulator activated by cytokine signals to control lineage commitment of THi cells. This adds another function of STAT3 in inflammaVOLUME 282 NUMBER 13 MARCH 30, 2007

9362 JOURNAL OF BIOLOGICAL CHEMISTRY

STAT3 Regulates Generation of IL-17-expressing T Cells

tion by inducing a subset of adaptive pro-inflammatory cells. STAT3 inhibitors may have additional potential in therapeutic intervention of inflammatory diseases.
AcknowledgmentsWe thank the Dong laboratory members for their help. REFERENCES
1. Mosmann, T. R., and Coffman, R. L. (1989) Annu. Rev. Immunol. 7, 145173 2. Dong, C., and Flavell, R. A. (2000) Arthritis Res. 2, 179 188 3. Glimcher, L. H., and Murphy, K. M. (2000) Genes Dev. 14, 16931711 4. Dong, C. (2006) Nat. Rev. Immunol. 6, 329 333 5. Langrish, C. L., Chen, Y., Blumenschein, W. M., Mattson, J., Basham, B., Sedgwick, J. D., McClanahan, T., Kastelein, R. A., and Cua, D. J. (2005) J. Exp. Med. 201, 233240 6. Park, H., Li, Z., Yang, X. O., Chang, S. H., Nurieva, R., Wang, Y. H., Wang, Y., Hood, L., Zhu, Z., Tian, Q., and Dong, C. (2005) Nat. Immunol. 6, 11331141 7. Harrington, L. E., Hatton, R. D., Mangan, P. R., Turner, H., Murphy, T. L., Murphy, K. M., and Weaver, C. T. (2005) Nat. Immunol. 6, 11231132 8. Chung, Y., Yang, X., Chang, S. H., Ma, L., Tian, Q., and Dong, C. (2006) Cell Res. 16, 902907 9. Liang, S. C., Tan, X.-Y., Luxenberg, D. P., Karim, R., Dunussi-Joannopoulos, K., Collins, M., and Fouser, L. A. (2006) J. Exp. Med. 203, 22712279 10. Mangan, P. R., Harrington, L. E., OQuinn, D. B., Helms, W. S., Bullard, D. C., Elson, C. O., Hatton, R. D., Wahl, S. M., Schoeb, T. R., and Weaver, C. T. (2006) Nature 441, 231234 11. Veldhoen, M., Hocking, R. J., Atkins, C. J., Locksley, R. M., and Stockinger, B. (2006) Immunity 24, 179 189 12. Bettelli, E., Carrier, Y., Gao, W., Korn, T., Strom, T. B., Oukka, M., Weiner, H. L., and Kuchroo, V. K. (2006) Nature 441, 235238 13. Akimzhanov, A. M., Yang, X. O., and Dong, C. (2007) J. Biol. Chem. 282, 5969 5972 14. Sutton, C., Brereton, C., Keogh, B., Mills, K. H. G., and Lavelle, E. C. (2006) J. Exp. Med. 203, 16851691 15. Chen, Z., Laurence, A., Kanno, Y., Pacher-Zavisin, M., Zhu, B. M., Tato, C., Yoshimura, A., Hennighausen, L., and OShea, J. J. (2006) Proc. Natl. Acad. Sci. U. S. A. 103, 8137 8142 Laouar, Y., Welte, T., Fu, X.-Y., and Flavell, R. A. (2003) Immunity 19, 903912 Takeda, K., Clausen, B. E., Kaisho, T., Tsujimura, T., Terada, N., Forster, I., and Akira, S. (1999) Immunity 10, 39 49 Panopoulos, A. D., Zhang, L., Snow, J. W., Jones, D. M., Smith, A. M., El Kasmi, K. C., Liu, F., Goldsmith, M. A., Link, D. C., Murray, P. J., and Watowich, S. S. (2006) Blood 108, 36823690 Parham, C., Chirica, M., Timans, J., Vaisberg, E., Travis, M., Cheung, J., Pflanz, S., Zhang, R., Singh, K. P., Vega, F., To, W., Wagner, J., OFarrell, A.-M., McClanahan, T., Zurawski, S., Hannum, C., Gorman, D., Rennick, D. M., Kastelein, R. A., de Waal Malefyt, R., and Moore, K. W. (2002) J. Immunol. 168, 5699 5708 Ivanov, I. I., McKenzie, B. S., Zhou, L., Tadokoro, C. E., Lepelley, A., Lafaille, J. J., Cua, D. J., and Littman, D. R. (2006) Cell 126, 11211133 Koni, P. A., Joshi, S. K., Temann, U. A., Olson, D., Burkly, L., and Flavell, R. A. (2001) J. Exp. Med. 193, 741754 Takeda, K., Kaisho, T., Yoshida, N., Takeda, J., Kishimoto, T., and Akira, S. (1998) J. Immunol. 161, 4652 4660 Cho, M. L., Kang, J. W., Moon, Y. M., Nam, H. J., Jhun, J. Y., Heo, S. B., Jin, H. T., Min, S. Y., Ju, J. H., Park, K. S., Cho, Y. G., Yoon, C. H., Park, S. H., Sung, Y. C., and Kim, H. Y. (2006) J. Immunol. 176, 56525661 Bromberg, J. F., Wrzeszczynska, M. H., Devgan, G., Zhao, Y., Pestell, R. G., Albanese, C., and Darnell, J. E., Jr. (1999) Cell 98, 295303 Ouyang, W., Ranganath, S. H., Weindel, K., Bhattacharya, D., Murphy, T. L., Sha, W. C., and Murphy, K. M. (1998) Immunity 9, 745755 Pear, W. S., Miller, J. P., Xu, L., Pui, J. C., Soffer, B., Quackenbush, R. C., Pendergast, A. M., Bronson, R., Aster, J. C., Scott, M. L., and Baltimore, D. (1998) Blood 92, 3780 3792 Markowitz, D., Goff, S., and Bank, A. (1988) J. Virol. 62, 1120 1124 Wen, R., Chen, Y., Xue, L., Schuman, J., Yang, S., Morris, S. W., and Wang, D. (2003) J. Biol. Chem. 278, 43654 43662 Kang, H. S., Beak, J. Y., Kim, Y. S., Petrovich, R. M., Collins, J. B., Grissom, S. F., and Jetten, A. M. (2006) Biochem. J. 397, 89 99 Fontenot, J. D., Gavin, M. A., and Rudensky, A. Y. (2003) Nat. Immunol. 4, 330 336 Onishi, M., Nosaka, T., Misawa, K., Mui, A. L.-F., Gorman, D., McMahon, M., Miyajima, A., and Kitamura, T. (1998) Mol. Cell Biol. 18, 38713879

16. 17. 18.

19.

20. 21. 22. 23.

Downloaded from www.jbc.org at Nagasaki University Library, on December 2, 2011

24. 25. 26.

27. 28. 29. 30. 31.

MARCH 30, 2007 VOLUME 282 NUMBER 13

JOURNAL OF BIOLOGICAL CHEMISTRY

9363