You are on page 1of 163

EL ORIGEN DE LA VIDA

1. Qu es la vida? 2. Un lugar adecuado para la vida 3. Una coctelera caliente 4. Un posible origen extraterrestre 5. El primer ser vivo

El ser humano de todos los tiempos y culturas siempre se ha planteado la misma pregunta

CMO SE ORIGIN LA VIDA? La respuesta a esta pregunta se puede buscar desde dos enfoques:

ciencia o religin
(Leed el apartado: ciencia o creencia?)
Creacin de Adn (Miguel ngel, Capilla Sixtina)

Te has hecho preguntas como estas?

Cmo han surgido los seres vivos que nos rodean?

Cmo han surgido los seres vivos que nos rodean?

Estas preguntas han estado en la mente humana desde nuestro mismo origen. Las religiones, la filosofa y la ciencia han compartido estas inquietudes.

Cmo se origin la vida?

Cmo hemos surgido nosotros?

1.QUE ES LA VIDA?
Es bastante problemtico responder a esta pregunta ya que no es tarea fcil encontrar una definicin clara de VIDA.

Leed la definicin cientfica de la vida

Es ms fcil describir las caractersticas propias de los seres vivos. Por cierto, sabras decir alguna de ellas?

CARACTERSTICAS PROPIAS DE LOS SERES VIVOS: 1. Tienen una composicin qumica y estructural compleja

CARACTERSTICAS PROPIAS DE LOS SERES VIVOS: 2. Estn formados por clulas

CARACTERSTICAS PROPIAS DE LOS SERES VIVOS:


3. Realizan las tres funciones vitales: Funcin de relacin

Funcin de nutricin Funcin de reproduccin

2.UN LUGAR ADECUADO PARA LA VIDA


Qu caractersticas de la Tierra han permitido el desarrollo de la vida en ella?

cual determina la existencia de agua lquida

- La distancia al Sol temperatura media de 15 C, lo - Su tamao atrae por gravedad a su atmsfera

protectora, deja pasar la luz visible pero atrapa las radiaciones de alta energa del sol.

- Atmsfera rica en oxgeno

Por qu no en MARTE?
Hay agua lquida en Marte?

Cul es la temperatura de Marte?

Hay indicios de vida en Marte?

3. UNA COCTELERA CALIENTE


Adems de explicar lo que es la vida, ha habido otro problema que ha preocupado al hombre desde siempre, y es el origen de la vida, de dnde viene?, cmo se ha formado?.

Hace unos 13000 millones de aos (m.a.) se origin el universo.

Hace 4600 m.a. se originaron el Sistema Solar y la Tierra.

Hace unos 3800 m.a. se consolid la corteza slida de la Tierra y se formaron la atmsfera, los ocanos y mares.

Hace 3600 m.a. se origin la vida sobre la Tierra.

Esto se sabe porque se han descubierto fsiles de organismos similares a las bacterias en rocas con 3500 m.a. En estos 3500 m.a. la vida se ha desarrollado ocupando todo el planeta y diversificndose en muchos grupos y especies.

Para explicar esto han existido dos grandes corrientes de pensamiento: - la generacin espontnea, idea que perdur hasta finales del siglo XIX, cuando L. Pasteur la rebati - modernamente, la teora del origen qumico de la vida y la teora del origen extraterrestre

TEORA DE LA GENERACIN ESPONTNEA

La vida puede surgir del lodo, de las aguas estancadas

La idea de la generacin espontnea de los seres vivos, que ya enunci Aristteles hace 2000 aos, perdur durante mucho tiempo.

TEORA DE LA GENERACIN ESPONTNEA


Estas ideas que hoy da nos parecen tan extraas o incluso cmicas, se basaban en observaciones como esta: si dejamos, por ejemplo, trozos de carne, al cabo de unos das salen gusanos. Esos gusanos apareceran ah solos, espontneamente.

Qu explicacin le das t a la aparicin de estos gusanos?

Francesco Redi, un mdico italiano, realiz en el siglo XVII el siguiente experimento:


Frasco abierto Frasco tapado con una gasa Frasco cerrado hermticamente

Carne

Carne Aqu aparecen huevos de mosca

Carne

Aparecen gusanos

No aparecen gusanos

Qu conclusin sacas de este experimento?

Cuestiones a) Cules son los hechos o fenmenos naturales de partida?. b) Cules son las observaciones de Redi?. c) Qu pregunta o problema se formula?. d) Cul es su hiptesis para explicar el problema?. e) El diseo experimental que realiz, confirm o refut su hiptesis?. f) Qu nuevas leyes, modelos o teora extrajo de sus conclusiones?. g) Despus de todo lo anterior, crees que Redi aplic el mtodo cientfico?.

Mosca (adulto)

Larva de la mosca (gusano)

Como habrs podido deducir, los gusanos . slo aparecen en la carne si entra en contacto con las moscas, que depositan en ella los huevos a partir de los cuales se desarrollan las larvas (gusanos)

Con este sencillo experimento Redi demostr que la vida slo puede surgir de vida preexistente.

A pesar del experimento de Redi, la controversia se prolong an otros doscientos aos hasta que en el siglo XIX, Louis Pasteur realiz el experimento que refut definitivamente la teora de la generacin espontnea.

LOS EXPERIMENTOS DE PASTEUR

Despus de esterilizado y enfriado en el caldo de carne no se desarrollaban microorganismos y se mantena as mucho tiempo. Si se rompa el cuello o se inclinaba hasta que el caldo pasase de la zona acodada este se contaminaba en poco tiempo.

QU CONCLUSIONES OBTUVO DE ESTOS EXPERIMENTOS?


El aire poda pasar a los recipientes, pero no as los microorganismos, que quedaban atrapados en el cuello. Si se corta el cuello el lquido se contamina con microorganismos.

Se desech para siempre la teora de la generacin espontnea.

TEORA DEL ORIGEN FSICO-QUMICO DE LA VIDA: OPARIN Y HALDANE


Los dos cientficos enunciaron esta teora simultneamente. Esta teora se basa en las condiciones fsicoqumicas que existieron en la Tierra primitiva y que permitieron el desarrollo de la vida.

Las condiciones eran distintas a las actuales


En nuestro planeta existan, unas altas temperaturas, provenientes de la actividad volcnica, las radiaciones solares y las descargas elctricas producidas por las frecuentes tormentas. No haba oxgeno libre en la atmsfera.

La atmsfera primitiva estaba formada por metano (CH4), amoniaco (NH3), hidrgeno (H2) y vapor de agua (H2O), era reductora y anaerobia. En estas sustancias estaban los principales

bioelementos

que forman la materia viva:

carbono (C), nitrgeno (N), hidrgeno (H) y oxgeno (O).

Cmo se formaron las biomolculas?


Las radiaciones solares, especialmente los rayos ultravioleta que llegaban sin dificultad por la ausencia de la capa de ozono, junto con las descargas elctricas proporcionaron la energa suficiente para que los componentes de la atmsfera reaccionasen y se formasen las biomolculas.

Cules fueron estas biomolculas?


Se formaron azcares, grasas simples, aminocidos y otras molculas sencillas que reaccionaron entre s para dar lugar a molculas ms complejas

Cmo se form el caldo primitivo?


Segn Oparn, los compuestos orgnicos que se formaron en la atmsfera fueron arrastrados hacia los mares por las lluvias y all, se fueron concentrando formando una disolucin de agua y molculas orgnicas e inorgnicas que l llam caldo primitivo.

Los precursores de las bacterias


En este caldo primitivo algunas molculas formaron membranas, originndose unas estructuras esfricas llamadas coacervados, algunos de ellos acumularon en su interior enzimas con las que fabricar sus propias molculas y obtener energa

Otros adquirieron su propio material gentico y as la capacidad de reproducirse. Se formaron as los primitivos protobiontes. Cuando estos evolucionaron dieron lugar a los eubiontes, que ya eran clulas

procariotas

Pero habra alguna manera de comprobarlo?

Experimento de Miller
En Hasta ahora, Este 1953, Miller experimento Hasta confirm la teora nadie que probaba ha se las entonces de logrado crear Oparin-Haldane condicionesque el pensaba en simulando una clula con el existentes slo un laboratorio seren las vida, pero planetapoda condiciones de unos la vivo hace este primitiva. 3500 Tierra millones de fabricar experimento Obtuvofueron tales compuestos aos materia orgnicos apudieron que ha sido partir orgnica de crucial para otros formarse (aminocidos, inorgnicos. entender espontneamente

cidos mejor molculas cmo grasos) pudo haber orgnicas. ocurrido.

Miller

4. UN POSIBLE ORIGEN EXTRATERRESTRE


Qu naci primero: la vida o el sistema solar?
Sabes en qu consiste la panspermia?

Las ideas deAnaxgoras (S IV a C) fueron la base de la panspermia Berzelius (S XIX) manifest la presencia de compuestos orgnicos en los meteoritos, aunque existan dudas si podan haberse contaminado al llegar a la Tierra

Segn Arrhenius (s XX) la vida se origin en el espacio y lleg a la Tierra en forma de esporas viajando en los meteoritos. En los ltimos aos se ha comprobado la existencia de gran nmero de molculas orgnicas en el espacio

Busca informacin sobre la panspermia y comenta razones a favor y en contra de ella

5. EL PRIMER SER VIVO


Para repasar como se originaron los primeros seres vivos realiza una actividad despus de ver el siguiente video:

Busca informacin sobre el significado de LUCA

Qu aparecieron antes los seres auttrofos o los hetertrofos? Por cierto, recuerdas la diferencia entre ambos?

PROCESO DE EVOLUCIN CELULAR

ACTIVIDAD: Lee el apartado las claves qumicas de la evolucin y busca informacin adicional. Haz una breve redaccin del proceso de evolucin celular desde la clula ancestral hasta la eucariota, en la misma debes utilizar las siguientes palabras: hetertrofo, auttrofo, fotosntesis, respiracin, oxgeno, teora endosimbionte, estromatolitos y cianofceas.

EVOLUCIN DE LAS ESPECIES


1. Una idea escandalosa 2. El proceso del cambio 3. La evolucin de una teora 4. Las explicaciones de la gentica 5. La formacin de las especies 6. Cubriendo de vida todo el planeta 7. Evidencias a favor de la evolucin 8. La especie humana

1. UNA IDEA ESCANDALOSA


Antiguamente se crea que las especies entonces conocidas haban mantenido su aspecto sin cambiarlo desde el mismo momento de la creacin.

En el s. XVIII las ideas imperantes en Europa son las del fijismo creacionista, que se basan en las creencias judeocristianas del Gnesis segn las cuales:
1. El mundo y todo lo que en l hay fue creado en seis das y tendra slo unos 6000 aos 2 Dios cre las especies tal y como son ahora y son inmutables

Dos importantes cientficos fijistas fueron Linneo y Cuvier.

Sin embargo, en el siglo XIX comenzaron a surgir diversas teoras que postulaban que los organismos vivientes eran el resultado de un dilatado proceso desarrollado a lo largo de la historia de la Tierra. Todos los seres vivos tienen un origen comn, a partir del cual se formaron las distintas especies y adquirieron niveles organizativos superiores. Este proceso se denomina evolucin.

Los cientficos se preguntaban cmo podan explicarse las extraas formas de vida, hoy inexistentes, que parecan estar grabadas en piedra: los fsiles. Tambin se hacan preguntas acerca de las variaciones en los animales y plantas domsticos y el origen de sus razas.

Por lo que al fijismo se le opuso el transformismo, cuya versin ms moderna, el evolucionismo, fue abrindose paso a partir del s XVIII y sobre todo el XIX. Dos importantes cientficos evolucionistas fueron Lamarck y Darwin.

Fijismo y evolucionismo
Fijistas
Los seres vivos son distintos porque han sido creados distintos, sin relaciones de parentesco.

Evolucionistas
Los seres vivos son distintos porque evolucionan, pero mantienen relaciones de parentesco. Esto quiere decir que tienen un origen comn, ms o menos lejanos en el tiempo.

Ciervo

Gamo Elefante asitico Elefante africano

El viaje del Beagle. Tras graduarse en Cambridge en 1831, el joven Darwin se enrol a los 22 aos en el barco de reconocimiento HMS Beagle como naturalista sin paga, para emprender una expedicin cientfica alrededor del mundo.

La expedicin dur cinco aos y recogi datos hidrogrficos, geolgicos y meteorolgicos en Sudamrica y otros muchos lugares. Las observaciones de zoologa y botnica de Darwin le llevaron a desarrollar la teora de la seleccin natural. La asombrosa fauna de las Islas Galpagos dio mucho que pensar a Darwin

Iguana

Varias especies de pinzones

Cormorn con alas atrofiadas

Tortugas gigantes

Desde Darwin el ser humano se situaba al mismo nivel que el resto de los seres vivos

Leed el apartado dos hombres y una idea y a continuacin realiza las siguientes actividades:

2. EL PROCESO DEL CAMBIO


Ninguno de los cientficos que apostaban por las teoras evolucionistas conoca la existencia de los genes ni de las mutaciones, pero ya entonces intuan que los cambios ocurridos en los individuos de una especie se transmitan a los descendientes.

Por qu se parecen tanto entre s? Por qu se parecen tanto entre s?

Por qu se parecen tanto entre s? Por qu se parecen tanto entre s?

Por qu se parecen tanto entre s? Por qu se parecen tanto entre s?

Por qu se parecen tanto entre s? Por qu se parecen tanto entre s?

Por qu se parecen tanto entre s? Por qu se parecen tanto entre s?

Por qu se parecen tanto entre s? Por qu se parecen tanto entre s?

Las semejanzas entre los seres vivos se deben a las relaciones de parentesco entre ellos, por lo que sern ms parecidos cuanto ms cercano en el tiempo se encuentre un antepasado comn.

Presente

Lnea del tiempo

Ciervo

Gamo

Elefante asitico

Elefante africano

Antepasado comn
El descubrimiento y estudio de los fsiles estimulaba las ideas evolucionistas

Antepasado comn

Pasado

Fijistas
Explicaban la desaparicin de especies antiguas por catstrofes naturales que eran ordenadas por Dios. Eran catastrofistas y creacionistas.

Evolucionistas
Los fsiles se explican porque los antiguos seres se extinguieron para dejar paso a nuevas formas de vida que surgieron a partir de las anteriores.

El Mamut y otras criaturas se habran extinguido por no haberse salvado del Diluvio en el Arca de No

A lo largo del siglo XIX, la comunidad cientfica asisti al enfrentamiento entre los defensores y detractores de las teoras evolucionistas, que trascendi el mbito de la mera especulacin cientfica y suscit furibundos ataques por parte de los estamentos eclesisticos, para los que la idea de la evolucin representaba una grave amenaza a las creencias ms profundamente arraigadas.

Caricaturas contra Darwin como esta intentaban ridiculizar sus ideas incluso insultndolo personalmente.

Las ideas evolucionistas chocaban con las ideas religiosas que el propio Darwin tena.

Lamarckismo
Lamarck pensaba que las especies cambiaban evolucionando, para adaptarse a sus necesidades, aumentando as poco a poco la complejidad de los organismos vivos.

Lamarck
(1744 1829)
Jean Baptiste de Monet, caballero de Lamarck, naturalista francs. En 1809 public Philosophie zoologique, donde expuso las primeras ideas razonadas sobre la evolucin. Sus ideas no fueron aceptadas.

Por ejemplo, el ancestro de la actual jirafa se adapt estirando cada vez ms su cuello, generacin tras generacin, para poder llegar a las ramas ms altas.

La premisa central de su hiptesis giraba en torno a dos ideas fundamentales: 1. La influencia del medio en el que se desarrollan las especies determinan los cambios de estas. 2. Dichos cambios son hereditarios, es decir, sern transmitidos a la descendencia.
Crneo y vrtebras cervicales de jirafa

Segn Lamarck, las modificaciones en el entorno de una especie genera nuevas necesidades, en respuesta a las cuales los seres vivos se ven obligados a utilizar un determinado rgano determinado: La funcin hace el rgano, en palabras del propio Lamarck. El uso continuado del mismo lo fortalece y desarrolla, mientras que el no usarlo determina su atrofia y desaparicin (ley del uso y desuso).

Esforzndose y usndolo, este animal lograra desarrollar su cuello. Y despus lograra transmitir eso a sus hijos.

Esta hiptesis es totalmente inadmisible hoy da por la Gentica, pues se sabe que los caracteres adquiridos (como, por ejemplo, el aumento de la masa muscular por el ejercicio o ponerse moreno cuando se toma el sol) no se transmiten a la descendencia, pues no afectan al material gentico.

Darwinismo
Las ideas de Darwin se resumen en 3 conceptos:

1.- La lucha por la existencia 2.- La variabilidad intraespecfica 3.- La seleccin natural

Charles Darwin (1809 1882)

ms aptos..

La seleccin natural tiende a promover la supervivencia de los

Veamos estos conceptos

Cmo van evolucionando los seres vivos?

Son muchos los que nacen


Nacen ms individuos de los que son capaces de sobrevivir en un medio con recursos limitados.

Dentro de cada especie hay variedad en las caractersticas. Los individuos no son idnticos entre s. Nacen con diferencias entre ellos, es decir, hay una variabilidad intraespecfica (dentro de la especie)

Son muchos los que nacen

Pero
Algunos no encuentran suficiente alimento o sufren enfermedades y mueren Otros son la presa de algn depredador
Hay una lucha por la existencia

Son muchos los que nacen

Pero

Hay una lucha por la existencia y por la reproduccin

Algunos no encuentran pareja o no consiguen reproducirse por algn motivo

Son muchos los que nacen

Pero
Slo sobreviven unos pocos: los que han nacido con caractersticas que les permiten adaptarse mejor a su medio.

La Seleccin Natural ha eliminado a los que nacieron con caractersticas menos apropiadas para la supervivencia.

Slo sobreviven unos pocos


Los que sobreviven transmiten a sus hijos esas caractersticas que precisamente les ayudaron a sobrevivir mejor en su medio.

Las especies evolucionan, pero no como deca Lamarck

1.- Hay una variabilidad intraespecfica 2.- Hay una lucha por la existencia 3.- Ha actuado la seleccin natural 1 2 3

A diferencia de Lamarck, Darwin pensaba que nacan jirafas con cuellos ms largos o ms cortos. Sobreviviran slo aquellas que haban heredado un cuello suficientemente largo.

Compara las dos teoras y reflexiona


Lamarck
Presente

Darwin

Pasado

Lnea del tiempo

Compara las dos teoras y reflexiona

Lamarck

Darwin

Presente

Lnea del tiempo

Transmiten a los hijos un cuello ms largo

Luchan por la supervivencia

La Seleccin Natural se encarga de eliminar las de cuello corto. El cuello largo se va extendiendo en la especie Slo sobreviven y se reproducen las de cuello ms largo

Usan mucho su cuello Transmiten a los hijos un cuello ms largo

Luchan por la supervivencia

Pasado Las jirafas desarrollan un cuello largo por esforzarse y usarlo mucho para coger su alimento Hay una variabilidad dentro de la especie: algunas nacen con el cuello ms largo.

Reflexiona: Cmo ha llevado la evolucin a que este insecto parezca una hoja segn la teora de Lamarck? segn la teora de Darwin?

Phyllium giganteum

Neodarwinismo o Teora Sinttica de la Evolucin


Ninguno de los cientficos evolucionistas conoca la existencia de los genes ni de las mutaciones, pero ya entonces intuan que los cambios ocurridos en los individuos de una especie se transmitan a los descendientes. Darwin no saba explicar cmo se transmiten los caracteres hereditarios. En sus tiempos no se conocan los cromosomas, ni mucho menos el ADN, ni las leyes de Mendel.

Neodarwinismo o Teora Sinttica de la Evolucin


La Biologa moderna explica el hecho evolutivo sumando a las ideas de Darwin las Leyes de Mendel y los conocimientos de la moderna Gentica.

Ningn cientfico niega hoy da el hecho evolutivo

+
Darwin Mendel

Neodarwinismo o Teora Sinttica de la Evolucin

Gentica Moderna

Por fin quedaba resuelto el misterio del modo transmitirse los caracteres hereditarios. descubrimiento de las leyes de la herencia y material gentico permita explicar aquello que cientficos contrarios a Darwin ms le criticaron.
El origen de las especies de Darwin se public en 1859, antes de los trabajos de Mendel.

de El del los

Neodarwinismo o Teora Sinttica de la Evolucin


La recombinacin gentica que ocurre en la meiosis y la reproduccin sexual producen la variabilidad intraespecfica de la que hablaba Darwin

Pap pato conoce a mam pata

mam pata puso huevos en el nido

y tuvieron hermosos patitos. Pero no habr una oportunidad para el patito feo: la Seleccin Natural acabar con l. El pato malvasa bucea para obtener alimento del fondo de lagunas

La Seleccin Natural sigue admitindose como el principal motor de la Evolucin. La Seleccin Natural escoge dentro de la variabilidad.

Neodarwinismo o Teora Sinttica de la Evolucin


Como ya sabes, a veces se producen errores en la duplicacin del ADN, dando lugar a genes alterados, distintos al original. Son las MUTACIONES. ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG
Doble cadena de ADN sin mutar

ATTCGCGGCATTAATCCGATACCTAGGACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCCTGGCGCCTAAATTTGTACCTAG
Doble cadena de ADN con mutacin
Mutacin

Las mutaciones son la fuente original de la variabilidad. La meiosis y la reproduccin sexual son fuentes aadidas de variabilidad.

Variabilidad dentro de la especie Eriopis eschscholtzi

Algunas mutaciones provocan la muerte, pero otras, en s, no son buenas ni malas: todo depender del medio donde vive la especie.

Neodarwinismo o Teora Sinttica de la Evolucin


Las mutaciones, la recombinacin gentica en la meiosis, y la combinacin de gametos en la reproduccin sexual ocurren aleatoriamente (al azar)

El nmero de combinaciones posibles de alelos de genes en una especie es elevadsimo (casi infinito).
Sabras calcular el nmero de combinaciones posibles de figuras de dados tirando cinco de ellos?.

Neodarwinismo o Teora Sinttica de la Evolucin


En este medio, los ratones de fenotipo oscuro sobreviven con ms probabilidad

La naturaleza arroja sus dados y nacen animales ms claros, ms oscuros Dependiendo del medio, un color u otro ser mejor o peor
En este medio, los ratones de fenotipo claro sobreviven con ms probabilidad
Con el tiempo, en esta poblacin de ratones, aumenta la frecuencia de genes que determinan el fenotipo claro

Bho normal

Bho nival

La formacin de las especies


Aqu ves 6 especies de felinos que se originaron a partir de un ancestro comn. Pero Qu es exactamente una ESPECIE?

1
2

Los individuos pertenecen a una misma especie cuando pueden reproducirse entre s y tener descendencia frtil.
Macho adulto

Hembra adulta

Subadulto Joven Las cuatro especies de buitres ibricos Cachorro Foca monje (Monachus monachus) Recin nacido

Son de la misma especie estas dos aves?:

No. Por qu?


A simple vista vemos que hay diferencias entre estos dos individuos: la forma del pico, los colores del plumaje, etc. Dos seres como estos (macho y hembra) NO PUEDEN REPRODUCIRSE ENTRE S

Cuntos individuos hay aqu? 19 Y cuntas especies ves? 8

Todava se pueden reproducir entre s

Ya no se pueden reproducir entre s

Canis familiaris (perro)


El perro comenz a acompaar al ser humano desde la Prehistoria. Estudios de ADN confirman que proviene del lobo y no del zorro.

Canis lupus (lobo)

Vulpes vulpes (zorro)

Canis lupus (lobo)

Antepasado comn

A veces existe un DIMORFISMO SEXUAL, es decir, que el macho y la hembra muestras diferentes colores, tamao y forma del cuerpo o de algunos rganos

Estos monos, aunque no lo parezca, pertenecen a la misma especie (la variabilidad intraespecfica es muy alta)

Otras veces ocurre lo contrario: animales o plantas que parecen iguales a simple vista, en realidad pertenecen a diferentes especies, como ocurre por ejemplo con las cebras

Se hace necesario estudiar a fondo las poblaciones de animales para conocer si se trata de una especie o de varias. Por ejemplo, despus de siglos pensando que en frica slo haba una especie de cebra, se sabe desde hace pocos aos que en realidad hay tres:

Equus zebra
Su parecido es tan grande porque estn muy emparentadas. Eso significa que el ancestro comn de las tres especies est relativamente prximo en el tiempo.

Equus grevyi

Equus quagga

Esto no es un capricho de los bilogos. Son especies diferentes porque no se reproducen entre s dando unos hijos frtiles

Equus zebra
En algunos zoolgicos se han podido reproducir especies diferentes de cebras. Pero los hijos resultantes, aunque viven con normalidad, son ESTRILES

Equus grevyi

Equus quagga

Desde muy antiguo se sabe que tambin pueden reproducirse dos especies diferentes: caballo y asno. La mula es un hbrido que resulta del cruce entre burro y yegua o entre caballo y burra. Las mulas no se pueden reproducir porque son ESTRILES

quidos

Animales del gnero Equus

Mula (es un hbrido asno-caballo) Cuando se originan las especies dejan de reproducirse unas con otras. Adoptan colores, formas y comportamientos que les impiden cruzarse con especies diferentes

Una especie puede definirse como el conjunto de individuos que constituyen una poblacin con caractersticas estructurales y funcionales semejantes, y que son capaces de aparearse entre s y generar una descendencia frtil.

El cortejo en las palomas

Apareamiento en el ciervo volante

Cul es la causa de la biodiversidad?


1. La adaptacin al medio genera una serie de cambios pequeos y graduales en una poblacin que, a lo largo de miles de aos, pueden llegar a constituir una especie nueva. 2. La formacin de especies nuevas a partir de otra preexistente, o especiacin, fenmeno que es principal responsable de la diversidad de los organismos vivientes.

Ancestro de los quidos quido actual

ESPECIACIN ALOPTRIDA ESPECIACIN ALOPTRIDA


Adems de intervenir la adaptacin al medio por seleccin natural, debe producirse adems el AISLAMIENTO de una poblacin que, al evolucionar y diferenciarse gradualmente del resto de la especie original, llega a originar una especie nueva. Al principio las poblaciones de una misma especie quedan separadas por una barrera fsica (un mar, una cadena montaosa, un desierto). Al cabo de varias generaciones, se hace imposible del todo la reproduccin entre las especies diferentes que se han formado
El okapi es un jirfido de cuello corto que vive en las selvas africanas Las dos especies: jirafa y okapi, no se pueden reproducir entre s.

ESPECIACIN SIMPTRIDA ESPECIACIN ALOPTRIDA


Tambin puede ocurrir, aunque de forma ms infrecuente, que se desarrollen dos especies en el misma rea geogrfica que la especie progenitora sin que exista una separacin geogrfica. El aislamiento es debido a la adaptacin de sus poblaciones a otras situaciones ambientales (luz, agua, temperatura,) de manera que se produce el aislamiento reproductor.

Realizad las actividades de los endemismos de las islas Canarias

La formacin de las especies


Como ya hemos visto, la principal fuerza evolutiva son las mutaciones genticas, que son las responsables de la mayora de la variabilidad gentica de las poblaciones, aunque no son la nica fuerza evolutiva que acta, ya que existen otras que son tambin muy importantes: - la reproduccin sexual, que es la responsable de la mezcla de genes y alelos en los individuos - el nmero de individuos de la poblacin, ya que si la poblacin es muy pequea los cambios genticos se dan ms deprisa - los movimientos de individuos, las migraciones, que alteran el conjunto de genes y alelos de la poblacin y - por supuesto, la SELECCIN NATURAL, que escoger aquellas combinaciones genticas ms favorables para ese medio, haciendo que esos individuos mejor adaptados produzcan ms individuos y su EFICACIA BIOLGICA sea mayor.

CUBRIENDO DE VIDA TODO EL PLANETA


Leed este apartado del libro de texto y realizad por grupos y con ayuda del libro de texto una representacin de la historia de la vida en la Tierra

EVIDENCIAS A FAVOR DE LA EVOLUCIN


PRUEBAS MORFOLGICAS PRUEBAS PALEONTOLGICAS PRUEBAS EMBRIOLGICAS PRUEBAS BIOGEOGRFICAS PRUEBAS BIOQUMICAS

Pruebas biolgicas

La mariposa Biston betularia de Inglaterra puede ser clara u oscura. En condiciones normales, la proporcin de individuos que llevan el gen responsable del color claro es muy alta. Sin embargo, en zonas donde azotaba la contaminacin y los rboles oscurecan con el holln, predominan los individuos con fenotipo oscuro.
Tronco ennegrecido por el holln

Mariposas descansado, posadas sobre troncos de abedul

Pruebas morfolgicas
Se basan en el estudio comparado de la morfologa de los rganos de seres vivos actuales o de fsiles. Mediante la ANATOMIA COMPARADA se estudian las semejanzas y diferencias entre rganos de diversas especies.

Pruebas morfolgicas
Observa detenidamente estos dibujos de extremidades anteriores de vertebrados:

Todas son diferentes pero tienen un esquema comn de organizacin Ese esquema comn de organizacin se debe a unHOMLOGOS Estos dibujos muestran ejemplos de RGANOS antepasado comn que invent un esquema bsico. La evolucin por seleccin natural llev a distintas adaptaciones de esta extremidad para correr, nadar, volar Pero el esquema bsico se mantuvo en todas estas especies.

Pruebas morfolgicas
Los rganos HOMLOGOS son aquellos que tienen un mismo origen evolutivo y embrionario, con una estructura interna semejante, fruto de diversas modificaciones adaptativas a distintos hbitats.
Ejemplos:

Humano

Gato

Ballena

Murcilago

Pruebas morfolgicas
Te parecera apropiado pensar en un parentesco prximo entre un murcilago y un insecto slo porque vuelan?
Ala de murcilago Ala de insecto

Son ejemplos de rganos ANLOGOS

Son ejemplos de rganos HOMLOGOS

Brazo de murcilago

Brazo humano

Los rganos ANLOGOS son aquellos que tienen distinto origen evolutivo y embrionario, pero presentan una forma aparentemente semejante y realizan la misma funcin.

Pruebas morfolgicas

Ala de murcilago

Ala de insecto

Son ejemplos de rganos ANLOGOS Son ejemplos de rganos ANLOGOS

Estos machos de Lucanus cervus (ciervo volante), usan sus cuernos (mandbulas muy desarrolladas) para combatir entre ellos.

Los ciervos macho tambin combaten con sus cuernos

Pruebas morfolgicas
Los rganos ANLOGOS representan un fenmeno llamado CONVERGENCIA ADAPTATIVA, por el cual los seres vivos repiten frmulas y diseos que han tenido xito.

Pruebas morfolgicas

Los rganos HOMLOGOS representan la DIVERGENCIA ADAPTATIVA, por la cual los seres vivos modelan sus rganos segn su modo de vida, el ambiente en que estn, etc.

Pruebas biogeogrficas
Las encontramos repartidas por todo el planeta, y consisten en la existencia de grupos de especies ms o menos parecidas, emparentadas, que habitan lugares relacionados entre s por su proximidad, situacin o caractersticas, por ejemplo, un conjunto de islas, donde cada especie del grupo se ha adaptado a unas condiciones concretas. La prueba evolutiva aparece porque todas esas especies prximas provienen de una nica especie antepasada que origin a todas las dems a medida que pequeos grupos de individuos se adaptaban a las condiciones de un lugar concreto, que eran diferentes a las de otros lugares. Son ejemplos caractersticos de esto los pinzones de las islas Galpagos que fueron estudiados por Darwin

Un nico ancestro comn dio lugar a diversas especies de pinzones en las diferentes islas Galpagos

Pruebas biogeogrficas
Camello bactriano

Llama Camlidos de Asia frica Alpaca Guanaco Dromedario Vicua La familia de los camlidos se diversific de acuerdo a su distinta adaptacin en diferentes hbitats. Ello constituye una prueba biogeogrfica ms de la evolucin.

Camlidos de Sudamrica

Pruebas biogeogrficas

Diablo de Tasmania Equidna Ornitorrinco Lobo marsupial (extinguido) Koala La extraa fauna de Australia refleja su aislamiento evolutivo del resto de continentes. Las especies de mamferos evolucionaron independientemente de otras partes del mundo. Esto es una prueba biogeogrfica ms de la evolucin.

Wallaby Canguro rojo

Pruebas paleontolgicas
Ancestro de los quidos quido actual

Se han logrado reconstruir historias evolutivas completas como la que condujo hasta el caballo. Los antepasados del caballo fueron cambiando y gradualmente fueron perdiendo dedos como adaptacin a la carrera veloz.

En los fsiles est escrita la historia evolutiva

Pruebas paleontolgicas
Dedos vestigiales y sin garras

Garras en los dedos Pico con dientes

Plumas Cola larga

Cola corta

Ave actual

Pico sin dientes

El Arqueopterix pudo ser el antepasado extinguido de las aves. Era mitad reptil mitad ave

Fsil de Archaeopteryx Reconstrucciones del Archaeopteryx

Archaeopteryx
Vivi hace 150 millones de aos

Se considera un animal emblemtico en el estudio de la evolucin por su carcter transicional entre reptiles y aves

Pruebas paleontolgicas Fsiles vivientes


Hoja actual

Hojas fosilizadas

Nautilus actual
Concha de Este

Nautilus fosilizados
seccionados

molusco es un fsil viviente que lleva sin evolucionar 150 millones de aos. Se considera prximo en la evolucin a los extinguidos ammonites

Darwin llam al Ginkgo Biloba "fsil viviente", por considerarlo la especie vegetal ms antigua del planeta. Aparecieron hace 250 millones de aos, en el perodo Prmico, al final de la era primaria. Este pez, el celacanto es otros fsil viviente. Curiosamente, se conoca muy bien a los fsiles mucho antes de descubrirse el primer ejemplar vivo.

Al principio todos estos embriones Pruebas paleontolgicas son muy parecidos entre s
Observa detenidamente el desarrollo embrionario de estas especies:

Pruebas embriolgicas
Estas semejanzas son una prueba de que existe un parentesco entre las especies. Cuanto ms alto sea el parecido entre embriones, mayor ser el grado de parentesco entre dos especies. Durante el desarrollo embrionario es como si se reprodujese la historia evolutiva de los antepasados. Nuestro embrin, al principio, es muy parecido al de un pez. Nuestros antepasados remotos fueron peces.

Pruebas bioqumicas

Por ltimo, las pruebas ms recientes y las que mayores posibilidades presentan, consisten en comparar ciertas molculas que aparecen en todos los seres vivos esto se ha hecho sobre todo con protenas (por ejemplo protenas de la sangre) y con ADN.

CUANTO MS CERCANAS EVOLUTIVAMENTE ESTN LAS ESPECIES MS PORCENTAJE DE ADN TIENEN EN COMN (EXISTEN GENES IGUALES EN ESPECIES MUY DIFERENTES)

La evolucin de la especie humana


En qu difieren los humanos de los simios? Cul es el antecesor dela especie humana? Qu sucedi con los Neandertales?

Elige la/s correctas:


a) El ser humano desciende del mono b) Los monos y el ser humano descienden de un antepasado comn c) Los monos son grupos marginales en la evolucin humana d) Algunos humanos evolucionaron para originar el ser humano

Orangutn

Gorila

Chimpanc

Ser humano

?
Darwin pensaba que el ser humano no procede de ningn primate actual. Pero s crea que tenemos antepasados comunes con ellos.

Antepasado comn

En tiempos de Darwin no se conocan fsiles de antepasados humanos

Orangutn

Gorila

Chimpanc

Ser humano

?
Pero la ciencia moderna conoce muchos eslabones de esta cadena

(hace 5 millones de aos)

?
Procnsul

Australopithecus
(hace 20 millones no se conocan estos de aos)

Darwin fue atacado porque eslabones perdidos de la cadena de la evolucin humana 117

La moderna Antropologa conoce muchos ms detalles de la evolucin humana de lo que la gente piensa

Australopithecus afarensis

Del mono no. Su teora sobre la evolucin del hombre fue groseramente malinterpretada y encontr mucha oposicin. Los ataques a las ideas de Darwin que encontraron mayor eco no provenan de sus contrincantes cientficos, sino de sus oponentes religiosos.
Muchos atacaron a Darwin sin haber ledo su libro ni conocer a fondo sus argumentos e ideas.

La idea de que los seres vivos haban evolucionado por procesos naturales negaba la creacin divina del hombre y pareca colocarlo al mismo nivel que los animales. Ambas ideas representaban una grave amenaza para la teologa ortodoxa.

Darwin no pensaba que el hombre descendiese de ningn mono actual, sino que el hombre y otros primates descendan todos de antepasados comunes.

CLASIFICACIN DE LA ESPECIE HUMANA COMO ORGANISMO ANIMAL


Atendiendo a las caractersticas de la especie humana en comparacin con la del resto de los animales, la clasificacin taxonmica del hombre sera:

ORDEN PRIMATES
Presenta las siguientes caractersticas: - Las rbitas oculares estn dirigidas hacia delante (visin estereoscpica, 3D) - Antebrazo le permite trepar - Dedo pulgar oponible en las cuatros extremidades (excepto en la especie humana) - Uas planas en lugar de garras Adaptaciones al medio arbreo y a una alimentacin basada en consumo de frutas y pequeos animales. Hbitos nocturnos.

Hoy se sabe que los PRIMATES se originaron hace ms de 60 millones de aos. Los antropomorfos tuvieron un gran desarrollo y fueron muy abundantes hace 20 millones de aos

A medida que los primates fueron evolucionando surgieron los prosimios, los monos antropoideos (monos con aspecto humano) y dentro de estos ltimos surgieron los Homnidos.

Los primeros primates


Prosimios (65 ma) Monos (35 ma) Simios (23 ma) Homnidos (5 ma)

Primeros primates - rasgos


Rasgos fsicos comunes en primates: Denso cabello cubriendo la piel De sangre caliente Mamferos Dependencia infantil Rasgos sociales comunes en primates : Vida social Juegos Observacin e imitacin Jerarqua

De simio a homnido
Sahelanthropus tchadensis o Touma es un espcimen fsil de un primate antropomorfo, que se hall en Chad y se ha datado en 6 a 7 m.a. de antigedad. El fsil muestra una combinacin de rasgos primitivos y ms avanzados, y mientras la bveda craneana es muy similar a la de los simios, los huesos de la cara son breves y los dientes, especialmente los caninos, son pequeos, parecidos a los de los seres humanos. Adems, el crneo presenta una protuberancia a la altura de las cejas que no se encuentra fuera del gnero humano.

Desde la especie de homnido ms antigua de todas (Sahelanthropus tchadensis), que apareci hace 7 millones de aos, han ido apareciendo a lo largo de la historia numerosas especies de homnidos. De las cuales slo ha sobrevivido la ltima en aparecer, el Homo sapiens (que apareci en frica hace 200000 aos)

CONTESTA LAS SIGUIENTES CUESTIONES:

Cul es el registro fsil ms conocido de bipedismo encontrado en 1974? Qu nombre le pusieron a este individuo y porqu? Qu motiv el cambio de posicin cuadrpeda a bpeda?

Cul es el registro fsil ms conocido de bipedismo encontrado en 1974?


Los indicios ms conocidos de bipedismo lo constituyen unos huesos de pelvis y de los miembros anteriores de un individuo descubiertos en Hadar (Etiopa) en 1974 y que tienen una edad de entre 3,6 y 3 millones de aos.

Tambin en Laetoli (Tanzania) se han descubierto huellas de dos individuos con una marcha bpeda y que tienen una antigedad de 3,75 millones de aos.

Qu nombre le pusieron a este individuo y porqu?


A los restos fsiles de Hadar de 3,2 millones de aos le dieron el nombre de Lucy en honor a la cancin que escuchaba el equipo de investigacin Lucy in the sky with diamonds (Beatles). Perteneca a la especie de Australopithecus homnidos

afarensis

Qu motiv el cambio de posicin cuadrpeda a bpeda?


Hoy se piensa que un gran cambio climtico que sustituy amplias zonas de selva africana por la sabana, empujaron a los antecesores humanos a abandonar la vida arborcola. En este ambiente encontraban el alimento muy disperso vindose obligados a recorrer grandes distancias. Ciertos estudios confirman que la marcha bpeda consume un 50% menos de energa que la marcha cuadrpeda del chimpanc.

HOMINIZACIN
El proceso de HOMINIZACIN (proceso de cambio que dio lugar a la aparicin del Homo sapiens). Se caracteriza por un conjunto de - CAMBIOS ANATMICOS, - CAMBIOS PSQUICOS Y - CAMBIOS CULTURALES.

CAMBIOS ANATMICOS
* El bipedismo constituy el cambio evolutivo fundamental que orient la evolucin hacia la formacin de la humanidad actual. La posicin erguida permiti advertir la presencia de presas y depredadores Liberar las manos (mayor movilidad y precisin) Extremidades inferiores se hacen ms largas

CAMBIOS ANATMICOS
La pelvis se ensancha y acorta Columna vertebral adopta forma de S Dieta se diversifica remodelacin de la denticin) Crneo se modifica (reduce su zona facial y la mandbula inferior) Aumento del desarrollo del cerebro (del lbulo frontal responsable de capacidad intelectual y del rea responsable del lenguaje)

CAMBIOS ANATMICOS

La pelvis se ensancha y acorta

CAMBIOS ANATMICOS

Columna vertebral adopta forma de S

CAMBIOS ANATMICOS
Dieta se diversifica e incluye el consumo de carne (remodelacin de la denticin y una reduccin progresiva del tamao de las piezas dentarias). Homo habilis comenz a comer carne hace 2 millones de aos, dieta ms rica en protenas necesaria para mantener un cerebro grande.

CAMBIOS ANATMICOS

Crneo se modifica (reduce su zona facial y la mandbula inferior)

CAMBIOS ANATMICOS

Aumento del desarrollo del cerebro (del lbulo frontal responsable de capacidad intelectual y del rea responsable del lenguaje)

Busca la respuesta a las siguientes cuestiones:

Qu problemas ocasion el aumento del volumen cerebral para el parto de los homnidos? Cmo se solucion?

CAMBIOS PSQUICOS
La capacidad cerebral trajo consigo la adquisicin de: La racionalidad La inteligencia La capacidad de abstraccin El lenguaje (H. habilis y H. ergaster tenan desarrolladas las reas cerebrales relacionadas con el lenguaje, aunque por su aparato fonador debera ser rudimentario) El control de las conductas instintivas

EVOLUCIN CULTURAL
Adems de todos estos cambios, la especie humana ha sufrido un complejo proceso de evolucin cultural que se ha manifestado en: la construccin y utilizacin de herramientas: H. habilis utiliz hace 2,6 millones de aos cantos y piedras talladas. Los utensilios les permitieron dominar la naturaleza. vida en sociedad: que aumenta la eficacia de los individuos en su lucha por la supervivencia pero incrementa la competencia, por lo que se necesitan normas para regular la convivencia.

EVOLUCIN CULTURAL
- en sus manifestaciones artsticas y mticas (entierros rituales a partir de los neandertales) - Prolongacin de la infancia y de la niez (desarrollo del cerebro contina), el cuidado de los individuos jvenes fomenta ms los lazos sociales y la comunicacin. Comienza hace 1,8 millones de aos. - Posiblemente los neandertales fueron los primeros en vestirse hace unos 40000 aos.

EVOLUCIN DE LOS HOMNIDOS

En el rbol de la evolucin que condujo hasta nosotros, algunas ramas, como el Neardenthal, se extinguieron

Homo sapiens
Homo neardenthalensis Homo heidelbergensis

Homo erectus

Homo antecesor Homo ergaster

Australopithecus afarensis

Australopithecus boisei

Cundo emigraron lo homnidos de frica?


Hace 100000 aos salieron los primeros homnidos en direccin a sia (H. georgicus) originaron al H. erectus y lleg a a Europa e Indonesia Demostrando una gran capacidad de adaptacin

SOLO EL HOMO SAPIENS HA SOBREVIVIDO HASTA LA ACTUALIDAD SEGUIR EVOLUCIONANDO O SE EXTINGUIR?