Inhibitory Effect of Cannabichromene, A Major Non-Psychotropic Cannabinoid Extracted From Cannabis Sativa, On Inflammation-Induced Hypermotility in Mice

Inhibitory effect of cannabichromene, a major non-psychotropic inoid extracted from Cannabis sativa, on inflammation-induced hypermotility in mice
ent of Experimental Pharmacology, University of Naples Federico II, Via D. Montesano
IYI"fif1.tfdh
of Biomolecular Chemistry, National Research Council , Via Campi Flegrei, 34, orio Olivetti, 80078, Pozzuoli (NA) of Protein Biochemistry, National Research Council, Pozzuoli (NA), Italy
ndence: Angelo A Izzo Department of Experimental Pharmacology, University of Naples II, Via D. Montesano 49, 80131 Naples Italy, fax number +39.081.678403, e-mail: nina.it and Vincenzo Di Marzo, Endocannabinoid Research Group, Institute of
has been accepted for publication and undergone full scientific peer review but has not been through the ,typesetting, pagination and proofreading process which may lead to differences between this version and sion of Record. Please cite this article as an 'Accepted Article', doi: 10.111lIj.1476-538 1.2012.01 879.x
In
he Authors British Journal of Pharmacology 2012 Society
The British Pharmacological
Biomolecular Chemistry, National Research Council, Via Campi Flegrei, 34, Comprensorio 0078, Pozzuoli (NA), Italy. e-mail: vdimarzo@icmib.na.cnr.it
title: cannabichromene and intestinal motility OUND AND PURPOSE
!'~IIII'hromene
is a major non-psychotropic phytocannabinoid which inhibits endocannabinoid
BC on mouse intestinal motility in physiological and pathological states.
Inflamm tion was induced in the small intestine by croton oil. Endocannabinoid (anandamide and onoyl glycerol), palmitoylethanolamide and oleoylethanolamide levels were measured by
"!flfUJfj!i3Kj~~IJfi!&f!Jj311fffft'&i'
omatography-mass spectrometry; TRPAl and cannabinoid receptors were analysed by ive reverse transcription-PCR; upper gastrointestinal transit, colonic propulsion and whole t were evaluated in vivo; contractility was evaluated in vitro by stimulating the isolated
and palmitoylethanolamide, up-regulation of TRPAl and CB1 receptors and down-
motility in control mice, but normalized croton oil-induced hypermotility. In vitro, romene reduced preferentially EFS- vs. acetylcholine -induced contractions. Both in vitro vi
0,
the inhibitory effect of cannabichromene was not modified by cannabinoid and TRPAl
20l2 The Authors British Journal of Pharmacology 20l2 Society
2 The British Pharmacological
SIONS AND IMPLICATIONS
'hromene selectively reduces inflammation-induced hypermotility in vivo in a cannabinoid and TRPAl-independent manner.
ds: 2-arachydonoylglycerol, anandamide, cannabichromene, cannabinoids, cannabinoid gastrointestinal transit, ileum, intestinal motility, transient receptor potential (TRP)
ylyl cyclase; 2-AG, 2-arachydonoylglycerol; API8, 4-(4-Chlorophenyl)-3-methyl-3ne oxime; cAMP, cyclic AMP; CBC, cannabichromene; DAGLa, diacylglycerol lipase a; diacylglycerol lipase ~; CPA, cyclopiazonic acid; DMSO, dimethyl sulphoxide; EFS, field stimulation; EMT, endocannabinoid membrane transporter; GC, geometric centre; ycerophosphodiester phosphodiesterase 1; MAGL, monoacylglycerol lipase; HC-030031, ""qt,#~It.@.~ft!.::}I\nethyl-2,6-dioxo-l,2,3,6-tetrahydro-7H-purin-7-yl)-N-(4isopropylphenyl)acetamide; 3-isobutyl-l-methylxanthine; MET, mean expulsion time; NAPE-PLD, N-acyl-
thanolamine-selective phospholipase D, NAPE PLD; OEA, oleoylethanolamide; sphodiesterase; PEA, palmitoylethanolamide; TRP, transient receptor potential; TRPAI, receptor potential of ankyrin type-l
iehromene (CBC) is, together with /19 -tetrahydrocannabinol, cannabidiol, and cannabinol, abundant naturally occurring cannabinoid (Turner et al., 1980; Russo, 2011). It is
20l2 The Authors British Journal of Pharmacology 20l2 Society 3 The British Pharmacological
particularly abundant in freshly harvested dry-type Cannabis material and it is the second most cannabinoid in some strains of marijuana growing in the United States (Brown and 990). A report covering 46,211 Cannabis preparations confiscated in the USA during 8 period showed that CBC represented 0.7% and 0.9% of the constituents from hashish or espectively (Mehmedic et al., 2010). Despite the relative abundance of this compound in
!'~W"fi'ff!51. preparations,
very little is known about its pharmacology (Izzo et al., 2009a). Early
3; Wirth et al., 1980), while showing no "Cannabis like" activity in the Rheseus monkey
as been shown that CBC exerts antimicrobial (Appendino et at. 2008), antinfiammatory
rodents (El-Alfy et al., 2010). Pharmacodynamic studies have shown that CBC, like t natural products (Gertsch et al., 2010), is an inhibitor of endocannabinoid cellular Ligresti et al., 2006) and a weak inhibitor of MAGL (De Petrocellis et al. 2011b), but is
et al., 2008; De Petrocellis et al., 2011b). Likely through activation of TRPA1,
d possibly via potentiation of adenosine signalling, CBC was also recently found to pathway of antinociception in the ventrolateral periaqueductal grey
th endocannabinoids and TRPAl are known to be involved in the control of intestinal n brief, endocannabinoids (i.e. anandamide and 2-arachydonoylglycerol (2-AG)], are lipid synthesised' 'on demand" from membrane phospholipids by the concerted action of a of enzymes including N-acyl-phosphatidylethanolamine-selective
phospholipase
D
4
(NAPE-PLD) and glycerophosphodiester
phosphodiesterase
1 (GDE1) (involved in anandamide
is) and diacylglycerol lipase a (DAGLa) and DAGL~ (involved in 2-AG biosynthesis). thesised, endocannabinoids, activate cannabinoid CB1 and CB2 receptors to elicit a response, after which they are inactivated through reuptake (facilitated by the putative abinoid membrane transporter (EMT)] and enzymatic degradation [anandamide is !f'~lI'~W~"d fatty acid amide hydrolase (FAAH), and 2-AG mostly by monoacylglycerol lipase by
. ion in vitro and gastrointestinal motility in vivo (Izzo and Coutts, 2005; Sanger, 2007; t et al., 2008; Izzo and Sharkey, 2010). TRPA1, a member of the TRP family, is expressed by vagal, splanchnic and pelvic) afferents (Brierley et al., 2009; Cattaruzza et al., 2010;
al., 2009; Yu et al., 2010; Brierly et al., 2009; Boesmans et al., 2011; Holzer, 2011) and
f the intestinal mucosal (Purhonen et al., 2008). TRPAl agonists have been shown to tractions of the isolated guinea pig ileum and mouse colon (Penuelas et al., 2007; Nozawa 9) and to affect motility in vivo (Doihara et al., 2009a; Doihara et al., 2009b)., although
t study we have evaluated the effect of CBC on intestinal motility in mice. CBC was d on upper gastrointestinal transit (both in physiological and inflammatory conditions), ropulsion and whole gut transit in vivo. In vitro, we evaluated the effect of CBC on y or acetylcholine-induced contractions in the ileum. A preliminary account of this work communicated to the omano et al., 2010).
zo" Annual
Symposium of the International Cannabinoid Research
5
Methods
mice (Harlan Laboratories, S. Pietro al Natisone, Italy) weighing 20-25 g were used after climation period (temperature 232 C; humidity 60%, free access to water and standard animal procedures were in conformity with the principles of laboratory animal care (NIH
in the European Communities Council Directive of24 November 1986 (86/609/ECC).
inflammation
al inflammation was induced as previously described (Pol and Puig, 1997; Capasso et al., riefly, two doses of croton oil (20 ).11 mouse") in two consecutive days were orally red to mice and four days after the first administration of croton oil, upper gastrointestinal
ice was measured. This time was selected on the basis of a previous work (Pol and Puig, hich reported that maximal inflammatory response occurred 4 days after the first treatment.
enum, jejunum and ileum from control and croton oil-treated mice (treated or not with
tion of croton oil), and tissue specimens were immediately weighed, immersed into liquid and stored at -80C until extraction of endocannabinoids. Tissues were extracted, nd analyzed as described in detail elsewhere (Di Marzo et al., 2008).
ive (real-time) RT-PCR analysis
o enum, jejunum and ileum from control and croton oil-treated mice (treated or not with
LJ~"'"(~,,,."'dj
mg kg-I, i.p., 30 min before croton oil) were removed (four days after the first
administration of croton oil) and collected in RNA later (Invitrogen) and homogenized by a rotorogenizer in 1.5 ml of Trizol (Invitrogen). Total RNA was extracted according to rer recommendations, dissolved in RNAase-free water, and further purified by spin by the Micro-to-Midi total RNA purification system (Invitrogen). Total RNA was in RNA storage solution (Ambion), UV-quantified by a Bio-Photometer (Eppendorf),
DNA-free kit) in a 20 f.l 1 final volume reaction mixture to remove residual
uated by the RNA-6000-Nano microchip assay using a 2100 Bioanalyzer equipped 2100 Expert Software (Agilent) following the manufacturer's instructions. For amples tested, the RNA integrity number was greater than 8 relative to a 0-10 microgramoftotalRNA, as evaluated by the 2100 Bioanalyzer, was reverse-transcribed in the SuperScript III SuperMix (Invitrogen). The reaction mixture was incubated in a er iCycler-iQ5 (BioRad) for a 5 min at 60C step, followed by a rapid chilling for 2 min e protocol was stopped at this step and the reverse transcriptase was added to the samples,
wed by 40 min at 50C. Finally, the reaction was terminated by heating at 95C for 10 tive real-time PCR was performed by an iCycler-iQ5 in a 20 u I reaction mixture 1x SsoFast EVAGreen supermix (BioRad), lOng of cDNA (calculated on the basis of -transcribed RNA), and 330 nMfor each primer. The amplification profile consisted of an
annealing temperature, see below), and elongation for 45 s at 68C. Fluorescence data
e by melt-curve data analysis. Assays were performed in quadruplicate (maximum ~Ct of amples <0.5), and a standard curve from consecutive fivefold dilutions (100 to 0.16 ng)
2012 The Authors British Journal of Pharmacology 2012 Society 7 The British Pharmacological
of a cDNA pool representative of all samples was included for PCR efficiency determination. primers for SYBR-green analysis and optimum annealing temperatures were designed llele-Id software version 7.0 (Biosoft International) and were synthesized (HPLCgrade) by MWG-Biotech (NAPE-PLD accession NM_178728, F:
TGGTGGAAATGG, R: GTGGTTGTGACTGATGAGG; GTGTGAATGATGATGCT~
CBl accession NM_007726, F: CB2 accession, F:
NM_019580.4, GCAGAAGCCATATC;
F:
ATAACACAGTAGATAGGACAACA,
R:
FAAH accession NM_010173, F: GCCTCAAGGAATGCTTCA,
'ACTCTCCGATGTCA)
gene
~-actin
(accession:
NM_ 007393; HPRT
F:
CCAGGCATTGCTGACAGG; (accession: NM_013556;
R:
F:
GGTGGACAGTGAGG) CTGGTAAAACAATGC;
and
R: GCCTGTATCCAACACTTCG)
was performed by iQ5
s measured by evaluating the intestinal location of rhodamine-B-labeled dextran (Izzo et b). Animals were given fluorescent-labeled dextran (100 ul. mL of 25 mg mL-1 stock via a gastric tube into the stomach. At 20 min after administration, the animals were killed iation with CO2 and the entire small intestine with its content was divided into 10 equal
te tinal contents of each bowel segment were vigorously mixed with 2mL of saline solution . a supernatant containing the rhodamine. The supernatant was centrifuged at 35 g to
precipitate the intestinal chyme. The fluorescence in duplicate aliquots of the cleared supernatant n a multi-well fluorescence plate reader (LS55 Luminescence spectrometer, Perkin Elmer ts, Waltham, MA, USA; excitation 5305 nm and emission 590IO nm) for tion of the fluorescent signal in each intestinal segment. From the distribution of the t marker along the intestine, we calculated the geometric centre (OC) of small intestinal .'''i'll'~follows: OClI4S(fraction of fluorescence per segment segment number") OC ranged from
t marker administration, both to control mice and to mice with intestinal inflammation d by croton oil. In croton oil-treated animals, the effect ofCBC (10 mg kg") was evaluated in retreated (i.p., 10 min before CBC) with the CBI receptor antagonist rimonabant (0.1 mg CB2 receptor antagonist SRI44528 (1 mg kg") or the selective TRPAI antagonists HC"!flflll!i3Kj~~IJfi!&f!Jj311fffft'&i'
n"ll If I, I jS; ..
Omg kg") and AP18 (100 mg kg"]. The dose of the cannabinoid receptor antagonists has previously shown in our laboratory to counteract the effect of selective cannabinoid gonists on croton-oil induced hypermotility in mice (Capasso et al. 2008b). The dose of
that this antagonist, given i.p., attenuated TRPAI-mediated pain in mice. Higher doses
ta not shown). On the other hand, AP18, even at the high dose of 100 mg kg", given . not affect transit.
onic propulsion was measured as previously described (Broccardo et al., 1998; Borrelli et 6 . A single 3-mm glass bead was inserted 2 em into the distal colon of each mouse with the atheter and the time to expulsion of the glass bead was determined for each animal. CBC
(10 and 20 mg kg'),
WIN 55,212-2 (1 mg kg-I, used as a positive control) or vehicle was given
in before glass bead insertion.
t transit time in vivo e housed in individual cages 72 h prior to the experiment. On the day of the experiment,
carmine red suspension in 0.5% carboxymethylcellulose.
The time to the first red bowel
ment was measured in min and constituted the whole gut transit time (Storr et al., 2010).
fly (and agonists)-induced

contractions in the isolated ileum with carbon dioxide and the ileum was removed, NaCl flushed of
e killed by asphyxiation
ontents, and placed in Krebs' solution (composition: 1.2 mM, NaHC03 25 mM, MgS04
119 mM, KCl 4.75 mM, 11 mM).
1.5 mM, CaCb 2.5 mM, and glucose
(37C)
organ bath containing Krebs' solution gassed with 95% O2 and 5% CO2. The to an isometric transducer (tension: 5 mN) in such a way to record
connected
ns from the longitudinal r, visualized, recorded
axis. Mechanical
activity was digitized on an analog-to-digital computer using the PowerLab/400 1 h equilibration
and analysed
on a personal
go Basile, Comerio, Italy). All experiments
started after a minimal
. ns were obtained with electrical field stimulation (EFS, 8Hz for 10 s, 400 rnA, Ims pulse by a pair of electrodes placed around the ileal tissue derived from both control and croton animals; the interval between each contraction was 20 min. EFS-induced 20l2 The Authors British Journal of Pharmacology 20l2 Society contractions 10 The British Pharmacological
were performed
in the presence
of the acetylcholinesterase
inhibitor
neostigmine
(1 u.M), to
cholinergic neurotransmission
(Baldassano et al., 2009). After stable control contractions responses were observed in the presence of
EFS had been recorded, the contractile cumulative concentrations Preliminary
ofCBC (10-8_10-4 M). The contact time for each concentration showed that this contact time was sufficient for CBC to
experiments
ntagonist rimonabant (3x10-8 M), the CB2 receptor antagonist SR144528 (10-7 M), and L(3x10-4 M) plus apamin (10-7 M) (alone or in combination),
ai-conotoxin (10-8 M), the non(IBMX, 10-7 M), the
phosphodiesterase (PDE) inhibitor 3-isobutyl-1-methylxanthine
C) forskolin
(10-7 M) . The concentration
of rimonabant
(3x10-8 M) was able to on EFS-induced
t the inhibitory effect of the cannabinoid receptor agonist WIN55,212-2 ns (data not shown). The concentrations
of the HC-030031 (10-5 M), ruthenium red (3x1 0-
1 antagonists (McNamara
et al., 2007; Alexander et al., 2009). Higher concentrations
of
The other concentrations
used in the present study were selected on the basis of
work (Borrelli et al., 2011; Coutts and Pertwee, 1998; Nocerino et al., 2002; Capasso et
,212-2 (10-9_10-6 M, contact time for each concentration: 20 min) on EFS-induced
am (10-6 M) orforskolin (10-7 M)J.
In some experiments, the effect of CBC (10-8_10-4 M) was also evaluated (contact time 20 min) on ctions produced by exogenous acetylcholine (10-6 M) or KCl (10-2 M). Acetylcholine or left in contact with the tissue for 60 sand 90 s, respectively, and then washed out In one eriments, the effect of CBC on acetylcholine-induced contractions was evaluated in the (contact time ~30 min) of cyclopiazonic acid (CPA 10-5 M, a sarcoplasmic reticulum !'Il~MJt"~tbitor),verapamil (10-6 M) (a L-type Ca2+ blocker) or ai-conotoxin (10-8 M). In this set of
ns were expressed as % of contractions produced by 10-3 M acetylcholine; this tration of acetylcholine produced a maximal contractile response (100% contraction).
expressed as the means.e.mean of experiments in n mice. To determine statistical ce, Student's t test was used for comparing a single treatment mean with a control mean, -way analysis of variance followed by a Tukey-Kramer multiple comparisons test was
by HPLC: 97.3) was kindly supplied by OW Pharmaceuticals (Porton Down, , UK). ACh hydrochloride, atropine sulphate, NG-nitro-L-arginine methyl ester (L-NAME) ride, apamin, ruthenium red, tetrodotoxin, 3-isobutyl-methylxanthine (IBMX), rolipram,
eugenol, cyclopiazonic acid (CPA), verapamil hydrochloride were purchased from ilan, Italy). WIN 55,212-2 mesylate, ai-conotoxin GVIA, AP18 and HC-030031 were ased from Tocris Cookson (Bristol, UK). Rimonabant and SR144528 (N-[-lS-endo-1,3,3-
12
trimethyl bicyclo[2.2.1] heptan-2-yl]-5-( 4-chloro-3-methylphenyl)-I-( 4-methylbenzyl)-pyrazole-3ide) were a kind gift from (Sanofi-Aventis, Montpellier, France). nt, SR144528, WIN55,212-2, HC-030031, AP18, IBMX, rolipram, forskolin, eugenol were dissolved in dimethyl sulphoxide (DMSO), CBC in ethanol (stock solution at 10-2 uent dilutions in distilled water), while the other drugs were dissolved in saline.
retal.,2011)
PEA and OEA levels in control and croton oil-treated mice: effect of romene ere performed in the duodenum, jejunum and ileum, both in control and in croton oilimals. Compared to control mice, croton oil administration caused a significant reduction
, although a conventional statistical significance was not fully achieved, PEA levels were y croton oil in the ileum (P<0.06), but not in the duodenum or jejunum (Figure 2). No t differences between control and croton oil-treated animals were observed in OEA levels odenum, jejunum and ileum (Figure 2). CBC (15 mg kg") did not modify significantly abinoid (anandamide and 2-AG), PEA and OEA levels both in control (data not shown) ton oil-treated mice (Figure 1 and Figure 2).
n r RNA expression of enzymes involved in anandamide biosynthesis and degradation in the
if control and croton oil-treated mice: effect of cannabichromene

Because a significant decrease of anandamide was observed in the jejunum
(but not in the
or ileum) of croton oil-treated mice, we measured in this tissue the mRNA expression s involved in anandamide biosynthesis (i.e. NAPE-PLD, GDEl) and degradation (i.e.
of the anandamide biosynthetic enzyme GDEl (NAPE-PLD showed a strong trend
-induced GDEl hyper-expression and reduced FAAH expression further in croton oil
er RNA expression of cannabinoid receptors in control and croton oil-treated mice: effect
ichromene 1 animals (i.e. not given croton oil), CBC (15 mg kg") up-regulated CBI receptors in the only (Figure 4A) (mRNA fold expression: control 1.000.32, eBe 2.09O.S3, P<O.OS, down-regulated CB2 receptors in the duodenum (mRNA fold expression: control , eBe 0.34O.07, P<O.Ol, n=4) and ileum (mRNA fold expression: control1.00O.23,
, eBe l.ll0.34).
(in the duodenum, jejunum and ileum) (Figures 4A and 4B). In croton oil-treated mice, 5;mg kg") reduced the expression of both CBI and CB2 receptors mRNA (in the jejunum, the ileum) (Figure 4A and Figure 4B). No data are available for the effect of CBC in the of croton oil treated mice (mRNA in the samples of the duodenum was degraded).
2012 The Authors British Journal of Pharmacology 2012 Society 14 The British Pharmacological
A expression in control and croton oil-treated mice: effect of cannabichromene mice (i.e. not given croton oil), CBC (15 mg kg-I, i.p.) significantly n in ileum, (mRNA fold expression: control1.000.34, the duodenum or jejunum (Figure 4C) (data not shown). increased TRPAI
CRC 4.901.02, P<O.OOl, n=4),
the ileum (Figure 4C). No data are available for the effect of CBC in the duodenum of oil treated mice (mRNA in the samples of the duodenum was degraded).
e reported in Figure 5. CBC (10 and 20 mg kg") did not affect upper gastrointestinal igure SA), colonic propulsion (Figure 5B) or whole gut transit (Figure 5C). By contrast, otropic cannabinoid receptor agonist WIN 55,212-2 (1 mg kg"), used as a reference drug,
colon colonic propulsion (thus indicating an inhibitory effect on colonic propulsion)
and
time of expulsion of an orally-given red marker (which indicates an inhibitory effect
trointestinal transit in the inflamed intestine inistration of croton oil produced a significant increase in intestinal transit, shown as an value of the GC (Figure 6). Intraperitoneal administration of CBC caused a reduction in
motility in croton oil-treated animals, which was statistically significant at doses of 10 and
-1
(Figure 6). The inhibitory effect of CBC 10 mg kg-1 was not significantly modified by 15 The British Pharmacological
2012 The Authors British Journal of Pharmacology 2012 Society
the cannabinoid
CBI receptor antagonist rimonabant
(0.1 mg kg'),
the CB2 receptor antagonist
(1 mg kg") or the TRPA1 antagonists HC-030031 (30 mg kg") and AP18 (100 mg kg"]
oth in control and in croton oil-treated mice).
ice and in croton oil-treated mice, EFS of the mouse ileum evoked contractions that were
8 6 ed by tetrodotoxin (3x10- M) or atropine (10- M) and strongly reduced (634% inhibition,
-conotoxin (10-8 M), thus indicating that these contractions were due to the release of
line from enteric
nerves
and that N-type Ca2+ channels have a major role in
ine release. The co-conotoxin-resistant contractions were abolished by tetrodotoxin.

(10-7 M), L-NAME (3x10-4 M) ruthenium red (3x10-6M), HC-030031 (10-5 M), rimonabant ), SR144528 (10-7 nM), IBMX, (10-7 M), rolipram (10-6 M), forskolin (10-7 M), at the
de to those evoked by EFS (data not shown). Acetylcholine-induced
contractions were
reduced by verapamil (10-6 M, 533% inhibition, n=8) and CPA (10-5 M, 594% , n=9), but left unchanged by ai-conotoxin (10-8 M).
-8
_10-4 M)
significantly
and
in a concentration-dependent
manner,
inhibited
the
ns induced by acetylcholine or by EFS, both in control mice and in croton oil-treated mice . CBC was significantly (P<O.OOl) more potent and effective at inhibiting the contractions Y EFS than those induced by acetylcholine. 2012 The Authors British Journal of Pharmacology 2012 Society Both in control and in croton oil-treated 16 The British Pharmacological
animals (Figure 9), the inhibitory effect of CBC on EFS was not significantly modified by the CB1 ntagonist rimonabant (3x10-8 M) or the CB2 receptor antagonist SR144528 (10-7 M)
TRPA1 antagonist HC-030031
(10-5 M) (Figure 9C and Figure 9D). L-NAME (3x10-4
amin (10-7 M) (alone or in combination) were also ineffective at antagonizing the effects
lipram and forskolin duced contractions
significantly
reduced the inhibitory
response to WIN55,212-2
on
in control mice (see insert to figure 10 C). the inhibitory effect
ntrol (Figure 11A) and in croton oil-treated animals (Figure lIB),
locker verapamil (l0-6 M), but not by CPA (l0-5 M, an inhibitor of the sarcoplasmatic
2 Ca +ATPase) or by to-conotoxin),
In the presence
of verapamil,
CBC, at the lowest
tions tested (lff8M, 10-7 M and 10-6 M) slightly (less than 10%) increased acetylcholine-
BC (10-8_10-4 M) also inhibited the contractions
evoked by KCl in control mice (%
-8M CBC 2.4%; 10-7 M CBC 54; 10-6 M CBC 8.02.1; 10-5 M CBC 15. 83. 9; 10-4
r RNA expression
of cannabinoid
receptors and proteins
involved in endocannabinoid
n in control and croton oil-treated mice: effect of cannabichromene xperiments we measured the mRNA CB1 and CB2 expression as well as the transcriptional xpression of enzymes involved in endocannabinoid biosynthesis (NAPE-PLD, GDE1,
DAGL~) and degradation
(FAAH, MAGL) in the duodenum, jejunum
and ileum from 17
control and croton oil-treated
animals. The effect of CBC (15 mg kg") on these enzymes and
as also evaluated, both in control and in croton oil treated animals.
n (in the duodenum, jejunum
and ileum) (Figures 7B and 7C). In addition, croton oil biosynthetic enzymes NAPE-PLD (an effect
!f'@~'~'f~.
the mRNA expression
of the anandamide
m and up-regulation
in the ileum (Figure 8C) and no effect on DAGL~ mRNA expression reduced the expression of the degrading enzymes
8D). Finally, croton oil significantly
d MAGL in the duodenum and jejunum, but not in the ileum (Figure 8E and 8F).
mRNA (in the jejunum, but not in the ileum) (Figure 7B and Figure 7C). CBC had no NAPE-PLD in jejunum or ileum croton oil-treated animals (Figure 8A), significantly
e expression of GDEI mRNA in the jejunum (but not in the ileum) (Figure 8B), had a
icantly reduced DAGL~ mRNA expression in the jejunum (but not in the ileum) (Figure
in croton oil-treated animals (Figure 8E and 8F). No data are available for the effect of the duodenum of croton oil treated mice (mRNA in the samples of the duodenum was
animals (i.e. not given croton oil), CBC (15 mg kg") up-regulated
CBI receptors in the
nly (mRNA fold expression: control 1.00O.32, CBC 2.09O.53, P<O.05, n=4) and downCB2 receptors in the duodenum (mRNA fold expression: control 1.000.26, CBC
, P<O.OI, n=4) and ileum (mRNA fold expression: control 1.000.23, CBC: 0.43O.08, 20l2 The Authors British Journal of Pharmacology 20l2 Society 18 The British Pharmacological
P<O.Ol), but not in the jejunum (mRNA fold expression: control 1.00O.38, CBC 1.11O.34). In BC significantly up-regulated GDE1 in the ileum (mRNA fold expression: control , CBC 1.60O.16,P<O.05, n=4 , no significant changes in the duodenum or jejunum, data ) and had mixed effects on DAGLa since CBC down-regulated DAGLa in the duodenum ld expression: control1.000.19, CBC O.670.10, P<O.05, n=4) and up-regulated it in the
it the ileum (mRNA fold expression: control 1.000.15, CBC 1.410.29, P<O.05, n=4). significantly reduced DAGL~ in the duodenum (mRNA fold expression: control 1.00O.09, O.06, P<O.Ol, n=4) and in the jejunum (mRNA fold expression: control 1.00O.09,CBC 7, P<O.Ol, n=4), while it had no significant effect in the ileum (data not shown). No
t changes were observed for MAGL and NAPE- PLD in the duodenum, jejunum and ta not shown).
sent study we have evaluated the effect of CBC, a major non-psychotropic ingredient of plant Cannabis sativa, on intestinal motility, both in physiological states and in a intestinal ileitis induced by croton oil. Intestinal inflammation induced by croton oil is ized by disruption of the mucosa and an infiltration of lymphocytes into the submucosa d Pol, 1997), with increased activity of myeloperoxidase (an index of neutrophil n) (Pol et al., 2005) and vascular permeability (Jimenez et al., 2006). Such changes are to induction of iNOS (Pol et al., 2005) and up-regulation cannabinoid CB b opioid d DOR) and a2-adrenergic receptors (Izzo et al., 2001; Pol et al., 1996, Puig and Pol,
19
Although
this model has been previously tion-induced hypermotility
employed to evaluate the effect of cannabinoid
drugs on is
(Izzo et al., 2001;Capasso
et al., 2008a), less information cannabinoid
on whether or not it is accompanied nabinoid receptors,
by changes of the endogenous and proteins
system in
endocannabinoids, and degradation),
potentially
involved
abinoid biosynthesis
as instead has been shown for other models of
abinoid inactivation
and an activator of TRPA1,
we first
analysed
here the mRNA
sion of this channel as well as of endocannabinoid
metabolic enzymes and receptors.
inflammation rally accepted that the endogenous to inflammatory stimuli cannabinoid system undergoes adaptive changes in
(Wright, 2008; Izzo and Camilleri, 2009; Izzo and Sharkey
abinoid levels associated to up-regulation
ofCBI
and CB2 receptors in the inflamed gut changes in FAAH (Izzo et al.,
rkey, 2010). Few studies have looked at possible
rr et al., 2008; Borrelli et al., 2009), while changes in NAPE-PLD es involved in the biosynthesis of anandamide), and MAGL
and GDE1 (two of
DA GLa and DA GLp (the enzymes that (i.e. the enzyme responsible are largely observed of 2-AG
the last step in 2-AG biosynthesis) . n) in experimental increased DA GLa models
of intestinal
inflammation have been
uninvestigated., in patients with
and MA GL expression
tory bowel disease (Marquez et al., 2009).
20
A second The first step of the present study was the measurement of endocannabinoid levels in the , jejunum and ileum of control and croton oil-treated animals. In a previous paper, we t the levels of anandamide slightly decreased in the whole small intestine of croton oilice, although the difference did not reach a statistical significance (Izzo et al., 2001). By here endocannabinoid levels in the different portions of the small intestine, we detected a !1I1~ffff"~lt ecrease in anandamide levels in the jejunum (but not in the duodenum or ileum) of d
ding changes in the mRNA expression of anandamide metabolic enzymes (i.e. NAPEnd GDE1, involved in anandamide synthesis, as well as FAAH, involved in anandamide degrada on). It is possible that other enzymes or the availability of phospholipid biosynthetic
oil-inflamed mouse small intestine. We also measured the levels of PEA and OEA, two olamides chemically related to anandamide, which reduce gastric and intestinal motility et al., 2001;Capasso et al., 2005;Aviello et al., 2008; Cluny et al., 2009) and the levels of
nsen and Diep, 2009). We found that PEA, but not OEA, decreased in the intestine of ted animals (although a full statistical difference was not achieved, being the P value .06), a finding which is in line with our previous work (Capasso et al., 2001). e analysed the expression of cannabinoid receptors, we found that croton oil
ation was associated to up-regulation of CB1 mRNA receptor expression in the mouse This result is in line with our previous data showing an increase of CB1 protein expression del of intestinal inflammation (Izzo et al., 2001) as well as with other studies showing CB1 receptor expression in the inflamed intestine (Massa et al., 2004; Wright et al., 2008; Camilleri, 2009). However, we also found, perhaps quite surprisingly, a down-regulation
21
of CB2 mRNA receptor expression in the duodenum, jejunum and ileum of mice treated with croton esult is at odds with previous immunohistochemical studies showing a more intense CB2
m in the mustard oil-model of inflammatory bowel disease (Kimball et al. 2006) as well as
s with ulcerative colitis or Crohn's disease (Wright et al. 2005). On the other hand, others n no changes of CB2 receptor mRNA, both experimentally (Duncan et al., 2008) and in
n, we found an increase in the mRNA expression of the enzymes involved in anandamide thesis (i.e. NAPE-PLD and GDEI), and a down-regulation ofDAGLa (which is involved in 2-AG bI synthesis) as well as a down-regulation of the enzymes involved in endocannabinoid
. A decrease in FAAH mRNA expression has been previous documented in experimental of inflammatory bowel disease (Storr et al., 2008, Borrelli et al., 2009). Previously, we n increase in FAAH activity in the croton oil model of intestinal inflammation (Izzo et al.,
urther step of our study was the evaluation
of the mRNA
expression
of TRPA1,
can be activated by CRC. It is well known that TRPAl is involved in inflammatory
ain (Kimball et al. 2006, Yang et al., 2008; Brierley et al., 2009; Cattaruzza et al., 2010
I\/t.trr\u.f'
et al., 2010); in addition, intestinal inflammatory stimuli may cause up-regulation of
e found TRPAl mRNA to be expressed in the mouse small intestine of healthy mice. However we have found, for the first time in the gut wall, that the mRNA encoding for this channel lated in the experimental model of intestinal inflammation used here. The TRPAl upwas observed in all the small intestine (i.e. duodenum, jejunum and ileum). During the
22
review process of this manuscript, others have found that the TRPAl mediates colitis in mice al., 2011).
CBC on endocannabinoid levels and on the mRNA expression of cannabinoid receptors, nd anandamide metabolizing enzymes in the intestine of control and croton oil-treated
roton oil-treated animals whereas, in these animals, but not in control mice,
eRe down-
ted the mRNA expression of both GDEI and FAAH, which are involved in the biosynthesis and de adation of anandamide, respectively. These findings leave open the possibility that,
r lack thereof, in the mouse small intestine might underlie the lack of effect of ide levels in this tissue. On the other hand, CBC down-regulated
es involved in both the biosynthesis (e.g. ODE!,
eRe on
changed the expression in the
which was down-regulated
degradation (i.e. FAAH, which was down-regulated) anandamide endocannabinoids
and MAOL, which were both down-
(Figure 8). In addition, We also found that CBC, in
treated animals, decreased the expression of the mRNA encoding for both CB1 and CB2 in the jejunum, whilst exerting no effect in the ileum. In summary, the inhibitory effect
on motility observed here (see below) are unlikely to be due to changes in abinoid signaling since treatment with the phytocannabinoid caused a decrease of
receptor expression and no changes in endocannabinoid levels, which, taken anything should have resulted in increased motility. Accordingly,
id receptor antagonists failed to modify CBC-induced changes selective (see 23 The British Pharmacological
on motility
pharmacological experiments discussed below). In addition,
eRe changed
the mRNA expression
inoid receptors also in control mice, making it unlikely that these effects of r intestinal inflammation.
eRe are
en recently demonstrated that CBC can alter the intestinal transient receptor potential annels of vanilloid type 1-4 mRNA expression already after a pharmacological in vivo
'~I'~ff~'t as 30 min (as in the present study), thus providing another potential mechanismas short
TRPAI expression in the jejunum of croton oil-treated animals, it elevated the expression channel in the ileum, thus pointing to a possible overall null net effect on TRPAI-mediated modulat n of intestinal motility. It could be of interest to see in future studies, if changes in oid receptor and TRPAl mRNA expression caused by CBC both in the healthy and in the
intestine could be important for the potential - and yet to be demonstrated - antitory and/or analgesic effect of CBC in the gut.
logical experiments in vivo and in vitro
tract. In this study, we have found that this phytocannabinoid did not affect upper
ced croton-oil-induced intestinal hypermotility

,~!lre upper gastrointestinal
(upper gastrointestinal
transit). In order of
24
transit, we used a method
which reflects a combination
gastric emptying and small intestinal transit; even if our results do not establish a distinctive site r intestinal) of action for CRC, but a combination of both, they clearly show that CRC that this compound is pharmacologically active in vivo only when intestinal
tasis is perturbed by an inflammatory stimulus. The observation that CBC administration is iated with constipating effects under physiological conditions is relevant as one of the .~'f8j[i&ff~1.e effects associated with opiate administration (the most known agents able to reduce
astric emptying in the rat (Doihara et al., 2009b), reduced upper gastrointestinal transit Ionic propulsion in mice (Capasso et al., 2011 unpublished), stimulated gastric antrum um motility in the dog (Doihara et al. 2009a) and induced the occurrence of giant
'gate the mechanism of action ofCBC-induced delay in motility in vivo, we considered the involvement of cannabinoid receptors as well as TRPAI channels. Indeed CRC has been ') to inhibit endocannabinoid re-uptake, and thus to potentially activate indirectly - via
'RPAI channels (De Petrocellis et al., 2008; De Petrocellis et al., 20lla). We found that effect of CBC on croton oil-induced intestinal hypermotility was not modified by the rimonabant, nor by the CB2 receptor antagonist SRI44528. These
ists, at the doses used in the present paper, were previously shown to counteract the
effect of selective CB1 and CB2 receptor agonists on croton oil-induced intestinal
ility (Capasso et al., 2008b). Furthermore, the inhibitory effect of CBC on motility was
a route of administration (i.p.) previously shown to attenuate TRPAI-mediated pain in Namara et al., 2007) nor by AP18 (100 mg kg"], another selective TRPAI antagonist.
25
logical experiments in vitro provide insights on the site of action of CBC, we have performed in vitro experiments on ed ileum from control and croton oil-treated mice. Our data show that CBC preferentially e contractile response elicited by EFS (which is mediated by the release of acetylcholine
ereas a direct inhibitory effect on smooth muscle was observed only at greater trations of CBC. It is unlikely that the inhibitory effect of CBC was due to antimuscarinic actions,ecause the phytocannabinoid also inhibited the contractions induced by KCl. In contrast to
inflamed intestine (with no significant differences in potency or efficacy being observed). es between in vitro and in vivo actions of cannabinoids have been previously documented estive tract (Coruzzi et al., 2006; Capasso et al., 2008a; Sanger, 2007).
the effect of cannabinoid receptor antagonists and TRPAl antagonists on CBC-induced
BC on EFS-induced contractions was not significantly modified by cannabinoid receptor

ists (rimonabant and SRI44528) or by TRPAI blockers [i.e. ruthenium red (a pan-TRP
nd HC-03003I (a selective TRPAI antagonist)]. We have used concentrations ofTRPAI s which were approximately two-three fold higher than the IC50 values of these previously reported (McNamara et al., 2007; Alexander et al., 2009). Higher tions of the two TRPAl antagonists were not used because they inhibited per se the EFS- duced contractions. Importantly, in a recent study, we have shown that also the effect of
26
the prototypical TRP Al agonist allyl isothiocyanate
on intestinal motility, both in vitro and in vivo, TRP Al antagonists, including HC-
odified by a number of selective and non-selective
. t, it has been demonstrated
that genetic ablation of the TRPA1 does not affect upper activation inhibits spontaneous neurogenic
stinal transit in mice and that TRPA1
smitter(s) release from myenteric rongly reduced in the presence unchan d by drugs which
nerves. We found
2 +
that the inhibitory
effect of CRC but left by
of the N-type Ca
channel cAMP
blocker oi-conotoxin, intracellular
are expected
to increase
levels either
rim en tal conditions, 1998), forskolin, 12-2, a cannabinoid
and as previously rolipram and IRMX
reported for the guinea pig ileum (Coutts and significantly reduce the inhibitory effect
receptor agonist which is known to inhibit EFS in the mouse ileum
odify the inhibitory effect of CRC on acetylcholine-induced ai-conotoxin reduces the inhibitory effect
contractions,
making it very
of CRC by acting postjunctionally. contraction, at least in part,
ly such results suggest that CRC inhibits EFS-induced
y limiting the availability of intraneuronal

e intermediacy of the ACIcAMPIPDE the possibility
Ca2+ via inhibition
of N-type Ca2+ channels,
system. that CBC inhibited EFS-induced contractions by
e also excluded
enteric inhibitory nerves (at least, the inhibitory component mediated by NO and ATP) s combination of apamin [a blocker of Ca2+ activated K+ channels which blocks the enteric component mediated by ATP or related purine] (Crist et al., 1992) and L-NAME (an 2012 The Authors British Journal of Pharmacology 2012 Society 27 The British Pharmacological
inhibitor of NO synthase), the combination which is known to block enteric inhibitory nerves n and Costa, 1994), did not modify the inhibitory effect of CBC on twitch response. e also evaluated the effect of CRC on acetylcholine-induced contraction (i.e. the small the inhibitory effect of CRC which is exerted at postjunctionallevel) in the presence of
t influence Ca2+ levels in smooth muscles. We found that the inhibitory effect of CRC
IC
for CRC as this E-type Ca2+ channel antagonist did not did not modify the inhibitory
inhibits,
t least in part, acetylcholine-induced contractions with a mechanism involving L-type
exert antispasmodic actions via a mechanism independent of extracellular Ca2+ influx reviously documented in the rat small intestine (Leal-Cardoso et al., 2002).
shown that CBC, a major non-psychotropic component of the marijuana plant, normalizes al motility in an experimental model of intestinal inflammation, without slowing the nsit in control animals. These protective effects of CBC were accompanied by intestinal .n cannabinoid and TRPAl expression, but not of endocannabinoid levels. In vitro results al ileal segments showed that this phytocannabinoid preferentially reduces EFS-induced ns - rather than acetylcholine-induced contractions - with a mechanism involving N-type nels. Both in vitro and in vivo, the inhibitory effect of CBC does not involve cannabinoid or TRPAl channels. Although the precise mechanism of the inhibitory effect of CBC rther studies, the present results are of potential clinical interest because intestinal
28
dysmotility in inflammatory diseases is a well-recognized and clinically accepted phenomenon

t al., 2007), which the currently used drug counteract often only in association with
[ng effects (Jafri and Pasricha, 2001). In addition, by disclosing the effect of CBC on oid and TRPAl mRNA expression, the present results open the way to investigate the his safe plant compound in other pathophysiological conditions (e.g. intestinal secretion, .f"15"f~fnflammation, visceral pain and intestinal cancer) in which such receptors are potentially
edgments
undation (Rome, Italy)
AAI are recipients of research grants from GW Pharma, Ltd.
SP, Mathie A, Peters JA (2011). Guide to Receptors and Channels (GRAC), 5th edition. acoI164:S1-S324. ni A, Wright KL, Larvin M, O'Sullivan SE (2011). Cannabinoids mediate opposing inflammation-induced intestinal permeability. Br J Pharmacol. 2011 Jul 11. [Epub ahead
29
Aviello G, Matias I, Capasso R, Petrosino S, Borrelli F, Orlando P, et al. (2008). Inhibitory effect of xic compound oleoylethanolamide on gastric emptying in control and overweight mice. J 86:413-422. o G, Gibbons S, Giana A, Pagani A, Grassi G, Stavri M, et al. (2008). Antibacterial ids from Cannabis sativa: a structure-activity study. J Nat Prod 71:1427-1430. o S, Zizzo MG, Serio R, Mule F (2009). Interaction between cannabinoid CB1 receptors genous ATP in the control of spontaneous mechanical activity in mouse ileum. Br J 1158:243-251. ~~~~tiM, Storr MA, Nikas SP, Wood JT, Godlewski G, Liu Jet al. (2011) Inhibiting fatty acid ;~'il~drolase normalizes endotoxin-induced enhanced gastrointestinal motility in the mouse. Br rmacol. 2011 Aug 30 [Epub ahead of print] W, Owsianik G, Tack J, Voets T, Berghe PV (2011). TRP channels m roenterology: opportunities for therapeutic intervention. Br J Pharmacol 162:18-37. lli F, Izzo AA (2009). Role of acylethanolamides in the gastrointestinal tract with special to food intake and energy balance. Best Pract Res Clin Endocrinol Metab 23:33-49. Borrelli F, Aviello G, Romano B, Orlando P, Capasso R, Maiello F, et al. (2009). Cannabidiol, a safe an non-psychotropic ingredient of the marijuana plant Cannabis sativa, is protective in a "!flfU~ifi3"lli~I'jf'odel of colitis. J Mol Med 87:1111-1121. , Capasso F, Capasso R, Ascione V, Aviello G, Longo R, et al. (2006). Effect of serrata on intestinal motility in rodents: inhibition of diarrhoea without constipation. Br J 1148:553-560. , Capasso R, Severino B, Fiorino F, Aviello G, De Rosa G, et al (2011). Inhibitory effects lain, a cysteine protease derived from pineapple stem (Ananas comosus), on intestinal in mice. Neurogastroenterol Moti123:745-e331. Hughes PA, Page AJ, Kwan KY, Martin CM, O'Donnell TA, et al. (2009). The ion 1 is required for normal mechanosensation and is modulated by algesic stimuli. rology 137:2084-2095. oM, Improta G, Tabacco A (1998). Central effect ofSNC 80, a selective and systemically lta-opioid receptor agonist, on gastrointestinal propulsion in the mouse. Eur J Pharmacol 51. K, Harvey DJ (1990). In vitro metabolism of cannabichromene m seven common animals. Drug Metab Dispos 18:1065-1070. , Aviello G, Romano B, Borrelli F, De Petrocellis L, Di Marzo V, Izzo AA (2011). n of mouse gastrointestinal motility by allyl isothiocyanate, a constituent of cruciferous 1 s: evidence for TRPA1-independent effects. Br J Pharmaco12011 Sep 28.[Epub ahead of
30
Capasso R, Borrelli F, Aviello G, Romano B, Scalisi C, Capasso F, et al. (2008a). Cannabidiol, from Cannabis sativa, selectively inhibits inflammatory hypermotility in mice. Br J 1154:1001-1008. , Matias I, Lutz B, Borrelli F, Capasso F, Marsicano G, et al. (2005). Fatty acid amide controls mouse intestinal motility in vivo. Gastroenterology 129:941-951. , Izzo AA, Fezza F, Pinto A, Capasso F, Mascolo N, et al. (2001). Inhibitory effect of ethanolamide on gastrointestinal motility in mice. Br J Pharmacol 134:945-950.
!'~~'~'MlR, Borrelli
F, Cascio MG, Aviello G, Huben K, Zjawiony JK, et al. (2008b). Inhibitory alvinorin A, from Salvia divino rum, on ileitis-induced hypermotility: cross-talk between oid and cannabinoid CB(l) receptors. Br J Pharmacol155:681-689.
a F, Spreadbury I, Miranda-Morales M, Grady EF, Vanner S, Bunnett NW (2010). receptor potential ankyrin-1 has a major role in mediating visceral pain in mice. Am J astrointest Liver Physio1298:G81-91. NL, Keenan CM, Lutz B, Piomelli D, Sharkey KA (2009). The identification of peroxisome r-activated receptor alpha-independent effects of oleoylethanolamide on intestinal transit eurogastroenterol Motil 21 :420-429. Coruzzi G, Adami M, Guaita E, Menozzi A, Bertini S, Giovannini E, et al. (2006). Effects of "!flfmf!i3ffllli1illl'~'IDid receptor agonists on rat gastric acid secretion: discrepancy between in vitro and in vivo Dis Sci 51:310-317. , Pertwee RG (1998). Evidence that cannabinoid-induced inhibition of electrically ntractions of the myenteric plexus--longitudinal muscle preparation of guinea-pig small an be modulated by Ca2+ and cAMP. Can J Physiol Pharmacol 76:340-346. ,,!qt,#~1Ii113~.'iHe XD, Goyal RK (2002) Both ATP and the peptide VIP are inhibitory neurotransmitters -pig ileum circular muscle. J Physiol 447: 119- 131. G Valenti M, Scaglione G, Cosenza V, Sorrentini I, Di Marzo V (2006). Up-regulation levels as an endogenous mechanism and a pharmacological strategy to limit colon ion. FASEB J 20:568-570.
:LHu.aHJ.H.f~
NA, Izzo AA, Degenhardt B, Valenti M, Scaglione G, Capasso R, et al. (2005). ent of the cannabimimetic compound, N-palmitoyl-ethanolamine, in inflammatory and ic conditions: review of the available pre-clinical data, and first human studies. rmacology 48:1154-1163.
~'Il\Ti<, 'Xjf;l\A,
Hatoum NS (1983). Neurobehavioral actions of cannabichromene rahydrocannabinol. Gen Pharmacol14:247-252.
and interactions with
T, Wolf CE, Poklis A, Lichtman AH (2010). Pharmacological evaluation of the natural t of Cannabis sativa, cannabichromene and its modulation by Delta(9)ydrocannabinol. Drug Alcohol Depend 112:126-133.
De Petrocellis L, Vellani V, Schiano-Moriello A, Marini P, Magherini PC, Orlando P, et al. (2008). tived cannabinoids modulate the activity of transient receptor potential channels of ankyrin melastatin type-8. J Pharmacol Exp Ther 325:1007-1015. ellis L, Ligresti A, Moriello AS, Allara M, Bisogno T, Petrosino S, et al. (2011a). Effects inoids and cannabinoid-enriched Cannabis extracts on TRP channels and endocannabinoid ~tab1E)!1Cnzymes. Br J Pharmacol Sep 28 [Epub ahead of print] e cellis L, Orlando P, Schiano Moriello A, Aviello A, Stott C, Izzo et al. (2011 b) oid actions at TRP channels: effects on TRPV3 and TRPV 4 and their potential relevance testinal inflammation. Acta Physiol Jul 4 [Epub ahead of print] '<'V%~.i&.ldf6V (2008). Targeting the endocannabinoid ov 7:438-455. system: to enhance or reduce? Nat Rev Drug
V, Capasso R, Matias I, Aviello G, Petrosino S, Borrelli F, et al. (2008). The role of abinoids in the regulation of gastric emptying: alterations in mice fed a high-fat diet. Br J 1153:1272-1280. , Nozawa K, Kawabata-Shoda E, Kojima R, Yokoyama T, Ito H (2009a). Molecular cloning nd characterization of dog TRP Al and AITC stimulate the gastrointestinal motility through TRPA1 in conscious dogs. Eur J Pharmaco1617:124-129. Y1flfUU1iU,iJfJiI1WllIfl&H,K, Kawabata-Shoda E, Kojima R, Yokoyama T, Ito H (2009b). TRPA1 Nozawa elay gastric emptying in rats through serotonergic pathways. Naunyn Schmiedebergs maco1380:353-357. , Mouihate A, Mackie K, Keenan CM, Buckley NE, Davison JS, et al. (2008). oid CB2 receptors in the enteric nervous system modulate gastrointestinal contractility in ccharide-treated rats. Am J Physiol Gastrointest Liver Physio1295:G78-G87.
=~.LV
r1T, Ivey K, Robinson K, Ahmed S, Radwan M, Slade D, et al. (2010). Antidepressant-like delta9-tetrahydrocannabinol and other cannabinoids isolated from Cannabis sativa L. B' chern Behav 95:434-442. ,Leffler A, Niedermirtl F, Babes A, Zimmermann K, Filipovic MR, et al. (2011) TRPA1 nee P mediate colitis in mice. Gastroenterology 141:1346-1358. , Pertwee RG, Di Marzo V (2010). Phytocannabinoids ? Br J Pharmacol160:523-9. (2009). N-acylethanolamines, beyond the Cannabis plant - do
anandamide
and food intake.
Biochem
NS, Davis WM, Elsohly MA, Turner CE (1981). Cannabichromene and delta 9cannabinol: interactions relative to lethality, hypothermia and hexobarbital hypnosis. Gen ac 1 12:357-362. ><~ (2011). Transient receptor potential (TRP) channels as drug targets for diseases of the Ho digestivei!system. Pharmacol Ther 131: 142-70 20l2 The Authors British Journal of Pharmacology 20l2 Society 32 The British Pharmacological
Camilleri M (2009). Cannabinoids 5. Coutts AA (2005). -98. Cannabinoids
in intestinal inflammation
and cancer. Pharmacol Res
and the digestive
tract. Handb
Exp Pharmacol
Sharkey KA (2010). Cannabinoids Pharmacol Ther 126:21-38.
and the gut: new developments
and emergmg
Aviello G, Petrosino S, Orlando P, Marsicano G, Lutz B et al., (2008) Increased abinoid levels reduce the development of precancerous lesions in the mouse colon. J Mol 9-98. Borrelli P, Capasso R, Di Marzo V, Mechoulam R (2009a). Non-psychotropic plant vLu<HUIJHJ,yids: therapeutic opportunities from an ancient herb. Trends Pharmacol Sci 30:515new
AA, Piscitelli P, Capasso R, Aviello G, Romano B, Borrelli P, et at. (2009b). Peripheral abinoid dysregulation in obesity: relation to intestinal motility and energy processing y food deprivation and re-feeding. Br J PharmacoI158:451-61. Izzo AA, Pezza P, Capasso R, Bisogno T, Pinto L, Iuvone T, et at. (2001). Cannabinoid CB1"!flfUkif!i34~1t1}'f(~l/l&i,mediated regulation of gastrointestinal motility in mice in a model of intestinal ion. Br J Pharmacol 134:563-570. asricha PJ (2001). Agents used for diarrhoea, constipation, and inflammatory bowel gents used for biliary and pancreatic disease. In: Goodman and Gilman's. The logical Basis of Therapeutics. eds. Hardman, J.G. and Limbird, L.E.,10th edn. McGrawYork, pp 1037-1058. Pertwee RG, Parsons ME (2010). The effects of Deltacannabinol and cannabidiol alone and in combination on damage, inflammation and in . disturbances in rat colitis. Br J PharmacoI160:712-723. , Puig MM, PolO (2006). Antiexudative effects of opioids and expression of kappa- and id receptors during intestinal inflammation in mice: involvement of nitric oxide. J Exp Ther 316:261-270. S, Schneider CR, Wallace NH, Hornby PJ (2006). Agonists of cannabinoid receptor 1 and experimental colitis induced by oil of mustard and by dextran sulfate sodium. Am J Gastrointest Liver Physiol 291 :G364-3 71. , Obata K, Miyoshi K, Sakurai J, Tanaka J, Miwa H, et at. (2009). Transient receptor 1 mediates gastric distention-induced visceral pain in rats. Gut 58:1342-1352. a oso JH, Lahlou S, Coelho-de-Souza AN, Criddle DN, Pinto Duarte GI, Santos MA et al. ). Inhibitory actions of eugenol on rat isolated ileum. Can J Physiol PharmacoI80:901-906.
Ligresti A, Moriello AS, Starowicz K, Matias I, Pis anti S, De Petrocellis L, et al. (2006). Antitumor f plant cannabinoids with emphasis on the effect of cannabidiol on human breast . J Pharmacol Exp Ther 318:1375-1387. , Piscitelli F, Gatta L, Vita D, De Petrocellis L, Palazzo E, et al. (2011). Non-psychoactive ids modulate the descending pathway of antinociception in anaesthetized rats through ... mechanisms of action. Br J Pharmacol162:584-596. a CR, Mandel-Brehm J, Bautista DM, Siemens J, Deranian KL, Zhao M, et al. (2007). ediates formalin-induced pain. Proc Natl Acad Sci USA 104:13525-13530.
f;IISt!/j!ffffJDEWfflf;lf.J
",e,vpnl"t
Marsicano G, Hermann H, Cannich A, Monory K, Cravatt BF, et al. (2004) The us cannabinoid system protects against colonic inflammation. J Clin Invest 113: 1202-
m R, Shani A, Edery H, Grunfeld Y (1970). Chemical basis of hashish activity. Science 12. edic Z, Chandra S, Slade D, Denham H, Foster S, Patel AS, et al. (2010). Potency Trends of THC and Other Cannabinoids in Confiscated Cannabis Preparations from 1993 to 2008. J Forensic ci 55:1209-1217 M, Shahbazian A, Bock E, Pabst MA, Holzer P (2010). Chemo-nociceptive signalling olon is enhanced by mild colitis and blocked by inhibition of transient receptor potential channels. Br J Pharmacol 160: 1430-1442. E, Izzo AA, Borrelli F, Capasso F, Capasso R, Pinto A, et al. (2002). Relaxant effect of e in the isolated rat ileum. Naunyn Schmiedebergs Arch Pharmaco1365:187-192. K, Kawabata-Shoda E, Doihara H, Kojima R, Okada H, Mochizuki S, et al. (2009). gulates gastrointestinal motility through serotonin release from enterochromaffin cells. Acad Sci USA 106:3408-3413.
M'~'~'I:
H ri M, Ozaki H (2007). Mechanism of abnormal intestinal motility in inflammatory how smooth muscle contraction is reduced? J Smooth Muscle Res 43:43-54.
, Tashima K, Tsuchiya S, Matsumoto K, Nakamura T, Horie S, et al. (2007). Contractile RPA1 receptor agonists in the isolated mouse intestine. Eur J Pharmaco1576:143-150. G (2009). Emerging strategies for exploiting cannabinoid receptor agonists as medicines. acol156:397-411.
ig MM (1997). Reversal of tolerance to the antitransit effects of morphine during acute inflammation in mice. Br J Pharmacol122:1216-1222. saki M, Jimenez N, Dawson VL, Dawson TM, Puig MM (2005). The involvement xide in the enhanced expression of mu-opioid receptors during intestinal inflammation Pharmacol145:758-766. 20l2 The Authors British Journal of Pharmacology 20l2 Society of in
PolO, Valle L, Ferrer I, Puig MM (1996). The inhibitory effects of alpha(2)-adrenoceptor agonists intestinal transit during croton oil-induced intestinal inflammation. Br J Pharmacol 1655. , Pelayo JC, Cattaruzza F, Kuo YM, Gai G, Chiu JV, et al. (2011). Transient receptor nkyrin 1 is expressed by inhibitory motoneurons of the mouse intestine. Gastroenterology -575. , Pol 0(1998). Peripheral effects of opioids in a model of chronic intestinal inflammation Pharmacol Exp Ther 287:1068-1075.
t/ur'hOlleli!
AK, Louhivuori
LM, Kiehne K, Kerman
KE, Herzig KH (2008). TRP Al
channel
'<'V%~lli\i{f!~[i'i~fi induces cholecystokinin release via extracellular calcium. FEBS Lett 582:229-232.
, Capasso R, Aviello G, De Petrocellis L, Pescatore A, Izzo AA, Di Marzo V (2010) effect of cannabichromene on intestinal motility in mice. 20th Annual Symposium of the nal Cannabinoid Research Society (Lund, Sweden, July 23-27), Pl-12 EB (2011). Taming THC: potential cannabis effects. Br J Pharmacol163:1344-1364. Sanger GJ (2007). Endocannabinoids Pharma 1152:663-670. synergy and phytocannabinoid-terpenoid
and the gastrointestinal
tract: what are the key questions? Br J
, Storr MA (2010). Targeting the endocannabinoid system for gastrointestinal rapeutic strategies. Exp Rev Clin Pharmacol 3: 193-207.
diseases:
S, Wissniowski TT, Lohwasser C, Alinger B, Neureiter D, Ocker M (2011). Role of id receptors and RAGE in inflammatory bowel disease. Histol Histopatho126:735-745.
1~i'.I, Bashashati M, Hirota C, Vemuri VK, Keenan CM, Duncan M, et al. (2010). Differential
of CB(l) neutral antagonists troenterol Moti122:787-796. and inverse agonists on gastrointestinal motility in mice.
enan CM, Emmerdinger D, Zhang H, Yiice B, Sibaev A, et al. (2008). Targeting abinoid degradation protects against experimental colitis in mice: involvement of CB 1 and tors. J Mol Med 86:925-936. , Giangaspero A, Sosa S, Negri R, Grassi G, Casano S, et al. (2010). Comparative topical matory activity of cannabinoids and cannabivarins. Fitoterapia 81: 816-819. E, Elsohly MA (1981). Biological activity of cannabichromene, rmaco121:283S-291S. its homologs and isomers.
, Elsohly MA, Boeren EG (1980). Constituents of Cannabis sativa L. XVII. A review of 1 constituents. J Nat Prod 43:169-234. rman SA, Costa M (1994). The role of enteric inhibitory motoneurons uinea-pig small intestine. J Physio1477 (Pt 3):459-468. 20l2 The Authors British Journal of Pharmacology 20l2 Society in peristalsis in the
Wirth PW, Watson ES, EISohly MA, Seidel R, Murphy JC, Turner CE (1980). Anti-inflammatory f cannabichromene homologs. J Pharm Sci 69: 1359-1360. , Rooney N, Feeney M, Tate J, Robertson D, Welham M, et al. (2005). Differential m of cannabinoid receptors in the human colon: cannabinoids promote epithelial wound astroenterology 129:437-453. , Duncan M, Sharkey KA (2008). Cannabinoid CB2 receptors in the gastrointestinal gulatory system in states of inflammation. Br J PharmacoI153:263-270 . ~~'~~f&".~.Li Zuo X, Zhen Y, Yu Y, Gao L (2008). Transient receptor potential ankyrin-l Y, es in visceral hyperalgesia following experimental colitis. Neurosci Lett 440:237-241. Yang J, Zuo XL, Gao LJ, Wang P, Li YQ (2010). Transient receptor potential vanilloid-l and ankyrin-l (TRP AI) participate in visceral hyperalgesia in chronic water avoidance model. Neurochem Res 35:797-803.
Legends to figure Anandamide (AEA) and 2-arachydonoylglycerol (2-AG) levels in the duodenum (A,D),
},ejullllm,ltB,E) and ileum (C,F) of mice treated or not with croton oil. Some mice treated with croton
Iso treated with cannabichromene

. *P<0.05 vs control.
(CBC 15 mg kg-I, i.p.). Data are means.e.mean
of
"'''i!t,#0Ifii~.t'lfft't. Palmitoylethanolamide
(PEA) and oleoylethanolamide
(OEA) levels in the duodenum
r~I!A'!~i~~~',unum and ileum (C,F) of mice treated or not with croton oil. Some mice treated with (B,E) e e also treated with cannabichromene (CBC 15 mg kg-I, i.p.). Data are means.e.mean
. Relative
expression
of N-acyl-phosphatidylethanolamine-selective phosphodiesterase
phospholipase
D, A), Figure 8A), glycerophosphodiester cerollipase e hydrolase the jejunum
1 (GDEl, B), Figure 8B),
a (DAGLa, Figure 8C), diacylglycerollipasi
~ (DAGL~, Figure 8D), and fatty lipasi (MAGL, Figure 8F)
(FAAH, C) Figure 8E) and monoacylglycerol duodenum, jejunum
and ileum of animals treated or not with croton oil. (CBC 15 mg kg-I, i.p.).
e treated with croton oil were also treated with cannabichromene
that the effect of CBC was evaluated in the jejunum and ileum only (mRNA in the samples of ftI;,~~~numwas degraded). Total RNA extracted from the intestine of control and croton-oil20l2 The Authors British Journal of Pharmacology 20l2 Society 36 The British Pharmacological
treated mice was subjected to quantitative (real-time) RT-PCR analysis as described in "Materials ds." Data were analyzed by OENEX software for groupwise comparisons and statistical The expression \!fI!JfftJffj$tml!~u~t~.'das 1. Results 001
vs
in control tissues (duodenum, jejunum are means s.e.mean
and ileum) for each target was *P<0.05, **P<O.OI and vs control and
of four experiments.
control; #P<0.05, #P<O.OI and P<O.OI vs croton oil. ***P<O.OOl
vs croton oil.
. Relative expression of cannabinoid (CBI and CB2) receptors (A, B) and transient receptor '<'Vff~tlll'l'ifl'ifofankyrin type-l (TRPAl) 'r not with croton cannaoicnromene (C) mRNA in the duodenum, jejunum and ileum of animals with croton oil were also treated with
oil. Some mice treated
(CBC 15 mg kg-I, i.p.). Note that the effect of CBC was evaluated in the jejunum
only (mRNA in the samples of the duodenum was degraded). Total RNA extracted from estine of control and croton-oil-treated mice was subjected to quantitative (real-time) RT-
ysis as described in "Materials and methods." Data were analyzed by OENEX software for groupwise comparisons and statistical analysis. The expression in control tissues (duodenum, as 1. Results are means s.e.mean of four
nd ileum) for each target was considered ts. *P<0.05 and **P<O.OI
vs
control; #P<0.05, #P<O.OI and ###P<O.OI vs croton oil.
. Effect
of i.p. injected
cannabichromene
(CBC,
10 and 20 mg kg") and of the
""qt,JI~~!I!t~l~pic cannabinoid
receptor agonist WIN 55,212-2 (1 mg kg") on upper gastrointestinal (B) and whole gut transit in mice (C) (see methods for details of 6-11 mice for each
It~f#~~.), olonic propulsion c

measurement roup **P<O.OI
of motility). Bars represent the means.e.mean

vs
control. Note that a decreased transit is indicated by a decreased (min)" (B) or by an increased time
e (A),
by an increased value of "time of expulsion
gut transit (min)" (e).
. Inhibitory
effect of i.p.-injected
cannabichromene
(CBC, 1-20 mg kg')
on intestinal
roton oil-treated mice in vivo. Transit was expressed as the geometric centre (OC) of the on of a fluorescent marker along the small intestine. OC ranged from 1 (minimal motility) ximal motility) (see Methods section). Bars represent the means.e.mean of 10-12 mice
h experimental group. #P<0.05 vs control and *P<0.05 vs croton oil. Note that eBe (10 and '~1) id not affect transit in control mice (see figure 5). d 20l2 The Authors British Journal of Pharmacology 20l2 Society 37 The British Pharmacological
Croton oil-treated mice: effect of cannabichromene (CBC, 10 mg kg-I, i.p.) alone or in the of the cannabinoid CBI receptor antagonist rimonabant (0.1 mg kg-I , i.p.), the CB2 \!fI!Jfftffi1j$t)~~.ilt~!I!'ntagonist SR144528 (1 mg kg-I, i.p.) or the TRPAI antagonists HC-030031 (30 mg kg-I,
P18 (100 mg kg", i.p.) on upper gastrointestinal transit in vivo. Transit was expressed as
tric centre (OC) of the distribution of a fluorescent marker along the small intestine. OC ~'S!~ljifflilirm (minimal motility) to 10 (maximal motility) (see Methods section). Bars represent 1 mice for each experimental group. #P<0.05 vs control, *P<0.05 vs
Inhibitory effect of cannabichromene (CBC, 10-8_10-4 M ) on the contractions induced by line (Ach, 10-6 M) or electrical field stimulation (EFS) in the isolated mouse ileum of 1and croton-oil-treated mice. Each point represents means.e.mean of 7-8 experiments. Both mice and in croton oil-treated mice the curve representing the inhibitory effect of CBC on acetylcholine- induced contractions was statistically different (P<O.001) from the curve representing
"!~'f$Mi!i3k~'tEJ&lj~~ . tory effect of CBC on EFS-induced contractions. .
Electrically-induced contractions in the isolated mouse ileum of control (A,C,E) and (B,D,F) treated mice: inhibitory effect of cannabichromene (CBC, 10-8_10-4 M) alone or in the presence of rimonabant (3xl0-8 M) and SR144528 (10-7 M) (A,B) (Figure 5A),
",,'Wt,wi
f#;IIJ.jl (10-5 M) and ruthenium red (3xl0-6 M) (C,D) (Figure 5B) or L-NAME (3xl0-4 M) and ~~Ejlt~i,!10-7 (alone or in combination, Figure 5C) (E,F). Each point represents means.e.mean M) ents. No significant differences among the curves were observed.
Electrically-induced contractions in the isolated mouse ileum of croton oil-treated mice nhibitory effect of cannabichromene (CBC, 10-8_10-4M) alone (vehicle) or in the presence of t (3xl0-8 M) and SR144528 (10-7 M) (Figure 6A), HC-030031 (10-5 M) and ruthenium
-6
M) (Figure 6B) or L-NAME (3xl0-4 M) and apamin (10-7 M) (alone or in combination,
). Each point represents means.e.mean of 7-8 experiments. No significant differences e curves were observed.
e 10. Electrically-induced contractions in the isolated mouse ileum of control (A,C) and
(B,D) treated mice: inhibitory effect of cannabichromene (CBC, 10-8_10-4 M) alone

38
(vehicle) or in the presence of ai-conotoxin (10-8 M) (A,B), IBMX (10-7M), rolipram (10-6 M) or (10-7 M) (C,D). Each point represents means.e.mean of 7-8 experiments. Both in ice (A) and in croton oil-treated mice (B), ai-conotoxin (but not IBMX, rolipram or
\!'Jfftffit,J$.t1f.tifl~~f'; significantly (P<0.01) reduced the inhibitory effect of CBC (significance between
'he insert tofigure 1OCshows that IBMX (1ff7 M), rolipram (10-6 M) and forskolin (10-7
Icantly
(P<0.01) reduced the inhibitory effect of WIN55,212-2 (1ff9_10-6 M) on
'y-induced contractions in the ileum of control mice (n=5)
' ' ' VU,llfl ,fffBfl. Acetylcholine (Ach, 1a' M)-induced contractions in the isolated mouse ileum of
) and croton oil (B) treated mice: inhibitory effect of cannabichromene (CBC, 10-8_10-4 (vehicle) or in the presence of ai-conotoxin (10-8 M), verapamil (10-6 M) or nic acid (CPA, 10-5 M). Each point represents means.e.mean of 8-9 experiments. in control mice (A) and in croton oil-treated mice (B), Verapamil (but not CPA or w-
Iz) significantly
curves).
(P<0.01) reduced the inhibitory effect of CBC (significance between
anandamlde (AEA) B jejunum

24
ileum
<6 w
<
Icontrol
2... arachidonoylglycerol (2..,AG)

E jejunum F
..
~CBC
croton oil till croton oil +
esc
ileum
Figure 1
palmltoylethanolamlde (PEA) B jejunum C ileum
0.5
Ol
~
o E
U_L::J'1t"''-l
U.'I.II"t1
.!?; o.
tn 0.10
0... 0.05 0.00
I . ,control
oleoy/ethanolamlde (OEA)
jejunum
EmCeC ..... croton oil III!croton oil + eBC ileum
<C
o control mcac
_croton 011
mmCBC
+ croton oil
igure 5
Fig
croton oil
control roton oil (CO) CO+CBC
csc
croton oil
EFS
D ACh
ACh (croton oil)
EFS (croton oil)
-7
Fig
-6 C.BC [LflgM]
... 5
.. 4
Figu
81l A vehicle
ill
B
vehicle
a c:onotoxin
II)
o .c:onoto)Q1'I
II)
21:1
.6
.5
S
CBC!logMI
.5
CBClleg,.,
81l C
Btl Il
vehicle
61l .IBMX a roliprl!lm
'f
vehicle tBMI
60
a rolipram
forskolin
,. fOfllikoli1'!
Figu
1
.6
.5
CBC[logMj
CBCtlogMj
40
A 30
(J
a CPA
vehitle
verapamil V (I}-conotoxin
10
esc
e
[LogM]
40
B 30
vehicle
CPA
verapamil v (I}-conotoxin
.,. 10
Figu
1
esc
[LogM]

Inhibitory Effect of Cannabichromene, A Major Non-Psychotropic Cannabinoid Extracted From Cannabis Sativa, On Inflammation-Induced Hypermotility in Mice

Загружено:

Сведения о документе

Исходное описание:

Оригинальное название

Авторское право

Доступные форматы

Поделиться этим документом

Поделиться или встроить документ

Параметры публикации

Этот документ был вам полезен?

Это неприемлемый материал?

Авторское право:

Доступные форматы

Inhibitory Effect of Cannabichromene, A Major Non-Psychotropic Cannabinoid Extracted From Cannabis Sativa, On Inflammation-Induced Hypermotility in Mice

Загружено:

Авторское право:

Доступные форматы

Inhibitory effect of cannabichromene, a major non-psychotropic inoid extracted from Cannabis sativa, on inflammation-induced hypermotility in mice

ent of Experimental Pharmacology, University of Naples Federico II, Via D. Montesano

he Authors British Journal of Pharmacology 2012 Society

The British Pharmacological

title: cannabichromene and intestinal motility OUND AND PURPOSE

is a major non-psychotropic phytocannabinoid which inhibits endocannabinoid

BC on mouse intestinal motility in physiological and pathological states.

and palmitoylethanolamide, up-regulation of TRPAl and CB1 receptors and down-

20l2 The Authors British Journal of Pharmacology 20l2 Society

2 The British Pharmacological

SIONS AND IMPLICATIONS

et al., 2008; De Petrocellis et al., 2011b). Likely through activation of TRPA1,

The British Pharmacological

(NAPE-PLD) and glycerophosphodiester

1 (GDE1) (involved in anandamide

Symposium of the International Cannabinoid Research

20l2 The Authors British Journal of Pharmacology 20l2 Society

in the European Communities Council Directive of24 November 1986 (86/609/ECC).

ive (real-time) RT-PCR analysis

20l2 The Authors British Journal of Pharmacology 20l2 Society

DNA-free kit) in a 20 f.l 1 final volume reaction mixture to remove residual

TGGTGGAAATGG, R: GTGGTTGTGACTGATGAGG; GTGTGAATGATGATGCT~

CBl accession NM_007726, F: CB2 accession, F:

FAAH accession NM_010173, F: GCCTCAAGGAATGCTTCA,

NM_ 007393; HPRT

CCAGGCATTGCTGACAGG; (accession: NM_013556;

was performed by iQ5

(10 and 20 mg kg'),

WIN 55,212-2 (1 mg kg-I, used as a positive control) or vehicle was given

in before glass bead insertion.

carmine red suspension in 0.5% carboxymethylcellulose.

The time to the first red bowel

fly (and agonists)-induced

119 mM, KCl 4.75 mM, 11 mM).

1.5 mM, CaCb 2.5 mM, and glucose

ns from the longitudinal r, visualized, recorded

activity was digitized on an analog-to-digital computer using the PowerLab/400 1 h equilibration

go Basile, Comerio, Italy). All experiments

started after a minimal

EFS had been recorded, the contractile cumulative concentrations Preliminary

ai-conotoxin (10-8 M), the non(IBMX, 10-7 M), the

phosphodiesterase (PDE) inhibitor 3-isobutyl-1-methylxanthine

(10-7 M) . The concentration

(3x10-8 M) was able to on EFS-induced

of the HC-030031 (10-5 M), ruthenium red (3x1 0-

et al., 2007; Alexander et al., 2009). Higher concentrations

The other concentrations

used in the present study were selected on the basis of

,212-2 (10-9_10-6 M, contact time for each concentration: 20 min) on EFS-induced

am (10-6 M) orforskolin (10-7 M)J.

20l2 The Authors British Journal of Pharmacology 20l2 Society

11 The British Pharmacological

20l2 The Authors British Journal of Pharmacology 20l2 Society

n r RNA expression of enzymes involved in anandamide biosynthesis and degradation in the

if control and croton oil-treated mice: effect of cannabichromene

Because a significant decrease of anandamide was observed in the jejunum

(but not in the

of the anandamide biosynthetic enzyme GDEl (NAPE-PLD showed a strong trend

CRC 4.901.02, P<O.OOl, n=4),

colon colonic propulsion (thus indicating an inhibitory effect on colonic propulsion)

time of expulsion of an orally-given red marker (which indicates an inhibitory effect

2012 The Authors British Journal of Pharmacology 2012 Society