Seminario Técnico: Compuestos Azufrados Volátiles en Vinos

Organizan:
Seminario Tcnico
Compuestos azufrados voltiles en vinos

Problemas de reduccin y aromas varietales
Tarragona, 23 de abril de 2009 Madrid, 24 de abril de 2009
Colaboran:
ndice
Ponencias 01. Relacin entre el contenido nitrogenado 4
en mosto/uva y la sntesis de aromas: efecto sobre la produccin de sulfhdrico
Prof. Gemma Beltran Universidad Rovira i Virgili Prof. Jose Manuel GuillaMn Universidad Rovira i Virgili Instituto de Agroqumica y Tecnologa de Alimentos IATA-CSIC
Artculos relacionados 41 Influence of the Timing of Nitrogen Additions

during Synthetic Grape Must Fermentations on Fermentation Kinetics and Nitrogen Consumption
51 59 59 63 73 77 83 87 91 103
Formacin de compuestos voltiles azufrados por levaduras vinicas. Una revolucin en el sector enlogico: Levaduras de vinificacin que no producen Sulfuro de hidrgeno (H2S) Nitrogen management is critical for wine Managing Director, flavour and style Unravelling the genetic blueprint of wine yeast When the heat is on, yeast fermentation runs out of puff Taking control of alcohol A la recerca del codi digital dels llevats del vi Effect of Micro-oxygenation on Color and Anthocyanin-Related Compounds of Wines with Different Phenolic Contents Efectos de la microoxigenacin en vino tinto
18
isak S. Pretorius The Australian Wine Research Institute, PO Box 197, Glen Osmond, Adelaide, SA 5064, Australia
02. Los nuevos retos en microbiologa del vino. Levaduras no productoras de SH2
30
03. La micro-oxigenacin de vinos tintos: Control de la reduccin y estabilizacin del color

Prof. encarna Gmez Plaza Universidad de Murcia
36
04. Los compuestos voltiles no son todos perjudiciales!

rmi Guerin-SCHneiDer Institut Franais de la Vigne et du Vin ENTAV-ITV France
01. Relacin entre el contenido nitrogenado en mosto/uva y la sntesis de aromas: efecto sobre la produccin de sulfhdrico
Prof. Gemma BeltRan Universidad Rovira i Virgili Prof. Jose Manuel GUillaMn Universidad Rovira i Virgili instituto de agroqumica y tecnologa de alimentos iata-CSiC
Contenido Resumen 6 6 1. Introduccin 7 2. Efecto de la concentracin y tipo de

nitrgeno sobre el crecimiento de las levaduras y su cintica fermentativa.
9 10 15
3. Efecto de la concentracin y tipo de nitrgeno sobre la cintica fermentativa 4. Relacin entre el contenido en nitrgeno y la sntesis de compuestos aromticos Bibliografa
Seminario tcnico
Jos M. Guillamn navarro

Requena, 6 de julio de 1967. e-mail: guillamon@iata.csic.es
Gemma Beltran Casellas
investigacin:
Coautor de 50 artculos cientficos en revistas internacionales de las reas de Tecnologa de Alimentos, Biotecnologa y Microbiologa. Coautor de 20 artculos en revistas de divulgacin del sector agroalimentario y vitivincola. 80 comunicaciones a Congresos nacionales e internacionales, 24 de ellas como ponente invitado o comunicacin oral. Autor de 5 captulos de libros especializados y 37 captulos en libros de congresos. Autor de 3 patentes de levaduras vnicas en explotacin. Director de 3 tesis doctorales (2 de ellas con formato de doctorado europeo)
Posicin actual:
Profesora ayudante doctor del Departamento de Bioqumica y Biotecnologa de la Universidad Rovira i Virgili, Facultad de Enologa, desde diciembre del 2007. Miembro del grupo de investigacin de Biotecnologa Enolgica de la Facultad de Enologa de la URV, dentro de la lnea de estudio de las levaduras vnicas.
lneas de investigacin
Estudio del metabolismo de las levaduras en condiciones de fermentacin vnica. Efecto de las bajas temperaturas de fermentacin y del metabolismo del nitrgeno. Estudio de las poblaciones de levaduras y bacterias acticas durante los procesos de elaboracin de vino. Utilizacin de marcadores moleculares para la caracterizacin e identificacin de los microorganismos del vino.
estancias en Centros extranjeros:

Estancia post-doctoral en la Universidad de Utrecht (junio del 1998 a mayo del 1999). Estancia post-doctoral en el Institute for Wine Biotechnology (Stellenbosch University) en Stellenbosch (Sudfrica) (septiembre del 2004 a marzo del 2005).
A lo largo de su carrera investigadora Gemma Beltran ha colaborado en proyectos sobre el estudio las levaduras y sus requerimientos nutricionales, analizando los factores que pueden condicionar a una mejora en la fermentacin alcohlica, tanto los que se derivan del mosto (niveles de nitrgeno disponible) como de varias prcticas enolgicas (fermentaciones a bajas temperaturas, rehidratacin). Sus investigaciones predoctorales se centraron principalmente en el estudio la represin catablica por nitrgeno a lo largo de la fermentacin (Beltran et. al. 2004, 2005), as cmo en el efecto de las bajas temperaturas de fermentacin sobre los cambios en la expresin gnica global y el metabolismo de la levadura vnica (Beltran et al. 2006, 2007, 2008). Adems, en su estancia post-doctoral realizada en el grupo de Biologa Molecular de levaduras del profesor Stefan Hohmann (Suecia), estuvo involucrada en estudios de sealizacin de nutrientes, en concreto estudiando el metabolismo de la tiamina y la ruta de la represin catablica por glucosa, como parte de un proyecto europeo de investigacin. Gemma Beltran es autora o co-autora de un total de 15 publicaciones internacionales y 9 publicaciones nacionales, ha participado en un total de 12 proyectos investigacin o contratos de transferencia, asistido a 22 congresos cientficos, dirigido tesis de master y est actualmente dirigiendo una tesis doctoral. Actualmente es profesora de Bioqumica y Microbiologia Enolgica en la Facultad de Enologa, y desde su reincorporacin al grupo de Biotecnologa Enolgica de la URV en diciembre de 2007 ha estado colaborado en proyectos de investigacin y transferencia con el sector vitivincola, centrndose nuevamente en el estudio de los requerimientos nitrogenados de las levaduras vnicas de primera y segunda fermentacin.
Ponencias
31 de octubre de 1975
Captulo
Resumen:
La cantidad y calidad del componente nitrogenado de los mostos no determina nicamente un buen crecimiento de la levadura y una buena capacidad fermentativa, sino que influye directamente sobre la sntesis de un buen nmero de compuestos voltiles o aromas. En un trabajo de nuestro grupo (Beltran et al., 2005) comprobamos que las adiciones de nitrgeno asimilable en forma de aminocidos, y despus de la fase exponencial de crecimiento, aumentaban los niveles de alcoholes superiores y de algunos steres. En un estudio similar, Vilanova y cols. (2007) observaron tambin incremento en la sntesis de alcoholes superiores y en steres de acetato cuando los mostos eran suplementados con concentraciones de amonio no superiores a los 300 mg/l. Sin embargo, la concentracin y fuente nitrogenada no solo tiene influencia en la sntesis de compuestos con impacto positivo en las calidades organolpticas de los vinos, sino que tambin varios trabajos han sealado una relacin directa entre el nitrgeno asimilable y la sntesis de sulfhdrico. Otros factores nutricionales y ambientales relacionados con la sntesis de este compuesto han sido: la concentracin de sulfatos y sulfitos (en forma de SO2) y la deficiencia en vitaminas (en concreto el cido pantotnico y la tiamina).
muy frecuentes las situaciones industriales en las que el nitrgeno se convierte en un factor limitante para el desarrollo de las levaduras y para la finalizacin de la fermentacin alcohlica. Son varios los autores que han tratado de establecer una concentracin mnima donde se pone en peligro la fermentacin alcohlica. Estos valores no coinciden entre los distintos trabajos, fluctuando de los 120-140 g Nitrgeno asimilable/l (Bely et al, 1990) hasta los 200 o 267 (Mendes-Ferreira et al, 2004), es decir ms del doble. Dichas diferencias pueden ser debidas a varios factores, pero entre los ms importantes podemos destacar dos: la cepa de levadura, perfectamente conocido por los productores de levaduras que incluso las catalogan como con elevado o bajo requerimiento nitrogenado o nutritivo y la forma qumica en que el nitrgeno est disponible en el mosto. Evidentemente otros factores como la forma de vinificacin, variedad de uva, etc. tambin son relevantes, pero su efecto se puede considerar como incluido en la forma qumica y cantidad de nitrgeno en el medio. El nitrgeno en el mosto puede estar presente en dos formas claramente diferenciadas: la inorgnica, bsicamente como amonio, y la orgnica, formada por aminocidos, pptidos y protenas. No todas estas formas son igualmente disponibles, ya que, por ejemplo, los pptidos y las protenas no se suelen considerar como autnticas fuentes de nitrgeno, y los aminocidos son muy variables como fuentes nitrogenadas, ya que mientras algunos son consumidos vidamente (glutamina, por ejemplo), otros no lo son en absoluto en condiciones anaerobias como la prolina. Curiosamente la prolina, junto con la arginina, son los dos aminocidos mayoritarios en mostos. La levadura necesita la presencia de oxgeno para llevar a cabo la utilizacin de la prolina, adems este proceso de metabolizacin de la prolina se lleva a cabo principalmente en la mitocondria, que se encuentra muy poco funcional en condiciones fermentativas. Sin embargo, no se ha estudiado si en condiciones de fermentaciones ms aireadas, tales como durante la maceracin en tintos, puede haber un consumo mayor de este aminocido. El nitrgeno en forma de amonio suele ser altamente disponible para las levaduras, por lo que es una forma qumica que se suele utilizar de forma abundante en la industria enolgica. La presencia de nitrgeno en cualquiera de estas formas qumicas es fuertemente variable, dependiendo de diversos factores, entre ellos la variedad, grado de maduracin de la uva, caractersticas edafo-climticas en las que se desarrolla sta y diversos aspectos tecnolgicos (tipo de vinificacin, prensado, etc). En resumen, debemos considerar como nitrgeno asimilable (NA) por las levaduras en las condiciones de vinificacin al amonio como fuente inorgnica (representa hasta el 40% del NA), y todos los aminocidos excepto la prolina. Sin embargo, la levadura vnica Saccharomyces cerevisiae no consume este ni-
1. introduccin:
La transformacin de la uva en vino es un proceso biotecnolgico donde los microorganismos presentes, fundamentalmente las levaduras, utilizan los nutrientes del mosto para su crecimiento, produciendo toda una gama de metabolitos que convierten un lquido empalagoso en una solucin hidroalcohlica de sabor y aroma ms agradable. La principal reaccin bioqumica durante la fermentacin alcohlica es la conversin de los azcares en etanol. Sin embargo, no es la nica. Un pequeo porcentaje de los azcares van destinados a la sntesis de metabolitos secundarios (glicerol, succnico, lctico, actico, alcoholes superiores, steres, etc), de menor concentracin que el etanol pero que son los determinantes de la calidad del vino. Tambin hay una pequea parte de los azcares del mosto que va destinada a la sntesis de componentes celulares, es decir, a la sntesis de biomasa. En esta sntesis de biomasa no solo intervienen los azcares sino que es imprescindible el componente nitrogenado. Aunque el componente nitrogenado es cuantitativamente el segundo nutriente ms abundante en el mosto, presenta una gran desproporcin con el componente carbonatado (azcares). Mientras que la suma de glucosa y fructosa se encuentra del orden de 200 a 300 g/litro, concentraciones de mil veces menores (200-300 mg/litro) suelen ser valores muy habituales para el nitrgeno asimilable. Por tanto, son

trgeno asimilable de manera aleatoria, sino que tiene un orden de preferencia por los distintas fuentes de nitrgeno. S. cerevisiae ha desarrollado diferentes mecanismos moleculares que le permiten utilizar preferentemente aquellas fuentes que le permiten crecer mejor. Este mecanismo de seleccin de la fuente de nitrgeno se conoce como Represin Catablica por Nitrgeno (NCR). El NCR se caracteriza porque la clula es capaz de detectar la presencia de las fuentes de nitrgeno ms ricas. Esto desencadena una cadena de seales, que culmina con la activacin de los genes implicados en el transporte y metabolismo de estas fuentes ricas y en la represin de aquellos genes implicados en el transporte y utilizacin de fuentes ms pobres. Una vez consumida las fuentes de nitrgeno ms ricas (amonio, glutamina y asparagina), la levadura activa la maquinaria metablica para la utilizacin de las ms pobres (arginina, glutamato, alanina, etc.) (Figura 1). Sin embargo, la importancia del nitrgeno no reside exclusivamente en ser necesario para la formacin de biomasa. El contenido en nitrgeno tambin tiene una influencia clara sobre la velocidad fermentativa (Taillandier et al., 2007). La mayor parte de la fermentacin alcohlica se produce en una fase de no proliferacin celular o estacionaria. En este punto el nitrgeno del medio es utilizado para el recambio proteico de los diferentes enzimas celulares. Por ltimo, este contenido en nitrgeno tiene una influencia manifiesta en los diferentes metabolitos producidos durante la fermentacin, muchos de ellos con un impacto muy claro en el aroma del vino. A continuacin trataremos en mayor profundidad los diferentes aspectos de la fisiologa y metabolismo celular que se ven afectados tanto por la cantidad como por la calidad del nitrgeno del mosto. Especial hincapi dedicaremos a la sntesis de aromas de reduccin o produccin de SH2 y otros compuestos derivados del metabolismo del azufre.
Seminario tcnico
2. efecto de la concentracin y tipo de nitrgeno sobre el crecimiento de las levaduras y su cintica fermentativa.
Varela y cols. (2004) propusieron que la velocidad de fermentacin depende por un lado del estado metablico de las clulas y por otro del nmero de clulas alcanzados durante la fermentacin alcohlica. Dicho de otro modo, de la viabilidad (nmero de clulas fermentando) y la vitalidad de cada una de estas clulas. Ambos componentes tienen una dependencia importante del nitrgeno disponible en el mosto. En este punto nos vamos a centrar en como afecta el nitrgeno a la divisin celular o produccin de biomasa y en el siguiente apartado abordaremos como afecta a la vitalidad o actividad celular. En un trabajo reciente de nuestro grupo hemos comprobado como el nitrgeno es el substrato limitante del crecimiento celular hasta alcanzar valores cercanos a los 200 mg/l, aunque esto depende de la fuente de nitrgeno utilizada. Para ello hacamos crecer las levaduras en un mosto sinttico (similar al natural) donde iba cambiando nicamente la concentracin de N y el tipo de fuente de N. Como puede verse en la figura 2, el nmero de clulas o biomasa (medido por la densidad ptica (O.D.) a 595 nm) iba aumentando conforme aumentaba la concentracin de nitrgeno, en este caso en forma de arginina como nica fuente de nitrgeno. Esto fue as hasta niveles de 180 mg de
Figura 1. Representacin grfica del mecanismo de Represin Catablica por nitrgeno (nCR) segn Cooper (2002)
Ponencias
Figura 2. evolucin de la OD de la cepa PDM en mosto sinttico con arginina como nica fuente de nitrgeno y con concentraciones crecientes entre 20 y 140 mg n/l.
N/l (en la grfica solo se representa hasta 140 mg de N/l), por encima de esta cantidad ya no determinamos diferencias en la biomasa obtenida. Como se comenta anteriormente, no solo tiene importancia la cantidad sino la calidad o tipo de nitrgeno. En un experimento similar determinamos la biomasa producida para la misma concentracin de diferentes fuentes de nitrgeno. Como puede verse en la figura 3, la glutamina permite un mayor crecimiento celular que la arginina, y resulta sorprendente que la menor cantidad de biomasa producida se obtiene con la utilizacin de amonio, tericamente una de las fuentes de nitrgeno ms interesante para la levadura. Varela y cols (2004) determinaron el efecto que tena la cantidad de clulas en un mosto deficiente en N
(50 mg/l) sobre la velocidad y tiempo de fermentacin. Para ello aadan dos y 5 veces ms de la dosis recomendable de levadura seca activa a los mostos. El resultado fue que en estas fermentaciones, con mayor concentracin de clulas, se alcanzaban velocidades de fermentacin similares a las obtenidas en un mosto rico en nitrgeno (300 mg/l). De esta manera mostraban una relacin directa entre mayor concentracin de biomasa y mayor velocidad fermentativa en mostos pobres en nitrgeno. Desde un punto de vista aplicado para la industria enolgica, esto sugiere dos posibles soluciones frente a un mosto pobre en nitrgeno. La primera y ms habitual solucin consiste en la suplementacin de los mostos con nitrgeno, fundamentalmente en forma de sales de amonio. Como posible alternativa, sera la adicin de una mayor cantidad de levadura seca activa o la adicin de biomasa de otros
Figura 3. Comparativa de crecimiento en las tres fuentes de nitrgeno para una cantidad idntica de 140 mg n/l.
Amonio Arginina Glutamina

tanques de fermentacin. Aunque un aumento de la biomasa aadida podra tener efectos sobre el aroma y sabor del vino (excesivo sabor a levadura). Mendes-Ferreira y col. (2004) tambin estudiaron el efecto de diferentes concentraciones de amonio sobre el crecimiento y la velocidad fermentativa. En este estudio, y para la cepa PYCC 4072, estos autores determinaron la produccin mxima de biomasa (7,8 g/l) para una concentracin de 402,5 mg de N/l. En concentraciones limitantes de N (66 mg de N/l) la cantidad de biomasa producida era 3,5 veces menor (2,2 g/l). Las concentraciones crecientes en N no solo afectaban a la produccin de biomasa, sino a la velocidad de fermentacin. Mientras la fermentacin con una cantidad suficiente de N acabo la fermentacin en 5 das, la fermentacin limitante en N (66 mg de N/l) requiri 28 das para su finalizacin. En nuestro grupo, para comprobar el efecto que tena la adicin de nitrgeno durante la fermentacin alcohlica, llevamos a cabo un trabajo donde adicionbamos una mezcla de amonio y aminocidos a mostos deficientes en N (60 mg/l) en diferentes fases de la fermentacin (Beltran et al., 2005). En concreto, estas adiciones se hicieron en fermentaciones que estaban a densidades de 1080 (inicio de una fermentacin), 1060 y 1040 (mitad de fermentacin) y 1020 y 1000 (final de fermentacin). Cuando la adicin se realizaba al principio y mitad de fermentacin (hasta 1040 de densidad), sta tena un efecto claro sobre el aumento de la biomasa (Figura 4). Si se realizaba en las fases finales (1020 y 1000 de densidad) ya no se registraba un aumento de la biomasa, pero si que se produca un aumento de la velocidad de fermentacin (Figura 5). De hecho, la fermentacin suplementada a una densidad de 1020 finalizaba la fermentacin 5 das antes que la fermentacin no suplementada con N. Estos resultados mostraban que el mejor momento para la adicin de N era durante el crecimiento exponencial de la levadura (primeros das de fermentacin). En esta fase tena un efecto sobre el crecimiento celular y sobre la velocidad de fermentacin. En este trabajo tambin determinamos la cantidad de nitrgeno consumido en las diferentes fermentaciones. Como es de esperar, esta cantidad era mayor cuanto ms temprano en el proceso se adicionaba el N (Figura 6). En esta misma figura, podemos ver la preferencia de la levadura por el N inorgnico (amonio) o el orgnico (aminocidos) en las diferentes fases. Result muy curioso comprobar que el amonio parece ser la fuente de N preferida para la produccin de biomasa (mayor consumo durante las primeras fases) mientras que apenas era consumida en las ltimas fases de fermentacin. Estas diferencias en la proporcin de consumo de amonio o aminocidos tambin produjeron diferencias en los perfiles organolpticos de los distintos vinos, como se explica en los siguientes apartados. Figura 4. efecto de la adicin de una mezcla de amonio y aminocidos (240 mg de n/l) sobre la produccin de biomasa medida como densidad ptica (O.D. a 600 nm). la densidad a que se realizaba la adicin viene reflejada en el pie de la figura.
Seminario tcnico
Figura 5. efecto de la adicin de una mezcla de amonio y aminocidos (240 mg de n/l) sobre la velocidad fermentativa, medida como reduccin de la densidad del mosto. la densidad a que se realizaba la adicin viene reflejada en el pie de la figura.
Figura 6. Consumo de n total, amonio y aminocidos (expresados como mg de n/l) en las distintas fermentaciones.
3. efecto de la concentracin y tipo de nitrgeno sobre la cintica fermentativa

Resulta evidente de nuestro anterior trabajo (Beltran et al., 2005) que el enriquecimiento en N del medio de fermentacin tena un efecto sobre la cintica fermentativa, independiente del crecimiento celular. Algunos autores (Taillandier et al., 2007) confirman que este efecto estimulador del consumo de azcares es incluso ms importante que el efecto sobre el crecimiento. Este hecho resulta muy interesante desde el punto de vista industrial si tenemos en cuenta
Ponencias
que la mayor parte de la fermentacin alcohlica se produce en la fase estacionaria o de no proliferacin celular. A pesar de que durante este periodo no hay multiplicacin celular, las levaduras necesitan nitrgeno para mantener su metabolismo activo. El medio de fermentacin es un ambiente cambiante y hostil que requiere una readaptacin continua para las nuevas condiciones. Esta readaptacin al medio supone un recambio proteico continuo en la maquinaria enzimtica celular. Para este recambio de protenas celulares, es necesaria la disponibilidad de nitrgeno en el medio de fermentacin. Taillandier y col. (2007) establecieron la cantidad de nitrgeno consumido por la levadura por gramo de azcar consumido (mg N/g de glucosa o fructosa). Como siempre hay que contar con las diferentes necesidades de las distintas cepas, esta cantidad tena un rango de 0,61 a 0,91 mg de N por gramo de azcar. Es decir, una relacin mg N/g azcar prcticamente asegura cubiertas las necesidades nitrogenadas y es una relacin muy sencilla para el enlogo poder calcular las diferentes necesidades de sus mostos. Una relacin similar establecieron Bisson y Butzke (2000), pero en este caso, entre necesidad de N asimilable frente a grado alcohlico probable (GAP) (figura 7). Figura 7. Relacin entre grado alcohlico probable (GaP) y cantidad necesaria de n asimilable (mg de n/l) para alcanzar dicha cantidad (Bisson y Butzke, 2000).
cols (2004) observaron una activacin del enzima fosfofructoquinasa, enzima clave de la glucolisis, con la adicin de amonio.
4. Relacin entre el contenido en nitrgeno y la sntesis de compuestos aromticos

Adems del efecto sobre el crecimiento, la disponibilidad de nitrgeno tambin tiene un efecto importante sobre el metabolismo de las levaduras, afectando la formacin de compuestos voltiles y no voltiles, los cuales son de gran importancia para las calidades organolpticas del vino final (revisado por Alberts y col. 1998, Bell y Henkschke, 2005). La concentracin de compuestos no voltiles como son el glicerol, el cido mlico, cido succnico o cido alfa-cetoglutrico, puede variar dependiendo de la cantidad y la fuente nitrogenada presente en los mostos. Alberts y col. (1996) observaron, por ejemplo, que la concentracin de glicerol es mayor cuando la ratio nitrgeno amoniacal respecto al nitrgeno orgnico representado por los aminocidos. En un trabajo de nuestro grupo (Beltran y col. 2005) observamos que la concentracin de glicerol disminuye en fermentaciones con limitacin de nitrgeno. Esto demuestra que la produccin de glicerol es directamente proporcional a la produccin de biomasa. Muchos de los compuestos voltiles, que son los que contribuirn al aroma final del vino, tambin estn afectados por el tipo y/o concentracin de nitrgeno disponible para la levadura. Los compuestos mayormente afectados son el cido actico, los alcoholes superiores, los cidos grasos de cadena media y corta y sus steres etlicos, y los esteres de acetato. En la Figura 8 vemos relacin entre la acumulacin de algunos compuestos voltiles y la concentracin inicial de nitrgeno en vinos producidos a partir de mosto sinttico con dos cepas Saccharomyces cerevisiae (resultados obtenidos por Carrau y col. 2007). De este trabajo se desprende que hay una relacin inversa entre crecimiento (o disponibilidad de nitrgeno) y produccin de alcoholes superiores. Mientras que la mayor presencia de nitrgeno parece estimular una mayor produccin de steres. Sin embargo, los resultados de este trabajo demuestran que la concentracin ptima de nitrgeno para la sntesis de steres depende de la cepa en cuestin. La cepa KU1 produca su mxima concentracin de steres para una concentracin de nitrgeno mucho menor que la cepa M522. Esta ltima tena una mayor produccin de estos compuestos. La carencia en nitrgeno en los mostos es generalmente subsanada mediante adiciones de sales de amonio. En la Tabla 1 y Figura 9 observamos cmo afecta tambin el momento de la suplementacin de nitrgeno a la produccin de algunos de estos compuestos.
Sin embargo, el aumento de la cintica fermentativa no debe ser solo entendido por la disponibilidad de nitrgeno para facilitar el recambio proteico celular, sino que se ha demostrado que algunas fuentes de nitrgeno, en concreto el amonio, pueden actuar como activadores de la actividad de enzimas glucolticos claves. En concreto, se ha visto un incremento importante del transporte de azcares por activacin de las permeasas implicadas (genes HXT) (Bely et al., 1990). Taillandier y cols (2007) tambin informaron de una mayor actividad fructoflica (mayor consumo de la fructosa frente a la glucosa) de la levadura en presencia de mayor concentracin de nitrgeno, probablemente por un cambio en la afinidad de los transportadores de hexosas. Igualmente, Berthels y
10

El contenido en cido actico vara segn la concentracin de nitrgeno en el medio, habiendo una relacin inversa entre la cantidad de cido actico producido y la disponibilidad de nitrgeno a concentraciones bajas o moderadas de nitrgeno, pero una relacin directa a concentraciones altas (Bely y col. 2003, HernandezOrte y col. 2006). De hecho, trabajos de Beltran y col. (2005) y de Vilanova y col. (2007) muestran que a mayor disponibilidad y consumo de nitrgeno por parte de la levadura, mayor produccin de cido actico (Figura 9). Esta mayor produccin de actico a mayores concentraciones de nitrgeno puede estar relacionada con una mayor tasa de crecimiento. El actico es producido por las levaduras como substrato para la sntesis de cidos grasos, un mayor crecimiento podra justificar una mayor sntesis de actico. Otra posibilidad es que siempre hay una relacin directa entre sntesis de glicerol y de actico. Por tanto, a concentraciones altas de nitrgeno se produce ms glicerol y, por tanto, ms actico. Resultado similar se observ con la produccin de acetaldehdo. Los alcoholes superiores pueden aportar aromas pesados y desagradables a los vinos si se encuentran en concentraciones muy altas (excluyendo el 2-feniletanol, que tiene aroma floral). Existe una relacin inversa entre el contenido en alcoholes superiores y la concentracin inicial de nitrgeno, excepto por concentraciones muy bajas de nitrgeno (Beltran y col. 2005, Vilanova y col. 2007, Carrau y col. 2008). Los alcoholes superiores se pueden formar a partir de aminocidos (via de Ehrlich) o a partir del catabolismo de los azcares (via anablica) (Figura 10). Esta ltima es la principal va de produccin de alcoholes superiores durante la fermentacin alcohlica. Cuando hay poco nitrgeno disponible en el medio, hay un aumento en la sntesis de alpha-cetocidos a partir de azcares. Estos alfacetocidos son los precursores en la sntesis de aminocidos, pero la escasez de nitrgeno alfa-amnico necesario en la reaccin de transaminacin, hace que los alfa-cetocidos formados se acaben excretando en el medio en forma de alcoholes superiores, sin llegar a formar los aminocidos necesarios. Sin embargo, en un medio con alto contenido en nitrgeno, el nitrgeno disponible permite la biosntesis de aminocidos, lo que reduce el exceso de alfa-cetocidos y por tanto la produccin de alcoholes superiores (Oshita y col., 1995).
Seminario tcnico
Figura 8. Relacin entre la acumulacin de algunos compuestos voltiles y la concentracin inicial de nitrgeno en vinos producidos a partir de mosto sinttico con dos cepas Saccharomyces cerevisiae (cepa M522 () y cepa KU1 ()). (Carrau y col., 2008)
Ponencias
11
tabla 1. Relacin entre el momento de la adicin de nitrgeno y la produccin de metabolitos secundarios por la levadura. las fermentaciones se realizaron con mosto sinttico limitante en nitrgeno (60 mg/l Yan), al que se aadi 240 mg/l de nitrgeno (mezcla amonio y aminocidos) en distintos momentos de fermentacin (densidad 1080 g/l o inicio, 1060, 1040, 1020, 1000 g/l y no suplementado). (Beltran y col. 2005)
Figura 9. Relacin entre la concentracin de metabolitos secundarios (normalizados con el valor de mayor produccin en cada caso) y el momento de la suplementacin de nitrgeno. las fermentaciones se realizaron con mosto sinttico limitante en nitrgeno (60 mg/l Yan), al que se aadi 240 mg/l de nitrgeno (mezcla amonio y aminocidos) en distintos momentos de fermentacin (densidad 1080 g/l o inicio, 1060, 1040, 1020, 1000 g/l y no suplementado).
Figura 10. Ruta de sntesis de alcoholes superiores a partir de aminocidos (via de ehrlich) o a partir de los azcares (via anablica)
Glucosa Vaanablicaodesntesis Piruvato
COOH H C NH2
COOH H C O
H C O
NADHNAD+
H H C OH
R R R R NH3 CO2 Aminocido Aldehido Alcoholsuperior cetocido Desaminacin Descarboxilacin Reduccin ViadeEhrlich:viacatablicadeaas
12

Este efecto ha sido observado experimentalmente por distintos trabajos. Carrau y col. (2008) muestran claramente que la cantidad de alcoholes superiores disminuye con el aumento de nitrgeno disponible, aunque se observa el efecto inverso en la produccin de 1-propanol (Figura 8d, 8e). Estos hechos tambin fueron observados en estudios realizados por nuestro grupo de investigacin (Tabla 1, Figura 9). En ellos vimos que la sntesis de alcoholes superiores disminuye cuando un mosto limitante en nitrgeno se suplementa durante la fase exponencial de crecimiento de las levaduras, disminuyendo as su periodo de limitacin, y lo que lleva tambin a un mayor consumo total de nitrgeno que si se suplementa en fases ms tardas de la fermentacin. Por otro lado, si el nitrgeno es adicionado en fase estacionaria, despus de un largo periodo de limitacin, el contenido en alcoholes superiores aumenta considerablemente. Los esteres de etilo y de acetato muestran una relacin ms compleja con la disponibilidad de nitrgeno, debido a sus distintos orgenes de sntesis, pero, en la mayora de los estudios, el acetato de etilo y los esteres de acetato estn relacionados positivamente con la concentracin de nitrgeno del medio. Figura 11. Ruta de sntesis de H2S a travs de la secuencia de reduccin del sulfato (SRS) y la ruta de biosntesis de aminocidos azufrados (metionina y cistena) en S. cerevisiae. adenosyl 5-fosfosulfato (aPS), 3-fosfoadenosil 5-fosfosulfato (PaPS), O-acetilserina (O-aS), O-acetilhomoserina (O-aH). (Swiegers y Pretorius, 2007)
Seminario tcnico
4.1 Relacin entre el contenido en nitrgeno y la sntesis de compuestos azufrados

Las levaduras vnicas pueden formar H2S a partir de compuestos de azufre inorgnicos (sulfato o sulfito), o compuestos orgnicos azufrados (cistena o glutatin). Normalmente el mosto es deficiente en compuestos orgnicos azufrados, y esto puede llevar a la levadura a sintetizar algunos de estos compuestos a partir de fuentes inorgnicas, normalmente abundantes en el mosto. En Saccharomyces cerevisiae, la produccin de H2S es el producto de la ruta de la secuencia de reduccin del sulfato (SRS), y es un intermediario en la biosntesis de los aminocidos azufrados (metionina, y cistena). (Figura 11). Varios factores ambientales y nutricionales se han asociado con la produccin de H2S en condiciones de vinificacin: la cepa de levadura utilizada, la cantidad de azufre presente en los mostos (ya sea en forma de sulfito o de sulfato), la carencia de vitaminas, y la carencia o disponibilidad de nitrgeno. Varios estudios se han centrado en analizar este ltimo punto, el impacto del nitrgeno en la formacin de aromas de reduccin o azufrados. Para la biosntesis de los aminocidos azufrados (cistena y metionina) se requiere por un lado esqueletos de carbono que contengan nitrgeno (O-AH: Oacetilhomoserina, O-AS: O-acetilserina), los cuales derivan de un pool intracelular de nitrgeno, y por otro lado sulfito, que deriva de la ruta de reduccin del
sulfato. En carencia de nitrgeno, disminuye el pool de nitrgeno intracelular y por tanto la sntesis de los precursores nitrogenados O-AS y O-AH, con lo que el sulfito producido no podr utilizarse para la sntesis de aminocidos y se excretar en forma de cido sulfhdrico (SH2). As pues, el ratio de formacin del H2S parece estar regulado por los requerimientos celulares de aminocidos azufrados, y por el mantenimiento de los pools de nitrgeno intracelular. Jiranek y col. (1995) observaron que en fermentaciones vnicas existe una relacin directa entre la limitacin de nitrgeno y la sntesis de sulfhdrico. Algunos de sus resultados se muestran el la Figura 12 y Tabla 2. En la Figura 12 observamos que la produccin de sulfhdrico por parte de la levadura aumenta en el momento en que el nitrgeno del medio se consume (en presencia de sulfito). Este efecto es mucho ms pronunciado en fase exponencial de crecimiento, cuando la levadura tiene ms requerimientos nitrogenados, que en fase estacionaria, donde disminuyen las necesidades nitrogenadas, y tambin la produccin de sulfhdrico. Estos autores relacionaron tambin este aumento en la produccin con la actividad sulfito reductasa, la cual es mayor en fase exponencial de crecimiento. Por otro lado, si un medio limitante en nitrgeno se suplementa con amonio o con la mayora de aminocidos, la produccin de sulfhdrico disminuye. Pero este no es el caso de los aminocidos azufrados (principalmente Cistena, de manera individual o en combinacin con Metionina), la adicin de los cuales da lugar a un aumento incluso mayor en la produccin de H2S por parte de las levaduras (Tabla 2). Esto es debido a la liberacin del sulfhdrico como subproducto
Ponencias
13
Figura 12. Relacin entre la produccin de H2S y el momento en que se produce la limitacin de nitrgeno durante la fermentacin. las fermentaciones se realizaron con la cepa aWRi77 en mosto sinttico con distintas concentraciones de nitrgeno inicial: 3.3 (), 16.6 () o 24.9 () mM. las flechas indican el momento en que se aadi sulfito (132 M) a los medios, 1 hora antes del consumo total de nitrgeno. (Jiranek y col. 1995)
tabla 2. Produccin de H2S por parte de la levadura aWRi77, 6 horas despus de haber suplementado un medio limitante en nitrgeno con aminocidos o amonio de manera individual. la suplementacin se realiz una hora antes de que el nitrgeno inicial fuera consumido. los datos estn normalizados al valor obtenido por el cultivo suplementado con amonio (Jiranek y col. 1995)
de la degradacin / transaminacin de estos aminocidos para ser utilizados como fuente de nitrgeno. En un trabajo reciente, Mendes-Ferreira y col. (2009) analizaron en varias cepas la relacin entre la concentracin de nitrgeno en el medio y la produccin de varios compuestos aromticos, entre ellos el cido sulfhdrico. Los resultados obtenidos variaban entre las distintas cepas, la Figura 13 muestra los resultados de la cepa UCD522, considerada alta productora de sulfhdrico. La sntesis de H2S se produce en el momento en que se consume el nitrgeno del medio, pero curiosamente el medio con una cantidad ptima de nitrgeno (267 mg/l), el cual se consume a las 48 horas de fermentacin, presenta valores mayores que el medio muy limitante en nitrgeno (66 mg/l). El exceso de nitrgeno disminuye la produccin de
sulfhdrico, pero este exceso puede provocar por otro lado la inestabilidad del vino y la produccin de otros compuestos indeseados. Pero el cido sulfhdrico no es el nico compuesto azufrado que podemos encontrar en los vinos, a partir de este compuesto se pueden formar mercaptanos o tioles, algunos de los cuales aportan olores desagradables a los vinos, los temidos caracteres de reduccin. H2S es un compuesto altamente reactivo, y se Figura 13. Perfil de fermentacin y de liberacin de cido sulfhdrico de la cepa UCD522 en medio sinttico y con distintas concentraciones de nitrgeno inicial: 66 mg/l (a), 267 mg/l (b) y 402 mg/l (c). (Mendes-Ferreira y col. 2009)
14

puede combinar con otros componentes presentes en el vino para formar otros compuestos voltiles azufrados (Vermeulen y col. 2005). Por ejemplo, la reaccin del sulfhdrico con el etanol o el acetaldehdo da lugar a etil-mercaptano (con olor a cebolla o gas natural), y por otro lado la formacin de polisulfuros (dimetil disulfuro, dimetil trisulfuro y dimetil tetrasulfuro) proviene de la oxidacin del metantiol, producto de la degradacin de la metionina (Swiegers y Pretorius, 2007). La levadura puede luego reducir estos compuestos disulfuro y formar mercaptanos, con las consecuencias organolpticas que esto supone. Sin embargo, a pesar de la mala popularidad que tienen los compuestos aromticos azufrados, no todos ellos aportan caractersticas negativas a los vinos, otros pueden llegar a contribuir positivamente, como es el caso de los tioles voltiles 4-mercapto-4-metilpentanona (4MMP), 3-mercaptohexanol (3-MH) y 3-mercaptohexilacetato (3MHA), los cuales forman parte de la identidad varietal del vino, especialmente en los vinos de la variedad Sauvingon Blanc. Estos compuestos azufrados varietales, se originan por la levadura en fermentacin alcohlica a partir de precursores tiolicos inodoros que contienen molculas de cistena en su estructura (Swiegers y col. 2007). Thibon y col. (2008) demostraron que en Saccharomyces cerevisiae, la represin catablica por nitrgeno controla tambin la liberacin de estos tioles voltiles a lo largo de la fermentacin, reprimiendo probablemente las permeasas de aminocidos que permiten la entrada de estos precursores a la clula, y reprimiendo la expresin del gen IRC7, que codifica para el principal enzima involucrado en la bioconversin de tioles (cistationa--liasa).
Seminario tcnico
Bibliografa
alberts, e., C. larsson, G. liden, C. niklasson, l. Gustafsson (1996) Influence of the nitrogen source on Saccharomyces cerevisiae anaerobic growth and product formation. Appl Environ Microbiol 62: 31873195 alberts, e., G. lidn, C. larsson, l. Gustafsson (1998) Anaerobic redox balance and nitrogen metabolism in Saccharomyces cerevisiae. Recent Res. Dev. Microbiol. 2:253-279. Bell, S.J., P.a. Henschke (2005) Implications of nitrogen nutrition for grapes, fermentation and wine. Aust. J. Grape Wine Res. 11:242-295. Beltran, G., B. esteve-Zarzoso, n. rozes, a. Mas, y J. M. Guillamon. influence of the timing of nitrogen additions during synthetic grape must fermentations on fermentation kinetics and nitrogen consumption. J agric. Food Chem, 53: 996-1002, 2005. Bely,M., Sablayrolles,J.M., Barre,P. (1990). Automatic detection of assimilable nitrogen deficiencies during alcoholic fermentation in oenological conditions. J.Ferment.Bioeng. 70, 246-252. Bely, M., a. rinaldi, D. Dubourdieu (2003) Influence of assimilable nitrogen on volatile acidity production by Saccharomyces cerevisiae during high sugar fermentation. J. Biosci Bioeng. 96:507-512 Bisson,l.F., Butzke,C.e. (2000). Diagnosis and rectifications of stuck and sluggish fermentations. Am.J.Enol. Vitic. 51, 168-177. Carrau, F.M., K. Medina, l. Farina, e. Biodo, P.a. Henschke, e. Dellacassa (2008) Production of fermentation aroma compounds by Saccharomyces cerevisiae wine yeasts: effects of yeast assimilable nitrogen on two model strains. FEMS Yeast Res. 8:11961207. Cooper,t.G. (2002). Transmitting the signal of excess nitrogen in Saccharomyces cerevisiae from the Tor proteins to the GATA factors: connecting the dots. FEMS Microbiol.Rev. 26, 223-238. Hernndez-Orte, P., J.F. Cacho, V. Ferreira (2002) Relationship between varietal aminoacid profile of grapes and wine aromatic composition. Experimetns with model solutions and chemometric study. J. Agric. Food Chem. 50: 2891-2899. Jiranek V, langridge P y Henschke Pa (1995a) Regulation of hydrogen sulfide liberation in wine-producing Saccharomyces cerevisiae strains by assimilable nitrogen. Appl Environ Microbiol 61: 461467. Mendes-Ferreira,a., Mendes-Faia,a., leao,C. (2004). Growth and fermentation patterns of Saccharomyces cerevisiae under different ammonium concentrations and its implications in winemaking industry. J.Appl.Microbiol. 97, 540-545.
Ponencias
15
Mendes-Ferreira, a., C. Barbosa, V. Falc, C. leao, a. Mendes-Faia (2009) The production of hydrogen sulphide and other aroma compounds by wine strains of Saccharomyces cerevisiae in synthetic media with different nitrogen concentrations. J. Ind. Microbiol. Biotechnol. DOI 10.10007/s10295-009-0527-x Oshita, K., M. Kubota, M. uchida, M. Ono (1995) Clarification of the relationship between fusel alcohol formation and amino acid assimilation by brewing fusel alcohol formation and amino acid assimilation by brewing yeast using 13C-labeled amino acid. Proceedings of the European Brewing Convention. Bruxelles, 387-394. Swiegers J. H. y i. S. Pretorius (2007) Modulation of volatile sulfur compounds by wine yeast Appl Microbiol Biotechnol 74:954960 thaillandier, P., ramon-Portugal, F., Fuster, a. y Strehaiano P. (2007) Effect of ammonium concentration on alcoholic fermentation kinetics by wine yeasts for high sugar content. Food Microbiology 24: 95-100.
thibon, C., P. Marullo, O. Claisse, C. Cullin, D. Dubourdieu, t. tominaga (2008) Nitrogen catabolic repression controls the release of volatile thiols by Saccharomyces cerevisiae wine fermentation. FEMS Yeast Res. 1-11. Varela C, Pizarro F, agosin e (2004) Biomass content governs fermentation rate in nitrogen-deficient wine musts. Appl Env Microbiol 70:33923400. Vermeulen, C., l. Gijs, S. Collin (2005) Sensorial contribution and formation pathways of thiols in foods: a review. Food Rev. Int. 21:69-137. Vilanova, M., M. ugliano, C. Varela, t. Siebert, i.S. Pretorius, P.a. Henschke (2007) Assimilable nitrogen utilisation and production of volatile and on-volatile compounds in chemically defined medium by Saccharomyces cerevisiae wine yeasts. Appl. Microbiol. Biotechnol. 77:145-157.
16
Seminario tcnico
Ponencias
17
02. los nuevos retos en microbiologa del vino. levaduras no productoras de SH2
isak S. Pretorius the australian Wine Research institute, PO Box 197, Glen Osmond, adelaide, Sa 5064, australia
Contenido 19 Resumen 19 1. Introduccin 20 2. Control de la dinmica de la fermentacin

de la levadura para mejorar la calidad del vino
21 22 23 24 25 25 25
3. Optimizacin de la fermentacin 4. Optimizacin de la calidad del vino: evitar la produccin de sabores y aromas indeseables 5. Optimizacin de la calidad del vino: mejora del aroma deseable, el sabor y el color 6. Aumento de las opciones de los vinicultores mediante el desarrollo de cepas de levaduras vincolas mejoradas y novedosas 7. Conclusiones y previsiones futuras 8. Agradecimientos 9. Lecturas complementarias
Seminario tcnico
Resumen
Un mundo sin levaduras, esos humildes hongos unicelulares que nos ayudan a confeccionar alimentos y bebidas, tambin nos negara la capacidad de hacer avanzar las fronteras de la ciencia y de la tecnologa. La mayor parte de todo el abanico de funciones desempeadas por las levaduras es realizada por una sola especie, la Saccharomyces cerevisiae. De todas sus funciones, esta levadura es bien conocida por su capacidad para impulsar la transformacin del mosto en vino. Si bien la Saccharomyces cerevisiae es conocida como la levadura vinica, no se pueden considerar todas sus cepas iguales, dadas sus diferencias en el desarrollo de la fermentacin y atributos organolpticos. En la enologa moderna, donde es esencial disponer de fermentaciones rpidas y fiables para producir vinos estables en el tiempo y con estilo predeterminado y una calidad predecible, se prefiere la inoculacin en el mosto de cepas seleccionadas de Saccharomyces cerevisiae. Actualmente seguimos profundizando en el conocimiento de las interacciones asociadas con el vino que se producen entre nutrientes, precursores de sabores derivados de la uva, condiciones de la fermentacin y cepas especficas de levaduras. El presente documento aborda cmo los enologos pueden gestionar correctamente la fermentacin a travs de la dinmica de las levaduras en los mostos con el fin de optimizar su rendimiento y evitar el desarrollo de sabores y aromas indeseables, y sacar partido de cepas especializadas de levaduras de nuevo desarrollo y de las estrategias de inoculacin para mejorar la generacin de sabores.
Professor i.S. (Sakkie) Pretorius

Managing Director The Australian Wine Research Institute Ltd, PO Box 197, Glen Osmond, Adelaide, SA 5064, Australia Tel.: +61-8-83036610; Fax: +61-8-83036601 E-mail: Sakkie.Pretorius@awri.com.au Sakkie Pretorius se licenci en la University of the Orange Free State (Sudfrica) y obtuvo su doctorado en gentica molecular de levaduras , bajo la direccin del Profesor Julius Marmur en el Albert Einstein College of Medicine de New York en 1986. En la actualidad es director gerente del Australian Wine Research Institute, localizado en Adelaida. Es adems profesor asociado de la Universidad de Adelaida Sus investigaciones estn centradas en la microbiologa y biotecnologa del vino. Ha supervisado a 31 estudiantes de Doctorado y 56 estudiantes de Master en Ciencias. Ha publicado ms de 200 artculos de investigacin y captulos de libros, impartido ms de 500 lecciones magistrales y conferencias y es autor de 6 patentes. Defiende como principio que la investigacin del vino debe perseguir en primer lugar el conocimiento, pero tambin responder a las necesidades de productores y consumidores, tanto en la seleccin del tema de investigacin como en el diseo experimental. Cree que la investigacin inspirada en la bsqueda de conocimiento de los principios fundamentales y en las consideraciones de una aplicacin futura es la ms poderosa dinamo del progreso tecnolgico y que con una mnima inyeccin de recursos obtiene una sustancial calidad mejorada del producto, beneficios en la salud del consumidor y escaso impacto ambiental.
1. introduccin
Imagnese, si puede, un mundo sin levaduras. Imagnese que se encuentra entre las muchas personas que asumen la comida y la bebida que hay en sus mesas sin preguntarse cmo ha llegado hasta all, tan sana y rica. Imagnese un mundo sin nada para subir la masa al cocer el pan, sin nada con lo que hacer cerveza, vino o bebidas de alta graduacin. Imagnese tambin un mundo en el que nuestra capacidad para hacer avanzar las fronteras de la ciencia y de la tecnologa en varios frentes de manera sana y relativamente barata estuviera muy limitada. Y por ltimo imagnese un mundo con muy pocas alternativas con las que convertir los residuos agrcolas ricos en azcar en bioetanol para el uso como fuentes de energa renovables. Si puede imaginarse todo eso, estar viendo un mundo en el que nuestro avance tecnolgico y nuestro patrn de utilizacin de energa, nuestra gastronoma, jovialidad y buen estilo de vida se veran afectados considerablemente. Lo que necesitamos y explotamos parar evitar tal mundo inimaginable es un humilde hongo unicelular que durante milenios nos ha ayudado a confeccionar
Ponencias
19
alimentos y bebidas, y que en los ltimos tiempos ha sido moldeado por seleccin artificial para realizar una ms vasta, si cabe, variedad de funciones primero como agente de fermentacin vital en panificadoras, fbricas de cerveza, bodegas de vino y destileras y, en los tiempos ms recientes, como herramienta cientfica en los laboratorios de investigacin y como minifbricas para la produccin de productos biotecnolgicos de bajo volumen y gran valor tales como enzimas, productos qumicos, protenas teraputicas y otros productos farmacuticos importantes comercialmente. Lo que es an ms increble es que la mayora de esta gama de diversas funciones es realizada por una nica especie de levadura, la Saccharomyces cerevisiae. No obstante, de todas estas funciones y productos, esta extraordinaria levadura es probablemente mejor conocida por su capacidad para transformar la dulce, azucarada y poco sabrosa uva en el producto distintivo y rico en sabor que conocemos como vino. Los trminos levadura y fermentacin provienen etimolgicamente de palabras que se refieren al efecto de hervir o burbujear producido cuando el azcar se convierte bioqumicamente en alcohol etlico y dixido de carbono, pero la fermentacin producida por las levaduras es mucho ms que eso. De hecho, es la responsable de la mayora de los cambios asociados con la biotransformacin del mosto en vino el aroma, el sabor, la sensacin en el paladar, el color y la complejidad qumica son producidos por la levadura conforme diversifica y ampla su mundo con los productos de su metabolismo. Tradicionalmente el vino se elaboraba con las de levaduras ambientales que realizaban una fermentacin espontnea; la inoculacin deliberada de cultivos de levaduras puras es una tcnica relativamente reciente. En la fermentacin espontnea, existe una sucesin de levaduras indgenas provcedentes del viedo y de la bodega, pero las etapas finales estn dominadas de manera invariable por cepas de Saccharomyces cerevisiae tolerantes al alcohol. Hace mucho tiempo esta importante especie conocida universalmente como la levadura del vino, evolucion su capacidad para fabricar, acumular, tolerar y, bajo ciertas condiciones de crecimiento, incluso consumir alcohol, mientras que simultneamente produce metabolitos que mejoran el sabor y el aroma, tan importantes en nuestra apreciacin sensorial del vino. No obstante no todos los miembros de la tribu Saccharomyces cerevisiae pueden considerarse iguales, dado que existen diferencias en su robustez, rendimiento de la fermentacin y en los atributos sensoriales que introducen en el vino que las hacen nicas. En la vinicultura moderna, donde es esencial disponer de fermentaciones rpidas y fiables para producir homogneamente vino segn unas especificaciones definibles de sabor, unos estilos predeterminados y
una calidad predecible, se prefiere la inoculacin de cepas seleccionadas de Saccharomyces cerevisiae en el mosto. Las funciones principales de estas cepas seleccionadas son establecer un dominio numrico y metablico en la fase temprana de la fermentacin del vino y catalizar la conversin completa y eficiente de los componentes de la uva a alcohol, dixido de carbono y metabolitos que mejoran su sabor y aroma sin desarrollar sabores y aromas indeseables. La eleccin de la cepa de levadura a inocular en el caldo y la gestin eficaz de las interacciones entre la levadura, el mosto y las condiciones de fermentacin son factores importantes que determinan la duracin de la fermentacin y la composicin qumica y las propiedades organolpticas de un vino. En los apartados siguientes se aborda brevemente cmo los enlogos pueden controlar la dinmica de la levadura en los caldos para optimizar el desempeo de la fermentacin y por tanto evitar el desarrollo de muchos sabores y aromas indeseables y cmo pueden aprovecharse de cepas especializadas de reciente desarrollado para gestionar correctamente la fermentacin del vino.
2. Control de la dinmica de la fermentacin de la levadura para mejorar la calidad del vino

A diferencia de las prcticas microbiolgicas en otros sectores de la industria agroalimentaria, en enologa los microorganismos asociados con las uvas, otras materias primas y la maquinaria de procesamiento pueden entrar en el proceso de fermentacin e influir en su eficacia y en la calidad del producto. Las uvas albergan una gran variedad de levaduras y bacterias epifticas y, dependiendo de la adicin de sulfitos, la temperatura de la uva, el tiempo empleado en el transporte a la bodega, el estado higinico de las maquinaria de procesamiento de la uvas y los procedimientos de premaceracin, prensado y clarificacin, as ser la proporcin de levaduras que sobreviven en el zumo o mosto. Estas levaduras pueden proliferar en el zumo o mosto junto con los microorganismos asociados al equipo de procesamiento dependiendo de las condiciones fisicoqumicas y de nutrientes. Las etapas tempranas de la fermentacin son dominadas habitualmente por especies poco fermentativas como la Hanseniaspora uvarum (anamorfo de Kloeckera apiculate), debido a su gran tamao poblacional inicial. Con una prevalencia numricamente inferior a estas levaduras existen especies de Candida, Cryptococcus, Debaryomyces, Dekkera (anamorfo de Brettanomyces), Issatchenkia, Kluyveromyces, Metschnikowia, Pichia, Rhodotorula, Saccharomycodes, SchizoSaccharomyces, Torulaspora y ZygoSaccharomyces. Algunas de las levaduras mejor adaptadas no pertenecientes al gnero Saccharomyces tienden a reemplazar a las especies dbilmente fermentativas, pero finalmente
20

son tambin reemplazadas por las Saccharomyces, ya que stas ltimas estn mejor adaptadas al elevado contenido etlico y las condiciones anaerbicas del mosto o zumo en fermentacin. Saccharomyces cerevisiae es habitualmente la levadura dominante en la mayora de las regiones vincolas del mundo, si bien la especie criotolerante Saccharomyces bayanus es la dominante ms frecuente en las regiones ms fras. Saccharomyces paradoxus se encuentra en varias regiones fras de Europa del Este. Los tratamientos de clarificacin y la aplicacin de sulfitos habitualmente reducen el nmero de levaduras indgenas y, si inocula un cultivo vigoroso activador, ste dominar a la microflora indgena. Sin perjuicio de lo anterior, el uso subptimo de sulfitos antes de la fermentacin puede, por ejemplo, afectar a la eficacia de la fermentacin y a la calidad del vino. Si las condiciones lo permiten, la Hanseniaspora uvarum indgena puede desarrollarse rpidamente y eliminar nutrientes importantes del mosto. Por ejemplo, la tiamina, la cual es esencial para que las Saccharomyces produzcan etanol eficazmente, puede consumirse rpidamente. La Hanseniaspora uvarum puede tambin generar sabores y aromas no deseables, especialmente cido actico y acetato de etilo. Los lactobacilos tambin se pueden multiplicar rpidamente y producir cido actico junto con otros compuestos antagonistas de las levaduras, de modo que ralentizan o paran la fermentacin. Con el reciente descubrimiento de que la Dekkera bruxellensis puede estar presente en las uvas, al menos en la regin de Burdeos, la entrada de esta levadura contaminante en la corriente del vino ahora es ms obvia. Adems, el uso de sulfitos aparentemente no afecta a su establecimiento durante la fermentacin dado que posee una tolerancia relativamente alta a este agente antimicrobiano. A pesar de que los caldos en fermentacin espontneos (levaduras naturales, salvajes o silvestres) habitualmente tardan ms en fermentar que los inoculados (y habitualmente ms de lo que la mayora de los vinicultores estn dispuestos a aceptar) y a pesar de que el resultado de un mosto en fermentacin espontnea no siempre es predecible, no existe consenso entre los vinicultores del mundo sobre si es mejor usar cultivos iniciales o dejar la fermentacin espontnea. En un extremo se encuentran aquellos que continan utilizando levaduras indgenas exclusivamente, dado que creen que la contribucin nica de diversas especies de levaduras confiere una complejidad al vino no vista en fermentaciones inoculadas o guiadas. Otros prefieren empezar con levaduras nativas y posteriormente inocular un cultivo activador. Otros inician la fermentacin con activadores pero a un nivel de inoculacin inferior al recomendado. En la produccin vincola a gran escala, donde es esencial disponer de fermentaciones rpidas y fiables para conseguir un sabor homogneo y una calidad predecible, se prefiere utilizar cultivos seleccionados de levaduras puras con una capacidad, un conteo de clulas viables y una vitalidad conocidos. Con el fin de obtener los beneficios de la fermentacin espontnea y guiada, cada vez ms vinicultores estn co-inoculando dos o ms cepas diferentes pero compatibles de Saccharomyces cerevisiae, o mezclas de cultivos compuestas de una cepa de Saccharomyces cerevisiae y otra especie de Saccharomyces o no perteneciente a este gnero. Se debe optimizar la proporcin de las cepas o especies seleccionadas en los cultivos de siembra con el fin de obtener los mejores resultados previstos.
Seminario tcnico
3. Optimizacin de la fermentacin
Cuando se prepara el mosto a partir de uvas sanas y maduras, con una poblacin baja de microorganismo indgenas y un buen equilibro de nutrientes, si a este mosto se inocula un cultivo de levaduras vigoroso, la fermentacin empieza y finaliza rpidamente, dejando una pequea cantidad de azcar residual. Bajo estas condiciones ideales, las fermentaciones subptimas son relativamente infrecuentes. No obstante, cuando se producen, es necesario recuperar recursos considerables y pueden conducir a la prdida de la calidad del vino por un deterioro oxidativo, microbiolgico o autoltico de las levaduras. Se pueden producir fermentaciones subptimas en cualquier tipo de vino o producto en fermentacin, y stas pueden ocurrir incluso cuando se utilizan las cepas ms robustas fisiolgicamente hablando. Si bien las levaduras son enormemente adaptativas al ambiente del mosto, las condiciones fisicoqumicas y nutritivas no siempre son favorables para una actividad fisiolgica vigorosa y, a menos que la levadura se pueda adaptar a condiciones cambiantes durante la fermentacin, una reduccin del estado fisiolgico puede conducir a una fermentacin incompleta. Habitualmente se observan cuatro tipos de fermentaciones subptimas: (i) inicio con retraso; (ii) fermentacin continuamente lenta; (iii) fermentacin ralentizada; y (iv) fermentacin incompleta o interrumpida. Las fermentaciones que comienzan despus de un tiempo, pero que a menudo finalizan por ellas mismas de manera normal, son habitualmente el resultado de la utilizacin de un cultivo activador con una calidad deficiente. Las fermentaciones que constantemente son lentas, que pueden llegar a su finalizacin, habitualmente son el resultado de una cantidad reducida de nitrgeno asimilable. Las fermentaciones ralentizadas e interrumpidas, sin embargo, parecen ser causadas por varios factores relacionados con las interacciones entre la fisiologa de las levaduras, el estado de los nutrientes del mosto, la presencia de inhibidores y las condiciones de fermentacin. Concentraciones elevadas de azcar en el mosto, lo cual viene determinado principalmente por la ma-
Ponencias
21
durez de la uva en su vendimia, es probablemente la causa principal de fermentaciones ralentizadas e interrumpidas, y esto se debe a su vez primordialmente a la relacin entre la concentracin inicial de azcar y la produccin final de etanol; cuanto ms azcar hay en la uva, ms alcohol habr en el vino. Este problema se magnifica por la tendencia a utilizar uvas muy maduras o demasiado maduras en las bodegas. Por tanto, cada vez es ms importante elegir cepas de levaduras con alta tolerancia al etanol. El riesgo de que aparezcan problemas de fermentacin aumenta cuando el mosto tiene un contenido subptimo de nutrientes, especialmente de nitrgeno asimilable y vitaminas. Es importante saber que estas ltimas se pueden perder durante la vendimia y el procesamiento del mosto. Un elevado ndice de azcar con respecto a otros nutrientes puede provocar una reduccin de la cantidad de biomasa y una bajada de la velocidad de fermentacin, as como el inicio precoz de la inactivacin del transporte de azcar en las levaduras. La clarificacin del mosto es un factor importante en la fermentacin de vinos blancos debido al profundo efecto que la disminucin de los slidos de las uvas tiene sobre la definicin de la variedad de la uva, sobre el sabor y aroma del vino y sobre la aparicin de aromas fenlicos indeseables. No obstante, el exceso de clarificacin elimina lpidos importantes necesarios para que las levaduras puedan tolerar el etanol; en la prctica se adquiere una solucin de compromiso determinada por la experimentacin para establecer el nivel de slidos de la uva que favorecen una tasa satisfactoria de fermentacin manteniendo la calidad del vino en un nivel aceptable. La incapacidad de finalizar la fermentacin de mostos demasiado clarificados, con una elevada cantidad de azcar y una fermentacin anaerbica, pueden evitarse parcialmente introduciendo un paso de aireacin breve durante la fermentacin. La aireacin, unida a la adicin de nitrgeno asimilable despus de que haya finalizado la fase de crecimiento de las levaduras, revigoriza considerablemente la fermentacin. Este paso de aireacin no tiene un impacto detectable sobre el sabor del vino e incluso es beneficioso ya que minimiza el riesgo del desarrollo de sabores y aromas indeseables que podran originarse a partir de una fermentacin incompleta. No obstante, cuando la fermentacin se frena debido a una cantidad elevada de azcar, el procedimiento de rescate ms exitoso depende de la adaptacin secuencial de un cultivo fresco de levaduras a los inhibidores del vino en fermentacin interrumpida. Este procedimiento, que comienza preparando un cultivo activador de una levadura altamente tolerante al etanol, implica multiplicar sucesivamente por dos el volumen de cultivo, por adicin al vino en fermentacin interrumpida, a la vez que se mantienen la aireacin y
el aporte de nutrientes. Despus de dos a cuatro ciclos de adaptacin al vino en fermentacin interrumpida, el cultivo de rescate altamente adaptado puede finalizar la fermentacin en presencia de concentraciones de etanol y de cidos grasos voltiles normalmente inhibidoras. Los procedimientos que mantienen la levadura en suspensin hasta que vuelve a comenzar la produccin de CO2 mejoran ms la tasa y la probabilidad de que se complete la fermentacin.
4. Optimizacin de la calidad del vino: evitar la produccin de sabores y aromas indeseables

Es importante gestionar los nutrientes de la fermentacin con el fin de mantener una tasa de fermentacin vigorosa, alcanzar un punto final de bajo contenido de azcar residual y disminuir la produccin de sabores y aromas indeseables. Las uvas cultivadas en regiones con suelos de bajo contenido orgnico y pocas lluvias en la temporada de crecimiento pueden contener un nivel de nutrientes inferior al ptimo, especialmente de nitrgeno asimilable, el cual es necesario para el crecimiento de las levaduras y su funcin metablica. Se conoce bien cmo afecta la nutricin del nitrgeno sobre la produccin de compuestos voltiles de azufre. Durante la fermentacin de mostos con pocos nutrientes, la cantidad de nitrgeno asimilable baja precozmente e induce la produccin de sulfuro de hidrgeno (H2S) debido a la ausencia de compuestos que capten el sulfuro. En muchos casos se puede controlar la produccin de H2S mediante la adicin de sales nitrogenadas como el fosfato de diamonio. Otros estudios sugieren que es necesaria una concentracin de 200 250 mg/L de nitrgeno asimilable para minimizar el riesgo de produccin de H2S. No obstante, no todas las cepas comerciales responden a la mejora del mosto por la adicin de fosfato de diamonio, y el fallo en la respuesta habitualmente indica una deficiencia en el mosto de una o ms vitaminas, de cido pantotnico, de piridoxina o biotina, los cuales estn implicados en el metabolismo del H2S. La persistencia de problemas por produccin de H2S, an con la suplementacin de nutrientes, requiere la seleccin de una levadura de baja produccin de H2S en tales mostos. La ausencia de respuesta sobre el H2S tambin puede venir originada por la presencia de azufre elemental residual que no se ha utilizado en la via segn las recomendaciones del fabricante o cuando la vendimia se ha realizado prematuramente debido a condiciones meteorolgicas adversas. El exceso de algunos nutrientes tambin puede provocar la aparicin de sabores y aromas indeseables. La utilizacin excesiva de cido nicotnico, presente en algunos suplementos nutritivos, se asocia con la produccin de cido actico. La utilizacin excesiva de fosfato de diamonio tambin puede provocar la aparicin de sabores indeseables. El fosfato de dia-
22

monio estimula la produccin de steres, los cuales en cantidades moderadas pueden ser beneficiosos, pero cuando la concentracin total de in amonio se acerca al nitrgeno mximo que la levadura puede consumir (aprox. 400 500 mg/L de nitrgeno asimilable), la produccin de acetato de etilo es excesiva provocando un sabor indeseable debido a este ster voltil. Como una posible alternativa, existen algunos datos sobre productos de levaduras inactivadas que al utilizarse cuando se rehidrata la levadura seca activa pueden reducir el riesgo de produccin de H2S. Dado que el nitrgeno asimilable afecta tanto sobre la produccin de sabores indeseables durante la fermentacin, es importante medir el nitrgeno asimilable en los zumos o mostos antes de la fermentacin con el fin de optimizarlo. En los viedos con historia de problemas de fermentacin, se deben llevar a cabo anlisis de nitrgeno en varias temporadas. A menos que existan condiciones higinicas deficientes en la bodega, normalmente no se puede detectar la contaminacin por Brettanomyces durante la fermentacin. Sin embargo, cuando la Dekkera bruxellensis est presente, incluso en un nmero relativamente bajo, si el inicio o la terminacin de la fermentacin malolctica tarda mucho, el riesgo de crecimiento de la D. bruxellensis y la produccin de etil fenoles aumenta considerablemente. Las condiciones fisicoqumicas y nutritivas existentes durante la fermentacin malolctica son favorables para el desarrollo de esta levadura contaminante, y toda condicin que perjudique el desarrollo de la Dekkera bruxellensis tambin retrasar el desarrollo de bacterias malolcticas. Por tanto, para controlar esta levadura contaminante es obligatorio mantener su tamao poblacional en un mnimo inmediatamente despus de la fermentacin alcohlica y antes de la induccin de la fermentacin malolctica. Minimizar los nutrientes residuales, especialmente fructosa y nitrgeno asimilable puede ser beneficioso para este fin, y la compatibilidad entre la levadura y las bacterias malolcticas utilizadas para las fermentaciones primaria y secundaria est resultando ser un factor importante para el xito de las fermentaciones malolcticas. dos de nitrgeno asimilable, ca. 200 350 mg/L, mejora el equilibrio de los steres florales con respecto a los alcoholes de fusel, dotando al vinos de sabores ms frescos y limpios. El fosfato de diamonio estimula la produccin de steres de acetato especialmente, pero tambin de etil estres afrutados, e impide la produccin de alcoholes superiores, los cuales tienden a afectar negativamente al aroma del vino. No obstante, se debe tener cuidado de no sobredimensionar la adicin de nitrgeno a partir de fuentes como el fosfato de diamonio, ya que, como se ha indicado anteriormente, esto puede conducir a una produccin excesiva de steres de acetato. Es ms, investigaciones recientes indican que la adicin de fosfato de diamonio puede reducir la respuesta de los precursores responsables de los aromas a frutas tropicales en Sauvignon Blanc y otras variedades similares; ya que se desfavorece la hidrlisis de conjugados de la cistena, por lo que disminuye la produccin de tioles polifuncionales de cadena larga. Otra herramienta importante que puede ayudar a los vinicultores a producir vinos con perfiles sensoriales especficos y segn las especificaciones del mercado es la eleccin de la cepa de levadura y la estrategia de inoculacin. Por ejemplo, ahora sabemos que la levadura desempea un papel esencial en la evolucin de molculas responsables del aroma provenientes de la propia levadura y de la uva. Las primeras son las grandes responsables del carcter del vino, e incluyen metabolitos voltiles de la levadura como steres, alcoholes superiores, cidos, carbonilos y compuestos de azufre, mientras que las ltimas contribuyen a los caracteres especficos de las variedades. Existen dos clases importantes de compuestos derivados de la uva que son precursores del sabor y el aroma: los conjugados de la cistena y los conjugados con grupo de enlace de azcar (o grupo gluco-). Los conjugados de la cistena, que estn presentes en la variedad Sauvignon Blanc y en variedades relacionadas, son hidrolizados durante la fermentacin por la accin de enzimas carbono-azufre-lasas. Esta hidrlisis libera potentes tioles voltiles como 4-mercapto-4-metilpentan-2ona (4MMP) y 3-mercaptohexanol (3MH), los cuales son responsables de aromas a maracuy, boje, pomelo y grosella negra. Adems, el 3MH es esterificado por una alcohol acetiltransferasa codificada por el gen ATF1 para producir el ms potente acetato de 3-mercaptohexilo (3MHA). En unos recientes estudios de co-fermentacin se inocularon dos cepas de levaduras vincolas en zumo de uva Sauvignon Blanc. Una cepa hidroliz el conjugado y la otra esterific el producto, por lo que las dos se complementaban entre s y mejoraban los sabores y aromas de la Sauvignon Blanc. Los glucoconjugados no voltiles de las uvas son especialmente importantes para el desarrollo del aroma de los vinos a partir de variedades de uvas muy aromticas como la Muscat y la Riesling, y tambin de al-
Seminario tcnico
5. Optimizacin de la calidad del vino: mejora del aroma deseable, el sabor y el color
De lo anterior se desprende claramente que existen muchas herramientas para minimizar el riesgo de desarrollar sabores y aromas indeseables durante la fermentacin, pero debemos considerar qu estrategias podemos emplear para que las fermentaciones proporcionen caractersticas positivas al vino. La rehidratacin de la levadura con nutrientes de levaduras inactivas puede estimular la produccin de aromas afrutados. De manera similar, niveles modera-
Ponencias
23
gunas variedades no aromticas como la Chardonnay, la Semillon y la Sauvignon Blanc. Entre los ejemplos de compuestos derivados de la fruta con sabor y aroma potenciales se encuentran los alcoholes monoterpenos florales linalool y geraniol, as como los norisoprenoides tales como la -damascenona. En variedades no aromticas, estos sabores y aromas se desarrollan durante la fermentacin, y la acidez del vino, la cual permite una hidrlisis qumica de los precursores no voltiles de aromas lenta, se ha considerando durante mucho tiempo una ruta importante de la formacin de estos compuestos. No obstante, trabajos recientes demuestran la existencia de al menos otras cuatros rutas (en las que estn implicadas las levaduras). De estas, la hidrlisis de glucoconjugados por glucsidos extracelulares de las levaduras parece ser la ms importante cuantitativamente durante la fermentacin. El color es otro atributo sensorial del vino muy importante y, en el vino tino, ste est ampliamente determinado por los antocianinos y pigmentos derivados de la antocianina. Existen numerosos factores viticulturales y viniculturales implicados en la formacin y en la estabilizacin del color del vino tinto, no obstante el papel de la levadura solamente se ha estudiado recientemente. La eleccin de la cepa de levadura no slo afecta a la profundidad del color, sino que tambin a su matiz; los tonos rojo-morados. Existe un estudio en curso para comprender el mecanismo bioqumico que afecta al desarrollo del color del vino. Los conocimientos extrados de este estudi permitirn desarrollar estrategias genticas para personalizar cepas de levadura con el fin de ofrecer a los consumidores vinos de un aspecto excepcional.
cida como tecnologa de modificacin gentica). A este respecto, el desarrollo de cepas de levaduras de vino es una fuente importante de una nueva diversidad gentica para mejorar las opciones disponibles de los vinicultores. Por ejemplo, la produccin de hbridos intra- e inter-especficos del gnero Saccharomyces permite la generacin de cepas novedosas de levaduras con las propiedades de fermentacin robusta de la levadura vincola comercial y las diversas propiedades sensoriales ofrecidas por otras especies. El sector est actualmente evaluando desde un punto de vista vincola los hbridos interespecficos de Saccharomyces kudriavzevii y Saccharomyces cariocanus con Saccharomyces cerevisiae. Se espera que estos hbridos aporten aromas multicapa diferenciadores en ciertos estilos de vinos. Otro ejemplo de aplicacin satisfactoria de estrategias sin modificacin gentica en nuestro programa de desarrollo de cepas es la produccin y la comercializacin de cepas novedosas de Saccharomyces cerevisiae con la capacidad de fermentar robustamente y de producir simultneamente niveles ptimos de tioles afrutados deseables y cantidades mnimas de H2S. En primer lugar, la investigacin de los beneficios de las estrategias de co-inoculacin ha contribuido al desarrollo de dos productos comercializados mixtos (una mezcla de cepas de un proporcin especfica) que mejoran los aromas afrutados provenientes de tioles. En segundo lugar, se han utilizado estrategias sin modificacin gentica para desarrollar cepas de vino que fermentan excepcionalmente bien sin producir cantidades detectables de H2S. Estas cepas comerciales que producen menos H2S obtuvieron resultados excelentes a escala industrial. Con el fin de empezar a investigar las bases genticas de las diferencias entre cepas de la levadura vnica, el Australian Wine Research Institute (Instituto de Investigacin Enolgica de Australia) obtuvo el genoma de una cepa de levadura vincola y lo compar con el de la cepa de Saccharomyces cerevisiae de laboratorio. La cepa de vino result ser muy diferente a su homloga de laboratorio. La secuenciacin del genoma de otras cepas industriales proporcionar una visin ms profunda de las variaciones presentes en las cepas vincolas y debera resaltar variaciones comunes y especficas de cepas que puedan asociarse con caractersticas industriales importantes. As como las investigaciones fundamentales sobre levaduras pasaron de estrategias clsicas reduccionista a estudios que implican todo el genoma, estos ltimos pasarn tambin al siguiente nivel de investigacin biolgica conocido como la biologa de sistemas. La denominada revolucin -mica promete, con la ayuda de modelos matemticos, la consecucin de una comprensin total de las clulas de la levadura vnica en toda su complejidad. Esta metodologa permitir el
6. aumento de las opciones de los vinicultores mediante el desarrollo de cepas de levaduras vincolas mejoradas y novedosas
Actualmente es indudable que las levaduras desempean un papel esencial a la hora de dotar al vino de sus propiedades sensoriales. Durante siglos de vinicultura se han aislado y utilizado, accidental o deliberadamente, cepas de Saccharomyces cerevisiae por su capacidad para convertir eficazmente el mosto de uva en vino a pesar de su exposicin a un esfuerzo osmtico, de nutrientes y etlico. Estas levaduras han desarrollado una serie de caractersticas especficas de cada cepa, como la produccin de diversos sabores y aromas y diferentes perfiles de utilizacin de nutrientes, lo cual es reflejo de su historia y ahora puede emplearse para adecuar cepas especficas a las condiciones y estilos concretos de cada vino. Adems de esta diversidad de opciones disponibles en la actualidad, se han mejorado muchas cepas de levadura vincola utilizando mtodos genticos clsicos (mutagnesis, hibridacin, evolucin adaptativa), y en los ltimos tiempos mediante ADN recombinate (tambin cono-
24

desarrollo de cepas con una precisin y velocidad sin rival, y facilitar la utilizacin a medida del metabolismo de la levadura para satisfacer las cada vez mayores demandas de los vinicultores y las preferencias siempre cambiantes de los consumidores en un mercado masificado y sobre-abastecido. das del mercado en el futuro y reducir o eliminar sabores y aromas indeseables.
Seminario tcnico
8. agradecimientos
El Australian Wine Research Institute Ltd (AWRI, Instituto de Investigacin Enolgica de Australia), un miembro del Wine Innovation Cluster (Grupo de Innovacin del Vino) de Adelaida, recibe el apoyo de viticultores y vinicultores australianos a travs de su agencia de inversiones, la Grape and Wine Research and Development Corporation (Corporacin para la Investigacin y el Desarrollo de la Uva y el Vino), la cual lo financia segn una metodologa matching funds con el Gobierno australiano. Me gustara agradecer la contribucin investigadora indicada en este documento a todos los miembros actuales y pasados del departamento de biociencia del AWRI: Caroline Abrahamse, Eveline Bartowsky, Jenny Bellon, Etjen Bizaj, Paul Chambers, Anthony Borneman, Antonio Cordente, Peter Costello, Chris Curtin, Angus Forgan, Paul Henschke, Wanphen Jitjaroen, Robyn Kievit, Ellie King, Dariusz Kutyna, Jane McCarthy, Jean Macintyre, Simon Schmidt, Tina Tran, Hentie Swiegers, Maurizio Ugliano, Cristian Varela y Gal Winter.
7. Conclusiones y previsiones futuras

En conclusin, el sector enolgico y sus organismos de investigacin estn continuamente profundizando en el conocimiento de las interacciones entre nutrientes, los precursores de sabores derivados de la uva, las condiciones de fermentacin y las cepas especficas de levaduras para la produccin del vino. Existen muchas oportunidades innovadoras abiertas para investigaciones futuras. El sector del vino se centrar en el desarrollo de la evaluacin de nutrientes rpidos y el control de la fermentacin a travs de tcnicas anteriormente inimaginables como la tecnologa del infrarrojo cercano en lnea. Tambin mejorarn las cepas especializadas de la levadura vincola y las estrategias de inoculacin que puedan potenciar los caracteres deseables los vinicultores ahora buscan cepas de bajo alcohol, tolerantes al etanol y potenciadoras de sabores deseables, con capacidades bioconservantes y biosaludables para satisfacer las demandas espera-
9. lecturas complementarias
1. Alexandre, H., P.J. Costello, F. Remize, J. Guzzo, & M. Guilloux-Benatier. 2004. Saccharomyces cerevisiaeOenococcus oeni interactions in wine: current knowledge and perspectives. International Journal of Food Microbiology 93:141154. Bartowsky, E.J. & I.S. Pretorius. 2009. Microbial formation and modification of flavour and off-flavour compounds in wine. In: H. Knig, G. Unden & J. Frlich (eds.), Biology of Microorganisms on grapes, in must and wine. Springer, Heidelberg, Alemania. Captulo 11, pp. 209-231. 8. 3. Bataillon, M., A. Rico, J.-M. Sablayrolles, J. -M. Salmon & P. Barre. 1996. Early thiamin assimilation by yeasts under enological conditions: impact of alcoholic fermentation kinetics. Journal of Fermentation and Bioengineering 82:145150. Bauer, F.F. & I.S. Pretorius. 2000. Yeast stress response and fermentation efficiency: how to survive the making of wine A review. South African Journal of Enology and Viticulture 21:27-51. Bell, S.J. & P.A. Henschke. 2005. Implications of nitrogen management for grapes and wine. Australian Journal of Grape and Wine Research 11:242-295. 9. 6. Bellon, J., A. Heinrich & P. Chambers. 2006. Yeast research increases choice for winemakers and consumers. Australian & New Zealand Grapegrower & Winemaker (514):102-103. Bellon, J., L. Rose, B. Currie, J. Ottawa, S. Bell, H. Mclean, C. Rayment, C. Treacher & P. Henschke. 2008 Summary from the winemaking with nonconventional yeasts workshops, 13th AWITC. Australian & New Zealand Grapegrower & Winemaker (528):72-77. Berthels, N.J., R.R. Cordero Otero, F.F. Bauer, I.S. Pretorius and J.M. Thevelein. 2008. Correlation between glucose/fructose discrepancy and hexokinase kinetic properties in different Saccharomyces cerevisiae wine yeast strains. Applied Microbiology and Biotechnology 77:1083-1091. Bisson, L.F. & C.E. Butzke. 2000. Diagnosis and rectification of stuck and sluggish fermentations. American Journal of Enology and Viticulture 51:168-177.
7. 2.
4.
5.
10. Bisson, L.F. 1999. Stuck and sluggish fermentations. American Journal of Enology and Viticulture 50:107-119.
Ponencias
25
11. Bohlscheid, J.C., J.K. Fellman, X.D. Wand, D. Ansen & C.G. Edwards. 2007. The influence of nitrogen and biotin interactions on the performance of Saccharomyces in alcoholic fermentation. Journal of Applied Microbiology 102:390400. 12. Borneman, A.R., P.J. Chambers & I.S. Pretorius. 2007. Yeast Systems Biology: modelling the winemakers art. Trends in Biotechnology 25:349355. 13. Borneman, A.R, P.J. Chambers & I.S. Pretorius. 2009. Systems biology as a platform for wine yeast strain development. In: H. Knig, G. Unden & J. Frlich (eds.), Biology of Microorganisms on grapes, in must and wine. Springer, Heidelberg, Alemania. Captulo 22, pp. 395-414. 14. Borneman, A.R., A.H. Forgan, P.J. Chambers & I.S. Pretorius. 2008. Unravelling the genetic blueprint of wine yeast. Australian and New Zealand Wine Industry Journal 23:21-23. 15. Borneman, A.R., A. Forgan, P.J. Chambers & I.S. Pretorius. 2008. Comparative genome analysis of a Saccharomyces cerevisiae wine strain. FEMS Yeast Research 8:1185-1195. 16. Borneman, A.R, P.J. Chambers & I.S. Pretorius. 2009. The way forward: modelling the winemakers art using yeast systems biology. In: P. Romano & G.H. Fleet (eds.), Yeast in Wine Fermentation. Springer, Heidelberg, Alemania (en prensa). 17. Boulton, R.B., V.L. Singleton, L.F. Bisson & R.E. Kunkee. 1998. Principles and Practices of Winemaking. USA: Aspen Publishers, Inc. 18. Chambers, P.J., Bellon, J.R., Schmidt, S.A., Varela, C. & Pretorius, I.S. 2008. Non-genetic engineering approaches to isolating and generating novel yeasts for industrial applications. In: G. Kunze & T. Satyanarayana (eds.), Diversity and Potential Biotechnological Applications of Yeasts. Elsevier (en prensa). 19. Cordente, A.G., A. Heinrich, I.S. Pretorius & J.H. Swiegers. 2009. Isolation of sulfite reductase variants of a commercial wine yeast with significantly reduced hydrogen sulfide production. FEMS Yeast Research (en prensa). 20. Curtin, C.D., J.R. Bellon, A.D. Coulter, G.D. Cowey, E.M.C. Robinson, M.A. de Barros Lopes, P. W. Godden, P.A. Henschke & I.S. Pretorius. 2005. The six tribes of Brett in Australia: Distribution of genetically divergent Dekkera bruxellensis strains across Australian winemaking regions. Australian and New Zealand Wine Industry Journal 20:2835.267:159-166.
21. De Barros Lopes, M., J.R. Bellon, N.J. Shirley & P.F. Ganter. 2002. Evidence for multiple interspecific hybridization in Saccharomyces sensu stricto species. FEMS Yeast Research 1:323-331. 22. Edwards, C. & J.C. Bohlscheid. 2007. Impact of pantothenic acid addition on H2S production by Saccharomyces cerevisiae under fermentative conditions. Enzyme & Microbial Technology 41:14. 23. Eglinton, J.M. & P.A. Henschke. 1993. Can the addition of vitamins during fermentation be justified? Australian Grapegrower and Winemaker (352):4749,5152. 24. Eglinton, J.M. & P.A. Henschke. 1999. Restarting incomplete fermentations: the effect of high concentrations of acetic acid. Australian Journal of Grape and Wine Research. 5:7178. 25. Fleet, G.H. 2003. Yeast interactions and wine flavour. International Journal of Food Microbiology 86:11-22. 26. Gockowiak, H. & P.A. Henschke. 1992. Nitrogen composition of grape juice and implications for fermentation: results of a survey made in N-E Victoria. Australian & New Zealand Grapegrower& Winemaker (340):131, 133138. 27. Henschke, P.A. 1997. Stuck fermentation: causes, prevention and cure. Allen, M.; Leske, P.; Baldwin, G., eds. Advances in juice clarification and yeast inoculation: proceedings of a seminar; 15 August 1996; Melbourne, Vic. Adelaide S.A: Australian Society of Viticulture and Oenology; 1997: 3038, 41. 28. Henschke, P.A. & V. Jiranek. 1991. Hydrogen sulfide formation during fermentation: effect of nitrogen composition in model grape must. Rantz, J.M., ed. Proceedings of the international symposium on nitrogen in grapes and wine; 18-19 June 1991; Seattle, Washington, USA. Davis, CA: American Society for Enology and Viticulture; pp. 172-184. 29. Houtman, A.C. & C.S. Du Plessis. 1981. The effect of juice clarity and several conditions promoting yeast growth on fermentation rate, the production of aroma components and wine quality. South African Journal of Enology and Viticulture 2:7181. 30. Howell, K.S., J.H. Swiegers, G.M. Elsey, T.E. Siebert, E.J. Bartowsky, G.H. Fleet, I.S. Pretorius, & M.A. de Barros Lopes. 2004. Variation in 4-mercapto-4methyl-pentan-2-one release by Saccharomyces cerevisiae commercial wine strains under diffe-
26

rent wine fermentation conditions. FEMS Microbiology Letters 240: 125-129. 31. Jolly, N.P., O.P.H. Augustyn & I.S. Pretorius. 2006. The role and use of non-Saccharomyces yeasts in wine production. South African Journal of Enology and Viticulture 27:15-39. 32. King, E.S., J.H. Swiegers, B. Travis, I.L. Francis, S. Bastian & I.S Pretorius. 2008. Coinoculated fermentations using Saccharomyces yeasts affect the volatile aroma composition and sensory properties of Vitis vinifera L. cv. Sauvignon Blanc wines. Journal of Agricultural and Food Chemistry 56:1082910837. 33. Le Jeune, C., M. Lollier, C. Demuyter, C. Erny, J.L. Legras, M. Aigle & I. Masneuf-Pomarede. 2007. Characterization of natural hybrids of Saccharomyces cerevisiae and Saccharomyces bayanus var. uvarum. FEMS Yeast Research 7:540549 34. Lilly, M., M.G. Lambrechts & I.S. Pretorius. 2000. The effect of increased yeast alcohol acetyltransferase activity on the sensorial quality of wine and brandy. Applied and Environmental Microbiology 66: 744-753. 35. Lilly, M., G. Styger, F.F. Bauer, M.G. Lambrechts & I.S. Pretorius. 2006. The effect of increased yeast branched-chain amino acid transaminase activity and the production of higher alcohols on the flavor profiles of wine and distillates. FEMS Yeast Research 6:726-743. 36. Lilly, M., F.F. Bauer, M.G. Lambrechts, J.H. Swiegers, D. Cozzolino & I.S. Pretorius. 2006. The effect of increased alcohol acetyl transferase and esterase activity on flavor profiles of wine and distillates. Yeast 23:641-659. 37. Molina, A.M, J.H. Swiegers J.H, C. Varela, I.S. Pretorius & E. Agosin. 2007. Influence of wine fermentation temperature on the synthesis of yeastderived volatile aroma compounds. Applied Microbiology and Biotechnology 38. Monk, P.R. 1986. Rehydration and propagation of active dry wine yeast. Australian Wine Industry Journal 1:3-5. 39. Pretorius, I.S. 2000. Tailoring wine yeast for the new millennium: novel approaches to the ancient art of winemaking. Yeast 16: 675-729. 40. Pretorius, I.S. & F.F. Bauer. 2002. Meeting the consumer challenge through genetically customised wine yeast strains. Trends in Biotechnology 20:426-432. 41. Pretorius, I.S. & P.B. Hj. 2005. Grape and Wine Biotechnology: Challenges, opportunities and potential benefits. Australian Journal of Grape and Wine Research 11:83-108. 42. Renouf, V., A. Lonvaud-Funel & J. Coulon. 2007. The origin of Brettanomyces bruxellensis in wines: A review. Journal International des Sciences de la Vigne et du Vin. 41:161-173. 43. Sablayrolles, J.M., C. Dubois, C. Manginot, J.L. Roustan & P. Barre. 1996. Effectiveness of combined ammoniacal nitrogen and oxygen additions for completion of sluggish and stuck fermentations. Journal of Fermentation and Bioengineering 82:377-381. 44. Salmon, J.M. 1989. Effect of sugar transport inactivation in on sluggish and stuck oenological fermentations. Applied and Environmental Microbiology 55:953-958. 45. Schmidt, S.A., T. Tran, P.J. Chambers, M.J. Herderich & I.S. Pretorius. 2006. Developing indicators of wine yeast performance: an overview of the impact of ethanol stress. Australian and New Zealand Wine Industry Journal 21:24-30. 46. Subileau, M., R. Schneider, J.-M. Salmon & E. Degryse. 2008. Nitrogen catabolite repression modulates the production of aromatic thiols characteristic of Sauvignon Blanc at the level of precursor transport. FEMS Yeast Research (en prensa). 47. Swiegers, J.H., E.J. Bartowsky, P.A. Henschke & I.S. Pretorius. 2005. Yeast and bacterial modulation of wine aroma and flavour. Australian Journal of Grape and Wine Research 11:139-173. 48. Swiegers, J.H., D. Capone, G. Elsey, M.A. Sefton, I.L. Francis, & I.S. Pretorius. 2007. Engineering volatile thiol release in Saccharomyces cerevisiae for improved wine aroma. Yeast 24:561-574. 49. Swiegers, J.H., I.L. Francis, M.J. Herderich, & I.S. Pretorius. 2006. Meeting consumer expectations through management in vineyard and winery: The choice of yeast for fermentation offers great potential to adjust the aroma of Sauvignon Blanc wine. Australian and New Zealand Wine Industry Journal 21:34-42. 50. Swiegers, J.H. & I.S. Pretorius. 2007. Modulation of volatile sulfur compounds by wine yeast. Applied Microbiology and Biotechnology 74:954-960. 51. Swiegers, H., M. Ugliano, T. van der Westhuizen & P. Bowyer. 2008. Impact of yeast rehydration on the aroma of Sauvignon Blanc wine. Austra-
Seminario tcnico
Ponencias
27
lian & New Zealand. Grapegrower Winemaker 54. Torrea, D., & P.A. Henschke. 2004. Ammonium su(528):6871. pplementation of grape juice-effect on the aroma profile of a Chardonnay wine. Technical Review 52. Swiegers, J.H, S.M.G. Saerens & I.S. Pretorius I.S. 150:5963. 2008. The development of yeast strains as tools to adjust the flavour of fermented beverages to 55. Ugliano, M., P.A. Henschke & I.S. Pretorius. 2007. market specifications. In: D.H. Frenkel & F. BelanNitrogen management is critical for wine flavour ger (eds.), Biotechnology in Flavour Production. and style. Australian and New Zealand Wine InBlackwell Publishing, Oxford, Reino Unido. Capdustry Journal 22:24-30. tulo 1, pp.1-55. 56. Vilanova, M., M. Ugliano, C. Varela, T. Siebert, I.S. Pretorius & P.A. Henschke. 2007. Assimilable ni53. Swiegers J.H., R.L. Willmott, T.E. Siebert, K. Lattey, trogen utilisation and production of volatile and B.R. Bramley, I.L. Francis, E.S. King & I.S. Pretorius. non-volatile compounds in chemically defined 2009. The influence of yeast on the aroma of Saumedium by Saccharomyces cerevisiae wine yeasts. vignon Blanc wine. Food Microbiology 26:204Applied Microbiology and Biotechnology 77:145211. 157.
28
Seminario tcnico
Ponencias
29
03. la microoxigenacin de vinos tintos: Control de la reduccin y estabilizacin del color

Prof. encarna GMez Plaza Universidad de Murcia
Contenido 31 La reactividad del oxgeno en los vinos 32 La tcnica de la micro-oxigenacin 35 Bibliografa
Seminario tcnico
la reactividad del oxgeno en los vinos

El oxigeno juega un papel importante en diversos procesos bioqumicos en los mostos y en los vinos, tanto durante la fermentacin alcohlica como en postfermentacin, e incluso durante el embotellado. Su presencia modifica el estado redox de los vinos, lo que conlleva cambios que pueden afectar positiva o negativamente a la calidad de los vinos. Para una correcta gestin del oxgeno es necesario conocer como ste acta en el vino, particularmente en el control de la actividad de las levaduras, manejo de los olores azufrados y estabilizacin del color de los vinos tintos. La presencia de oxgeno en el vino provoca una oxidacin, un proceso donde hay una transferencia de electrones. En el vino, el oxgeno es reducido a ciertos intermedios y finalmente a H2O2 y a H2O Considerando la cantidad de oxgeno que un vino puede tomar (de 60 a 600 ml/l, de acuerdo con Singleton, 1986), est claro que no hay otros compuestos oxidables en el vino en cantidad suficiente que no sean los compuestos fenlicos. Por lo tanto, stos sern los principales implicados en los fenmenos de oxidacin de los vinos. El oxigeno tiene una limitada reactividad en su forma molecular. El potencial oxidante del oxigeno se debe a la generacin de especies reactivas del oxgeno. As, la transferencia inicial de un electrn lleva a la formacin de O2- que al pH del vino existe como radical hidroxiperxido. Este paso requiere un catalizador, preferentemente un metal como Fe. La transferencia de un segundo electrn producir un perxido (en vino H2O2). La siguiente reduccin crea un agente oxidante incluso ms reactivo que los anteriores, el radical hidroxilo. La ltima reaccin produce agua como producto final de la reduccin del oxgeno
Dra. encarna Gmez Plaza

Doctora por la Universidad de Murcia (1992). Fue becaria predoctoral en el Departamento de Viticultura y Enologa del CIDA (actual Instituto Murciano de Investigacin y Desarrollo Agroalimentario) siendo el tema de la tesis doctoral el estudio de los componentes voltiles de uvas y vinos. Realiz su estancia post-doctoral en Fresno (Califormia, EE.UU.), contratada por el Agricultural Research Service y la California Raisin Advisory Board para realizar un proyecto de investigacin sobre la presencia de tricloroanisoles en uvas pasas. Volvi a Espaa con un contrato de reincorporacin de Doctores y Tecnlogos incorporndose de nuevo al CIDA donde durante tres aos continu trabajando en uvas y vinos, centrndose en la caracterizacin polifenlica y cromtica de stos (1994-1996). Se incorpor a la Universidad de Murcia en 1997, primero como Profesor Ayudante, posteriormente como Profesor Titular del rea de Tecnologa de Alimentos y desde el 2007 como Catedrtica de Universidad. Ha dirigido numerosos proyectos de investigacin con financiacin regional y nacional, relacionados con el estudio de uvas y vinos. Es autora de un alto nmero de publicaciones cientficas en revistas tanto de divulgacin como de alto impacto cientfico y revisora de algunas de las mejores revistas cientficas de tecnologa de alimentos. Actualmente, su rea de investigacin se centra sobre todo en el estudio de las caractersticas cromticas de uvas y vinos. Los dos ltimos proyectos en los que se encuentra trabajando son el estudio del efecto de la micro-oxigenacin de vinos y la crianza de estos (barrica y virutas) sobre la evolucin y estabilidad del color y en el diseo de nuevas estrategias para la extraccin de compuestos fenlicos de las uvas durante la vinificacin.
Adaptado de Waterhouse y Laurie, 2006
Los radicales formados durante este proceso intermedio pueden ser directamente reducidos por los fenoles y son mejores oxidantes que el oxgeno (Waterhouse y Laurie, 2006). Los principales productos secundarios de la reduccin del oxgeno en el vino sern quinonas y aldehdos, fundamentalmente el acetaldehdo. Las quinonas pueden participar en reacciones de polimerizacin que llevarn a la formacin de grandes polmeros, normal-
Ponencias
31
la tcnica de la micro-oxigenacin
Estas observaciones pueden ser la base cientfica que explica los resultados de la micro-oxigenacin, tcnica que naci en la dcada de los 90. Est basada en el aporte controlado de pequeas cantidades de oxgeno al vino mediante un microdifusor poroso, de forma continua y lenta, siendo la velocidad de aporte de oxigeno inferior a la velocidad de consumo, evitando la acumulacin de ste en el vino. Los efectos positivos de la micro-oxigenacin sobre los vinos tintos se pueden resumir en: Estabilizacin del color Reduccin de olores a reduccin y sabores herbceos Suavizacin del vino por disminucin de astringencia Estos efectos se deben a la formacin de esos productos finales de la oxidacin en los vinos. As, las quinonas formadas pueden fijar compuestos azufrados y contribuir a la disminucin de los olores a reduccin en los vinos. Adems, las quinonas formadas pueden comenzar un proceso de polimerizacin de compuestos fenlicos, lo que puede modificar el sabor y la astringencia de los vinos. De igual forma, otro de los productos que aparecen, el acetaldehdo, participa en las reacciones de estabilizacin de color de los vinos tintos a travs de la formacin de compuestos fenlicos unidos por puente de etilo (tanino-tanino y antociano-tanino fundamentalmente) y favoreciendo la formacin de piranoantocianos, compuestos ms estables que los antocianos nativos de los vinos.
Adaptado de Waterhouse y Laurie, 2006
mente de color pardo, responsables del pardeamiento. Pero tambin, las quinonas pueden reaccionar y formar aductos con otros compuestos del vino, como los tioles, contribuyendo al control del problema de reduccin en los vinos (Waterhouse y Laurie, 2006; Vidal y Aagaard, 2008). Los aldehdos, en el caso del vino tinto sobre todo, pueden participar en reacciones que sern de inters pues favorecen la estabilizacin del color de los vinos (Timberlake y Bridle, 1976). Ya se haba observado desde hace tiempo una diferencia importante entre los resultados en el vino de una oxidacin lenta frente a una oxidacin rpida, que sugiere la existencia de unas reacciones adicionales, que ocurren de forma lenta y que aumentan el conjunto de sustratos oxidables en el vino (Singleton, 1986). As, lentamente, dos semiquinonas radicales se pueden unir covalentemente. Este proceso se llama polimerizacin regenerativa y lleva a la generacin de una hidroquinona reoxidable. Tiene un potencial de reduccin menor que sus constituyentes originales e incrementar la capacidad de tomar oxgeno del vino. Es decir, la polimerizacin regenerativa lenta lleva a unidades no oxidables (quinonas) a incorporarse en hidroquinonas reoxidables lo que incrementar los sustratos oxidables del vino y proteger a los sustratos originales. Si el oxigeno se aade rpidamente, esta reaccin no ocurre, se agotan tambin rpidamente los fenoles para reaccionar, con formacin de muchas quinonas y, por tanto, el pardeamiento de los vinos.
a) Control de la reduccin
Uno de los motivos por los que a este defecto se le llama olor a reduccin es por que normalmente aparece
Compuestos azufrados de bajo Pm Sulfuro de hidrgeno (H2S) Metanotiol (MeSH) Etanotiol (EtSH) Sulfuro de dimetilo (DMS) Sulfuro de dietilo (DES) Disulfuro de carbono (CS2) Disulfuro de dimetilo (DMDS) Disulfuro de dietilo (DEDS) Metil tioacetato (MeSAc) Etil tioacetato (EtSAc) Metionol
Descripcin del olor Huevos podridos Goma quemada, putrefaccin Cebolla, goma, terroso Col cocida, esparragos Ajo, goma Dulce, goma, azufrado Vegetal, col, cebolla (a alta concentracin) Olor desagradable, cebolla Azufrado, huevo, queso Azufrado, cebolla, ajo Col cocida
Umbral olfatorio (ppb) 1 1,5 1,5 25 1 5 10 4 40 70 1200
Adaptado de Vidal y Aagaard, 2008
32

cuando el potencial redox del vino es bajo y se debe normalmente a la aparicin de compuestos azufrados voltiles, generalmente descritos como olor a goma quemada, ptridos, huevos podridos, cebolla, col, ajo..... aunque no hay que olvidar que entre los compuestos azufrados volatiles existen algunos como el 3-mercaptohexanol o 3-mercaptohexil acetato que imparten aromas afrutado positivos al vino (Zoecklein, 2006). El azufre tiene varias formas reducidas en el vino: - H2S, que se produce naturalmente durante la fermentacin alcohlica y cuya formacin se debe intentar controlar, sobre todo al final de la fermentacin alcohlica o formar otros compuestos azufrados, - los tioles, que se forman normalmente al final del fermentacin alcohlica y en postfermentacin y poseen un umbral de percepcin bastante bajo y, - sulfuros y disulfuros, que se forman durante todo el proceso de vinificacin y por la oxidacin de tioles en vinos terminados, tienen los umbrales de percepcin mas altos por lo que son menos problemticos pero son ms difciles de eliminar y en botella pueden revertir a tioles. El H2S es un intermediario en la biosntesis de compuestos azufrados requeridos por las clulas para el crecimiento celular y su funcionamiento. El azufre en forma de SO42-, S, SO32- entra en la clula y se reduce a sulfuro a travs de dos pasos activados por ATP. En este momento el sulfuro se combina enzimaticamente con precursores que contienen nitrgeno para formar cisteina y metionina. En ausencia de nitrgeno intracelular lo que se forma es un exceso de H2S que no se incorpora a los aminocidos sino que se libera al vino (Zoecklein, 2006). En otros casos, un suministro suficiente de nitrgeno tambin puede llevar a altas cantidades de H2S, debido a la carencia de otros nutrientes y otros efectos no tan conocidos. Hay una serie de medidas que se pueden tomar para intentar controlar la formacin de estos compuestos azufrados, tanto antes de la fermentacin alcohlica (evitar uvas tratadas con S o Cu en fechas cercanas a vendimia, aadir cantidades justas de SO2), como en las primeras etapas de la fermentacin alcohlica (utilizar nutrientes para las levaduras y cepas seguras, temperaturas moderadas de fermentacin) y en las ltimas etapas de fermentacin (evitar el uso de SO2, mantener la sanidad de las levaduras..). Tambin el oxgeno puede tener un papel importante en este control. El oxigeno aadido al mosto en fermentacin (como macro-oxigenacin o micro-oxigenacin) limita el impacto de compuestos azufrados voltiles de dos formas: a) permitiendo que la levadura sintetice cidos grasos y esteroles y as soporta mejor el estrs y b) incrementando el potencial redox y reduciendo la presencia de azufrados voltiles. Otro efecto del oxgeno es que puede reaccionar con el H2S y formar S y agua. El azufre se eliminar despus por medio de los trasiegos. En postfermentacin tambin se puede utilizar el oxgeno para controlar los problemas de reduccin y los compuestos azufrados voltiles. Los compuestos azufrados son sensibles al oxgeno y el aporte de oxgeno reducir su concentracin. Comnmente se acepta que la reaccin que ocurre es (Zoecklein, 2007):
Seminario tcnico
CH3-SH 0.2 ppb
O2
H3C-S-S-CH3 12 ppb
Como se observa, los compuestos azufrados no desaparecen sino cambian a otras formas con umbrales de percepcin ms altos. Pero esta reaccin es reversible y en ambiente reductor se puede volver a formar tioles. Pero no hay que olvidar que otra reaccin es posible en presencia de oxgeno y es la reaccin entre las quinonas formadas por oxidacin de fenoles con los grupos SH de los compuestos azufrados (Waterhouse y Laurie, 2006).
As, estudios realizados micro-oxigenando vinos tintos han mostrado que los vinos con micro-oxigenacin tenan menos niveles de metanotiol y etanotiol que los vinos testigo, disminuyendo su concentracin por debajo de su umbral aromtico y adems no se detect acumulacin de disulfuros (McCord, 2003).
Es muy importante mantener el suficiente aporte de oxigeno para producir continuamente quinonas que atrapen las nuevas molculas azufradas que se pueden ir formando durante el envejecimiento del vino, tanto por hidrlisis de tiosteres o por condiciones anaerobias.
b) Mejora de la estabilidad del color

La importancia del oxgeno en la evolucin del color del vino tinto ya se conoce desde hace tiempo, tanto con respecto a la oxidacin de polifenoles como la la formacin de nuevos compuestos ms estables derivados de los antocianos. Entre las reacciones que ocurren como consecuencia de la presencia de oxgeno hay que incluir los cambios en la longitud de las cadenas de taninos, que afecta a la astringencia, y la formacin de piranantocianos y compuestos unidos por puente de etilo (por la presencia de acetaldehdo)
Ponencias
33
Figura. Comparacin de la concentracin de etanotiol, metanotiol y dimetilsulfuro en vinos control, micro-oxigenados, micro-oxigenados y con aplicacin de duelas de roble y microoxigenados y con aplicacin de segmentos de roble (adaptado de McCord, 2003).
que son mas estables que los antocianos originales, dando lugar a una mayor estabilidad e intensidad del color de los vinos micro-oxigenados (Timberlake y Bridle, 1976; Francia-Aricha et al., 1997; Salas et al., 2004). La correcta aplicacin de la tcnica para conseguir los mayores beneficios va a depender del periodo de aplicacin y el tipo de vino a micro-oxigenar. Fundamentalmente, las mayores ventajas las vamos a encontrar cuando el vino est equilibrado, la proporcin de
antocianos-taninos sea correcta y haya una cantidad importante de antocianos libres. Si no hay suficientes antocianos libres en el vino para reaccionar se puede acumular acetaldehdo y verse favorecida la polimerizacin de taninos, hasta que las molculas formadas sean tan grandes que precipiten. Los diversos ensayos realizados han puesto de manifiesto que la etapa comprendida entre fermentacin alcohlica y fermentacin malolctica es la que mejores resultados suele dar por una alta presencia de antocianos libres, cido pirvico y ausencia de SO2. Esto se observa en los trabajos de Cano-Lpez et al. (2006), donde se ha puesto de manifiesto que se observa un incremento en la intensidad de color fundamentalmente en el primer periodo de microoxigenacin (entre la fermentacin alcohlica y el inicio de la fermentacin malolctica) en los vinos microoxigenados. Al finalizar la fermentacin malolctica se observ en todos ellos un descenso, probablemente consecuencia de la variacin del pH y la precipitacin de materia coloidal que arrastra materia colorante. Aunque el aporte de oxigeno durante el segundo periodo (se comenz cuando la fermentacin alcohlica ya esta finalizada) fue menor, se observ de nuevo un aumento de intensidad de color en los vinos microoxigenados, diferencindose todos los vinos en color, y observndose tambin el efecto de la dosis de oxgeno aplicada. El incremento de color se adscribi a una mayor concentracin de piranoantocianos y com-
Figura. evolucin del grado medio de polimerizacin de los taninos en vinos micro-oxigenados y sus correspondientes testigos (W1: vino de bajo contenido polifenlico, W2: vino de contenido polifenlico medio, W3: vino de alto contenido polifenlico). adaptado de Cano-lpez et al. 2008
Concentracin de las principales familias de antocianos y compuestos derivados en vinos de Monastrell micro-oxigenados (Cano-lpez et al., 2006). Compuestos identificados t0 Control Antocianos monomricos (mg L-1) Aductos directos (g L-1) Suma de Piranoantocianos Compuestos unidos por etilo (g L-1) Pico polimrico (mg L-1) 277.94.2c 190087a 14872374b 500846a 19.70.2a Control 1850.9b 212151b 9974225a 550314a 19.20.7a tf Dosis 1 1787.4b 194584a 1452499b 588318b 21.62ab Dosis 2 15916.1a 1858110a 1409116b 6262145c 23.41.1b
34

evolucin desde final de fermentacin alcohlica hasta la finalizacin del proceso de microoxigenacin de la intensidad de color en vinos (no se aplic la micro-oxigenacin durante la fermentacin malolctica) todos los vinos y despus cae, excepto para el vino de contenido fenlico bajo. Este incremento se corresponde a la fase estructurante descrita en las observaciones empricas y suele ocurrir incluso cuando no se est aplicando oxigeno al vino. La reduccin que se observa despus, principalmente en los vinos de contenido fenlico medio y alto micro-oxigenados puede ser debido a un rearreglo estructural de los taninos a formas mas cortas, y sto se asocia a un descenso en astringencia. Tambin la reaccin de estas cadenas mas cortas con antocianos reducir la astringencia. El comportamiento diferente del vino de contenido fenlico bajo microoxigenado puede estar relacionado con una sobre-oxigenacin del vino, debido a su bajo contenido en antocianos libres. El conjunto de observaciones realizadas en el trabajo de Cano-Lpez et al. (2008) pone de manifiesto como la micro-oxigenacin mejora las caractersticas de los vinos de mas alto contenido fenlico por tener altas cantidades de antocianos libres, incrementndose su color y mejorando notablemente su estructura. Todas estas observaciones nos llevan a concluir que la micro-oxigenacin es una tcnica de aplicacin muy interesante en vinos tintos, sobre todo en vinos con potencial fenlico. No acelera el envejecimiento pero si lo puede optimizar y ayudar a controlar problemas de reduccin en los vinos.
Seminario tcnico
puestos unidos por puente de etilo en los vinos microoxigenados (Cano-Lpez et al., 2006). Tambin los efectos de la micro-oxigenacin sobre los taninos del vino han sido estudiados (Cano-Lpez et al., 2008). Se han observado diferentes comportamientos con respecto a la evolucin del grado medio de polimerizacin. Este parmetro siempre se incrementa en el primer periodo (fin de fermentacin alcohlica-inicio de fermentacin malolctica) para
Bibliografa
Cano-lpez, M.; Pardo-Mnguez, F.; lpez-roca, J.M.; Gmez-Plaza, e. (2006). Effect of microoxygenation on anthocyanin and derived pigment content and chromatic characteristics of red wines. American Journal of Enology and Viticulture 57, 325-331. Cano-lpez, M.; Pardo-Mnguez, F.; Schmauch, G.; Saucier, C.; teissedre, C.; lpez-roca, J.M.; GmezPlaza, e. (2008). Effect of Micro-oxygenation on Color and Anthocyanin-Related Compounds of Wines with Different Phenolic Contents. Journal of Agricultural and Food Chemistry, 56, 5932-5941 Francia-aricha, e.; Guerra, M.t.; rivas-Gonzalo, J.; Santos-Buelga, C. (1997). New anthocyanin pigments formed after condensation with flavanols. Journal of Agricultural and Food Chemistry, 45, 2262-2266. rauhut. D (2002). Volatile sulfur compounds. Impact on reduced sulfur flavor defects and atypical aging in wine. 31st Annual New York Wine Industry Conference. Salas, e.; atanasova, V.; Poncet-legrand, e.; Meudec, e.; Mazauriz, J.; Cheynier, V. (2004). Demostration of occurrence of flavanol-anthocyanin adducts in wine and model solutions. Analytica Chimica Acta, 213, 367-370. Singleton, V. (1987). Oxygen with phenols and related reactions in musts, wines and model systems. Observations and practical implications. American Journal of Enology and Viticulture, 38, 69-77. timberlake, C.; Bridle, P. (1976). Interaction between anthocyanins, phenolic compounds and acetaldehyde and their significance in red wines. American Journal of Enology and Viticulture, 27, 97-105. Vidal, S., aagaard, O. (2008). Oxygen management during vinification and storage of Shiraz wine. Wine Industry Journal, 23, www. Winebiz.com.au Waterhousse, a.; laurie, F. (2006). Oxidation of wine phenolics. A critical evaluation and hypothesis. American Journal of Enology and Viticulture, 57, 306-312. Zoecklein, B. (2006). Sulfur compounds: impact on aroma, flavor and texture and practical management. Enology notes, 113 Zoecklein, B. (2007). Factors impacting sulfur-like off odors in wine and winery options. 8th Annual Enology and Viticulture British Columbia Wine Grape Council Conference.
Ponencias
35
04. los compuestos voltiles no son todos perjudiciales! los tioles varietales y el sulfuro de dimetilo
Rmi GUeRin-SCHneiDeR institut Franais de la Vigne et du Vin entaV-itV France
Contenido 38 1. Los tioles varietales 39 2. El sulfuro de dimetilo 40 Conclusin
Seminario tcnico
Rmi Guerin-Schneider
Ingeniero Agrnomo y Enlogo, Schneider, completa su formacin con una Tesis Doctoral, en el ao 2001, sobre el potencial aromtico de los vinos de Muscadet. Ingeniero de Investigacin y Desarrollo el Instituto francs de la Via y del Vino desde 2001, est encargado del Proyecto tiles y mtodos de caracterizacin de la calidad de uvas y vinos Particularmente especializado en el anlisis de compuestos aromticos de vinos y de sus precursores, Remi Schneider, es autor de numerosas publicaciones cientficas centradas en la puesta apunto de metodologas analticas sensibles y fiables, particularmente empleando dilucin isotpica, as como mtodos de estimacin del potencial aromtico de uvas procedentes de viedos de alta produccin. Desde el ao 2006, coordina un programa de investigacin (UMT Qualinnov ) agrupando equipos de el INRA y del IFV.
Publicaciones principales
R. SCHNEIDER, A. RAZUNGLES, C. AUGIER, R. BAUMES, 2001. Monoterpenic and Norisoprenoidic Glycoconjugates of Vitis vinifera L. cv. Melon B. as Precursors of Odorants in Muscadet Wines. J. Chromatogr., 936, 145-147. R. SCHNEIDER, A. RAZUNGLES, F. CHARRIER, R. BAUMES, 2002. Effet du site, de la maturit, et de lclairement des grappes sur la composition aromatique des baies de Vitis vinifera L. cv. Melon B. dans le vignoble du Muscadet. Bulletin de lOIV,855-856, 269-283. A. BELANCIC-MAJCENOVIC, R. SCHNEIDER, J.P. LEPOUTRE, V. LEMPEREUR, R. BAUMES, 2002. Synthesis and Stable Isotope Dilution Assay of Ethanethiol and Diethyl Sulfide in Wine using Solid Phase Microextraction. Effect of Aging on their Levels in Wine. J. Agric. Food Chem., 50, 6653-6658. R. SCHNEIDER, Y. KOTSERIDIS, J.L. RAY, C. AUGIER, R. BAUMES, 2003. Quantitative Determination of Sulfur-Containing Wine Odorants at sub-ppb Levels. Part II : Development and Application of a Stable Isotope Dilution Assay. J. Agric. Food Chem., 51, 3243-3248. R. SCHNEIDER, F. CHARRIER, M. MOUTOUNET, R. BAUMES, 2004. Rapid Analysis of Grape Aroma Glycoconjugates using Fourrier-Transform Infrared Spectrometry and Chemometric Techniques. Analytica Chimica Acta, 513, 91-96. C. PROUTEAU, R. SCHNEIDER, Y. LUCCHESE, F. NEPVEU, R. RENARD, C. VACA-GARCIA, 2004. Improving Headspace Solid phase Microextraction of 3-Isobutyl-2-methoxypyrazine by Experimental Design with Regard to Stable Isotope Dilution Gas Chromatography- Mass Spectrometry Analysis of Wine. Analytica Chimica Acta, 513, 223-227. DAZ-MAROTO M.C., SCHNEIDER R., BAUMES R., 2005. Formation pathways of ethyl esters of branched short-chain fatty acids during wine aging. J. Agric. Food Chem., 53, 3503-3509. DAGAN L., SCHNEIDER R., LEPOUTRE J.P., BAUMES R., 2006. Stability of sotolon in acidic and basic aqueous solutions. Application to the synthesis of a deuterated analogue for its quantitative determination in wine. Analytica Chimica Acta, 563, 365-374. SCHNEIDER R., CHARRIER F.,RAZUNGLES A., BAUMES R., 2006. Evidence for an alternative biogenetic pathway leading to 3-mercaptohexanol and 4-mercapto-4-methylpentan-2-one in wines. Analytica Chimica Acta, 563, 58-64. M. SUBILEAU, R. SCHNEIDER, JM. SALMON, E. DEGRYSE, 2008 Nitrogen catabolite repression modulates the production of aromatic thiols characteristicof SauvignonBlanc at the level of precursor transport, FEMS Yeast Res, 8, 771780
Ponencias
37
04. Los compuestos voltiles no son todos perjudiciales! Los tioles varietales y el sulfuro de dimetilo
Los compuestos azufrados voltiles estn presentes en gran nmero en los vinos. Se acostumbra a separarlos en dos clases distintas, los compuestos sulfurosos ligeros, cuyo punto de ebullicin es inferior a 90C, y los compuestos sulfurosos pesados que presentan un punto de ebullicin ms elevado. Esta clasificacin, prctica por su simplicidad, aporta sin embargo escasa informacin acerca de la naturaleza de los compuestos y de su origen. Si nos adentramos con ms detalle en el tema, encontramos tres grandes familias de compuestos en trminos de estructura qumica: los tioles, los mono-o polisulfuros y los tiol-ster. De manera general, las funciones qumicas azufradas confieren a estos compuestos olores desagradables, intensos, que son percibidos negativamente. No obstante, cuando su peso molecular aumenta, el efecto negativo del grupo funcional sulfuroso se atena y las percepciones olfativas de los compuestos son ms agradables. As pues, la mayor parte de los compuestos sulfurosos ligeros, principalmente en productos en curso de fermentacin son perjudiciales para la calidad del aroma, mientras que los compuestos sulfurados ms pesados, pueden contribuir de manera favorable a mejorar el perfil aromtico de los vinos. Es concretamente el caso de los tioles varietales (Tominaga et al. 1998) y del sulfuro de dimetilo (Sgurel, 2005).
ritariamente presente en la piel (Murat et al., 2001b; Peyrot des Gachons et al., 2002a). As pues, la maceracin pelicular afecta principalmente al P3MH, cuyas cantidades recuperadas en el mosto son ms importantes en relacin a una vinificacin clsica (Murat et al., 2001b; Peyrot des Gachons et al., 2002a). Cabe sealar igualmente la presencia en los mostos de Sauvignon Blanc de un conjugado del 3 mercaptohexanol o glutathion que ser el precursor biogentico del conjugado a la cisteina correspondiente, por hidrlisis de los dos aminocidos asociados a la cisteina del glutation (Peyrot des Gachons et al., 2001). Ms recientemente (Fedrizzi et al, 2009) un conjugado de la 4MMP al glutathion, ha sido formalmente identificado en un mosto de Sauvignon. An que poco abundantes y poco numerosos, estos precursores cisteinicos contribuyen sin embargo en gran manera al aroma del vino. Son en efecto el origen de cuatro tioles extremadamente olorosos, ausentes en la uva, pero responsables en el vino de notas olfativas reconocibles cuando sus contenidos son los suficientes el 3-sulfanilhexan-1-ol (3MH), el acetato de 3-sulfanylhexyle (ac3MH), el 4-metil-4-sulfanilpentan-2-one (4MMP), presentando umbrales de percepcin olfativa muy bajos, respectivamente de 60 ng/L, 4,2 ng/L y 0,8 ng/L en solucin hidroalcohlica (Tominaga et al., 2000). Estos presentan respectivamente olores de pomelo, de corteza de ctricos y de boj, que participan de manera importante en el afrutado de numerosos vinos blancos y rosados. Si la 4MMP parece especfica de un reducido nmero de variedades (Sauvignon, Bacchus, Scheurebe), el 3-sulfanyl-hexanol y su acetato han sido observados en un gran nmero de variedades. Estos participan no solamente en el aroma de los vinos de numerosas variedades blancas como pueden ser la Gewrztraminer, Scheurebe, Colombard, Petit Manseng, Melon Blanc sino igualmente en tintas, como en la Garnacha, Merlot, Cabernet franc, Cabernet Sauvignon, Syrah, Mourvdre, Cinsault (Darriet et al., 1993; Darriet et al., 1995; Gth, 1997a; Tominaga et al., 2000; Tominaga et al., 1996; Gth, 1997a; Bouchilloux et al., 1998; Kotseridis et Baumes, 2000; Lopez et al., 2003; Murat et al., 2003; Schneider et al., 2003; Fretz et al., 2005, Ferreira et al., 2002, Schneider et Masson, 2009). Estudios recientes (Ferreira et al 2002; Masson et Schneider, 2009), han demostrado que el mercaptohexanol era por otra parte un aroma clave en los vinos rosados de Garnacha, y ms concretamente en los Rosados de Provence (Masson et Schneider, 2009). Esta ubicuidad del 3MH es en parte debida a una segunda va de formacin de este tiol durante la fermentacin, no proveniente de S-conjugados a la cisteina de la uva, sino al aadido de fuentes sulfurosas al (E)-2-hexenal en un mosto en fermentacin (Schneider et al., 2006). Esta va de formacin ha sido por otra
1. los tioles varietales

Los compuestos sulfurosos varietales se forman durante la fermentacin a partir de los S- conjugados a la cisteina de la uva. Estos S-conjugados a la L-cisteina o precursores cisteinicos han sido evidenciados e identificados directamente en la uva recientemente (Darriet et al., 1993; Tominaga et al., 1995; Tominaga et al., 1998b). nicamente 3 de estos precursores han sido identificados formalmente en la uva : la S-(1-hidroxihex-3-yl)-L-cisteina (P3MH), el S-(4-metil-2-oxopent-4yl)-L-cisteina (P4MMP) y el S-(4-metill-2-hidroxipent4-yl)-L-cisteina (P4MMPOH ; (Tominaga et al., 1995; Tominaga et al., 1998b). Este ltimo interviene raramente en el aroma del futuro vino. Debido a las dificultades analticas han sido publicados pocos datos cuantitativos acerca de los S-conjugados a la cisteina. Sus contenidos son reducidos y no superan la centena de ug/L en caso del P3MH, el ms abundante, en el mosto del Sauvignon Blanc, (Peyrot des Gachons et al., 2000; Peyrot des Gachons et al., 2002a; Peyrot des Gachons et al., 2005 Dagan, 2006). En cuanto a sus evoluciones durante la maduracin de la uva, se muestran variables en funcin del precursor y de la aada (Peyrot des Gachons et al., 2000, Dagan, 2006). En la baya de la uva, la P4MMP se reparte por igual en la piel y en la pulpa mientras que el P3MH est mayo-
38

parte demostrada en las mismas condiciones para el 4-metil-4-sulfanil-pentan-2-one va oxido de mesitilo, pero este ltimo o su hidrato no ha sido jams encontrado en la uva. Vas anlogas han sido por otra parte evidenciadas para el 2-furanmetanetiol (umbral de percepcin olfativa de 5ng/l en el vino tinto), responsable de las notas de caf tostado de los vinos elaborados en barricas de roble (Blanchard, 2001), y podran explicar la formacin de otros tioles olorosos del vino, como el 3-mercapto-3-metilbutan-1-ol. Es durante la fermentacin cuando la levadura, por intervencin de las enzimas de tipo liasa, libera los tioles olorosos por ruptura de la asociacin C-S de la parte cisteina de los precursores cisteinicos de la uva (Tominaga et al., 1998b). Los rendimientos de transformacin de los precursores cisteinicos al final de la fermentacin en diferentes cepas de levadura Saccharomyces cerevisiae son dbiles y variables, independientemente de cual sea el precursor estudiado en el medio de muestra o natural, aunque la mayor parte de los precursores iniciales se hayan degradado : de 0,06% a 0,6% para la P4MMP (Murat et al., 2001a), y de 0,6% a 10,2 % para el P3MH ( Murat et al., 2001b). En lo relativo al ac3MH que no tiene en la uva ningn S-conjugado a la cisteina, es igualmente la levadura quien lo forma mediante acetilacin del 3MH, al igual que sta acetila los alcoholes de su metabolismo nitrogenado. As pues, la formacin de estos tioles por la levadura depende mucho de la cepa de levadura, del mosto y de las condiciones de fermentacin e incluso de algunas cepas salvajes de Saccharomyces bayanus var. Uvarum eran especialmente activas (Murat et al., 2001a; Masneuf et al., 2002; Howell et al., 2004; Dubourdieu et al., 2006 ; Masneuf-Pomarede et al., 2006, Subileau, 2008). En lo relativo a la evolucin de estos tioles olorosos durante la conservacin del vino, sus contenidos disminuyen generalmente, pero esta disminucin depende en gran parte de los fenmenos de oxidacin ligados a esta conservacin. As los factores que previenen la alteracin del potencial reductor del vino (contacto limitado con el oxigeno, dixido de azufre, las, glutathion, antocianos) limitan estas prdidas en tioles olorosos (Murat et al., 2003). tintos y de los vinos de vendimia tarda (Du Plessis e t Loubster, 1974; Spedding et Raut, 1982; AnocibarBeloqui, 1998). En los vinos tintos, de dbil concentracin parece amplificar las notas de frutas rojas, mientras que en fuertes concentraciones, contribuye a las notas de garriga, olivas y trufas (Sgurel, 2005; Escudro et al, 2007). Contrariamente sera percibido ms bien de manera negativa en los vinos blancos (Goniak et Noble, 1987). Durante la fermentacin, el DMS es liberado por la accin de las levaduras a partir de aminocidos azufrados, en especial la cisteina, el glutation, la S-adenosilmetionina (Schreier et al., 1974; De Mora et al., 1986; Anocibar Beloqui, 1998). Sin embargo, el DMS producido por las fermentaciones es en gran medida eliminado por arrastre por el CO2, ya que es muy voltil (punto de ebullicin 37C/1 atm). As pues, sus contenidos en los vinos en proceso de finalizar su fermentacin son generalmente muy inferiores a su umbral de percepcin, pero pueden producirse en cantidades elevadas, asociados a otros compuestos azufrados ligeros nauseabundos, en los vinos que presentan el defecto de olor a reduccin (Park et al., 1994). No obstante, algunos trabajos han mostrado que los contenidos en DMS se incrementan con el tiempo y la temperatura durante el proceso de envejecimiento en botella, hasta llegar ha alcanzar contenidos del orden de mg/L, (Marais, 1979; De Mora et al., 1986; De Mora et al., 1993; Anocibar Beloqui, 1998; Sgurel et al., 2004; Dagan, 2006). El DMS as producido durante en el envejecimiento, sera percibido de manera favorable en la gnesis del bouquet de reduccin de los grandes vinos tintos y de los vinos de vendimia tarda, contrariamente a su percepcin en los vinos blancos jvenes (ver ms arriba). Estas informaciones sensoriales son sin embargo bastante limitadas y debern ser completadas para el conjunto de las variedades y de sus diferentes tipos de vino. Por otra parte, un mtodo de mediad de los precursores del DMS en el vino ha sido recientemente desarrollado, (Sgurel et al., 2005), el cual realiza una estimacin correcta del DMS susceptible de ser liberado en el vino durante el envejecimiento (Sgurel et al., 2005). Adems, estos trabajos han demostrado que la uva posee igualmente un PDMS. Entre los derivados del metil-sulfonium a da de hoy conocido en las plantas (Howard et Russell, 1997), nicamente el SMM podra ser el precursor del DMS, presente en la uva, la SMM sera transmitida al vino, donde liberara DMS por medio de una reaccin de degradacin qumica durante su conservacin. La formacin de DMS seguira un proceso qumico lento, dependiendo de la duracin y de las condiciones de conservacin. De esta manera, las diferencias en las concentraciones de DMS para vinos de edades equivalentes, se explicaran esencialmente por las diferencias de PDMS inicial en el embotellado.
Seminario tcnico
2. el sulfuro de dimetilo
El sulfuro de dimetilo (DMS) es un compuesto sulfuroso ligero evidenciado por Du Plessis et Loubster (1974) en el vino, en el que sus umbrales de percepcin olfativa eran del orden de 25 g/l. Sus contenidos en los vinos jvenes eran ms bien inferiores a este umbral, pero podan alcanzar los 900 g/l en vinos ms evolucionados (Dagan 2006 y referencia mencionada). El DMS es uno de los constituyentes importantes del aroma de trufas, una nota olfativa a menudo citada para el bouquet de reduccin de los grandes vinos
Ponencias
39
04. Los compuestos voltiles no son todos perjudiciales! Los tioles varietales y el sulfuro de dimetilo
Los anlisis de uvas efectuados a da de hoy han revelado un potencial en DMS extremadamente heterogneo, y a veces muy elevado en algunas muestras de uva de la variedad Petit y Gros Manseng en estado de sobremaduracin, de hasta 4,5 mg/L (Dagan, 2006), mucho ms elevado que los contenidos encontrados en la Garnacha y el Syrah en maduracin tecnolgica (Sgurel et al., 2004). Para las muestras de estas cuatro variedades, las nicas estudiadas a da de hoy, el PDMS es dependiente de la variedad, del terreno y de la aada, y sus contenidos aumentan de manera muy importante en estado de sobremaduracin en el caso de la variedad Manseng, los nicos estudios realizados a da de hoy para este parmetro. Sin embargo, en algunas de las muestras de estas cuatro variedades, el PDMS de las uvas, quizs mucho ms elevado que en los vinos correspondientes, la simple degradacin qumica no puede explicar estas prdidas a veces considerables de transmisin de PDMS. Las causas de estas prdidas son a da de hoy desconocidas, pero existen varias hiptesis que podran explicarlas. La hiptesis de la degradacin de la SMM por las levaduras es muy plausible, ya que ha sido descubierta recientemente una nueva permeasa, capaz de transportar de manera especfica la SMM, que permitira a la Saccharomyces cerevisiae utilizar la SMM como fuente de azufre (Rouillon et al., 1999), pero la evolucin de la SMM en la levadura no ha sido todava estudiada. Sea cual sea, el DMS formado sera casi enteramente eliminado por arrastre por el gas carbnico durante la fermentacin
alcohlica o mediante simple vaporizacin mientras el vino no est en un medio cerrado.
Conclusin
Los compuestos sulfurados juegan un papel importante en el aroma de los vinos. Si los compuestos sulfurados ligeros, excepto el DMS, son sistemticamente vectores de defectos organolpticos cuando superan sus umbrales de deteccin olfativa, los compuestos sulfurados ms pesados pueden conferir notas olfativas muy interesantes y refinadas. Es especialmente el caso de los tioles varietales, caracterizados por sus notas de ctricos y de boj de los Sauvignon, que de una manera general aportan frescor y afrutado a los vinos. El caso del DMS se muestra mucho ms complejo si cabe, por una parte su efecto realzante en bajas concentraciones, pero que en elevadas concentraciones puede ser percibido negativamente en algunos tipos de vinos blancos. As pues, disponemos a da de hoy de numerosos elementos tecnolgicos para controlar y dominar los contenidos de estos compuestos en los vinos, no hay que olvidar que el aroma de un vino es un conjunto complejo, y que al exacerbar uno u otro de sus componentes, nos arriesgamos a desequilibrar el perfil aromtico y ofrecer simplemente una caricatura.
40
Seminario Tcnico
Influence of the Timing of Nitrogen Additions during Synthetic Grape Must Fermentations on Fermentation Kinetics and Nitrogen Consumption
Beltran, G.; Esteve-Zarzoso, B.; Rozs, N.; Mas, A. And Guillamn J.M. Unitat dEnologia del Centre de Referncia de Tecnologia dAliments, Department Bioqumica i Biotecnologia, Facultat dEnologia de Tarragona, Universitat Rovira i Virgili, Ramn y Cajal, 70, 43005 Tarragona, Spain, and Bodegas Miguel Torres, Miquel Torres i Carb 6, 08720 Vilafranca del Peneds, Barcelona, Spain Nitrogen deficiencies in grape musts are one of the main causes of stuck or sluggish wine fermentations. In the present study, we have supplemented nitrogen-deficient fermentations with a mixture of ammonium and amino acids at various stages throughout the alcoholic fermentation. The timing of the nitrogen additions influenced the biomass yield, the fermentation performance, the patterns of ammonium and amino acid consumption, and the production of secondary metabolites. These nitrogen additions induced a nitrogen-repressed situation in the cells, and this situation determined which nitrogen sources were selected. Glutamine and tryptophan were the main amino acids consumed in all the fermentations. Ammonium is the preferred nitrogen source for biomass production but was hardly consumed when it was added in the final stages of the fermentation. The higher ammonium consumption in some fermentations correlated with a greater synthesis of glycerol, acetate, and acetaldehyde but with a lower synthesis of higher alcohols. KEYWORDS: Saccharomyces cerevisiae; Alcoholic Fermentation; Amino acids; Ammonium; GAP1; MEP2
INTRODUCTION
The nitrogen composition of grape musts affects the growth and metabolism of yeast, the fermentation rate, and the completion of fermentation (1). Nitrogen deficiencies are one of the main causes of stuck or sluggish fermentations. One way of avoiding these problems is to add nutritional supplements, usually inorganic forms of nitrogen such as ammonium salts, to grape must prior to fermentation (2-4). These additions are generally made empirically in wine cellars, and the initial nitrogen concentration in the must or the nitrogen requirements of the usual yeast strain used in the cellar are not determined. Yeasts respond metabolically to differences in nitrogen availability, so this lack of control of nitrogen leads to differences in wine composition. Nitrogen affects yeast cells in two ways: it increases biomass production and stimulates the rate of sugar utilization. Nitrogen additions during the period of cell growth have resulted in maximum cell populations. Later additions during the stationary phase have had no effect on the cell population but have increased the specific fermentation rate, thus reducing the length of the fermentation (2, 5, 6). Nitrogen supplementation affects the pattern of nitrogen uptake. Ammonium is a preferred yeast nitrogen source, and when plentiful, it represses the expression of catabolic pathways by degrading other nitrogenous compounds (7, 8). This mechanism, called nitrogen catabolite repression (NCR), has recently been studied during wine fermentations (9). It inhibits the uptake of arginine and alanine and stimulates the consumption of branched-chain and aromatic amino acids. Changes in the nitrogen uptake patterns influence the production of aroma and spoilage compounds (particularly hydrogen sulfide) and the amount of urea, the major precursor of the carcinogen ethyl carbamate (10-13). The volatiles identified in wines are usually dominated by fermentation products. Organic acids, higher alcohols, and esters are the main group of flavor compounds coming from yeast metabolism (12). Higher alcohols can be produced either by the catabolic conversion of the branched-chain amino acids (via Ehrlich) or by the anabolic formation of these amino acids de novo from a sugar substrate (14). An excess of higher alcohols (above 400 mg L-1) can be regarded as a negative influence on the quality of wine, but at the concentrations generally found in wines (below 300 mg L-1), they usually contribute to the desirable complexity of wine. Furthermore, these alcohols, together with the acids in wine, are substrates for ester formation. Most esters, with the exception of ethyl acetate, impart a pleasant smell of fruits and flower notes in the wine (15).
J. Agric. Food Chem. 2005, 53, 996-1002
Textos asociados
41
As mentioned, in winemaking, most of the nitrogen additions are made empirically and do not take into account the different nitrogen needs of the cell during wine fermentation, the proper timing of these additions, or the nitrogen source added. In this study, we supplemented nitrogen-deficient fermentations with a mixture of ammonium and amino acids at different stages of the alcoholic fermentation. We then studied the effect of these additions on the fermentation kinetics, the consumption of organic and inorganic nitrogen throughout the fermentation, and the influence of this consumption on the organoleptic profile of the wines. We also monitored the effect of the nitrogen supplementations on the NCR system and the effect of the nitrogen-repressed situation on nitrogen uptake.
In the latter stages of the fermentation, the sugar consumption was assayed by enzymatic kits (Roche Applied Science, Germany). Fermentation was considered to be complete when the residual sugars were below 2 g L-1. Cell growth was determined by absorbance at 600 nm. Absorbance values were corrected for the initial absorbance reading obtained for juice. Cells were harvested at different points during the fermentation so that mRNA could be analyzed. Flasks were magnetically stirred to resuspend settled biomass, transferred to centrifuge tubes, and centrifuged at 5000 rpm for 5 min at room temperature to prevent temperature shock. Cell pellets were transferred to 1.5 mL Eppendorf tubes and frozen immediately in liquid nitrogen. They were kept at -80 C until they were analyzed. The supernatant of these samples was stored at -20 C for extracellular metabolites and nitrogen content analysis. Nitrogen Content Analysis. YAN was analyzed by the formol index method (18), and the ammonium content was quantified using an enzymatic method (Roche Applied Science, Germany). The individual amino and imino acids were analyzed by OPA and FMOC derivatizations, respectively, using the Agilent 1100 Series HPLC equipped with a low-pressure gradient quaternary pump, a thermostated autosampler, a DAD ultraviolet detector, and a fluorescence detector (Agilent Technologies, Germany). The sample (2 L) was injected into a 4.6 mm 250 mm 5 m Hypersil ODS column (Agilent Technologies, Germany). The gradient solvent system was: solvent A (16 mM sodium acetate and 0.022% triethylamine, adjusted to pH 7.2 with 1-2% acetic acid, and 0.6% tetrahydrofuran) from 100% at t ) 0 to 0% at t ) 18 min, and solvent B (20% of 66 mM sodium acetate, adjusted to pH 7.2 with 1-2% acetic acid, 40% acetonitrile and 40% methanol) from 0% at t ) 0 to 100% at t ) 18 min. The analysis temperature was 40 C, and the flow rate was 1.5 mL min-1. Several dilutions of each sample were analyzed and averaged using the analysis software. The concentration of each amino acid was calculated using external and internal standards and expressed as mg L-1. The software used was Agilent ChemStation Plus (Agilent Technologies, Germany). Ethanol, Glycerol, and Organic Acid Analysis. Ethanol, glycerol, and organic acids were analyzed in all the samples at the end of the fermentation process. Analytical HPLC was carried out on a Hewlett- Packard HP 1050 connected to a Hewlett-Packard Integrator 3395 equipped with an HP 1047 RI detector (Agilent Technologies, Wilmington, DE) (19). The wine sample (450 L) was mixed with 50 L of formic acid (internal standard), and 25 L was injected into a 300 mm 7.8 mm AMINEX HPX-87H column (BioRad, Hercules, CA). The solvent used was sulfuric acid 2.5 mM at 0.5 mL min-1. The analysis temperature was 60 C. The con-
MATERIALS AND METHODS

Strain, Fermentations, and Sampling. A commercial Saccharomyces cereVisiae Var. bayanus wine strain QA23 (Lallemand S. A., Toulouse, France) was used in this study. Fermentations were carried out in a synthetic grape must (pH 3.3) as described by Riou et al. (16) but with 200 g L-1 of reducing sugars (100 g L-1 Glucose and 100 g L-1 Fructose) and without anaerobic factors. Only the nitrogen content changed in the different fermentations. The yeast assimilable nitrogen (YAN) content in the control synthetic grape must was 300 mg N L-1, ammoniacal nitrogen (NH4Cl) 120 mg N L-1, and amino acids 180 mg N L-1 (Table 2). This medium also contained 426 mg L-1 of Proline, but it should not be considered as assimilable nitrogen (17). The proportions of the different amino acids and ammonium were maintained in all the fermentations. Nitrogenlimited fermentations were carried out with 60 mg L-1 of YAN (24 mg L-1 of ammoniacal nitrogen and 36 mg L-1 of amino acid nitrogen), and 240 mg L-1 of YAN nitrogen was added at different fermentation points (96 mg L-1 of ammoniacal nitrogen and 144 mg L-1 of amino acid nitrogen). The supplementation points were chosen by monitoring the decrease in density of the media. Density was measured throughout the fermentation by weighing 5 mL, and nitrogen was added when the density of the must was 1060 g L-1 (30 h after inoculation), 1040 g L-1 (72 h), 1020 g L-1 (144 h), and 1000 g L-1 (240 h). Fermentations took place at room temperature (22-28 C) in laboratory-scale fermenters: 2 L bottles filled with 1.8 L of medium and fitted with closures that enabled the carbon dioxide to escape and the samples to be removed. Fermentations were in semi-anaerobic conditions since limited aeration was necessary in order to harvest samples for the subsequent analysis. The population inoculated in every flask was 2 106 cell mL-1 from dry yeast rehydrated in water at 37 C.
42

centration of each metabolite was calculated using external and internal standards. Fatty Acid Analysis. Fatty acids were extracted using the method published by Lopez et al. (20). Analytical GC was carried out on a Hewlett-Packard 6890N connected to a computer with the ChemStation software (Agilent Technologies, Wilmington, DE). The extract (2 L) was injected (splitless, 0.75 min) into a Tracer TR column of 60 m 250 m and 0.25 m phase thickness with an HP automatic injector (Agilent). The temperature program was 40 C for 5 min followed by 2 C min-1 to 240 C (15 min). Injector and detector temperatures were 220 and 240 C, respectively. The carrier gas was hydrogen at 60 mL min-1. 2-Ethylphenol (0.2 mg L-1) was added as internal standard. Internal patterns were used to estimate the quantity of the different compounds. Analysis of Higher Alcohols and Esters. Higher alcohols and esters were extracted by liquid/liquid extraction (wine 10 mL, 200 L 1,1,2- trichlorotrifluoroethane, 0.5 g NaCl), with n-decanol (0.2 mg L-1) as internal standard (21). After agitation for 2 min and centrifugation, the organic phase was extracted and 2 L was injected. The chromatographic program used is the same as that used for the fatty acid analysis. Quantification was conducted by comparison with known quantities of different products in a hydro alcoholic solution. RNA Extraction and cDNA Synthesis. Total RNA was isolated from yeast samples as described by Sierkstra et al. (22) and resuspended in 50 L of DEPC-treated water. Total RNA suspensions were purified using the High Pure Isolation kit (Roche Applied Science, Germany) following the protocol provided by the manufacturer. RNA concentrations were determined using a GenQuant spectrophotometer (Pharmacia, Canada), and the quality of RNA was verified electrophoretically on 0.8% agarose gels. Solutions and equipment were treated so that they were RNase free, as outlined in Sambrook et al. (23). Total RNA was reverse-transcripted with Superscript II RNase Hreverse transcriptase (Invitrogen, Carlsbad, CA) in a GenAmp PCR System 2700 (Applied Biosystems, Foster City, CA). Oligo (dT)12-18 primer ( 0.5 g, Invitrogen) was used with 0.8 g of total RNA as template in a reaction volume of 20 L. Following the protocol provided by the manufacturer, after denaturation at 70 C for 10 min, cDNA was synthesized at 42 C for 50 min. Finally, the reaction was inactivated at 70 C for 15 min. Real-Time Quantitative PCR. The PCR primers used in this study are ACT-F, TGGATTCCGGTGATGGTGTT, and ACT-R, CGGCCAAATCGATTCTCAA (ACT, for actine gene); GAP1-F, CTGTGGATGCTGCTGCTTCA, and GAP1-R, CAACACTTGGCAAACCCTTGA (GAP1, for general amino acid permease gene); and MEP2- F, GGTATCATCGCTGGCCTAGTG, and MEP2-R, ACAACGGCTGACCAGATTGG (MEP2, for ammonium permease gene) (9).They were all designed with the available GenBank sequence data and the Primer Express software (Applied Biosystems) in accordance with the Applied Biosystems guidelines for designing PCR primers for quantitative PCR. All amplicons were short, which ensured maximal PCR efficiency and, therefore, the most precise quantification. For each gene, a standard curve was made with yeast genomic DNA. DNA extraction was performed as described by Querol et al. (24), digested by RNase, and isolated by 2-fold phenol-chloroform extractions and ethanol precipitation. Concentration was determined using a GeneQuant spectrophotometer (Pharmacia, Canada). Serial 10-fold dilutions of DNA were carried out to yield DNA concentrations from 4 to 4 10-5 ng L-1. These dilution series were amplified (in duplicate) by SYBR PCR for each gene to obtain standard curves (see above). The standard curve displays the Ct value vs log10 of each standards starting quantity. The starting quantity of the unknown samples was calculated against the standard curve by interpolation, and gene expression levels are shown as the concentration of the studied gene normalized with the concentration of the housekeeping ACT gene. The real-time quantitative PCR reaction was performed using SYBR Green I PCR (Applied Biosystems). In SYBR PCR, amplification is monitored by the gain in fluorescence of the double-strand-specific DNAbinding dye SYBR green. The 25 L SYBR PCR reactions contained 300 nM of each PCR primer, together with 1 L cDNA (or 5 L of each DNA serial dilution for standard tubes) and one time SYBR master mix (Applied Biosystems).
Seminario Tcnico
The PE5700 cycler provided cycle-by-cycle measurement of the fluorescence emission from each PCR reaction. Analysis resulted in the assignation of a threshold cycle (Ct) value to each PCR reaction. The Ct value is the cycle number at which an increase in reporter fluorescence above a baseline signal can first be detected. The threshold was positioned to intersect the exponential part of the amplification curve of positive reactions, as recommended by Applied Biosystems. The Ct value is inversely proportional to the log of the amount of template in the PCR reaction; the lower the
Textos asociados
All PCR reactions were mixed in 96-well optical plates (Applied Biosystems) and cycled in a PE Applied Biosystems 5700 thermal cycler under the following conditions: 50C for 2 min, 95C for 10 min, and 40 cycles at 95C for 15 s and at 60 C for 60 s.
43
Ct value, the higher the concentration of template in the PCR reaction. Assuming a 100% effective PCR amplification, a difference of one Ct value corresponds to a 21 ) 2-fold difference in the amount of template. All samples were analyzed in duplicate, and the expression values were averaged by the analysis software (Applied Biosystems). The coefficient of variation in all samples analyzed was less than 10%.
and amino acid nitrogen. Unlike their effect on the O. D. values, the nitrogen additions clearly stimulated the fermentation regardless of when they were made. In the nitrogen-deficient fermentation, yeast consumed the total YAN after the first day (data not shown). However, nitrogen was not completely consumed in the control fermentation. The nitrogen additions were all carried out when the initial YAN had already been depleted, and the later the nitrogen was added, the lower the amount of YAN was consumed (Table 2). The ammonium consumed was 54% of the total YAN consumed in the control fermentation (Table 2), but this proportion decreased when nitrogen was added later in the fermentation. Ammonium was proportionally preferred as the nitrogen source when the additions were made in the first half of the fermentations (N1060 and N1040). In later additions (N1020 and N1000), the small amount of nitrogen consumed was mostly from amino acids. The consumption of amino acids was monitored at different points during the fermentations. The yeasts pattern of amino acid utilization changes with the time of YAN supplementation (Table 2). The amino Figure 1. Effect of nitrogen additions on O. D. measures ( = 600 nm) throughout synthetic grape must fermentations. The arrows indicate the time of addition.
RESULTS
Effect of Nitrogen Addition on Fermentation Kinetics and Nitrogen Consumption. Five fermentations started with a nitrogen content of 60 mg L-1, which is low enough for a fermentation to be sluggish but high enough for it to finish. Four of these nitrogen-deficient fermentations were supplemented at different points with 240 mg L-1 of YAN; the first one at a density of 1060 g L-1, and the second, third, and fourth at 1040, 1020, and 1000 g L-1, respectively. The remaining fermentation was not supplemented, but subjected to nitrogen deficiency throughout the process. As a fermentation control, we used the same medium with a nondeficient amount of nitrogen (300 mgN L-1) (9). Figure 1 shows the effect of nitrogen additions on O. D. measures throughout the fermentations studied. The nitrogendeficient fermentations had lower O. D. values than the control fermentation. When nitrogen was added in the first half of the fermentations (density of 1060 and 1040), these effects were almost overcome, and the O. D. values were similar to those of the control fermentation. Additions at densities of 1020 and 1000, however, had minimal effects on O. D. measures. Table 1 summarizes the evolution of the fermentation and nitrogen consumption, measured as ammonium
Table 1. Determination of Yeast Assimilable Nitrogen (YAN) in the Fermentation Media, Represented by the Amino Acid Fraction (YAN aas) and bythe Ammonium fraction (YAN NH4+)
control fermentation density () 1080 1060 1040 1020 1000 990 (endb) time (h) 0 30 56 96 168 312 YAN NH4+ (mg N L- 1) 120 70 52 36 35 41 N addition at =1020 density () 1080 1060 1040 1020 1000 990 (endb)
a
N addition at F ) 1060 YAN aas (mg N L- 1) 168 98 95 98 98 102 time (h) 0 36 62 96 168 312 YAN NH4+ (mg N L- 1) 25 0.5 (90a) 50 45 42 50 YAN aas (mg N L- 1) 41 4 (145a) 105 104 108 110 time (h) 0 36 78 120 192 336
N addition at = 1040 YAN NH42+ (mg N L- 1) 25 0.1 0.1 (92a) 68 65 66 no N addition time (h) 0 36 78 150 264 504 YAN NH4+ (mg N L- 1) 26 0 0 0 1 1 YAN aas (mg N L- 1) 40 5 2 1 1 1 YAN aas (mg N L- 1) 40 4 4 (136a) 104 110 114
N addition at = 1000 time (h) 0 36 78 150 264 456 YAN NH4+ (mg N L- 1) 26 0 0 0 0 (99a) 100 YAN aas (mg N L- 1) 40 7 4 4 2 (147a) 130
time (h) 0 36 78 150 240 408
YAN NH4+ (mg N L- 1) 25 0 0 0 (92a) 81 88
YAN aas (mg N L- 1) 41 7 7 4 (143a) 109 118
44
NH4+ and aas YAN content just after the nitrogen addition. b End of fermentation.

Table 2. Total Consumption of Amino Acids and Ammonia at the End of Each Fermentation Expressed as mg N L-1a
amino acids Gln Trp Thr His Leu Ile Phe Val Ser Met Lys Arg Tyr Glu Gly Ala Asp YAN aas YAN NH4+
a
Seminario Tcnico
full N media content 47.4 10.3 9.9 3.8 4.7 3.8 2.8 5.1 7.5 1.8 1.9 47.9 1.4 11.8 3.1 12.1 4.2 179.5 120.0
control consumption total 25.5 6.6 9.4 3.7 4.2 3.2 2.4 3.0 2.8 1.8 1.1 0.6 0.4 0.5 0.2 65.5 79.2
N1060 consumption total 34.9 6.8 3.6 1.5 2.6 1.8 1.2 1.6 2.9 1.1 0.7 5.9 0.2 2.3 1.2 68.4 64.9 post-add 22.1 4.2 1.4 1.5 1.1 0.6 0.4 0.4 0.8 0.5 34.5 39.5
N1040 consumption total 24.5 7.7 2.6 1.2 1.8 1.4 1.3 1.1 1.7 1.0 1.0 9.0 0.3 2.0 1.7 58.2 51.4 post-add 11.8 4.1 0.7 1.2 0.8 0.7 0.5 0.1 0.6 0.9 0.9 22.2 26.0
N1020 consumption total 29.0 8.1 2.0 0.8 1.4 0.8 1.2 1.0 1.7 0.6 1.0 8.8 0.3 2.7 2.7 62.1 29.5 post-add 16.2 4.5 0.2 0.8 0.4 0.2 0.4 0.3 0.9 0.7 0.2 24.6 4.1
N1000 consumption total 23.1 7.8 1.9 0.4 1.2 0.7 0.9 1.1 1.9 0.5 0.1 8.2 0.3 2.5 0.3 3.1 53.9 25.4 post-add 10.3 4.1 0.1 0.4 0.2 0.1 0.1 0.1 0.2 15.7
no N consumption total 12.8 3.6 1.8 1.0 0.6 0.8 1.0 1.8 0.3 0.2 8.2 0.3 2.5 0.4 3.2 0.1 38.6 25.4
In the fermentations with nitrogen additions, post-add represents the nitrogen taken up after this addition.
acids can be grouped in different sets according to the preference of the cell in the different conditions. The amino acids that are most consumed are glutamine and tryptophan. Together they represented 32% of the total assimilable amino acids of the synthetic grape must (Table 2), and regardless of the fermentation conditions, their consumption accounted for 50% to 65% of the total amino acids consumed. On the other hand, the consumption of arginine, glutamate, glycine, alanine, and aspartate, which were approximately 44% of the total assimilable amino acids in the medium (Table 2), was together hardly 2% of the total amino acids consumed in the control fermentation. The consumption of these amino acids was much higher in the fermentations supplemented with nitrogen. However, yeast cells only consumed these amino acids before the nitrogen addition: that is, when the fermentations were nitrogen-deficient. Last, there is one other set of amino acids, consisting of threonine, histidine, leucine, isoleucine, phenylalanine, valine, and methionine, which was consumed proportionally more in the control fermentation than in the supplemented fermentations. GAP1 and MEP2 Gene Expression. The expression of the nitrogen transporters GAP1 and MEP2 was analyzed and quantified relative to the expression of the housekeeping actine gene. Time zero was the expression of yeast before inoculation (and after rehydration). Both genes were repressed in the first hours after inoculation in the must-like medium (Figure 2). In the nitrogen-deficient fermentation, these genes started to be activated/de-repressed after 30 h, when nitrogen was almost depleted. The expression of both genes increased continuously during the first days of fermentation and peaked after 4 and 6 days for GAP1
Figure 2. Gene expression of ammonium permease (MEP2) and general amino acid permease (GAP1) at time zero (before inoculation) and at different points during the control fermentation and the nitrogendeficient fermentation (without nitrogen addition). The data were quantified by calculating the ratio between the concentration of the studied genes normalized with the concentration of the housekeeping ACT gene, and expressed as a percentage (the quantity ratio 1 was set as 100%). YAN and ammonia consumption throughout the fermentations are also indicated.
and MEP2, respectively. The expression of the genes decreased in the last days of fermentation, after several days without a nitrogen source. On the other hand, the presence of residual nitrogen in the control fermentation repressed these genes throughout.
Textos asociados
45
Figure 3. Relative gene expression of GAP1 and MEP2 at different points in the first 24 h after the nitrogen addition. Time zero represents the point just before this addition. The data were calculated as in Figure 2.
Table 3. Secondary Metabolites Produced by Yeasts during the Different Fermentationsa

control ferm. ethanol glycerol acetate acetaldehyde citrate succinate lactate N1060 N1040 N1020 no N N1000 addition 98.7 101.1 5.78 6.12 0.89 0.81 0.24 0.22 0.39 0.41 0.23 0.23 0.02 0.02 13 16 94 53 176 0.50 0.59 0.80 0.18 1.90 2.43 0.14 0.32 6.86 12 16 94 43 165 0.41 0.60 0.60 0.15 1.85 2.49 0.46 0.28 6.83
Alcohols and Acids (g L 1) 98.7 97.2 98.0 98.0 6.56 6.57 6.32 6.11 1.17 1.22 0.98 0.80 0.33 0.28 0.26 0.25 0.41 0.41 0.38 0.41 0.13 0.21 0.27 0.26 0.04 0.05 0.04 0.03 Higher Alcohols (mg L 1) 37 33 28 20 11 13 16 16 50 48 81 97 11 21 42 46 109 115 167 179 Fatty Acids (mg L 1) 0.39 0.40 0.43 0.63 0.73 0.67 0.63 0.37 0.30 0.12 0.09 0.09 2.06 1.58 1.40 2.30 1.95 1.84 0.39 0.37 0.21 0.16 0.14 0.09 6.70 5.63 5.02 0.39 0.72 0.44 0.10 1.53 2.34 0.19 0.16 5.87
n-propanol isobutanol isoamylic alcohol phenyl-2-ethanol

isobutyric acid butyric acid isovaleric acid valeric acid hexanoic acid octanoic acid decanoic acid dodecanoic acid
Figure 3 shows the gene expression of GAP1 and MEP2 in the first 24 h after the nitrogen addition. They were both repressed in all the fermentations. However, the later the addition took place in the fermentation process, the longer it took for the genes to be repressed. When nitrogen was added at the end of the fermentation (density 1000), the effect was negligible because of the low expression at this point. Analytical Profile. We analyzed the residual sugars, ethanol, glycerol, and acids in the wines obtained from the different fermentations and such flavor compounds as higher alcohols, volatile fatty acids, and esters, which arose from yeast metabolism (Table 3). The later the nitrogen addition was, the lower the concentration of glycerol, acetic acid, and acetaldehyde was. The higher alcohol content was lower when excess nitrogen was available at the beginning of the fermentation (control fermentation and N1060). These different concentrations were accounted for by the increase in isoamyl alcohol and 2-phenylethanol. The concentration of these compounds increased considerably in the fermentations with nitrogen additions in the later phases (or no addition), and were approximately 2 and 5 times higher than in the control fermentation. The increase in isoamyl alcohol did not lead to a corresponding clear increase in its ester (isoamyl acetate) in these fermentations, and the phenyl-2-ethanol acetate ester only increased slightly. In fact, the differences in the concentration of the total acetate esters between the fermentations were due to the concentration of ethyl acetate, which was more than 95% of the total acetate esters.
Acetate Esters (mg L 1) ethyl acetate 35 35 32 25 19 28 isobutyl acetate 0.023 0.024 0.012 0.016 0.011 0.011 isoamyl acetate 0.49 0.46 0.39 0.69 0.39 0.29 hexyl acetate 0.006 0.005 phenyl-2-ethanol acetate 0.21 0.37 0.41 0.47 0.41 0.29 35.73 35.86 32.81 26.18 19.81 28.59 ethyl butyrate ethyl isobutyrate ethyl hexanoate ethyl octanoate ethyl decanoate Fatty Acid Esters (mg L 1) 0.224 0.220 0.163 0.006 0.005 0.006 0.089 0.071 0.23 0.022 0.022 0.060 0.002 0.004 0.019 0.343 0.322 0.478 0.232 0.005 0.31 0.081 0.024 0.652 0.164 0.004 0.23 0.059 0.019 0.446 0.124 0.007 0.085 0.020 0.004 0.240
Values are the average of two determinations and the coefficient of variation in all the compounds analyzed was less than 10% with the exception of decanoic acid (18%), dodecanoic acid (38%), ethyl octanoate (16%), and ethyl decanoate (29%).
Its concentration was higher in the control fermentation and the N1060 and 1040 fermentations, which correlated with a higher acetate concentration. The differences in the concentration of fatty acids and their esters were smaller in the final products of the fermentations.
DISCUSSION
The addition of nitrogen to grape musts, especially in the form of ammoniacal nitrogen, is a common winemaking practice that prevents nitrogen-related fermentation problems. Several studies, in which grape musts were supplemented with diammonium phosphate, have proved that nitrogen supplements can optimize fermentation performance (2-4). In the present study, we supplemented a nitrogen-deficient synthetic must with a mixture of ammonium and amino acids at different stages of the alcoholic fermentation. Then we studied the effect of these additions on
46

the fermentation kinetics, the consumption of organic and inorganic nitrogen throughout the fermentation, and the influence of this consumption on the aroma compound profile of the wines. We observed a reduction in the fermentation length regardless of the time of addition and, consequently, a reduction in the total fermentation time. However, the fermentation length decreased even further when nitrogen was added during the exponential phase and yeast cells probably used this nitrogen for biomass production. These results largely agree with those previously reported (2-4). However, the yeast strain QA23 used in this study seems to have low nitrogen requirements. It used only 147 mg N L-1 in the control fermentation and finished it with only 60 mg N L-1. Agenbach (25) established that fermentations require a minimal amount of 140 mg N L-1 to avoid getting stuck. In fact, nitrogen demands and preferences are strain dependent (26-28) and, therefore, it should be taken into account that we only used one strain. As in previous experimental studies (2, 6), we observed that nitrogen additions during the period of cell growth resulted in an increase in cell biomass. During the cell growth phase of the fermentation, most carbon- and nitrogen-containing compounds are diverted to biomass production. When growth stops, however, only small amounts of these nutrients are required, primarily for cell maintenance (3). The metabolism of nitrogen depends heavily on its uptake through the different nitrogen transporters. In this study, we monitored the activity of the genes encoding two important permeases in the transport of amino acids (GAP1) and ammonium (MEP2) throughout fermentation. In a previous study (5), we observed that both permeases were repressed in a nitrogen-rich medium by the mechanism called nitrogen catabolite repression (NCR). The present study confirms this repression because in the control fermentation their expressions were almost negligible and in the limiting nitrogen condition their expressions dropped sharply at the beginning, when nitrogen was still available, and increased continuously when it was not. The NCR of both transporters was fast and effective, as seen with the nitrogen additions, although the cell response to the excess of nitrogen in the medium was quicker when the nitrogen addition was in the first half of fermentation. During the last stages of fermentation, ethanol content is high and it is well established that the first target of ethanol toxicity is the plasma membrane (29, 30), which can be impaired for a long period of anaerobic growth. Therefore, the sensing system of the cell, mainly located in the plasma membrane, may be affected by both effects (31). The moment of the fermentation process at which the NCR was established (by the nitrogen addition) determined the pattern of amino acid consumption. As previously reported (9), arginine, alanine, aspartate, glutamate, and glycine were the amino acids that were most affected by the NCR because they were hardly consumed when there was an excess of nitrogen. In fact, they were not taken up until the medium was depleted of good nitrogen sources. These amino acids must be transported mainly by the general amino acid permease (Gap1p) or by other specific permeases also subjected to NCR. A similar uptake pattern for these amino acids was previously reported in both synthetic and natural grape juices (1, 26). On the other hand, in brewing conditions (32) arginine and glutamine were rapidly consumed whereas ammonium uptake was delayed. Branched-chain and aromatic amino acids behaved in a completely different way. Except for tryptophan, they were mostly consumed in the first stages of the control fermentation: that is, when the cells were subjected to NCR from the beginning of the fermentation process. A common feature of the genes that encode the permeases of the branched-chain amino acids (BAP1 and BAP2) and aromatic amino acids (TAT1 and TAT2) is that they are induced in a nitrogen-rich medium (33, 34). Regardless of the time of addition, glutamine and tryptophan were the main amino acids consumed after the nitrogen additions, and therefore, they may be very important for the yeast cell metabolism throughout the process. Ammonium accounted for 40% of the total YAN of the fermentation media. However, its consumption depended on the timing of the addition. Ammonium is the preferred nitrogen source for biomass production but was hardly consumed when it was added in the final stages of the fermentation. These differences in ammonium uptake are difficult to explain in terms of permease regulation. In the present study and in our previous one (9), we detected that, the more nitrogen there was in the fermentation media, the more repressed the three MEP genes were. Marini et al. (35) have proposed two possible hypotheses to explain this paradox: either the yeast possesses additional ammonium transport systems unrelated to the Mep proteins, or highly concentrated ammonium is taken up into the cells by simple diffusion. The timing of the nitrogen additions directly determined the likely aroma characteristics of the wines. Glycerol increased in the fermentations with higher biomass production and higher ammonium consumption. The relationship between biomass formation and glycerol synthesis has already been reported (36- 38). Likewise, a higher glycerol yield was also observed on a synthetic glucose-rich medium when ammonium was used as the sole nitrogen source instead of a mixture of ammonium and amino acids (39). Michnick et al. (40) also related the production of glycerol to the accumulation of acetate and acetaldehyde.
Seminario Tcnico
Textos asociados
47
Higher alcohols were also affected by the changes in nitrogen utilization. These compounds can be produced either by the catabolic conversion of the branched-chain amino acids (via Ehrlich) or by the anabolic formation of these amino acids de novo from a sugar substrate (14, 15). Our results show that the anabolic route is of greater importance because the increase in isoamyl alcohol and 2-phenyl ethanol was inversely proportional to the consumption of leucine and phenylalanine, respectively. Furthermore, the closer the nitrogen concentration is to the growth-limiting level, the higher the yield of fusel alcohols is. There is also an inverse correlation between ammonium consumption and the production of fusel alcohols (12). A greater concentration of higher alcohols did not seem to determine an increase in esters. In contrast, the acetate concentration seemed to determine a greater concentration of acetate esters, especially ethyl acetate. In conclusion, our study shows the quantity and quality of the nitrogen demands of the wine strain QA23. Although further studies should be carried out with other wine strains, our data show that cell growth and fermentation have different preferred nitrogen sources. Nitrogen additions always improved fermentation performance but had a minimal effect on biomass production when added in the second half of the fermentation. These nitrogen additions subjected the cells to NCR and changed the profile of nitrogen consumption. The differences in the pattern of nitrogen consumption were related to different aroma compound compositions in the wines. In our opinion, this study is a starting point for further investigation into using an ammonium/amino acid mixture as nitrogen supplementation in the wine industry and the effect that these additions have on yeast physiology, fermentation performance, and wine quality.
LITERATURE CITED
(1) Bisson, L. F. Influence of nitrogen on yeast and fermentation of grapes. In Proceedings of the International Symposium on Nitrogen in Grapes and Wine; Ranz, J. M., Ed.; American Society of Enology and Viticology: Davis, CA, 1991. (2) Bely, M.; Sablayrolles, J. M.; Barre, P. Automatic detection of assimilable nitrogen deficiencies during alcoholic fermentation in oenological conditions. J. Ferment. Bioeng. 1990, 70, 246- 252. (3) Jiranek, V.; Langridge, P.; Henschke, P. A. Yeast nitrogen demand: selection criterion for wine yeasts for fermenting low nitrogen musts. In Proceedings of the International Symposium on Nitrogen in Grapes and Wine; Ranz, J. M., Ed.; American Society of Enology and Viticology: Davis, CA, 1991. (4) Monteiro, F. F.; Bisson, L. F. Nitrogen supplementation of grape juice. I. Effect on amino acid utilization during fermentation. Am. J. Enol. Vitic. 1992, 43, 1-10. (5) Bely, M.; Sablayrolles, J. M.; Barre, P. Description of alcoholic fermentation kinetics: its variability and significance. Am. J. Enol. Vitic. 1990, 41, 319-324. (6) Mendes-Ferreira, A.; Mendes-Faia, A.; Leao, C. Growth and fermentation patterns of Saccharomyces cereVisiae under different ammonium concentrations and its implications in winemaking industry. J. Appl. Microbiol. 2004, 97, 540545. (7) Cooper, T. G. Nitrogen metabolism in Saccharomyces cereVisiae. In The molecular Biology of the Yeast Saccharomyces; Stratherm, J. N., Jones, E. W., Broach, J. R., Eds.; Cold Spring Harbor Laboratory: Cold Spring Harbor, New York, 1982. (8) ter Schure, E. G.; van Riel, N. A.; Verrips, C. T. The role of ammonia metabolism in nitrogen catabolite repression in Saccharomyces cereVisiae. FEMS Microbiol. ReV. 2000, 24, 67- 83. (9) Beltran, G.; Novo, M.; Rozes, N.; Mas, A.; Guillamon, J. M. Nitrogen catabolite repression in Saccharomyces cereVisiae during wine fermentations. FEMS Yeast Res. 2004, 4, 625-632. (10) Jiranek, V.; Langridge, P.; Henschke, P. A. Regulation of hydrogen sulfide liberation in wine-producing Saccharomyces cereVisiae strains by assimilable nitrogen. Appl. EnViron. Microbiol. 1995, 61, 461467.
ACKNOWLEDGMENT
This work was supported by grant AGL20000205-P4-03 from the Comisin Interministerial de Ciencia y Tecnologa, Spain. The authors wish to thank the language service of the Rovira i Virgili University for revising the manuscript.
48

(11) Ough, C. S. Influence of nitrogen compounds in grapes in ethyl carbamate formation in wines. In Proceedings of the International Symposium on Nitrogen in Grapes and Wine; Ranz, J. M., Ed.; American Society of Enology and Viticology: Davis, CA, 1991. (12) Rapp, A.; Versini, G. Influence of nitrogen compounds in grapes on aroma compounds of wines. In Proceedings of the International Symposium on Nitrogen in Grapes and Wine; Ranz, J. M., Ed.; American Society of Enology and Viticology: Davis, CA, 1991. (13) Marks, V. D.; van der Merwe, G. K.; van Vuuren, H. J. Transcriptional profiling of wine yeast in fermenting grape juice: regulatory effect of diammonium phosphate. FEMS Yeast Res. 2003, 3, 269-287. (14) yrp, T. Biosynthetic formation of higher alcohols by yeast. Dependence on the nitrogenous nutrient level of the medium. J. Inst. Brew. 1971, 77, 276. (15) Lambrechts, M. G.; Pretorius, I. S. Yeast and its importance to wine aroma. S. Afr. J. Enol. Vitic 2000, 21, 97-129. (16) Riou, C.; Nicaud, J. M.; Barre, P.; Gaillardin, C. Stationaryphase gene expression in Saccharomyces cereVisiae during wine fermentation. Yeast 1997, 13, 903-915. (17) Salmon, J. M.; Barre, P. Improvement of nitrogen assimilation and fermentation kinetics under enological conditions by derepression of alternative nitrogen-assimilatory pathways in an industrial Saccharomyces cereVisiae strain. Appl. EnViron. Microbiol. 1998, 64, 3831-3837. (18) Aerny, J. Composes azotes des mouts et vins. ReV. Suisse Vitic. Arboric. Hortic. 1996, 28, 1611 65. (19) Torija, M. J.; Beltran, G.; Novo, M.; Poblet, M.; Rozes, N.; Mas, A.; Guillamon, J. M. Effect of organic acids and nitrogen source on alcoholic fermentation: study of their buffering capacity. J. Agric. Food Chem. 2003, 51, 916-922. (20) Lopez, R.; Aznar, M.; Cacho, J.; Ferreira, V. Determination of minor and trace volatile compounds in wine by solid-phase extraction and gas chromatography with mass spectrometric detection. J. Chromatogr. A 2002, 966, 167-177. (21) Ferreira, V.; Sharman, M.; Cacho, J.; Dennis, J. New and efficient microextraction/solid-phase extraction method for the gas chromatographic analysis of wine volatiles. J. Chromatogr. A 1996, 731, 247-259. (22) Sierkstra, L. N.; Verbakel, J. M.; Verrips, C. T. Analysis of transcription and translation of glycolytic enzymes in glucoselimited continuous cultures of Saccharomyces cereVisiae. J. Gen. Microbiol. 1992, 138, 2559-2566. (23) Sambrook, J.; Fritsch, E. F.; Maniatis, T. Methods in Yeast Genetics: A Laboratory Manual, 2 ed.; Cold Spring Harbor Laboratory: Cold Spring Harbor, New York, 1989. (24) Querol, A.; Barrio, E.; Ramon, D. A comparative study of different methods of yeast strain characterization. Syst. Appl. Microbiol. 1992, 21, 315-323. (25) Agenbach, W. A. A study of must nitrogen content in relation to incomplete fermentations, yeast production and fermentation. Proc. South Afr. Soc. Enol. Vitic. 1977, 87. (26) Jiranek, V.; Langridge, P.; Henschke, P. A. Amino acid and ammonium utilization by Saccharomyces cereVisiae wine yeasts from a chemical defined medium. Am. J. Enol. Vitic. 1995, 46, 75-83. (27) Manginot, C.; Roustan, J. L.; Sablayrolles, J. M. Nitrogen demand of different yeast strains during alcoholic fermentation. Importance of the stationary phase. Enzyme Microb. Technol. 1998, 23, 511-517. (28) Ough, C. S.; Huang, D. A.; Stevens, D. Amino acid uptake by four commercial yeasts at two different temperatures of growth and fermentation: Effects on urea excretion and readsorption. Am. J. Enol. Vitic. 1991, 41, 26-40. (29) Alexandre, H.; Rousseaux, I.; Charpentier, C. Relationship between ethanol tolerance, lipid composition and plasma membrane fluidity in Saccharomyces cereVisiae and Kloeckera apiculata. FEMS Microbiol. Lett. 1994, 124, 17-22. (30) Alexandre, H.; Rousseaux, I.; Charpentier, C. Ethanol adaptation mechanisms in Saccharomyces cereVisiae. Biotechnol. Appl. Biochem. 1994, 20, 173-183. (31) Gagiano, M.; Bauer, F. F.; Pretorius, I. S. The sensing of nutritional status and the relationship to filamentous growth in Saccharomyces cereVisiae. FEMS Yeast Res. 2002, 2, 433-470.
Seminario Tcnico
Textos asociados
49
(32) Pierce, J. S. The Margaret Jones Memorial Lecture: Amino acids in malting and brewing. J. Inst. Brew. 1982, 88, 228-233. (33) Forsberg, H.; Ljungdahl, P. O. Sensors of extracellular nutrients in Saccharomyces cereVisiae. Curr. Genet. 2001, 40, 91-109. (34) Regenberg, B.; During-Olsen, L.; Kielland-Brandt, M. C.; Holmberg, S. Substrate specificity and gene expression of the amino acid permeases in Saccharomyces cereVisiae. Curr. Genet. 1999, 36, 317-328. (35) Marini, A. M.; Soussi-Boudekou, S.; Vissers, S.; Andre, B. A family of ammonium transporters in Saccharomyces cereVisiae. Mol. Cell Biol. 1997, 17, 4282-4293. (36) Bakker, B. M.; Overkamp, K. M.; van Maris, A. J.; Kotter, P.; Luttik, M. A.; van Dijken, J. P.; Pronk, J. T. Stoichiometry and compartmentation of NADH metabolism in Saccharomyces cereVisiae. FEMS Microbiol. ReV. 2001, 25, 15-37.
(37) Radler, F.; Schutz, H. Glycerol production of various strains of Saccharomyces. Am. J. Enol. Vitic. 1982, 33, 36-40. (38) Watanabe, M.; Uehara, M.; Shinohara, T. Effect of cell number on the formation of glycerol and some volatile components by yeast. J. Brew. Soc. Jpn. 1982, 77, 346. (39) Albers, E.; Larsson, C.; Liden, G.; Niklasson, C.; Gustafsson, L. Influence of the nitrogen source on Saccharomyces cereVisiae anaerobic growth and product formation. Appl. EnViron. Microbiol. 1996, 62, 3187-3195. (40) Michnick, S.; Roustan, J. L.; Remize, F.; Barre, P.; Dequin, S. Modulation of glycerol and ethanol yields during alcoholic fermentation in Saccharomyces cereVisiae strains overexpressed or disrupted for GPD1 encoding glycerol 3-phosphate dehydrogenase. Yeast 1997, 13, 783-793. Received for review August 2, 2004. Revised manuscript received November 12, 2004. Accepted November 17, 2004.
50
Seminario Tcnico
Formacin de compuestos voltiles azufrados por levaduras vinicas.

Swigers, J. H.; Pretorius, I.S. Australian Wine Research Institute AWRI. El artculo ntegramente reproducido a continuacin se publico on line en Applied Microbiol Biotechnol en Enero de 2007.
1- Introduccin
El azufre es un elemento abundante en la naturaleza y presente en muchos compuestos. Puede presentarse en forma oxidada (sulfato) o reducida (sulfuro). El azufre es uno de los elementos ms importantes necesarios para la vida, particularmente como componente de los aminocidos cistena y metionina, y tambin es un componente de cofactores esenciales. Los microorganismos pueden metabolizar los compuestos de azufre a travs de dos rutas. En la ruta de reduccin asimilativa del azufre se toma sulfato y se utiliza para la biosntesis de compuestos orgnicos como la cistena y la metionina. En la ruta de reduccin disimilativa del sulfato, la molcula de sulfato se reduce como parte de una ruta respiratoria a sulfito o sulfuro. Ninguno de estos metabolitos se vuelve a metabolizar y la mayora se excreta (Kappler y Dahl 2001). La ruta anterior es realizada por bacterias reductoras de sulfato que estn ampliamente distribuidas en ambientes anaerbicos como el suelo, los sedimentos, agua de mar y agua dulce y en la boca e intestino de muchos animales (Purdy et al. 2002). Los microorganismos tambin son capaces de descomponer los aminocidos con azufre cistena y metionina para formar sulfuros y posteriormente otros compuestos voltiles de azufre y tioles (Dainty et al. 1989; Russell et al. 1995; Bonnarme et al. 2000; Seefeldt y Weimer 2000; Morales et al. 2005). La levadura de vino Saccharomyces cerevisiae es responsable de la produccin de varios compuestos voltiles de azufre que afectan a la calidad sensorial del vino. Estos importantes compuestos voltiles de azufre son: (1) sulfuro de hidrgeno (aroma a huevos podridos); (2) metanotiol (metilmercaptano; aroma a col cocida); (3) dimetilsulfuro, dimetildisulfuro y dimetiltrisulfuro (aromas a col, coliflor y ajo); (4) metiltioesteres (tioacetato de S-metilo, tiopropanato de S-metilo y tiobutanato de S-metilo; aromas a coliflor cocida, queso y cebolleta); y (5) los tioles voltiles afrutados del vino (aromas a maracuy, pomelo, grosella espinosa, guayaba y aromas a boje; Swiegers y Pretorius 2005; Swiegers et al. 2006). Durante la fermentacin del vino, la reduccin asimilativa de sulfato por la levadura (para biosintetizar cistena y metionina) puede producir un exceso de iones HS-, lo que genera la formacin H2S en el vino (Jiranek et al. 1995; Spiropoulos et al. 2000; Mendes- Ferreira et al. 2002; Swiegers et al. 2005a). Esto es probablemente uno de los problemas ms comunes en una bodega y, si no se trata, el vino resultante estar contaminado provocando una prdida de calidad y la posibilidad de que sea rechazado por los consumidores (Vos y Gray 1979; Henschke y Jiranek 1991; Rauhut 1993). Los vinos fermentados finalizados a menudo se tratan con sulfato de cobre con el fin de que reaccione con los compuestos de azufre para formar complejos estables y, por tanto, eliminar los efectos negativos del H2S y de los mercaptanos. No obstante no es deseable utilizar sulfato de cobre en el vino. La concentracin de H S producido durante Applied Microbiol Biotechnol, Enero de 2007 (on line)
Resumen
Los compuestos de azufre en el vino constituyen una espada de doble filo. Por una parte, ciertos compuestos voltiles que contienen azufre como el sulfuro de hidrgeno ofrecen un aroma similar a huevos podridos, por lo que pueden afectar negativamente a la calidad sensorial del vino pero, por otra parte, algunos compuestos de azufre como el 3-mercaptohexanol, que proporciona notas afrutadas, puede tener un impacto positivo sobre el sabor y el aroma del vino. Adems, estos compuestos se pueden volver ms o menos atractivos o repulsivos dependiendo de sus concentraciones absolutas y relativas. Por consiguiente es un desafo interesante que los vinicultores modulen las concentraciones de tales compuestos determinantes de la calidad del vino segn las preferencias de los consumidores. La levadura del vino, Saccharomyces cerevisiae, desempea un papel clave en la produccin de compuestos voltiles de azufre. A travs de la ruta de la secuencia de reduccin del sulfato se forma HS-, el cual puede conducir a la formacin de sulfuro de hidrgeno y diversos mercaptanos. Por tanto, limitar la formacin del in HS es un objetivo importante en la ingeniera metablica de esta levadura. La levadura del vino tambin es responsable de la transformacin de precursores de azufre no voltiles presentes en la uva, en tioles voltiles con propiedades aromatizantes. En particular, 4-mercapto-4-metilpentan-2-ona, 3-mercaptohexanol y acetato de 3-mercaptohexilo son los tioles voltiles ms importantes que aaden aromas afrutados al vino. El presente documento revisa brevemente el proceso metablico implicado en la produccin de importantes compuestos voltiles de azufre y las principales estrategias a la hora de conseguir desarrollar cepas de levaduras como herramienta para ajustar el aroma del vino a las especificaciones del mercado. Palabras clave: Aroma . Sabor . Bebidas fermentadas . Tioles . Vino . Levadura
Textos asociados
51
Formacin de compuestos voltiles azufrados por levaduras vinicas
la fermentacin del vino depende de varios factores como la presencia de compuestos de azufre, la cepa de la levadura, las condiciones de fermentacin y los nutrientes del zumo de uva (Henschke y Jiranek 1991; Rauhut 1993; Spiropoulos et al. 2000). No obstante, algunas cepas parecen producir H2S intrnsecamente sin que les afecten las condiciones ambientales, lo que posiblemente indica un defecto metablico (Jiranek et al. 1995; Spiropoulos et al. 2000; MendesFerreira et al. 2002). Por otra parte, las levaduras de vino pueden producir compuestos voltiles de azufre beneficiosos para la calidad del vino. Algunos de estos son el furfuriltiol, un compuesto identificado en el aroma del Pinot Manseng blanco, tintos de Burdeos, y en las duelas tostadas (Tominaga et al. 2000). El furfuriltiol es un aromatizante extremadamente potente (umbral de percepcin de 0,4 ng/l) y tambin se ha identificado en el caf tostado, la carne, el pan de trigo y en las palomitas de maz. Se cree que la levadura forma el furfuriltiol mediante la transformacin del furfural liberado durante la fermentacin a partir de las duelas de roble tostadas (Tominaga et al. 2000). Otros tioles voltiles que mejoran el aroma producidos por la levadura a partir de los precursores de la uva son el 4-mercapto-4-metilpentano- 2-ona (4MMP), el 3-mercaptohexan-1-ol (3MH) y el acetato de 3-mercaptohexilo (3MHA). Los tioles voltiles son extremadamente potentes y tienen umbrales de percepcin bajos: 0,8 ng/l (4MMP), 60 ng/l (3MH) y 4 ng/l (3MHA). En los Sauvignon Blanc, estos compuestos son de particular importancia para diversos caracteres dado que ofrecen aromas a boje (4MMP), maracuy, pomelo, grosella espinosa y guayaba (3MH y 3MHA; Tominaga et al. 1995, 1998a,b; Dubourdieu et al. 2006). No obstante, tambin se han identificado 4MMP, 3MH y 3MHA en distintas concentraciones en vinos elaborados a partir de uvas Colombard, Riesling, Semillon, Merlot y Cabernet Sauvignon, por lo que tambin podran afectar al aroma y la calidad de tales vinos (Tominaga et al. 1995, 1998a,b; Murat et al. 2001b). El desafo de la enologa moderna es limitar (o eliminar) la produccin de H2S y mercaptanos indeseables y, al mismo tiempo, mejorar la produccin de tioles voltiles beneficiosos. El uso de sulfato de cobre introduce un interesante dilema para el vinicultor, ya que es utilizado para tratar vinos contaminados con H2S y mercaptanos, pero al mismo tiempo reduce la concentracin de tioles voltiles deseables ya que el in Cu2+ no discrimina entre los dos tipos de compuestos de azufre. Por tanto, la mejor solucin yace en el desarrollo de levaduras que produzcan durante la fermentacin concentraciones absolutas y relativas de tioles voltiles que mejoren el aroma sin la formacin de H2S ni mercaptanos (Pretorius 2000; Pretorius y Bauer 2002). En el siguiente apartado de este documento se detallan los elementos metablicos de la
levadura del vino que resultan en la produccin de compuestos voltiles de azufre. Adems, se discuten los ltimos avances en la modificacin del metabolismo del azufre de la levadura del vino para mejorar el sabor y el aroma del vino.
2.- Mecanismo de formacin de azufre voltil 2.1 Formacin de sulfuro de hidrgeno a travs de la ruta de secuencia de reduccin de sulfato.
La levadura del vino puede formar metablicamente H2S a partir de compuestos inorgnicos de azufre como los sulfatos y sulfitos, as como de compuestos orgnicos como la cistena y el glutatin (Henschke y Jiranek 1993; Rauhut 1993; Hallinan et al. 1999; Spiropoulos et al. 2000). En general, la uva debe ser deficiente en compuestos orgnicos de azufre, ya que stos pueden activar la sntesis de tales compuestos de azufre a partir de fuentes inorgnicas habitualmente abundantes en el mosto (Henschke y Jiranek 1993; Park et al. 2000; Moreira et al. 2002). En la S. cerevisiae, H2S es el producto de la ruta de la secuencia de reduccin de sulfato (SRS) (Fig. 1; Yamagata 1989; Rauhut 1993). En la ruta SRS, el H2S procede del in HS-, un intermedio metablico de la reduccin del sulfato o sulfito necesario para la sntesis de compuestos orgnicos de azufre. Si durante la fermentacin estas reacciones se producen en presencia de un Fig. 1 Un diagrama que representa la ruta SRS y la biosntesis de aminocidos en S. cerevisiae. Adenosil 5-fosfosulfato (APS); 3-fosfoadenosil 5-fosfosulfato (PAPS); O-acetilserina (O-AS); O-acetlilhomoserina (O-AH)
52

aporte adecuado de nitrgeno, el in HS- es captado por la O-acetilserina y la O-acetilhomoserina, que son productos derivados del metabolismo del nitrgeno, para formar compuestos orgnicos de azufre como metionina y cistena (Henschke y Jiranek 1993; Park et al. 2000; Moreira et al. 2002). Sin embargo cuando las fuentes de nitrgeno son insuficiente o inadecuadas, el H2S puede acumularse en la clula y pasar al mosto en fermentacin por difusin (Vos y Gray 1979; Henschke y Jiranek 1991; Giudici y Kunkee 1994; Jiranek et al. 1995, 1996). Parece que, al menos parcialmente, la capacidad de produccin de H2S de una cepa determinada es gentica, ya que la produccin de H2S de diferentes cepas vara en las mismas condiciones (Thornton y Bunker 1989; Henschke y Jiranek 1993; Jiranek et al. 1995; Spiropoulos et al. 2000). El primer paso de la ruta metablica SRS implica el transporte del sulfato desde el medio hasta la clula de levadura mediante la sulfato permeasa. El sulfato se reduce a continuacin a sulfuro a travs de una serie de pasos que implican el uso de la enzima ATP-sulfurilasa (que emplea dos molculas de ATP) y de la sulfito reductasa. El siguiente paso conduce la captacin del sulfuro: la O-acetilserina (del aminocido serina) se combina con el sulfuro para formar cistena, y la O-acetilhomoserina (del aminocido aspartato) se combina con el sulfuro para formar homocistena, la cual se puede convertir en metionina (Thornton y Bunker 1989; Yamagata 1989; Henschke y Jiranek 1993; Rauhut 1993; Jiranek et al. 1995; Spiropoulos et al. 2000). Dado que las concentraciones de cistena y metionina en los zumos de uva habitualmente no son suficientes para cubrir las necesidades metablicas de las clulas en crecimiento, se activa la ruta metablica SRS para cubrir esta demanda (Henschke y Jiranek 1993). Cuando existe una cantidad adecuada de nitrgeno en el medio, existirn suficientes precursores de estos aminocidos (O-acetilserina y O-acetilhomoserina) para captar el sulfuro. Si la cantidad de nitrgeno es limitada, no habr suficientes precursores; la ruta SRS se activar y el sulfuro se acumular debido a la ausencia de precursores. El exceso de sulfuro se libera de las clulas en forma de H2S (Henschke y Jiranek 1993; Rauhut 1993; Jiranek et al. 1995; Spiropoulos et al. 2000). Algunas veces, se producen cantidades importantes de H2S cuando en el producto en fermentacin hay sulfito, el cual se difunde hacia las clulas. Por tanto, en condiciones de poco nitrgeno, se observa una produccin elevada y continua de H2S en presencia de sulfito (Jiranek et al. 1995; Hallinan et al. 1999). Otros factores ambientales que pueden afectar a la produccin de H2S son (1) niveles elevados de azufre elemental, (2) presencia de dixido de azufre, (3) presencia de compuestos orgnicos con azufre, (4) deficiencia de pantotenato, (5) alto contenido relativo de treonina con respecto a otros aminocido y (6) de metionina con respecto a la concentracin de amonio (Henschke y Jiranek 1991; Rauhut 1993; Spiropoulos et al. 2000). En un estudio se ha investigado recientemente el papel de la enzima bifuncional O-acetilserina/Oacetilhomoserina tiolasa como medio para modular la produccin de H2S por la levadura industrial (Spiropoulos y Bisson 2000). El estudio demostr que la sobreexpresin del gen MET17, que codifica la Oacetilserina/O-acetilhomoserina tiolasa, en una cepa de S. cerevisiae origin que se formara mucho menos H2S en un vino en fermentacin. Sin embargo esto no sucedi en otra cepa de S. cerevisiae con sobreexpresin de MET17, lo que indica que la actividad de la O-acetilserina/O-acetilhomoserina tiolasa no est directamente relacionada con la formacin de H2S (Spiropoulos y Bisson 2000). Se ha demostrado que la sobreexpresin de dos genes, el MET14, que codifica una adenosilfosfosulfato cinasa, y SSU1, que codifica un portador de sulfito, aumenta la formacin de sulfito (Donalies y Stahl 2002). Por tanto, se ha postulado que la ausencia del gen MET14 o del gen MRX1, que codifican una metionina sulfoxido reductasa, podra ser la manera ms eficaz de impedir que la levadura del vino produzca H2S durante la fermentacin (Pretorius 2000, 2003, 2004; Pretorius y Hj 2005). Otro mtodo para evitar la formacin de H2S fue la modificacin de la actividad de la enzima sulfito reductasa mediante la alteracin de una de las subunidades de la enzima (Sutherland et al. 2003). La sulfito reductasa es un heterotetrmero compuesto de dos subunidades y dos subunidades , las cuales son codificadas por los genes MET10 y MET5 respectivamente (Sutherland et al. 2003). La enzima, una hemoflavoprotena, enlaza los cofactores flavn adenina dinucletido, flavn mononucletido y sirohemo. Se introdujeron mutaciones en el gen MET10 de modo que la subunidad no se pudiera enlazar a los cofactores pero pudiera formar aun un complejo protenico heterotetrmetro con la subunidad . De este modo, la sobreexpresin del gen MET10 mutante producira una subunidad no funcional que podra reducir la proporcin de sulfito reductasa funcional en la clula, y por tanto reducir la formacin de sulfuro. Sin embargo, es necesario investigar ms para confirmar si esta estrategia es capaz de evitar la formacin de H2S en el vino en fermentacin. El H2S es muy reactivo y se puede combinar con otros componentes del vino para formar compuestos voltiles de azufre relacionados (Vermeulen et al. 2005). Por ejemplo, el etanotiol se puede formar por reaccin de H2S con etanol o acetaldehdo (Amerine et al. 1980; Rauhut 1993). En el vino, se piensa que la formacin de disulfuro de dimetilo, trisulfuro de dimetilo y tetrasulfuro de dimetilo se produce mediante la oxidacin del metanotiol, un compuesto que se con-
Seminario Tcnico
Textos asociados
53
sidera procedente de la descomposicin de la metionina (Rauhut 1993). La concentracin de disulfuro de dimetilo encontrada en algunos vinos est muy por encima del umbral sensorial de 25 g/l (vino blanco) y 60 g/l (vino tinto; Rauhut 1993). En bajas concentraciones, se considera que el disulfuro de dimetilo es un compuesto beneficioso que contribuye al aroma asociado al tiempo de maduracin en botella (Rauhut 1993; Ribreau-Gayon et al. 2000).
2.2. Formacin de tioles voltiles mediante la levadura a travs de carbono tiolasas

Se ha propuesto que la formacin de furfuriltiol a partir de furfural por la S. cerevisiae es catalizada por la enzima cistena desulfidrasa, la cual es necesaria para la produccin de cistena (Tominaga et al. 2000). Por tanto el anin HS- se produce a travs de esta enzima, originando la formacin de H2S. La formacin de H2S mejora a su vez la formacin de furfuriltiol a partir de furfural. Esto se ha confirmado al observar que el vino en fermentacin con una fuente aadida de nitrgeno (por tanto se inhibe la formacin de H2S) no produce tanto furfuriltiol. Por consiguiente, la produccin de furfuriltiol se vincula a la produccin del anin HS-, el cual no se produce cuando el sulfato de amonio se aade a un caldo en fermentacin en cantidades suficientes (Tominaga et al. 2000). Los tioles voltiles 4MMP, 3MH y 3MHA son prcticamente inexistentes en el zumo de uva y solamente se desarrollan durante la fermentacin (Fig. 2). No obstante, se ha demostrado que 4MMP y 3MH existen en la uva en forma de conjugados enlazados a la cistena no voltiles y que la levadura del vino es responsable de extraer el tiol del precursor (Darriet et al. 1995). Ciertos experimentos demuestran que una clula de un extracto de enzima libre de clula de la Eubacterium limosum (que contiene enzimas carbonotiolasa) podra liberar 4MMP de su precursor S-4-(4-metilpentan-2-ona)-Lcistena (Cis-4MMP) lo que indica que la presencia de un mecanismo similar de liberacin a travs de las carbono-tio-lasas de la levadura es ms probable durante la fermentacin del vino (Tominaga et al. 1995). La hiptesis de Tominaga et al. (1995) se comprob investigando la capacidad de la levadura de liberar 4MMP a partir de Cis-4MMP cuando se eliminan los genes que codifican las posibles carbonotio-lasas en una cepa de laboratorio de S. cerevisiae (Howell et al. 2005). Cuatro genes, identificados como responsables de las posibles enzimas carbonotiolasas, influyeron en la liberacin del tiol voltil 4MMP, lo que indica que el mecanismo de liberacin implica probablemente varios genes. Se eliminaron tambin los genes identificados en una variacin homocigosa de la levadura comercial VL3, y el resultado mostr que la eliminacin de los cuatro genes asociados a la carbonotio-lasa conduca a una disminucin de la cantidad de 4MMP liberado (Howell et al. 2005). En este
ltimo estudio no se observ que la sobreexpresin de estos genes produjera un aumento de la liberacin de 4MMP. No obstante, recientemente, nuestro grupo sobreexpres un gen heterolocigoso que codifica una enzima carbono-tio-lasa en una levadura comercial ampliamente utilizada (VIN13) y demostr como conclusin que, en vinos en fermentacin modelos, la cepa VIN13 modificada liberaba diez veces ms 4MMP y 3MH de sus precursores sintetizados qumicamente que la cepa control VIN13. Adems, el vino Sauvignon Blanc producido por la levadura modificada tuvo un muy potente aroma no detectado en el vino control. Por tanto, es posible modificar levaduras para utilizar ms precursores de tioles derivados de la uva y por tanto mejorar el aroma del vino (Swiegers et al. sin publicar). Se ha demostrado anteriormente que la cantidad liberada de 4MMP en el vino depende de qu cepa de levadura se utilice para llevar a cabo la fermentacin (Dubourdieu et al. 2006). Por tanto, la gentica y la fisiologa de la cepa determinan su capacidad para liberar tioles voltiles. Algunos estudios del primer trabajo indicaron que las cepas comercialmente disponibles de S. cerevisiae VL3 y EG8 liberan ms tioles que las cepas VL1 y 522d. Adems, las cepas de Saccharomyces bayanus liberan ms 4MMP que las cepas de S.cerevisiae VL3 y EG8. Los vinos confeccionados con cepas hbridas de S.bayanus/S. cerevisiae muestran un contenido superior de tioles voltiles (Murat et al. 2001b). Estos hallazgos se han confirmado al observar que diferentes cepas comerciales tienen capacidades diferentes de liberacin de 4MMP a partir del precursor Cis-4MMP en vinos modelo en fermentacin (Howell et al. 2004). Howell et al. (2004) han identificado cepas comerciales de levaduras que liberan an ms tioles que VL3. En un estudio de seguimiento, el Sauvignon Blanc producido por siete cepas diferentes de levadura del vino (VL3 entre ellas) mostr perfiles nicos de tioles voltiles, siendo la cepa VIN7 la que produjo mayor concentracin de 4MMP y 3MHA, mientras que VIN13 produjo mayores concentraciones de 3MH (Swiegers et al. 2006). Se ha demostrado que durante la fermentacin, el 3MHA se forma a partir del 3MH por la accin de la alcohol acetiltransferasa que forma steres y que es codificada por el gen ATF1 (Swiegers et al. 2005b). La sobreexpresin del gen ATF1 en la cepa de levadura VIN13 produjo un aumento significativo de la cantidad de 3MHA producido. Por otra parte, la sobreexpresin del gen IAH1, el cual codifica un enzima que descompone steres, produjo una reduccin en la concentracin de 3MHA. Tambin se investig la capacidad de diferentes levaduras comerciales para convertir 3MH en 3MHA durante la fermentacin. Se observaron grandes variaciones en la concentracin de 3MHA y, en la mayora de los casos, no correspondan con la capacidad de liberacin de 4MMP de las levaduras (Swiegers et al. 2005b). Por tanto, queda puesto de manifiesto que la seleccin de la cepa de levadura es de mxima importancia en la modulacin
54

de las concentraciones de tioles en el vino. Se ha demostrado que cuando disminuye la concentracin del precursor de tioles S-3- (hexan-1-ol)L-cisteina (Cis-3MH), aumenta la cantidad de 3MH durante la fermentacin. No obstante, solamente una pequea fraccin (1,6%) del precursor enlazado a la cistena presente originalmente se libera como 3MH (Dubourdieu et al. 2006). Adems en mostos Cabernet Sauvignon y Merlot, se ha observado que la cantidad de 3MH liberada era proporcional a la concentracin de Cis-3MH presente al inicio de la fermentacin. Por tanto, cuanto mayor es la concentracin de precursores de tioles conjugados a la cistena en el mosto, mayor es la concentracin de tioles voltiles en el vino resultante (Murat et al. 2001a). No obstante, en el estudio anterior, solamente el 3,2% del precursor presente originalmente en el mosto se liber en forma de tioles voltiles durante la fermentacin. Recientemente se ha determinado el impacto de la temperatura de fermentacin sobre la concentracin de tioles voltiles en un medio modelo y en zumo de uva. Se demostr que las concentraciones de 4MMP, 3MH y 3MHA fueron mayores cuando se produjo la fermentacin alcohlica a 20 C con respecto a 13C, independientemente de la cepa utilizada (Masneuf Pomarde et al. 2006). Por el contrario, Swiegers et al. (2006) ha demostrado que en vinos en fermentacin modelos, se libera ms 4MMP y ms 3MH se convierte en 3MHA a bajas temperaturas (18C) en comparacin con altas temperaturas (23 y 28 C) al final de la fermentacin. No obstante, al principio de la fermentacin, hay ms tioles voltiles en los caldos en fermentacin ms calientes (Swiegers et al. 2006).
Seminario Tcnico
3. Conclusin
El objetivo final de todo vinicultor es conseguir un vino con unas caractersticas ptimas de calidad, precio y apariencia al consumidor (Pretorius 2006). Para lograr este objetivo, es necesario un control exhaustivo del mtodo de produccin, de las condiciones de fermentacin, de la eleccin de la cepa de levadura y de la produccin de componentes que afectan favorablemente a la calidad organolptica del vino. Los compuestos voltiles de azufre son aromatizantes y saborizantes potentes que pueden tener un efecto
Fig. 2 El vino es una mezcla muy compleja de compuestos derivados de la uva, de los microorganismo y, en algunos casos, del roble, que definen en gran medida su apariencia, aroma, sabor y sensaciones en el paladar (Swiegers et al. 2005). Los compuestos derivados de la uva distinguen al vino por su variedad y lo dotan de su estructura bsica. La fermentacin de los azcares por parte de las levaduras no slo produce etanol y dixido de carbono, sino que tambin una gama de metabolitos menores pero importantes organolpticamente que proporcionan el carcter del vino. Estos metabolitos voltiles que son steres, alcoholes superiores, carbonilos, cidos grasos voltiles y compuestos de azufre, son derivados del metabolismo de los azcares y de los aminocidos. Los tioles voltiles, particularmente 4MMP, 3MH y 3MHA, contribuyen de manera importante al aroma de los vinos, particularmente en variedades como la Sauvignon Blanc. Durante la fermentacin del vino, la S. cerevisiae favorece la divisin de precursores no voltiles con cistena (Cis-4MMP y Cis-3MH) existente el zumo de uva para liberar 4MMP y 3MH. La ausencia de tioles voltiles en la uva indica la importancia de la fermentacin de la levadura para su formacin (Swiegers et al. 2006)
Textos asociados
55
considerable sobre la calidad del vino. Las levaduras de vino son las principales generadoras de compuestos voltiles de azufre, los cuales son producidos a partir de fuentes de azufre y precursores derivados de las uvas (y en algunos casos por productos aadidos por el vinicultor, e.g., SO2). A da de hoy se han conseguido avances significativos para dilucidar las rutas metablicas responsables de la formacin de compuestos voltiles de azufre. Este conocimiento se est utilizando actualmente para desarrollar cepas de levaduras de vino que: (1) produzcan nada o mucho menos sulfuro de hidrgeno y mercaptanos asociados y (2) tengan una mayor capacidad de producir compuestos voltiles de azufre deseables que aporten aromas afrutados al vino. En algunos casos, se ha aplicado ingeniera gentica con el objetivo de evaluar la viabilidad del diseo de tales cepas para lograr los resultados deseados. Si bien los consumidores actuales son an muy resistentes a consumir bebidas producidas por microorganismos modificados genticamente, la reciente comercializacin de una levadura genticamente modificada en la industria vitivincola norteamericana podra indicar la aceptacin gradual de esta tecnologa (Husnik et al.2006). No obstante, aunque en el futuro cercano no se utilice para producir vino co-
mercial ninguna de estas levaduras genticamente modificadas con metabolismos del azufre alterados, sirven como modelos y prototipos tiles para aportar ms informacin que podra aplicarse para desarrollar cepas no modificadas genticamente utilizando tcnicas ms convencionales (por ejemplo, mutagnesis, hibridacin y evolucin adaptativa). Por tanto, existe un gran consenso sobre la posibilidad de confeccionar a medida levaduras de vino sin acudir a ingeniera gentica. Sin embargo, para personalizar levaduras no modificadas genticamente con el fin de que los vinicultores ajusten las concentraciones de compuestos que determinan la calidad del vino, el conocimiento fundamental requerido continuar generndose ampliamente a partir de informacin obtenida mediante cepas prototipo modificadas genticamente. Agradecimientos: la investigacin en el Australian Wine Research Institute (Instituto de Investigacin Enolgica de Australia) es posible gracias al apoyo de viticultores y vinicultores australianos a travs de su organismo inversor, la Grape y Wine Research Development Corporation, la cual financia segn una metodologa matching funds junto al Gobierno australiano.
Referencias
Amerine MA, Berg HV, Kunkee RE, Ough CS, Singleton VL, Webb AD (1980) The technology of winemaking, 4th edn. AVI Technical Books, Westport, CT Bonnarme P, Psoni L, Spinnler HE (2000) Diversity of L-methionine catabolism pathways in cheese-ripening bacteria. Appl Environ Microbiol 66:55145517 Dainty RH, Edwards RA, Hibbard CM, Marnewick JJ (1989) Volatile compounds associated with microbial growth on normal and high pH beef stored at chill temperatures. J Appl Bacteriol 66:281289 Darriet P, Tominaga T, Lavigne V, Boidron J, Dubourdieu D (1995) Identification of a powerful aromatic compound of Vitis vinifera L. var. Sauvignon wines: 4-mercapto-4-methylpentan-2-one. Flavour Fragr J 10:385392 Donalies UEB, Stahl U (2002) Increasing sulfite formation in Saccharomyces cerevisiae by overexpression of MET14 and SSU1. Yeast 19:475484 Dubourdieu D, Tominaga T, Masneuf I, Peyrot des Gachons C, Murat ML (2006) The role of yeasts in grape flavor development during fermentation: the example of Sauvignon Blanc. Am J Enol Vitic 57:8188 Giudici P, Kunkee RE (1994) The effect of nitrogen deficiency and sulfur-containing amino acids on the reduction of sulfate to hydrogen sulfide by wine yeasts. Am J Enol Vitic 45:107112 Hallinan CP, Saul DJ, Jiranek V (1999) Differential utilization of sulfur compounds for H2S liberation by nitrogen-starved wine yeast. Austral J Grape Wine Res 5:8290 Henschke PA, Jiranek V (1991) Hydrogen sulfide formation during fermentation: effect of nitrogen composition in model grape must. Proceedings of the international symposium on nitrogen in grapes and wine, Seattle, USA. American Society for Enology and Viticulture, Davis, CA, pp 172184 Henschke PA, Jiranek V (1993) Yeastgrowth during fermentation. In: Fleet GH (ed) Wine microbiology and biotechnology. Harwood Academic, Chur, Switzerland, pp 2754 Howell KS, Swiegers JH, Elsey GM, Siebert TE, Bartowsky EJ, Fleet GH, Pretorius IS, de Barros Lopes MA (2004) Variation in 4-mercapto-4-methyl-pentan2-one release by Saccharomyces cerevisiae commercial wine strains. FEMS Microbiol Lett 240:125129
56

Howell KS, Klein M, Swiegers JH, Hayasaka Y, Elsey GM, Fleet GH, Hj PB, Pretorius IS, de Barros Lopes MA (2005) Genetic determinants of volatile thiol release by Saccharomyces cerevisiae during wine fermentation. Appl Environ Microbiol 71:54205426 Husnik JI, Volschenk H, Bauer J, Colavizza D, Luo Z, van Vuuren HJ (2006) Metabolic engineering of malolactic wine yeast. Metab Eng 8(4):315323 Jiranek V, Langridge P, Henschke PA (1995) Validation of bismuthcontaining indicator media for predicting H2S producing potential of Saccharomyces cerevisiae wine yeasts under enological conditions. Am J Enol Vitic 46:269273 Jiranek V, Langridge P, Henschke PA (1996) Determination of sulphite reductase activity and its response to assimilable nitrogen status in a commercial Saccharomyces cerevisiae wine yeast. J Appl Bacteriol 81:329336 Kappler U, Dahl C (2001) Enzymology and molecular biology of prokaryotic sulfite oxidation. FEMS Microbiol Lett 203:19 Masneuf-Pomarde I, Le Jeune C, Durrens P, Lollier M, Aigle M, Dubourdieu D (2006) Influence of fermentation temperature on volatile thiols concentrations in Sauvignon blanc wines. Int J Food Microbiol 108:385390 Mendes-Ferreira A, Mendes-Faia A, Leao C (2002) Survey of hydrogen sulphide production by wine yeasts. J Food Prot 65:10331037 Morales P, Fernandez-Garcia E, Nunez M (2005) Volatile compounds produced in cheese by Pseudomonas strains of dairy origin belonging to six different species. J Agric Food Chem 53:68356843 Moreira N, Mendes F, Pereira O, Guedes de Pinho P, Hogg T, Vasconcelos I (2002) Volatile sulphur compounds in wines related to yeast metabolism and nitrogen composition of grape musts. Anal Chim Acta 458:157167 Murat ML, Masneuf I, Darriet P, Lavigne V, Tominaga T, Dubourdieu D (2001a) Effect of Saccharomyces cerevisiae yeast strains on the liberation of volatile thiols in Sauvignon Blanc wine. Am J Enol Vitic 52:136139 Murat ML, Tominaga T, Dubourdieu D (2001b) Assessing the aromatic potential of Cabernet Sauvignon and Merlot musts used to produce rose wine by assaying the cysteinylated precursor of 3-mercaptohexan1-ol. J Agric Food Chem 49:54125417 Park SK, Boulton RB, Noble AC (2000) Formation of hydrogen sulfide and glutathione during fermentation of white grape musts. Am J Enol Vitic 51:9197 Pretorius IS (2000) Tailoring wine yeast for the new millennium: novel approaches to the ancient art of winemaking. Yeast 16:675729 Pretorius IS (2003) The genetic analysis and tailoring of wine yeasts. In: de Winde JH (ed) Genetics and genomics of industrial yeasts. Springer, Berlin Heidelberg New York, pp 99134 Pretorius IS (2004) The genetic improvement of wine yeasts. In: Arora DK, Bridge PD, Bhatnagar (eds) Handbook of fungal biotechnology. Marcel Dekker, New York, USA, pp 183223 Pretorius IS (2006) Grape and wine biotechnology: setting new goals for the design of improved grapevines, wine yeast and malolactic bacteria. In: Hui HY, Barta J, Cano MP, Gusek T, Sidhu JS, Sinha N (eds) Handbook of fruits processing science and technology. Blackwell, Ames, IA, USA, pp 453489 Pretorius IS, Bauer FF (2002) Meeting the consumer challenge through genetically customized wine-yeast strains. Trends Biotechnol 20:426432 Pretorius IS, Hj PB (2005) Grape and wine biotechnology: challenges, opportunities and potential benefits. Austral J Grape Wine Res 11:83108 Purdy KJ, Embley TM, Nedwell DB (2002) The distribution and activity of sulphate reducing bacteria in estuarine and coastal marine sediments. Antonie Van Leeuwenhoek 81:181187 Rauhut D (1993) Yeastsproduction of sulfur compounds. In: Fleet GH (ed) Wine microbiology and biotechnology. Harwood Academic, Chur, Switzerland, pp 183223 Ribreau-Gayon P, Dubourdieu D, Donche B, Lonvaud A (2000) Handbook of Enology, vol 1: the microbiology of wines and vinification. Wiley, Chichester, UK, p 454 Russell SM, Fletcher DL, Cox NA (1995) Spoilage bacteria of freshbroiler chicken carcasses. Poult Sci 74:20412047 Seefeldt KE, Weimer BC (2000) Diversity of sulfur compound production in lactic acid bacteria. J Dairy Sci 83:27402746 Spiropoulos A, Bisson LF (2000) MET17 and hydrogen sulfide formation in Saccharomycescerevisiae. Appl Environ Microbiol 66:44214426
Seminario Tcnico
Textos asociados
57
Captulo
Spiropoulos A, Tanaka J, Flerianos I, Bisson LF (2000) Characterization of hydrogen sulfide formation in commercial and natural wine isolates of Saccharomyces. Am J Enol Vitic 51:233248 Swiegers JH, Pretorius IS (2005) Yeast modulation of wine flavour. Adv Appl Microbiol 57:131175 Swiegers JH, Bartowsky EJ, Henschke PA, Pretorius IS (2005a) Yeast and bacterial modulation of wine aroma and flavour. Austral J Grape Wine Res 11:139173 Swiegers JH, Willmott R, Hill-Ling A, Capone DL, Pardon KH, Elsey GM, Howell KS, de Barros Lopes MA, Sefton MA, Lilly M, Pretorius IS (2005b) Modulation of volatile thiol and ester aromas in wine by modified wine yeast. Proceedings of the Weurman flavour research symposium, Roskilde, Denmark, 21 24 June 2005, Developments in Food Science, Elsevier, Amsterdam, The Netherlands Swiegers JH, Francis IL, Herderich MJ, Pretorius IS (2006) Meeting consumer expectations through management in vineyard and winery: the choice of yeast for fermentation offers great potential to adjust the aroma of Sauvignon Blanc wine. Austral NZ Wine Ind J 21:3442 Sutherland CM, Henschke PA, Langridge P, de Barros Lopes M (2003) Subunit and cofactor binding of Saccharomyces cerevisiae sulfite reductasetowards developing wine yeast with lowered ability to produce hydrogen sulfide. Austral J Grape Wine Res 9:186193
Thornton RJ, Bunker A (1989) Characterisation of wine yeasts for genetically modifiable properties. J Inst Brew 95:181184 Tominaga T, Masneuf I, Dubourdieu D (1995) A Scysteine conjugate, precursor of aroma of white sauvignon. J Int Sci Vigne Vin 29:227232 Tominaga T, Peyrot des Gachons C, Dubourdieu D (1998a) A new type of flavour precursors in Vitis vinifera L. cv. Sauvignon Blanc: S-cysteine conjugates. J Agric Food Chem 46:52155219 Tominaga T, Furrer A, Henry R, Dubourdieu D (1998b) Identification of new volatile thiols in the aroma of Vitis vinifera L. var. Sauvignon Blanc wines. Flavour Fragr J 13:159162 Tominaga T, Blanchard L, Darriet P, Dubourdieu D (2000). A powerful aromatic volatile thiol, 2-furanmethanethiol, exhibiting roast coffee aroma in wines made from several Vitis vinifera grape varieties. J Agric Food Chem 48:17991802 Vermeulen C, Gijs L, Collin S (2005) Sensorial contribution and formation pathways of thiols in foods: a review. Food Rev Int 21:69137 Vos PJA, Gray RS (1979) The origin and control of hydrogen sulphide during fermentation of grape must. Am J Enol Vitic 30:187197 Yamagata S (1989) Roles of O-acetyl-L-homoserine sulfhydrylases in micro-organisms. Biochimie 71:11251143
58
Seminario Tcnico
Una revolucin en el sector enlogico: Levaduras de vinificacin que no producen Sulfuro de hidrgeno (H2S)
Cordente, T.; Swiegers, H.; (Australian Wine Research Institute AWRI), Heinrich, A.; (Mauri Yeast Australia) El artculo ntegramente reproducido a continuacin se publico por primera vez en la revista The Australian and New Zealand Grapegrover ans Winemaker Magazine en noviembre de 2007. Publicado con el permiso de la citada revista . Las cepas de levadura descritas en este artculo como su correspondiente proceso de desarrollo estn pendientes de patente.
manteniendo a la vez una excelente capacidad de fermentacin? El Instituto de Investigacin Vitivincola de Australia (AWRI) ha desarrollado, en colaboracin con la Sociedad Mauri Yeast Australia, nuevas cepas de levadura que producen cantidades indetectables de H2S. Estas levaduras son Advantage, Platinum y Distinction.
Cmo han sido desarrolladas ests levaduras de baja produccin de H2S?

Para el desarrollo de estas cepas, el AWRI ha utilizado mtodos biolgicos clsicos (no OGM). La cepa Maurivin PDM era la cepa parental ideal, dada la popularidad de la que goza entre los elaboradores a nivel internacional. El objetivo radicaba en adaptar la cepa de manera que sta realzara sus propiedades favorables, es decir su capacidad en no producir cantidades detectables de H2S y a partir de ella se han obtenido las cepas cuyos ensayos se exponen a continuacin. Estas cepas, pendientes de patente, estn clasificadas como no OGM en todos los pases vitivincolas del mundo.
Probar las cepas en mostos empobrecidos en nitrgeno asimilable

Las cepas seleccionadas se probaron en mostos que contenan bajas cantidades de nitrgeno asimilable (100 mg. N/L). No se aadi ningn aporte en DAP durante el proceso de fermentacin. Las fermentaciones de laboratorio se realizaron a 18 C, por triplicado, con una concentracin inicial en azcar de 240 gr./lt. (aproximadamente 13.5 B). Unas cintas reactivas (tipo Fluka) extremadamente sensibles al H2S fueron insertadas en cada frasco con el fin de poner en evidencia la produccin de H2S; las cintas blancas, indicaban la ausencia de liberacin de H2S. Las cintas de color marrn indicaban, por otra parte, una presencia de H2S en cantidades indetectables para el olfato humano. Las cintas negras indicaban en cambio una presencia de H2S ms all del lmite perceptible por el olfato humano an que en un nivel de concentracin no perjudicial para la calidad del vino. Al finalizar la fermentacin, las cintas reactivas sumergidas en las muestras que contenan Advantage y Distinction se quedaron blancas o de color muy claro Platinum (Figura 1) Este resultado confirm que estas cepas no producan cantidades detectables de H2S, incluso en presencia de cantidades muy bajas de nitrgeno asimilable. El patrn , Maurivin PDM, quedo claramente coloreado. Conviene destacar que en los mostos que contenan cantidades suficientes de nitrgeno asimilable, Maurivin PDM no produjo nada de H2S. The Australian and New Zealand Grapegrover ans Winemaker Magazine, noviembre de 2007
Introduccin
La produccin excesiva de Sulfuro de Hidrgeno (H2S) que tiene lugar en el transcurso del proceso de fermentacin del mosto constituye un problema bastante comn en lo que a vinificacin se refiere (Monk 1986; Henschke and Jiranek 1991). El principal motivo de ello radica en la baja concentracin de elementos nitrogenados en el medio. Con el objeto de paliar este problema, los enologos pueden, en el transcurso del proceso de fermentacin, aumentar el grado de nitrgeno en el mosto, aadindole fosfato diamnico (DAP) o utilizando sulfato de cobre despus de la fermentacin con el fin de suprimir el H2S del vino. Pero a pesar del aporte en DAP, la levadura sigue produciendo H2S en algunos medios y todo ello sin hablar del hecho de que la mayora de los enlogos preferira no tener que recurrir al uso del sulfato de cobre. Los vinos que contienen H2S desprenden un olor desagradable (a huevo podrido), pero adems, debido a su olor, el H2S, no solo reduce las cualidades organolpticas del vino sino tambin oculta las notas aromticas favorables de ste. Cabra imaginar que en el futuro podamos llevar a cabo una fermentacin con levaduras de vinificacin que no produzcan H2S detectable sea cual sea el contenido en nitrgeno asimilable del medio y sin ningn aporte en DAP? Por otro lado, Estas cepas de levadura seran capaces de realzar aromas favorecedores
Textos asociados
59
Una revolucin en el sector enlogico: Levaduras de vinificacin que no producen Sulfuro de hidrgeno
Estos resultados demuestran que estas tres cepas Advantage, Platinum y Distinction, fermentan mostos empobrecidos en nitrgeno asimilable sin producir cantidades de H2S detectables por la nariz humana. Asimismo, estas tres cepas de levadura presentan cinticas de fermentacin comparables con las de la cepa de levadura PDM, conocida por su robustez (Tabla 1, Figura 2).
cantidad de H2S que sobrepasaba el lmite de la percepcin sensorial. Las catas llevadas a cabo al finalizar el anlisis demostraron que los vinos presentaban caractersticas sensoriales positivas. Adems, las cepas revelaron unas cinticas de fermentacin comparables a la obtenida con la cepa Maurivin PDM .
Y en condiciones reales de vinificacin

Las cepas han sido probadas en condiciones reales de vinificacin con el fin de reflejar su aptitud en las condiciones ambientales propias al vino. Se someti a prueba un mosto de Chardonnay con una concentracin de azcar de 190 gr./lt. Y, al igual que en la prueba anterior, no se aadi DAP en todo el transcurso del proceso de fermentacin. Utilizando condiciones de fermentacin similares a las anteriormente descritas, la fermentacin se llev a cabo a una temperatura de 15 C y, de la misma manera, los grados de fermentacin obtenidos fueron similares a los obtenidos con la cepa testigo de referencia (Maurivin PDM). Las cintas reactivas de todos los mostos de Chardonnay fermentados con las tres nuevas cepas se quedaron blancas. Hecho que confirma que, sin ningn aporte en DAP estas cepas no producen H2S con la variedad Chardonnay. Las catas tampoco revelaron presencia alguna de H2S. Los catadores indicaron la presencia de notas afrutadas, dada la ausencia de notas azufradas. Estas cepas de levadura presentan pues con la variedad Chardonnay, unas capacidades de fermentacin indudables; y por este motivo fueron sometidas a prueba otras variedades con el fin de confirmar dicha aptitud fermentara.
En resumen
La produccin de H2S es perjudicial para la produccin de vinos de calidad. Felizmente, hoy en da, existen cepas de levaduras llamadas Advantage, Platinum Distinction.. Estas cepas se adaptan especialmente a los mostos que, empobrecidos en nitrgeno, evitan la produccin de H2S. Por lo general se trata de cepas polivalentes que permiten la fermentacin de una amplia gama de variedades a la vez que una produccin de vinos de calidad con caractersticas sensoriales considerablemente mejoradas. Adems, al no tener que recurrir al DAP (o emplearlo en cantidades inferiores) se facilita as el procesos de vinificacin.
Agradecimientos
Los autores dan las gracias al Dr. Nick Yap, al Dr. Dan Johnson y al Profesor Sakkie Pretorius por su valiosa colaboracin a lo largo de todo este proyecto as como por la crtica constructiva que hicieron de este artculo. El Dr. Toni Cordente se ha beneficiado del apoyo econmico del grupo AB Mauri. El Dr.Hentie Swiegers es investigador en el Instituto de Investigacin Vitivincola de Autralia, subvencionado por la asociacin de los vinificadores y viticultores Australianos a travs de su organismo de inversin: la sociedad de Desarrollo de la Investigacin sobre Uva y Vino as como por los fondos del gobierno de Australia.
Resultados obtenidos con la variedad Sauvignon Blanc

A lo largo de este estudio, se uso un mosto de Sauvignon Blanc para llevar a cabo la fermentacin, con el objetivo de marcar ms las diferencias sensoriales usando una variedad aromtica. El mosto presentaba las caractersticas analticas siguientes: 190 gr./lt. de azcar, pH 3.3, acidez total de 5.1 gr./lt. Las fermentaciones se realizaron a una temperatura 18C. Las cintas reactivas confirmaron de nuevo que en ausencia de cualquier aporte de DAP las cepas Advantage, Distinction y Platinum no producan H2S mientras que en el mismo tiempo, la cepa testigo produca una
Referencias
Monk, P.R. Formation, utilization and excretion of hydrogen sulfide by wine yeast. (1986) Wine Industry Journal, Noviembre 10-16. Henschke PA, Jiranek V (1991) Hydrogen sulfide formation during fermentation: effect of nitrogen composition in model grape must. Proceedings of the international symposium on nitrogen in grapes and wine, Seattle, USA. American Society for Enology and Viticulture, Davis, CA, Pg.172184
60

Tabla 1. Anlisis qumicos de los vinos PDM Azcar residual (Fructosa) gr./lt. Glicerol gr./lt. cido actico gr./lt. Etanol % Das de fermentacin (<2 gr./lt.) 1.7 4.8 0.28 11.4 17 Advantage 1.2 5.8 0.35 11.3 19 Platinum 0.2 5.2 0.06 11.3 12 Distinction 0 5.3 0.20 11.5 12
Seminario Tcnico
Figura 1. Cintas reactivas cuyo color negro indica la presencia de pequeas cantidades de H2S
Figura 2. Cintica de fermentacin de distintas cepas de levadura
Textos asociados
61
62
Seminario Tcnico
Nitrogen management is critical for wine Managing Director, flavour and style
Ugliano, M.; Henschke, P.A.; Herderich, M.J.; Pretorius, I.S. The Australian Wine Research Institute, PO Box 197, Glen Osmond (Adelaide), South Australia 5064, Australia Winemaking begins in the vineyard is a mantra that has widespread support amongst winemakers. It conveys the concept of vineyard or, in French jargon, terroir as an intrinsic property of grape, and consequently the corresponding wine. There is no doubt that many great wines are associated with great vineyards. So, where do yeast fi t in? The perception that fermentation yeast faithfully transform grape must into wine has been changing in the detail over the past decades. This is a result of science uncovering the many roles that yeast perform, and the wider selection of strains available that promote these various attributes. For example, whereas most strains produce a relatively similar, generic, fermentation bouquet only some strains possess a strong ability to hydrolyse cysteine conjugates responsible for Sauvignon Blanc character, meaning that only selected strains can enhance varietal expression (Swiegers et al. 2006). Winemakers today have many options through fermentation management to enhance the varietal characteristics of their wine, or to express further regional attributes. Furthermore, yeast strongly respond to their environment. It is well known that temperature aff ects the rate of fermentation, that grape solids enhance survival and that high osmotic stress, as imposed by a Botrytis-aff ected must, leads not only to increased glycerol production but also to higher volatile acidity. The latter example highlights the remarkable ability of yeast to adapt to stressful (i.e. high sugar) environments. However, there is an accompanying metabolic adaptation which can have positive or negative fl avour implications. At the time of inoculation, yeast are subjected to a range of stresses to which the cell must adapt in order to exploit its new environment. Some of the known stresses are osmotic pressure, oxidative conditions,
sulphite toxicity and temperature shock (Bauer and Pretorius 2000). Nutrients, whether present in sub- or super-optimal concentration, can also induce stress and metabolic responses. The primary response is aimed at protecting the cell from committing to reproduction when key nutrients are lacking or dealing with potential toxicity when the concentration is outside the normal range. The metabolic response often involves a cascade of biochemical reactions, some of which can lead to altered metabolism of nutrients such that the yeast will secrete end-products in diff erent amounts (Albers et al. 1998). Some of the end products that have sensory properties can lead to changes in the fl avour profi le of the wine. H2S formation is an all-too-well known example relating to nitrogen depletion stress. Clearly, the vineyard environment and intervention by the viticulturist shape the development of the vine and especially the composition of the grape. Because the viticulturist attempts to balance a long list of priorities in order to produce fruit to specifi cation, most attention will focus on those factors that cannot be modifi ed once the fruit has been harvested. Therefore, yeast nutrients, especially nitrogen, might not be optimised for fermentation, largely in the belief that nutrients can be easily corrected in the winery. Given that we estimate that up to 500t of diammonium phosphate (DAP) could be used each year to produce Australian wine, is this winemaking input being used eff ectively? Our current state of knowledge on the implications of controlling vineyard nitrogen as opposed to fermentation nitrogen on fermentation performance and wine composition has been recently reviewed by Bell and Henschke (2005). In this article, we will focus on the role that fermentation nitrogen has in modulating metabolism and some of the changes that this can have on wine fl avour. We will fi rst summarise current best practice for managing fermentation nitrogen and then describe the main fl avour changes that are aff ected by nitrogen. Finally, we will consider the fl avour implications of nitrogen for white and red wine fermentations.
CURRENT BEST PRACTICE FOR MANAGING FERMENTATION NITROGEN

A common practice amongst winemakers is to make a standard addition of DAP to the juice or must (100300mg/L) at inoculation without measuring the nitrogen concentration. This article will show that DAP addition has signifi cant fl avour consequences and that measuring the initial nitrogen concentration provides the opportunity to adjust DAP addition not only to achieve an adequate fermentation rate, but also to more reliably guide the fl avour profi le and style of wine required. This work is still in a conceptual stage
Wine Industry Journal > Vol 22 No 6 > November / December 2007
Textos asociados
63
based on studies with Chardonnay and Shiraz; however, it should stimulate winemakers to experiment with these and other varieties.
1.1 Measuring YAN

Grapes contain a variety of nitrogenous compounds of which the most important are the primary or alpha amino acids, ammonium ion and small peptides. Proline, a dominant secondary amino acid in many grape varieties, cannot be assimilated under anaerobic conditions (Ingledew et al. 1987). These nitrogenous compounds, excluding proline, constitute what is commonly referred to as yeast assimilable nitrogen (YAN). Because amino acids are chemicallydiverse molecules, the most convenient measure of assimilable nitrogen relates to assaying the free or alpha-amino group of the primary amino acids, which is commonly referred to as free amino nitrogen (FAN). Proline, a secondary amino acid, and protein are excluded in FAN assay methods. Of the several chemical, enzymatic and physical methods available (Shively and HenickKling 2001; Bell and Henschke 2005; Filipe-Ribereiro and Mendes-Faia 2007) the method of choice is the o-phthaldialdehyde/N-acetyl-L-cysteine (NOPA) method (Dukes and Butzke 1998). An additional enzymatic method is needed to determine ammonia, of which 82% is nitrogen. Summation of these two nitro-
gen measurements yields YAN (Figure 1). This procedure is used by NATA-accredited laboratories such as AWRIs Analytical Service laboratory (http://www.awri. com.au/analytical_ service/analyses/yeast_assimilable_ nitrogen/), which can provide a timely service during vintage. The so-called Formol Titration is a simpler, rapid method for measuring YAN (Shively and Henick-Kling 2001; Gump et al. 2002; Filipe-Ribereiro and MendesFaia 2005), although the use of formaldehyde, a toxic volatile reagent, requires a well-trained analyst and suitable laboratory. YAN determination with midinfrared (MIR) spectrometry, which is most rapid, has recently been developed by the AWRI (Dambergs et al. 2005). YAN measurements, ideally, should be performed directly on juice or must samples at the point of inoculation to avoid over-estimation due to processing losses which inevitably occur between vineyard and the fermentor. Furthermore, juice samples taken from grape musts can under-estimate total berry YAN due to an important proportion of amino acid contained in the grape skin. Refer to the review by Bell and Henschke (2005) for a detailed discussion of these points. Nevertheless, an early warning for low YAN can be achieved by sampling in the vineyard one to two weeks prior to harvest, such as during maturity sampling.
1.2 Supplementing must YAN

The YAN content of Australian grape juices varies widely from approximately 50-350mg/L, with a mean value of around 200mg/L. As a benchmark, it is generally agreed that maximum yeast biomass yield and fermentation rate results when YAN exceeds 400mg/L, whereas 150mg/L YAN marks a transition zone, below which the risk of slow or stuck fermentation notably increases (Henschke and Jiranek 1993; Blateyron et al. 2003). Since much of the background research work to establish these benchmarks has been carried out in synthetic and fi ltered grape juices, this risk value is technically only valid for highly clarifi ed, anaerobic, juice fermentations. Nonetheless, it represents a worst-case scenario and is a useful guide for other types of fermentation. In general, in order to achieve an adequate rate of fermentation to dryness, a cellar bright juice containing <150mg/L YAN should be supplemented with nitrogen to at least 150-200mg/L when the respective vineyard has a history of low YAN fermentation problems or a high nitrogen-demanding yeast has been selected. Nitrogen supplementation should be increased to the higher end of the range for higher Brix juices, whereas juices containing grape solids, or fermentations that are aerated, are less susceptible to low YAN diffi culties (Ribreau-Gayon et al. 2000; Blateyron et al. 2003; Eglinton et al. 2005). Later on in this
Figure 1. Summation of free amino nitrogen and ammonia nitrogen levels provides a useful estimate of the yeast assimilable nitrogen level.
64

article, when we consider the fl avour consequences of juice YAN content, some winemakers might choose to supplement low YAN juices up to a fi nal concentration of 250-300mg/L YAN so as to produce a cleaner, fruitier style. DAP is widely used as a YAN supplement for this purpose. DAP contains 21% N, therefore, for convenience we can consider 100mg DAP to contain 20mg YAN. By way of an example, it will be necessary to add 500mg/L DAP to a juice to increase its YAN concentration from 100mg/L to 200mg/L. While this fi gure seems a large addition of DAP, the YAN equivalent of 1.5g DAP would be needed to reach the point at which maximum fermentation rate would be achieved. Australian winemakers can visit the AWRI website to access the calculator to estimate DAP additions: http://www. awri.com.au/ practical_solutions/calculators/. One disadvantage of DAP as a supplement is the acidifi cation that can result in some juices, leading to a lowerthan- expected wine pH. Utilisation of the ammonium cation by yeast leaves a notable proportion of the phosphate anion, which can lower pH, depending on initial pH and must titratable acidity (TA). Furthermore, large additions of DAP can lead to excessive wine phosphate content. In practice, the maximum addition of DAP is limited by the concomitant concentration of soluble phosphate remaining in the wine, which is set at 400mg P/L (Australian and New Zealand Food Standard 4.5.1). This concentration of phosphate-P would correspond to a maximum of 1.7g/L DAP (equivalent to 360mg/L YAN) if we assume that the juice/must contained no phosphate; in practice a lesser amount of DAP can only, therefore, be added. Overuse of DAP can also stimulate overproduction of acetate esters, especially ethyl acetate, resulting in the perception of volatile acidity (VA) and suppression of varietal character. As discussed in the following sections, high YAN (exceeding 450-500mg/L YAN) can stimulate ethyl acetate production by many yeast strains. When working with very low YAN juices, we have observed that other nutrients can similarly be low. Thus, when YAN is low and other nutrient defi ciencies are suspected, it can be useful to add a proprietary yeast food that contains more complex forms of N, as well as vitamins, lipids and minerals. Indeed, continued H2S production after DAP addition suggests a general vitamin defi ciency (Henschke 1996; Wang et al. 2003), though other causes are also possible. Most yeast suppliers can advise on the use of yeast foods, which are generally produced from inactivated yeast.
Seminario Tcnico
GENERAL METABOLIC RESPONSES OF YEAST TO YAN

The principal role of sugar metabolism in yeast is to generate energy and carbon skeletons for building all the components of the cell. These metabolic activities result in the accumulation of several by-products, including esters, higher alcohols and polyols, carbonyls, acids and thiols which contribute to the aroma and fl avour of wine. Nitrogen metabolism, which is involved in the assimilation of nitrogen for the synthesis of protein and nucleic acids, also contributes to the pool of aroma and fl avour compounds. Because nitrogen metabolism is central to cell growth, it regulates other pathways, including sugar and sulphur metabolism. Consequently, nitrogen availability can signifi cantly impact on the production of many fl avouractive metabolites. The nitrogen status of a juice or must, therefore, contributes to wine fl avour as well as aff ecting yeast growth and the fermentation of sugars.
2.1 Major fermentation products

In addition to ethanol and CO2, other major products of sugar metabolism are the polyols, such as glycerol and butanediol and the organic acids, especially acetic and succinic acids and, to a lesser extent, the ketoacids, such as pyruvic acid and -ketoglutaric acid. The production of many of these primary metabolites of sugar metabolism is modulated by YAN, although the magnitude of changes has been observed to depend on the yeast strain under consideration. Furthermore, the type of nitrogen source used, DAP or amino acids, aff ects metabolite production (Albers et al. 1996). Because low YAN juices are typically supplemented with DAP, only the impact of ammonium ion concentration on the production of yeast metabolites will be discussed in this article.
Glycerol Concentration Malic acid Succinic acid Acetic acid SO2 100 200 YAN 300 400
Figure 2. Effect of yeast assimilable nitrogen on production or utilisation of major metabolic products of sugar fermentation and sulphur assimilation.
Textos asociados
65
Ethanol is the major product of sugar fermentation. However, while DAP addition increases yeast growth and the rate of fermentation, it has little to no practical eff ect on fi nal ethanol yield. Theoretically, DAP-grown yeast are forced to synthesise amino acids for cell growth when compared with amino acid grown yeast. This decreases the proportion of sugar available for ethanol production (Albers et al. 1996), but in our experiments this has a minor aff ect on ethanol yield. Glycerol and acetic acid, which are important to wine composition and fl avour, respond relatively strongly to juice YAN concentration (Albers et al. 1998; Torrea et al. 2005; Vilanova et al. 2007). Figure 2 summarises general trends observed in synthetic juice and white wine fermentations. Both glycerol and acetic acid production depends strongly on the yeast strain used. For example, when using yeast Vitilevure M05 DAP addition increases glycerol production whereas the reverse is the case for AWRI 796 (Vilanova et al. 2007). Both yeast, however, produce the lowest concentrations of acetic acid at moderate YAN concentrations (range of 200-250mg/L) while higher concentrations are produced at both lower and higher concentrations of YAN. Malic acid consumption does, however, increase with increasing DAP concentration, irrespective of yeast strain. On the contrary and depending on the strain, succinic acid concentration can increase with increasing DAP addition (Coulter et al. 2004). In general, YAN can aff ect TA and the balance of organic acids which can aff ect fl avour (Sowalsky and Noble 1998). Sulphur dioxide production during fermentation can also be stimulated by initial YAN concentration, but the response seems to be yeast strain dependent. Experimental work in synthetic media and wort suggests that low SO2 is produced in low YAN media but increases when initial YAN availability is higher (Duan et al. 2004; Osborne and Edwards 2006). SO2 production contrasts with H2S production, which is generally lowered by increasing YAN. Increased risk of MLF inhibition has also been associated with high YAN addition but this inhibition has not been conclusively correlated with SO2 production (Osborne and Edwards 2006). Nevertheless, until better information is available, consideration should be given to limiting high YAN conditions when malolactic fermentation (MLF) is required.
tation-derived volatiles in the aroma character of wine (Smyth et al. 2005). Several studies have indicated that both the total available nitrogen and the balance of amino acids and ammonia can signifi cantly aff ect the production of different groups of fermentationderived volatile compounds. From a practical point of view, the problem of juice nitrogen composition is primarily linked to the frequent occurrence of juices with suboptimal concentrations of nitrogen, and higher risk of slow or stuck fermentation. As this problem is frequently corrected in the winery through the addition of DAP, several studies have investigated the implications of this common winery practice on the volatile composition of wine (Ayrapaa 1971, Rapp and Versini 1991; Carrau 2003; Torrea and Henschke 2004; Hernandez-Orte et al. 2005, 2006; Vilanova et al. 2007). Due to the variety of yeast strains and fermentation conditions employed, it is somewhat diffi cult to extrapolate from the literature defi nitive conclusions concerning the eff ect of DAP addition on wine aroma. Nevertheless, some general trends relating to DAP supplementation and wine volatile composition are summarised in Figure 3. Higher alcohols, which are directly related to amino acid metabolism in the cell, exhibit a characteristic behaviour. Therefore, when total nitrogen is increased by adding ammonium to a medium containing very low levels of YAN, the production of higher alcohols is initially increased, but then tends to decrease after a peak between 200-300mg/L YAN. This activity depends on various factors, including yeast strain and fermentation conditions.Higher alcohols are characterised by fusel-like odours, and are generally thought to contribute to the complexity of wine fermentation bouquet. However, when present in very high concentrations they can have a negative impact on wine aroma, mainly because they mask fruity characters. Several authors have reported that ammonium supplementation can improve wine sensory quality
Concentration of yeast aroma compounds
Higher alcohols
Ethyl acetate Acetate esters Fatty acids ethyl esters Branched chain esters 100 200 300 YAN 400 500
2.2 Volatile aroma compounds

Among the various yeast metabolic pathways that are infl uenced by the nitrogen composition of the juice, those leading to volatile compounds are of particular importance due to the primary role played by fermen-
Figure 3. Relationship between initial YAN concentration and fi nal concentration of volatile compounds after fermentation.
66

by lowering higher alcohols production (Rapp and Versini 1991). However, based on the trend shown in Figure 3, this advice has to be taken cautiously as it might apply only to fermentations with initial YAN in the range included in the descending part of higher alcohols production pattern, i.e. YAN >200mg N/L. The production of fatty acids ethyl esters, as well as of acetate esters, including ethyl acetate, is generally increased when DAP is added to the juice prior to alcoholic fermentation (Figure 3). This can have interesting implications for wine fl avour as fatty acids ethyl esters and acetates are generally responsible for the fruity character of wine (Guth and Sies 2002). However, ethyl acetate, one of the dominant yeast-derived volatile metabolites, when present at very high concentrations, can give unwanted sensory characteristics, often described with terms like nail lacquer/solvent and volatile acidity. Branched chain esters are, from a quantitative point of view, the less abundant volatiles produced during fermentation. Although their contribution to wine fl avour has still to be clarifi ed, tentative evidence is available in the literature for these compounds to be important contributors to the red berry fruit character of some red wines (Diaz- Maroto et al. 2005). Their concentration appears to decrease with increased DAP additions, however. The existence of a variety of diff erent responses for the various groups of yeastderived volatile compounds to DAP supplementation arises from the fact that each group of volatiles is derived from a diff erent metabolic pathway, each of which respond differently to DAP supplementation. However, from a practical point of view, understanding the potential of DAP supplementation as a tool to modulate wine sensory characteristics cannot be based simply on compositional data. The various volatiles or groups of volatiles illustrated in Figure 3 occur in wine over an extremely broad range of concentrations. However, this fi gure does not represent the actual quantitative relationship between diff erent chemical species. For example, higher alcohols, characterised by herbaceous, fusellike odours, typically occur in concentrations that can be up to 400 times higher than ethyl fatty acid esters,
120 100 Odour Activity Value 80 60 40 20 0 100 200 300 YAN 400 500 Isoamyl alcohol Ethyl octanoate Isoamyl acetate Ethyl 3-methylbutanoate Ethyl acetate
Seminario Tcnico
characterised by fruit-like odours. Nevertheless, relatively small variations in the concentration of ethyl fatty acid esters, such as those introduced by variations in YAN content, are more likely to aff ect the aroma of wine than if proportionally similar variations would occur for higher alcohols. This is due to the fact that some of the possible sensory modifi cations associated with changes in the concentration of specifi c aroma compounds depend, among other factors, on the ability of that aroma compound to generate an olfactory stimulus at a given concentration. This complex relationship is often simplifi ed by means of the concept of odour threshold, defi ned as the minimum concentration at which a given compound can be detected by the sense of smell (Guth 1997). This is referred to as the odour activity value (OAV). Some of the fermentation-derived volatile compounds, such as esters, that are generally associated with the fruity character of wine, are extremely powerful odourants (i.e. have a very low odour threshold) and can, therefore, impart specifi c sensory attributes even when present in low concentrations. On the contrary, compounds like higher alcohols possess a much higher odour threshold and, therefore, are likely to generate variations in the aroma profi le of a wine only when their concentration varies to a very large extent. In Figure 4, a theoretical relationship between the OAV of selected volatile compounds, belonging to the chemical classes of Figure 3, and DAP supplementation is illustrated. It appears clear then that the range of variations potentially introduced by DAP in the concentration of acetates and fatty acid ethyl esters (isoamyl acetate and ethyl octanoate are used as reference compounds for these two classes) can have a dramatic impact on the volatile character of wine, whereas variations in compounds such as higher alcohols (isoamyl alcohol), although quantitatively extremely large, are likely to have a limited impact. Although it has to be stressed that OAVs only give a projection of the potential of a given compound to contribute to the overall aroma of a wine, the trends shown in Figure 4 provide a good indication of which one of the compositional changes associated with DAP supplementation is likely to have a greater impact on wine aroma.
IMPLICATIONS OF NITROGEN FOR WINE FERMENTATIONS 3.1 Implications of nitrogen for white wine fermentations
Interestingly, the results obtained in various winemaking trials conducted at the AWRI with sub-optimal YAN juices have indicated that, under typical winemaking conditions, DAP supplementation is an extremely powerful tool for modulating the production of esters which, based on the previous discussion, are probably
Figure 4. Theoretical relationship between initial YAN concentration and Odour Activity Values of selected yeast-derived aroma compounds.
Textos asociados
67
the most sensorially-interesting group of compounds generated during fermentation. Figures 5 and 6 show the variations in volatile compounds and the sensory profi le of Chardonnay wines made at diff erent DAP concentrations. In good agreement with the trends shown in Figure 3, DAP had a positive eff ect on ester production, while it lowered the formation of higher alcohols. However, the wines obtained with moderate nitrogen supplementation of the juice were preferred by panellists compared with those obtained without or with high DAP addition. This preference might be due to a combination of higher acetates, ethyl fatty acid ester concentrations and moderate levels of ethyl acetate, the latter being associated with unwanted, solvent-like characteristics when present at very high concentrations. DAP addition to low YAN juices also suppresses the production of H2S and mercaptans by many wine yeasts, which although not quantifi ed in this study, no doubt contributed to the preference of the moderate YAN wines. The impact of DAP addition on the production of fruity thiols, such as 4MMP, 3MH and 3MHA, still needs to be determined. These results highlight the complexity of predicting wine aroma from compositional data. They also underline the importance of measuring YAN and adding the appropriate amount of DAP, if necessary, before or during fermentation in order to reduce the potentially negative eff ects that inadequate or excessive DAP supplementation can have on wine aroma. Particularly, the risk of excessive formation of ethyl acetate has to be considered as this ester is relatively stable during wine ageing, compared with other acetate and ethyl fatty acid esters, which tend to decrease signifi cantly after several months of bottle storage.
3.2 Implications of nitrogen for red wine fermentations

More recently, researchers at the AWRI have investigated the eff ect of DAP supplementation on the volatile composition of Shiraz wine (Ugliano et al. 2007). It is generally believed that the conditions normally adopted for the production of red wine (i.e. higher temperatures, aeration of the fermenting must during cap management operations, extraction of YAN and other nutrients from skin during maceration) render fermentations less susceptible to slow or stuck fermentations, even when YAN concentrations approach the sub-optimal range. Nevertheless, several surveys have shown that YAN levels in red grapes can be well below optimal (Gockowiak and Henschke 1992; Butzke 1998; Nicolini et al. 2004; Ugliano and Henschke, unpublished data). Although during red wine fermentations YAN defi ciencies are likely to have a more moderate eff ect on fermentation kinetics, they can still negatively aff ect the formation of important aroma compounds. From the results of a trial which was carried out on a low YAN Shiraz must (YAN 100mg/L) with S. cerevisiae AWRI 796, it is again clearly evident that DAP supplementation is a powerful tool for modulating the volatile composition of red wine. This confi rms some of the trends observed during experiments with model substrates and white grape juices. As can be seen in Figure 7, DAP supplementation resulted in higher production of ethyl fatty acid esters and acetate esters, while higher alcohols were scarcely affected. Preliminary results also indicated that YAN supplementation of must can have an impact on red wine
12,000
160mg/L YAN
320mg/L YAN
480mg/L YAN
Wet cardboard Sweaty Less preferred aromas
Banana 4 3.5 3 2.5 2 1.5 1 0.5 0
Fruit ester Artificial grape More preferred aromas
10,000
Concentration g/L
8000
Cheesy
Musk
6000
Acetic
Floral
4000
Nail lacquer Stewed fruit
2000
Stale beer Tropical Honey Bruised apple Citrus
0 Fatty acids ethyl esters Acetates Ethyl acetate/10 Higher alcohols/100
Figure 5. Volatile compounds of wines obtained from a low YAN (160mg/L) Chardonnay juice supplemented with two increasing concentrations of DAP, to a fi nal YAN of 320mg/L and 480mg/L, respectively. Fermentations were carried out at 18C using S. cerevisiae AWRI 796.
Figure 6. Sensory characteristics of wines obtained from a low YAN (160mg/L) Chardonnay juice (green line) supplemented with two increasing concentrations of DAP, to a fi nal YAN of 320mg/L (red line) and 480mg/L (blue line), respectively. Fermentations were carried out at 18C using S. cerevisiae AWRI 796.
68

colour composition. Analytical parameters related to colour intensity and hue were indeed found to vary with DAP supplementation (Ugliano et al. 2007). The factors responsible for this eff ect are currently being investigated at the AWRI. The eff ect might be ascribable to various aspects of yeast metabolism that are known to modulate wine colour and phenolics composition. Factors include variations in the rate of ethanol production, absorption of anthocyanins on yeast cell walls (Morata et al. 2003) or reactions with yeast-derived metabolites such as pyruvic acid and acetaldehyde to form pigmented polymers (Romero and Bakker 1999). red wine fermentations, suggesting that, as in white wines, must YAN can aff ect the development of wine fl avour. Our preliminary data suggest that wine colour and phenolics composition can also be infl uenced by YAN. Overall, these results suggest that, at least for Chardonnay, the fl avour and style of wine is dramatically modulated by the initial YAN concentration of the grape juice. Low YAN level juices favour the production of more complex wines with less fruity aromas, whereas moderate YAN levels produce cleaner and fruitier wines. However, high YAN levels can lead to excessively estery wines. Similar eff ects can be expected in other varieties, excepting for those varieties that depend on thiols, for which no information is presently available. Clearly, more wine sensory studies need to be undertaken to better understand the eff ects of must YAN and amino acid profi le on wine fl avour. A red wine trial is currently in progress to understand better the impacts of managing nitrogen in the vineyard compared with that in the winery on wine fl avour and quality. This research can be expected to provide grapegrowers and winemakers with better information for optimising wine style and quality according to consumer preferences and other desired outcomes.
Seminario Tcnico
CONCLUSION
This work shows that the concentration of yeast assimilable nitrogen is not only important for ensuring that adequate yeast growth and fermentation kinetics are achieved, but also can aff ect the production of the major metabolites arising from sugar fermentation. Whereas ethanol concentration is little aff ected, that of glycerol and various carboxylic acids can be markedly modulated. These changes are likely to aff ect wine fl avour. Most importantly, however, is the fi nding that YAN can strongly infl uence production of some of the volatile metabolites, especially the acetate and ethyl esters, which are known to be positive to wine aroma when in balance. The impact of higher alcohols, which can be negative when present in high concentration, can also be modulated by YAN. These various yeast metabolites were also found to vary in
ACKNOWLEDGEMENTS
We thank our many colleagues for supporting this project, especially Tracey Siebert and Dimitra Capone for help with analysis of fermentation volatiles; Mariola Kwiatkowski and Meagan Mercurio for analysis of phenolic compounds; Kate Lattey, Belinda Bramley and Dr Leigh Francis for carrying out the sensory analyses; Industry Development and Support and Analytical Service team members for help with chemical analyses; and Dr Paul Chambers, Dr Cristian Varela and Biosciences team members for many helpful discussions. Professor Francisco Carrau, of Uruguay, and visiting scientists Drs Diego Torrea and Mar Vilanova, from Spain, have made important contributions to this project. We are especially grateful to Mike Farmilo, of Boars Rock winery, for supplying a large number of juice samples and donating must for the Shiraz fermentation trials, and Russell Johnstone and Inca Pearce, of Orlando Wines, and Louisa Rose and Simon Dillon of The Yalumba Wine Company, for supplying white wine juices. Current work on nitrogen management also involves collaboration with Dr Sally-Jean Bell and Marcel Essling. Rae Blair is thanked for her editorial assistance. This project is supported by Australias grapegrowers and winemakers through their investment agency, the Grape and Wine Research and Development Corporation, with matching funds from the Australian Government. The AWRI is a member of the Wine Innovation Cluster.
10,000 9000 8000 Concentration g/L 7000 6000 5000 4000 3000 2000 1000 0 Fatty acids ethyl esters Acetates Ethyl acetate Higher alcohols/100 100mg/L YAN 250mg/L YAN 400mg/L YAN
Figure 7. Volatile compounds of wines obtained from low YAN (100mg/L YAN) Shiraz grapes supplemented with two increasing concentrations of DAP, to a fi nal YAN of 250mg/L and 400mg/L respectively. Fermentations were carried out at 22C using S. cerevisiae AWRI 796, with cap plunging three times per day.
Textos asociados
69
REFERENCES
1 Albers, E.; Larsson, C.; Liden, G.; Niklasson, C. & Gustafsson, L. (1996) Infl uence of the nitrogen source on Saccharomyces cerevisiae anaerobic growth and product formation. Appl. Env. Microbiol. 62: 3187-3195. 2 Albers, E.; Lidn, G.; Larsson, C.; Gustafsson, L. (1998) Anaerobic redox balance and nitrogen metabolism in Saccharomyces cerevisiae. Recent Res. Develop. Microbiol. 2: 253-279; 1998. 3 yrp, T. (1971) Biosynthetic formation of higher alcohols by yeast. Dependence on the nitrogenous nutrient level of the medium. J. Inst. Brew. 77: 266-276. 4 Bauer, F.F.; Pretorius, I.S. (2000). Yeast stress response and fermentation effi ciency: how to survive the making of wine A review. S. Afr. J. Enol. Vitic. 21: 27-51. 5 Bell, S.-J.; Henschke, P.A. (2005) Implications of nitrogen nutrition for grapes, fermentation and wine. Aust. J. Grape Wine Res. 11: 242-295. 6 Blateyron, L.; Ortiz-Julien, A; Sablayrolles, J.M. (2003) Stuck fermentations: oxygen and nitrogen requirements importance of optimising their addition. Aust. N.Z. Grapegrower Winemaker 478: 73-79. 7 Butzke, C. (1998). Survey of Yeast Assimilable Nitrogen status in musts from California, Oregon, and Washington. Am. J. Enol. Vitic. 49: 220-224. 8 Carrau, F.M. (2003) Characterization of yeast in relation to the ability to utilize nitrogen Studies of aroma compounds. PhD thesis, Universidad de la Republica, Uruguay. 9 Coulter, A.D.; Godden, P.W.; Pretorius, I.S. (2004) Succinic acid-how is it formed, what is its eff ect on titratable acidity, and what factors infl uence its concentration in wine? Aust. N.Z. Wine Ind. J. 19: 16-20, 22-25. 10 Dambergs, R.G.; Kambouris, B.; Cynkar, W.; Janik, L.J.; Cozzolino, D.; Henschke, P.A.; Gishen, M. (2005) A comparison of near infrared and midinfrared spectroscopy for the analysis of yeast-assimilable nitrogen in grape juice. Blair, R.J.; Williams, P.J.; Pretorius, I.S. (eds.) Proceedings of the twelfth Australian wine industry technical conference; 2429 July 2004; Melbourne, Vic. Australian Wine Industry Technical Conference Inc., Adelaide SA: 334.
11 Diaz-Maroto, M.C.; Schneider, R.; Baumes, R. (2005) Formation pathways of ethyl esters of branched short-chain fatty acids during wine aging. J. Agric Food Chem., 53, 3503-3509. 12 Duan, W.; Roddick, F.A.; Higgins, V.J.; Rogers, P.J. (2004) A parallel analysis of H2S and SO2 formation by brewing yeast in response to sulphur-containing amino acids and ammonium ions. J. Am. Soc. Brew. Chem. 62: 35-41. 13 Dukes, B.C.; Butzke, C.E. (1998) Rapid determination of primary amino acids in grape juice using an o-phthaldialdehyde/N-acetyl-L-cysteine spectrophotometric assay. Am. J. Enol. Vitic. 49: 125-134. 14 Eglinton, J.; Siebert, T.; Kwaitkowski, M.; Francis, L.; Henschke P. (2005) Compositional and sensory implications of practical strategies for ensuring complete fermentation with non-conventional yeast. Blair, R.J.; Williams, P.J.; Pretorius, I.S.(eds.) Proceedings of the twelfth Australian wine industry technical conference; 24-29 July 2004; Melbourne, Vic. Australian Wine Industry Technical Conference Inc., Adelaide SA: 288. 15 Filipe-Ribeiro, L.; Mendes-Faia, A. (2007) Validation and comparison of analytical methods used to evaluate the nitrogen status of grape juice. Food Chem. 100: 1272-1277. 16 Gockowiak, H.; Henschke, P.A. (1992) Nitrogen composition of grape juice and implications for fermentation: results of a survey made in N-E Victoria. Aust Grapegrower Winemaker 340: 131, 133-138. 17 Gump, B.H.; Zoecklein, B.W.; Fugelsang, K.C.; Whiton, R.S. (2002) Comparison of analytical methods for prediction of prefermentation nutritional status of grape juice. Am. J. Enol. Vitic. 53: 325-329. 18 Guth, H. (1997) Quantitation and sensory studies of character impact odorants of diff erent white wines varieties. J. Agric. Food Chem., 45: 3027-3032. 19 Guth, H.; Sies, A. (2002) Flavour of wines: Towards an understanding by reconstitution experiments and an analysis of ethanols eff ect on odour activity of key compounds. Blair, R.J.; Williams, P.J.; Hj, P.B. (eds.). Proceedings of the eleventh Australian Wine Industry Technical Conference, 7-11 October 2001, Adelaide SA. Australian Wine Industry Technical Conference Inc., Adelaide SA 128-139. 20 Henschke, P.A. (1996) Hydrogen sulphide production by yeast during fermentation. Proceedings Eleventh international oenological symposium, Sopron, Hungary (International Association for Winery Technology and Management: Breisach, Germany) pp. 83-102.
70

21 Henschke, P.A.; Jiranek, V. (1993) Yeasts metabolism of nitrogen compounds. In: Wine Microbiology and Biotechnology. Fleet, G.H. (ed.) (Harwood Academic Publishers: Chur, Switzerland) pp. 77-164. 22 Hernndez-Orte, P.; Ibarz, M.J.; Cacho, J.; Ferreira V. (2005) Eff ect of the addition of ammonium and amino acids to must of Airen variety on aromatic composition and sensory properties of the obtained wines. Food Chem. 89: 163-174. 23 Hernndez-Orte, P.; Bely, M.; Cacho, J.; Ferreira, V. (2006) Impact of ammonium additions on volatile acidity, ethanol, and aromatic compounds production by diff erent Saccharomyces cerevisiae strains during fermentation in controlled synthetic media. Aust. J. Grape. Wine Res. 12: 150-160. 24 Ingledew, W.M.; Magnus, C.A.; Sosulski, F.W. (1987) Infl uence of oxygen on proline utilization during wine fermentation. Am. J. Enol. Vitic. 38: 246248. 25 Morata, A.; Gomez-Cordoves, M.C.; Suberviola, J.; Bartolom, B.; Colomo, B.; Surez, J.A. (2003) Adsorption of anthocyanins by cell walls during the fermentation of red wines. J. Agric. Food. Chem. 51, 4084-4088. 26 Nicolini, G.; Larcher, R.; Versini, G. (2004) Status of yeast assimilable nitrogen in Italian grape musts and eff ect of variety, ripening and vintage. Vitis, 43: 89-96. 27 Osborne, J.P.; Edwards, C.G. (2006) Inhibition of malolactic fermentation by Saccharomyces during alcoholic fermentation under low- and highnitrogen conditions: a study in synthetic media. Aust. J. Grape Wine Res. 12: 69-78. 28 Rapp, A.; Versini, G. (1991). Infl uence of nitrogen compounds in grapes on aroma compounds of wine. Proceedings of the International Symposium on Nitrogen in Grapes and Wine. Davis USA: American Society for Enology and Viticulture, 156-164. 29 Ribreau-Gayon, J.; Dubourdieu, D.; Donche, B.; Lonvaud, A. (2000) Handbook of Enology, Volume 1: The microbiology of wines and vinifi cation. John Wiley & Sons Ltd: Chichester, UK.: 454. 30 Romero C.; Bakker, J. (1999) Interactions between grape anthocyanins and pyruvic acid, with eff ect of pH and acid concentration on anthocyanin composition and color in model systems. J. Agric. Food Chem. 47, 3130-3139. 31 Shively, C.E.; Henick-Kling, T. (2001) Comparison of two procedures for assay of free amino nitrogen. Am. J. Enol. Vitic. 52: 400-401. 32 Smyth, H., Cozzolino, D., Herderich, M.J., Sefton, M.A.; Francis, I.L. (2005) Relating volatile composition to wine aroma: identifi cation of key aroma compounds in Australian white wines. Blair, R.J.; Williams, P.J.; Pretorius, I.S. (eds.) Proceedings of the Twelfth Australian Wine Industry Technical Conference, Melbourne, Vic, 24-29 July 2004. Australian Wine Industry Technical Conference Inc., Adelaide SA: 31-33. 33 Sowalsky, R.A.; Noble, A.C. (1998) Comparison of the eff ects of concentration, pH and anion species on astringency and sourness of organic acids. Chem. Senses 23: 343-349. 34 Swiegers, J.H.; Francis, I.L.; Herderich, M.J.; Pretorius, I.S. (2006) Meeting consumer expectations through management in the vineyard and winery: the choice of yeast for fermentation off ers great potential to adjust the aroma of Sauvignon Blanc wine. Aust. N.Z. Wine Ind. J. 21: 34-42. 35 Torrea, D.; Henschke P.A. (2004) Ammonium supplementation of grape juice eff ect on the aroma profi le of a Chardonnay wine. Tech. Rev. 150, 59-63. 36 Torrea, D.; Siebert, T.; Liebich, B.; Ancin, C.; Francis, L.; Henschke, P.A. (2005) Eff ect of ammonium supplementation of a Chardonnay must on wine aroma. Blair, R.J.; Williams, P.J.; Pretorius, I.S. (eds.) Proceedings of the Twelfth Australian Wine Industry Technical Conference, Melbourne, Vic,, 24-29 July 2004. Australian Wine Industry Technical Conference Inc., Adelaide, SA: 293. 37 Ugliano, M.; Siebert, T.; Capone, D.; Mercurio, M.; Henschke, P.A. (2007) Colour, aroma and fl avour compounds in Shiraz wine as aff ected by DAP addition before fermentation. Blair, R.J.; Williams, P.J.; Pretorius, I. S. (eds.) Proceedings of the thirteenth Australian Wine Industry Technical Conference, Adelaide, SA, 28 July-2 August 2007. Australian Wine Industry Technical Conference Inc. Adelaide, SA: in press. 38 Vilanova, M.; Ugliano, M.; Siebert, T.; Pretorius, I.J.; Henschke, P.A. (2007) Assimilable nitrogen utilization and production of volatile and nonvolatile compounds in chemically defi ned medium by Saccharomyces cerevisiae wine strains. App. Microbiol. Biotechnol. 77: 145-157. 39 Wang, X.D.; Bohlscheid, J.C.; Edwards, C.G. (2003) Fermentative activity and production of volatile compounds by Saccharomyces grown in synthetic grape juice media defi cient in assimilable nitrogen and/or pantothenic acid. J. Appl. Microbiol. 94: 349-359.
Seminario Tcnico
Textos asociados
71
72
Seminario Tcnico
Unravelling the genetic blueprint of wine yeast

Borneman, A.R.; Forgan, A.H.; Chambers, P.J.; and Pretorius, I.S. The Australian Wine Research Institute, PO Box 197, Glen Osmond (Adelaide), South Australia 5064, Australia In a world first, scientists at the Australian Wine Research Institute have sequenced the wine yeast genome, characterising the recipes of life that shape this winemakers friend. Unlocking the secret to what makes wine yeast tick will put winemakers in a stronger position to use science to their advantage. This work paves the way for the development of new yeast strains, potentially leading to innovative solutions to tackle stuck fermentation and to create wines with desired alcohol levels and flavour profiles. Every four years, the Olympic Games inspire the world with spectacular performances and feats of endurance, speed and grace. We marvel at the athletic performance of the competitors; most of us can only wonder how these champions reach the standards they do. What makes world record-breakers so profoundly different to the rest of us? Are we not the same species, and therefore shouldnt we all have the same potential? Couldnt we also win gold in swimming or running if we had the same training regimes, diet, lifestyle, etc.? The answer is no. Elite athletes are born with a potential that has gold stamped all over it. They have muscle-types, physique, physiology and aptitude that, with training, can be honed for international success. Unfortunately, most of us would require a great deal more than honing to reach this elite level; until bionics is able to rebuild what we are born with, when it comes to athletics, most humans will have to settle for amateur league or less (Figure 1(a)). Differences in performance of individuals of the same species are not peculiar to humans; in fact we see it everywhere in nature. Take, for example, the humble yeast that winemakers use to craft complex, delicious wine from sweet, syrupy grape juice. Most wine yeast are the same species, Saccharomyces cere visiae, but not all members of this group are able to produce wine, and, among those that do, there is considerable variation in how reliably and efficiently they work, and in the quality of the wine they produce. This begs the question: What makes a wine yeast tick? What, in the inner workings of this elite athlete, enables it to grow in such an inhospitable environment and de-
liver gold medal wines when other S. cerevisiae strains dont even leave the starting blocks? Research at the Australian Wine Research Institute (AWRI) is beginning to unravel the mysteries of the variation across the S. cerevisiae species, and early results on what they tell us about wine yeast are tantalising. The variation in performance that we see across strains of S. cerevisiae is inheritable; this means that it is genetically determined. The starting point for characterising this variation, therefore, should focus on yeast genetics. Fortunately, S. cerevisiae was the first organism of its type to have its genetic make-up (its genome) sequenced, and this was done over ten years ago on a strain, known as S288c, chosen for its laboratory friendly characteristics (for more information on what genes and genomes are, see the breakout box). Scientists love this yeast because it is very easy to work with, but it would not win any medals in the winemaking arena; in fact, it is probably not even up to amateur status. Nevertheless, if you want to find out what makes wine yeast so different from other S. cerevisiae strains, you have to have something to compare it with, and S288c is a good starting point. Another strain of S. cerevisiae, YJM789, recently had its genome sequenced. The genome of this yeast, an opportunistic pathogen isolated from the lungs of an AIDS patient, turned out to be quite different to that S288c. Thus we had two different versions of S. cerevisiae to compare a wine yeast against, and this is what we found. It turns out that our wine yeast is a little more different to the two previously sequenced strains than they are to each other (Figure 2). About 0.6% of the letters of the wine yeast sequence are different to what is found in the laboratory strain. This might seem like a small difference, but if you consider that genetic differences between humans and chimpanzees amount to only about 1-2%, it is really quite large. Perhaps of greater interest, however, is that there are extra DNA sequences in the wine yeast; enough to carry at least 27 genes that are not present in the two yeasts it was compared against. In fact, some of the sequences in this extra DNA do not resemble anything found in other species of Saccharomyces; they appear to be more like genes found in very distant fungal relatives. We do not yet know how they got into the wine yeast genome, but we are curious to find out whether or not they play a part in distinguishing wine yeast from other S. cerevisiae, particularly in the winemaking stakes. Some of the wine yeast-specific genes encode proteins that are probably associated with the cell wall,
Wine Industry Journal > Vol 23 No 5 > September /October 2008
Textos asociados
73
Unravelling the genetic blueprint of wine yeast
a feature of yeast that is undoubtedly important for resilience in inhospitable environments. We are curious to find out whether these genes impact on robustness of wine yeast, a feature that is crucial for completing fermentations. Do these genes, for example, make the yeast more or less vulnerable to becoming stuck or sluggish in a ferment? We have also identified genes that probably encode proteins associated with amino acid uptake (a neutral amino acid transporter) and metabolism (an aspartate transaminase). Because amino acid metabolism is associated with flavour development, it is tempting to suggest that these genes will impact on sensory attributes in wine, but, of course, this will have to be tested. Then there are lots of genes that we cannot guess the function(s) of yet, and these might turn out to be the most exciting of all; time and experimental work will tell. Interestingly, we also found some sizeable rearrangements in the genome that we are also curious about,
but cannot even guess what their significance will be. What does the future hold now that we have this rich source of information on a wine yeast? We will, of course, ascertain as far as possible, which of the unique features of a wine yeast genome are important in a winemaking context. However, we also plan to build on data gathered from this project by sequencing and comparing the genomes of several other wine yeast strains that are known to have different winemaking properties This will enable us to work out what is common to all wine yeasts (i.e. what constitutes the core requirements of a wine yeast) and what differences between them drive production of wines with differing qualities (e.g. different propensities to deliver fruity flavours and aromas). Once we understand what makes a wine yeast tick, and the significance of variation among wine yeasts, we will be much better placed to develop strains of
1(a)
1(b)
Figure 1. No two humans have the same genetic make-up. An elite athlete, for example, is born with a genome that has gold medal stamped all over it (Figure 1(a)). Similarly, not all wine yeasts are the same; different wine yeasts have different genetic make-up (Figure 1(b)). This is why some wine yeast strains are more robust that others and different strains impart different sensory properties to wines. Understanding what, in the genome of a wine yeast, determines its robustness and its ability to produce desirable (and undesirable) sensory attributes will enable the development of improved strains that will assist winemakers to craft wines for an increasingly demanding and constantly changing market.
74
Seminario Tcnico
ACKNOWLEDGEMENTS
The AWRI, a member of the Wine Innovation Cluster in Adelaide, is supported by Australias grapegrowers and winemakers through their investment body, the Grape and Wine Research and Development Corporation, with matching funds from the Australian Government. Systems biology research at the AWRI is performed using resources provided as part of the National Collaborative Research Infrastructure Strategy, an initiative of the Australian Government, in addition to funds from the South Australian State Government. We gratefully acknowledge the contribution of the Australian Genome Research Facility, a member of Bioplatforms Australia, where the actual sequencing of the wine yeast genome was carried out. We also thank Sharon Mascall and Rae Blair for editorial assistance, and JeffEglinton for the preparation of the illustrations. The detailed results of this work are published in the peer-reviewed journal FEMS Yeast Research.
Figure 2. The genome sequences of three strains of Saccharomyces cerevisiae has revealed how similar they are to each other. The numbers in circles on the arrows separating the different strains represent the number of letters in the genome that differ between the strains. The 60,399 differences between a wine yeast and a laboratory yeast is equivalent to about 0.6% of the genome. this microorganism that can complete the marathon of fermentation without becoming stuck or sluggish en route, while producing gold medal wines; and all of this should be possible without the need of performance enhancing additives. Just like our Olympians at the Australian Institute of Sport, the wine sector has gold-medal aspirations. Backed by sound science and robust research it should be gold all of the way for Australian winemakers.
FURTHER READING
Borneman, A.R, Forgan; A., Chambers, P.J. and Pretorius, I.S. (2008) Comparative genome analysis of a Saccharomyces cerevisiae wine strain. FEMS Yeast Research 8:1185-1195. Borneman, A.R.; Chambers, P.J. and Pretorius, I.S. (2007) Yeast Systems Biology: modelling the winemakers art. Trends in Biotechnology 25:349-355. Goffeau A.; Barrell B.G.; Bussey H.; Davis R.W.; Dujon B.; Feldmann H.; Galibert F.; Hoheisel J.D.; Jacq C.; Johnston M,; Louis E.J.; Mewes H.W.; Murakami Y.; Philippsen P.; Tettelin H. and Oliver S.G. (1996) Life with 6000 genes. Science 274: 546, 563-567.
enes are recipes for making proteins. For example, your cells carry a gene/recipe for making the protein insulin, which is a hormone that regulates blood sugar level. You also have genes/recipes that instruct your cells how to make proteins that control how tall you can grow, the colour of your eyes, the general shape of your body, etc. It is these recipes of life that dictate whether you will have athletic potential or not, and, because you inherited them from your parents you end up looking like them. If genes are recipes then genomes are recipe books. The human genome carries all of the recipes required for making proteins to build a human body from conception to adulthood, and repair and defend that body during its life. All of our physiology and anatomy is shaped by a collection of 20,000-25,000 genes that comprise the human genome. And, unless you have an identical twin, your recipe book diff ers a little from everyone elses. The language of the genes is very diff erent the languages we use to communicate with each other. It is based on an alphabet of only four letters (A, T, G and C) and its lexicon is limited to three letter words, which means there are only 64 words in the genetic dictionary. However this is more than enough to string together sets of instructions for building all of the proteins (enzymes, hormones, muscles, antibodies, cartilage etc.) we require for life. The paper on which the words that make up the recipes of life is written is known as DNA, and when we read an entire recipe book of an organism, decoding what is recorded in its DNA, we say we are sequencing its genome. What we end up with in this process is a long sequence of millions of A, T, G, and Cs, with no spaces or obvious punctuation marks, that we have to decipher. Thankfully, sophisticated computational aids can do most of this for us.
Textos asociados
Cracking the Code: Genes and Genomes
75
76
Seminario Tcnico
When the heat is on, yeast fermentation runs out of puff

Coulter, A.D.; Henschke, P.A.; Simos, C.A. and Pretorius, I.S. The Australian Wine Research Institute, PO Box 197, Glen Osmond (Adelaide), South Australia 5064, Australia South Australia was sweltering. For more than two weeks in March this year, Adelaide sweated in unrelenting heat. Thermometers glared red as daytime temperatures refused to drop below 35C. Scientists called it a record-breaking heatwave: a once in three millennia event. On the vines, sugar levels also soared to record-breaking heights. Varieties that normally mature weeks apart ripened together. Winemakers scrambled to harvest their fruit and crammed their fermentors full. Everyone hoped for the best. Fermenting a must through to dryness with such high sugar concentrations would have been challenging even for the toughest yeast due to the high levels of ethanol produced. Ferments kicked-offwell but later many started to run out of puffand required robust fermentation rescue procedures. Some were still ticking over months later. In the past, the number of queries we receive about stuck fermentations has been fairly constant. This year they doubled. The Australian Wine Research Institute (AWRI) regularly handles calls from winemakers looking for help and advice. But, although the chemistry behind stuck fermentation is simple, the causes are invariably complex making them frustratingly difficult to predict. There is evidence that most of the stuck ferment queries we received were related to the heatwave that hit much of South Australia and Victoria in the first half of March 2008. But stuck fermentation is a complex
24 12
problem and research has identified a multitude of potential causes, any combination of which can be involved. Our inability to measure or assess many of these factors in real time further exacerbates the problem. As a result, it can be difficult to work out why it happens. The definition is straightforward. At some point during fermentation, the process slows or stops too soon, preventing the remaining sugar in the wine from being converted to alcohol and carbon dioxide (Figure 1). Yeast activity or a lack of it is usually the culprit. The yeast might be feeling quite stressed due to its environment, or there might be something wrong with the yeast itself, preventing it from doing its job. Wine yeast works best when the temperature is not too hot, or not too cold and there are plenty of nutritious side-dishes to go with the main carbohydraterich course. Like any selfrespecting organism, it enjoys sanitary conditions and relative freedom from the irritating excesses of unwanted dinner guests (Figure 2) that can spoil the best parties. Coming up for air turns out to be surprisingly important for fermenting yeast a sniffof oxygen will repay the winemaker many fold with renewed enthusiasm to get back to the job at hand. Inebriating agents render it incompetent. Too much ethanol, for example, can stop yeast from growing by starving it of nutrients and increasing the toxicity of other compounds. The advice from the AWRI is that stuck fermentation is usually avoidable if winemakers keep the basics in balance: moderation of sugar levels, adequate supply of key nutrients including nitrogen and oxygen, effective sulfur dioxide, pH control, avoiding over-clarification, vigilant barrel management and clean conditions from harvester to fermentor. But this year, the heat created a new set of problems.
20 Alcohol Biomass 16
% Ethanol
8 Brix Stuck Sluggish Slow Delayed onset Optimal 12
8 4 4
0 0 100 200 Time (hr) 300 400
Figure 1. Optimal and sub-optimal fermentation profi les. Four types of sub-optimal fermentation are commonly observed: delayed on-set; continuously slow ferments; sluggish ferments; and incomplete or stuck ferments.
Inside the wineries, in the fermentors, dehydrated and shrivelled fruit was hard to process, causing blockages in heat exchangers. The first week of the heatwave was bad enough with rapidly rising sugar levels, as has been seen in previous hot vintages. But, the second week stressed the already drought stressed vines beyond their limit producing heavily dehydrated fruit, perhaps as the parched vines deprived sunburnt berries of moisture. Outside, in the trucks queued up with their precious loads, the microbes took hold. Micro-organisms had a field day in the mountains of warm berries. Delays, lack of refrigeration and the un-
Textos asociados
During Marchs heatwave, winemakers reported fruit arriving at the crusher with temperatures in the mid to high 30s. On one particular day, fruit arrived at one winery where temperatures topped 40C. Some cooling systems could not cope. The scramble to harvest and deliver the rapidly ripening fruit made matters worse.
77
relenting heat offered an opportunity for growth. The combination of heat stress, dehydration and mechanical harvesting had left more fruit damaged than usual. Enemy microbes had the perfect breeding ground. Left to grow unchecked, some bugs can wreak havoc. The grape apiculate yeast Hanseniaspora uvarum can develop quickly, for example, robbing grape must of important nutrients. One of its targets is thiamine, for which it has an insatiable appetite. Thiamine is essential for the efficient production of ethanol by Saccharomyces yeast. There is no easy procedure to detect vitamin deficiencies until the ferment becomes sluggish and responds to supplements. When excessive growth of wild yeast (Figure 2) is observed between the harvester and fermentor it is important to add thiamine and other vitamins to the starter culture. For musts from vineyards with a history of fermentation problems, the addition of complex inactivated yeast nutrients can also be beneficial. Hanseniaspora uvarum can also produce off-flavours including the vinegary taste of acetic acid. Research has shown that hot conditions can dramatically increase the production of acetic acid and, this year, winemakers have reported high levels of volatile acidity (VA) to the AWRI. Lactic acid bacteria also thrive in warm conditions, producing acetic acid as well as other unwanted compounds from the grape sugars and acids. Growth of certain lactic acid bacterial strains is enough to leave the pluckiest wine yeast running for cover. Spoilage in addition to stuck fermentation is often the result.
Accumulation of acetic acid beyond a gram per litre starts to affect yeast growth and becomes more toxic as the alcohol level builds. When this years stuck ferments were tested at the AWRI, sensory analysis revealed that a number of them were affected by a mousy off-flavour. They had high concentrations of acetic acid, low concentrations of malic acid many ferments underwent malolactic fermentation and they contained various unwelcome micro-organisms. The results after analysing one red wine with stuck fermentation were typical of those tested (Table 1, see page 27). Lactic acid bacteria are also known to produce mousy off- flavour in grape bins when given a long journey under warm conditions without sufficient protective sulfites. The winemakers usual weapons against enemy microbes are sulfites, and clarification treatments for whites. But a review of research into stuck fermentation published by the AWRI shows that in extreme conditions, adding sulfur dioxide to grape bins might not be enough. Sulfur dioxide has a tendency to hook up with sugar, sapping its effectiveness. The high levels of sugar caused by this years heatwave would have had such an effect. The higher levels of spoilage noted this year signals that the levels of sulfites normally used to control wild yeast and bacteria was often inadequate under these exceptional conditions. As a result, winemakers needed to increase their use of sulfites and clean their harvester bins regularly to keep the bugs at bay. Without these kinds of control measures, the development of large populations of indigenous microorganisms could have depleted nutrients. This would have made it very hard for the wine yeast to complete the fermentation, which with the higher sugar levels would have been an even harder task.
Hanseniaspora Candida Kloeckera
Debaryomyces
Saccharomycodes Wild yeast Spoilage bacteria
Schizosaccharomyces Kluyveromyces
Pichia
Table 1. Results of analysis of a typical high VA 2008 red ferment. Analysis Alcohol Acetic acid Glucose + fructose Malic acid pH Microbiological Result 12.0% v/v 1.94g/L 47.0g/L <0.05g/L 3.81 Yeast: Saccharomyces sp., non-Saccharomyces sp. Bacteria: Lactobacillus sp. Acetobacter sp. Sensory Volatile, mousy off-flavour
Cryptococcus Metschnikowia
Dekkera
Zygosaccharomyces
Saccharomyces
Lactic acid bacteria
Acetic acid bacteria
Figure 2. Grapes harbour a variety of yeasts and bacteria, and depending on the addition of sulfi tes, grape temperature and time taken for transport to the winery, the hygienic status of grape processing machinery, pre-maceration, pressing and clarifi cation procedures, a variable proportion of grape yeasts survive in the juice or must. Together with microorganisms associated with processing equipment, these yeasts can proliferate in juice or must, depending on physicochemical and nutrient conditions.
78

Even when microbes were kept in check, the heatwave still took its toll. Yeast is particularly sensitive to heat in its growth phase and when temperatures top well over 30C, in combination with high ethanol, it becomes stressed. When the heat is on, research has shown that the viability and vitality of yeast are affected; it produces more volatile acidity and stuck fermentation is more likely. High temperatures also increase yeast consumption of nitrogen. If yeast assimilable nitrogen (YAN; Figure 3) is low due to growth of wild micro-organisms or prevailing drought conditions then stuck fermentation is also more likely. The AWRIs analysis of YAN levels in several hundred juice samples taken from tanks in two South Australian wine regions after crushing show a drop in YAN levels for the 2008 vintage, compared with the previous year (Figure 4(a)). There were also greater variations between YAN levels in samples taken from the 2008 vintage (Figure 4(b)). This means that some juices would have had relatively low concentrations and the risk of stuck fermentation was more likely. Various studies have tried to find out how much YAN is needed to reduce the risk of slow or stuck fermentations. As a rough guide, the risk increases when YAN levels fall below 140mg N/L in clarified white must of moderate sugar levels, i.e. around 20% (Figure 3). However, since YAN demand increases at high fermentation temperatures and when sugar concentra200
Seminario Tcnico
tions are high, this threshold increases. More research is needed to determine a threshold for red wine ferments. Recent research at the AWRI is showing that YAN can affect wine style, especially so in white wines. Low YAN ferments tend to give more complex flavour profiles, sometimes a bit dirtier, whereas moderate YAN levels give cleaner, fruitier styles in Chardonnay. But this trend is yeast strain and variety dependent. Some yeast strains actually make more H2S at moderate YAN levels compared with low YAN levels; so it is important to know the characteristics of your favourite yeast. Until we have better information, it appears that moderate diamonnium phosphate (DAP) addition may actually reduce the formation of the characteristic tropical fruit thiols in Sauvignon Blanc and related varieties. Using complex inactivated yeast nutrients in this latter case appears to be a better option. Research has also shown that agrochemicals might also have played a role in the increased incidence of stuck fermentations. While residues of copper from fungicides, are unlikely to cause problems on their own, they might frustrate fermentation when other factors come into play. Late application of agrochemicals to fruit that was harvested weeks ahead of schedule, together with the dry conditions, could have contributed to slightly higher residue levels. One favourite suspect often held responsible for stuck fermentation by winemakers is not proven guilty, however, by AWRI research. Every year, the AWRI handles enquiries about glucose-to-fructose ratios, as winemakers suspect that fructose is somehow to blame when fermentation grinds to a halt. Research has shown, and indeed has been known for nearly a century, for example, that the Saccharomyces yeast tends to consume glucose more quickly than fructose and that the last few grams of sugar feeding the final stages of fermentation will be fructose. Under normal circumstances, when there are no other factors affecting fermentation, the yeast will use the fructose. But as far as the AWRI is aware, there is no conclusive evidence that higher amounts of fructose will cause stuck fermentation. Until proven otherwise, it appears that the high fructose:glucose ratio is a symptom rather than cause of stuck fermentation. Sluggish and stuck ferments from the 2008 vintage are characterised by higher residual sugar concentrations than usual. Under these tougher conditions more robust rescue procedures are needed. By all reports, the AWRIs acclimatisation procedure is working well and has benefited from several improvements, such as fining musts with yeast hulls and racking offyeast lees before reinoculation, and rehydrating the initial yeast preparation with complex yeast nutrients. The important principal behind this procedure is that the rescue culture is sequentially acclimatised to the high
160
Initial YAN (mg/L)
Glucose (g/L)
120 Stuck 80 Slow 40
25
Optimal 50 400 250 80 Time (hr) 150 120 100 160 200
0 0 40
Figure 3. The risk of fermentation problems is increased when grape must is sub-optimal in nutrient content, especially for assimilable nitrogen, and vitamins, the latter of which can be lost during grape harvest and must processing. A high ratio of sugar to other nutrients can lead to low biomass and fermentation rate, and the early onset of sugar transport inactivation in yeast. The general rule of thumb is that musts with YAN levels of <150mg/L are more likely to result in slow fermentations, and musts with <50mg/L are more likely to result in stuck ferments (see also Figure 1).
Textos asociados
79

4(a) 250 200 150 100 50 0 YAN concentration SD (mg/L) Region B YAN concentration (mg/L) 2007 2008 4(b) 120 100 80 60 40 20 0
Region A
Region A
Region B
Figure 4(a). The average YAN concentration in juices from two regions in South Australia for the 2007 vintage and the 2008 vintage. For region A, n = 855 in 2007 and 1272 in 2008; for region B, n = 414 in 2007 and 788 in 2008. Figure 4(b). Standard deviation in average YAN concentration from wine regions A and B was greater in 2008 than in 2007. concentrations of inhibitors in the stuck wine, especially ethanol. It is, however, critically important that the yeast not be starved of sugar or nitrogen during the stepwise acclimatisation procedure. The culture should also be briefly aerated at each step. Fresh yeast lees from successfully completed ferments can also be useful for reinvigorating or restarting ferments when a relatively small amount of residual sugar remains. A small addition of DAP and limited aeration, once the yeast is actively fermenting, promotes good activity. This procedure provides a more convenient rescue option when yeast lees are available. Looking ahead, the AWRI is also alerting winemakers to the longer term effects of the 2008 heatwave. If red wines contain higher than usual amounts of residual sugar, and other nutrients added as fermentation stimulants, for example, the Brettanomyces/Dekkera yeast, can strike later in the maturation cycle or even after bottling of unfiltered wines. The higher alcohol concentrations of 2008 wines might slow the growth of this spoiler meaning that greater vigilance should be maintained further on down the process chain. Malolactic fermentation is also adversely affected by high alcohol levels such that Brettanomyces/Dekkera yeast can have a greater opportunity while the wine is unprotected by sulfites. The more alcohol tolerant lactobacilli, which are capable of forming biogenic amines, will also thrive if the pH is not maintained below 3.5, which is more favourable to Oenococcus. The impact of March 2008 might continue if not managed with greater care due to the perturbed nature of this years wine chemistry.
Stuck fermentations what you can do

Increase the concentration of sulfur dioxide added to grape bins. Th is will keep microbial bugs at bay and slow oxidation which can speed up at higher temperatures. Sanitise bins between loads. Cover bins during transport to keep the sun off fruit. Clean all equipment to stop bacteria. Choose yeast known to have high tolerance to alcohol and prepare it properly. Rehydration of dried yeast with complex inactivated yeast nutrients can be benefi cial for stressful ferments. Dilute very high sugar musts with low strength juice (LSJ) before fermentation to improve wine balance, in accordance with wine statutory regulations. Add tartaric acid as soon as must tanks are is not possible, add DAP as a precaution mixed and acidity levels are known. Check against low YAN, especially in dry years and again after thorough mixing to ensure le- when sugar concentrations are high, since vels are correct. more YAN is needed by yeast to achieve low Take steps to reduce pH to improve the effi residual sugars. cacy of sulfur dioxide. Lower pH increases Aeration of ferments around the mid point its antimicrobial and antioxidant proper- of fermentation can be highly benefi cial by ties. It controls the growth of unwanted restoring lagging rates and has no known microorganisms including lactobacilli, adverse impact on wine fl avour, rather it some species of which are known to inhibit can prevent quality losses which sometiyeast development. mes result from stuck fermentations. Monitor pH during fermentation and main- Increasing juice turbidity consistent with tain it between 3.4-3.5. target wine style can considerably improve Measure YAN, preferably on the last vine- growth and fermentation activity. yard maturity sample before harvest, so Consider adding lysozyme to must of ferthat DAP can be added accordingly. If this ments to control bacterial development.
80
Seminario Tcnico
ACKNOWLEDGEMENTS
The Australian Wine Research Institute, a member of the Wine Innovation Cluster in Adelaide, is supported by Australias grapegrowers and winemakers through their investment body, the Grape and Wine Research and Development Corporation, with matching funds from the Australian Government. We thank Sharon Mascall and Rae Blair for editorial assistance, and JeffEglinton for the preparation of illustrations.
Henschke, P.A. (1997) Stuck fermentation: causes, prevention and cure. Allen, M.; Leske, P.; Baldwin, G., eds. Advances in juice clarification and yeast inoculation: proceedings of a seminar; 15 August 1996; Melbourne, Victoria. Adelaide, South Australia: Australian Society of Viticulture and Oenology; 1997: 30-38, 41. Sablayrolles, J.M.; Dubois, C.; Manginot, C.; Roustan, J.L. and Barre, P. (1996) Effectiveness of combined ammoniacal nitrogen and oxygen additions for completion of sluggish and stuck fermentations. Journal of Fermentation and Bioengineering 82:377-381. Schmidt, S.A.; Tran, T.; Chambers, P.J.; Herderich, M.J. and Pretorius, I.S. (2006) Developing indicators of wine yeast performance: an overview of the impact of ethanol stress. Australian and New Zealand Wine Industry Journal 21:24-30. Ugliano, M.; Henschke, P.A.; Herderich, M.J. and Pretorius, I.S. (2007) Nitrogen management is critical for wine flavour and style. Australian and New Zealand Wine Industry Journal 22:24-30. These articles can be obtained by contacting the AWRIs John Fornachon Memorial Library. Email library@awri.com.au, telephone (08) 8303 6600. Further information is also available on the AWRIs website www.awri.com.au A summary of factors affecting sub-optimal fermentation is presented by Dr Paul Henschke in a webcast at www.awri.com.au. This site is accessible to all Australian grape and wine levy payers.
FURTHER READING
Bell, S.J. and Henschke, P.A. (2005) Implications of nitrogen management for grapes and wine. Australian Journal of Grape and Wine Research 11:242-295. Bisson, L.F. and Butzke, C.E. (2000) Diagnosis and rectification of stuck and sluggish fermentations. American Journal of Enology and Viticulture 51:168177. Bisson, L.F. (1999) Stuck and sluggish fermentations. American Journal of Enology and Viticulture 50:107119. Eglinton, J.M. and Henschke, P.A. (1999) Restarting incomplete fermentations: the effect of high concentrations of acetic acid. Australian Journal of Grape and Wine Research. 5:71-78.
Summary
The 2008 vintage in southern Australia experienced an increase in High sugar levels led to high amounts of ethanol, which can be toxic cases of stuck fermentation. to yeast, leading to higher residual sugar levels in wine. Higher The March heatwave was a key factor. Yeast does not thrive in ex- nutrients can stimulate Brettanomyces/Dekkera yeast during matreme heat or cold, or indeed when subjected to rapid changes in turation. temperature. Low YAN levels after persistent drought also had an impact. Heat stress, transport delays and refrigeration problems gave Simple strategies such as keeping bins and equipment clean, mounwanted microbes a head start, further compromising yeast ac- nitoring pH and using the right yeast and nutrients, can give winetivity. makers the upper hand.
Textos asociados
81
82
Seminario Tcnico
Taking control of alcohol

Varela, C.; Kutyna, D.; Henschke, P.A.; Chambers, P.J.; Herderich, M.J.; Pretorius, I.S. The Australian Wine Research Institute, PO Box 197, Glen Osmond (Adelaide), South Australia 5064, Australia Alcohol is the backbone of wine, yet too much can put a wine off-balance. Taking control of alcohol levels in wine is, therefore, critical to the winemakers art; can winemakers bottle the sunshine flavours we expect of Australian wine but leave out some of the alcohol? One of the keys is wine yeast. Previously chosen for their efficiency in converting sunshine into alcohol, we are now generating new strains of yeast that make reduced levels of alcohol; still lots of sunshine in the bottle but with less risk of sunburn. Getting the alcohol level right in winemaking can be surprisingly difficult. This is particularly evident when grapes are grown where the weather is warm and fruit is given lots of time on the vine for flavour development; in these conditions high alcohol can become a problem. Over the past 20 years, the Australian Wine Research Institute has charted an increase in average alcohol levels in Australian wine. In 1984, levels were 12.4% v/v; in 2004, they had risen to 14.2% v/v, and similar stories are heard from around the grapegrowing regions of the world. The 2008 vintage hit another sugar high as the heatwave across southern Australia midway through harvest took its toll. Hot weather accelerates ripening, which leads to higher levels of sugar. Higher amounts of sugar lead to higher levels of alcohol. In countries like ours, where the sun shines for long hours and some grapes are left on the vine to create rich, full-bodied flavours, high alcohol is becoming an issue. Wine with high alcohol levels can mean higher costs. In countries where taxes are levied according to ethanol content, high alcohol wines can be taxed out of the market. High alcohol can also compromise flavour, and todays society is seeking a healthier approach to high alcohol consumption. To tackle the problem, the Australian wine sector is investigating new ways to lower the concentration of ethanol in wine. One strategy is to harvest grapes before they reach full maturity, when the concentration of sugar in the berries is lower. To a degree, this approach is already being used by some winemakers. But, until we understand viticultural factors that advance
flavour development in relation to sugar ripeness, this approach can undermine the full-bodied character and ripe fruit flavours for which some Australian wines are known. Removing sugar from grape must before fermentation is another way to lower ethanol but is relatively expensive to carry out. A third strategy used successfully at a number of wineries around the world is to remove alcohol from wine after fermentation. Even this has its drawbacks: it adds to production costs; might impact wine flavour under certain conditions, and not all international markets might accept Australian wine that has undergone this procedure. Another strategy is to target wine yeast. The hunt is on for strains of wine yeast that convert less of the sugar they consume into ethanol (see, for example, Figure 1). Commercially available Saccharomyces cerevisiae strains have been categorised by some yeast manufacturers according to the concentrations of ethanol they produce. But how different are these yeasts? Do strains really differ in terms of the ethanol they produce? To find out, scientists at the AWRI checked how much ethanol is produced by six commercial wine yeasts described by manufacturers as low- or high-ethanol strains. We also investigated two of our own novel wine yeasts produced at the AWRI to see how efficient they were at fermentation and how much ethanol they produced. The two strains came from early stage experimental work at the AWRI aimed at generating yeast that produce reduced amounts of ethanol.
A
Grape sugars: Glucose Fructose Glycerol
Ethanol C0 2
Grape sugars: Glucose Fructose
Ethanol
Figure 1. Sugar metabolism of wine yeast. A: Consumption of sugars leads mainly to the production of ethanol and carbon dioxide and, to a lesser extent, glycerol. B: Modifying yeast metabolism so more glycerol is synthesised reduces the amount of ethanol produced.
Textos asociados
83
Taking control of alcohol

12.0
CDGJ
acid as well as alcohol in the synthetic wine (CDGJ) and Chardonnay using advanced analysis techniques. The concentrations of ethanol produced by the six commercial wine strains are shown in Figure 2. In synthetic wine, ethanol concentrations varied between 11.3% v/v and 11.6% v/v with a maximum difference of 0.3% v/v. In Chardonnay, ethanol content varied between 12.4% v/v and 12.9% v/v, with a maximum difference of 0.5% v/v. The differences look small but are statistically significant. They are also supported by a previous research study that tested 113 strains of wine yeast grown in synthetic grape juice. Although there are no published data on final ethanol concentrations in red varieties, our research shows it is very likely that 0.5% v/v is the maximum difference possible by choosing a currently available, commercial wine yeast strain. Commercial strains do not give rise to large differences in ethanol concentrations. As a result, we are trying to generate novel strains of wine yeast that metabolise sugar in such a way that less ethanol is produced while maintaining high wine quality. Using a non-genetically modified (non-GM) approach, known as adaptive evolution, we are working to create the right conditions to persuade yeast to produce less ethanol. Even though the science is not straightforward, early results have been promising. So far, two prototype yeast strains have been produced AWRI 1689 and AWRI 1690. Both generate less ethanol than their parent strain N96 (similar to stra-
11.5 Ethanol [% v/v]
11.0
10.5
10.0 AWRI 796 Maurivin B A WRI R2 PDM UCD522 N96 AWRI 1689 AWRI 1690
13.5
Chardonnay
13.0
12.5 Ethanol [% v/v]
12.0
11.5
11.0
10.5
AWRI 796 Maurivin B A WRI R2
PDM
UCD522
N96
AWRI 1689 AWRI 1690
Figure 2. Ethanol content of wine produced from chemically defined grape juice (CDGJ) and Chardonnay juice, fermented with different commercial wine yeast strains. We tested the eight different yeasts using chemically defined grape juice (CDGJ), containing specified levels of sugar and yeast assimilable nitrogen, and Chardonnay juice. Fermentation took place in controlled laboratory conditions and, once complete, samples were collected for analysis. The researchers measured residual sugar, ethanol, glycerol, malic acid and acetic
Table 1. Product concentrations in wine made from Chardonnay juice using N96 and wine yeast variants obtained by adaptive evolution. Strain N96 AWRI 1689 AWRI 1690 Ethanol [% v/v] 12.9 0.1 12.7 0.1 12.6 0.1 Glycerol [g/L] 5.8 0.1 7.0 0.0 7.1 0.0 Acetic acid [g/L] 0.1 0.0 0.1 0.0 0.0 0.0 Fermentation efficiency* [g sugar per 1% ethanol] 16.1 0.1 16.4 0.1 16.5 0.1
* Initial and residual sugar concentrations were used to calculate fermentation efficiency. Table 2. Product concentrations in wine made from Chardonnay juice using a range of different commercial wine yeast strains. Strain AWRI 796 Maurivin B AWRI R2 PDM UCD 522 N96 Ethanol [% v/v] 12.4 0.1 12.7 0.1 12.7 0.1 12.8 0.1 12.8 0.0 12.9 0.1 Glycerol [g/L] 7.7 0.2 6.4 0.0 6.4 0.0 5.9 0.1 6.3 0.1 5.8 0.1 Acetic acid [g/L] 0.1 0.0 0.5 0.0 0.1 0.0 0.2 0.0 0.1 0.0 0.1 0.0 Fermentation efficiency* [g sugar per 1% ethanol] 16.8 0.2 16.5 0.1 16.4 0.1 16.3 0.1 16.2 0.0 16.1 0.1
* initial and residual sugar concentrations were used to calculate fermentation efficiency.
84

ins known in the industry as EC1118, Pris de Mousse and PDM) but were still fast at fermentation. The two new strains metabolised a small portion of sugar in such a way that it did not turn into ethanol (Table 1). It was also important to investigate other metabolites, since major distortions in their concentrations might affect aroma or flavour. Table 2 shows glycerol and acetic acid concentrations in Chardonnay wines, fermented using commercial wine yeast strains. For all strains, there was clearly a link between ethanol and glycerol concentrations. Higher glycerol was associated with lower ethanol. The major component of volatile acidity, acetic acid, was not affected. The decrease in ethanol concentration might be small compared with the two lowered ethanol prototype yeast strains produced by the AWRI, but we are confident our non-GM strategy is working. The AWRIs technology should be capable of generating strains that are even lower in ethanol than those currently available. For winemakers wanting to take control of high alcohol, innovation is driving the evolution of wine yeast in the right direction. Nature took some 20 million years to evolve highly efficient fermentation yeast, we hope to reverse some of this evolution in a relative blink of the eye!
Seminario Tcnico
FURTHER READING
De Barros Lopes, M.; Eglinton, J.M.; Henschke, P.A.; Hj, P.B. and Pretorius, I.S. (2003) The connection between yeast and alcohol production in wine: Managing the double edged sword of bottled sunshine. Australian and New Zealand Wine Industry Journal 18:27-31. Godden, P.W. and Gishen, M. (2005) Trends in the composition of Australian wine 1984-2004. In: Blair, R.J.; Francis, M.E. and Pretorius, I.S. (ed) Advances in wine science commemorating 50 years of The Australian Wine Research Institute, The Australian Wine Research Institute, pp115-139. Guth, H. and Seis, A. (2002) Flavour of wines: towards an understanding by reconstitution experiments and an analysis of ethanols effect on odour activity of key compounds. Blair, R.J.; Williams, P.J. and Hj, P.B., (eds). In: Proceedings of the eleventh Australian Wine Industry Technical Conference; 7-10 October 2001. Adelaide, SA Australian, Australian Wine Industry Technical Conference Inc.; pp128-139. Jenson, I. (1997) Differences in alcohol production by various yeast strains: myth or fact? Allen, M.; Leske, P. and Baldwin, G. (eds.) Advances in juice clarification and yeast inoculation: Proceedings of a seminar; 15 August 1996; Melbourne, Vic. Adelaide, SA: Australian Society of Viticulture and Oenology; pp24-25. Palacios, A.; Raginel, F. and Ortiz-Julien, A. (2007) Can the selection of Saccharomyces cerevisiae yeast lead to variations in the final alcohol degree of wines? Australian and New Zealand Grapegrower and Winemaker 527, 71-75. Piskur, J.; Rozpedowska, E.; Polakova, S.; Merico, A. and Compagno, C. (2006) How did Saccharomyces evolve to become a good brewer? Trends in Genetics 22, 183-186.
ACKNOWLEDGEMENTS
The Australian Wine Research Institute, a member of the Wine Innovation Cluster in Adelaide, is supported by Australias grapegrowers and winemakers through their investment body, the Grape and Wine Research and Development Corporation, with matching funds from the Australian Government. The authors wish to thank Rae Blair and Sharon Mascall for editorial assistance.
Summary
Hot weather and mature fruit make high alcohol levels in wine more likely. The 2008 vintage is set to hit a sugar high, with high levels of ethanol. Winemakers want to keep alcohol under control for cost, taste and health reasons. Scientists at the AWRI have pioneered a new, GM-free approach to persuade yeast to produce less ethanol during fermentation. Studies have shown that the maximum variation in ethanol levels from current, commercial yeast strains is 0.5% v/v. Innovation at the AWRI is driving the evolution of new, low ethanol yeast in the right direction.
Textos asociados
85
86
Seminario Tcnico
A la recerca del codi digital dels llevats del vi

Borneman, A.R.; Forgan, A.H.; Chambers, P.J. i Pretorius, I.S. The Australian Wine Research Institute, Glen Osmond (Adelaida), Australia. Per primera vegada, cientfics del Australian Wine Research Institute han seqenciat el genoma dun llevat del vi, caracteritzant la recepta de la vida daquest microorganisme amic de lenleg. Un cam obert al desenvolupament de noves soques que puguin contribuir amb solucions innovadores al problema de les parades fermentatives i a augmentar les opcions de lenleg. Cada quatre anys, els Jocs Olmpics inspiren al mn amb actuacions espectaculars i proeses de resistncia, velocitat i elegncia. Ens sorprenem davant les fites atltiques dels competidors i la majoria de nosaltres noms podem preguntar-nos com aconsegueixen aquests campions arribar a aquests estndards de somni. Qu fa a aquests guanyadors tan diferents de la resta de persones? No som la mateixa espcie, i per tant, no haurem de tenir tots el mateix potencial? No podrem, tamb nosaltres, guanyar una medalla dor en nataci o atletisme si comptssim amb el mateix entrenament, dieta i estil de vida? La resposta s negativa. Els atletes delit neixen amb un potencial que porta el segell de lor ja estampat. Tenen el tipus de fibres musculars, el fsic, la fisiologia i les aptituds que, amb entrenament adequat, poden arribar a ser perfeccionats per a lxit internacional. Lamentablement, la majoria de nosaltres requerirem de molt ms que aquest afinament per assolir aquest nivell; fins que la binica ens permeti substituir all amb el que vam nixer, quan parlem datletisme, la majoria de nosaltres ens haurem de conformar amb participar en una lliga amateur o, fins i tot, menys.
sistible vi a partir del most del ram. La majoria dels llevats del vi sn de la mateixa espcie, Saccharomyces cerevisiae, per no tots els membres daquest grup sn capaos de produir vi i, entre aquelles soques que ho sn, hi ha una considerable variaci de com deficients sn i com fidedignament fan la seva feina i com poden produir vins de qualitat. Aix ens porta a la segent pregunta: Qu marca a un llevat del vi? Qu existeix en el funcionament intern daquest atleta delit, que li permet crixer en un ambient tan hostil i aconseguir vins amb medalles dor mentre altres soques de S. cerevisiae no passen de la lnia de sortida? Estudis portats a terme a lAustralian Wine Research Institute (AWRI) comencen a desvetllar misteris de les variacions entre soques de S. cerevisiae, essent els primers resultats obtinguts realment prometedors. La variaci en el rendiment que observem entre soques de S. cerevisiae s un atribut heretable; aix significa que est genticament determinat. Per tant, el punt de partida per caracteritzar aquesta variaci shauria denfocar prioritriament en la gentica dels llevats. Sortosament, S. cerevisiae va ser el primer organisme del seu tipus en tenir el seu genoma seqenciat. Aix va assolirse fa uns deu anys en una soca coneguda com S288c, escollida per la seva idonetat a les condicions del laboratori (per una informaci ms detallada sobre qu sn els gens i els genomes, consulteu requadre). Als cientfics els encanta aquest llevat ja que s molt fcil treballar amb ell, per daltra banda, no seria una soca capa de guanyar cap medalla en el camp de la producci de vi, de fet, s possible que ni tan sols arribi a nivells dels que en direm amateurs . No obstant, per discernir qu s el que fa un llevat del vi tan diferent daltres soques de S. cerevisiae s necessari disposar dalguna cosa amb qui comparar-la, i S288c s un bon punt de partida. El genoma duna altra soca de S. cerevisiae, YJM789, sha seqenciat recentment. El genoma daquest llevat, un patogen oportunista allat dels pulmons dun pacient amb SIDA, va resultar fora diferent al dS288c. Aix, ara disposem de dues versions diferents de S. cerevisiae amb les que poder comparar el llevat del vi, i aix va ser el que vam trobar.
Algunes de les seqncies de DNA addicional trobades en el llevat del vi, no sassemblen a res trobat en daltres espcies de Saccharomyces
La variaci individual
Aquestes diferncies en el rendiment dels individus duna mateixa espcie no sn tan sols exclusives de lsser hum. De fet, podem apreciar- les contnuament a la natura. Prenem, per exemple, lhumil llevat que els enlegs utilitzen per produir el complex i irre-
Lespecificitat gentica del llevat del vi

El nostre llevat del vi presenta ms diferncies amb les dues soques prviament seqenciades, que les que presenten aquelles dues entre elles. Prop del 0,6 ACE Revista dEnologia 4rt Trimestre 2008
Textos asociados
87
A la recerca del codi digital dels llevats del vi
% de les lletres gentiques de la seqncia del llevat del vi sn diferents de les de la soca de laboratori. Aix pot semblar una molt petita diferncia, per si considerem que la distncia gentica entre dues espcies com els humans i els ximpanzs s nicament dun 1-2 %, el 0,6 % seria una xifra fora considerable per a dues soques duna mateixa espcie. Daltra banda, potser el que sigui ms interessant daquests resultats, s que shan trobat seqncies addicionals al llevat del vi, que sn suficients per afegir com a mnim 27 gens que no estan presents en les soques de Saccharomyces amb que va ser comparada. De fet, algunes de les seqncies en aquest DNA addicional no sassemblen a res trobat en daltres espcies de Saccharomyces. De fet, aquestes seqncies sn ms similars a gens trobats en fongs fora llunyans filogenticament. Encara no sabem com van arribar al genoma del llevat del vi, per tenim una certa curiositat per avaluar si aquestes seqncies estan involucrades en la diferenciaci entre llevats del vi i altres S. cerevisiae, especialment en all referent a les caracterstiques necessries per produir vi. Alguns dels gens especfics en el llevat del vi codifiquen, probablement, protenes associades amb la paret cellular, un tret del llevat que s, sense cap mena de dubte, important per a la seva resistncia en ambients inhspits. Ens agradaria descobrir si aquests gens tenen alguna mena dimpacte en la robustesa del
En el futur, serem capaos desbrinar quins daquests trets nics del genoma dun llevat del vi sn determinants en lmbit de la producci vincola
llevat del vi, una caracterstica que s de gran importncia per completar la fermentaci. Ens preguntem, per exemple, si aquests gens fan al llevat del vi, ms o menys vulnerable a fermentacions lentes o a parades fermentatives. Tamb hem identificat gens que probablement codifiquen protenes associades amb la captura daminocids (un transportador daminocids neutre) i el seu metabolisme (una aspartat transaminasa). Pel fet que el metabolisme daminocids est directament relacionat amb el desenvolupament de compostos associats a sabor i aroma, s temptador suggerir que aquests gens podrien tenir un impacte en els atributs sensorials del vi, encara que aix shauria dinvestigar i confirmar. A ms a ms, existeixen multitud gens dels quals encara no podem inferir les seves funcions. Aquests podrien resultar ser els ms interessants de tots; el temps i el treball experimental ens ho diran.
De manera molt interessant, tamb hem trobat alguns reordenaments cromosmics en el genoma daquest llevat i sobre els quals tamb estem intrigats, encara que de moment no podem fer-nos una idea de quina ser la seva veritable importncia i abast.
El que fa a un llevat del vi

Qu ens portar el futur a partir dara que ja disposem daquesta enorme font dinformaci sobre un lle-
Desxifrant el codi: gens i genomes

ls gens sn receptes per fabricar protenes. Per exemple, les cllules del lector posseeixen un gen o recepta per fer la protena insulina, que s una hormona que regula els nivells de sucre en sang. Tamb tenim gens o receptes que instrueixen a les nostres cllules sobre com fer protenes que controlen lestatura fins la que creixerem, el color dels nostres ulls, la forma general del nostre cos, etc. Sn aquestes mateixes receptes de la vida les que dicten si disposarem de potencial atltic o no i, degut a que les heretem dels nostres pares, acabarem semblant-nos a ells. Si els gens sn receptes, llavors els genomes sn llibres de receptes. El genoma hum disposa de totes les receptes necessries per fabricar les protenes que es requereixen per construir un cos hum, des del moment de la concepci fins la maduresa, i per reparar i defensar aquest cos durant tota la vida. Tota aquesta fisiologia i anatomia estan modelades per una collecci de 20 000 25 000 gens que sestenen pel genoma hum. Excepte en el cas de tenir un bess idntic, el nostre llibre de receptes s diferent del que tenen la resta dels nostres congneres. El llenguatge dels gens s molt diferent dels llen- guatges que fem servir habitualment per comunicar-nos els uns amb els altres. Est basat en un alfabet de tan sls quatre lletres (A, T, G i C), i el seu lxic est limitat a paraules amb tres lletres, fet que significa que noms existeixen 64 paraules en el diccionari gentic. Tot i el que semblaria a primer cop dull, aix s ms que suficient per elaborar tot el conjunt dinstruccions que permeten construir totes les protenes (enzims, hormones, anticossos, cartlags, etc.) que requerim per a la vida. El paper en que les paraules que configures les receptes de la vida esta escrites es coneix com DNA, i quan nosaltres llegim el llibre de receptes complet dun organisme, desxifrant el que est gravat al DNA, diem que estem seqenciant el seu genoma. El que acabem tenint en aquest procs s una llarga seqncia de milions de lletres A, T, C i G, sense espais o signes de puntuaci evidents, i que hem de desxifrar. Afortunadament, disposem de programes informtics que poden fer la major part daquesta feina per nosaltres.
88
Seminario Tcnico
Els membres de lequip investigador australi. Desquerra a dreta: Paul Chambers, Angus Forgan, Sakkie Pretorius i Anthony Borneman. vat del vi? Per suposat, serem capaos de determinar quins daquests trets nics del genoma dun llevat del vi sn determinants en lmbit de la producci de vi. Tot i aix, tamb ens plantegem acumular ms dades a partir daquest projecte mitjanant la seqenciaci i comparaci dels genomes daltres llevats del vi, aquelles que posseeixen diferents propietats per la seva capacitat per produir vi. Aix ens permetr determinar qu s com a tots els llevats del vi (per exemple, quins sn els requeriments fonamentals dun llevat del vi) i quines diferncies entre elles condueixen a la producci de vins amb diferents qualitats (per exemple, la predisposici a produir uns determinats aromes i matisos frutals). Un cop puguem entendre que s all que determina el dest dun llevat del vi, i el significat profund daquestes variacions entre soques de llevats del vi, estarem en una millor posici per desenvolupar variants daquest microorganisme que puguin completar la marat de la fermentaci sense alentir-la o evitant quedar parades durant el seu curs, produint al mateix temps vins mereixedors duna medalla dor; i tot aix seria possible sense afegir additius que incrementin el rendiment. De manera similar als nostres esportistes olmpics, el sector del vi tamb ha de tenir aspiracions a medalles dor. Amb el suport duna cincia de qualitat i una recerca robusta, haurien de ser tot ors per als productors de vi. Research and Development Corporation, a ms duna subvenci equivalent del Govern australi. La recerca en lrea de la biologia de sistemes al AWRI es realitza amb recursos provinents en part del National Collaborative Research Infrastructure Strategy, una iniciativa del Govern australi, amb fons addicionals del Govern de lEstat de South Australia. Agram tamb la contribuci de la Australian Genome Research Facility, membre de Bioplatforms Australia, on es va portar a terme la seqenciaci del genoma del llevat del vi. Tamb volem agrair a Sharon Mascall i Rae Blair per lajut en la redacci, i a Jeff Eglinton per la preparaci de les illustracions. Els resultats cientfics detallats daquest treball han estat publicats a la revista FEMS Yeast Research.
Bibliografia
Borneman, A.R.; Forgan, A.H.; Chambers, P.J.; Pretorius, I.S.: Comparative genome analysis of a Saccharomyces cerevisiae wine strain, FEMS Yeast Research 2008; 8: 1185-1195. Borneman, A.R.; Forgan, A.H.; Chambers, P.J.; Pretorius, I.S.: Unravelling the genetic blueprint of wine yeast, Australian and New Zealand Wine Industry Journal 2008; 23: 21-23. Borneman, A.R.; Forgan, A.H.; Chambers, P.J.; Pretorius, I.S.: Cracking the genetic code of wine yeast, Wine Business Monthly 2008, octubre: 41-43. Borneman, A.R.; Chambers, P.J.; Pretorius, I.S.: Yeast Systems Biology: modelling the winemakers art, Trends in Biotechnology 2007; 25: 349-355. Goffeau, A.; Barrell, B.G.; Bussey, H.; Davis, R.W.; Dujon, B.; Feldmann, H.; Galibert, F.; Hoheisel, J.D.; Jacq, C.; Johnston, M.; Louis, E.J.; Mewes, H.W.; Murakami, Y.; Philippsen, P.; Tettelin, H.; Oliver, S.G.: Life with 6000 genes,
Agraments
Els membres de lequip del AWRI responsables de discernir el mapa gentic del llevat del vi sn els doctors Anthony Borneman, Angus Forgan, Paul Chambers i Sakkie Pretorius. LAustralian Wine Research Institute, un dels membres del Wine Innovation Cluster a Adelaida, disposa del suport econmic dels productors de ram i de vi a travs del seu organisme dinversi, el Grape and Wine
Textos asociados
89
90
Seminario Tcnico
Effect of Microoxygenation on Color and AnthocyaninRelated Compounds of Wines with Different Phenolic Contents
Cano-Lpez, M.; Pardo-Mnguez, F.; Schmauch, G.; Saucier, C.; Teissedre, P.L.; Lpez-Roca, J.M.; and Gmez-Plaza, E. Departamento de Tecnologa de Alimentos, Nutricin y Bromatologa, Facultad de Veterinaria, Universidad de Murcia, Spain, Bodegas San Isidro, Jumilla, Murcia, Spain, and Facult dOenologie, Universit Victor Segalen, Bordeaux 2, France Several factors may affect the results obtained when micro-oxygenation is applied to red wines, the most important being the moment of application, the doses of oxygen, and the wine phenolic characteristics. In this study, three red wines, made from Vitis vinifera var. Monastrell (2005 vintage) and with different phenolic characteristics, were micro-oxygenated to determine as to how this technique affected the formation of new pigments in the wines and their chromatic characteristics. The results indicated that the different wines were differently affected by micro-oxygenation. In general, the micro-oxygenated wines had a higher percentage of new anthocyanin-derived pigments, being that this formation is more favored in the wines with the highest total phenol content. These compounds, in turn, significantly increased the wine color intensity. The wine with the lowest phenolic content was less influenced by micro-oxygenation, and the observed evolution in the degree of polymerization of tannins suggested that it might have suffered overoxygenation. KEYWORDS: Wine; color; anthocyanins; anthocyanin-derived compounds; micro-oxygenation.
while their interactions with other compounds largely determine the color changes observed in maturing wines. The wine phenolic content depends on the grape characteristics and on the winemaking process. Factors such as phenolic maturity of the grapes, length of maceration, frequency of pumping over, etc. determine the final wine phenolic content (13). The importance of oxygen in the evolution of wine color has been studied for many years, both as regards its role in polyphenol oxidation (47) and as a promoter of the formation on new anthocyanin-derived compounds (5, 811). Indeed, one way of manipulating the phenolic structure of a wine is to use the micro-oxygenation (MO) technique, which relies on the formation of microbubbles through the injection of gaseous oxygen into the wine using a microdiffuser (12). These bubbles rise through the wine, dissolving as they travel to the surface. Empirical results have indicated that MO benefits include the stabilization of wine color, the softening of tannins, and the lessening of vegetative aromas (13, 14). Reactions involving wine polyphenols are the key to these processes, which include changes in proanthocyanin chain length and the consequent effect on wine astringency and the linking of anthocyanins and tannins to form more stably colored forms. Dissolved oxygen leads to the formation of acetaldehyde that, in turn, reacts with flavanols and anthocyanins to induce the formation of a very reactive carbocation that quickly reacts with another flavanol molecule or with anthocyanin, producing ethyl bridge-linked compounds (15, 16). They are unstable (17) and undergo reactions that lead to the formation of new compounds such as flavanyl pyranoanthocyanins. These end products are more stable and colored than the original compounds (11). Moreover, incorporation of anthocyanin into tannin structures also may lead to a decrease in astringency (18). Since its commercial adoption, MO has become common practice and is now used worldwide, although most of the available information is from empirical results. Only a few scientific publications can be found that are related to the effects of MO (8, 1923). Several factors may affect the final results obtained by MO, the most important being the moment of application, doses of oxygen, and wine characteristics. Wines have marked differences in their respective abilities to consume oxygen. As a general rule, this facility is directly related to their relative concentration of polyphenols since phenolic compounds are the main consumers of oxygen (60%) together with ethanol (20%) and SO2 (12%) (22). In our first studies, we tested the use of different doses of oxygen and the effect of the moment of application on wine chromatic characteristics (23, 24). Here, we report the results of a commercial scale MO experiment where the influence of applying oxygen to three wines made from Monastrell grapes of J. Agric. Food Chem. 2008, 56, 59325941
INTRODUCTION
Phenolic compounds are responsible for many of the organoleptic characteristics of wines. Among them, anthocyanins are responsible for the color of red wine,
Textos asociados
91
Effect of Micro-oxygenation on Color and Anthocyanin-Related Compounds of Wines with Different Phenolic Contents
Table 1. Evolution of Some Physicochemical Parameters during MO of Monastrell Winesa t0 W1 pH titratable acidityb volatile acidityc free SO2 (mg/L) total SO2 (mg/L) acetaldehyde (mg/L) 3.72 5.87 0.39 25 39 22.2 W2 pH titratable acidityb volatile acidityc free SO2 (mg/L) total SO2 (mg/L) acetaldehyde (mg/L) 3.66 6.31 0.33 25 41 29.1 W3 pH titratable acidityb volatile acidityc free SO2 (mg/L) total SO2 (mg/L) acetaldehyde (mg/L) 3.63 6.45 0.40 27 48 32.3 t1 t2 t3 W1 W1 W1 W1 W1 W1 (C) (MO) (C) (MO) (C) (MO) 3.78 5.76 0.40 26 32 13.5 3.76 5.35* 0.41 22* 28* 12.8 3.85 5.38 0.43 37 50 15.1 3.83 5.17* 0.47 37 49 16.6 3.83 5.06 0.42 22 48 21.3 3.79* 4.90* 0.34 14* 46 32.6*
W2 W2 W2 W2 W2 W2 (C) (MO) (C) (MO) (C) (MO) 3.71 5.83 0.33 31 35 23.0 3.67 5.96 0.34 22* 33 24.7 4.00 5.60 0.29 38 61 32.2 4.00 5.73* 0.32 33 61 23.4* 3.83 5.08 0.37 16 51 41.4 3.80 4.90 0.33 11* 35* 45.2
When MLF was complete for all wines, SO2 was added to leave the wines with a free SO2 content close to 30 mg/L, and MO was resumed (January 19, 2006). At this moment, the oxygen supply was reduced to avoid accumulation of acetaldehyde (3 mL/L/month). After 2 months, the oxygen supply was reduced again (1.5 mL/L/month) before it was completely stopped. The wine was analyzed immediately before the MO system began (t0), at the beginning of MLF (t1), when MO began again after MLF (t2), and 15 days after the MO system was stopped (t3) since wines take 8-10 days to absorb the oxygen, depending on temperature and phenolic composition of the wines (26). The MO system (Agrovin S.A., Alcazar de San Juan, Spain) was comprised of an oxygen cylinder (food grade) and a dosing chamber that allowed the doses of oxygen flowing through nine different microdiffusers to be programmed. General Determinations. pH and titratable acidity were measured using an automatic titrator (Metrohm, Herisau, Switzerland). Volatile acidity was determined according to the OIV Official Methods (27). Acetaldehyde and malic acid concentration were determined using enzymatic test kits from Roche Boehringer, Mannheim, Germany. The SO2 concentration (free and total) was measured iodometrically by the Ripper procedure (28) modified to detect the end point potentiometrically with an automatic titrator (Metrohm, Herisau, Switzerland). Identification and Quantification of Anthocyanins. Wines were analyzed by direct injection of the samples previously filtered through a 45 m nylon filter (Teknokroma, Barcelona, Spain). The HPLC analyses were performed on a Waters 2690 liquid chromatograph (Waters, Milford, MA), equipped with aWaters 996 diode array detector and a 250 mm 4 mm i.d., 5 m particle size Lichrocart RP-18 column (Merck, Darmstadt, Germany), using as solvents 4.5% aqueous formic acid (solvent A) and acetonitrile (solvent B) at a flow rate of 0.8 mL/ min. Elution was performed with a gradient starting with 10% B to reach 14.5% B at 30 min, 15.2% B at 45 min, 18% B at 60 min, 25% B at 100 min, and 25-100% B in 30 min. Chromatograms were recorded at 520 nm. Compounds were identified by comparing their UV spectra recorded with the diode array detector and those reported in the literature (11, 29). In addition, an HPLC-MS analysis was conducted to confirm each peak identity. An LC-MSD-Trap VL-01036 liquid chromatograph-ion trap mass detector (Agilent Technologies, Waldbronn, Germany) equipped with an electrospray ionization (ESI) system was used. Elution was performed with the HPLC analysis conditions detailed previously. The heated capillary and voltage were maintained at 350 C and 4 kV, respectively. Mass scans (MS) were measured from m/z 300-1100. Mass spectrometry data were acquired in the positive ionization mode. Anthocyanins and anthocyanin-
W3 W3 W3 W3 W3 W3 (C) (MO) (C) (MO) (C) (MO) 3.66 5.70 0.37 32 44 25.6 3.66 5.56 0.38 25* 35 23.2 4.01 5.66 0.33 26 64 28.7 4.02 5.27* 0.37 29 64 28.4 3.77 5.09 0.37 16 61 22.3 3.78 4.89* 0.39* 11* 38* 35.0*
a An asterisk indicates significant differences between control and microoxygenated wines for each time considered. b Expressed as g/L of tartaric acid. c Expressed as g/L of acetic acid.
different phenolic contents was investigated.
MATERIALS AND METHODS

Wine Samples. Three different red wines, made from Vitis Vinifera var. Monastrell (2005 vintage), differing in their total phenol content, were used for the experiment (W1, W2, and W3). Each wine was distributed into four 17 500 L tanks, and the MO experiment was carried out in triplicate, with a control (C) and three MO tanks for each type of wine. The height of each tank was 4.5 m, enough for the complete dissolution of oxygen microbubbles into the wine. MO began just after alcoholic fermentation had finished (November 7, 2005), applying a oxygen dose of 10 mL/L/month. Malolactic fermentation (MLF) occurred spontaneously. When MLF started (detected by the decrease in malic acid), the MO system was stopped (November 30 for W1 and December 20 for W2 and W3). During MLF, the bacteria consume the acetaldehyde produced. They are capable of metabolizing acetaldehyde, even the acetaldehyde bound to sulfur dioxide (25); therefore, any excess of acetaldehyde produced during the MO process will disappear.
92

derived compounds were quantified at 520 nm as malvidin- 3-glucoside, using malvidin-3-glucoside chloride as an external standard (Extrasynthe`se, Genay, France). Color Determinations in Wines. Absorbance measurements were made in a Helios Alpha spectrophotometer (Thermo Electron Corp., Waltham, MA) with 0.1, 0.2, or 1 cm path length glass cells. Samples were previously centrifuged, and the pH was adjusted to 3.6. CIELab parameters were determined by measuring the transmittance of the wine every 10 nm from 380 to 770 nm, using a D65 illuminant and a 10 observer. The L* (measure of lightness), C* (measure of chroma), and H* (hue angle) parameters were determined. Color intensity (CI), calculated as the sum of absorbance at 620, 520, and 420 nm, and percentages of red (%R), yellow (%Y), and blue (%B) color were determined according to Glories (30); the hue was calculated as the ratio between absorbance at 420 nm and absorbance at 520 nm (31). Total phenols (abs280) were calculated according to Ribereau Gayon et al. (32). Wine color (WC), total color of pigments (WCP), and color due to derivatives resistant to SO2 bleaching (CDRSO2) were determined using a method adapted from that described by Levengood and Boulton (33), with all measurements made at 520 nm. These parameters were calculated as follows. WC. Twenty microliters of 10% acetaldehyde solution was added to 2 mL of a wine sample in a 10 mm plastic cuvette to release any anthocyanins involved in bisulfite adducts. After 45 min, the sample was placed in a 1 mm cuvette. The reading was corrected to 10 mm path length by multiplying by 10. WCP. A total of 0.5 mL of wine was diluted in 20 mL of 0.1 N HCl. Absorbance was measured in a 10 mm cuvette after 30 min to ensure complete conversion of anthocyanins into the flavylium form. The reading was corrected for dilution. CDRSO2. A total of 160 L of a 5% SO2 solution (10% potassium metabisulfite solution) was added to 2 mL of the wine sample. After 1 min, the sample was placed in a 2 mm cuvette. The reading was corrected to 10 mm path length by multiplying by 5. Determination of Total Tannins. The wine tannin concentration was evaluated using a protein precipitation assay, with bovine serum albumin (BSA). Sample preparation and a protein precipitation assay were conducted according to methods described by Harbertson et al. (34). For quantification, results were compared with a (+)-catechin standard and reported as mg/L (+)-catechin equivalents. Analysis of Proanthocyanidins. Proanthocyanidin composition was determinated by HPLC-DAD-MS after purification and concentration of the wine extract and acid catalysis in the presence of excess phloroglucinol. The results of phloroglucinolysis provided information on the proanthocyanidin subunit composition (terminal and extension unit concentrations) and the mean degree of polymerization (mDP). The analyses were carried out in triplicate. The phloroglucinolysis protocol, described by Drinkine et al. (35), included a purification step using C18 solid-phase extraction (SPE). Water (15 mL) was added to 5 mL of wine, and the sample was passed through a preconditioned cartridge. The retained compounds were eluted with 50 mL of methanol with a flow rate of 2 mL/min. This fraction was dried under reduced pressure and then dissolved in 2 mL of methanol. The second step was the phloroglucinolysis reaction. A solution of 0.2 N HCl in methanol, containing 100 g/L phloroglucinol and 20 g/L ascorbic acid, was prepared. A total of 100 L of the wine sample was reacted with 100 L of the phloroglucinol reagent at 50 C for 20 min, and then 1 mL of 80 mM aqueous sodium acetate was added to stop the reaction. The extension and terminal units resulting from phloroglucinolysis (catechin, epicatechin, (epi)catechin gallate, and (epi)gallocatechin) were determined by LC-MS. LC-MS analyses were performed on a Micromass Platform II simple quadruple mass spectrometer (Micromass- Beckman, Roissy Charlesde-Gaulle, France) equipped with an electrospray ion source. The mass spectrometer was operated in negative-ion mode. The source temperature was 120 C, the capillary voltage was set at 3.5 kV, and the cone voltage was -30 V. HPLC separations were performed on a Hewlett-Packard 1100 series (Agilent, Massy, France) instrument including a pump module and a UV detector. Both systems were operated using Masslynx 3.4 software. The absorbance was recorded at 280 nm, and mass spectra were recorded from 200 to 1200 amu. The elution conditions were wateras follows: acetic acid (99:1; v/v) as solvent A, methyl alcohol as solvent B, and the following elution gradient: from 5 to 15% B in 5 min, 15% B for 2 min, from 15 to 20% B in 3 min, from 20 to 50% B in 10 min, from 50 to 100% B in 2 min, and from 100 to 5% B in 2 min, with a flow of 1 mL/min. The column used was a reversed-phase 4.6 mm 100 mm i.d., 3.5 m packing C18 Waters Xterra protected with a guard column of the same material (Agilent, Saint Quentin-en-Yvelines, France). Statistical Analysis. Significant differences between wines and for each variable were assessed with analysis of variance (ANOVA). This statistical analysis, together with a cluster analysis and a principal components analysis, was performed using Statgraphics 5.1 (Statistical Graphics Corporation, Rockville, MD).
Seminario Tcnico
Textos asociados
93
Figure 1. Development of monomeric anthocyanins and ethyl-linked compounds in W1, W2, and W3 wines (SD). Each point corresponds to t0, t1, t2, and t3.
RESULTS AND DISCUSSION

When comparing the initial composition of the studied wines (Table S1 in the Supporting Information and initial point in all figures), W1 and W2 showed a very similar phenolic content (abs280 of 52 and 58, respectively), while the highest phenolic content was found in W3 (abs280 of 76), mainly due to its high tannin content. Although tannins and color density were higher in W3, monomeric anthocyanins and WCP showed higher values in W2, a wine that showed a low degree of anthocyanin polymerization (CRDSO2). Color percentages also differed between the wines. W1 presented a higher yellow percentage and lower red percentage. W3 was the darkest wine, with the highest blue percentage. The tannin characterization showed that the percentages of the different flavanol units also differed. The profile of W1, with the highest percentage of epicatechin and epigallocatechin, indicated a high percentage of skin tannins (18, 36), whereas the lowest percentage of epigallocatechin and relatively high percentage of epicatechin gallate in W3 were according to the longer maceration period used during the elaboration of W3, with seed tannins contributing significantly to the tannin fraction. The profile found in W2 indicates
an intermediate situation, the maceration time being intermediate between W1 and W3. As seen in Table 1, there was little effect of MO on pH, and small differences were observed in titratable acidity after MLF (t2) and at the end of the experiment (t3). With regard to concerns about potential microbial spoilage, the volatile acidity did not increase during the studied period. When the MO application was finished, a higher concentration of acetaldehyde was detected in the W1 and W3 MO wines, as compared to their control counterparts, and similar quantities of acetaldehyde were found in W2 (C) and W2 (MO). Excessive oxidation may result in increased levels of acetaldehyde, a compound that at sensory threshold levels adversely affects wine flavor and aroma. Sensory detection limits for red wines are typically in the range of 40-100 ppm (37, 38). Our results showed that, even in wines containing the highest content of acetaldehyde, its sensory detection limit barely was reached. MO promoted a slightly lower content of free in the wines, but differences were small. Total was also lower in W2 and W3 MO wines. Boulet Moutounet (12) reported no effect of MO on SO2 SO2 and SO2
94
Seminario Tcnico
Figure2. Development of carboxypyranoanthocyanins and sum off lavanyl- and vinylpyranoanthocyanins in W1, W2, and W3 wines (SD).Each point corresponds to t0, t1, t2, and t3. content, whereas Prez-Magario et al. (39) reported small decreases due to MO, results that are similar to our findings. The results of Tao et al. (21) showed that SO2 had a moderating effect on the interaction of oxygen with wine polyphenols since it has the ability to reduce oxidized polyphenols and to remove peroxide. The levels of SO2 in MO wine affect the rate of development of wine polyphenol chemistry, including the formation of polymeric pigments and changes in tannin structure, affecting wine astringency. Anthocyanins and Derived Compounds. The predominant compounds detected in HPLC analyses were the monoglucosides of malvidin, petunidin, delphinidin, peonidin, and cyanidin and their respective acetyl and coumaryl derivatives. The combined concentration of all these compounds diminished with time (Figure 1) the decrease being larger in the MO wines, as also found by Atanasova et al. (8), a decrease that might be explained by the various reactions where anthocyanins are involved, including degradation or polymerization reactions. The most significant decrease was detected between t0 and t2, except in W1, whose concentrations barely changed during this period. This was probably due to the fact that W1 wines were MO for 17 days before MLF started, whereas W2 and W3 were MO for 44 days since the starting of MLF was delayed in these wines. Acetaldehyde-mediated condensation between anthocyanin- 3-glucoside and (epi)catechin leads to ethyl bridge-linked compounds. Three possible isomers were elucidated as well as another compound in which the flavanyl moiety is a dimer. Throughout the experiment, the concentration of ethyl-linked compounds was higher in the MO wines (Figure 1). These are compounds with a purple color, less sensitive to bleaching by SO2 and pH than monomeric anthocyanins, and their formation is favored by oxygen (8, 40). A very large increase was observed in W2 (MO) from t0 to t1, after which it fell sharply. These compounds are unstable and have a tendency to increase in size in the presence of available acetaldehyde. The behavior is in accordance with their reactivity; they are rapidly formed, but also, they can be rapidly broken down, releasing ethyl-flavanol units that, in turn, may react again with anthocyanins or dimers, giving more condensed products or even polymers (11). Pyroanthocyanins are compounds formed when a pyran ring is introduced between the C4 and the
Textos asociados
95
Figure 3. Development of direct anthocyanin-flavanol adducts and polymeric compounds in W1, W2, and W3 wines (SD). Each point corresponds to t0, t1, t2, and t3. hydroxyl group attached to C5 in the anthocyanin molecule. Some compounds result from the addition of anthocyanin and pyruvic acid (carboxypyranoanthocyanins). Several of these compounds were detected in our samples: petunidin 3-glucoside pyruvate, vitisin A (malvidin 3-(glucoside)pyruvate), acetyl vitisin A (malvidin 3-(acetylglucoside) pyruvate), and coumaryl vitisin A (malvidin 3-(coumarylglucoside) pyruvate). Another pyranoanthocyanin resulting from the cycloaddition of acetaldehyde to malvidin 3-glucoside, and referred to as vitisin B, also was found, and its quantification was included with the carboxypyranoanthocyanins. Pyranoanthocyanins are considered to be important compounds concerning the color of red wine since the cycloaddition process seems to strongly increase the stability of the products, and, in this way, vitisin A has been reported as being more stable than malvidin 3-glucoside or ethyl-linked compounds and more resistant to oxidation (41). The sum of carboxypyranoanthocyanins and vitisin B increased from t0 to t1 (Figure 2), with MO wines increasing more (except for W1). At the end of the experiment, carboxypyranoanthocyanins showed lower concentrations in the control wines than in the MO wines, the greatest increases being detected in W2. Other authors found a strong decrease in vitisin A and related compounds during the first year of wine storage, after which the concentration remained relatively constant (4244). Such a decrease, observed mainly in our study between t1 and t2, was ascribed to their incorporation into polymeric compounds (42). The concentration of carboxypyranoanthocyanins in wines is a result of a balance between the formation reactions and their incorporation in the polymeric compounds. The formation of vitisin A and related compounds requires the presence of free monoglucosides and pyruvic acid. Oxygen or reactive oxygen species are also necessary for the reaction to proceed since all cycloaddition pathways require an oxidation step to recover the flavylium moiety within the final structures (4547). Therefore, the MO process seemed to enhance the formation of vitisin-type compounds by providing oxygen. This result is contrary to that of Atasanova et al. (8), who stated that the addition of pyruvic acid to anthocyanins is not influenced by oxygen. W2, with a higher anthocyanin monoglucoside content (as quantified by HPLC), was the wine showing the highest final concentration of carboxypyranoanthocyanins. Another group of anthocyanins, constituted by hydroxyphenyl- pyranoanthocyanins, results from
96
Seminario Tcnico
Figure 4. Development of color intensity and hue in W1, W2, and W3 wines (SD). Each point corresponds to t0, t1, t2, and t3. the reactions of anthocyanins and vinyl derivatives (48, 49). Malvidin 3-glucoside- 4-vinylphenol, pinotin A (malvidin 3-glucoside-4-vinylcatechol), and malvidin 3-glucoside-4-vinylguaiacol were detected in our samples. The presence of vinyl derivatives in wine was attributed to enzymatic decarboxylation of phenolic acids by yeast enzymes (48). However, Schwarz and Winterhalter (50) demonstrated that pinotin A also could be formed as a result of the direct addition of caffeic acid to malvidin-3-glucoside, without the need for prior decarboxylation of cinnamic acid derivatives by wine yeasts (51). Also, flavanylpyranoanthocyanin was detected in our samples. We found that the concentration of vinyl and flavanylpyranoanthocyanins increased with time (Figure 2), the increases being larger in the MO wines, especially from t2 to t3. We also detected compounds formed by direct reactions between anthocyanins and flavanols (Figure 3). These may result from the addition of flavanols to anthocyanins (47, 52). Little differences were detected in the direct adducts between control and MO wines. A broad peak at the end of the chromatogram was observed (polymeric peak). It absorbed at around 540, indicating that it contained flavylium units. Its concentration increased with time while its max value decreased, perhaps because anthocyaninethyl- flavanol adducts would first have been formed during winemaking and then transformed into flavanyl-pyranoanthocyanins during wine aging, compounds that present lower max values. The contribution of these polymeric pigments to the overall color of aged red wines may be superior to the contribution of either genuine monomeric anthocyanins or pyranoanthocyanins (50). The area of this peak, as shown in Figure 3, is larger, in general, in MO wines, although no significant differences were observed between W3 (C) and W3 (MO) at the end of the experiment. Chromatic Characteristics of Wine. Figure 4 reflects the evolution of color intensity and hue. The wines behaved in a similar way, independently of their phenolic content. An increase from t0 to t1 was observed in all wines and was higher in MO wines, these wines also being darker in color (see Table S2 in the Supporting Information). A decrease during MLF was then detected, probably due to an increase in pH and the degradation of pigmented compounds by lactic bacteria. After MLF, CI increased, although MO wines maintained a statistically higher CI value. The higher CI in MO wines was probably due to the contribution of
Textos asociados
97
Figure 5. Development of WC, WCP, and CRDSO2 in W1, W2, and W3 wines (SD). Each point corresponds to t0, t1, t2, and t3. the newly formed pigments, for example, ethyllinked pigments, since the absorbance of these molecules at 620 nm is higher than that of genuine anthocyanins (the percentage of blue color in MO wines was higher than in control wines). Pyranoanthocyanins also may have participated in the higher CI as they show both higher absorbance at 420 nm and contribute to the redness of wines. The hue evolved in a very similar way in all the wines, with a tendency to increase, but more so in control wine, demonstrating that no detectable browning occurred in the MO wines. Figure 5 reflects the evolution of WC, WCP, and CRDSO2. A very small decrease in WC was observed in all wines with no differences due to MO. WCP decreased with time, and the decreases were concomitant with the loss of free anthocyanins usually observed during wine evolution, meaning that the formation of anthocyanin-derived pigments did not compensate for free anthocyanin degradation. Figure 6. Development of abs280 and tannins in different wines (SD). Each point corresponds to t0, t1, t2, and t3. A continuous increase in pigments resistant to SO2 bleaching was observed. The formation of pyranoanthocyanins, which are very stable compounds toward
98

With regard to optical density and tannin content (Figure 6) and mean degree of polymerization (mDP) (Figure 7), no changes in abs280 were detected in any of the wines, indicating the absence of significant wine pigment precipitation. As regards tannins, their levels decreased during MLF in W2 and W3, but since no decrease in abs280 was detected, this phenomenon was probably due to tannins breaking down to give small structures that were not detected by the BSA method. Similar values for the control and MO wines were observed at t2. From t2 to t3, the concentration barely changed, although MO wines showed a slightly higher tannin content. Different behavior with regard to mDP was observed for the different wines. This parameter always increased in the first period (from t0 to t1) for all wines and then fell, except for W1. According to Nikfardjam and Dykes (53), this increase corresponds to the wine structuring phase described in empirical observations (13), and this phase appears to occur irrespective of whether oxygen is being dosed into the wine. The reduction of mDP observed afterward, mainly in W2 (MO) and W3 (MO), may be due to a possible structural rearrangement of the tannins to shorter forms, which would correlate with the small decreases observed in the tannins measured by the BSA method. This reduction in mDP may be responsible for a reduction in wine astringency (54, 55). The interaction of these newly formed intermediates with anthocyanins also may reduce astringency since they can form terminal units of these shorter forms, preventing further polymerization (56). The different behavior of W1 (MO) was similar to that described by Du Toit et al. (57) when MO was applied to a wine for too long a period of time. It seems that W1 could have suffered overoxygenation in the MO wine, and therefore, an increase of mDP was observed. Multivariate statistical analysis was used in this study to check as to whether the wines could be grouped according to the variables studied. First, a cluster analysis was conducted using all the studied variables since this is a powerful visualization tool that enables groupings to be observed within the data. This is an unsupervised method for pattern recognition, where the samples were clustered without prior knowledge of their belonging to any wine type. The distance matrix was calculated using square Euclidean distances and an average linkage method algorithm. Distance measures the similarity or dissimilarity between the different samples. Two clearly differentiated clusters were found (data shown in Supporting Information). In one of them we found W1, both control and MO wines, and W2 (C), showing that W1 (C) and W2 (C) were quite close. W2 (MO) was classified as closer to the W3 wines. In the case of W2, it seems that MO originated the maximum differences in the wine characteristics. MO promoted changes in its phenolic structure, leading to a wine with chromatic characteristics closer to a wine with a higher phenolic content.
Seminario Tcnico
Figure 7. Development of mean degree of polymerization of tannins in W1, W2, and W3 wines (SD). Each point corresponds to t0, t1, t2, and t3.
Figure 8. Graphical plot representing the distribution of the wine samples in the plane defined by principal components 1 and 2 as regards their chromatic characteristics (MO wines: solid symbols; control wines: open symbols; W1: circles; W2: squares; and W3: triangles). The variance explained by each principal component is shown in parentheses. SO2 and pH due to the substitution of C4 (47), was probably associated with this evolution. Ethyl-linked compounds also should be resistant to sulfite addition and may have contributed to the observed changes, explaining as to why the values were higher in MO wines.
Textos asociados
99
Having obtained this grouping, a principal components analysis was conducted with the same data and using the same variables to find as to which variables were mainly responsible for the grouping found (Figure 8). The first two principal components explained 83% of the variance. The representation of these two principal components showed that all MO wines had lower values in component 1 than their corresponding control wines mainly due to lower values of L*, H*, and hue and higher values of CI and anthocyanin-derived compounds, among others. The wines with the highest phenolic content showed negative values of PC1, while W2 differed from the other wines especially in the highest values of PC2, due to the high WC and anthocyanin monoglucoside values. W2 (MO) and W3 (C) were again very close. MO favored reactions that led to the greater formation of new pigments, which, in turn, increased CI and CRDSO2 in all the wines, regardless of their phenolic content. W1 wine was less influenced by MO and the observed increases in mDP for W1 (MO) suggested overoxygenation. This wine presented an anthocyanin content that was too low to promote any great level of condensation reactions. W3 was favored by MO, but the most evident results were found in W2 (MO), with its high anthocyanin content that favored the formation of more stable derived pigments and led to a wine close to W3 (C). Supporting Information Available: Figure of differentiated clusters and tables of wine characteristics at the end of alcoholic fermentation and evolution of CIELab and color. This material is available free of charge via the Internet at http://pubs.acs.org.
(5) Singleton, V. A survey of wine aging reactions, especially with oxygen. In Proceedings of the 50th AnniVersary Annual Meeting; Rantz, J. M., Ed.; American Society for Enology and Viticulture: Davis, CA, 2000; pp 323-336. (6) Singleton, V. Oxygen with phenols and related reactions in must, wines, and model systems: Observations and practical implications. Am. J. Enol. Vitic. 1987, 38, 6977. (7) Danilewicz, J. Review of reaction mechanism of oxygen and proposed intermediate reduction products in wine: Central role of iron and copper. Am. J. Enol. Vitic. 2003, 54, 7385. (8) Atanasova, V.; Fulcrand, H.; Cheynier, V.; Moutounet, M. Effect of oxygenation on polyphenol changes occurring in the course of wine-making. Anal. Chim. Acta 2002, 458, 1527. (9) Jordao, A. M.; Ricardo-da-Silva, J. M.; Laureano, O. Effect of oak constituents and oxygen on the evolution of malvidin-3- glucoside and (+)-catechin in model wine. Am. J. Enol. Vitic. 2006, 57, 377381. (10) Salmon, J. M. Interactions between yeast, oxygen, and polyphenols during alcoholic fermentations: Practical implications. Food Sci. Technol. 2006, 39, 959965. (11) Alcalde-Eon, C.; Escribano-Bailon, M. T.; SantosBuelga, C.; Rivas-Gonzalo, C. Changes in the detailed pigment conposition of red wine during maturity and ageing. A comprehensive study. Anal. Chim. Acta 2005, 563, 238254. (12) Boulet, J.; Moutounet, M. Micro-oxigenacin de los vinos. In Enologa: Fundamentos Cientficos y Tecnolgicos; Flanzy, C., Ed.; MundiPrensa Ediciones: Madrid, 2000; pp 638-642. (13) Parish, M.; Wollan, D.; Paul, R. Micro-oxygenation. A review. Aust. Grapegrower Winemaker 2000, 438, 4750. (14) Kamio, I.; Kamio, X.; Roig, G.; Otero, B.; Yerle, S. Microoxygenation dans la Pninsule Ibrique: Repenser lelevage des vins du sud. ReV. Oenol. 2008, 126, 2227. (15) Dallas, C.; Ricardo da Silva, J. M.; Laureano, O. Products formed in model wine solutions involving anthocyanins, procyanidin B2, and acetaldehyde. J. Agric. Food Chem. 1996, 44, 24022407. (16) Es-Safi, N.; Fulcrand, H.; Cheynier, V.; Moutounet, M. Studies on the acetaldehyde-induced condensation of (-)-epicatechin and malvidin-3-glucoside
LITERATURE CITED
(1) Prez-Magario, S.; Gonzlez-San Jos, M. L. Evolution of flavanols, anthocyanins, and their derivatives during the aging of red wines, elaborated from grapes harvested at different stages of ripening. J. Agric. Food Chem. 2004, 52, 11811189. (2) Bautista-Ortn, A. B.; Fernndez-Fernndez, J. I.; Lpez-Roca, J. M.; Gmez-Plaza, E. The effect of grape ripening stage on red wine color. J. Int. Sci. Vigne Vin 2006, 40, 1424. (3) Bautista-Ortn, A. B.; Fernndez-Fernndez, J. I.; Lpez-Roca, J. M.; Gmez-Plaza, E. Wine-making of highly colored wines: Extended pomace contact and run-off of juice prior to fermentation. Food Sci. Technol. Int. 2004, 10, 287295. (4) Ribreau-Gayon, P.; Glories, Y. Phenolics in grapes and wines. In The Sixth Australian Wine Industry Technical Conference; Lee, T. H., Ed.; Australian Industrial Publishers: Adelaide, Australia, 1986; pp 247-256.
100

in model solution systems. J. Agric. Food Chem. 1999, 47, 20962102. (17) Escribano-Bailon, T.; Alvarez-Garcia, M.; RivasGonzalo, J. C.; Heredia, F. J.; Santos-Buelga, C. Color and stability of pigments derived from the acetaldehyde-mediated condensation between malvidin 3-O-glucoside and (+)-catechin. J. Agric. Food Chem. 2001, 49, 12131217. (18) Cheynier, V.; Dueas, M.; Salas, E.; Maury, C.; Souquet, J.; Sarni- Manchado, P.; Fulcrand, H. Structure and properties of wine pigments and tannins. Am. J. Enol. Vitic. 2006, 57, 298305. (19) Llaudy, M.; Canals, R.; Gonzalez-Manzano, S.; Canals, J. M.; Santos-Buelga, C.; Zamora, F. Influence of micro-oxygenation treatment before oak aging on phenolic compound composition, astringency, and color of red wine. J. Agric. Food Chem. 2006, 54, 42464252. (20) Prez-Magario, S.; Snchez-Iglesias, M.; OrtegaHeras, M.; Gonzlez-Huerta, C.; Gonzlez-Sanjose, M. L. Color stabilization of red wines by microoxygenation treatment before malolactic fermentation. Food Chem. 2007, 101, 881893. (21) Tao, J.; Dykes, S. I.; Kilmartin, P. A. Effect of SO2 concentration on polyphenol development during red wine micro-oxygenation. J. Agric. Food Chem. 2007, 55, 61046109. (22) Devatine, A.; Chiciuc, I.; Poupot, C.; Mietton-Peuchot, M. Microoxygenation of wine in presence of dissolved carbon dioxide. Chem. Eng. Sci. 2007, 62, 45794588. (23) Cano-Lopez, M.; Pardo, F.; Lopez-Roca, J. M.; Gmez-Plaza, E. Effect of the micro-oxygenation on anthocyann and derived pigment content and chromatic characteristics of red wines. Am. J. Enol. Vitic. 2006, 57, 325331. (24) Cano-Lpez, M.; Lpez-Roca, J. M.; Gmez-Plaza, E.; Pardo- Minguez, F. Efecto de la microoxigenacin en vinos tintos con diferente contenido polifenlico. Tecnol. Vino 2006, Julio-Agosto, 4550. (25) Osborne, J.; Mira de Ordua, R.; Pilone, G.; Liu, S. Acetaldehyde metabolism by wine lactic acid bacteria. FEMS Microbiol. Lett. 2000, 191, 5155. (26) Vivas, N.; Glories, Y. Racking of red wine matured in barrels. A tentative classification of racking techniques. Aust. NZ Wine Ind. J. 1995, 10, 241243. (27) O.I.V. Recueil des Mthodes Internationales dAnalyse des Vins et des Mouts; Office International de la Vigne et du Vin: Paris, 1990. (28) Ough, C. S.; Amerine, M. A. Methods for Analysis of Musts and Wine; Wiley Interscience Publications: ew York, 1974. (29) Boido, E.; Alcalde-Eon, C.; Carrau, F.; Dellacassa, E.; Rivas- Gonzalo, C. Aging effect of the pigment composition and color of Vitis Vinifera L. c.v. Tannat wines. Contribution of the main pigment families to wine color. J. Agric. Food Chem. 2006, 54, 66926704. (30) Glories, Y. La coleur des vins rouges: 1 partie. Les equilibres des anthocyanes et des tanins. Con. Vigne Vin 1984, 18, 195 217. (31) Sudraud, P. Interpretation des courbes dabsortion des vins rouges. Ann. Technol. Agric. 1958, 7, 203208. (32) Ribreau Gayon, P.; Glories, Y.; Maujean, A.; Dubourdieu, D. Trait dOenologie. 2. Chimie du Vin. Stabilisation et Traitements; Dunod: Paris, 1998. (33) Levengood, J.; Boulton, R. The variation in color due to copigmentation in young Cabernet Sauvignon wines. In Red Wine Color. ReVealing the Mysteries; Waterhouse, A., Kennedy, J., Eds.; American Chemical Society: Washington, DC, 2004; pp 35- 52. (34) Harbertson, J. F.; Kennedy, J. A.; Adams, D. O. Tannin in skins and seeds of Cabernet Sauvignon, Syrah, and Pinot Noir berries during ripening. Am. J. Enol. Vitic. 2002, 53, 5459. (35) Drinkine, J.; Lopes, P.; Kennedy, J. A.; Teissedre, P. L.; Saucier, C. Analysis of ethylidene-bridged flavan-3-ols in wine. J. Agric. Food Chem. 2007, 55, 11091116.
Seminario Tcnico
(37) Peynaud, E. The Taste of Wine; Wiley: New York, 1996. (38) Amerine, M.; Roessler, E. Wines, Their Sensory EValuation; W. H. Freeman: New York, 1982. (39) Perez-Magario, S.; Snchez-Iglesias, M.; OrtegaHeras, M.; Gonzlez-Huerta, C.; Gonzlez-Sanjos, M. L. Color stabilization of red wines by microoxygenation treatment before malolactic fermentation. Food Chem. 2007, 101, 881893. (40) Rivas-Gonzalo, J.; Bravo-Haro, S.; Santos-Buelga, C. Detection of compounds formed through the reaction of malvidin-3- monoglucoside and ca-
101
Textos asociados
(36) Fernandez, K.; Kennedy, J. A.; Agosin, E. Characterization of Vitis Vinifera L. Cv. Carmanere grape and wine proanthocyanidins. J. Agric. Food Chem. 2007, 55, 36753680.
techin in the presence of acetaldehyde. J. Agric. Food Chem. 1995, 43, 14441449. (41) Morata, A.; Gomez-Cordoves, C.; Colomo, B.; Suarez, J. A. Pyruvic acid and acetaldehyde by different strains of Saccharomyces cereVisiae: Relationship with vitisin A and B formation in red wines. J. Agric. Food Chem. 2003, 51, 74027409. (42) Schwartz, M.; Quast, P.; von Baer, D.; Winterhalter, P. Vitisin A content in Chilean wines from Vitis Vinifera cv. Cabernet Sauvignon: A contribution to the color of aged red wines. J. Agric. Food Chem. 2003, 51, 62616267. (43) Revilla, I.; Gonzlez-San Jos, M. L. Evolution during the storage of red wines treated with pectolytic enzymes: New anthocyanin pigment formation. J. Wine Res. 2001, 12, 183197. (44) Asestorfer, R.; Markides, A.; Iland, P.; Jones, G. Formation of vitisin A during red wine fermentation and maturation. Aust. J. Grape Wine Res. 2003, 9, 4046. (45) Lee, D.; Swinny, E.; Asenstorfer, R.; Jones, G. Factors affecting the formation of red wine pigments. In Red Wine Color. ReVealing the Mysteries. ACS Symposium Series 886; Waterhouse, A., Kennedy, J. A., Eds.; American Chemical Society: Washington, DC, 2004; pp 125-142. (46) Pozo-Bayon, M. A.; Monagas, M.; Polo, M. C.; Gomez-Cordoves, C. Occurrence of pyroanthocyanins in sparkling wines manufactured with red grape varieties. J. Agric. Food Chem. 2004, 52, 13001306. (47) Fulcrand, H.; Atanasova, V.; Salas, E.; Cheynier, V. The fate of anthocyanins in wine. Are they determining factors? In Red Wine Color. ReVealing the Mysteries. ACS Symposium Series 886; Waterhouse, A., Kennedy, J. A., Eds.; American Chemical Society: Washington, DC, 2004; pp 68-88. (48) Monagas, M.; Nuez, V.; Bartolom, B.; GomezCordobes, C. Anthocyanin-derived pigments in Graciano, Tempranillo, and Cabernet Sauvignon wines produced in Spain. Am. J. Enol. Vitic. 2003, 54, 163169.
(49) Schwartz, M.; Winterhalter, P. A novel synthetic route to substituted pyranoanthocyanins with unique color properties. Tetrahedron Lett. 2003, 44, 75837587. (50) Schwartz, M.; Winterhalter, P. Novel aged anthocyanins from Pinotage wines: Isolation, characterization, and pathway of formation. In Red Wine Color. ReVealing the Mysteries. ACS Symposium Series 886; Waterhouse, A., Kennedy, J. A., Eds.; American Chemical Society: Washington, DC, 2004; pp 179- 197. (51) Schwarz, M.; Hofmann, G.; Winterhalter, P. Investigations on anthocyanins in wines from Vitis Vinifera cv. Pinotage: Factors influencing the formation of Pinotin A and its correlation with wine age. J. Agric. Food Chem. 2004, 52, 498504. (52) Salas, E.; Atanasova, V.; Poncet-Legrand, C.; Meudec, E.; Mazauric, J. P.; Cheynier, V. Demostration of the occurence of flavonol-anthocyanin adducts in wine and in model disolutions. Anal. Chim. Acta 2004, 513, 325332. (53) Nikfardjam, M.; Dykes, S. I. Micro-oxygenation research at Lincoln University. Part 3: Polyphenolic analysis of Cabernet Sauvignon wines under the application of micro-oxygenation. Aust. NZ Grapegrower Winemaker 2003, 467, 4144. (54) Vidal, S.; Cartalade, D.; Souquet, J. M.; Fulcrand, H.; Cheynier, V. Changes in proanthocyanidin chain length in winelike model solutions. J. Agric. Food Chem. 2002, 50, 22612266. (55) Cheynier, V.; Remy, S.; Fulcrand, H. Mechanisms of anthocyanin and tannin changes during winemaking and aging. In The ASEV 50th AnniVersary Annual Meeting; Rautz, J., Ed.; ASEV: Davis, CA, 2000; pp 337-344. (56) Du Toit, W.; Marais, J.; Pretorius, I. S.; du Toit, M. Oxygen in must and wine: A review. S. Afr. J. Enol. Vitic. 2006, 57, 7694. (57) Du Toit, W.; Lisjak, K.; Marais, J.; du Toit, M. The effect of micro-oxygenation on the phenolic composition, quality, and aerobic wine-spoilage microorganisms of different South African red wines. S. Afr. J. Enol. Vitic. 2006, 27, 5767. Received for review February 28, 2008. Revised manuscript received May 9, 2008. Accepted May 9, 2008. This work was made possible by financial assistance from the Fundacin Sneca (PB/31/FS/02).
102
Seminario Tcnico
Efectos de la microoxigenacin en vino tinto

Cano Lopez, M,; Fuentes Peralta, S.; Pardo Minguez, F.(1); Lpez-Roca, J.M.; Gmez-Plaza, E Departamento de Tecnologa de Alimentos, Nutricin y Bromatologa. Facultad de Veterinaria, Universidad de Murcia. Campus de Espinardo, 30071 Murcia
(1)
valores mximos en el vino microoxigenado con dosis media. Estos parmetros muestran que se ha favorecido la formacin de nuevos pigmentos en los vinos. Por otro lado, el contenido de acetaldehdo libre en los vinos microoxigenados es menor que en el testigo, manifestando que el acetaldehdo generado forma parte de nuevos pigmentos, no interfiriendo en las caractersticas organolpticas de los vinos microoxigenados. Al final del tratamiento se realiz un anlisis organolptico de los vinos, que junto a los resultados obtenidos se concluye que la dosis media result ser la mas adecuada al finalizar la microoxigenacin.
Bodegas B.S.I. Ctra. Murcia, Jumilla, Murcia
INTRODUCCIN
Los compuestos fenlicos en un vino tinto determinan sus caractersticas sensoriales, principalmente el color y la astringencia. La composicin fenlica depende de la composicin de la uva, factores edafoclimticos, procesos de vinificacin y diferentes prcticas enolgicas. El oxigeno juega un papel importante en diversos procesos bioqumicos en los mostos y en los vinos, tanto durante la fermentacin alcohlica como en las reacciones de oxidacin y/o polimerizacin de compuestos polifenlicos que se producen durante el envejecimiento del vino. Por ello, tradicionalmente se han efectuado aportes de oxigeno, bien mediante remontados al inicio de la fermentacin alcohlica; bien mediante trasiegos tras la fermentacin alcohlica y fermentacin malolctica cuyo objetivo es eliminar y/o evitar la formacin de compuestos sulfhdricos y retirar las las gruesas (1). Durante el envejecimiento del vino en barrica de roble se produce la cesin de compuestos fenlicos y aromas propios de la madera al vino, adems de una microoxigenacin natural, al difundirse pequeas cantidades de oxgeno a travs del esquive de la barrica,
Autor de contacto: e-mail: encarnag@um.es, tel. 968 367323
RESUMEN
La microoxigenacin est basada en el aporte controlado de pequeas cantidades de oxigeno de forma continua y lenta; siendo la velocidad del aporte de oxigeno inferior a la velocidad de su consumo, evitando la acumulacin de oxigeno. El objetivo de esta tcnica es favorecer la condensacin entre taninos y antocianos y la formacin de nuevos pigmentos; proporcionando as un incremento y estabilizacin del color del vino. Se ha estudiado el efecto de la tcnica aplicando distintas dosis de oxigeno (dosis baja, media y alta), a vinos de Monastrell. Los resultados obtenidos muestran que la aplicacin de oxigeno no afecta a la sanidad del vino. Los vinos microoxigenados presentan mayor intensidad colorante que el testigo. La tonalidad es similar en todos ellos, manifestando la mnima oxidacin de polifenoles producida. Se destaca el incremento de la fraccin de color debido a pigmentos polimricos, el ndice de ionizacin y de PVPP en los vinos microoxigenados, presentando sus
Figura 1.- Estructura del polmero por condensacin directa, A) tanino-antociano y B) compuesto bicclico formado por la reaccin entre el flavano y Mv-3Glu. (Remy et al. 2000). Enlogos Efecto de la microoxigenacin en vinos tintos. Enologos 34,46-50, 2005
103
Textos asociados
Captulo
entre las uniones de las duelas y los poros de la madera. Este oxigeno se ha demostrado que influye notablemente en la composicin fenlica del vino, ya que interviene en reacciones de oxidacin y/o polimerizacin, generando nuevos pigmentos que incrementan y estabilizan el color del vino (7,8,9,10,11,12,13,14, 15). La generacin de estos pigmentos sigue los siguientes mecanismos: a) Reacciones de condensacin directa entre antocianos (A) y taninos (T): Los nuevos compuestos se forman mediante procesos de adicin nucleoflica dando lugar a estructuras A+-T y T-A+. Han sido encontradas en vinos envejecidos (10, 16), ya que es una reaccin lenta (17). Ambas estructuras son mas complejas que los antocianos monmeros, de color similar a los antocianos pero resistentes a la decoloracin por SO2, especialmente la estuctura A+-T. La formacin de estos compuestos genera una disminucin de la astringencia de los vinos durante el envejecimiento (Figura 1).
b) Reaccin de condensacin mediante puentes de etilo. En estas reacciones est involurado el acetaldehdo, producto que aparece en el vino producido en pequeas cantidades por las levaduras durante el metabolismo de azcares (18) y por la oxidacin de etanol. El resultado son productos enlazados por puente de etilo, incluyendo taninos (T-etil-T), aductos de taninos-antocianos (T-etil-A) y oligmeros de antocianos (A-etil-A). La reaccin de polimerizacin finaliza cuando en el otro extremo del polmero se encuentra unido un antociano (20, 21). Su formacin es ms rpida que la de los pigmentos polimricos por condensacin directa (17). La presencia de estos pigmentos produce incremento y estabilizacin del color del vino; su color es malva, son resistentes a las variaciones de pH, a la decoloracin del sulfuroso y a las oxidaciones (19, 24), aunque se ha demostrado que su estabilidad en el tiempo es pequea y evolucionan hacia otros tipos de compuestos polimricos (Figura 2).
Figura 2.- Compuestos formados en presencia de acetaldehdo y de otros metabolitos de las levaduras. (Cheynier 2005).
104
Seminario Tcnico
MATERIALES Y MTODOS
a) Condiciones de microoxigenacin de los vinos Para la experiencia de microoxigenacin se ha utilizado un vino tinto de la variedad Monastrell, elaborado por Bodegas BSI de Jumilla (Murcia), que presentaba las siguientes caractersticas cromticas iniciales: intensidad colorante (IC): 14.7, tono: 0.51, ndice de polifenles totales (IPT): 67.40 y antocianos totales: 443.63 mg/L Tras la fermentacin alcohlica el vino se dispuso en depsitos de 17.500L., uno de ello se utiliza como testigo, en los otros se aplic tres dosis diferentes de oxgeno y en tres periodos distintos de la elaboracin. La adicin de oxigeno se ha realizado durante tres periodos:
Figura 3.- Estructura qumica Vitisina 1) A y 2) B. (Cheynier 2005). c) Nuevos pigmentos de bajo peso molecular. Estos pigmentos se forman mediante la cicloadicn de metabolitos producidos por las levaduras, como el acetaldehdo, cido pirvico o vinilfenoles, con el antociano, generando pigmentos como la Vitisina A y B y los antocianovinilfenoles. Han sido identificados en vinos envejecidos (8,9,12,13,15,22) en botella y en barrica y en vinos microoxigenados (7). Son pigmentos ligeramente anaranjados, ms resistentes a las variaciones de pH, al sulfuroso (9) y a las oxidaciones que los antocianos; estabilizando as el color del vino (12, 23) (Figura 3). Debido a la importancia de la presencia de pequeas cantidades de oxgeno y de acetaldehdo en la formacin de estos pigmentos, naci en la dcada de los 90 la tcnica de la microoxigenacin, basada en el aporte controlado de pequeas cantidades de oxigeno al vino mediante un microdifusor poroso, de forma continua y lenta, siendo la velocidad de aporte de oxigeno inferior a la velocidad de consumo, evitando la acumulacin en vino y generando la mxima cantidad posible de este aldehdo. Determinadas experiencias han observado que tanto la crianza en barrica como la microoxigenacin producen resultados similares en cuanto al incremento de color y disminucin de astringencia, pudiendo con esta tcnica reproducir, e incluso acelerar, parte de las transformaciones que sufren los compuestos fenlicos durante la crianza en barrica (3, 4). En este estudio se pretende conocer el efecto de esta tcnica, aplicando distintas dosis de oxigeno, sobre el color de un vino tinto de la variedad Monastrell.
- Durante dos semanas, entre el final de la fermentacin alcohlica y el inicio de malolctica, con dosis aplicadas de 5, 10 y 15 mL/L/mes. La cantidad de oxigeno aplicada en este periodo, es la mas alta, para favorecer la generacin de acetaldehdo. - Despus de la fermentacin malolctica, durante un periodo de 45 das, las dosis aplicadas fueron 3, 5 y 7 mL/L/mes. - Tras un anlisis organolptico de los vinos, se continu microxigenando 15 das ms, suavizando los vinos microxigenados, aunque en este periodo las dosis en los tres casos se reduce a la mitad, puesto que el contenido de antocianos haba descendido en todos los vinos. La Figura 4 muestra un esquema del sistema de microoxigenacin. Cada salida de oxigeno esta conectada a un microdifusor poroso que se encuentra suspendido en el interior del depsito sin llegar a tocar el fondo, de tal manera que las microburbujas se disuelvan en el vino antes de que lleguen a la superficie. b) Determinaciones fisico-qumicas y espectrofotomtricas El pH, la acidez total (g/L de cido tartrico) y la acidez voltil se determinaron segn los mtodos oficiales. Las medidas de absorbancia se realizan en un espectrofotmetro Helios Alpha (Thermospectronic). Las muestras son centrifugadas y se ajust el pH a 3.6. La intensidad de color (IC) se calcul como la suma de absorbancias a 620 nm, 520 nm y 420 nm; otras variables calculadas son los porcentajes de rojo, amarillo y azul del color del vino (30). El tono como el coeficiente entre la absorbancia a 420 nm y 520 nm (25). El anlisis del ndice de polifenoles totales (IPT), antocianos totales y taninos totales (g/L), y los ndices
105
Textos asociados
Captulo
SISTEMADEALIMENTACIN BOMBONADE OXGENO
MANMETRO
MICRODIFUSOR
Figura 4.- Esquema de la disposicin del sistema de microoxigenacin en el depsito.
de PVPP, ionizacin y HCl se efectu siguiendo los mtodos descritos por Ribereau-Gayon et al. (29). La fraccin de color debida a los pigmentos polimricos se calcul de acuerdo con los mtodos descritos por Boulton (27).
RESULTADOS Y DISCUSIN
El Grfico 1 muestra la evolucin de pH, acidez total y acidez voltil durante la microoxigenacin. Dichos parmetros son similares en los vinos microoxigenados y el testigo, manifestando que el aporte de oxigeno no altera la sanidad del vino. Se observa un incremento en la IC (Grfico 2a) en el primer periodo de microoxigenacin (Octubre-Diciembre/03) en los vinos microoxigenados. Tras la fermentacin malolctica (Enero/04) se observ en todos ellos un descenso, probablemente consecuencia de la variacin del pH y la precipitacin de materia coloidal que arrastra materia colorante. Aunque el aporte de oxigeno durante el segundo periodo fue menor, se observ de nuevo un aumento de IC en los vinos microoxigenados, diferencindose todos los vinos en color. Este incremento de color en presencia de pequeas cantidades de oxigeno durante los primeros meses de la elaboracin tambin ha sido encontrado por otros autores (3,5,6, ). Por otra parte, la evolucin del tono, representado por el Grfico 2b; es similar en los distintos vinos, indicando que los compuestos fenlicos sufren una mnima oxidacin durante el tratamiento. Mientras que la IC vari para los diferences vinos, el % rojo tras la microoxigenacin (Grfico 3) se mantuvo constante en todos los vinos; sugiriendo que ambos parmetros no estn relacionados directamente, tal y como se ha indicado en otros trabajos (31,32), sino que la IC depende tambin de la absorbancia de los compuestos que aportan tonos amarillos y azules. El
Grfico 1.- Evolucin durante la microoxigenacin de a) pH, b) acidez total y c) acidez voltil de los vinos durante la microoxigenacin.
106

go, de forma similar a los resultados encontrados por Cabanillas et al.(3). Finalizada la microoxigenacin, el vino testigo sufre una disminucin de este ndice y su valor se incrementa en los vinos microoxigenado, ponindose de manifiesto de esta forma la presencia de pigmentos coloreados formados mediante puente de acetaldehdo y por cicloadicin del aldehdo a los antocianos. Siendo el ndice de ionizacin mximo en el vino con dosis media de oxigeno. Por otro lado, el ndice de PVPP, que representa el porcentaje de antocianos combinados con taninos, nos da una idea del incremento y estabilidad del color, ya que estos compuestos presentan un color malva y son menos sensibles a las oxidaciones, a las variaciones pH y al sulfuroso que los antocianos libres. Su comportamiento es similar al ndice de ionizacin, su valor es mayor en los vinos microxigenados, pero en el testigo disminuye tras el periodo de la microoxigenacin, de forma opuesta a lo que ocurre en los vinos microoxigenados, siendo mximo su valor en el vino con dosis media.
Seminario Tcnico
Grfico 2.- Evolucin de a) intensidad colorante (I.C.) y b) tono durante la microoxigenacin. Grfico 3 muestra la variacin de la componente amarilla y azul en los vinos tras la microoxigenacin. Se observa un incremento de la componente azul en los vinos microoxigenados, siendo mxima para el vino donde se aplic la dosis media de oxgeno; mientras que la componente amarilla se mantiene constante en todos ellos excepto en el testigo. Estos resultados sealan la presencia de pigmentos polimricos unidos mediante acetaldehdo en los vinos microoxigenados, ya que como propone Gmez-Cordovs et al. (23) existe una correlacin directa con la componente azul y la polimerizacin de polifenles. El contenido de antocianos totales (Grfico 4) desciende por igual en todos los vinos durante la experiencia. El incremento de color y la disminucin de antocianos totales en los vinos microoxigenados son datos aparentemente contradictorios, pero tiene su explicacin cuando se analiza la evolucin de la fraccin de color debido a pigmentos polimricos, como muestra el Grfico 5. El color debido a los pigmentos polimricos incrementa durante la aplicacin de oxigeno, al igual que los resultados recogidos por Atanasova et al. (7). Su evolucin es similar a la variacin del color (Grfico 2a), dicha relacin tambin fue observada por Castellari et al. (6), presentando al finalizar la microoxigenacin su valor mximo en el vino con dosis media. El incremento de color en los vinos microoxigenados puede explicarse tambin mediante el anlisis del ndice de ionizacin y PVPP, como muestra el Grfico 6. El ndice de ionizacin indica el porcentaje de antocianos que presentan color en el vino. Los vinos microoxigenados presentan mayor valor que el testi-
Grfico 3.- Variacin al inicio y al final de la microoxigenacin de los distintos vinos, % rojo, % amarillo y % azul.
107
Textos asociados
Captulo
Grfico 4.- Evolucin de antocianos totales (mg/L) de los vinos durante la microoxigenacin.
Grfico 5.- Evolucin de la fraccin de color debido a pigmentos polimricos.
Grfico 7.- Evolucin de A) IPT y B) taninos totales (g/L) de los vinos durante la microoxigenacin.
Grfico 6.- ndice de ionizacin y de PVPP en el vino inicial y en todos los vino tras la microoxigenacin.
Grfico 8.- ndice de HCl finalizada la microoxigenacin
Los Grficos 7a y 7b muestran la evolucin de IPT y taninos totales. Ambos parmetros son similares en todos los vinos; lo que indica que no se produce ninguna precipitacin de taninos durante la aplicacin de esta tcnica. El anlisis del contenido en taninos (procianidinas), representado por el Grfico 7b, muestra que los niveles se mantiene durante la microoxigenacin y es semejante en todos los vinos. No obstante, el ndice de HCl, indicador del porcentaje de la polimerizacin de taninos presentes en vino; es superior en los vinos microoxigenados que en el testigo tras el periodo de microoxigenacin (Grfico 8), al igual que a Cabanillas
et al.(2001), presentando el mximo en el vino microoxigenado con la dosis media. Confirmando que la presencia de oxigeno favorece la polimerizacin de taninos, traducindose en una disminucin de astringencia. Tras la microoxigenacin se realiz el anlisis organolptico de los vinos, concluyendo que: - El vino testigo era ligeramente spero en boca con taninos agresivos. - Los vinos microoxigenados con dosis baja y media en boca eran redondos y con gusto agradable a mitad
108

de boca. En nariz apareca aroma afrutado y sin notas a reduccin. - El vino microoxigenado con dosis ms altas en boca era similar a los otros dos vinos microoxigenados, aunque se apreciaban aromas a fruta madura y algo ms evolucionado. Concluyendo que organolpticamente las dosis ms adecuadas son las dosis baja y media. Teniendo en cuenta los resultados expuestos y el anlisis organolptico de los diferentes vinos se concluye que la dosis adecuada durante la microoxigenacin es la dosis media. Cabe esperar que estas diferencias sean mayores con el tiempo, haciendo interesante el seguimiento durante el envejecimiento en barrica y botella. (8) Wang H., Edward J.R., Shrikhande J. (2003). Anthocyanin transformation in Cabernet Sauvignon Wine during Aging. J. Agric. Food Chem.,51,79897994. (9) Bakker J. and Timberlake C.F. (1997). Isolation, Identification and Characterization of New Color-Stable Anthocyanins Occuring in Some Red Wine. J. Agric. Food Chem.,45,35-47. (10) Vivar- Quintana A.M., Santos-Buelga C., RivasGonzalo J.C. (2002). Analytica Chimica Acta,458, 147-155. (11) Mateus N. and Freitas V. (2001). Evolution and Stability of Anthocyanin-Derived Pigments during Port Wine Aging. J. Agric. Food Chem.,49,52175322. (12) Mateus N, Silva A.M.S., Vercauteren J., Freitas V.(2001). Occurrence of Anthocyanin- Derived Pigments in Red Wines. J. Agric. Food Chem.,49,4936-4840. (13) Mateus N., Pascual-Teresa S., Rivas-Gonzalo J.C., Santos Buelga C. (2002). Stuctural diversity of anthocyanin-derived pigments in port wines. Food Chemistry,76, 335-342. (14) Cameira-dos-Santos P.J., Brillouet J.M., Cheynier V, Moutounet M. (1996) Detection and Partial Characterisation of New Anthocyanin- Derived Pigments in Wine. J. Agric. Food Chem.,70,204-208. (15) Revilla I., Prez-Magario S., Gonzlez-SanJos M.L., Beltran S. (1999) Identification of anthocyanin derivatives in grape skin extracts and red wine by liquid chromatography with diode array and mass spectrometric detection. J. Chromatogr. A, 847, 83-90. (16) Remy S., Fulcrand H., Labarbe B., Cheynier V. (2000). First confirmation in red Wine of products resulting from direct anthocyanin-tannin reactions. J. Sci. Food Agric. 80, 745-751. (17) Dallas C., Ricardo-da-Silva J., Laureano O. (1996). Products Formed in Model Wine Solutions involving Anthocyanins, Procyanindin B2 , and Acetaldhyde. J. Agric. Food Chem.,44, 2402-2407. (18) Morata A., Gmez-Cordovs M.C., Colomo B., Surez J.A.(2003). Pyryvic Acid (19) Sims C.A. and Morris J.R. (1986) Effects of acetaldehyde and tannins on the color and chemical age of red Muscadine (Vitis Rotundifolia) Wine Research Note JEV 37(2), 163-165.
Seminario Tcnico
BIBLIOGRAFA
(1) Delteil D.(2000). Los diferentes roles del oxigeno. Viticultura/ Enologa Profesional, 74, 35-45. (2) Prez- Magario y Gozlez San-Jos M L. (2003). Efectos de la aplicacin de la microoxigenacin durante la fermentacin de los vinos tintos. Tecnologa del vino, 47, 107-112. (3) Cabanillas P, Canals J.M., Rozs N., Arola L. Y Zamora F.(2001) Influencia de la microoxigenacin en el color y las caractersticas organolpticas de los vinos tintos Tecnologa del vino, Sept/Octubre 2001,51-55. (4) Llaudy C., Canals R., Cabanillas P., Rozs N., Canals J.M. y Zamora F. (2004) Logroo Influencia de la microoxigenacin en presencia y ausencia de las sobre la composicin en polifenoles y el color del vino; comparacin con la crianza en barricas IV Foro Mundial del vino 13-14 mayo 2004. (5) Gonzlez D.C., Herrera P., Fernndez J.A., Snchez M.,Prez S., Ortega M., Gonzlez M.L.(2003) Memoria de Actividades de Investigacin 2002/2003. Instituto Tecnolgico Agrario de Castilla y Len. Estacin Enologca 03. (6) Castellari M., Matricardi l., Arfelli G., Galassi S., Amati A. (2000) Level of single bioactives phenolics in red wine as a function of the oxygen supplied during storage, Food Chemistry 69,6167. (7) Atanasova V., Fulcrand H., Cheynier V., Moutonet M. (2002) Effect of the oxigenation on polyphenol changes occurring in the course of wine-making Analitica Chimica Acta 458, 15-27.
109
Textos asociados
Captulo
(20) Es-Safin.E, Fulcrand H., Cheynier V., Mountounet M.(1999). Studies on the Acetaldhyde-Induced concensacion of (-)- epicatequina and Malvini-3 Glucoside in a Model Solution system. J. Agric. Food Chem.,47,2096-2102. (21) Es-Safin.E, Cheynier V., Mountounet M.(2002). Role of Aldehydic Derivates in the Condensation of Phenolic Compounds with emphasis on the sensorial Propieties of fruit-derived foods. J. Agric. Food Chem.,50,5571-5585. (22) Fancia- Aricha E.M., Guerra M.T., Rivas- Gonzalo J.C., Santos-Buelga C. (1997) New anthocyanin Pigments formed after condensation with flavanols J.Agric. Food Chem.,45,2262-2266. (23) Sarni-Manchado P., Fulcrand H., Souquet JM., Cheynier V., Moutounet M.(1996). Stability and Color of unreported wine anthocyanin-derived Pigments. J.Food Science,61,938-941. (24) Escribano-Bailon T., lvarez-Garca M., RivasGonzalo J., Heredia F.J., Santos-Buelga C.(2001). Color and Stabity of Pigments-Derived from Acethaldehido medianted condensation between Mv-3-O-Glu and (+)-catequin. J.Agric. Food Chem.,49,1213-1217. (25) Sudraud P.(1958). Interpretationdes courbes dabsortion des vins rouges. An Technol Agric.,7,203-208. (26) OIV (1990).Rcueil des Mthodes Internationales dAnalyse des vins et mots. Office International de la Vigne et du Vin, Paris, Francia.
(27) Boulton R.B. (2001). The copigmentationof anthocyanins and its role in the color in red wine: a critical review. Am. J. Enol. Vitic. 52, 67-87. (28) Ribreau-Gayon J, Peynaud E., Sudraud P., Ribreau-Gayon P. (1982) Trait denologie. Sciences et Thechniques et du Vin.Tome I. Analise et contrle des Vins.Ed.Dunod. Paris. Francia. (29) Ribreau-Gayon P., Gories Y., Maujean A., Dubourdieu D.(1998). Trait dOenologie.2. Chimie du Vin. Stabilisation et traitaments. Editorial Dunod. (30) Glories Y. (1978). Recherches sur la materie colorant des vins rouges. Thesis de la Universite de Bourdeaux, Universit de Bourdeaux. (31) Revilla I., Gonzlez-SanJos M.L. and Gmez Cordovs (1999). Modificaciones cromticas del vino timto de crianza segn el tipo de varrica en que envejece. Food Sci. Tech. Int., 5(2): 177-181. (32) Prez-Prieto L.J., De la Hera-Orts M.L., Lpez Roca J.M., Fermandez-fernndez J.I. y Gmez Plaza E. (2003). Oak-matured wines: Influence of the caracteristics of the barrel on wine colour and sensory characteristics. J. Sci. Food Agric., 83: 14451450. (33) Gmez- Cordovs C and Gonzlez-SanJos M.L (1995). Interpretation of color Varibles during the aging of red wines: Relathionship with Families of phenolic compounds. J.Agric. Food Chem., 43(3): 557-561. (34) Cheynier V. (2005). Polyphenols in foods are more complex than often thought. Am. J. Clin. Nutr., 81 (suppl): 223S-229S.
110
Avd. de los Vinos s/n. Pol. Alces 13600 Alczar de San Juan (Ciudad Real) Tel.: +34 926 55 02 00 Fax.: +34 926 54 62 54 central@agrovin.com www.agrovin.com
Modesto Lafuente 41-2 D 28003 Madrid fundacion@culturadelvino.org www.culturadelvino.org

Seminario Técnico: Compuestos Azufrados Volátiles en Vinos

Загружено:

Сведения о документе

Авторское право

Доступные форматы

Поделиться этим документом

Поделиться или встроить документ

Параметры публикации

Этот документ был вам полезен?

Это неприемлемый материал?

Авторское право:

Доступные форматы

Seminario Técnico: Compuestos Azufrados Volátiles en Vinos

Загружено:

Авторское право:

Доступные форматы

Organizan:

Compuestos azufrados voltiles en vinos

Tarragona, 23 de abril de 2009 Madrid, 24 de abril de 2009

Artculos relacionados 41 Influence of the Timing of Nitrogen Additions

03. La micro-oxigenacin de vinos tintos: Control de la reduccin y estabilizacin del color

04. Los compuestos voltiles no son todos perjudiciales!

Contenido Resumen 6 6 1. Introduccin 7 2. Efecto de la concentracin y tipo de

Compuestos azufrados voltiles en vinos

Jos M. Guillamn navarro

Gemma Beltran Casellas

estancias en Centros extranjeros:

Compuestos azufrados voltiles en vinos

Amonio Arginina Glutamina

Compuestos azufrados voltiles en vinos

3. efecto de la concentracin y tipo de nitrgeno sobre la cintica fermentativa

4. Relacin entre el contenido en nitrgeno y la sntesis de compuestos aromticos

Compuestos azufrados voltiles en vinos

Glucosa Vaanablicaodesntesis Piruvato

Compuestos azufrados voltiles en vinos

4.1 Relacin entre el contenido en nitrgeno y la sntesis de compuestos azufrados

Compuestos azufrados voltiles en vinos

Compuestos azufrados voltiles en vinos

Contenido 19 Resumen 19 1. Introduccin 20 2. Control de la dinmica de la fermentacin

Compuestos azufrados voltiles en vinos

Professor i.S. (Sakkie) Pretorius

2. Control de la dinmica de la fermentacin de la levadura para mejorar la calidad del vino

Compuestos azufrados voltiles en vinos

4. Optimizacin de la calidad del vino: evitar la produccin de sabores y aromas indeseables

Compuestos azufrados voltiles en vinos

Compuestos azufrados voltiles en vinos

7. Conclusiones y previsiones futuras

Compuestos azufrados voltiles en vinos

Compuestos azufrados voltiles en vinos

03. la microoxigenacin de vinos tintos: Control de la reduccin y estabilizacin del color

Contenido 31 La reactividad del oxgeno en los vinos 32 La tcnica de la micro-oxigenacin 35 Bibliografa

Compuestos azufrados voltiles en vinos

la reactividad del oxgeno en los vinos

Dra. encarna Gmez Plaza

Adaptado de Waterhouse y Laurie, 2006

03. La micro-oxigenacin de vinos tintos: Control de la reduccin y estabilizacin del color

Adaptado de Waterhouse y Laurie, 2006

Umbral olfatorio (ppb) 1 1,5 1,5 25 1 5 10 4 40 70 1200

Adaptado de Vidal y Aagaard, 2008

Compuestos azufrados voltiles en vinos

CH3-SH 0.2 ppb

b) Mejora de la estabilidad del color

03. La micro-oxigenacin de vinos tintos: Control de la reduccin y estabilizacin del color

Compuestos azufrados voltiles en vinos

Contenido 38 1. Los tioles varietales 39 2. El sulfuro de dimetilo 40 Conclusin

Compuestos azufrados voltiles en vinos

1. los tioles varietales

Compuestos azufrados voltiles en vinos

alcohlica o mediante simple vaporizacin mientras el vino no est en un medio cerrado.

Compuestos azufrados voltiles en vinos

J. Agric. Food Chem. 2005, 53, 996-1002

MATERIALS AND METHODS

Compuestos azufrados voltiles en vinos

time (h) 0 36 78 150 240 408

YAN NH4+ (mg N L- 1) 25 0 0 0 (92a) 81 88

YAN aas (mg N L- 1) 41 7 7 4 (143a) 109 118

Compuestos azufrados voltiles en vinos

Table 3. Secondary Metabolites Produced by Yeasts during the Different Fermentationsa

n-propanol isobutanol isoamylic alcohol phenyl-2-ethanol

Compuestos azufrados voltiles en vinos