Duplication, Dicistronic Transcription, and Subsequent Evolution of the Alcohol dehydrogenase and Alcohol dehydrogenase-related Genes in Drosophila

Esther Betran1 and Michael Ashburner

Department of Genetics, University of Cambridge, Cambridge, England It has recently been discovered that the Alcohol dehydrogenase and Alcohol dehydrogenaserelated genes of Drosophila melanogaster and closely related species constitute a single transcription unit and that the Alcohol dehydrogenaserelated gene is exclusively expressed from a dicistronic mRNA. Here, we show that in Drosophila lebanonensis, subgenus Scaptodrosophila, Adhr is also transcribed as a dicistronic transcript with Adh. Using degenerate primers designed on the sequence of the known ADHR proteins, we have been able to amplify and sequence a partial sequence of Adhr in species representative of the whole subgenus Drosophila. This has allowed the study of the organization and expression of Adhr in Drosophila buzzatii. We nd that in D. buzzatii Adhr is transcribed as a monocistronic transcript. Adh and Adhr are believed to originate by duplication, and our data suggest that the cotranscription of these two genes was the primitive state, and that their independent transcription in the subgenus Drosophila is derived. We can rationalize the D. buzzatii condition as being correlated with the two genes evolving independent transcriptional control. However, why these two genes with clear divergence in the functions of their proteins should remain cotranscribed in groups as divergent as the subgenus Sophophora and the subgenus Scaptodrosophila remains a mystery.

Introduction Polycistronic transcription, that is, the coexpression of more than one open reading frame from a single promoter to make a polycistronic mRNA, is uncommon in eukaryotes, and its signicance is not very well understood (Blumenthal 1998). Known examples seem to fall into three classes. In one, the clustered genes are very different in sequence and the signicance of polycistronic expression is that the products function in the same pathway. This is so in the case of the cyclophilin and the disulphide isomerase genes in Caenorhabditis elegans. These genes are cotranscribed, and both are needed to modify the initial translation product of the collagen gene (Page 1997). The lin-15B and lin-15A genes play a role in vulva development in C. elegans; they are unrelated in sequence and cotranscribed (Clark, Lu, and Horvitz 1994; Huang, Tzou, and Sternberg 1994). An example in Drosophila melanogaster is that of the two genes cotranscribed at the stoned locus (Andrews et al. 1996). In the second type of example, two unrelated proteins are also produced, but there is no clear reason for their coexpression. In C. elegans, 25% of gene expression is achieved by means of polycistronic transcription, but in only few of these instances has this been shown to have a functional meaning (Spieth
1 Present address: Department of Ecology and Evolution, University of Chicago.

Abbreviations: Adh, Alcohol dehydrogenase; Adhr, Alcohol dehydrogenase related; cDNA, complementary DNA to an RNA obtained by retrotranscription; PCR, polymerase chain reaction; RT-PCR, PCR in a cDNA. Key words: duplication, dicistronic transcription, Drosophila, Adh, Adhr. Address for correspondence and reprints: Esther Betran, Depart ment of Ecology and Evolution, University of Chicago, 1101 East 57th Street, Chicago, Illinois 60637. E-mail: ebetran@midway.uchicago.edu.
Mol. Biol. Evol. 17(9):13441352. 2000 2000 by the Society for Molecular Biology and Evolution. ISSN: 0737-4038

et al. 1993; Zorio et al. 1994; Blumenthal 1995; Blumenthal and Spieth 1996). In mice, the growth/differentiation factor-1 (GDF-1) is cotranscribed downstream of the gene UOG-1, a membrane protein not known to be related in function (Lee 1991). In the third type of example, there is polycistronic transcription of two genes that are clearly related in sequence and have, we presume, evolved by gene duplication. Two cases in D. melanogaster are those of Alcohol dehydrogenase (Adh) and Alcohol dehydrogenase related (Adhr) (Brogna and Ashburner 1997) and sesB and Ant2 (Zhang et al. 1999). In both cases, the gene pairs are clearly related in sequence, although in the case of Adh and Adhr, they are apparently not related in function. The evidence that the Adh and Adhr genes of D. melanogaster evolved by duplication is twofold: rst, there is their sequence similarity (about 40% amino acid identity); second, they have a common intron/exon structure (Rat, Veuille, and Lepesant 1991; Schaefer and Aquadro 1987). This duplication is clearly very old, perhaps as old as 180 Myr (Russo, Takezaki, and Nei 1995). The function of Adh is well known: it is the detoxication of dietary alcohols (Chambers 1988; Ashburner 1998). Adhr is of unknown function, although it seems not to be a NAD-dependent dehydrogenase (Jeffs, Holmes, and Ashburner 1994). Within the genus Drosophila, the ADHR protein is evolving slightly more slowly than the ADH protein (Albalat, Marfany, and Gonzalez-Duarte 1994). The dicistronic transcription of Adh and Adhr has been studied in great detail in D. melanogaster (Brogna and Ashburner 1997). In this species, there are only two different kinds of transcript: one ( 1 kb) includes only Adh, and the other ( 2 kb) is dicistronic, including both genes. Adh and Adhr in D. melanogaster are arranged in tandem, being separated by only 300 bp. The dicistronic transcript includes this intergenic region. The dicistronic transcript is rare, with its abundance being only about 1% that of the monocistronic Adh transcript.

1344

Adh/Adhr Transcription Evolution

1345

Table 1 Types, Names, and Sequences of the Primers Used to Get Adhr in Different Drosophila Species (see text for more details)

Type Degenerate . . . . Specic . . . . . .

Name D1 D4 1a 2a 3a 4a 1b 2b 3b 4b 5b

Sequence (5 3 )a ATGGTNCARATGGAYTAYAT RTCNGCCATRTGCCARTA TGCGATGAGCAQGGACATTGATG CTTTGCGATGAGCGAAATATTGATG ACGCTCTGCGACGAGCAGGAC TGCGGTGAGCAAGAAATTGATG CCTTTGTCGGCTATCCAAATCTG CCTTTGTCTGCTATCCAAATCTG CCTTTGTCAGCAATCCAAATCCG CCCTTGTCCGCTATCCAAATCTG CCCTTGTCGGCTATGAAAATCTG
A or G; and Y T or C.

Species All species studied All species studied D. virilis, D. montana, D. robusta, and D. biseriata D. funebris D. repleta, D. mulleri, and D. hydei D. gymnobasis D. virilis and D. montana D. robusta D. funebris D. repleta, D. mulleri, and D. hydei D. biseriata and D. gymnobasis

A, T, C or G; R

The relative level of the two transcripts is controlled by the efciency of transcriptional read-through of the termination and polyadenylation signals in the intergenic region (Brogna and Ashburner 1997). Quite a lot is known about the distribution of the Adhr gene in the genus Drosophila (Russo, Takezaki, and Nei 1995; Amador and Juan 1999); it has been described in the Scaptodrosophila subgenus and in many species of the Sophophora subgenus, but in two only species of the Drosophila subgenus (in D. immigrans and, recently, in D. funebris). One striking fact is that although the duplication predates the radiation of the genus Drosophila (4065 Myr; Powell 1997, pp. 282 285), Adhr has not been found in many species of Drosophila, despite considerable study of their Adh genes (Oakeshott et al. 1982; Sullivan, Atkinson, and Starmer 1990; Nurminsky et al. 1996; Begun 1997). Here, using degenerate primers designed on the sequence of the known ADHR proteins, we were able to amplify a partial sequence of Adhr in species representative of the whole subgenus Drosophila. This allowed the study of the organization and expression of Adhr in D. buzzatii, of the subgenus Drosophila. The Adh region in D. buzzatii is very different from that in D. melanogaster, since the Adh gene itself has been duplicated (Oakeshott et al. 1982; Sullivan, Atkinson, and Starmer 1990; Begun 1997). We show that in this species, Adh and Adhr are not transcribed as a dicistronic message. We also studied the expression of Adhr in Drosophila lebanonensis (subgenus Scaptodrosophila), thought to be an early radiation in the subfamily Drosophilinae (Tatarenkov et al. 1999). In this species, Adh and Adhr are transcribed as a dicistronic mRNA, as in D. melanogaster. These results suggest that the cotranscription of Adh

and Adhr is the primitive state and that their independent transcription in the subgenus Drosophila is derived. Materials and Methods Drosophila Stocks and Isolation of DNA Genomic DNA of adult ies was isolated from D. mulleri, D. hydei, D. repleta, and D. buzzatii (repleta species group); D. virilis and D. montana (virilis species group); D. robusta (robusta species group); D. funebris (funebris species group); and the Hawaiian species D. biseriata and D. gymnobasis. Stocks of all of these species were obtained from Bowling Green Centre, except for D. buzzatii (2st 39.13; Betran 1996). The Puregene kit protocol was used for the isolation of genomic DNA. PCR Protocols Degenerate primers based on the amino acid sequences of the known ADHR proteins were designed to partially amplify the Adhr gene in different species. The primers were designed from regions that were conserved among ADHR proteins but not between ADHR and ADH. Polymerase chain reaction (PCR) amplications were done at an annealing temperature of 45 C. The initial PCR product (500700 bp) was isolated from the gel, cloned in a T-end easy vector (Promega), and sequenced. Further primers were designed based on this sequence and used to obtain two further PCR amplications (except for D. buzzatii, for which genomic sequence was obtained; see below). The primers are given in table 1.

1346

Betran and Ashburner

FIG. 1.Diagrams of the Adh region in Drosophila lebanonensis (Juan, Papaceit, and Quintana 1994) and Drosophila buzzatii (Shafer [1992] for Adh and this work for Adhr). These gures indicate the positions of the primers used (see Materials and Methods).

Genomic Sequence of D. buzzatii A lambda phage genomic library (kindly provided by Mario Caceres [Caceres et al. 1999]) was screened with PCR-amplied products from the D. buzzatii Adhr gene. Two lambda clones were isolated and partially sequenced. Sequencing Procedures DNA sequencing was done on an ABI automated DNA sequencer (Applied Biosystems) with uorescent DyeDeoxy terminator reagents. PCR products were sequenced either directly after gel purication (Qiagen kit) or after cloning in a T-end easy vector. Phage lambda cloned DNA was sequenced using PCR primers. Sequence Alignment and Phylogenetic Inference The coding regions of the sequences were aligned using CLUSTAL W (Thompson, Higgins, and Gibson 1994) and revised by eye. MEGA, version 1.01 (Kumar, Tamura, and Nei 1994), was used to manipulate the les. The DNAML program of PHYLIP, version 3.5c (Felsenstein 1993), was used to build maximum-likelihood (ML) trees using information from all positions. PUZZLE, version 4.0 (Strimmer and von Haeseler 1996), was used to estimate from the data the transition/transversion parameter used in the DNAML program. TREEVIEW (Page 1996) was used to display the phylogenies. The sequence of the Fat body protein 2 (Fbp2) protein of D. melanogaster was used as an outgroup in

all the comparisons. This gene is clearly a member of the Adh/Adhr gene family, sharing both sequence similarities and conserved intron positions (Rat, Veuille, and Lepesant 1991). In sequence, it is roughly equally distant from both ADH and ADHR. The DDBJ/EMBL/GenBank accession numbers of sequences used in the analysis are as follows: Adh and Adhr of D. melanogaster, X78384; Fbp2 of D. melanogaster, S57693; Adh and Adhr of D. lebanonensis, M97637; Adh1 and Adh2 of D. hydei, X58694; AdhF of D. hydei, U76469; Adh1 and Adh2 of D. buzzatii, U65746; AdhF of D. buzzatii, U77607; Adh1 and Adh2 of D. mulleri, X03048; AdhF of D. mulleri, U76478; Adh1 and Adh2 of D. virilis, U26846; Adh1 of D. montana, U26842; and Adh2 of D. montana, U26845. RNA Extraction Total RNA preparations were made as described in Ashburner (1989), except that tissues were homogenized directly, without previous grinding in liquid nitrogen. RT-PCR Experiments in D. lebanonensis Total RNA was prepared from D. lebanonensis larvae and adults. Single-strand complementary DNA (cDNA) was synthesized using Superscript (GibcoBRL). Primer L6 was used to synthesize the D. lebanonensis Adhr cDNA. Adhr cDNA was amplied and sequenced using primers L1 and L2 in the Adh region and L4 and L5 in the Adhr region. Primers are described in gure 1A.

Adh/Adhr Transcription Evolution

1347

Northern Blots, Rapid Amplication of cDNA Ends, and Circular Retrotranscription PCR Experiments in D. buzzatii RNA was electrophoresed and blotted as described in Sambrook, Fritsch, and Maniatis (1989). Hybridizations were carried out as described by Yang et al. (1993) using 32P dATPlabeled probes. The full-length sequence of the D. buzzatii Adhr transcript in larvae was obtained by sequencing the products of 5 and 3 rapid amplication of cDNA ends (RACE) experiments. Single-strand cDNA was synthesized from total RNA using Superscript (Gibco-BRL). Oligo-(dT) was used to prime the synthesis of the 3 end of the cDNA. Oligo-(dT) and the specic primers R1 and R4 were used to PCR-amplify the 3 end. The nested PCR product was subcloned and sequenced. Primer R7 was used to synthesize the 5 end of the cDNA. The cDNA was tailed with dCTP by using terminal transferase (Boeringher). Oligo-(dG) and the nested primers R5 and R3 were used to PCR-amplify the 5 end of the cDNA. Primers are described in gure 1B. As an alternative method to determine the ends of the D. buzzatii Adhr transcript, we used circular retrotranscription PCR (cRT-PCR; Brogna 1999). mRNA was decapped using tobacco acid pyrophosphatase (TAP). The decapped RNA was then ligated using T4 RNA ligase. To remove the poly(A), the decapped mRNA was hybridized with oligo-T (20 C for 20 min) and the hybrid duplex was digested with RNase H. Primer R4 (see g. 1) was used to synthesize a cDNA for Adhr across the poly(A) junction. Primers R3 and R6 (g. 1) were used to amplify the Adhr cDNA. A nested amplication was achieved by using primers R2 and R8. Products were sequenced. mRNA In Situ Hybridization The temporal patterns of expression of Adh and Adhr were studied in D. buzzatii and D. lebanonensis embryos, larvae, and adult tissues. Embryos were collected in cages, dechorionated using 50% bleach, and xed in 4% formaldehyde. Hybridization was conducted as described in Tautz and Pfeie (1989) after removal of the vitelline membrane using methanol. Larval and adult tissues were dissected in PBS and xed in ice-cold 4% formaldehyde in phosphate buffer. Hybridization was performed as described in Cubas et al. (1991). Probes were DIG-dUTPlabeled by random priming. Increasing the amount of the random primer allowed the production of very small probes that easily entered cells. The probes used in D. buzzatii were the subcloned PCR products made using primers A1 and A3 for Adh and primersR1 and R7 for Adhr. The probes used for D. lebanonensis were also amplied by PCR from clones of the Adh region (kindly provided by Elvira Juan). Primers L2 and L3 were used to amplify the Adh probe, and primers D1 and D4 were used to amplify the Adhr probe (see g. 1A and table 1). Results Adhr in the Subgenus Drosophila Using degenerate primers, we partially sequenced Adhr from 10 species of the subgenus Drosophila. An ML tree of these sequences (g. 2) shows them to cluster apart from the Adh sequences, with which they show only 40%45% nucleic acid sequence identity. Adhr in D. buzzatii Drosophila buzzatii has three Adh-like genes (Adh Finnegan [AdhF], Adh2, and Adh1) within 8 kb (Shafer 1992). Adh2 and Adh1 are alcohol dehydrogenase genes and originate from a recent gene duplication (Oakeshott et al.1982; Sullivan, Atkinson, and Starmer 1990; Russo, Takezaki, and Nei 1995). The third gene, AdhF, is a less recent duplication. It had been thought to be a pseudogene, but the data of Begun (1997) support the view that it is functional. We obtained the complete sequence of the Adhr gene in D. buzzatii (g. 3A). In structure, this gene is very similar to Adhr of D. melanogaster, although the

FIG. 2.Maximum-likelihood tree (DNAML) using the 393 nt of the coding region of the Adhr partial sequences of Drosophila mulleri, Drosophila hydei, Drosophila repleta, Drosophila buzzatii, Drosophila virilis, Drosophila montana, Drosophila robusta, Drosophila funebris, and the Hawaiian species Drosophila biseriata and Drosophila gymnobasis. Sequences were aligned with the Adh sequences of these species. We also included in this alignment the sequences of the Drosophila melanogaster and Drosophila lebanonensis Adh and Adhr genes. The Fbp2 gene sequence of D. melanogaster was used as an outgroup (see text). The transition/transversion parameter used by DNAML was 1.11. This transition/transversion ratio is in agreement with that of 1.1, estimated by Russo, Takezaki, and Nei (1995) from 42 Adh sequences.

1348

Betran and Ashburner

FIG. 3.A, Complete sequence of Drosophila buzzatii Adhr. A longer sequence (see g. 2) was obtained for the 3 anking region (not shown). The transcript is in italics. The coding region and some features of the sequence are indicated as follows: initiator (TCAGTG), downstream promoter element (DPE) (GTCG), and polyadenylation signal (AATAAA) are underlined. The 5 untranslated region (UTR) is 35 bp. The 3 UTR is 211 bp. B, Alignment of ADHR in Drosophila melanogaster, Drosophila lebanonensis, and Drosophila buzzatii.

buzzatii gene has a rare splice donor sequence (GC) in intron 2. The predicted protein sequence of this gene is 82% identical to those of D. melanogaster and D. lebanonensis. In D. buzzatii, Adhr maps to the same polytene chromosome band as does the Adh gene cluster (3G1a; Labrador, Naveira, and Fontdevila 1990), as determined by in situ hybridization. The distance between Adhr and the cluster is not known. The distance could be as short as 1.5 kb if the cluster is located immediately downstream of the Adh genes (g. 1B). However, we tried to amplify the intergenic region considering all possible organizations by long PCR without succeeding and believe that the distance is longer. Adhr Is Monocistronic in D. buzzatii Figure 4A shows a Northern blot using total RNA from larvae and adults; it shows transcripts for both Adh and Adhr in both larvae and adults. The size of these transcripts suggests that both are monocistronic. There is no cross-hybridization between Adh and Adhr (g. 4B). As in D. melanogaster (Brogna and Ashburner 1997), the Adh transcript is much more abundant than that of Adhr. The monocistronic structure of the Adhr

mRNA was conrmed by a full-length cDNA sequence (g. 3A) and independent sequencing of its 5 and 3 ends by cRT-PCR. Based on the structure of the cDNA, it seems that the Adhr transcript starts 35 bp upstream of the ATG codon and ends 16 bp after the polyadenylation signal (AATAAA; g. 3A). There is no TATA box sequence. However, some putative consensus features of the known Drosophila TATA-less genes are observed (Burke and Kadonaga 1996). There is a consensus sequence for the initiation of transcription, TCAGTG, and a downstream promoter element (DPE), GTCG (g. 3A). The TATA box and the DPE appear to be functionally redundant, and promoters generally do not contain both elements (Burke and Kadonaga 1997). The DPE promoter is usually located at 18 32 and shows a requirement for spacing: any change reduces the transcriptional activity. In D. buzzatii Adhr, the putative DPE is at 14. This position may explain the low levels of expression of this gene. Temporal Pattern of Expression The tissues that show ADH activity are the larval and adult fat body and gut, the larval Malpighian tu-

Adh/Adhr Transcription Evolution

1349

The sequence conrmed that this was a dicistronic AdhAdhr transcript, including the intergenic region; the intron sequences were spliced. Since a monocistronic transcript for Adh has been detected in D. lebanonensis (Albalat and Gonzalez-Duarte 1993; Juan, Papaceit, and Quintana 1994), we believe that, as in D. melanogaster, there are two transcripts: one monocistronic transcript that encodes ADH and one dicistronic transcript that encodes both ADH and ADHR. Temporal Pattern of Expression ADH activity and/or transcription has previously been detected in larvae, pupae, and adults of D. lebanonensis but not in embryos (Juan, Papaceit, and Quintana 1994). We detected Adh and Adhr transcripts in D. lebanonensis in embryos, larvae, and adult tissues (data not shown). The localization of the transcripts in larvae and adults was similar to that observed previously. In embryos, both genes are expressed in a striking segmental pattern from stage 13 onward. Discussion In D. melanogaster, the duplicate genes Adh and Adhr are transcribed as a dicistronic mRNA, with the ADHR protein being translated, most likely, after internal ribosome entry in the 300-bp region between their coding sequences (Brogna and Ashburner 1997). We nd that Adhr is widespread, probably universal, in the subfamily Drosophilinae. In the subgenus Drosophila, as represented by D. buzzatii, it may be close to Adh but transcribed independently of that gene. In the subgenus Scaptodrosophila, these two genes are very closely linked (just 287 bp apart; Juan, Papaceit, and Quintana 1994), and, as in D. melanogaster Adhr and closely related species, they are transcribed as a dicistronic mRNA. Figure 5 summarizes what is currently known about the distribution and transcription of the Adhr gene in the genus Drosophila. One consequence of dicistronic transcription is coregulation, at least at the transcriptional level (although it is clear that translational regulation may result in different expression at the protein level). In D. buzzatti, a species in which Adh and Adhr are independently transcribed, they are also expressed in the same tissues with a very similar temporal patterns, at least at the coarse level, despite the fact that Adhr is apparently a TATAless gene. One difference in transcription between these genes in this species is seen in the embryonic gastric caecae, where Adhr, but not Adh, is expressed. It is interesting that this is a site of high Adhr expression in D. melanogaster (Brogna and Ashburner 1997). There is some evidence that the Adh genes of drosophilids have evolved from a gene encoding a member of the short-chain dehydrogenase family with a different function (Ashburner 1998; S. Brogna, personal communication). This gene may have been Adhr, or it may have been one of the several other genes encoding members of this protein family in drosophilids. The phylogeny supports the view that the ancient organization after Adh/Adhr duplication consisted of two very close genes.

FIG. 4.A, Northern blot showing total RNA from larvae and adults of Drosophila buzzatii. Total RNA from larvae and adults was run and blotted together with a Promega RNA size marker (left). Total RNA was hybridized rst with an Adhr probe (R1R7; g. 2). It was exposed for 4 days at 70 C. It was then stripped and hybridized with an Adh probe (A1A3; see g. 2). This probe should hybridize to both Adh1 and Adh2. The lter was exposed for 2 h at room temperature. RNA loading was controlled by hybridization with Drosophila melanogaster rDNA probe (kindly provided by Saverio Brogna) and exposed for 4 h at room temperature. The same amount of radiolabeled probe was used in the three hybridizations. B, Northern hybridization of total larval RNA. The Adh mRNAs were cut by RNase H after hybridization (20 C for 20 min) with oligonucleotides designed to recognize their central regions; 21-bp oligonucleotides F3, A2, and A4 were designed for the AdhF, Adh2, and Adh1 transcripts, respectively (g. 2A). After hybridization, the DNA/RNA hybrid heteroduplex was digested with RNase H. On the left, the digested larval total RNA was hybridized with a mixed Adh probe (Adh: A1A3; AdhF: F1F2 probe) and exposed for 2 h at room temperature. The 600-bp band expected from the cleaved mRNA and a small amount of residual undigested mRNA are observed. On the right, the digested larval total RNA was hybridized with an Adhr probe (R1R7) and exposed for 4 days at 70 C. Adhr is still hybridizing with the same monocistronic transcript (1 kb) and is not showing any cross-hybridization with the shorter fragment. The lter was rst hybridized with Adhr and then stripped to hybridize with Adh. The sizes of the RNA Promega marker used in the experiment are shown on the left.

bules, and the adult ovaries (Shafer 1992). We studied the distribution of Adh and Adhr transcripts in D. buzzatii embryos, larvae, and adult tissues by in situ hybridization (data not shown). Adh and Adhr transcripts were detected in all of the tissues where ADH activity has been detected. However, the location of the two transcripts in embryos differs. Adhr is expressed only in the gastric caecae, while Adh shows a residual maternal expression and is expressed early in the yolk and mesoderm and later in the fat body. Adhr in D. lebanonensis cDNA Analysis We carried out an RT-PCR to directly check the existence of a dicistronic transcript of Adh and Adhr with total larval and adult RNA of D. lebanonensis. A PCR product from larvae and adults of the size expected for a dicistronic transcript was cloned and sequenced.

1350

Betran and Ashburner

FIG. 5.Distribution of Adh and Adhr in the genus Drosophila (Russo, Takezaki, and Nei 1995; Amador and Juan 1999; this work). Lines indicate species and gene phylogenies. A double arrow indicates a duplication event. An asterisk indicates 300 bp, and a discontinuous line indicates an unknown position. Note that whenever Adhr was found prior to this work it was very closely linked to Adh. Transcription of Adhr (monocistronic or dicistronic) is shown below the gene when known (Brogna and Ashburner 1997; this work).

Our data suggest that the cotranscription of Adh and Adhr is the primitive state and that their independent transcription in the subgenus Drosophila is derived. While we can rationalize the latter condition as being correlated with the two genes evolving independent transcriptional control, why they should remain cotranscribed in groups as divergent as the subgenus Sophophora and the subgenus Scaptodrosophila remains a mystery, a mystery compounded by the clear divergence in function of their proteins. Given that these two genes are believed to originate from an adjacent duplication, most parsimoniously, the two genes have been cotranscribed since the duplication event and have evolved different functions despite this. Supplementary Material Partial or complete sequences of Adhr in the 10 species of the subgenus Drosophila have been deposited in GenBank with the accession numbers AF260690 AF260699. Alignments have been submitted to the EMBL sequence alignment database (ds42702).

Acknowledgments We are indebted to the Saverio Brogna for his generosity. His suggestions and support during the experimental work were of great help. Sam Loh, Stefan Oehler, and Natalia Sanchez-Soriano were also very helpful at different stages in the work. Mario Caceres and Al fredo Ruiz kindly supplied the genomic phage library of D. buzzatii. Elvira Juan kindly provided clones for Adh and Adhr of D. lebanonensis. We thank Antonio Barbadilla, Saverio Brogna, Martin Kreitman, Manyuan Long, Alfredo Ruiz, two anonymous reviewers, and Wolfgang Stephan for critically reading the manuscript. E.B. was supported by a postdoctoral Marie Curie Research and Mobility fellowship from European Commission Work was supported by an MRC Programme grant to M.A., Steve Russell, and David Gubb.
LITERATURE CITED
ALBALAT, R., and R. GONZALEZ-DUARTE. 1993. Adh and Adhdup sequences of Drosophila lebanonensis and D. immigrans: interspecies comparisons. Gene 126:171178.

Adh/Adhr Transcription Evolution

ALBALAT, R., G. MARFANY, and R. GONZALEZ-DUARTE. 1994. Analysis of nucleotide substitutions and amino acid conservation in the Drosophila Adh genomic region. Genetica 94:2736. AMADOR, A., and E. JUAN. 1999. Nonxed duplication containing the Adh gene and a truncated form of the Adhr gene in the Drosophila funebris species group: different modes of evolution of Adh relative to Adhr in Drosophila. Mol. Biol. Evol. 16:14391456. ANDREWS, J., M. SMITH, J. MERAKOVSKY, M. COULSON, F. HANNAN, and L. E. KELLY. 1996. The stoned locus of Drosophila melanogaster produces a dicistronic transcript and encodes two distinct polypeptides. Genetics 143:1699 1711. ASHBURNER, M. 1989. Drosophila. A laboratory manual. Cold Spring Harbor Laboratory Press, New York. . 1998. Speculations on the subject of alcohol dehydrogenase and its properties in Drosophila and other ies. BioEssays 20:949954. BEGUN, D. J. 1997. Origin and evolution of a new gene descended from alcohol dehydrogenase in Drosophila. Genetics 145:375382. BETRAN, E. 1996. Efecto del polimorsmo cromosomico sobre componentes de la ecacia biologica y caracteres morfolo gicos en Drosophila buzzatii. Ph.D. thesis. Universidad Autonoma de Barcelona Press, Barcelona, Spain. ` BLUMENTHAL, T. 1995. Trans-splicing and polycistronic transcription in Caenorhabditis elegans. Trends. Genet. 11:132 136. . 1998. Gene clusters and polycistronic transcription in eukaryotes. BioEssays 20:480487. BLUMENTHAL, T., and J. SPIETH. 1996. Gene structure and organization in Caenorhabditis elegans. Curr. Opin. Genet. Dev. 6:692698. BROGNA, S. 1999. Nonsense mutations in the alcohol dehydrogenase gene of Drosophila melanogaster correlate with an abnormal 3 end processing of the corresponding premRNA. RNA 5:562573. BROGNA, S., and M. ASHBURNER. 1997. The Adh-related gene of Drosophila melanogaster is expressed as a functional dicistronic messenger RNA: multigenic transcription in higher organisms. EMBO J. 16:20232031. BURKE, T. W., and J. T. KADONAGA. 1996. Drosophila TFIID binds to a conserved downstream basal promoter element that is present in many TATA-box-decient promoters. Genes Dev. 10:711724. . 1997. The downstream core promoter element, DPE, is conserved from Drosophila to humans and is recognized by TAFII60 of Drosophila. Genes Dev. 11:30203031. CACERES, M., J. M. RANZ, A. BARBADILLA, M. LONG, and A. RUIZ. 1999. Generation of a widespread Drosophila inversion by a transposable element. Science 285:415418. CHAMBERS, G. K. 1988. The Drosophila alcohol dehydrogenase gene-enzyme system. Adv. Genet. 25:40107. CLARK, S. G., X. LU, and H. R. HORVITZ. 1994. The Caenorhabditis elegans locus lin-15, a negative regulator of a tyrosine kinase signaling pathway, encodes two different proteins. Genetics 137:987997. CUBAS, P., J. F. DE CELIS, S. CAMPUZANO, and J. MODOLELL. 1991. Proneural clusters of achaeta-scute expression and the generation of sensory organs in the Drosophila imaginal disc. Genes Dev. 5:9961008. FELSENSTEIN, J. 1993. PHYLIP (phylogeny inference package). Version 3.5. Distributed by the author, Department of Genetics, University of Washington, Seattle.

1351

HUANG, L. S., P. TZOU, and P. W. STERNBERG. 1994. The lin15 locus encodes two negative regulators of Caenorhabditis elegans vulval development. Mol. Biol. Cell. 5:395412. JEFFS, P. S., E. C. HOLMES, and M. ASHBURNER. 1994. The molecular evolution of the Alcohol dehydrogenase and Alcohol dehydrogenase-related genes in the Drosophila melanogaster species subgroup. Mol. Biol. Evol. 11:287304. JUAN, E., M. PAPACEIT, and A. QUINTANA. 1994. Nucleotide sequence of the genomic region encompassing Adh and Adh-Dup genes of D. lebanonensis (Scaptodrosophila): gene expression and evolutionary relationships. J. Mol. Evol. 38:455467. KUMAR, S., K. TAMURA, and M. NEI. 1994. MEGA: molecular evolutionary genetics software for microcomputers. Comput. Appl. Biosci. 10:189191. LABRADOR, M., H. NAVEIRA, and A. FONTDEVILA. 1990. Genetic mapping of the Adh locus in the repleta group of Drosophila by in situ hybridization. J. Hered. 81:8386. LEE, S. J. 1991. Expression of growth/differentiation factor 1 in nervous system: conservation of a bicistronic structure. Proc. Natl. Acad. Sci. USA 88:42504254. NURMINSKY, D. Y., E. N. MORIYAMA, E. R. LOZOVSKAYA, and D. L. HARTL. 1996. Molecular phylogeny and genome evolution in Drosophila virilis species group: duplication of the Alcohol dehydrogenase gene. Mol. Biol. Evol. 13:132149. OAKESHOTT, J. G., G. K. CHAMBERS, P. D. EAST, J. B. GIBSON, and J. S. F. BARKER. 1982. Evidence for a genetic duplication involving alcohol dehydrogenase genes in Drosophila buzzatii and related species. Aust. J. Biol. Sci. 35:73 84. PAGE, R. D. M. 1996. TREEVIEW: an application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12:357358. PAGE, A. P. 1997. Cyclophilin and protein disulphide isomerase genes are cotranscribed in a functionally related manner in Caenorhabditis elegans. DNA Cell Biol. 16:13351343. POWELL, J. R. 1997. Progress and prospects in evolutionary biology: The Drosophila model. Oxford University Press, Oxford, England. RAT, L., M. VEUILLE, and J. A. LEPESANT. 1991. Drosophila fat body protein P6 and Alcohol dehydrogenase are derived from a common ancestral protein. J. Mol. Evol. 33:194 203. RUSSO, C. A. M., N. TAKEZAKI, and M. NEI. 1995. Molecular phylogeny and divergence times of drosophilid species. Mol. Biol. Evol 13:391404. SAMBROOK, J., E. F. FRITSH, and T. MANIATIS. 1989. Molecular cloning. A laboratory manual. 2nd edition. Cold Spring Harbor Laboratory Press, New York. SCHAEFER, S. W., and C. F. AQUADRO. 1987. Nucleotide sequence of the Adh gene region of Drosophila pseudoobscura: evolutionary change and evidence for an ancient gene duplication. Genetics 117:6173. SHAFER, D. J. 1992. Developmental and molecular studies of Adh in Drosophila buzzatii. Masters thesis, University of New England Armidale, New South Wales, Australia. SPIETH, J., G. BROOKE, S. KUERSTEN, K. LEA, and T. BLUMENTHAL. 1993. Operons in C. elegans: polycistronic mRNA precursors are processed by trans-splicing of SL2 to downstream coding regions. Cell 73:521532. STRIMMER, K., and A. VON HAESELER. 1996. Quartet puzzling: a quartet maximum likelihood method for reconstructing tree topologies. Mol. Biol. Evol. 13:964969. SULLIVAN, D. T. P., P. W. ATKINSON, and W. T. STARMER. 1990. Molecular evolution of the Alcohol dehydrogenase genes in the genus Drosophila. Evol. Biol. 24:107147.

1352

Betran and Ashburner

TATARENKOV, A., J. KWIATOWSKI, D. SKARECKY, E. BARRIO, and F. J. AYALA. 1999. On the evolution of Dopa decarboxylase (Ddc) and Drosophila systematics. J. Mol. Evol. 48:445462. TAUTZ, D., and C. PFEIFLE. 1989. A non-radioactive in situ hybridization method for the localization of specic RNAs in Drosophila embryos reveals translational control of the segmentation gene hunchback. Chromosoma 98:8185. THOMPSON, J. D., D. G. HIGGINS, and T. J. GIBSON. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specic gap penalties and weight matrix choice. Nucleic Acids Res. 22:46734680. YANG, H., J. MCLEESE, M. WEISBART, J. L. DIONNE, I. LEMAIRE, and R. A. AUBIN. 1993. Simplied high throughput

protocol for Northern hybridization. Nucleic Acids Res. 21: 33373338. ZHANG, Y., J. ROOTE, S. BROGNA, A. W. DAVIS, D. A. BARBASH, D. NASH, and M. ASHBURNER 1999. Stress sensitive B encodes an adenine nucleotide translocase in Drosophila melanogaster. Genetics 153:891903. ZORIO, D. A. R., N. N. CHENG, T. BLUMENTHAL, and J. SPIETH. 1994. Operons as a common form of chromosomal organization in C. elegans. Nature 372:270272.

WOLFGANG STEPHAN, reviewing editor Accepted May 29, 2000