You are on page 1of 178

ANNALS OF ANIMAL SCIENCE

NATIONAL RESEARCH INSTITUTE OF ANIMAL PRODUCTION


Vol. 6

KRAKOW 2006

No. 1

EDITORIAL BOARD Je drzej Krupinski (Chairman) Krakow-Balice, Franciszek Brzoska Krakow-Balice, Clas Elwinger Uppsala, Tibor Gere Gyngys, Kay-Uwe Gtz Poing-Grub, Ingemar Gustavsson Uppsala, Eugeniusz Herbut Krakow-Balice, Dymitr Kaliszewicz Olsztyn, Jolanta Kury Jastrzebiec, Andrzej Potkanski Poznan, Eligiusz Rokicki Warszawa, Marian Rozycki Krakow-Balice, Yasuo Shioya Ibaraki, Zdzisaw Smorag Krakow-Balice, Vasyl Vlizlo Lviv, Stanisaw We yk Krakow-Balice, z Jacek Wojtowski Poznan EDITORIAL STAFF Editor-in-Chief Ewa Sota Deputy Editors-in-Chief Marian Duniec, Mariusz Pietras Secretary Halina Lach Editing Danuta Dobrowolska, Halina Lach, Jerzy Pilawski Cover design Beata Barszczewska-Wojda

Address of Editorial Office Instytut Zootechniki ul. Sarego 2, 31-047 Krakow, Poland

The Annals of Animal Science are derived from the journal Roczniki Naukowe Zootechniki which has been published since 1974 This publication was supported by the Ministry of Education and Science

Copyright by National Research Institute of Animal Production

PL ISSN 1642-3402

Ann. Anim. Sci., Vol. 6, No. 1 (2006)

CONTENT

Genetics and farm animal breeding 1. M. Bugno, M. Owczarek-Lipska, A. Pienkowska-Schelling, E. Sota Variation in the size of the Y chromosome in four breeds of domestic horse . . . . . . . . . . . . bek, A. Zyga, A. Radko, E. Sota Analysis of genetic variation in Maopolski 2. T. Za horses using molecular and pedigree data . . . . . . . . . . . . . . . . 3. U. Czarnik, T. Zabolewicz, C.S. Pareek, R. Zieminski, K. Walawski Evaluation of putative relationship between PRNP octapeptide repeat polymorphism and variability of milk production traits in cattle . . . . . . . . . . . . . . . . . . . . . . . . . . 4. A. Felenczak, A. Fertig, E. Gardzina, M. Ormian, J. Trela Technological traits of milk of Simmental cows as related to -casein polymorphism . . . . . . . . . . . 5. J. Komisarek, K. Waskowicz, Z. Dorynek Analysis of the relationship between two single nucleotide polymorphisms of the butyrophilin (BTN1A1) gene and milk production traits in Jersey cattle . . . . . . . . . . . . . . . . . . . . . . . . Biology, physiology and animal reproduction 6. J. Pytlewski, I. Antkowiak, Z. Dorynek Relationship between interpregnancy interval and lifetime productivity of cows . . . . . . . . . . . . . . . . . . . 7. A. Mazanowski, Z. Bernacki, M. Adamski, T. Kisiel Analysis of time trends for reproductive and meat traits in randomly mated conservation flocks of northern variety geese . 8. A. Mazanowski, E. Samorek-Salamonowicz, M. Urbanowski Level and duration of persistence of antibodies in the blood serum of native varieties of geese after vaccination against Derzsys disease . . . . . . . . . . . . . . . . . . . . . . . . .

5 13

29 37

45

53 59

75

Animal nutrition and feedstuffs 9. F. Brzoska Effect of rapeseed meal protected with calcium salts of fatty acids from linseed oil on cows yield and milk and blood parameters . . . . . . . . . . . . . 87 tkiewicz Effect of glucanase and 10. E. Hanczakowska, J. Urbanczyk, I. Khn, M. Swia xylanase supplementation of feed for weaned piglets . . . . . . . . . . . . . 101 11. A. Szewczyk, F. Borowiec, E. Hanczakowska Fatty acid and cholesterol content of meat of broilers fed linseed oil or different linseed varieties . . . . . . . . . . . . 109 12. S. Nowaczewski, H. Kontecka, E. Pruszynska-Oszmaek Effect of feed supplementation with vitamin C on haematological indices, corticosterone concentration in blood and duration of tonic immobility in pheasants . . . . . . . . . . . . . . . . . . . 117 Environment, hygiene and animal production technology 13. S. Kornas, B. Nowosad, M. Skalska Dynamics of small strongyle (Cyathostominae) infection in horses under different management systems . . . . . . . . . . . . 14. P. Paraponiak Effect of crossbreeding on pasture rearing of lambs and chemical and sensory properties of slaughter material . . . . . . . . . . . . . . . .

129 139

4
15. Hannu T. Korhonen, L. Jauhiainen, T. Rekil Effects of year-round nestbox availability and temperament on welfare and production performance in blue foxes (Alopex lagopus) 16. I. Skomorucha, E. Herbut Use of an earth-tube heat exchanger to optimize broiler house climate during the summer period . . . . . . . . . . . . . . . . . . . 149 169

Ann. Anim. Sci., Vol. 6, No. 1 (2006) 5 12

VARIATION IN THE SIZE OF THE Y CHROMOSOME IN FOUR BREEDS OF DOMESTIC HORSE*

M o n i k a B u g n o1, M a r t a O w c z a r e k - L i p s k a2, A l d o n a P i e n k o w s k a - S c h e l l i n g2, E w a S o t a1


1

Department of Immuno- and Cytogenetics, National Research Institute of Animal Production, 32-083 Balice n. Krakow, Poland 2 Department of Genetics and Animal Breeding, Agricultural University, Woynska 33, 60-637 Poznan, Poland

Abstract The mean relative lengths of the Y chromosome were measured for each of four horse breeds (pure Arab, noble half-bred, Hutsul and Shetland pony). The measurement included the length of the X and Y chromosomes as well as the constitutive heterochromatin block of the Y chromosome. Using statistical methods, highly significant within-species differences were shown in the ratios of the constitutive heterochromatin block to Y chromosome length and the ratio of Y chromosome length to X chromosome length. Key words: horse, length polymorphism, Y chromosome

The Y chromosomes of different mammalian species vary widely in the morphology, size and content of genes. The smallest Y chromosome is found in marsupials: it is only 10 Mb in size and has no pseudoautosomal region, which means that no pairing with the X chromosome and thus no formation of synaptonemal complexes and no recombination with the X chromosome, take place (Toder et al., 2000). The human Y chromosome has a completely different structure. It is considerably larger (approximately 60 Mb) and has two pseudoautosomal regions localized in the distal part of the short and long arms (Quintana-Murci et al., 2001). Most of the human Y chromosome sequences (as much as 95%) are defined as non-recombining regions (NRY). They can occur in euchromatic, centromeric and heterochromatic regions (Foote et al., 1992).

* The work was conducted as part of NRIAP statutory activity, project no. 3207.1.

M. Bugno et al.

In horses, the size of the Y chromosome corresponds with the smallest acrocentric chromosomes, while the X chromosome is a large submetacentric. After CBG staining, constitutive heterochromatin emerges in the area of almost the entire Y chromosome and on an additional band on the q arm of the X chromosome (Bugno et al., 2005). Because of the different degrees of chromosome spiralization during the course of mitosis, which prevents the absolute values from being compared, the relative value of the Y chromosome was evaluated in all the studies with the aim of showing the polymorphism of the Y chromosome. This value was expressed as the centromeric index, the long arm to short arm ratio (q : p), or the percentage length of the haploid set of autosomes plus the length of the X chromosome (Sawomirski b, et al., 1979; Switonski and Podra 1983; Kozubska-Sobocinska et al., 1995). witonski and Podrab, 1983; Animals of the same breed were compared (S Switonski, 1984; Koodziejski et al., 1997; Koodziejski and Pietrzak, 1999) and possible between-breed differences were also explored (Sawomirski et al., 1979; Popescu, 1990; Kozubska-Sobocinska et al., 1995). It was found that the differences in Y chromosome size were observed both between animals of the same breed and between different breeds. To investigate Y chromosome polymorphism, this study compared the size of the Y chromosome in relation to the X chromosome as well as measured the constitutive heterochromatin block and its relation to the entire Y chromosome. This allowed for an objective evaluation of polymorphism in the pure Arab, noble half-bred, Hutsul and Shetland pony breeds.

Material and methods Y chromosome polymorphism was classified based on measurements of sex chromosome lengths in four horse breeds of different utility types: pure Arab, noble half-bred, Hutsul and Shetland pony. Cytogenetic analysis covered pure Arab, noble half-bred and Hutsul stallions (three per breed) and four Shetland Pony stallions. Metaphase plates, obtained by routine lymphocyte culture, were CBG stained (Sumner, 1972) to reveal constitutive heterochromatin and to identify sex chromosomes. Using the LUCIA computer image analysis system, the lengths of the X, Y and pair 1 chromosomes were measured on ten different metaphase plates, taking into account the mean length of two chromatids. The relative length of the Y sex chromosome was calculated from the ratio of the mean length of the X chromosome chromatids (Y : X). In addition, the size of the constitutive heterochromatin block and its ratio to the entire Y chromosome were determined. Due to considerable differences in the length of sex chromosomes within the metaphase plates of the same animal, means from 10 measurements of the relative length of the Y chromosome were calculated for each stallion. The mean lengths of the Y chromosome for each breed were calculated based on

Variation in the size of the Y chromosome in the horse

30 measurements and compared by statistical methods using one-way analysis of variance and the Fisher-Snedecor test to identify the Y chromosome polymorphism between the analysed breeds. This test analyses continuous random variables (in this case, the measurements taken).

Results Statistical analysis did not show any significant differences in the relative Y chromosome length or heterochromatin block lengths between the pure Arab, noble half-bred, Hutsul and Shetland pony breeds (Tables 1 and 2).
Table 1. Analysis of variance of the relative length of the heterochromatin region of the Y chromosome in horses between pure Arab, noble half-bred, Hutsul and Shetland pony breeds Source of variation Total Between breeds Within breeds Degrees of freedom 12 3 9 Sum of square deviations (SS) 0.026 0.007 0.019 Mean square deviations (MS) 0.0023 0.002 F value

1.5

Table 2. Analysis of variance of the relative length of the Y chromosome in horses between pure Arab, noble half-bred, Hutsul and Shetland pony breeds Source of variation Total Between breeds Within breeds Degrees of freedom 12 3 9 Sum of square deviations (SS) 3097 0.02 3.95 Mean square deviations (MS) 0.01 0.44 F value

0.02

Analysis of variance for the size of the Y chromosome and constitutive heterochromatin block of this chromosome for all the stallions revealed highly significant differences between the animals (Tables 3 and 4). In this case, detailed comparisons were analysed (Table 5).

Table 3. Analysis of variance of the relative length of the Y chromosome in all investigated horses Source of variation Total Between animals Within animals Degrees of freedom 129 12 117 Sum of square deviations (SS) 0.80 0.18 0.62 Mean square deviations (MS) 0.02 0.005 F value

2.89**

M. Bugno et al. Table 4. Analysis of variance of the relative length of the heterochromatin region of the Y chromosome in all investigated horses Source of variation Degrees of freedom 129 12 117 Sum of square deviations (SS) 0.862 0.214 0.648 Mean square deviations (MS) 0.018 0.005 F value

Total Between animals Within animals

3.22 xx

xx highly significant differences at P 0.01.

When analysing the ratio of the constitutive heterochromatin length to the entire Y chromosome length and the ratio of the Y chromosome to X chromosome length, it was found that animal no. 13 (Table 5), a Shetland pony, showed the greatest highly significant and values in within-species variation in the first measurement, compared to the other animals. Meanwhile, animal no. 5 (Table 5), a noble half-bred horse, showed highly significant within-species variation in the second measurement compared to the other animals.

Table 5. Results of the detailed NIR-Fisher test for the animals investigated No. Breed Number and frequency of the objects compared using the NIR-Fisher test heterochromatin/Y chromosome Y chromosome/X chromosome = 0.05 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. Pure Arab Pure Arab Pure Arab Noble half-bred Noble half-bred Noble half-bred Hutsul Hutsul Hutsul Shetland pony (mini) Shetland pony Shetland pony Shetland pony 3 (6.52%) 5 (10.87%) 3 (6.52%) 4 (8.70%) 5 (10.87%) 5 (10.87%) 4 (8.70%) 2 (4.35%) 1 (2.17%) 1 (2.17%) 3 (6.52%) 1 (2.17%) 9 (19.57%) = 0.01 (4.55%) (9.09%) (4.55%) (13.63%) (13.63%) (13.63%) (9.09%) 0 0 1 (4.55%) 0 0 6 (27.28%) 1 2 1 3 3 3 2 = 0.05 0 1 (3.12%) 1 (3.12%) 1 (3.12%) 11 (34.38%) 1 (3.12%) 4 (12.50%) 3 (9.38%) 1 (3.12%) 2 (6.26%) 3 (9.38%) 1 (3.12%) 3 (9.38%) = 0.01 2 (8.33%) 1 (4.17%) 1 (4.17%) 1 (4.17%) 10 (41.66%) 1 (4.17%) 1 (4.17%) 0 1 (4.17%) 1 (4.17%) 2 (8.33%) 1 (4.17%) 2 (8.33%)

The examples of different length Y chromosomes are shown in Figure 1.

Variation in the size of the Y chromosome in the horse

Figure 1. The examples of different length Y chromosomes between horse breeds

Discussion The earliest Y chromosome polymorphism studies were carried out in humans. At a Denver conference in 1960, it was stated that the Y chromosome varies the most in terms of total length and arm length ratio. Two size variants of the Y chromosome were observed and both the small Y chromosome (Genest and Lejeune, 1972; Genest, 1981) and the large Y chromosome (Unnerus et al., 1967) were shown to be heritable traits. As animal cytogenetic studies developed, attempts were made to determine the phenomenon of chromosomal polymorphism in different species (Vorontsov et al., 1978; Eldridge et al., 1983; Sota et al., 1985; Kozubska-Sobocinska et al., 1995). Y chromosome polymorphism has been described more often in cattle than in any other species of farm animal. In bovines, highly significant between-breed differences were identified, and Y chromosome polymorphism was found to be heritable (Cribiu and Popescu, 1974; Cribiu, 1975; Hansen and Ellebby, 1975; de Giovanni b, and Cribiu, 1977; Switonski and Podra 1983; Switonski, 1984; Kozubska-Sobocinska et al., 1995). Studies of Y chromosome length polymorphism have also been carried out in sheep (Sota et al., 1985), and in pigs (Sota, 1998). Significant differences in the relative length of chromosome Y between investigated pig breeds and lines were observed. The polymorphic variants of the chromosome Y length were found to be a characteristic feature of every breed. Observations made by Pienkowska-Schelling et al. in 2004 on Canidae animals provide a significant source of information on differences in the Y chromosomes of the maned wolf and fennec. It was found that the Y chromosome of the maned wolf

10

M. Bugno et al.

is characterized by a very large constitutive heterochromatin block, which affects the size of the chromosome, unlike in the fennec, in which this block is practically non-existent and the Y chromosome is very small (Pienkowska-Schelling et al., 2004). The first observations and measurements of the Y chromosome in horses were made in the 1980s by Stranzinger (1980) and Hansen (1984). They suggested that Y chromosomes can be of different lengths, as confirmed by the studies of Power, which revealed that the largest Y chromosome was twice the length of the smallest Y chromosome (Power, 1988). The present measurements were subjected to statistical analysis to reveal significant differences in the size of the Y chromosome. Highly significant differences were found for the ratio of the constitutive heterochromatin block to Y chromosome length and the ratio of Y chromosome length to X chromosome length. Preliminary detailed analysis showed that a Shetland pony horse made the greatest contribution to within-species variation of Y chromosome length polymorphism as measured by the ratio of the constitutive heterochromatin block to the Y chromosome, and a noble half-bred horse had the greatest within-species variation as measured by the ratio of Y chromosome length to X chromosome length. Until now no correlation has been observed between Y chromosome size and same phenotypical or physiological traits. It can be concluded from the present study that variation is an animal-specific rather than a breed-specific trait. However, it would be beneficial to continue this study with a greater number of animals per breed to provide extensive information on between-breed variation in the length of the Y chromosome.

References B u g n o M., S o t a E., P i e n k o w s k a - S c h e l l i n g A., S c h e l l i n g C. (2005). Efektywna metoda diagnozy aneuploidii chromosomu X najczestszej aberracji kariotypu koni. Rocz. Nauk. Zoot., 32, 1: 11 14. C r i b i u E.P. (1975). Variation interraciale de la taille du chromosome Y chez Bos Taurus L. Ann. Genet. Sel. Anim., 7, 2: 139 144. C r i b i u E.P., P o p e s c u C.P. (1974). Un cas de chromosome Y anormalement long chez Bos Taurus L. Ann. Genet. Sel. Anim., 6: 387 390. E l d r i d g e F.E., F a r v e r K o e n i n g J.L., H a r r i s N. (1983). Y chromosome variation in the bovine. Abstr. 3th North Amer. Symp. Cytogenet. Cell Biol. Domest. Anim., Medison; p. 245. F o o t e S., V o l l r a t h D., H i l t o n A., P a g e D.C. (1992). The human Y chromosome: overlapping DNA clones spanning the euchromatic region. Science, 258: 60 66. G e n e s t P. (1981). Etude complementaire sur la nature dun petit Y multicentenaire. Ann. Genet., 24, 4: 165 166. G e n e s t P., L e j e u n e J. (1972). Recherche sur lorigine dun petit chromosome multicentenaire. Ann. Genet., 15, 1: 51 53. G i o v a n n i A. de, C r i b i u E.P. (1977). Etude des variations du chromosome Y dans quatre races bovines italiennes. Ann. Genet. Sel. Anim., 9: p. 527. H a n s e n K.M. (1984). Two different length of the Y chromosomes of the domestic horse (Equus caballus). 6th Eur. Coll. Cytogenet. Domest. Anim., pp. 172 176.

Variation in the size of the Y chromosome in the horse

11

H a n s e n K.M., E l l e b b y F. (1975). Chromosome investigation of Danish A.I. beef bulls. Nord. Vet. Med., 27: 102 105. K o o d z i e j s k i Z., P i e t r z a k S. (1999). Okreslenie polimorfizmu chromosomu Y u ogierow wybranych ras krajowych. Aktualne kierunki hodowli i uzytkowania koni w Europie. Symp. miedz., Krakow, 17 19.09.1999, pp. 360 366. K o o d z i e j s k i Z., J a s z c z a k K., S y s a P. (1997). Polimorfizm chromosomu Y u koni ras krajowych. XXV Ogolnopolska Jubileuszowa Konferencja Naukowa Sekcji Fizjologii i Patologii Konia PTNW, Pawowice, 23 24.05.1997, pp. 4 5. K o z u b s k a - S o b o c i n s k a A., S o t a E., D a n i e l a k - C z e c h B., R e j d u c h B. (1995). Clas sification of the chromosome Y polymorphism in four cattle breeds based on the measurements of sex chromosome length. Rocz. Nauk. Zoot., 22, 2: 29 36. P i e n k o w s k a - S c h e l l i n g A., Z a w a d a M., S c h e l l i n g C. (2004). Initial Cytogenetic Studies in three wild canid species. Cytogenet. Genom Res., 106: p. 13. P o p e s c u P.C. (1990). Chromosomes of the cow and bull. Adv. Vet. Sci. Comp. Med., 34: 41 71. P o w e r M.M. (1988). Y chromosome length variation and its significance in the horse. J. Hered., 79: 311 313. Q u i n t a n a - M u r c i L., K r a u s z C., M c E l r e a v e y K. (2001). The human Y chromosome: function, evolution and disease. Forensic Sci. Int., 118: 169 170. S a w o m i r s k i J., S y s a P.S., L i w s k a J. (1979). Charakterystyka morfologiczna metafazalnych chromosomow pciowych u byda domowego (Bos Taurus dom., L.). Med. Wet., 4: 236 237. S o t a E. (1998). Polimorfizm chromosomow swini. Rocz. Nauk. Zoot., Rozp. hab., nr 7. S o t a E., K o z u b s k a A., K r u p i n s k i J. (1985). Charakterystyka chromosomow pciowych trzech ras owiec hodowanych w Polsce. Rocz. Nauk. Zoot., 12, 1: 15 22. S t r a n z i n g e r G. (1980). Zytogenetic im dienste der Nutztierzucht. Jahrbuch Schweiz. Naturforsch. Gessell. Wiss., 3: 68 79. S u m n e r A.T. (1972). A simple technique for demonstrating centromeric heterochromatin. Exp. Cell. Res., 75: 303 306. S w i t o n s k i M. (1984). Cytogenetic examination of bulls. Variants of the Y chromosome. Genet. Pol., 25, 4: 427 434. b cych morfologie chromo S w i t o n s k i M., P o d r a A. (1983). Zmiennosc parametrow charakteryzuja somow pci u buhajow. VIII Zjazd PTG, streszcz.; p. 59. T o d e r R., W a k e f i e l d M.J., G r a v e s J.A.M. (2000). The minimal mammalian Y chromosome the marsupial Y as a model system. Cytogenet. Cell Genet., 91: p. 285. U n n e r u s V., F e l l m a n J., C h a p e l l e A. de la (1967). The length of the human Y chromosome. Cytogenetics, 6: 213 227. V o r o n t s o v N.N., B o r i s o v Y.M., K a r t a v e v a I.V. (1978). Variability in mammalian sex chromosomes. XIV Int. Congr. Genet., Moscow; p. 281.

Accepted for printing 27 IV 2006

MONIKA BUGNO, MARTA OWCZAREK-LIPSKA, ALDONA PIENKOWSKA-SCHELLING, EWA SOTA


Zroznicowanie wielkosci chromosomu Y u koni czterech ras STRESZCZENIE W oparciu o pomiary dugosci chromosomow X, Y, jak rowniez bloku heterochromatyny konstytutywnej chromosomu Y u koni czterech ras (czysta krew arabska, szlachetna pokrew, hucu i kuc c szetlandzki) obliczono srednie wzgledne dugosci chromosomu pciowego Y dla kazdej rasy. Posuguja

12

M. Bugno et al.

trzgatunkowe w stosunku bloku sie metodami statystycznymi wykazano wysoko istotne roznice wewna heterochromatyny konstytutywnej do dugosci chromosomu Y oraz dugosci chromosomu Y do dugosci chromosomu X.

Ann. Anim. Sci., Vol. 6, No. 1 (2006) 13 27

ANALYSIS OF GENETIC VARIATION IN MAOPOLSKI HORSES USING MOLECULAR AND PEDIGREE DATA* b T o m a s z Z a e k, A g a t a Z y g a, A n n a R a d k o, E w a S o t a
Department of Animal Immuno- and Cytogenetics, National Research Institute of Animal Production 32-083 Balice n. Krakow, Poland Abstract Maopolski horses have different proportions of Anglo-Arabian and oriental horse breeds in their pedigrees. Since 1999 a steady reduction in the population of this breed has been observed. Studies on genetic variation using 18 microsatellites were conducted in 5 Maopolski subpopulations and in Thoroughbred and Arabian horses, the breeds used in Maopolski breeding. Analysis of the genetic structure of the investigated Maopolski population revealed that the gene pool characteristic of its original population could be reduced by a strong influence from other horse breeds, especially Thoroughbreds. The variation levels expressed by expected heterozygosity for Maopolski horses were close to those reported for other crossbred populations of horses. The studied Maopolski population is not in danger of inbreeding, and the main source of genetic variation in Maopolski horses is the presence of a number of breeds in their pedigrees used for breeding purposes in this breed. Phylogenetic analysis revealed that Thoroughbreds have made the greatest contribution to the gene pool of the current Maopolski population. Key words: Maopolski horse, microsatellites, genetic variation

The Maopolski breed derives from horses bred in the south-eastern part of Poland in the 15th century. Initially, local horses from this region were improved with oriental horses such as Persian, Turkish, Turkmenian and purebred Arabian horses, leading to the formation of halfbred oriental type. Since the second half of the 19th century, in addition to the use of halfbred stallions from oriental Austro-Hungarian lineages (Schagya, Gidran, Dahoman, Amurath, Gazlan, Furioso, Przedswit, Nonius etc.), English part-bred and Thoroughbred stallions and also Arabian and Anglo-Arabian stallions have been intensively used for reproduction. The great contribution of Thoroughbred and Arabian blood has produced horses of the halfbred Anglo-Arabian type. Ultimately, the Maopolski breed was formed by

* This work was conducted as part of the research project no. 3P06D 001 24, financed by the State Committee for Scientific Research.

14

T. Zabek et al.

horses with different percentages of Anglo-Arabian blood, which had many characteristics of the oriental-type horses. The stud book for the Maopolski breed was founded in 1963. Since the reduction in demand for farm work horses, Maopolski horses have been increasingly used in leisure riding and sport. Since 1999 a steady reduction in the effective population size of this horse has been observed. The number of registered mares and sires is becoming smaller, and it is not known whether the size of the population will enable viable breeding in view of the genealogical differences between breeding lines with avoidance of inbred matings (http://www.pzhkm.pl/rasa.php). One of the first visible effects of inbreeding might be a reduction in the breeding value of Maopolski stallions in comparison to the stallions of other Polish warmblood breeds, reported by Dobrowolski and Geringer (2003). The purpose of our study was to evaluate the genetic variation of the current population of Maopolski horses with regard to the influence of Thoroughbred and purebred Arabian horses, using molecular marker loci (DNA microsatellite sequences). Highly polymorphic microsatellites are markers of choice for population study in a number of wild and domesticated animal breeds. In Poland, the polymorphism of these markers has been determined in purebred Arabian (Gralak et al., 1998), bek et Thoroughbred (Gralak et al., 1998; Niemczewski and Zorkowski, 2000; Za bek et al., 2003), Bigoraj (Za bek et al., 2005) and Polish al., 2003), Silesian (Za Primitive horses (Gralak et al., 2001). The present study involved analysing the genetic structure of the three horse populations on the basis of 18 microsatellite loci, studying the genetic variability within and between Maopolski subpopulations (studs), and determining molecular genetic relationships between them, including the influence of Arabian and Thoroughbred horses on the Maopolski gene pool.

Material and methods The investigated Maopolski population (M) (408 individuals) included mainly Anglo-Arabian horses with different proportions of Thoroughbred (TH), Arabian (AR), Anglo-Arabian (AA) and purebred Anglo-Arabian (*AA*) horses in pedigre es (Table 1). The five largest studs were: Walewice (WM), Prudnik (PM), Udorz (UM), Janow Podlaski (JM) and Ochaby (OM). Some other breeds also occurred in the pedigrees of the studied M horses, such as Polish pure half-bred (SP), Belgian warmblood (BWP), Hanoverian (HAN) and Selle-Franais (SF) horses. The forty Thoroughbred horses included in this study were derived from 3 Polish studs (Strzegom, Moszna and Stubno). The fifty horses of the Arabian breed came from the Janow Podlaski and Michaow studs. Hair root or blood samples of horses were the source of genomic DNA, prepared using a modified version of the method of Kawasaki (1990). Genotyping was performed on 18 microsatellite loci: AHT4, AHT5 (Binns et al., 1995), ASB2, ASB17 (Breen et al., 1997), HMS1, HMS2, HMS3, HMS6, HMS7 (Guerin et al., 1994), HTG4, HTG6 (Ellegren et al., 1992), HTG7, HTG10 (Marklund et al.,

Analysis of genetic variation in Maopolski horses

15

1994), VHL20 (Van Haeringen et al., 1994), ASB23 (Irvin et al., 1998), UCDEQ425 (Eggleston-Stott et al., 1997), LEX3 (Coogle et al., 1996), and LEX33 (Coogle, 1996). The DNA microsatellites were amplified by polymerase chain reaction (PCR) and fluorescently labelled PCR products were subjected to vertical electrophoresis in denaturing 4% polyacrylamide gel on a Genetic Analyser (ABI PRISM 377, Applied Biosystems, Foster City, USA). Allele sizes were determined after processing of raw data using the software packages GENESCAN 2.0 and GENOTYPER 2.1 (Applied Biosystems). Pedigree records were used to determine the number of progeny of the parents of particular breeds and to derive the mare families and male lines of the investigated Maopolski horses. For the pedigree analysis, data from the Studbook of Maopolski horses (volumes II to VI) were used. Part of the information also came from annual specifications of breeding plans released by particular studs. Estimation of allelic frequency and a test for the presence of Hardy-Weinberg equilibrium (H-W) following the method of Guo and Thompson (1992) were performed using the TFPGA program (Miller, 1997). The variation level in selected groups of horses was established according to the observed (Ho) and expected (He) heterozygosity (Nei, 1978) measured using the MSA program (Dieringer and Schltterer, 2002). Genetic differentiation among the studied horse populations was measured using the fixation coefficients (Fis and global Fst) calculated according to Weir and Cockerham (1984) using the FSTAT program (Gaudet, 1995). The Fis estimator was used as an inbreeding coefficient for the evaluation of genetic equilibrium in the studied populations. The P-values of the F-statistic permutation test were adjusted according to the sequential Bonferroni method (Holm, 1979). Pairwise Fst coefficients were used to demonstrate genetic differences between the investigated horse groups. To illustrate the gene flow between groups of horses, the number of effective migrants per generation (Nm) was calculated based on Fst estimates using the formula described by Wright (1969). The distance based on proportion of shared alleles Dps (Bowcock et al., 1994) was calculated using the MSA program (Dieringer and Schltterer, 2002). Using distance matrices the UPGMA tree was generated using the Phylip 3.2 package (Felsenstein, 1989) and phylogenetic dendrograms were constructed using TreeView 1.6 software (Page, 1996).

Results The number of progeny of mares and sires of particular breeds, as well as the number of determined mare families and male lines in Maopolski studs, are presented in Tables 1, 2 and 3, respectively. The majority of the investigated Maopolski horses are the progeny of AA dams (390 horses). From the paternal side of pedigrees, less than half (170 horses) of the studied Maopolski population is the progeny of sires of other breeds such as TH, *AA*, AR and SP. The greatest breed variability is present in the parental

16 tab. 1

T. Zabek et al.

Analysis of genetic variation in Maopolski horses

17

tab. 2

18

T. Zabek et al.

generation of M horses from the Walewice stud. The smallest number of breeds among parents was observed in Prudnik, with dominance of AA parents. Considering the proportion of pure breeds in the parental generation of M horses, a large number of the studied individuals are the progeny of TH sires (95 individuals), especially at the Ochaby (29), Udorz (25) and Walewice studs (22) (Table 1). Sixty-six mare families were determined in the studied population of Maopolski horses. Each stud is characterized by a variety of mare families with purebred Anglo-Arabian (*AA*), part-bred Anglo-Arabian (AA), Arabian (AR), Thoroughbred (TH), English part-bred, Austro-Hungarian, and Lipizzan (L) ancestors. Twenty families are present in Walewice, 16 in Ochaby, 13 in Prudnik, 9 in Udorz and 8 in the Janow Podlaski stud. The determined mare families are characterized by unrelated pedigrees until at least the 5th generation. Only two of all families are present in different studs (Table 2).

Table 3. Male lines present in the studied Maopolski population Stud Male line* Breed Walewice 10** 5 3 5 3 3 9 12 6 4 4 9 8 4 10 22 1 3 3 2 6 5 1 19 8 1 13 1 6 8 1 10 6 7 1 2 4 5 4 3 12 6 4 1 1 Prudnik Udorz 1 Janow Podlaski 9 Ochaby 8

Campetot Lirnik Kwartet Pick Wick Rahman Hippies Hetman First Des Termes Vice Versa Veritas Jalienny Decoration Elsing Lais Parysow Dakota Chef Supreme Mehari Dzielzan Arcus Cynik Saroyan Szafir Fordon

*AA* *AA* AA AA AA AA AA AA (France) AA (France) AA (France) AA (France) AA (France) AR SP TH TH TH TH TH TH/AA TH/AA TH/AA TH/AA TH/AA

1 1

7 5

4 7

* The furthest common male ancestor. ** Number of genotyped horses belonging to a given male line.

Analysis of genetic variation in Maopolski horses

19

Fifty-seven stallions that are sires of horses from 5 Maopolski stud belong to 23 male lineages originated from Arabian (1 lineage), purebred (2 lineages) and halfbred (10 lineages) Anglo-Arabian, as well as Thoroughbred (10 lineages) ancestors (Table 3). Sires belonging to 6 TH lines are Thoroughbred horses. The other 4 lines are formed by Anglo-Arabian sires derived from TH ancestors, designated as TH/AA in this study. A high number of identified male lines are present in different studs. For example, most of the TH lines are present in the Ochaby, Walewice and Udorz studs. In Walewice and Prudnik, one line of the AR ancestor is present. Some lines are found in one stud only: 2 lines in Prudnik (Lirnik *AA* and Hetman AA), 3 in Janow (Vice Versa AA, Veritas AA, Decoration AA) and 3 lines in Ochaby (Dzielzan TH, Chef Supreme TH, Szafir TH/AA). Electrophoretic separation of PCR products exhibited 116, 97 and 166 microsatellite variants in the Arabian, Thoroughbred and whole Maopolski population, respectively (Table. 4). Six allelic variants (HMS3-S, HMS7-P, HTG6-F, ASB17-Q, ASB23-H and -V) were found only in AR horses, two (ASB2-W and HTG6-R) in TH horses and fifty (AHT4-L and -N; AHT5-I and -S; ASB2-D, -J, -S, -T and -U; HMS2-O, -T and -U; HMS3-H; HMS6-J and -N; HMS7-H, -I and -S; HTG10-H, -N and -P; HTG4-P, HTG6-E, -L and -N; HTG7-P; VHL20-H, -J, -K and -R; ASB17-F, -H, -J, -K, -L and -S; ASB23-R, -T and -W; HMS1-H, -K and -O; LEX3-M; LEX33-F, -R and -S; UCDEQ425-G, -H and -P) were found only in the Maopolski population. Despite there being two allelic variants (ASB2-J and HTG4-P) in the M and one (HTG6-R) in the TH population these occur with very low frequency (<0.05). In the Arabian population in particular, a number of variants with higher frequency can be distinguished (AHT4-I; ASB2-A; HMS3-K; HMS6-N; HTG10-Q; HTG4-L; VHL20P; HMS1-N; LEX3-H and -K), which occur with extremely low frequency (<0.05) or were not detected in Maopolski or Thoroughbred horses. Additionally, a group of characteristic alleles can be found in both M and TH horses (HMS6-M; HMS7-N and -O; HTG10-I and -M; VHL20-M; ASB17-G; ASB23-U; LEX3-J and -R; LEX33-L; UCDEQ425-J), with no occurrence or very low frequency in the Arabian breed. The exact test for the presence of the Hardy-Weinberg equilibrium showed deviation at locus AHT4 in Arabian horses (P < 0.05), ASB23 in TH horses (P < 0.01) and ASB2, ASB23, HTG10 and LEX3 in M horses (P < 0.01). The number of observed homozygous genotypes exceeded the expected number calculated from the Hardy-Weinberg proportions. The mean estimates of Fis did not deviate from 0 in any of the investigated horse groups (Table 5). Fis values were highly significant only when calculated for the whole M population (Fis = 0.036, P < 0.01). The Fis obtained indicated a 3.6% loss of heterozygotes in relation to the expected number of heterozygous genotypes in the whole M population (Table. 5). With the exclusion of the Arabian and Thoroughbred populations, the observed heterozygosity (Ho) was highest for the M subpopulation at the Walewice stud (Ho = 0.723) and lowest in the subpopulation from Prudnik (Ho = 0.683). In Prudnik, the observed heterozygosity, Ho, was much lower than the expected heterozygosity, He (Table 5).

20 tab. 4

T. Zabek et al.

Analysis of genetic variation in Maopolski horses

21

cd. tab. 4

22

T. Zabek et al. Table 5. Genetic variation of the studied populations at 18 marker loci

Group AR TH M WM PM UM JM OM

33 26 279 90 26 61 55 47

17 14 129 23 20 34 27 25

Total individuals 50 40 408 113 46 95 82 72

Total allele no. 116 97 166 125 96 131 127 105

Mean Ho 0.677 0.671 0.709 0.723 0.683 0.716 0.689 0.719

Mean He 0.69 0.687 0.736 0.732 0.719 0.74 0.71 0.698

Mean Fis 0.018 0.024 0.036 xx 0.012 0.04 0.033 0.031 0.030

xx P < 0.01.

The global Fst value (overall Fst = 0.048, P < 0.05) describing the differentiation within the population indicated that about 5% of the total genetic variation is explained by breed differences, with the remaining 95% corresponding to differences between individuals. Considering the variation of the M population, 2.6% of the total variation (overall Fst = 0.026, P < 0.05) can be accounted for by differences between the 5 M subpopulations. The pairwise Fst coefficient used as a distance measure was lowest between the M subpopulation from Ochaby and Thoroughbred horses (Fst = 0.014) (Table 6). The Nm value was the greatest between both horse groups (Nm = 17.063). Excluding Fst and Nm between TH and AR horses, the highest Fst (0.117) and lowest Nm values (1.882) were obtained between the M population in Ochaby and the group of Arabian horses. At subpopulation level, the lowest Fst value (0.02) was between Walewice and Udorz group, which is correlated with the highest Nm value (12.389) between both Maopolski studs. The highest Fst and lowest Nm values were reported between the Prudnik and Ochaby (Fst = 0.038 and Nm = 6.252) and Prudnik and Janow Podlaski studs (Fst = 0.037 and Nm = 6.436) (Table 6). Relationships between the investigated horse groups revealed by pairwise Fst estimator were confirmed graphically by a dendrogram based on the distance calculated from the proportion of shared alleles (Dps) (Figure 1).

Figure 1. Dendrogram based on Dps distance

Analysis of genetic variation in Maopolski horses Table 6. Genetic relationships between TH and AR horses, and each of the M subpopulations AR AR TH WM PM UM JM OM 0.141 (1.528)1 0.096 (2.36) 0.104 (2.143) 0.105 (2.141) 0.096 (2.349) 0.117 (1.882) 0.026 (9.369) 0.043 (5.546) 0.03 (8.136) 0.044 (5.396) 0.014 (17.063) 0.03 (8.108) 0.02 (12.389) 0.024 (9.962) 0.021 (11.868) 0.025 (9.814) 0.037 (6.436) 0.038 (6.252) 0.03 (8.103) 0.029 (8.38) 0.035 (6.862) TH 0.476 WM 0.4 0.221 PM 0.418 0.274 0.241 UM 0.42 0.246 0.204 0.238 JM 0.398 0.271 0.215 0.254 0.236 OM 0.417 0.179 0.193 0.254 0.226 0.224

23

Above diagonal Dps. Below diagonal pairwise Fst. Nm in brackets.

Discussion Population data based on 18 microsatellite markers describe the genetic state of the current Maopolski population in the largest 5 studs in different parts of Poland. Analysis of the genetic structure of the investigated populations revealed the presence of numerous rare alleles characteristic for the Maopolski population. These alleles may have occurred more frequently in the original population of Maopolski horses, and most of them have been lost from the current gene pool of this breed. A group of characteristic alleles found for both M and TH horses shows that the gene pool of the current Maopolski population is strongly influenced by Thoroughbred horses. In relation to TH horses, the microsatellite pool of Arabian horses is more different from the pool of alleles detected in the M population. Great similarities between the gene pool of M and TH horses were also revealed in the bek et al. (2005) with the use of 12 microsatellites. study by Za The exact test for Hardy-Weinberg proportions revealed a significant deviation from genetic equilibrium at four marker loci in the M population, where an increase in homozygous genotypes was observed. Also, the significant mean value of Fis (0.036, P < 0.01) indicated an inbreeding-like effect for the whole Maopolski population. However, the mean values of Fis calculated for subpopulations from 5 Maopolski studs were not significant and were close to 0. Therefore, the increase in homozygosity in the whole M population results rather from population subdivision (Wahlund, 1928), where Arabian and Thoroughbred horses are genetically distinct groups contributing to the gene pool of AA horses from the investigated studs.

24

T. Zabek et al.

The study of genetic variation revealed high mean estimates of expected heterozygosity for the overall Maopolski population, typical of horse breeds improved with TH horses such as American Quarter horses (Bowling et al., 1997), Czech warmblood horses (Hamanova et al., 2001) and Oldenburg and Polish bek et al., 2003). The levels of variation estimators differ to Silesian horses (Za some extent between the subpopulations from particular Maopolski studs and depend on the proportion of particular breeds in the parental generation of the studied horses. Higher variation levels expressed by the observed heterozygosity are present at the Walewice, Ochaby and Udorz studs, probably because of the greater number of progeny of TH sires and sires of other breeds at these studs (Table 1). In contrast, horses from Prudnik are characterized by lower variability of breeds in the parental generation with most parents being AA (Table 1). Meanwhile, the subpopulation from Janow Podlaski includes the smallest number of mare families, which could reduce the variation level there in comparison with other Maopolski studs (Table 2). The differentiation described using the global Fst values calculated at inter- and intrapopulation level in this study was substantially lower than the differentiation between geographically isolated horse populations (Canon et al., 2000; Achmann et al., 2004). The levels of gene exchange expressed as migration rate between some M subpopulations were higher than the gene exchange between geographically isolated subpopulations of Lipizzan horses (Achmann et al., 2004). Despite a small number of individuals derived from two families being present in 3 Maopolski studs, pedigree records did not show closer relationships between studs of known mare families. Therefore the presence of common male lines for a number of M subpopulations and the use of particular stallions for breeding purposes in different studs may be more important for the degree of relationship between the investigated Maopolski subpopulations. It seems that the large contribution of Thoroughbreds to the pedigree of Maopolski horses determines the genetic differences between the investigated M subpopulations. The fact that the smallest pairwise Fst and Dps distance was found between the Walewice and Udorz studs may result from the presence of a high number of progeny of TH and SP sires at both studs (Table 2). The cluster of the TH population with the horse group from Ochaby on the phylogenetic tree expresses the strongest influence of TH horses on this M subpopulation. Distance data show greater genetic divergence of the Prudnik and Janow group from the cluster of other M subpopulations because of the presence of specific male lines at these studs (Table 3) and a smaller number of progeny of TH sires, especially at the Prudnik stud (Table 1). The greatest phylogenetic divergence of AR horses expressed as Dps distance and pairwise Fst values shows that the direct contribution of the AR breed to the present Maopolski population is much smaller in relation to TH horses. The genetic similarities described between Maopolski and Thoroughbred horses are similar to those found in studies of these relations between TH and Czech warmblood horses (Hamanova et al., 2001) and between TH and German

Analysis of genetic variation in Maopolski horses

25

bek et al., 2003). These result from Oldenburg horses (Mller-Eckert et al., 1999; Za a strong tendency towards using TH horses for improvement of a number of warm blood horse breeds (Mller-Eckert et al., 1999). Analysis of the genetic structure of the investigated Maopolski population revealed that its primary gene pool could have been changed by a strong influence from other horse breeds used for breeding purposes in the Maopolski breed. The present molecular and pedigree data show that the described M population is not in danger of inbreeding, and breed variability in pedigrees of Maopolski horses is the main factor behind the maintenance of genetic variation in this breed. A strong influence of Thoroughbred horses on the current Maopolski gene pool was documented.

References A c h m a n n R., C u r i k I., D o v c P., K a v a r T., B o d o I., H a b e F., M a r t i E., S l k n e r J., B r e m G. (2004). Microsatellite diversity, population subdivision and gene flow in the Lipizzan horse. Anim. Genet., 35: 285 292. B i n n s M.M., H o l m e s N.G., H o l l i m a n A., S c o t t A.M. (1995). The identification of polymorphic microsatellite loci in the horse and their use in Thoroughbred parentage testing. Brit. Vet. J., 151: 9 15. B o w c o c k A.M., R u z - L i n a r e s A., T o m f o h r d e J., M i n c h E., K i d d J.R., C a v a l l i - S f o r z a L.L. (1994). High resolution human evolutionary trees with polymorphic microsatellites. Nature, 368: 455 457. B o w l i n g A.T., E g g l e s t o n - S t o t t M.L., B y r n s G., C l a r k R.S., D i l e a n i s S., W i c t u m E., (1997). Validation of microsatellite markers for routine horse parentage testing. Anim. Genet., 28: 247 252. B r e e n M., L i n d g r e n G., B i n n s M.M., N o r m a n J., I r v i n Z., B e l l K., S a n d b e r g K., E l l e g r e n H. (1997). Genetical and physical assignments of equine microsatellites First integration of anchored markers in horse genome mapping. Mamm. Gen., 8 (4): 267 273. C a n o n J., C h e c a M.L., C a r l o s C., V e g a - P l a J.L., V a l l e j o M., D u n n e r S. (2000). The genetic structure of Spanish Celtic horse breeds inferred from microsatellite data. Anim. Genet., 31: 39 48. C o o g l e L. (1996 a). Equine dinucleotide repeat loci from LEX025 to LEX033. Anim. Genet., 27: 289 290. C o o g l e L., B a i l e y E., R e i d R., R u s s M. (1996). Equine dinucleotide repeat polymorphisms at loci LEX002, -003, -004, -005, -007, -008, -009, -010, -011, -013 and -014. Anim. Genet., 27: 126 127. D i e r i n g e r D., S c h l t t e r e r C. (2002). Microsatellite analyser (MSA): a platform independent analysis tool for large microsatellite data sets. Mol. Ecol. Notes, 3 (1): 167 169. D o b r o w o l s k i M., G e r i n g e r H. (2003). Porownanie ogierow szlachetnych pokrwi, maopolskich cych proby dzielnosci w Zakadach Treningowych w latach 1977 2000 na i wielkopolskich zdaja podstawie wartosci hodowlanej okreslonej metoda BLUP Animal Model. Mat. 68 Zjazdu Nauk. t PTZ: Zasoby genetyczne zwierza w Polsce, Krakow, 9 12.09.2003, p. 192. E g g l e s t o n - S t o t t M.L., D e l V a l l e A., B a u t i s t a M., D i l e a n i s S., W i c t u m E., B o w l i n g A.T. (1997). Nine equine dinucleotide repeats at microsatellite loci UCDEQ136, UCDEQ405, UCDEQ412, UCDEQ425, UCDEQ437, UCDEQ467, UCDEQ487, UCDEQ502 and UCDEQ505. Anim. Genet., 28 (5): 370 371. E l l e g r e n H., J o h a n s s o n M., S a n d b e r g K., A n d e r s s o n L. (1992). Cloning of highly polymorphic microsatellites in the horse. Anim. Genet., 23: 132 133. G r a l a k B., K u r y J., u k a s z e w i c z M., Z u r k o w s k i M. (1998). Applicability of nine microsatellite DNA sequences vs eleven polymorphic blood protein and enzyme systems for the parentage control in Polish Arabian and Thoroughbred horse. Anim. Sci. Pap. Rep., 16 (4): 209 218.

26

T. Zabek et al.

G r a l a k B., N i e m c z e w s k i C., J a w o r s k i Z. (2001). Genetic polymorphism of 12 microsatellite markers in Polish Primitive Horse. Anim. Sci. Pap. Rep., 19 (4): 277 283. G u r i n G., B e r t a u d M., A m i g u e s Y. (1994). Characterization of seven new horse microsatellites: HMS1, HMS2, HMS3, HMS5, HMS6, HMS7 and HMS8. Anim. Genet., 25, p. 62. G u o S.W., T h o m p s o n E.A. (1992). Performing the exact test of Hardy-Weinberg proportion for multiple alleles. Biometrics, 48: 361 372. H a e r i n g e n H. van, B o w l i n g A.T., L e n s t r a J.A., Z w a a g s t r a K.A., S t o t t M.L. (1994). A highly polymorphic horse microsatellite locus VHL20. Anim. Genet., 25: p. 207. H a m a n o v a K., M a j z l i k I., G l a s n a k V., S c h r f f e l o w a D., (2001). Characterization and comparison of some horse breeds in Czech Republic as based on microsatellite markers polymorphism. Anim. Sci. Pap. Rep., 19, 3: 219 230. H o l m S. (1979). A simple sequentially rejective multiple test procedure. Scand. J. Statist., 6: 56 70. I r v i n Z., G i f f a r d J., B r a n d o n R., B r e e n M., B e l l K. (1998). Equine dinucleotide repeat polymorphisms at loci ASB21, 23, 25 and 37 43. Anim. Genet., 29: p. 67. K a w a s a k i E.S. (1990). Sample preparation from blood, cells and other fluids. In: Innis M.A., Gelfand D.H., Sninsky J.J., White T.J. (eds), PCR Protocols: a Guide to Methods and Applications, Acad. Press. New York, pp. 146 152. M a r k l u n d S., E l l e g r e n H., E r i k s s o n S., S a n d b e r g K., A n d e r s s o n L. (1994). Parentage testing and linkage analysis in the horse using a set of highly polymorphic microsatellites. Anim. Genet., 25: 19 23. M l l e r - E c k e r t A., C h o l e w i n s k i G., B e u i n g R., E r h a r d t G. (1999). Charakterisierung der verwandschaftlichen Beziehungen von Schweren Warmblutpopulationen auf oldenburgischostfriesischer Grundlage und Deutschen Reitpferdepopulationen anhand von polymorphen Genorten. Zchtungskunde, 71: 359 370. N e i M. (1978). Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics, 89: 583 590. N i e m c z e w s k i C., Z u r k o w s k i M. (2000). The genetic structure of four families of Thoroughbred Horse as determined on the basis of the polymorphism of chosen class I and II genetic markers. Anim. Sci. Pap. Rep., 1: p. 5. P a g e R.D.M. (1996). TREEVIEW: An application to display phylogenetic trees on personal computers. Computer Appl. Biosci., 12: 357 358. W a h l u n d S. (1928). Zusammensetzung von Populationen und Korrelationserscheinungen von Standpunkt der Verebungslehre aus betrachtet. Hereditas, 11: 65 106. W e i r B.S., C o c k e r h a m C.C. (1984). Estimating F-statistics for the analysis of population structure. Evolution, 38: 1358 1370. W r i g h t S. (1969). The theory of gene frequencies: evolution and the genetics of populations. Vol. 2. Chicago University Press, Chicago, USA. b Z a e k T., D u n i e c M., B u g n o M. (2003). Genetic relationships between Silesian, Thoroughbred and Oldenburg horses based on DNA microsatellite polymorphism. Ann. Anim. Sci., 3, 2: 213 224. b Z a e k T., N o g a j A., R a d k o A., N o g a j J., S o t a E. (2005). Genetic variation of endangered Polish Bigoraj horses and two common horse breeds at the microsatellite loci. J. Appl. Genet., 46 (3): 299 305.

Accepted for printing 21 II 2006

Analysis of genetic variation in Maopolski horses

27

BEK, AGATA ZYGA, ANNA RADKO, EWA SOTA TOMASZ ZA


Analiza zmiennosci genetycznej koni maopolskich, na podstawie badan molekularnych i danych rodowodowych STRESZCZENIE Konie maopolskie posiadaja w rodowodach rozny udzia krwi anglo-arabskiej i koni w typie orientalnym. Od 1999 roku obserwuje sie systematyczny spadek wielkosci populacji tych koni. W prezentowanej pracy okreslono zmiennosc genetyczna 5 subpopulacji koni maopolskich, koni penej krwi angielskiej oraz koni czystej krwi arabskiej, z wykorzystaniem 18 markerow mikrosatelitarnych. Analiza struktury genetycznej wykazaa, ze pula genow typowych dla wyjsciowej populacji koni maopolskich moga ulec ograniczeniu w wyniku stosowania duzego dolewu krwi koni innych ras, a szczegolnie penej krwi angielskiej. Poziom zroznicowania genetycznego koni maopolskich, wyrazo , ny heterozygotycznoscia oczekiwana jest zblizony do zmiennosci innych ras powstaych w wyniku miedzyrasowych krzyzowek. Badana populacja koni maopolskich nie jest zagrozona wzrostem inbredu, a gownym zrodem zmiennosci genetycznej populacji tych koni jest obecnosc innych ras w rodowodach koni maopolskich, uzywanych do ich uszlachetniania. Analiza dystansu genetycznego wykazaa najwiekszy wpyw koni penej krwi angielskiej na pule genow obecnej populacji koni maopolskich.

Ann. Anim. Sci., Vol. 6, No. 1 (2006) 29 36

EVALUATION OF PUTATIVE RELATIONSHIP BETWEEN PRNP OCTAPEPTIDE REPEAT POLYMORPHISM AND VARIABILITY OF MILK PRODUCTION TRAITS IN CATTLE

U r s z u l a C z a r n i k 1, T a d e u s z Z a b o l e w i c z 1, C h a n d r a S . P a r e e k 1, R y s z a r d Z i e m i n s k i 2, K r z y s z t o f W a l a w s k i 1 Department of Animal Genetics, University of Warmia and Mazury, Oczapowskiego 5, 10-718 Olsztyn, Poland 2 Department of Cattle Breeding and Milk Production, Agricultural University, Chemonskiego 38C, 51-631 Wrocaw, Poland Abstract Previous investigations have focused on the association between prion protein (PRNP) and BSE susceptibility. The usefulness of PRNP polymorphism as a possible quantitative trait locus (QTL)-linked marker has generally been overlooked. The aim of this study was to evaluate PRNP octapeptide repeat polymorphism as a putative factor of milk production trait variability. This experiment was designed to separately investigate the segregation effects of PRNP 6 and PRNP 5 alleles caused by the sire. The study covered 495 cows from large herds of Black-andWhite cattle, made up of 222 randomly tested cows representing an outbreeding population and two half-sibling families of 106 cows related to the PRNP 6/5 sire and 167 cows related to the PRNP 6/6 sire. The milk production trait database was comprised of milk, fat and protein yield and content, evaluated over a 305-day lactation I period. Statistically significant differences were found in fat yield and protein content (P 0.05) between animal groups representing PRNP 6/6 and PRNP 6/5 genotypes. However, the results within animal groups revealed highly significant (P 0.01) and significant (P 0.05) differences only in the case of animal groups representing PRNP 6/6, where significant differences (P 0.05) were found for fat yield and protein yield and highly significant differences (P 0.01) for fat content and protein content, in the case of progenies originating from the PRNP 6/6 sire and randomly tested cows. Finally, significant differences (P 0.05) in protein content were also obtained in the progenies originating from the PRNP 6/6 and PRNP 6/5 sires. Key words: Black-and-White cattle, PRNP polymorphism, milk production traits, QTL marker
1

Conformational destabilization of the prion protein (PRNP) molecule has been recognized as a causal factor in neurodegenerative disorders. PRNP is a glycoprotein with four -helixes, while its pathogenic variant, after refolding of the two

30

U. Czarnik et al.

-helixes, is transformed into a -helix structure. The physiological role of normal PRNP has not been fully explained. However, a relationship with synaptic function (Collinge et al., 1994) and neuronal survival (Chen et al., 2003) has been postulated. The genetic background of transmissible encephalopathies has been well researched (Weissmann, 1996; Agrini et al., 2002; Mead et al., 2003; Goldfarb et al., 2004). In cattle, a PRNP gene was initially located within the U 11 syntenic group (Ryan and Womack, 1993) and physically mapped on BTA-13q17 (Schlpfer et al., 1998). Three exons comprising a total of 795 bp (Yoshimoto et al., 1992), a partial genomic nucleotide sequence of 4244 bp (Horiushi et al., 1998) and a complete 78056 bp of genomic DNA sequences (Hills et al., 2001) were identified in the bovine PRNP gene. It was found that in cattle, mainly only exon 3 is translated. Initially, two mutations were detected, i.e. deletion of 23 nucleotides within the ORF region of exon 3 as well as CT transition within the 3 flanking fragment (Goldmann et al., 1991). Further studies (Hills et al., 2001) found many other point mutations and the total number of mutations is currently considered to be about 60 (Sander et al., 2004). Polymorphism of the octarepeat fragment of Pro-His/Gln-Gly(Gly)-Gly-TryGly-Gln amino acids is expressed by the occurrence of three allelic variants. In all the examined cattle breeds, the six-repeat allele (PRNP 6) is the most common. The five-repeat allele (PRNP 5) is less common (McKenzie et al., 1992; Brown et al., 1993; Hunter et al., 1997; Premzl et al., 2000; Walawski and Czarnik, 2003), and the seven-repeat allele (PRNP 7) has been identified exclusively in one breed of Brown Alpine cattle (Schlpfer et al., 1999; Leone et al., 2002). Cattle population studies to date have been dominated by the search for a relationship between PRNP polymorphism and susceptibility to BSE (McKenzie et al., 1992; Neibergs et al., 1994; Hunter et al., 1997; Sander et al., 2004). Occurrence of the PRNP 5/5 homozygous genotype in the infected animal group has not yet been found. However, the very low frequency of the PRNP 5/5 genotype has caused real difficulties in the statistical verification of this regularity. Recently, in studies involving BSE-infected and healthy animals with PRNP 6/6 and PRNP 6/5 genotypes (Sander et al., 2004), statistically significant differences in PRNP allele frequency were found. The PRNP 5 allele was more frequent in infected than in healthy animals. On the other hand, genome-wide analysis (Hernandez-Sanchez et al., 2002) indicates putative markers associated with BSE in chromosome 5, but not in chromosome 13. In the studies completed to date, the possible use of PRNP polymorphism as a QTL marker has not been mentioned. The aim of the current study was to revise commonly observed abnormalities in the segregation of PRNP 6 and PRNP 5 alleles as well as to make a preliminary assessment of the putative relationship between PRNP octapeptide repeat polymorphism and variability of milk production traits.

Relationship between PRNP polymorphism and milk traits in cattle

31

Material and methods This study examined a total of 495 contemporary cows at lactation I, originating from large herds of Black-and-White cattle. The experiment was designed to enable verification of the co-segregation effect caused by PRNP 6 and PRNP 5 alleles transmitted by sires and cows and expressed by variability of milk production traits. Therefore, three groups of cows, comprised of 222 randomly tested animals from two herds and related to 28 AI sires as well as a half-sib group of 106 cows related to a PRNP 6/5 sire and a half-sib group of 167 cows related to a PRNP 6/6 sire originating from five herds, were qualified for experimental analysis. The sources of the genomic DNA were the spermatozoa of the sire semen and cows peripheral blood leukocytes. Polymorphism caused by deletion/insertion of 23 nucleotides in the ORF region of PRNP gene exon 3 was determined using the PCR method according to previously described procedures (Walawski and Czarnik, 2003). The PCR products were subjected to electrophoresis in 1.5% Amplisize Agarose (Bio-Rad) gel. Polymorphism was recorded using a Fluor STM Multimager (Bio-Rad). The milk trait database was comprised of milk yield and fat and protein yield, as well as the fat and protein content of milk from the 305 days of lactation I. Particular PRNP genotype groups, represented by an outbreeding herd of randomly examined cows as well as half-sib cow groups originating from PRNP 6/5 and PRNP 6/6 sires, were characterized on the basis of arithmetical mean values and standard deviation. The relationship between prion protein gene polymorphism (PRNP) and milk production traits was verified independently in subsequent sire families using the statistical program STATISTICA 6. For this, the ANOVA analysis was performed in the non-orthogonal form with interactions. The effect of milk production traits on animal groups as well as genotype groups was also analysed as the dependent factor, using the following model: yijk = + aj + bj + (ab)ij + eijk

where: yijk milk production trait values, population mean, aj influence of genotypes, bj influence of animal groups, (ab)ij interaction, eijk random error. The test of significant differences between average arithmetical means in animal groups was verified using Scheffes test.

32

U. Czarnik et al.

Results Table 1 shows the distribution of analysed animals (n = 495) with respect to PRNP genotype originating from outbreeding herd and half-sib sire families. In the analysed group of 495 animals, 368 cows were identified as PRNP 6/6 genotypes and 124 cows as 6/5 genotypes. This result indicated that the specific genetic structure of the cow group originating from the PRNP 6/6 sire, which is manifested in progeny by a very low percentage of PRNP 6/5 heterozygous animals, indicates the possible effect of restricted transmission of the PRNP 5 allele by dams.

Table 1. Numbers of animals (n) investigated for the PRNP octapeptide repeat polymorphism and variability of milk production traits in Polish Black-and-White cattle Genotype groups PRNP 6/6 PRNP 6/5 PRNP 5/5 Total Animal groups progeny of sire genotype PRNP 6/5 PRNP 6/6 50 53 3 106 157 10 0 167 randomly tested cows 161 61 0 222 Total

368 124 3 495

However, very few animals were genotyped as PRNP 5/5. This genotype was registered in 3 cows for progenies originating from the sire genotyped as PRNP 6/5. The differences between PRNP genotypes and milk production traits, analysed between the animal groups representing PRNP 6/6 and PRNP 6/5 genotypes and within the animal groups representing half-sib cows originating from PRNP 6/5 and PRNP 6/6 sires and in the randomly tested cows, are presented in Table 2. Comparison of the results obtained for the animal groups representing PRNP 6/6 and PRNP 6/5 genotypes revealed that the mean values of milk fat yield and protein content differ significantly (P 0.05) in the analysed animal groups for milk production traits. The mean values recorded were higher for milk fat yield and lower for protein content in the PRNP 6/5 genotypes. However, based on the results within animal groups, highly significant (P 0.01) and significant effects (P 0.05) were observed only in the case of animal groups representing PRNP 6/6. Significant differences (P 0.05) were observed between progenies originating from the PRNP 6/6 sire and randomly tested cows in the case of fat yield and protein yield. Likewise, highly significant differences (P 0.01) were observed between progenies originating from the PRNP 6/6 sire and randomly tested cows for fat content and protein content. Additionally, significant differences in protein content (P 0.05) were found between progenies originating from PRNP 6/6 and PRNP 6/5 sires.

Relationship between PRNP polymorphism and milk traits in cattle

33

Table 2. Differences between PRNP genotypes and milk production traits in half-sib cows originating from PRNP 6/5 and PRNP 6/6 sires and in randomly tested cows Genotype groups Animal groups n Statistical Milk measures yield (kg) x SD x SD x SD x SD x SD x SD x SD x SD Fat yield (kg) content (%) 4.47 0.45 4.56 A 0.49 4.32 B 0.60 4.44 0.55 4.62 0.61 4.52 0.56 4.42 0.55 4.52 0.58 Protein yield (kg) 207.08 44.63 220.58 a 36.52 209.34 b 43.59 213.81 41.19 225.02 48.06 212.00 31.14 215.38 45.83 219.28 45.78 content (%) 3.32 a 0.19 3.41 Ab 0.21 3.29 B 0.19 3.35 x 0.21 3.27 0.22 3.35 0.14 3.29 0.18 3.29 x 0.20

PRNP 6/6 progeny originating from sire genotype PRNP 6/5 progeny originating from sire genotype PRNP 6/6

50

6252 278.65 1410 63.72 6469 294.07 a 1122 54.17 6431 275.86 b 1228 61.74 6424 283.94 x 1209 59.40 6810 317.44 1329 70.64 6323 287.10 917 61.83 6569 288.22 1457 65.72 6653 300.79 x 1364 68.63

157

randomly tested cows 161 Total PRNP 6/5 progeny originating from sire genotype PRNP 6/5 progeny originating from sire genotype PRNP 6/6 randomly tested cows Total 368 53

10

61 124

x Differences between the PRNP genotypes were significant (P 0.05). A, B Within the genotypic group the differences between animal groups were highly significant (P 0.01), a, b within the genotypic group the differences between animal groups were significant (P 0.05).

Discussion The results of this and previous studies (Walawski et al., 2003) suggest that the statistically significant effect of natural or breeding selection in discriminating animals with PRNP 6/5 genotype may also concern PRNP 6/6 homozygous animals. The distribution of PRNP 6 and PRNP 5 generally exhibits an aberration from independent allele segregation. The PRNP 5/5 genotype occurs very rarely in some populations and exclusively in female animals. In studies of Black-and-White cattle (Walawski et al., 2003), irregular segregation of PRNP alleles was found in the offspring of heterozygous PRNP 6/5 parents. The genotype distribution (PRNP 6/6 44.8%, PRNP 6/5 32.8%, PRNP 5/5 22.4%) found in progeny groups indicates a drastic deformation of the expected genotype frequency rate (25%: 50%: 25%). A considerable number of PRNP 6/5 heterozygous individuals

34

U. Czarnik et al.

are supposed to be subject to natural elimination in the prenatal period or in the first weeks after birth. This indicates possible PRNP linkage with an as yet unidentified lethal gene locus which occurs alternatively in the cis and trans phase. Based on the results of this and previous studies, it is supposed that the statistically significant effect of natural selection discriminating animals with PRNP 6/5 may also concern, in some cases, the PRNP 6/6 homozygous genotype. The speculative character of the alleged positive and negative effects of alternative linkage phases of cis and trans between the PRNP locus and other genes of the BTA 13 chromosome requires further study to verify possible detection of diversified expression of milk production traits in cows with PRNP 6/6 and PRNP 6/5 genotypes. Hitherto, in a limited number of experimental results, in only a few cases has the possible occurrence of QTL microsatellite markers for milk production traits in the BTA 13 chromosome been indicated. However, statistically significant relationships have been observed between BMS1742, BMC1222, HUJ616 (Mosig et al., 2001) and BMS1352 (Olsen et al., 2002) markers and for differentiation of protein yield and content. Another interesting element of the studies completed to date has been the highly significant association between the occurrence in BTA13 of QTL markers for milk production traits, as well as for udder conformation traits (Schrooten et al., 2004). Based on the results of the previous studies, the BTA13 chromosome could be an interesting object of studies to identify the QTL for milk production traits. However, the suggested relationships between PRNP polymorphism and fat yield (our own studies) and protein yield/content and differentiation in milk somatic cell count (other authors studies) require further confirmation. Additionally, the hypothesis of cis and trans alternative variants of the conjugation of the PRNP locus and some anonymous loci expressed by lethal and subvital effects needs to be verified in further research.

References A g r i n i U., C o n t e M., M o r e l l i L., D i B a r i M.A., D i G u a r d o G., L i g i o s C., A n t o n u c c i G., A u f i e r o G.M., P o z z a t o N., M u t i n e l l i F., N o n n o R., V a c c a r i G. (2002). Animal transmissible spongiform encephalopathies and genetics. Vet. Res. Commun., 27: 31 38. B r o w n R., Z h a n H.M., N i e s e S.K. de, A x R.J. (1993). Bovine prion gene allele frequencies determined by AMFLP and RFLP analysis. Anim. Biotech., 4: 47 51. C h e n S., M a n g e A., D o n g L., L e h m a n S., S c h a c h n e r M. (2003). Prion protein as trans-acting partner for neurons is involved in neurite outgrowth and neuronal survival. Mol. Cell Neurosci., 22: 227 233. C o l l i n g e J., W h i t t i n g t o n M.A., S i d l e K.C., S m i t h C.J., P a l m e r M.S., C l a r k e A.R., J e f f e r y s J.G. (1994). Prion protein is necessary for normal synaptic function. Nature, 370: 295 297. G o l d f a r b L.G., C e r v e n k o v a L., G a j d u s e k D.C. (2004). Genetic studies in relation to kuru: an overview. Curr. Ml. Med., 4: 375 384.

Relationship between PRNP polymorphism and milk traits in cattle

35

G o l d m a n n W., H u n t e r N., M a r t i n T., D a w s o n H., H o p e J. (1991). Different forms of the bovine PrP gene have five or six copies of a short G-C element within the protein-coding region. Gen. Virol., 72: 201 204. H e r n a n d e z - S a n c h e z J., W a d d i n g t o n D., W i e n e r P., H a l e y C.S., W i l l i a m s J.L. (2002). Genome-wide search for markers associated with bovine spongiform encephalopathy. Mamm. Genome, 13: 164 168. H i l l s D., C o m i n c i n i S., S c h l a e p f e r J., D o l f G., F e r r e t t i L., W i l l i a m s J.L. (2001). Complete genomic sequence of the bovine prion gene (PRNP) and polymorphism in its promoter region. Anim. Genet., 32: 231 232. H o r i u s h i M., I s h i g u r o N., N a g a s a w a H., T o y o d a Y., S h i n g a w a H. (1998). Genomic structure of the bovine PrP gene and complete nucleoside sequence of bovine PrP cDNA. Anim. Genet., 29: 37 40. H u n t e r N., G o l d m a n n W., S m i t h G., H o p e J. (1997). Frequencies of PrP gene variants in healthy cattle and cattle with BSE in Scotland. J. Vet. Record., 135: 400 405. L e o n e P., C a s t i g l i o n i B., S e h i T., C a s s a n i P., S t e l l a A. (2002). Prion gene octa-peptide variability in the Italian cattle breeds. Proc. 7th World Congress on Genetics Applied in Livestock Production, 13: p. 40. M c K e n z i e D.I., C o w a n C.M., M a r s h R.F., A i k e n J.M. (1992). PrP gene variability in the US cattle population. Anim. Biotech., 3: 309 315. M e a d S., S t u m p f M.P., W h i t f e l d J., B e c k J.A., P o u l t e r M., C a m p b e l l T., U p h i l l J.B., G o l d s t e i n D., A l p e r s M., F i s h e r E.M., C o l l i n g e J. (2003). Balancing selection at the prion gene consistent with prehistoric kuru-like epidemics. Sciece, 300: 640 643. M o s i g M.O., L i p k i n E., K h u t o r e s k a y a G., T c h o u r z i n a E., S o l l e r M., F r i e d m a n n A. (2001). A whole genome scan for quantitative trait loci affecting milk protein percentage in Israeli Holstein cattle, by means of selective DNA pooling in a daughter design, using an adjusted false discovery rate criterion. Genetics, 157: 1683 1698. N e i b e r g s H.L., R y a n A.M., W o m A c k J.E., S p o o n e r R.L., W i l l i a m s J.L. (1994). Polymerase analysis of the prion gene in BSE-affected and unaffected cattle. Anim. Genet., 25: 313 317. O l s e n H.G., G o m e z - R a y a L., V a g e D.I., O l s a k e r I., K l u n g l a n d H., S v e n d s e n M., S a b r y A., K l e m e t s d a G., S c h u l m a n N., K r a m e r W., T h a l l e r G., N i n g e n K.R., L i e n S. (2002). A genome scan for Quantitative Trait Loci affecting milk production in Norwegian Dairy Cattle. J. Dairy Sci., 85: 3124 3130. P r e m z l M., B o z i c P., G a m u l i n V. (2000). PRNP octapeptide repeat allele genotype frequencies among the modern and rare cattle breeds in Croatia. Anim. Genet., 31: 408 409. R y a n A.M., W o m a c k J.E. (1993). Somatic cell mapping of the bovine prion protein gene and restriction fragment length polymorphism studies in cattle and sheep. Anim. Genet., 24: 23 26. S a n d e r P., H a m a n n H., P f e i f e r I., W e m h e u e r W., B r e n g B., G r o s c h u p M.H., Z i e g l e r U., D i s t l O., L e e b T. (2004). Analysis of sequence variability of the bovine prion protein gene (PRNP) in German cattle breeds. Neurogenetics, 5: 19 25. S c h l p f e r J., G a l l a g e r D.S. Jr., B u r z l a f f J.D., W o m a c k J.E., S t e l l y D.M., T a y l o r J.F., D a v i s S.K. (1998). Comparative mapping of bovine chromosome 13 by fluorescence in situ hybridization. Anim. Genet., 29: 265 272. S c h l p f e r J., S a i t b e k o v a N., G a i l l a r d C., D o l f G. (1999). A new allelic variant in the bovine prion protein gene (PRNP) coding region. Anim. Genet., 30: 386 389. S c h r o o t e n M.C., B i n k A.M., B o v e n h u i s H. (2004). Whole genome scan to detect chromosomal regions affecting multiple traits in dairy cattle. J. Dairy Sci., 87: 3550 3560. W a l a w s k i K., C z a r n i k U. (2003). Prion protein octapeptide-repeat polymorphism in Polish Black-and-White cattle. J. Appl. Genet., 44: 191 195. W a l a w s k i K., C z a r n i k U., W o j c i e c h o w s k i R., P a r e e k C.S. (2003). Abnormal segregation of prion protein octa-peptide repeat alleles in cattle. J. Appl. Genet., 44: 375 378. W e i s s m a n n C. (1996). The Ninth Datta Lecture. Molecular biology of transmissible spongiform encephalopathies. FEBS Lett., 389: 3 11.

36

U. Czarnik et al.

Y o s h i m o t o J., J i n u m a T., I s h i g u r o N., H o r i u s h i M., S h i n a g a w a M. (1992). Comparative sequence analysis and expression of bovine PrP gene in mouse. Virus Genet., 6: 343 356.

Accepted for printing 11 XII 2005

URSZULA CZARNIK, TADEUSZ ZABOLEWICZ, CHANDRA S. PAREEK, RYSZARD ZIEMINSKI, KRZYSZTOF WALAWSKI Analiza zwia zku miedzy polimorfizmem powtorzen osmiopeptydowego fragmentu genu biaka prionowego PRNP i cechami uzytkowosci mlecznej byda STRESZCZENIE Dotychczasowe badania koncentroway sie na poszukiwaniu zaleznosci miedzy polimorfizmem genu biaka prionowego (PRNP) a podatnoscia byda na BSE. Przydatnosc polimorfizmu PRNP jako potencjalnego markera QTL bya dotychczas pomijana. Celem prezentowanej pracy bya ocena cego sie zroznicowaniem mozliwosci wykorzystania polimorfizmu PRNP jako czynnika przejawiaja cech uzytkowosci mlecznej. Materia obejmowa 495 krow rasy czarno-biaej utrzymywanych w duzych ce stadach, w tym 222 losowo testowane krowy reprezentuja populacje masowa i dwie grupy posiostr cych po buhaju PRNP 6/5 i 167 krow stanowia cych potomstwo buhaja PRNP 6/6. 106 krow pochodza Kontrolowane cechy uzytkowosci mlecznej obejmoway: wydajnosc mleka, wydajnosc tuszczu i biaka, zawartosc tuszczu i biaka w okresie 305-dniowej I laktacji. Stwierdzono statystycznie istotne roznice t miedzy wydajnoscia tuszczu a zawartoscia biaka (P 0,05) pomiedzy grupami zwierza o genotypach PRNP 6/6 i PRNP 6/5. Wyniki w obrebie grup ujawniy wysoko istotne (P 0,01) i istotne (P 0,05) t roznice tylko w przypadku zwierza o genotypie PRNP 6/6, dla ktorych stwierdzono istotne roznice (P 0,05) w wydajnosci tuszczu i wydajnosci biaka oraz wysoko istotne roznice (P 0,01) w zawarto cego od buhaja PRNP 6/6 i losowo sci tuszczu i zawartosci biaka w przypadku potomstwa pochodza testowanych krow. Istotne roznice (P 0,05) w zawartosci biaka uzyskano takze dla potomstwa cego od buhajow o genotypach PRNP 6/6 i PRNP 6/5. pochodza

Ann. Anim. Sci., Vol. 6, No. 1 (2006) 37 43

TECHNOLOGICAL TRAITS OF MILK OF SIMMENTAL COWS AS RELATED TO -CASEIN POLYMORPHISM

A n d r z e j F e l e n c z a k 1, A n n a F e r t i g 1, E w a G a r d z i n a 1, M a r i a n O r m i a n 1, J a n T r e l a 2
1

Department of Cattle Breeding, Agricultural University, al. Mickiewicza 24/28, 30-059 Krakow, Poland 2 Department of Farm Animal Genetic Resources Conservation, National Research Institute of Animal Production, 32-083 Balice n. Krakow, Poland

Abstract The composition and technological properties of milk and milk protein polymorphism were studied in Simmental cows. -casein polymorphism was shown to have a significant differentiating effect on milk composition and properties. The milk of cows with BB and AB CSN3 genotypes was characterized by a more favourable composition, i.e. a higher fat, total protein and casein content, shorter clotting time and higher curd cheese yield. The results obtained indicate that CSN3 genotypes can serve as an additional and valuable source of information in cattle selection. Key words: cow, milk, -casein polymorphism, technological properties

A review of studies on the genetic polymorphism of milk proteins has revealed that the genes of these proteins are the most studied genes in cattle. Their chromosomal localization and nucleotide sequence are known. The genes of casein proteins are localized on chromosome 6, and the main whey protein (-lactoglobulin) is determined by a gene locus on chromosome 11 (Mercier and Vilotte, 1993). In cattle, a species that is most utilized for milk, genetic polymorphism has been shown for the main six proteins of milk: S1-casein (CSN1S1), S2-casein (CSN1S2), -casein (CSN2) and -casein (CSN3) as well as -lactoglobulin (LGB) and -lactoalbumin (LALBA) (Eigel et al., 1984). The aim of studies on milk protein polymorphism is to explain the relationships between the genetic variants of some proteins and the productive traits and technological and nutritive properties of milk. The occurrence of such relationships may be conditioned by the fact that the locus of the analysed proteins is located on the same chromosome and in the neighbourhood of the loci of genes that determine desirable traits. Studies to find the markers of dairy production traits in cattle have been carried out by Czarnik and Walawski (2003), among others.

38

A. Felenczak et al.

The principal milk protein is casein, which occurs in native state in the form of large, colloidal molecules known as micelles. A significant role in proteins is played by one of its fractions, -casein, which is a major stabilizing factor of the protein structure as it forms an external layer of casein micelles. The processes undergone by -casein during milk processing are the basis for gel formation and milk clotting. The CSN3 gene polymorphism affects the production of a specific protein, which, in turn, influences the course of technological processes during cheese-making. Previous studies by many authors have shown that milk containing BB and AB CSN3 polymorphic fractions is characterized by a more favourable composition and is more suitable for processing than milk with the AA CSN3 fraction (Aaltonen and Antila, 1987; Litwinczuk et al., 1997; Ng-Kwai-Hang, 1994; Strzakowska et al., 2000; Zieminski et al., 2002). The aim of the study was to examine the composition and technological properties of cows milk and to determine the relationship between the occurrence of polymorphic fractions of -casein and milk traits.

Material and methods Milk from 100 Simmental cows was investigated. Cows in the herd were milk recorded using the A4 method and were under constant veterinary supervision. Milk samples for analysis were collected once a month during test milking throughout lactation. Prior to milk sampling, udder health was examined using the area cell-mediated test and the somatic cell count (SCC) was determined using a Milkoscan device. Cow feeding in the herd was divided into summer and winter periods. The average milk yield of the cows for lactation was around 5400 kg. During the winter feeding period, the cows ration contained maize silage, meadow hay and concentrate. In the summer period, the basic feed was pasture grass supplemented with brewers grain and concentrate. Proteins in the analysed milk were separated using horizontal starch gel electrophoresis, according to the method of Mitjutko et al. (1974), to determine polymorphic fractions of proteins (S1-, - and -casein (CSN) and -lactoglobulin (LGB)) and the occurrence and frequency of alleles and genotypes. Milk samples were taken from healthy cows between the 3rd and 8th months of lactations to determine milk composition and properties. Each time, around 100 ml of milk per cow was collected for analysis. The milk was analysed using a Milkoscan device for basic chemical composition, i.e. levels of total protein, fat, lactose and solids, as well as the casein content according to the method of Walker, density using the aerometric method, thermostability (alcohol number), potential acidity according to the method of Soxhlet-Henkel, clotting time using the rennet method, and cheese yield using the enzymatic method (PN-68/A-86122). The results were analysed statistically using a multivariate analysis of variance and the Statistica 6.0 packet. The significance of differences between the means was analysed using the Scheffe test.

Technological properties of cows milk and -casein polymorphism

39

Results The separation of proteins using starch gel electrophoresis allowed simultaneous determination of the polymorphism of four milk protein fractions: betalactoglobulin and alphas1-, beta- and kappa-casein (Table 1). The largest number of genotypes in the analysed Simmental cattle was found in the -lactoglobulin (AA, AB, BB, BD) and -casein (AA, AB, BB, BC) systems. In each of the other protein systems, three genotypes were found. In the LGB system, the highest frequency (0.488) was characteristic of the AB genotype, while the frequency of AA and BB homozygotes was similar (0.236 and 0.252, respectively). Analysis of Simmental cows showed the occurrence of a rare genotype, BD LGB (frequency of 0.024).

Table 1. Frequency of genes and genotypes of milk proteins in the Simmental cows Milk proteins -lactoglobulin (LGB) Genotypes AA AB BB BD BB BC CC AA AB BB BC AA AB BB No. of cows 77 166 82 4 239 85 5 240 58 6 25 89 171 69 Frequency of genotypes 0.236 0.488 0.252 0.024 0.733 0.247 0.020 0.669 0.235 0.020 0.076 0.281 0.498 0.221 Gene frequency A = 0.486 B = 0.502 D = 0.012 B = 0.856 C = 0.144 A = 0.818 B = 0.144 C = 0.038 A = 0.530 B = 0.470

S1-casein (CSN1S1) -casein (CSN2)

-casein (CSN3)

-casein polymorphism manifested itself in the presence of two alleles, A and B, which condition the occurrence of three genotypes of this protein: AA, AB and BB. The highest frequency was characteristic of the AB genotype (0.498) and the frequency of the BB CSN3 genotype, which is commonly regarded as beneficial, was also high. The frequency of the CSN3 A allele was 0.530 and that of the B allele was slightly lower (0.470). The results obtained showed that the milk of Simmental cows is characterized by high levels of fat (4.20%), total protein (3.62%), casein (2.72%) and solids (13.59%). The milk was characterized by high density (1.0295) and a relatively short protein coagulation time (343 s). The average somatic cell count in the analysed milk was 220,000/cm3.

40

A. Felenczak et al.

The present study showed that CSN3 polymorphism is a significant differentiating factor of milk composition, i.e. the total protein and casein content (Table 2). The milk containing the polymorphic BB CSN3 fraction was characterized by the highest total protein and casein content, and the difference in relation to the milk with the AA CSN3 type was 0.19% in both cases. The milk with the AB CSN3 type was characterized by an intermediate protein content, which was significantly higher than that of the milk with the AA CSN3 type. The percentage of fat in the milk containing the AB and BB CSN3 polymorphic fractions was similar but higher than that in the milk of AA CSN3 homozygous cows.

Table 2. Technological milk properties of cows with different -casein genotypes CSN3 genotypes Traits x N Fat (%) Crude protein (%) Casein (%) Lactose (%) Solids (%) Density (g/cm3) Acidity (oSH) Thermal stability 4.13 3.50 AB 2.62 AB 4.76 13.23 1.0292 ab 7.09 4.99 161 0.62 0.43 0.28 0.42 0.90 0.018 0.06 0.31 4.22 3.66 A 2.74 A 4.80 13.83 1.0296 a 7.17 4.98 AA SD x 307 0.60 0.43 0.26 0.36 0.63 0.015 0.07 0.32 4.20 3.69 B 2.81 B 4.78 13.49 1.0297 b 7.26 5.12 AB SD x 138 0.64 0.39 0.31 0.40 0.92 0.016 0.06 0.38 BB SD

Values in rows with the same letter are significantly different: aa P 0.05; AA P 0.01.

Significant differences between the CSN3 genetic groups were also observed for milk properties, i.e. protein clotting time, density and cheese yield. The shortest clotting time (308 s) was characteristic of the milk of BB CSN3 homozygous cows. It was 48 s shorter than in the AA CSN3 genotype group (Figure 1). Similarly, the highest cheese yield was found for the milk of cows with the BB CSN3 genotype and the difference in relation to AA homozygotes exceeded 4% (Figure 2). In addition, the milk containing the polymorphic BB CSN3 fraction was characterized by the highest density and a high alcohol number, which indicates that its thermal stability was good. The milk containing the AB CSN3 fraction had the highest levels of fat and solids. As regards the other milk traits, no large differences were found between the genotype groups.

Technological properties of cows milk and -casein polymorphism

41

Figure 1. Protein clotting time from milk of cows with different -casein genotypes

Figure 2. Cheese yield from milk of cows with different -casein genotypes

Discussion Total protein and casein are particularly important parameters of cows milk composition, both in terms of the nutritive value of milk and its suitability for processing. Milk with a higher level of these components has superior technological properties as it is more useful for cheese-making. The results obtained indicate a positive effect of the B CSN3 allele on the above traits. These findings are confirmed by Ikonen (2000) and Wan and Ng-Kwai-Hang (1997). Likewise, Mackle et al. (1998) obtained statistically significant differences in the total protein and casein content in cows with the AA and BB CSN3 genotype. They found that the milk of cows with the homozygous type BB CSN3 contained as much as 0.43% more total protein than that of AA homozygotes. Clotting time and cheese yield are very important technological parameters of milk. In light of the results available, many authors hold the view that the selection of dairy cows with the CSN3 genotype might help to improve these parameters (Dikkeboom et al., 2000; Fitzgerald, 1998; Felenczak et al., 2002).

42

A. Felenczak et al.

In the present study, we found that the B CSN3 allele has a significant effect on protein clotting time and cheese yield. This influence was additive. Likewise, Ikonen (2000) indicated the B CSN3 allele as a factor affecting milk clotting processes through significant shortening of the flocculation time and better compactness of the casein clot. According to Summer et al. (2002), milk containing the homozygous form of the B CSN3 fraction is characterized by considerably higher level of CSN3 in solids, and thus a higher proportion of micelles of low diameter. Such micelles, in turn, show better reactivity with the rennet, which directly produces a greater amount of casein clots. All these characteristics have a considerable effect on the clotting properties of cows milk and on cheese yield. In the studies by Fitzgerald (1998), milk of the BB CSN3 type had a 7 min shorter clotting time and an 8% higher cheese yield in relation to milk of the AA CSN3 type. Buchberger and Dovc (2000) reported that milk from cows with the BB CSN3 genotype was characterized by a 3 6% higher Cheddar cheese yield. It is concluded that the milk of the analysed cows was characterized by a high total protein, casein and fat content. CSN3 polymorphism was a factor that significantly differentiated milk composition and properties. The milk of cows with the BB and AB CSN3 genotypes was characterized by a more favourable composition, shorter clotting time and higher curd cheese yield. The research results obtained so far demonstrate that CSN3 genotypes can be an additional and valuable source of information in the selection of dairy cattle.

References A a l t o n e n M.L., A n t i l a V. (1997). Milk rennet properties and the genetic variants of proteins. Milchwissenschaft, 42, 8: 490 492. B u c h b e r g e r J., D o v c P. (2000). Lactoprotein genetic variants in cattle and cheese making ability. Food Techn. Biotechn., 38 (2): 91 98. C z a r n i k U., W a l a w s k i K. (2003). Cicha mutacja genu podjednostki CD18 ITGB2 jako potencjalny marker cech uzytkowosci mlecznej byda. Zesz. Nauk. PTZ, Prz. Hod., 69: 9 17. D i k k e b o o m A.L., C h e n C.M., J a e g g i J.J., J o h n s o n M.E., T r i c o m i W.A., Z i m b r i c M.G. (2000). Milk proteins and cheese composition the influence of genetic variants. Dairy Pipeline, 12, 3: 6 7. E i g e l W.N., B u t l e r J.E., E r n s t r o m C.A., F a r r e l l H.P., H a r w w a l k a r V.R., J e n n e s s R., W h i t n e y R.M. (1984). Nomenclature of proteins of cows milk: fifth revision. J. Dairy Sci., 67: 1599 1631. F e l e n c z a k A., S z a r e k J., G a r d z i n a E. (2002). Polymorphism of proteins versus composition and properties cow milk. Proc. Int. Sci. Conf.: XX Genetic Days, Brno, 2002; pp. 49-51. F i t z g e r a l d R.J. (1998). Genetic variants of milk proteins Relevance to milk composition and cheese production. End of project report. Dairy Prod. Res. Centre, 19: 3 11. I k o n e n T. (2000). Possibilities of genetic improvement of milk coagulation properties of dairy cows. University of Helsinki, Department of Animal Science, http://ethesis.helsinki.fi/julkaisut/maa/kotie/ vk/ikonen/contents.html. L i t w i n c z u k Z., L i t w i n c z u k A., B a r o w s k a J., C h a b u z W. (1997). Porownanie wydajnosci i skadu mleka krow rasy czarno-biaej i jersey oraz ich mieszancow F1 (cb jersey) ze

Technological properties of cows milk and -casein polymorphism

43

szczegolnym uwzglednieniem polimorfizmu biaek. Ann. Univ. M.C.-S., Lublin, Polonia, XV, 2: 7 13. M a c k l e T.R., B r y a n t A.M., P e t c h S.F., H i l l J.P., A u l d i s t H.J. (1998). Nutritional influences on the composition of milk from cows of different protein phenotypes in New Zealand. J. Dairy Sci., 82: 172 180. M e r c i e r J.C., V i l o t t e J.L. (1993). Structure and function of milk protein genes. J. Dairy Sci., 76, 10: 3079 3098. N g - K w a i - H a n g K.F. (1994). Genetic variants of milk proteins and cheese yield. Int. Dairy Feder., Brussels, Special Issue, 9402: 160 166. S t r z a k o w s k a N., K r z y z e w s k i J., R y n i e w i c z Z. (2000). Wpyw genotypu beta-laktoglobuliny i kappa-kazeiny na wydajnosc, skad chemiczny i podstawowe parametry technologiczne mleka krow cb. Pr. Mat. Zoot., 56: 107 119. S u m m e r A., M a l a c a r n e M., M a r t u z z i F., M a r i a n i P. (2002). Structural and functional characteristics of modenese cow milk in parmigiano-reggiano cheese production. Ann. Fac. Medic. Vet., Di Parma, 22: 163 174. W a n X i a o c h u n, N g - K w a i - H a n g K.F. (1997). Effect of genetic variants of -casein and -lactoglobulin on cheese yielding capacity of Ayrshire milk. www.mcgill.ca/animal/publications/1997/ Research reports 1997: pp. 67 70. Z i e m i n s k i R., J u s z c z a k J., W a l a w s k i K. (2002). Association between milk protein polymor phism and lifetime production traits in herds of Black-and-White and Red-and White cattle improved by Holstein-Friesian sires. Ann. Anim. Sci., 2 (1): 29 40.

Accepted for printing 23 III 2006

ANDRZEJ FELENCZAK, ANNA FERTIG, EWA GARDZINA, MARIAN ORMIAN, JAN TRELA Cechy technologiczne mleka krow rasy Simental oraz ich zwia zek z polimorfizmem -kazeiny STRESZCZENIE Badano skad, wasciwosci technologiczne oraz polimorfizm biaek mleka krow rasy Simental. cym istotnie skad i wasciwosci mleka. Wykazano, ze polimorfizm -kazeiny by czynnikiem roznicuja ce Mleko pochodza od krow o genotypach BB i AB CSN3 charakteryzowao sie korzystniejszym skadem, tj. wyzsza zawartoscia tuszczu, biaka ogolnego i kazeiny, a takze krotszym czasem koagulacji i wyzsza , wydajnoscia sera twarogowego. Uzyskane wyniki wskazuja ze genotypy CSN3 moga stanowic dodatkowe, cenne zrodo informacji w selekcji byda.

Ann. Anim. Sci., Vol. 6, No. 1 (2006) 45 52

ANALYSIS OF THE RELATIONSHIP BETWEEN TWO SINGLE NUCLEOTIDE POLYMORPHISMS OF THE BUTYROPHILIN (BTN1A1) GENE AND MILK PRODUCTION TRAITS IN JERSEY CATTLE*

J o l a n t a K o m i s a r e k, K r y s t y n a W a s k o w i c z, Z b i g n i e w D o r y n e k Department of Cattle Breeding and Milk Production, Agricultural University, Wojska Polskiego 71 A, 60-625 Poznan, Poland Abstract The aim of the present study was to analyse the relationship between the P35Q and K468R single nucleotide polymorphisms of the butyrophilin (BTN1A1) gene and milk production traits in cattle. The investigation was conducted on a population of 219 Jersey cows. The following allele frequencies were found: P35Q 0.84 (A) and 0.16 (C); K468R 0.66 (A) and 0.34 (G). The analysis did not reveal a significant association for P35Q polymorphism. For the K468R mutation, the AA genotype was characterized by significantly higher milk, fat, and protein yields than the AG and GG genotypes. The relationship has not, however, been confirmed by within-sire family analysis. Key words: cattle, butyrophilin, gene polymorphism, milk traits

Butyrophilin (BTN1A1) is a protein specifically expressed on the apical surface of the mammary epithelial cells in the final stage of pregnancy and during lactation (Aoki et al., 1997; Franke et al., 1981; Ogg et al., 1996). It is also the most abundant protein in the membrane surrounding milk-fat droplets (Mather et al., 1980; Mondy and Keenan, 1993). Although the function of BTN1A1 is not fully understood, its expression profile suggests an important role in lactation. Recently, a generation of BTN1A1-ablated mice supplied evidence that butyrophilin is required for proper milk-fat secretion (Ogg et al., 2004). Butyrophilin is a type I transmembrane glycoprotein containing an N-terminal exoplasmic domain with two Ig-like folds, a centrally located single membrane anchor, and a C-terminal cytoplasmic domain with a highly conserved B30.2 region (Banghart et al., 1998). The presence of Ig-like folds within the protein structure
* This work was conducted as part of the research project no. 2 P06D 017 26, financed by the State Committee for Scientific Research.

46

J. Komisarek et al.

makes butyrophilin a member of the Ig superfamily (Gardinier et al., 1992) and indicates its possible immunologic function, unrelated to milk-fat secretion. The BTN1A1-encoding gene has been described in several mammalian species, including cattle (Jack and Mather, 1990), humans (Taylor et al., 1996 b) and mice (Ishii et al., 1995). Both gene structure and protein amino acid sequence show a high degree of conservation (Ogg et al., 1996; Taylor et al., 1996 b). The bovine BTN1A1 gene has been mapped to chromosome 23 (Ashwell et al., 1996 a; Taylor et al., 1996 a). In the same genome region, several quantitative trait loci (QTLs) for health and production traits have been identified. Most of them were found to influence the somatic-cell content of milk (Ashwell et al., 1996 b; 1998; Heyen et al., 1999; Holmberg and Andersson-Eklund, 2004), but the presence of putative genes affecting milk yield and composition was also reported (Ashwell et al., 1997; Bennewitz et al., 2003; 2004; Zhang et al., 1998). Butyrophilin might serve as a possible candidate influencing the variation in the QTLs detected. The aim of the present study was to analyse the relationship between P35Q and K468R single nucleotide polymorphisms (SNPs) and milk production traits in Jersey cattle. P35Q is due to the C A substitution in exon 3 of the BTN1A1 gene (Seyfert and Lthen, 1998) resulting in the amino acid change from proline to glutamine at the IgI domain, whereas K468R is the A G mutation in exon 8 (Taylor et al., 1996 a) that leads to the lysine arginine replacement within the B30.2 region.

Material and methods The study included 219 Jersey cows born between 1996 and 2002 and kept on the Siedlec farm belonging to the Horse Stud Farm in Iwno. The studied animals were the progeny of 21 sires. The average number of daughters per sire was 10.4 and ranged from 1 to 51. Genomic DNA was isolated from blood using the phenol-chloroform method, according to the standard protocol. Genotypes were determined using the PCRRFLP technique. Primer sequences for PCR were established on the basis of the gene sequence available in the GenBank database (entry No. Z93323), using PRIMER3 software (http://www.genome.wi.mit.edu/cgi-bin/primer/primer3 www.cgi): P35Q-F: 5 TGGTAGGTCAGGAAGCCATC 3 P35Q-R: 5 GTATTCAGCCATCTCCTCGC 3 K468R-F: 5 TGGAGCTCTATGGAAATGGG 3 K468R-R: 5 ACCCTTTGGGTTTTCTGCTT 3 The PCR reaction volume of 10 l contained approximately 50 ng of genomic DNA, 0.5 units of Taq DNA polymerase (Fermentas), 1 PCR buffer with (NH4)2SO4 (Fermentas), 2 mM MgCl2, 5% DMSO, 1 M of each primer, and 200 M of each dNTP. Thermal cycling conditions included an initial denaturation

Relationship between polymorphisms of BTN1A1 gene and milk production traits in cattle

47

at 94oC for 5 min, followed by 30 cycles at 94oC for 30 s, 58oC (P35Q) or 56oC (K468R) for 30 s, and 72oC for 40 s, followed by a final extension at 72oC for 5 min. The PCR reactions were carried out using a TGradient thermocycler (Biometra). The amplified P35Q and K468 fragments were digested overnight at 37oC with 5 units of BcnI and BsuRI (HaeIII) restriction endonucleases (Fermentas), respectively, then subjected to electrophoretic separation in 2.5% ethidium bromidestained agarose gel (BASICA LE GQT, Prona). The frequencies of the alleles and genotypes were estimated, and a chi-square analysis was performed to test whether the genotype distributions obtained complied with the Hardy-Weinberg law. The effect of genotypes on milk traits was tested using the GLM procedure of the SAS package (SAS, 1989). The statistical model included the effects of BTN1A1 genotypes, the sire effect, and the effect of lactation number and year and season of calving. The analysis was carried out on the group of 185 cows with at least one 305-day complete lactation (185 animals with one lactation, 123 with two lactations, and 91 with three lactations). The additional test was performed on two families headed by those sires with the highest number of daughters (51 and 47 cows, respectively). The model used for the within-family analysis included the effects of BTN1A1 genotypes (K468R), the effect of lactation number, and the effect of the year and season of calving. Data for 305-day lactations, including overall milk, fat and protein yields as well as fat and protein contents, originated from the routine control of milk performance and were obtained from the farm documentation.

Results The PCR amplifications resulted in 574 bp and 780 bp long DNA products for P35Q and K468R butyrophilin gene polymorphisms, respectively. Five BsuRI restriction sites were found in the K468R lysine-encoding A allele, at PCR product positions 162, 175, 185, 556 and 693. In the arginine-encoding G allele, an additional restriction site at position 218 was present. The P35Q fragment, digested with the BcnI restriction enzyme, was visible on the gel as two (74 and 500 bp) or three (74, 96 and 404 bp) bands for the A (glutamine) and C (proline) alleles, respectively. Among the 219 cows examined, the P35Q AA genotype was identified in 154, AC in 59, and CC in 6 animals, giving allele frequencies of 0.84 (A) and 0.16 (C). For the K468R mutation, the following genotype and allele frequencies were obtained: AA 0.45, AG 0.43, and GG 0.12; A 0.66, and G 0.34, respectively. All genotypes were distributed according to the Hardy-Weinberg equilibrium. The effects of BTN1A1 genotypes on milk production traits were tested in the group of 185 Jersey cows. The results obtained are presented in Table 1. The analysis did not reveal any significant association for P35Q polymorphism. Animals with the AA genotype of the K468R SNP, however, were characterized by

48

J. Komisarek et al.

higher (P 0.05) milk, fat and protein yields than cows with the AG and GG genotypes. Fat and protein levels did not seem to be affected. To prove the significant results obtained to be true, an additional analysis was carried out on the two heterozygous sire families with the highest number of daughters (Table 2). The relationship between K468R and yield traits was not confirmed. Instead, in the half-sib family headed by sire 1, a relationship with milk-fat content was found.

Table 1. Overall means and their standard deviations for milk production traits in different P35Q and K468R genotypes Genotype Trait AA No. of animals 130 Milk yield (kg) 4454 724 Fat yield (kg) 248 43 Fat content (%) 5.58 0.54 Protein yield (kg) 174 28 Protein content (%) 3.91 0.22 P35Q AC 50 4592 834 256 43 5.59 0.53 177 31 3.86 0.26 CC 5 4352 547 236 22 5.46 0.58 166 19 3.83 0.25 AA 78 K468R AG 83 GG 24

4616 753 ab 4411 755 a 4311 635 b 257 42 ab 245 43 a 243 37 b 5.59 0.58 178 28 ab 3.89 0.24 5.57 0.54 171 29 a 3.92 0.23 5.57 0.36 168 27 b 3.90 0.17

a, b columns with the same superscript differ at P 0.05.

Table 2. Overall means and their standard deviations for milk production traits in cows with different K468R genotypes being the progeny of two heterozygous sires Trait Genotypes of sire 1 daughters AA AG GG Genotypes of sire 2 daughters AA AG 20 4601 676 246 40 5.41 0.38 172 28 3.74 0.15 GG 10 4361 626 237 35 5.44 0.27 166 24 3.80 0.16

No. of daughters 10 29 8 21 Milk yield (kg) 4460 493 4365 680 4307 611 4498 572 Fat yield (kg) 265 41 249 42 243 34 248 30 Fat content (%) 5.94 0.44 Aa 5.71 0.45 a 5.53 0.38 A 5.54 0.51 Protein yield (kg) 179 22 174 29 172 26 169 20 Protein content (%) 4.00 0.21 3.99 0.22 3.99 0.17 3.76 0.24

A, a columns with the same superscript differ at P 0.05 (small letters) or at P 0.01 (capital letters).

Relationship between polymorphisms of BTN1A1 gene and milk production traits in cattle

49

Discussion BTN1A1 is a likely candidate gene that affects economically important traits in dairy animals because it is specifically expressed in the lactating mammary epithelial tissue and the gene product may play a role in the secretion of milk lipid. However, although several polymorphic forms of BTN1A1 have been identified (Husaini et al., 1999; Seyfert and Lthen, 1998; Taylor et al., 1996 a; Zegeye et al., 1999), their impact on production traits in cattle has not been studied extensively. In this paper, the P35Q and K468R polymorphisms were examined. P35Q was first identified in a Holstein-Friesian (HF) population (Seyfert and Lthen, 1998), but, until now, no association analysis has been performed. The allele distribution obtained in the present study suggests that the most frequent allele A (0.84) might have been favoured by selection for dairy production. However, the direct impact of this mutation on milk production seems to be questionable. First, no relationship between P35Q and milk-related traits in Jersey cows has been found. Second, the polymorphism leads to an amino acid change within one of two exoplasmic Ig-like folds of the butyrophilin peptide. The IgI domain might be responsible for the immunologic function of BTN1A1, but is probably not involved in milk synthesis. Thus, the accumulation of the A allele could merely be a result of indirect selection on other, closely linked QTLs. On the other hand, the possibility that P35Q polymorphism has an effect that was not observed in the present investigation because of the low number of animals and low C allele frequency cannot be excluded. K468R is more likely the causative mutation affecting milk traits in cattle. The lysine to arginine substitution appeared within the highly conserved region of the butyrophilin cytoplasmic domain, known as B30.2, that probably participates in the protein-protein interactions (Henry et al., 1997; Ishii et al., 1995). One of the potential interactive partners is a xanthine dehydrogenase/oxidase (XDH/XO). It is postulated that the BTN1A1-XDH/XO protein complex interacts with lipid droplets at the apical surface of mammary epithelial cells and is essential for milk-fat secretion (for reviews, see Mather and Keenan, 1998; Murphy and Vance, 1999). On the other hand, both lysine and arginine are similar amino acids within the basic R-group. The substitution should not, therefore, affect the protein structure or its binding affinity. The K468R allele frequencies estimated for Jersey cows in the present study (A 0.66 and G 0.34) differ from those reported previously for HF cattle. In Holstein-Friesians, the G allele frequency was established to be equal to approximately half these values, ranging from 0.12 (Komisarek and Dorynek, 2003) to 0.15 (Husaini et al., 1999). Nevertheless, both breeds are characterized by the preponderance of the A variant, suggesting that it might be favoured by selection for milk performance. The association analyses performed so far have produced uncertain results. Zegeye et al. (1999) did not reveal a relationship between K468R (HaeIII) polymorphism and milk production in five grand-sire HF families. Also, comparison of the breeding values of HF bulls carrying the AA and AG genotypes

50

J. Komisarek et al.

(Komisarek and Dorynek, 2003) resulted in no significant association, although for one trait (milk-fat percentage) the difference came close to a significance level of P 0.05. In the present study, Jersey cows with the AA genotype were characterized by higher milk, fat and protein yields than cows with two other genotypes. The association was not, however, confirmed by within-family analysis. Thus, K468R is probably not the causative mutation affecting milk production in cattle. It might, however, be linked to a locus with a direct effect, which remains undetected due to the lack of causative gene allele segregation in two analysed families or because of the small number of daughters per sire. One of the potential candidates could be the prolactin (PRL)-encoding gene. It is located on chromosome 23, close to the BTN1A1 locus (Hallerman et al., 1988). The role of prolactin in lactation physiology is well known, and some relationships between bovine PRL polymorphisms and milk production traits have been found (Chung et al., 1996; Dybus, 2002; Brym et al., 2005). On the other hand, BTN1A1 cannot be definitively excluded as a source of variability of milk-related traits. Further investigations, conducted on larger populations, are therefore needed to verify the effect of butyrophilin in cattle.

References A o k i N., I s h i i T., O h i r a S., Y a m a g u c h i Y., N e g i M., A d a c h i T., N a k a m u r a R., M a t s u d a T. (1997). Stage specific expression of milk fat globule membrane glycoproteins in mouse mammary gland: comparison of MFG-E8, butyrophilin, and CD36 with a major milk protein, -casein. Biochim. Biophys. Acta, 1334: 182 190. A s h w e l l M.S., O g g S.L., M a t h e r I.H. (1996 a). The bovine butyrophilin gene maps to chromosome 23. Anim. Genet., 27: 171 173. A s h w e l l M.S., R e x r o a d C.E. Jr., M i l l e r R.H., V a n r a d e n P.M. (1996 b). Mapping economic trait loci for somatic cell score in Holstein cattle using microsatellite markers and selective genotyping. Anim. Genet., 27: 235 242. A s h w e l l M.S., R e x r o a d C.E. Jr., M i l l e r R.H., V a n R a d e n P.M., D a Y. (1997). Detection of loci affecting milk production and health traits in an elite US Holstein population using microsatellite markers. Anim. Genet., 28: 216 222. A s h w e l l M.S., D a Y., V a n r a d e n P.M., R e x r o a d C.E. Jr., M i l l e r R.H. (1998). Detection of putative loci affecting conformational type traits in an elite population of United States Holsteins using microsatellite markers. J. Dairy Sci., 81: 1120 1125. B a n g h a r t L.R., C h a m b e r l a i n C.W., V e l a r d e J., K o r o b k o I.V., O g g S.L., J a c k L.J., V a k h a r i a V.N., M a t h e r I.H. (1998). Butyrophilin is expressed in mammary epithelial cells from a single-sized messenger RNA as a type I membrane glycoprotein. J. Biol. Chem., 273: 4171 4179. B e n n e w i t z J., R e i n s c h N., G r o h s C., L e v e z i e l H., M a l a f o s s e A., T h o m s e n H., X u N., L o o f t C., K u h n C., B r o c k m a n n G.A., S c h w e r i n M., W e i m a n n C., H i e n d l e d e r S., E r h a r d t G., M e d j u g o r a c I., R u s s I., F o r s t e r M., B r e n i g B., R e i n h a r d t F., R e e n t s R., A v e r d u n k G., B l u m e l J., B o i c h a r d D., K a l m E. (2003). Combined analysis of data from two granddaughter designs: A simple strategy for QTL confirmation and increasing experimental power in dairy cattle. Genet. Sel. Evol., 35: 319 338. B e n n e w i t z J., R e i n s c h N., G u i a r d V., F r i t z S., T h o m s e n H., L o o f t C., K h n C., S c h w e r i n M., W e i m a n n C., E r h a r d t G., R e i n h a r d t F., R e e n t s R., B o i c h a r d D., K a l m E. (2004). Multiple quantitative trait loci mapping with cofactors and application of alternative variants of the false discovery rate in an enlarged granddaughter design. Genetics, 168: 1019 1027.

Relationship between polymorphisms of BTN1A1 gene and milk production traits in cattle

51

B r y m P., K a m i n s k i S., W o j c i k E. (2005). Nucleotide sequence polymorphism within exon 4 of the bovine prolactin gene and its associations with milk performance traits. J. Appl. Genet., 45: 179 185. C h u n g E.R., R h i n T.J., H a n S.K. (1996). Association between PCR RFLP markers of growth hormone and prolactin genes and production traits in dairy cattle. Korean J. Anim. Sci., 38: 321 336. D y b u s A. (2002). Associations of growth hormone GH and prolactin PRL genes polymorphism with milk production traits in Polish Black and White cattle. Anim. Sci. Pap. Rep., 20: 203 212. F r a n k e W.W., H e i d H.W., G r u n d C., W i n t e r S., F r e u d e n s t e i n C., S c h m i d E., J a r a s c h E.D., K e e n a n T.W. (1981). Antibodies to the major insoluble milk fat globule membrane-associated protein: specific location in apical regions of lactating epithelial cells. J. Cell Biol., 89: 485 494. G a r d i n i e r M.V., A m i g u e t P., L i n i n g t o n C., M a t t h i e u J.M. (1992). Myelin/oligodendrocyte glycoprotein is a unique member of the immunoglobulin superfamily. J. Neurosci. Res., 33: 177 187. H a l l e r m a n E.M., T h e i l m a n n J.L., B e c k m a n n J.S., S o l l e r M., W o m a c k J.E. (1988). Mapping of bovine prolactin and rhodopsin genes in hybrid somatic cells. Anim. Genet., 19: 123 131. H e n r y J., R i b o u c h o n M.-T., O f f e r C., P o n a r o t t i P. (1997). B30.2-like domain proteins: A growing family. Biochem. Biophys. Res. Commun., 235: 162 165. H e y e n D.W., W e l l e r J.I., R o n M., B a n d M., B e e v e r J.E., F e l d m e s s e r E., D a Y., W i g g a n s G.R., V a n R a d e n P.M., L e w i n H.A. (1999). A genome scan for QTL influencing milk production and health traits in dairy cattle. Physiol. Genom., 1: 165 175. H o l m b e r g M., A n d e r s s o n - E k l u n d L. (2004). Quantitative trait loci affecting health traits in Swedish dairy cattle. J. Dairy Sci., 87: 2653 2659. H u s a i n i Y., W i l k i n s R.J., D a v e y H.W. (1999). Identification of five point mutations, including an AluI RFLP, in the bovine butyrophilin gene. Anim. Genet., 30: 400 401. I s h i i T., A o k i N., N o d a A., A d a c h i T., N a k a m u r a R., M a t s u d a T. (1995). Carboxy-terminal cytoplasmic domain of mouse butyrophilin specifically associates with a 150-kDa protein of mammary epithelial cells and milk fat globule membrane. Biochim. Biophys. Acta, 1245: 285 292. J a c k L.J., M a t h e r I.H. (1990). Cloning and analysis of cDNA encoding bovine butyrophilin, an apical glycoprotein expressed in mammary tissue and secreted in association with the milk-fat globule membrane during lactation. J. Biol. Chem., 265: 14481 14486. K o m i s a r e k J., D o r y n e k Z. (2003). Polymorphism of BTN and GHR genes and its impact on bulls breeding value for milk production traits. J. Anim. Feed Sci., 12: 681 688. M a t h e r I.H., K e e n a n T.W. (1998). Origin and secretion of milk lipids. J. Mammary Gland Biol. Neoplasia, 3: 259 273. M a t h e r I.H., T a m p l i n C.B., I r v i n g M.G. (1980). Separation of the proteins of bovine milk-fatglobule membrane by electrofocusing with retention of enzymatic and immunological activity. Eur. J. Biochem., 110: 327 336. M o n d y B.L., K e e n a n T.W. (1993). Butyrophilin and xanthine oxidase occur in constant molar proportions in milk lipid globule membrane but vary in amount with breed and stage of lactation. Protoplasma, 177: 32 36. M u r p h y D.J., V a n c e J. (1999). Mechanisms of lipid-body formation. Trends Biochem. Sci., 24: 109 115. O g g S.L., K o m a r a g i r i M.V.S., M a t h e r I.H. (1996). Structural organization and mammary-specific expression of the butyrophilin gene. Mamm. Genome, 7: 900 905. O g g S.L., W e l d o n A.K., D o b b i e L., S m i t h A.J.H., M a t h e r I.H. (2004). Expression of butyrophilin (Btn1a1) in lactating mammary gland is essential for the regulated secretion of milk-lipid droplets. Proc. Natl. Acad. Sci., USA, 101: 10084 10089. S e y f e r t H.-M., L t h e n F. (1998). The structure of the bovine butyrophilin encoding gene differs grossly from mouse concerning promoter localization and exon organization of the S-untranslated region. Proc. 6th World Congr. Genet. Appl. Livest. Prod., 25: 51 54.

52

J. Komisarek et al.

T a y l o r C., E v e r e s t M., S m i t h C. (1996 a). Restriction fragment length polymorphism in amplification products of the bovine butyrophilin gene: assignment of bovine butyrophilin to bovine chromosome 23. Anim. Genet., 27: 183 185. T a y l o r M.R., P e t e r s o n J.A., C a r i a n i R.L., C o u t o J.R. (1996 b). Cloning and sequence analysis of human butyrophilin reveals a potential receptor function. Biochim. Biophys. Acta, 1306: 1 4. Z e g e y e A., A s h w e l l M., O g g S., R e x r o a d C., M a t h e r I.H. (1999). RFLP markers in the bovine butyrophilin gene. Anim. Genet., 30: 385 386. Z h a n g Q., B o i c h a r d D., H o e s c h e l e I., E r n s t C., E g g e n A., M u r k v e B., P f i s t e r g e n s k o w M., W i t t e L.A., G r i g n o l a F.E., U i m a r i P., T h a l l e r G., B i s h o p M.D. (1998). Mapping quantitative trait loci for milk production and health of dairy cattle in a large outbred pedigree. Genetics, 149: 1959 1973.

Accepted for printing 5 I 2006

JOLANTA KOMISAREK, KRYSTYNA WASKOWICZ, ZBIGNIEW DORYNEK


Analiza asocjacji miedzy dwoma polimorfizmami genu butyrofiliny (BTN1A1) a cechami produkcji mleka u byda rasy Jersey STRESZCZENIE Celem pracy bya analiza zaleznosci miedzy polimorfizmem P35Q i K468R butyrofiliny (BTN1A1) a cechami produkcji mleka u byda. Badaniem objeto populacje 219 krow rasy Jersey. Uzyskano ce nastepuja frekwencje alleli: P35Q 0.84 (A) i 0.16 (C); K468R 0.66 (A) i 0.34 (G). Analiza nie wykazaa istotnych asocjacji dla polimorfizmu P35Q. W przypadku mutacji K468R, genotyp AA charakteryzowa sie istotnie wyzsza wydajnoscia mleka, tuszczu i biaka w stosunku do genotypow AG i GG. Zaleznosc ta nie zostaa jednak potwierdzona w analizie przeprowadzonej w grupach porodzenstwa.

Ann. Anim. Sci., Vol. 6, No. 1 (2006) 53 58

RELATIONSHIP BETWEEN INTERPREGNANCY INTERVAL AND LIFETIME PRODUCTIVITY OF COWS

J a r o s a w P y t l e w s k i, I r e n e u s z A n t k o w i a k, Z b i g n i e w D o r y n e k Department of Cattle Breeding and Milk Production, Agricultural University, Wojska Polskiego 71 A, 60-625 Poznan, Poland Abstract The aim of the study was to investigate the relationship between the length of the interpregnancy interval and the lifetime productivity of Black-and-White cows. No clear correlation was found between the length of the interpregnancy interval and milk production traits. Cows in which the mean length of the interpregnancy interval ranged from 121 to 160 days had the longest lifespan, productive life and milking period, as well as the highest lifetime production of milk, butterfat and protein. Key words: cow, interpregnancy interval, lifetime productivity

A trend towards deteriorating health and fertility is observed in cows with increasing milk yields. This pattern is confirmed by the results obtained by Ps and Mntysaari (1996), who showed a negative genetic correlation between milk yields and reproduction indices. A consequence of this relationship is that the productive life of animals becomes shorter. Many researchers have shown that it is possible to make higher profits from cows with prolonged lactations resulting from increased lifetime milk production, extended cow productive life and decreased herd replacement costs. The aim of the study was to investigate the relationship between the length of the interpregnancy interval and the lifetime productivity of Black-and-White cows.

Material and methods The study included 407 culled Black-and-White cows with varying percentages of Holstein-Friesian genes (47.4% on average) in their genotypes. Animals were tek Rogalin Ltd. in the years removed from the herd belonging to Maja 1991 2004. Feeding of cows was based on feeds produced on the farm. Starting

54

J. Pytlewski et al.

from 1997, feed rations were formulated based on the INRA feeding standards. Culled cows were characterized on the basis of the following parameters: days of life, days of productive life, days of milking, mean length of the interpregnancy interval and lifetime production, as well as yields per day of life, day of productive life and day of milking. Milk production was expressed in kg of milk, butterfat, protein and fat-corrected milk (FCM). Cows were divided into groups based on the mean length of their interpregnancy interval: 95, 96 120, 121 160 and > 160 days. The study analysed relationships between the length of the interpregnancy interval and the lifetime productivity of cows. In order to perform statistical analyses the MEANS procedure of the SAS (ver. 9.1) software package was applied for means and standard deviations, and the GLM procedure for the analysis of variance. The calculations included the following effects: year of the study, lactation number, genotype, age at first lactation, causes of cow culling and mean interpregnancy interval. A detailed comparison of the means was performed using the LSD (least significant differences) test.

Results Table 1 presents the relationships between the length of the interpregnancy interval and the lifetime productivity of cows. Cows with a mean interpregnancy interval within the range of 121 160 days had the longest lifespan (2418 days), the longest productive lives (1539 days) and the longest milking period (1098 days). The least advantageous values for the above-mentioned parameters were found in cows with a mean interpregnancy interval of 95 days. As a result of the statistical analysis performed for the lifespan and length of productive life, highly significant differences were found between cows with a mean interpregnancy interval ranging from 121 to 160 days and the group of animals with a mean interpregnancy interval of 95 days. Significant differences were found between the population of animals with a mean interpregnancy interval ranging from 121 to 160 days and the groups of animals with mean interpregnancy intervals from 96 to 120 days and > 160 days, as well as cows with interpregnancy intervals of > 160 days and 95 days. In the analysis of the number of milking days, the group of cows with an interpregnancy interval from 121 to 160 days differed (P 0.01) from the populations of animals with mean interpregnancy intervals amounting to 95 days and > 160 days. In our study, the mean length of the interpregnancy interval was found to have an effect on lifetime production of cows. The highest yields of milk, butterfat, protein and FCM were observed in cows with a mean interpregnancy interval ranging from 121 to 160 days. Their lifetime productivity was 15 892 kg milk, 674 kg butterfat, 471 kg protein and 16 461 kg FCM. The lifetime milk production of cows with a mean interpregnancy interval ranging from 121 to 160 days differed highly significantly from the lifetime milk yields of animals with a mean interpregnancy interval of 95 days and significantly from the population of animals with the mean interpregnancy interval of > 160 days. Analysis of the

Relationship between interpregnancy interval and lifetime productivity of cows

55

tab. 1

56 tab. 2

J. Pytlewski et al.

Relationship between interpregnancy interval and lifetime productivity of cows

57

lifetime production of 4% FCM showed that the population of cows with a mean interpregnancy interval ranging from 121 to 160 days differed from the population of animals with a mean interpregnancy interval of 95 days at P 0.01. Moreover, statistically significant differences were found between the above-mentioned groups of cows in terms of butterfat and protein yields. Table 2 gives the productivity of cows per day of life, day of productive life and day of milking in terms of the length of the mean interpregnancy interval. In terms of data expressed per day of milking period only, cows with mean interpregnancy intervals of > 160 days and 95 days differed highly significantly in the production of FCM and significantly in milk yield. More advantageous values for the analysed traits were found in animals with a longer interpregnancy interval. Analysis of these milk production traits in terms of values expressed per day of life and day of productive life did not reveal any statistically significant differences between groups of cows with differing interpregnancy intervals.

Discussion In the opinion of Butler and Smith (1989) and Senatore et al. (1996), the energy deficit in cows after calving caused by high yields may disturb energy metabolism and result in ketosis, as well as problems with reproduction extending beyond the interpregnancy interval. Szarek (1998) reported that the present high productivity of cows requires breeders to change the system from 12 months to an extended production cycle of 15 or even 18 months, which improves the health of cows and results in an extension of their lifespan and productive life. A shortening of the lifespan of cows causes a shortening of their productive life, which in turn causes a decrease in their lifetime yields. According to Antkowiak et al. (2001), extension of the productive life of cows may be one of the essential factors in improving the profitability of milk production. The most advantageous interpregnancy interval (121 160 days), found in this study in terms of the lifetime productivity of cows, is consistent with the value of this index considered appropriate by Kaczmarek (1987). A study by Strzakowska et al. (2004), meanwhile, showed that the optimum length of the interpregnancy interval in cows producing approximately 9000 kg milk in one lactation is 110 days. The following conclusions can be drawn from the investigations conducted: no clear correlation was found between the length of the interpregnancy interval and milk production traits, cows in which the mean length of the interpregnancy interval ranged from 121 to 160 days had the longest lifespan, productive life and milking period, as well as the highest lifetime production of milk, butterfat and protein.

58

J. Pytlewski et al. References

A n t k o w i a k I., P y t l e w s k i J., S t a n i s a w s k i D. (2001). Intensywnosc i przyczyny brakowania krow w gospodarstwie farmerskim Paruszewo. Zesz. Nauk. PTZ, Prz. Hod., 59: 66 77. B u t l e r W.R., S m i t h R.D., (1989). Interrelationships between energy balance and postpartum reproductive function in dairy cattle. J. Dairy Sci., 72: 767 783. K a c z m a r e k A. (1987). Praca hodowlana nad doskonaleniem byda o uzytkowosci mlecznej. Mat. konf.: Obecny stan i przyszosciowe metody zwiekszenia produkcji bydlecej. Kalisz, 1987; ss. 1 73. P s J., M n t y s a a r i E.A. (1996). Genetic relationships between reproductive disorders, operational days open and milk yield. Livest. Prod. Sci., 46: 41 48. S e n a t o r e E.M., B u t l e r W.R., O l t e n a c u P.A. (1996). Relationship between EB and post-partum ovarian activity and fertility in first lactation dairy cows. Anim. Prod., 62: 17 23. S t r z a k o w s k a N., K r z y z e w s k i J., R e k l e w s k i A., D y m n i c k i E. (2004). Relationship between the strained length of calving intervals, some reproduction traits and adjusted cows milk yield. Med. Wet., 60: 1312 1316. S z a r e k J. (1998). Perspektywiczny cykl produkcji u krow mlecznych. Zesz. Nauk. PTZ, Prz. Hod., 38: 45 55.

Accepted for printing 9 V 2006

JAROSAW PYTLEWSKI, IRENEUSZ ANTKOWIAK, ZBIGNIEW DORYNEK Zaleznosc miedzy dugoscia okresu miedzycia owego a produkcyjnoscia zyciowa krow z STRESZCZENIE z Celem pracy byo zbadanie zaleznosci miedzy dugoscia okresu miedzycia owego a produkcyjnos cia zyciowa krow czarno-biaych. Nie stwierdzono jednoznacznej zaleznosci miedzy dugoscia okresu miedzyciazowego a badanymi cechami uzytkowosci mlecznej. Krowy, u ktorych srednia dugosc okresu z miedzycia owego wynosia od 121 do 160 dni, zyy najduzej, miay najduzszy okres uzytkowania i dojenia oraz najwyzsza wydajnosc zyciowa mleka, tuszczu i biaka.

Ann. Anim. Sci., Vol. 6, No. 1 (2006) 59 74

ANALYSIS OF TIME TRENDS FOR REPRODUCTIVE AND MEAT TRAITS IN RANDOMLY MATED CONSERVATION FLOCKS OF NORTHERN VARIETY GEESE*

A d a m M a z a n o w s k i 1,2, Z e n o n B e r n a c k i 1, M a r e k A d a m s k i 1, T o m a s z K i s i e l 2 Department of Poultry Breeding, University of Technology and Agriculture, Mazowiecka 28, 85-084 Bydgoszcz, Poland 2 Waterfowl Genetic Resources Station Dworzyska, National Research Institute of Animal Production, 62-035 Kornik, Poland Abstract The study was designed to analyse time trends for reproductive and meat traits in randomly mated conservation flocks of northern variety geese Kartuska (Ka), Rypin ska (Ry) and Suwalska (Su) and to evaluate the effect of reproductive traits, which increased during the study period, on the meat traits of their offspring. Suwalska geese were characterized by the greatest number of eggs (31) per goose and the highest egg weight (171.3 g) compared to Kartuska and Rypin ska geese. The highest egg fertility (68.8%) and the highest hatching percentage from fertilized eggs (62.9%) were characteristic of Rypin ska geese. Kartuska and Suwalska geese of both sexes had higher body weight (4541 and 4512 g) and longer breastbone (16.3 and 16.4 cm) than Rypin ska geese (16.1 cm). The breast muscle thickness of the northern variety geese was similar (2.2 cm). Meat percentage was highest in Rypin ska geese (32.2%) and fat percentage was highest in Kartuska geese (14.4%) compared to the other varieties of northern geese, which were less muscled (31.8%) but at the same time less fatty (14.0 14.3%). Time trends for the number of eggs per goose were positive, and time trends for hatching percentage from fertilized eggs were positive and statistically significant. The effect of the increasing reproductive trait values was noticeable mainly in the positive time trends for breastbone length and meat percentage. Time trends for fat percentage were similar throughout the study. During this time, statistically significant decreases in body weight and breast muscle thickness were also found. Random mating of the geese increased reproductive trait values, decreased body weight and breast muscle thickness, and increased breastbone length and carcass meat percentage. Key words: goose, regional varieties, reproductive traits, meat traits, time trends
1

Kartuska (Ka), Rypinska (Ry) and Suwalska (Su) geese, derived from greylag geese (Anser anser L.), represent the medium heavy northern variety (Mazanowski,
* This work was conducted as part of NRIAP statutory activity, project no. 17110.2.

60

A. Mazanowski et al.

1986; Smalec, 1991). Geese of these varieties were collected in 1973 1975 to form conservation flocks at the Waterfowl Breeding Farm in Dworzyska, which belongs to the National Research Institute of Animal Production. The term conservation flock refers to birds of one variety that are kept without any infusion of foreign blood and subjected to random mating in which the selection of next generation animals is not based on breeding criteria (Smalec, 1991). The goose varieties discussed in this study are included in the World Watch List for Domestic Animal Diversity (FAO, 2000). The preservation of farm animal (including bird) diversity is dictated not only by economic, breeding and scientific considerations, but also by biological, environmental, educational, cultural, ethnographic and even emotional considerations. In 1995, Poland ratified the Convention on Biological Diversity, which obliges each signatory state to preserve the diversity of plants and animals within its borders, not only in protected areas, but also in utilized agricultural areas. In addition to wild species, the convention covers livestock breeds and varieties developed by breeders, especially those facing extinction due to limited commercial use (FAO, 2000; Mazanowski, 1986; Smalec, 1991). The aim of the present study was to analyse time trends of reproductive (1982 2000) and meat traits (1982 1998) in randomly mated conservation flocks of northern variety geese (Kartuska, Rypinska and Suwalska) and to evaluate the effect of reproductive traits, which changed during the study, on the meat traits of the offspring.

Material and methods The study was carried out in 1982 2000 at the Waterfowl Genetic Resources Station Farm in Dworzyska, which belongs to the National Research Institute of Animal Production. During the whole study period, the number of females in the first year of egg production was 2408 for Kartuska geese, 2408 for Rypinska geese and 2291 for Suwalska geese, which were grouped with ganders at a 1 : 3 ratio (Mazanowski, 1984). The number of birds intended for conservation flocks and reared each year ranged from 40 to 80 for ganders and from 120 to 200 for geese. Ganders and geese were reared to 6 weeks of age in a rearing house without access to free range. Later, they were reared outdoors until the end of reproduction, in partially roofed pens with rye straw bedding. Geese of each variety were placed in four subgroups. From 1 to 6 weeks of age, geese were fed ad libitum with a complete diet containing 20.0% crude protein and 2827 kcal (11.82 MJ) metabolizable energy per kg feed. Later, until the end of reproduction, they received a diet containing 17.3% crude protein and 2665 kcal (11.14 MJ) metabolizable energy. During rearing and reproduction, geese were given, in separate troughs, a mineral mixture for poultry (MM-D), chalk, and gravel, mixed at a volumetric ratio of 1 : 1 : 4. Throughout the study, all the geese received mixtures of similar composition. The number of eggs laid was recorded daily in each conservation flock during successive reproduction periods, and the egg weight was monitored individually for

Analysis of time trends for reproductive traits in geese

61

2 weeks at the peak egg production. The percentages of fertilized eggs and hatchability of healthy goslings from fertilized eggs were systematically recorded each year in all the conservation flocks, during the entire reproductive period. At 12 weeks of age, ganders and geese were weighed and the length of their keel and forearm was measured. Breast muscle thickness with skin and subcutaneous fat was measured using a needle catheter, at a distance of 4 cm from the start of the keel and 2.5 cm laterally, perpendicular to the edge of the breastbone. Multiple regression equations (Bochno et al., 1981; Wawro et al., 1985) were used to estimate the weight of meat (M) and fat (F) in 12-week-old geese: M = 0.233 X1 + 18.915 X2 + 60.178 X3 113.944, F = 0.279 X1 63.252 X2 + 623.302, where: X1 body weight (g), X2 forearm length (cm), X3 thickness of breast muscles with skin and subcutaneous fat (cm). The meat and fat percentages of goose carcasses were calculated from the proportion of meat and fat weight to body weight. Patterns of reproductive and meat traits in the analysed years were shown as time trends plotted using linear regression equations (Mazanowski et al., 1999; 2000). In this equation, y = a + bx, a value of the analysed trait in the year of evaluation, b directional coefficient expressing the annual increment in the value of the trait, and x time in years. The time trends made it possible to interpret and compare trends in productive traits in conservation flocks of randomly mated geese. The means of traits and standard error of the mean were calculated, and linear trends of traits were plotted. Two-way analysis of variance was used in the calculations. The significance of the differences was analysed using Duncans test.

Results Suwalska geese were characterized by the greatest number of eggs per goose, the highest egg weight, and the lowest egg fertility compared to Kartuska and Rypinska geese (Table 1). Kartuska and Rypinska geese demonstrated similar egg production but different egg weights. The highest egg fertility and the highest hatchability of goslings from fertilized eggs were characteristic of Rypinska geese. The time trends for the number of eggs per goose were positive, and in Suwalska geese even statistically significant (Figure 1). The trend towards egg weight was positive in Rypinska geese only (Figure 2) and remained at a similar level in the other geese of the northern variety. The time trends for egg fertility were positive in Kartuska and Suwalska geese, and negative in Rypinska geese (Figure 3). The time trends for hatchability of goslings from fertilized eggs were positive and statistically significant (Figure 4).

62

A. Mazanowski et al.

Figure 1. Time trends for number of eggs per goose; *Time trends for trait differ significantly (P 0.05)

Figure 2. Time trends for egg weight

Analysis of time trends for reproductive traits in geese

Figure 3. Time trends for fertilized eggs

Figure 4. Time trends for healthy goslings from fertilized eggs; * Time trends for trait differ significantly (P 0.05)

63

64

A. Mazanowski et al.

Table 1. Mean values (x) and standard errors of the mean (SEM) for reproductive traits in geese (1982 2000) Symbol of geese Ka Ry Su x SEM x SEM x SEM Number of eggs per goose 25.0 b 0.02 25.0 b 0.06 31.0 a 0.08 Egg weight (g) 169.4 a 2.18 166.1 b 2.21 171.3 a 2.83 Fertilized eggs (%) 67.8 b 3.13 68.8 a 2.41 64.9 c 3.83 Healthy goslings from fertilized eggs (%) 57.9 b 3.11 62.9 a 2.63 62.1 a 2.45

Mean values for traits in columns followed by different letters differ significantly (P 0.05).

Table 2. Mean values (x) and standard errors of the mean (SEM) for meat traits in 12-week-old geese (1982 1998) Traits Body weight (g) x SEM Breast bone length x (cm) SEM Thickness of breast x muscles with skin SEM and fat (cm) Proportion of meat x (%) SEM Proportion of fat x (%) SEM Ka 4885 a 7.94 16.8 b 0.04 2.3 a 0.01 31.5 a 0.01 14.6 a 0.04 Ry males 4567 b 5.81 16.7 b 0.03 2.3 a 0.01 31.9 a 0.01 14.2 a 0.04 4827 a 5.60 17.0 a 0.03 2.2 b 0.01 31.6 b 0.01 14.4 a 0.04 4197 a 3.33 15.8 b 0.01 2.1 a 0.01 32.1 b 0.01 14.2 a 0.02 Symbol of geese sex Su Ka Ry females 3911 b 3.11 15.6 b 0.01 2.1 a 0.01 32.4 a 0.01 13.9 a 0.02 4197 a 2.80 15.9 a 0.02 2.1 a. 0.01 32.0 b 0.01 14.1 a 0.03 Su

Mean values for traits in rows separately for males and females followed by different letters differ significantly (P 0.05).

Table 3. Mean values (x) and standard errors of the mean (SEM) for meat traits in 12-week-old ganders and geese (1982 1998) Traits Body weight (g) Breast bone length (cm) Thickness of breast muscles with skin and fat (cm) Proportion of meat (%) Proportion of fat (%) x SEM x SEM x SEM x SEM x SEM Ka 4541 a 3.45 16.3 a 0.02 2.2 a 0.01 31.8 b 0.67 14.4 a 1.88 Symbol of geese Ry 4239 b 2.84 16.1 b 0.01 2.2 a 0.01 32.2 a 0.74 14.0 b 2.00 Su 4512 a 2.61 16.4 a 0.02 2.2 a 0.01 31.8 b 0.57 14.3 b 2.17

Mean values for traits in rows followed by different letters differ significantly (P 0.05).

Analysis of time trends for reproductive traits in geese

Figure 5. Time trends for body weight in 12-week-old ganders and geese;

* Time trends for trait differ significantly (P 0.05)

65

66
A. Mazanowski et al.

Figure 6. Time trends for breast bone length in 12-week-old ganders and geese

Analysis of time trends for reproductive traits in geese

Figure 7. Time trends for thickness of breast muscles in 12-week-old ganders and geese * Time trends for trait differ significantly (P 0.05)

67

68
A. Mazanowski et al.

Figure 8. Time trends for meat proportion in 12-week-old ganders and geese

Analysis of time trends for reproductive traits in geese

69

Figure 9. Time trends for fat proportion in 12-week-old ganders and geese

70

A. Mazanowski et al.

Kartuska and Suwalska ganders and geese had significantly higher body weights than Rypinska ganders and geese (Table 2). The longest breastbone was characteristic of Suwalska ganders and geese. Neither breast muscle thickness with skin and subcutaneous fat, nor carcass fat percentage, differed significantly between the conservation flocks of geese. The highest percentage of meat was found in Rypinska ganders and geese, and a significantly lower percentage in Kartuska and Suwalska ganders and geese. Body weight and keel length were significantly greater in Kartuska and Suwalska than in Rypinska ganders and geese (Table 3). Breast muscle thickness was similar in all the varieties of northern geese. Meat percentage was highest in Rypinska birds of both sexes and fat percentage was highest in Kartuska geese compared to the other northern varieties of geese, which had slightly poorer muscles but were less fatty. The time trends for the body weight of 12-week-old ganders and geese, as well as those for breast muscle thickness with skin and subcutaneous fat, were negative and statistically significant (Figures 5 and 7). The time trends for keel length (Figure 6), meat percentage (Figure 8) and fat percentage (Figure 9) were positive but the values were not significant.

Discussion Suwalska geese were characterized by the greatest number of eggs per goose and the highest egg weight, while Rypinska geese had the highest percentages of fertilized eggs and hatchability of goslings from fertilized eggs, with lower values for the other reproductive traits. The lowest reproductive trait values were found in Kartuska geese. The time trends for reproductive traits were positive, while the percentage of gosling hatchability from fertilized eggs was positive and statistically significant. The increase in the time trends for egg weight was the least noticeable because during random mating, progress in reproductive traits was influenced more by egg production, egg fertility and gosling hatchability than by egg weight. It appears that the positive time trends for reproductive traits could be related to the reproduction model adopted, in which the random mating of geese gave priority to those birds producing the greatest number of offspring, which were later used in further reproduction (Mazanowski, 1984; Mazanowski, 1986; Smalec, 1991). In z another study (Kisiel and Ksia kiewicz, 2004), the weight of eggs from geese of regional northern varieties did not differ significantly and ranged from 164.8 to 172.3 g. In Rhine and Roman geese, characterized by reproductive traits similar to those of regional geese of northern varieties, a negative time trend was found over 15 years of study for the number of eggs per goose and a positive but nonsignificant time trend for the percentage of fertilized eggs and gosling hatchability from fertilized eggs. The time trends for egg weight were negative in Rhine geese and positive in Roman geese (Mazanowski et al., 1999). The direction of the

Analysis of time trends for reproductive traits in geese

71

changes found in these geese was similar to that found in the northern variety geese, but not as clear for the number of eggs per goose and hatchability of goslings from fertilized eggs. In an earlier study (Mazanowski, 1986), the number of eggs per goose was 22 for Kartuska, 24 for Rypinska and 30 for Suwalska birds. The egg weight, 150-159 g, was lower than in the present study, while egg fertility did not exceed 51%. In another study (Tilki and Inal, 2004), egg weight during the first year of egg production ranged from 144.2 to 148.5 g according to goose variety. Similar results were obtained by Smalec (1991), who analysed 8 generations of geese for the mean values of reproductive traits during the first period of egg production. These reproductive traits were lower than in our study. Mazanowski et al. (2005 a) found that Suwalska geese produced 31 eggs per layer and Kartuska geese laid 23 eggs per layer. Egg fertility was 64.8% in Kartuska and 53.8% in Suwalska geese. In the same experiment, hatchability of goslings from fertilized eggs was 86.4% in Kartuska geese and 84.4% in Suwalska geese. Due to their good muscling and high reproductive trait values, ganders of northern varieties have also been used to create utility crossbreds (Mazanowski and Kieczewski, 1999; Mazanowski and Kisiel, 2004). In Suwalska or Kartuska ganders mated to White Kouda and Cuban crossbreds, egg fertility was 60.8 and 55.8%, and hatchability from fertilized eggs was 76.5 and 75.5%, respectively. Suwalska or Kartuska and White Kouda crossbred ganders mated to White Kouda and Cuban crossbred geese gave offspring of both sexes weighing 5118 5124 g at 12 weeks of age, which is higher than for Suwalska or Kartuska geese. Kartuska and Suwalska geese were characterized by very good egg production (46 and 58 eggs per layer) and high egg weight (177 g), while Kartuska birds of both sexes were also characterized by a significantly higher body weight than the other birds. Kartuska and Suwalska ganders and geese had higher body weight and longer breastbone than Rypinska geese, but they did not differ in the thickness of breast muscles with skin and fat. Carcass meat percentage was the highest in Rypinska geese and carcass fat percentage in Kartuska geese. The increase in time trends for the number of eggs per goose and the statistically significant increase in the time trends for gosling hatchability from fertilized eggs, as well as the increased percentage of fertilized eggs, could have a negative effect on the body weight of ganders and geese. With the increased time trends for reproductive traits and significantly declining time trends for the body weight of birds, positive time trends were found for keel length in geese of all the northern varieties. Keel length increases as a result of improving reproductive traits and is usually connected with a decrease in fatness and an increase in muscling (Cheng et al., 2003; Romanov, 1999; Schneider, 1987). Breast muscle thickness did not differ between the goose varieties. The time trends for the breast muscle thickness of ganders and geese were negative and statistically significant. This may be evidence of the negative effect the assumed mating scheme had on breast muscle thickness with skin and subcutaneous fat, both in ganders and

72

A. Mazanowski et al.

in geese. The small and positive time trends for carcass fat percentage were similar and statistically non-significant throughout the study. The time trends for carcass meat percentage were non-significant but assumed higher positive values than the time trends for carcass fat percentage in 12-week-old ganders and geese. The above findings suggest that the negative trends for breast muscle thickness with skin and fat were related more to decreased thickness of skin with fat than to the thickness of breast muscles. The reproductive trait values increased as a result of the reproductive use of ganders and geese obtained from random mating, which led to decreased body weight, increased breastbone length and increased carcass meat percentage in 12-week-old ganders and geese, and carcass fatness being maintained at a similar level throughout the study (Schneider, 1987). The latter fact is connected with a significant decrease in the time trends for breast muscle thickness with skin and fat. Analysis of the time trends for reproductive and meat traits in Rhine geese selected for body weight, increased meatiness and decreased carcass fatness showed a favourable effect of selection on the positive time trends for breastbone length and meat percentage and on the negative time trends for carcass fat percentage. In 12-week-old Roman ganders and geese, which, just like the geese from the conservation flocks, were randomly mated, positive time trends were found for keel length and meat percentage. There were also favourable negative time trends for carcass fat percentage (Mazanowski et. al., 2000). Kosowicz and Kukieka (1958) were the first to evaluate the meat traits of northern varieties of geese. The body weight of 22-week-old geese was 4700 g for Suwalska, 4563 g for Rypinska and 4872 g for Kartuska birds. During oat fattening the geese of northern varieties had weight gains of 815 1146 g. Their carcasses were very well muscled (43.7%), with only 22.5% fat in the carcasses. In another study, 12-week-old ganders and geese weighed 4475 g (Suwalska), 4211 g (Rypins ka) and 4450 g (Kartuska). Breastbone length ranged from 15.4 to 15.7 cm and breast muscle thickness with skin and fat was 2.3 cm (Mazanowski, 1986). In a study by Smalec (1991), body weights were 4780 g for Suwalska, 4472 g for Rypinska, and 4700 g for Kartuska geese. The muscling of northern variety geese was good and carcass fatness low. The values of meat traits were similar to those obtained in our study. Meanwhile, the body weight of 12-week-old four-way crossbreds with wild greylag geese averages 4354 g, and breastbone length is 16.8 cm (Mazanowski et al., 2005 b). In geese of northern varieties, randomly mated in 1982 2000, positive time trends were found for the number of eggs per goose as well as significant and positive time trends for the percentage of gosling hatchability from fertilized eggs. The time trends for egg weight and egg fertility were mostly positive. The effect of the increasing reproductive trait values was reflected primarily in positive time trends for breastbone length and meat percentage. The time trends for fat percentage were similar throughout the study period. There was a statistically significant decrease in the time trends for body weight and breast muscle thickness with skin and subcutaneous fat. Random mating of the geese increased the

Analysis of time trends for reproductive traits in geese

73

reproductive trait values, decreased body weight and breast muscle thickness, and increased breastbone length and carcass meat percentage.

References B o c h n o R., L e w c z u k A., W a w r o E., W a w r o K. (1981). Badania nad opracowaniem rownan regresji wielokrotnej przydatnych do szacowania zawartosci miesa, tuszczu i kosci w tuszkach gesi. Rocz. Nauk. Zoot., 8, 2: 33 44. C h e n g Y.S., R o u v i e r R., H u Y.H., T a i J.J.L., T a i C. (2003). Breeding and genetics of waterfowl. Worlds Poultry Sci. J., 59, 4: 509 519. FAO (2000). World Watch List for Domestic Animal Diversity. 3rd edition. FAO, UNDP, pp. 350 352. z K i s i e l T., K s i a k i e w i c z J. (2004). Physical traits and hatching results of eggs from geese of polish regional varieties. Ann. Anim. Sci., 4, 1: 33 42. K o s o w i c z W., K u k i e k a E. (1958). Charakterystyka wartosci uzytkowych odmian gesi krajowej. Rocz. Nauk Roln., 72-B-4: 615 643. M a z a n o w s k i A. (1984). Metody zachowania rezerw genetycznych ptactwa wodnego. Biul. Inf. IZ, 22, 3: 14 23. M a z a n o w s k i A. (1986). Rezerwa genetyczna gesi w Polsce. Mat. konf.: Hodowla, chow i patologia gesi. IZ, Krakow, pp. 15 29. M a z a n o w s k i A., K i e c z e w s k i K. (1999). Wyniki reprodukcji gesi ze stad rezerwy genetycznej i gesi biaych koudzkich w dwoch okresach niesnosci. Rocz. Nauk. Zoot., 26, 1: 55 72. M a z a n o w s k i A., K i s i e l T. (2004). Cechy reprodukcyjne i miesne gesi wybranych stad zachowawczych. Rocz. Nauk. Zoot., 31, 1: 21 38. M a z a n o w s k i A., K o k o s z y n s k i D., S z u k a l s k i G. (1999). Analiza trendow czasowych cech reprodukcyjnych w stadach rezerwy genetycznej gesi zagranicznych. BTN Bydgoszcz, Pr. Wydz. Nauk Przyrod., 45: 19 28. M a z a n o w s k i A., K o k o s z y n s k i D., S z u k a l s k i G. (2000). Analiza trendow czasowych cech miesnych w stadach rezerwy genetycznej gesi zagranicznych. Zesz. Nauk. AT-R Bydgoszcz, Zoot., 227, 32: 61 74. M a z a n o w s k i A., K i s i e l T., A d a m s k i M. (2005 a). Evaluation of some regional varieties of geese for reproductive traits, egg structure and egg chemical composition. Ann. Anim. Sci., 5, 1: 67 83. M a z a n o w s k i A., B e r n a c k i Z., K i s i e l T. (2005 b). Meat traits and meat chemical composition in hybrids of Graylag (Anser anser L.) with White Kouda and Slovakian geese. Anim. Sci. Pap. Rep., 23, 1: 15 32. R o m a n o v M.N. (1999). Goose production efficiency as influenced by genotype, nutrition and production systems. Worlds Poultry Sci. J., 55, 3: 281 294. S c h n e i d e r K.H. (1987). Erhhung der Legeleistung bei Gnsen durch eine effektive Selektion auf Eizahl. Tierzucht, 41, 9: 416 418. S m a l e c E. (1991). Zroznicowanie gesi rezerwy genetycznej pod wzgledem cech uzytkowych i polimorfizmu biaek surowicy krwi. Zesz. Nauk. Drob., 3: 6 87. T i l k i M., I n a l S. (2004). Quality traits of geese eggs: 2. Effects of goose origin and storage time of eggs. Arch. Geflgelk., 68, 5: 230 234. W a w r o E., B o c h n o R., W a w r o K., J a n i s z e w s k a M. (1985). Zastosowanie rownan regresji wielokrotnej do oceny umiesnienia i otuszczenia gesi Woskich, Kubanskich i mieszancow tych ras. Pr. Mat. Zoot., 36: 77 88.

Accepted for printing 9 V 2006

74

A. Mazanowski et al. ADAM MAZANOWSKI, ZENON BERNACKI, MAREK ADAMSKI, TOMASZ KISIEL

Analiza trendow czasowych cech reprodukcyjnych i miesnych w rozmnazanych losowo stadach zachowawczych gesi odmian ponocnych STRESZCZENIE Celem pracy bya analiza trendow czasowych cech reprodukcyjnych i miesnych w kojarzonych losowo stadach zachowawczych gesi odmian ponocnych kartuskich (Ka), rypinskich (Ry) i suwalskich cych sie w badanym okresie cech reprodukcyjnych na cechy (Su) oraz ocena oddziaywania zwiekszaja miesne potomstwa. Gesi suwalskie cechowaa najwieksza liczba jaj od 1 gesi (31 sztuk) i najwieksza masa jaja (171,3 g) w porownaniu z gesiami kartuskimi i rypinskimi. Najwieksze zapodnienie jaj t (68,8%) i najwiekszy procent wylegu piskla z jaj zapodnionych (62,9%) miay gesi rypinskie. Gesi kartuskie i suwalskie obojga pci miay wieksza mase ciaa (4541 i 4512 g) oraz duzszy mostek (16,3 i 16,4 cm) niz rypinskie (16,1 cm). Grubosc miesni piersiowych bya podobna u gesi ze wszystkich odmian ponocnych (2,2 cm). Procentowy udzia miesa by najwiekszy u gesi rypinskich (32,2%), a procentowy udzia tuszczu u gesi kartuskich (14,4%), w porownaniu z pozostaymi odmianami gesi ponocnych, ktore byy gorzej umiesnione (31,8%), ale rownoczesnie mniej otuszczone (14,0 do 14,3%). t Trendy czasowe liczby jaj od 1 gesi byy dodatnie, a trendy czasowe procentow wylegu piskla z jaj zapodnionych dodatnie i statystycznie istotne. Trendy czasowe masy jaj i zapodnienia jaj byy w wiekszosci przypadkow dodatnie. Wpyw zwiekszania wartosci cech reprodukcyjnych zaznaczy sie przede wszystkim w dodatnich trendach czasowych dugosci mostka oraz w procentowym udziale miesa. Trendy czasowe procentowego udziau tuszczu byy podobne w caym okresie badan. W tym czasie stwierdzono tez statystycznie istotne zmniejszenie masy ciaa i grubosci miesni piersiowych. Kojarzenie losowe gesi spowodowao zwiekszenie wartosci cech reprodukcyjnych, a zmniejszenie masy ciaa i grubosci miesni piersiowych oraz zwiekszenie dugosci mostka i procentowego udziau miesa w tuszce.

Ann. Anim. Sci., Vol. 6, No. 1 (2006) 75 85

LEVEL AND DURATION OF PERSISTENCE OF ANTIBODIES IN THE BLOOD SERUM OF NATIVE VARIETIES OF GEESE AFTER VACCINATION AGAINST DERZSYS DISEASE

A d a m M a z a n o w s k i 1,3 E l z b i e t a S a m o r e k - S a l a m o n o w i c z 2, M a r i u s z U r b a n o w s k i3
1

Waterfowl Genetic Resources Station Dworzyska, National Research Institute of Animal Production, 62-035 Kornik, Poland 2 Laboratory for Diagnosis of Poultry Viral Diseases, National Veterinary Research Institute, Partyzantow 57, 24-100 Puawy, Poland 3 Department of Poultry Breeding, University of Technology and Agriculture, Mazowiecka 28, 85-084 Bydgoszcz, Poland

Abstract The antibody level and duration of persistence were determined after vaccination against Derzsys disease in native varieties of geese compared to White Kouda geese. Lubelska (Lu), Kielecka (Ki) and Podkarpacka (Pd) southern varieties and Kartuska (Ka), Rypin ska (Ry) and Suwalska (Su) northern varieties of ganders and geese were investigated. White Kouda (WK) geese were the control group. Each group included 45 ganders and 45 geese during rearing and 12 ganders and 24 geese during reproduction. The geese were immunized using a Palmivax vaccine (Merial). The first vaccination was performed in 4-week-old geese of both sexes and the second in adult birds before they went into egg production. Blood was drawn five times from 8 ganders and 8 geese of each group to determine antibody levels using the ELISA test. The level of maternal antibodies was determined in day-old goslings (0.153), four weeks after the first vaccination (0.247), on the day of the second vaccination (0.272), four weeks after the second vaccination (0.398) and during the final period of reproduction (0.226). The level of antibodies against Derzsys disease throughout reproduction was higher in geese (0.270) than in ganders (0.248) and was the highest in all the groups of geese four weeks after the second vaccination. Lubelska (0.320) and Kielecka (0.284) geese of both sexes had the highest level of post-vaccination antibodies compared to the geese of other varieties at four weeks after the first and second vaccinations. Towards the end of reproduction, the level of antibodies decreased in all the groups of native goose varieties to the level of maternal antibodies on the first day of goslings life. In White Kouda geese, the high level of antibodies persisted until the end of reproduction. The immune response of geese following vaccination against Derzsys disease, expressed as the level of antibodies, was found to vary according to the origin of the birds.

Key words: goose, conservation flocks, Derzsys disease, seroconversion after vaccination, antibodies

76

A. Mazanowski et al.

Derzsys disease, found in geese and Muscovy ducks, is one of the most dangerous of contagious diseases. It is caused by a parvovirus known as the Derzsys disease virus or goose parvovirus (Kisary, 1993). Transmission among goslings is horizontal via the digestive tract, while vertical infections are negligible (Derzsy, 1967; Kisary, 1993). The virus replicates in the intestines, and the target organs are the liver and heart, as well as the kidneys, thymus and pancreas (Derzsy, 1967; Kisary, 1986). Infected birds excrete a large number of molecules of the contagious virus, which spread in the environment. The incidence, clinical symptoms and mortality depend on the age and immune status of goslings. Goose parvovirus (GPV) is resistant to physical and chemical agents (Kisary, 1993), which makes Derzsys disease control on goose farms a challenge that requires concerted action aimed at eliminating the virus from the environment as well as preventing birds from contracting the infection, using vaccinations. The vaccine given to laying geese produces the antibodies, which are later transmitted to the progeny through the egg (Kisary, 1977; Kisary et al., 1978; SamorekSalamonowicz et al., 1989 b). Maternal antibodies protect goslings from infection during the time when they are most vulnerable, i.e. the first weeks of life (Kisary, 1986; Samorek-Salamonowicz, 1989 a). Despite the introduction of mass vaccinations, Derzsys disease continues to account for 15 20% of the mortality of geese and Muscovy ducks (Gough, 1997; Samorek-Salamonowicz et al., 1998). Analysis of disease cases has shown that the disease mostly affects goslings hatched towards the end of reproduction, at a time when inadequate maternal antibody titre is found (Samorek-Salamonowicz et al., 1989 b). In addition to White Kouda geese produced as a result of long-term selection, characterized by high reproductive and meat trait values and thus suitable for intensive breeding there are less productive native varieties of geese in Poland that are suited to extensive breeding in small farms (Smalec, 1991). These birds are resistant to harsh environmental conditions and poor nutrition. There are no data on the resistance of native geese to the disease or on the induction of immune processes. It is not entirely known whether the number of maternal antibodies and post-vaccination immunity are the same in native geese and high-producing geese (Samorek-Salamonowicz et al., 1997). Neither is it known whether the immunity against Derzsys disease in unselected geese of native varieties is the same as in White Kouda geese, which have been selected over many generations for their productive traits. The aim of the study was to determine the level and duration of persistence of serum antibodies after vaccination against Derzsys disease in six varieties of native geese and in White Kouda geese, during rearing and reproduction.

Material and methods The study was carried out at the Waterfowl Genetic Resources Station Dworzyska, belonging to the National Research Institute of Animal Production. Lubelska (Lu),

Level of antibodies in geese vaccinated against Derzsys disease

77

Kielecka (Ki) and Podkarpacka (Pd) southern varieties and Kartuska (Ka), Rypinska (Ry) and Suwalska (Su) northern varieties of ganders and geese were investigated. White Kouda (WK) geese were the control group. Each group included 45 ganders and 45 geese during the 28-week rearing period and 12 ganders and 24 geese during the reproductive period. The environmental and feeding conditions were identical for all the geese. The birds were clinically healthy. Additional parasitological tests conducted prior to vaccination and at the start and peak of lay were negative. The geese were immunized against Derzsys disease using a Palmivax vaccine (Merial, France), that is a lyophilized live vaccine for geese and Muscovy ducks. The vaccine contained the Hoekstra strain of the DDV virus and was administered intramuscularly, according to the manufacturers instructions, at a dose of 102.5 TCID50, 0.5 ml per bird. Geese were vaccinated twice under the programme. The first vaccination was performed in 4-week-old geese of both sexes, following the disappearance of maternal antibodies, and the second in adult birds before they went into egg production. Blood was collected randomly from 8 ganders and 8 geese of each native variety to determine antibody levels against Derzsys disease using the ELISA test. In order to allow comparison with the experimental geese, the serum level of antibodies was also examined in White Kouda geese. Blood was taken from the geese five times to determine the level of antibodies against Derzsys disease. The proportion of maternal antibodies was determined in day-old goslings, four weeks post-vaccination, on the day of the second vaccination, four weeks after the second vaccination, and towards the end of reproduction. Prior to blood sampling, food was withheld from geese for 12 hours. Blood was taken from the wing vein (Vena ulnaris cutanea). The ELISA test was performed according to the method of Samorek-Salamonowicz and Czekaj (1995). Nunclon polystyrene dishes were coated with an antigen made from the B-38 strain. Control and test sera were diluted at 1/100. Rabbit immunoglobulin against goose IgG, labelled with horseradish peroxidase, was used as the conjugate, with ABTS (Sigma) serving as a substrate. The results of colour reactions were read in a spectrophotometer at a wavelength of 405 m. Positive samples were those in which the mean value of optical density (OD), which determines the level of antibodies, exceeded 0.200. Samples with OD ranging from 0.150 to 0.200 were considered doubtful, and those with OD below 0.150 were considered negative (Samorek-Salamonowicz and Czekaj, 1995). For geese of native varieties and White Kouda geese, mean antibody levels (OD) against Derzsys disease were calculated on each serum collection day and for the whole study period. Time trends were also calculated for the level of antibodies in native geese (southern and northern variety) of both sexes and in White Kouda geese, taking into account dates of serum evaluation. The time trends were plotted using a linear regression equation y = a + bx, where a is the value of the analysed trait on test dates, b is the directional coefficient expressing the increment in the value of the trait on test dates, and x is the time expressed as the test dates. The time trends made it possible to interpret and compare antibody levels (OD) on serum test dates.

78

A. Mazanowski et al.

The results were analysed statistically (mean values of traits, standard errors of the mean, analysis of variance, time trends of traits) using a statistical package. Two-way analysis of variance was used in the calculations. The significance of differences was verified using Duncans test.

Results In day-old goslings, the mean antibody level, expressed in OD units, was negative (0.153). The highest antibody level was found in Kartuska (0.184) and Rypinska goslings (0.182). Four weeks after the first vaccination, the serum antibody level was positive (0.247) except in Rypinska and White Kouda goslings. On the day of the second vaccination, the antibody level in all the goose groups was positive and averaged 0.272 (Table 1). Four weeks after the second vaccination, the antibody level (0.398) was the highest in the whole study period, and the difference was statistically significant. At this time, a statistically significantly higher antibody level was found in Lubelska and Kielecka geese. Towards the end of reproduction, the level of antibodies declined dramatically in all the native varieties of geese. White Kouda geese represented an exception, as in these birds the antibody level was significantly higher than in other birds (0.340 in ganders and 0.353 in geese). The time trends for the antibody level in southern variety geese of both sexes were positive (Figure 1). The highest antibody level was found four weeks after the second vaccination, and the lowest on the first day of life and towards the end of reproduction. The time trends for the antibody level in northern variety geese of both sexes showed a slight increase, especially in Kartuska geese (Figure 2). Four weeks after the second vaccination, a statistically significantly higher level of antibodies was found in these geese. Towards the end of reproduction, the level of antibodies decreased markedly. In White Kouda geese, the time trend for the antibody level showed a statistically significant increase throughout the study (Figure 3). This increase became noticeable at the second vaccination (9 February 2000) and persisted until the end of reproduction (25 May 2000). The mean levels of antibodies against Derzsys disease in the serum of ganders and geese during the entire study period are given in Table 2. The highest level of antibodies was found in Lubelska (0.320) and Kielecka ganders and geese (0.284), as well as in White Kouda geese (0.273). The mean antibody levels during the entire study period were positive in native variety and White Kouda geese. The standard errors of the antibody level were low in the geese of all native varieties and in White Kouda geese.

Level of antibodies in geese vaccinated against Derzsys disease

79

tab. 1

80

Figure 1. Time trends of antibodies after vaccination against Derzsys disease in ganders and geese of southern varieties Lubelska (Lu), Kielecka (Ki) and Podkarpacka (Pd) on serum collection days. Mean values for traits followed by different letters differ significantly (P =0.05). Date of test given in Table 1.

A. Mazanowski et al.

Figure 2. Time trends of antibodies after vaccination against Derzsys disease in ganders and geese of northern varieties Kartuska (Ka), Rypinska (Ry) and Suwalska (Su) on serum collection days. Mean values for traits followed by different letters differ significantly (P 0.05). Date of test given in Table 1.

Level of antibodies in geese vaccinated against Derzsys disease

81

Figure 3. Time trends of antibodies after vaccination against Derzsys disease in ganders and geese of White Kouda (WK) variety on serum collection days. Mean values for trait followed by different letters differ significantly (P 0.05). * Time trends for traits differ significantly (P 0.05). Date of test given in Table 1.

Table 2. Mean values (x) and standard errors of the mean (SEM) for level of antibodies (OD) against Derzsys disease in blood serum of ganders and geese throughout the research period Symbol of conservation flock Lu Ki Pd Ka Ry Su BK x SEM Sex of geese

0.316 0.254 0.222 0.210 0.230 0.226 0.280 0.248 0.006 a bc c d bcd bcd b

0.324 0.314 0.257 0.242 0.241 0.247 0.266 0.270 0.006 a b c c c c bc

0.320 0.284 0.239 0.226 0.235 0.236 0.273 0.259 0.04 a b cd d c cd bc

Mean values for traits in columns followed by different letters differ significantly (P 0.05).

Discussion The immune processes taking place in geese have received little study. It is unknown whether unselected native geese are characterized by the same immunity to disease and immune process dynamics after vaccination (Samorek-Salamonowicz et al., 1997) as White Kouda geese that have been immunized against Derzsys disease. The level of antibodies produced after vaccination was determined using the immunoenzymatic ELISA test, which proved highly useful for the diagnosis of Derzsys disease, and produced results that showed high conformity with the results obtained using other tests (Kardi and Szegletes, 1996; SamorekSalamonowicz and Czekaj, 1995).

82

A. Mazanowski et al.

In day-old goslings, the level of antibodies was low, although statistically significant differences were found between goose varieties. The highest level of antibodies was found in day-old Kartuska and Rypinska goslings. Goslings acquire immune activity with age. Based on their own research, Kisary et al. (1978) suggest that until the end of the first month of life, the immune system of goslings is not mature, and their blood contains antibody inhibitors. Therefore, in this experiment we vaccinated 4-week-old goslings in accordance with the current immune prophylaxis calendar. Vaccination against Derzsys disease generated antibodies, the levels of which after the first vaccination were the highest in Lubelska and Kielecka ganders and geese, and the lowest in Podkarpacka, Kartuska and Rypinska geese. In White Kouda geese, the level of antibodies (OD) was only 0.189 and in practical terms can be regarded as negative. This level was similar in ganders (0.194). The reason for the slower immunization of White Kouda geese, although non-significantly different from that of ganders and geese of some native varieties, is obscure, because feeding and rearing conditions were the same for all the geese of native varieties and White Kouda geese. The geese were clinically healthy and their rearing followed a normal course. Nevertheless, vaccination of White Kouda geese evoked a weaker immune response. The first vaccination in 4-week-old geese and the second vaccination before the start of lay provide the progeny with antibodies that protect them for two thirds of, or even the entire, reproductive period (Kisary, 1986; Samorek-Salamonowicz et al., 1989 a). This only concerns White Kouda geese, in which the level of antibodies rises slowly, but unlike the antibody level in native variety geese, is still high (0.353) by the end of reproduction. On the day of the second vaccination against Derzsys disease, there was a marked drop in the level of antibodies in Lubelska and Kielecka geese and a smaller decline in Kartuska and Suwalska geese, compared to the antibody level four weeks after the first vaccination. In Podkarpacka, Rypinska and White Kouda geese, the level of antibodies increased. Overall, the level of antibodies on the day of the second vaccination was significantly higher in all the geese together compared to the antibody level four weeks after the first vaccination. In White Kouda geese, there was a marked increase in antibody titre on the day of the second vaccination, compared to the previous test. It is likely that the spread of the vaccine virus after the first vaccination against Derzsys disease caused an immune reaction and had an effect on the production of antibodies for a long time. Four weeks after the second vaccination, in a similar way to after the first, antibody levels were the highest in Lubelska and Kielecka ganders and geese. In the other native varieties, the antibody level ranged from 0.242 to 0.346 in ganders and from 0.312 to 0.381 in geese. These values, found in laying geese, guarantee that specific antibodies will be transmitted through the egg to the progeny. These antibodies will be sufficient to protect goslings from Derzsys disease during the first weeks of life.

Level of antibodies in geese vaccinated against Derzsys disease

83

At the end of the reproductive period, there was a marked decline in the level of antibodies in native variety geese. Antibody levels ranged from 0.174 in Kartuska ganders to 0.273 in Lubelska ganders, and from 0.169 in Lubelska geese to 0.242 in Suwalska geese. The level of antibodies was significantly high only in White Kouda geese of both sexes. In these geese, the level of antibodies increased gradually until the end of reproduction. The results obtained by other authors (Kisary et al., 1978; Samorek-Salamonowicz et al., 1989 a, b; 1997) indicate a decrease in the antibody titre of geese during the final period of reproduction. Therefore, the maintenance of, and even the increase in, the level of antibodies in White Kouda geese towards the end of reproduction requires further study. The level of serum antibodies against Derzsys disease in southern and northern variety ganders and geese were also presented as time trends. The time trend for the serum level of antibodies in Lubelska geese achieved a significantly higher value four weeks after the second vaccination, then diminished to a low value during reproduction, similar to the value found on the first day of life. The same types of changes were also found in Kielecka geese. In Podkarpacka geese of both sexes, the significantly higher time trends were found for the level of antibodies on the day of the second vaccination and four weeks after the second vaccination. In northern variety geese, the antibody level did not show such a clear positive time trend as in southern variety geese. For this reason, the decrease in the level of antibodies against Derzsys disease in northern variety geese was not as large at the end of reproduction as in the blood serum of southern variety geese, in which the level of antibodies increased rapidly four weeks after the second vaccination and decreased rapidly during reproduction. In Kartuska and Rypinska geese, no clear increase in the time trend for the level of antibodies against Derzsys disease was found four weeks after the second vaccination or during the final period of reproduction. This trend appeared only in Suwalska geese. The time trend for the level of antibodies against Derzsys disease in White Kouda geese increased from the first collection of blood from day-old goslings to the fourth collection, which was performed four weeks after the second vaccination. Towards the end of reproduction, the level of antibodies in White Kouda geese did not fall. The level of antibodies against Derzsys disease, calculated separately for ganders and geese of native southern and northern varieties and for White Kouda geese during the whole study period, was the highest in Lubelska and Kielecka geese, and the lowest in Kartuska geese. Standard errors of the mean for the antibody level were low. Foreign references reveal no studies on the immune response after vaccination against Derzsys disease in geese of different origin. Polish studies (Samorek-Salamonowicz et al., 1997) have compared the immune response of White Kouda and greylag geese and their reciprocal crosses after two-time vaccination against Derzsys disease. The highest antibody titres were found in greylag geese and White Kouda ganders crossed with greylag geese, which proved the most immunocompetent.

84

A. Mazanowski et al.

During the entire study period it was shown that the level of antibodies against Derzsys disease was slightly higher in geese than in ganders. In native geese of southern and northern varieties and in White Kouda geese, the antibody levels were the highest four weeks after the second vaccination. In southern variety Lubelska and Kielecka geese, compared to the other varieties of geese, the highest level of post-vaccination antibodies was found four weeks after the first and second vaccination. In the final period of reproduction, the level of antibodies decreased markedly in all the groups of native variety geese and was similar to or lower than the level of maternal antibodies on the first day of goslings life. Only in White Kouda geese was the level of antibodies against Derzsys disease similar four weeks after the second vaccination and towards the end of reproduction. The resistance of White Kouda geese against Derzsys disease increased slowly but lasted longer than in native variety geese. The highest antibody level in the whole study period was found in Lubelska, Kielecka and White Kouda ganders and geese. In summary, the intensification of the immune response in geese after vaccination against Derzsys disease, expressed as production of antibodies, varied according to the origin of the birds.

References D e r z s y D. (1967). A viral disease of goslings. Acta Vet. Hung., 17: 443 448. G o u g h R. E. (1997). Goose parvovirus infection. Diseases of Poultry X ed. Calnek B.W., MosbyWolfe, pp. 777 783. K a r d i V., S z e g l e t e s E. (1996). Use of ELISA procedures for the detection of Derzsys disease virus of geese and of antibodies produced against it. Avian Pathol., 25: 25 34. K i s a r y J. (1977). Immunological aspects of Derzsys disease in goslings. Avian Pathol., 6: 327 334. K i s a r y J., D e r z s y D., M e s z a r o s J. (1978). Attenuation of the goose parvovirus strain B. Laboratory and field trials of the attenuated mutant for vaccination against Derzsys disease. Avian Pathol., 7: 397 406. K i s a r y J. (1986). Acute virus infections of poultry. Martinus Nijhoff, Dordrecht, Netherlands, pp. 239 242. K i s a r y J. (1993). Virus infections of birds, Martinus Nijhoff, Dordrecht/Boston/Lancaster, pp. 157 162. S a m o r e k - S a l a m o n o w i c z E., C z e k a j H., T o m c z y k G. (1989 a). Ksztatowanie sie odpornosci sia cych od matek szczepionych przeciwko chorobie Derzsyego. Med. matczynej u ga t pochodza Wet., 45: 36 38. S a m o r e k - S a l a m o n o w i c z E., C z e k a j H., T o m c z y k G., M u s i a l i k M. (1989 b). Serokonwer sja po szczepieniu przeciwko chorobie Derzsyego u gesi niosek oraz ich potomstwa. Med. Wet., 45: 336 338. S a m o r e k - S a l a m o n o w i c z E., C z e k a j H. (1995). Opracowanie testow do szybkiej diagnostyki sia choroby Derzsyego u ga t. Mat. Sesji Naukowej Stan badan weterynaryjnych w swietle wynikow uzyskanych w zakonczonych projektach badawczych finansowanych przez KBN, Puawy. S a m o r e k - S a l a m o n o w i c z E., C h e m o n s k a B., K o z d r u n W., C h r z a n o w s k a M., Czekaj H. (1997). Serokonwersja po szczepieniu przeciwko chorobie Derzsyego u roznych ras gesi. Mat. II Miedzynarodowego Symp. Naukowego Aktualne problemy w rozrodzie ptakow, Wrocaw, 31: 251 253. ce S a m o r e k - S a l a m o n o w i c z E., C z e k a j H., K o z d r u n W. (1998). Choroby zakazne wystepuja u drobiu wodnego. Med. Wet., 54: 305 308.

Level of antibodies in geese vaccinated against Derzsys disease

85

S m a l e c E. (1991). Zroznicowanie gesi rezerwy genetycznej pod wzgledem cech uzytkowych i polimorfizmu biaek surowicy krwi. Zesz. Nauk. Drob., COBRD, Poznan (rozpr. hab.), 3: 5 87.

Accepted for printing 10 IV 2006

ADAM MAZANOWSKI, ELZBIETA SAMOREK-SALAMONOWICZ, MARIUSZ URBANOWSKI


Poziom i czas utrzymywania sie przeciwcia w surowicy krwi gesi odmian krajowych po szczepieniu przeciwko chorobie Derzsyego STRESZCZENIE Okreslono poziom i czas utrzymywania sie przeciwcia po szczepieniu przeciwko chorobie Derzsyego u gesi odmian krajowych, w porownaniu z gesiami biaymi koudzkimi. Materia doswiad czalny stanowiy gesiory i gesi odmian poudniowych lubelskie (Lu), kieleckie (Ki) i podkarpackie (Pd) oraz ponocnych kartuskie (Ka), rypinskie (Ry) i suwalskie (Su). Gesi biae koudzkie (BK) . tworzyy grupe kontrolna W czasie wychowu kazda grupa liczya 45 gesiorow i 45 gesi, a w okresie reprodukcji 12 gesiorow i 24 gesi. W celu uodpornienia gesi przeciwko chorobie Derzsyego zastosowano szczepionke Polmivax firmy Merial. Pierwsze szczepienie przeprowadzono u czterotygodniowych gesi obojga pci, a drugie u ptakow dorosych przed niesnoscia W celu okreslenia poziomu przeciwcia testem ELISA, pobrano . pieciokrotnie krew od 8 gesiorow i 8 gesi z kazdej grupy. Poziom przeciwcia matczynych okreslono sia u jednodniowych ga t (0.153), nastepnie w cztery tygodnie po pierwszym szczepieniu (0.247), w dniu drugiego szczepienia (0.272), w cztery tygodnie po drugim szczepieniu (0.398) i w koncowym okresie reprodukcji (0.226). Poziom przeciwcia przeciwko chorobie Derzsyego w caym okresie reprodukcji by wiekszy u gesi (0.270) niz u gesiorow (0.248) i we wszystkich grupach gesi najwiekszy w cztery tygodnie po drugim szczepieniu. Gesi obojga pci lubelskie (0.320) i kieleckie (0.284), w porownaniu z gesiami innych odmian, miay najwyzszy poziom przeciwcia poszczepiennych w cztery tygodnie po pierwszym i po drugim szczepieniu. W koncowym okresie reprodukcji poziom przeciwcia zmala we wszystkich sia grupach gesi odmian krajowych do poziomu przeciwcia matczynych w pierwszym dniu zycia ga t. Natomiast u gesi biaych koudzkich wysoki poziom przeciwcia utrzyma sie do konca reprodukcji. Stwierdzono, ze nasilenie odpowiedzi immunologicznej u gesi po szczepieniu przeciwko chorobie Derzsyego, wyrazone poziomem przeciwcia, byo rozne i zalezao od pochodzenia ptakow.

Ann. Anim. Sci., Vol. 6, No. 1 (2006) 87 99

EFFECT OF RAPESEED MEAL PROTECTED WITH CALCIUM SALTS OF FATTY ACIDS FROM LINSEED OIL ON COWS YIELD AND MILK AND BLOOD PARAMETERS
Franciszek Brzoska Department of Animal Nutrition and Feed Science, National Research Institute of Animal Production, 32-083 Balice n. Krakow, Poland Abstract The experiment involved 32 Red-and-White cows assigned equally to 4 groups, with 4 periods of 32 days each. Cows were fed on pasture and additionally received field forage, fresh brewers grains and feed mixture. The feed mixture contained 20% rapeseed meal unprotected from rumen degradation (control group) and 20, 25 or 30% rapeseed meal protected with calcium salts of fatty acids (CSFA) from linseed oil (experimental groups). This corresponded to a rapeseed meal intake of 1.56, 1.61, 1.80 and 2.15 kg/day, respectively. The amount of undegradable protein in the diets was 26, 28, 30 and 32% crude protein, respectively. Feed intake by the cows averaged 22.3 kg dry matter/day, including feed mixture intake of 7.54 kg dry matter/day. The milk yield of cows was 25.47 in the control group and 26.76, 27.72 and 26.08 kg/day in the experimental groups, respectively, and differed significantly between the groups. The amount fat and protein corrected milk (FPCM) was 25.14 in the control group and 25.80, 25.97 and 26.50 kg/day, respectively, in the experimental groups, and the difference compared to the control group was significantly higher. Feeding protected rapeseed meal increased the cows yield by 1 2.5 kg/day compared to feeding unprotected rapeseed meal. The fat and protein content of milk showed an upward tendency, but the differences were not significant. Giving protected rapeseed meal significantly increased the amount of fat and protein secreted in milk. Fat yield was 986 g/day in the control group and 982, 1120 and 1067 g/day in the experimental groups, respectively. No significant differences were found in the N fractions of milk or between groups of cows in terms of milk acidity, renneting time or density. There were no differences in plasma levels of glucose, total protein or triglycerides between cows from particular groups. Giving cows rapeseed meal protected with CSFA significantly increased blood urea levels. No significant differences were found between groups of cows in the fatty acid content of milk, including saturated and unsaturated fatty acids, or in their mutual proportions. It is concluded from the study that giving rapeseed meal protected with CSFA from linseed oil to cows with an average yield of 26 kg milk/day significantly increases their milk yield, increases daily production of fat and protein, and has no effect on other parameters of milk quality or on the overall metabolism of the cows, with an increase in the concentration of urea N in milk. Key words: protected rapeseed meal, milk yield, protein content, milk fatty acids Abbreviation key: PRSM protected rapeseed meal, Control not protected rapeseed meal, CSFA calcium salts of fatty acids, FPCM fat and protein corrected milk, CLA conjugated linoleic acid

88

F. Brzoska

In addition to soybean meal, rapeseed meal is one of the principal protein feeds used in cow nutrition in Poland. In terms of amino acid composition, the biological value of rapeseed protein does not differ significantly from the nutritive value of soybean meal. Earlier studies showed that rumen degradation of rapeseed meal is approximately 57 81% after 12 24 h of in sacco digestion (Pieszka and Brzoska, 2000). This means that over two-thirds of rapeseed meal is degraded in the rumen with less than one-third passing to the duodenum and the small intestine. Considering the high degradability of bulky feeds (including pasture forage, silage and hay), which negatively affects cows fertility (Canfield et al., 1990), in our climatic zone there is a shortage of feeds with reduced rumen degradability to formulate diets in accordance with the latest ruminant feeding requirements (Tamminga et al., 1994; INRA, 1988; NRC, 2001). There are several known methods for protecting feed protein against rumen degradation, such as the use of high temperature (Schroeder et al., 1995), formaldehyde (Subuh et al., 1996), lignosulphonates (Standford et al., 1995) and xylose (Nakamura et al., 1992). In recent years, CSFA have been used to protect oil meal protein (Rohr et al., 1993; Rossi et al., 1999). In this method, particles of high-protein feed are covered with a layer of CSFA. The fact that calcium salts melt at a higher temperature than the rumen temperature results in protein passing through the rumen without degradation by proteolytic bacteria. However, the effective protection of protein feeds requires fairly large amounts of calcium salts (200 300 g/kg feed), which reduces the overall level of protein in the feed (Pieszka and Brzoska, 2000; 2001 a). At present, CSFA are produced from vegetable oils, especially linseed oil, and enrich protein feeds in energy, including unsaturated fatty acids (Klusmayer et al., 1989), which may modify the fatty acid composition of milk. Preliminary studies on the efficiency of giving soybean meal and rapeseed meal protected with CSFA to silage-fed cows in the winter period have shown that these have a positive effect on milk yield and increase milk fat content (Pieszka and Brzoska, 2001 b). We hypothesized that giving pastured cows a feed mixture containing rapeseed meal protected with CSFA would have a stimulatory effect, leading to increased milk production and protein and fat synthesis in milk as a result of the increased supply of amino acids to the small intestine. Another hypothesis was that CSFA from linseed oil would increase the level of unsaturated fatty acids in milk. The aim of the study was to test these hypotheses.

Material and methods


Experimental design and animals

ski Experimental Station at the The study was carried out in the Grodziec Sla Lipowa farm (Silesian province), using 32 Red-and-White cows assigned equally to 4 groups (8 cows per group), with 4 periods of 32 days each. The experimental animals were chosen from a herd of 135 cows with an average yield of 6,000 7,000 kg milk. The cows were aged 5 7 years, were between their third and fifth lactations, and calved between late February and early April. The 138-day

Effect of protected rapeseed meal on cows yield and blood parameters

89

experiment began on 14 May. The cows ration contained grazed pasture grass as well as field-cultivated forage, brewers grains and feed mixture given in the cowhouse. The feed mixture was given at amounts of 0.28 kg/kg of milk obtained. The pasture forage contained mostly orchard-grass, perennial ryegrass and meadow fescue. The field forage contained a mixture of red clover and grasses. The feed mixture contained unprotected rapeseed meal (control) and rapeseed meal protected with CSFA (experimental), given at amounts of 20, 25 and 30% of the feed mixture (Table 1). Protected rapeseed meal was purchased for the experiment from the INNFOSS Company in Poznan, Poland. The grazing area was allocated every 2 days based on pasture yield, so as to ensure intake of approximately 8 10 kg dry matter during 8-hour grazing. The grazing area was surrounded by an electric fence. Cows had constant access to water. Cows received brewers grains and field forage in the afternoon, when they left the pasture. Feed mixtures were made on the farm from cereals, not protected or protected rapeseed meal, supplemented with Bovimix mineral mixture (BASF Kutno, Poland) at amounts of 1%, and administered twice a day during milking. In the cowhouse, cows were fed individually and intake of bulky feeds and feed mixture was determined.
Samples and analytical methods

Feed samples (500 g) were taken at 2-week intervals, and dried and pooled for each group and period separately. Feeds were assayed for dry matter, basic nutrients, acid detergent fibre (ADF) and neutral detergent fibre (NDF) content. The nutrient content was used to calculate the nutritive value of the feeds, using INWAR 1.3 software. Cows were milked twice a day. On the last 3 days of each experimental period, the milk yield of the cows was checked and milk samples were taken for analyses. The amount of milk drawn was checked using a Tru-Test milk meter (model FV). Milk samples were preserved with 2-bromo-2-nitro-1,3-propanediol (GROPOL) and stored frozen until further analyses. On the last day of each period, milk samples from the jugular vein were taken into heparinized tubes and centrifuged to obtain plasma. Glucose was determined in plasma samples after collection, and the other analyses in plasma were performed after thawing. The plasma was also assayed for total protein, urea and triglycerides. The basic nutrient content of the feeds was determined by way of standard procedures (AOAC, 1990) using nitrogen, fat (Bchi) and crude fibre analysers (Foss-Tecator). Feed dry matter was determined by drying at 105oC. The NDF and ADF content was determined according to Goering and van Soest (1970). Protein, fat and lactose in milk were determined using a MilkoScan FT 120 (Foss Electric), and milk pH, specific gravity and density were determined in accordance with standard PN-68/A-86112. Nitrogen fractions of milk were determined using the method of Kjeldahl according to the procedure described by Gordon and Kolan (1983). Milk fatty acids were determined as methyl esters of fatty acids using gas chromatography (GC Varian 3400 on a CP-Wax 58 column, 60 m, 0.53 mm, 1.0 micron) according to the method of Atwal et al. (1990). The acid determination method is described in detail by Brzoska (2004).

90

F. Brzoska

The levels of glucose, total protein, urea and triglycerides in plasma were determined enzymatically using diagnostic kits (Cormay Diagnostyka S.A., Lublin, Poland). FPCM yield was calculated using the formula of Subnel et al. (1994), where: FPCM = Fat and Protein Corrected Milk (kg) = [0.337 + 0.116 fat (%) + 0.06 protein (%)] milk (kg) The results were analysed statistically using analysis of variance and the new multiple range test using Statgraphics 6.0 software.

Results The unprotected rapeseed meal content of the feed mixture for the control group was 20%, which corresponded to an intake of 1.56 kg/day. The protected rapeseed meal content of the feed mixture in the experimental groups was 20, 25 and 30%, respectively (Table 1), which corresponded to an intake of 1.61, 1.80 and 2.15 kg/day, respectively (Table 2). Assuming that CSFA used to protect protein
Table 1. Composition of diets (on DM basis) Item Ingredients: meadow pasture arable land forage brewers barley grain ground wheat ground barley rapeseed meal, control rapeseed meal, protected mineral-vitamin mixture Chemical composition: crude protein crude fat NDF ADF ash Estimated RUP, NEL3: RUP (% CP) NEL (Mcal/kg) (MJ/kg) Control1 Protected RSM2 20 39.3 20.7 5.3 20.4 6.9 7.3 0.1 17.3 3.6 46.0 20.6 6.2 28.0 7.07 1.69 25 43.5 18.7 5.6 17.5 6.5 8.1 0.1 17.9 3.9 47.9 21.7 6.5 29.5 7.07 1.69 30 42.5 19.3 5.8 16.1 6.5 9.7 0.1 18.0 3.9 47.7 21.4 6.5 31.5 7.07 1.69

44.4 13.2 6.0 21.6 7.4 7.3 0.1 17.8 3.1 46.0 20.5 6.0 26.0 7.15 1.71

1 Control non protected rapeseed meal, 20% of concentrate; 2 protected rapeseed meal, 20, 25 and 30% of concentrate respectively; 3 rumen undigested protein computed from INRA (1988) tables as CP % values for diet ingredients.

Effect of protected rapeseed meal on cows yield and blood parameters

91

represented 25% of the meals, the actual protected rapeseed intake in the experimental groups was 1.21, 1.35 and 1.61 kg/day, respectively. The level of total protein in the control feed mixture was 159.4 g/kg and ranged from 152.8 to 164.6 g/kg in the experimental feed mixtures. Dry matter intake averaged 22.3 kg/day, including approximately 7.54 kg dry matter/day from feed mixtures, and did not differ significantly between the groups (Table 2). The milk yield of the cows was 25.47 kg/day in the control group and 26.85 kg/day in the experimental groups, and differed significantly between the groups (P < 0.01). The amount of FPCM was 25.14 kg in the control group and 26.76 kg in the experimental groups, and was significantly higher than in the control group (P < 0.01). The fat and protein content of milk did not differ significantly, although it showed an upward tendency. Significantly greater amounts of protected fat (P < 0.01) and protected protein (P < 0.05) were found to be secreted in the milk of cows receiving rapeseed meal. There were no significant differences in the N fraction content of milk (Table 3). Protected meal had no effect on physical traits of milk such as pH, renneting time, or density. The cows body weights varied greatly. No significant differences were found in the plasma levels of glucose, total protein, or triglycerides, with a significant increase in the urea content of blood in cows from the PRSM-30 group (P < 0.01) (Table 4).
Table 2. Milk yield, milk composition, milk physical parameters and cows body weight Item Dry matter intake (kg/day): total meadow pasture arable land forage brewers barley grain concentrate NSBM in concentrate PSBM in concentrate Body weight (kg) Milk yield (kg/day) FPCM (kg/day): fat (%) protein (%) lactose (%) fat (g/day) protein (g/day) lactose (g/day) urea Acidity (oSH) Renneting time (s) Density (g/cm3) BW change (g/day) Control1 20 23.28 9.16 4.83 1.23 8.06 1.61 521 25.47 cC 25.14 cC 3.87 b 3.35 4.88 986 cC 853 b 1243 0.038 1.59 194 1.031 + 186 534 26.76 bB 25.80 cC 3.67 b 3.35 4.92 982 cC 896 a 1317 0.036 1.59 163 1.0296 37 Protected RSM2 25 22.32 9.72 4.18 1.24 7.18 1.80 525 27.72 aA 27.97 aA 4.04 a 3.38 4.90 1120 aA 931 a 1358 0.036 1.65 148 1.0297 8 30 22.10 9.40 4.27 1.28 7.15 2.15 558 26.08 bB 26.50 bB 4.09 a 3.41 4.87 1067 bB 889 a 1270 0.039 1.58 195 1.0302 + 95 1.03 0.93 0.14 0.04 0.03 0.13 39 33 0.00 0.03 17 0.00 SEM

21.20 9.35 2.79 1.28 7.78 1.56

0.22 0.18 0.09 0.05 0.09

a, b, c values in the same rows with different letters differ significantly (P < 0.05). A, B values in the same rows with different letters differ significantly (P < 0.01). 12 for abbreviations see Table 1.

92

F. Brzoska Table 3. Milk nitrogen fractions (%) Item Control1 0.538 0.501 0.036 0.098 0.403 93.12 74.91 Protected RSM2 20 0.538 0.502 0.036 0.096 0.406 93.31 75.46 25 0.542 0.504 0.036 0.101 0.403 92.99 74.35 30 0.547 0.506 0.034 0.102 0.404 92.50 73.86 SEM 0.007 0.007 0.001 0.003 0.005 0.34 0.55

Total N True protein N NPN Whey protein N Casein N N true (% total N) N casein (% total N)

All values in the table were not significant. 12 for abbreviations see Table 1.

Table 4. Physiological parameters of cows blood plasma (mg/100 ml) Item Glucose Total protein Urea Triglycerides Control1 76.32 8.41 39.96 bB 6.92 Protected RSM2 20 74.88 8.60 38.24 bB 7.61 25 74.34 8.63 40.34 AB 7.11 30 SEM

74.70 0.08 8.48 0.11 46.05 aA 1.30 7.25 0.34

a, b values in the same rows with different letters differ significantly (P < 0.05). A, B values in the same rows with different letters differ significantly (P < 0.01). 12 for abbreviations see Table 1.

Giving the cows protected rapeseed meal significantly increased the unsaturated fatty acid (UFA) content of the milk of cows in the PRSM-25 group, including monounsaturated fatty acids (MUFA) (P < 0.01). In this group, the protected meal caused a significant improvement in the level of hypocholesterolemic fatty acids (DFA) in milk and the hypo- to hypercholesterolemic (DFA/OFA) acid ratio (P < 0.01). The conjugated linoleic acid (CLA) content remained similar across groups, with no significant differences (Table 5).
Table 5. Fatty acid content of fat milk (g/100 g) Item 1 Estimated: C8 C 10 C 12 C 14 C 16 C 16:1 C 18 Control1 2 2.10 4.09 4.47 12.59 30.94 2.14 12.20 20 3 2.08 4.01 4.26 12.68 30.92 1.91 12.73 Protected RSM2 25 4 1.80 3.20 3.43 11.31 29.63 1.96 13.40 30 5 2.01 3.59 3.84 12.41 31.36 1.80 13.72 SEM 6 0.05 0.10 0.10 0.19 0.20 0.03 0.19

aA aA abAB aA b

aAB aAB abAB bAB ab

bB bB bB abAB ab

abAB abAB aA bB a

Effect of protected rapeseed meal on cows yield and blood parameters Table 5 contd. 1 C 18:1 C 18:2 C 18:3 n-6 C 18:3 n-3 CLA C 20 C 20:4 C 20:5 EPA C 22 C 22:6 DHA Calculated: SFA UFA MUFA PUFA PUFA 6 PUFA 3 DFA OFA UFA/SFA DFA/OFA PUFA/SFA MUFA/SFA 2 26.35 b 2.57 0.19 0.51 1.61 0.15 bB 0.10 aA 0.047 a 0.067 b 0.004 66.55 33.45 28.21 4.95 2.86 0.57 45.65 54.35 0.51 0.87 0.07 0.43 3 25.98 b 2.62 0.19 0.51 1.69 0.19 aAB 0.09 abAB 0.045 ab 0.090 a 0.007 66.95 33.05 27.89 5.16 2.91 0.56 45.75 54.22 0.50 0.85 0.08 0.42 4 29.47 a 2.75 0.19 0.53 1.65 0.18 abAB 0.08 bcBC 0.038 bc 0.077 ab 0.005 64.26 36.67 31.43 5.25 3.02 0.58 50.07 49.93 0.58 0.93 0.08 0.50 5 26.12 b 2.57 0.19 0.54 1.74 0.20 aA 0.07 cC 0.037 c 0.091 a 0.007 66.84 33.17 28.01 5.15 2.84 0.58 46.89 53.11 0.50 0.89 0.08 0.42 6

93

0.41 0.03 0.00 0.01 0.04 0.00 0.00 0.001 0.002 0.000 0.50 0.47 0.43 0.06 0.03 0.01 0.49 0.49 0.01 0.02 0.00 0.01

b b

b b

a a

b b

bB aA bAB bB bAB

bB aA bAB bB bB

aA bB aA aA aA

abAB abAB bAB bAB bB

a, b, c values in the same rows with different letters differ significantly (P < 0.05). A, B, C values in the same rows with different letters differ significantly (P < 0.01). 12 for abbreviations see Table 1.

Discussion The intake of cows on pasture was 7 10 kg dry matter containing 18 24% crude protein, of which just 20% was rumen undegradable protein (McCormick et al., 1999). This could result in a deficiency of intestinally digested protein. Earlier studies in which cows were fed grass silages showed that giving soybean and rapeseed meal protected with CSFA to cows yielding an average of 26 30 kg milk/day increases their productivity by 1 2 kg, with increases in the protein and fat content of milk (Pieszka and Brzoska, 2001 b). A similar effect was obtained by giving cows protected soybean meal during the pasture period (Brzoska, 2005). The efficiency of using protected protein in cow nutrition depends on whether the requirement for intestinally digested amino acids is fulfilled. The amino acid deficit in cow nutrition increases with increasing milk yield. Schingoethe (1996) reported that cows producing more than 5 kg milk/day per 100 kg body weight respond to the intake of ruminal escape protein with a further increase in milk production. The positive effect of undegradable protein on the yield of cows has been confirmed in many studies (DePeters and Cant, 1992; Schor and Gagliostro, 2001), including

94

F. Brzoska

a study in which casein was infused into the abomasum (Whitelaw et al., 1986). In other studies, protected protein had no significant effect or did not affect the cows milk yield (Schingoethe, 1996; McCormick et al., 2001). In cow feeding standards, 28 30% crude protein is considered to be the optimal proportion of undegradable protein in the ration (NRC, 2001). Summer feeding with pasture forage causes the cows to have a relatively high intake of dry matter with a high level of protein, which is rapidly degraded in the rumen into ammonia (Horngherholt and Muller, 1998). This may lead to a deficiency of undegradable protein in early lactation. Increasing the amount of undegradable protein in feed mixtures for cows is considered important when feeding lactating cows (Santos et al., 1998). In many studies, blood meals, meat meals and feathers have been used as undegradable protein (Palmquist and Weiss, 1994). Their use in cow nutrition has been banned by law in the EU to help prevent the incidence of BSE in cattle. Fish meals (Schroeder and Gagliostro, 2000) and plant products such as maize gluten (Erdman and VanDersall, 1983), which are characterized by low rumen degradability, have also been used in cow nutrition. The search continues for efficient means of protecting plant protein against rumen degradation in our climatic zone, as an alternative to the methods currently used. The Megapro preparation, which is a rapeseed meal protected with calcium salts of palmitic acid, is available on the Polish market. Studies performed with cows yielding 32 35 kg milk/day have demonstrated a positive effect of Megapro supplementation in terms of milk yield and increased fat content, with a tendency towards higher milk protein content (Kraszewski et al., 2003). In other studies in cows with similar milk yield, which were fed maize gluten diets containing protein degraded to varying degrees in the rumen, there were no differences in cows milk yield or milk components (Erdman and VanDersall, 1983). An original method for the protection of soybean and rapeseed meal with Erafet friable fat was developed in Poland (E. Foss personal communication). This resulted in the creation of two preparations characterized by 35 40% rumen degradability of protein, known as Soyafos and Rapefos (Pieszka et al., 2000). The present results indicate that giving cows rapeseed meal protected with CSFA at rates of 20, 25 and 30% of feed mixtures increases milk production in Red-and-White cows during the pasture period by 1 2 kg/day, with a significant increase in the fat content of milk and a tendency towards higher milk protein content. This results in increased production of FPCM as calculated according to the method of Subnel et al. (1994). Giving the cows rapeseed meal protected with CSFA did not adversely affect the physical traits of milk, including milk density, pH and renneting time, indicating that the milk of these cows is suitable for processing and cheese-making. No significant differences were found in the metabolic indicators based on analysis of cows blood serum, including carbohydrates and fats. There were no significant differences in the levels of these metabolic indicators in blood and these were in accordance with the reference data for lactating cows reported by Kopocki and Winnicka (1992). In the group of experimental cows with the highest

Effect of protected rapeseed meal on cows yield and blood parameters

95

proportion of protected meal, the blood serum urea content was significantly higher than in the other groups. The urea content of blood is closely linked to the level of urea in the rumen and to the degree of protein degradation to ammonia (Davidson et al., 2003). Giving cows protected protein should reduce the level of ammonia nitrogen in the rumen and thus the level of urea in blood serum. In this study, the reaction was reverse, which is hard to justify. A possible reason is that fat protected both the protein and the non-protein part of the whole crude protein found in rapeseed meal. The non-protein part contains plant nitrogen in the form of ammonia, which may be a source of increased urea synthesis in the body. The positive effect of giving early-lactation cows feeds with reduced rumen degradability during the pasture period has been reported by several authors (Rogers et al., 1980; Schroeder and Gagliostro, 2000), although this effect did not occur in other studies (Dunlap et al., 2000; McCormick et al., 2001). Schor and Gagliostro (2001) attributed the mechanism of increased milk yield to two factors: increased dry matter intake or increased fat mobilization in cows receiving protected protein. In this study, giving protected rapeseed meal increased the intake of pasture forage and field forage, which seems to support this theory. Higher fat mobilization was not found in cows from the experimental groups, as greater body weight decreases were found in these animals during the experiment. The latter authors also reported that it is unclear how the protected protein absorbed can affect the mobilization of fat. In another study, Rossi et al. (1999) showed unprotected soybean meal to have greater intestinal digestibility than fat-protected meal. They speculated that this is because the process of digestion by proteolytic enzymes is disturbed by the presence of a fat matrix. Studies in bulls on the intestinal digestibility of ruminally undegraded soybean and rapeseed meal protected with Erafet (Pieszka and Brzoska, 2000; 2001a) showed that it is 92% and 74%, respectively, with no differences in digestibility between meals protected and not protected with fat. These findings confirm the data reported by Zebrowska et al. (1997) for unprotected rapeseed meal. Opinions vary as to the intestinal digestibility and availability of amino acids from soybean and rapeseed meal. Comparative studies performed on intestinally cannulated heifers showed that compared to soybean meal, rapeseed meal increases the flow rate of total amino acids (including sulphur amino acids) to the small intestine, and its ruminal degradation is significantly lower (Lardy et al., 1999). Protection of high-protein meals is effective when fairly large amounts of CSFA are used. A daily intake of 1 2 kg protected meal corresponds to an intake of 0.20 0.40 kg of CSFA. Salts are fairly abundant in unsaturated fatty acids, which can modify the composition of milk fatty acids. In a study on the pasture feeding of cows receiving soybean meal protected with Erafet, increased milk fat content and increased milk production in 24-h cycles were found, while the increase in the level of unsaturated fatty acids fat in the cows milk was small (Brzoska, 2005). Analysis of milk nitrogen fractions showed that the proportions of true N and casein N in milk in relation to the total N content of milk conformed with standard values for cows milk and were in keeping with the results of earlier studies performed on Red-and-White cows (Brzoska et al., 1999; Ruppert et al., 2003).

96

F. Brzoska

It was expected that giving cows protected rapeseed meal would increase the supply of amino acids to the small intestine, which would, in turn, increase the protein content of milk and its 24-h synthesis. A slight increase in the protein content of the cows milk was found in an earlier study in which pastured cows were given soybean meal protected with CSFA (Brzoska, 2005). In this study there was no increase in the protein content of milk, although there was a tendency towards higher protein levels in the milk of cows receiving protected rapeseed meal. A significantly higher 24-h protein synthesis result was obtained. This suggests a need to study the amino acid composition of rumen escape protein in protected feeds, including rapeseed meal, so as to determine the flow rate and supply of amino acids to the small intestine using cows with a daily yield of 35 40 kg milk. In terms of physical traits, which together with casein content are of great technological importance for processing milk into cheese, the milk did not differ significantly across the groups. These parameters did not differ fundamentally from the earlier results of studies of Red-and-White cows (Brzoska et al., 1999; Pieszka and Brzoska, 2000; Brzoska, 2005), indicating that the level of undegradable protein in the rumen does not affect these parameters of milk. In summary, giving pastured cows with an average yield of approximately 26.0 kg milk/day rapeseed meal protected with CSFA from linseed oil increased their yield in the pasture period by 1.0 2.0 kg/day, with a significant increase in the fat content of milk and an increase in the daily synthesis of protein and fat. It is expected that protein protected with CSFA would have a greater impact in cows with a higher milk yield and a higher requirement for amino acids. Considering the protected protein purchase price of 2.0 2.3 zloty/kg and the milk purchase price of 1.0 1.2 zloty/kg, the increase in the cows milk yield obtained was close to the limit of economic efficiency for milk production, and did not compensate for the increased feeding costs of the cows. It is expected that the results would be better directly after calving, at a milk yield exceeding 30 kg milk/day.

References AOAC (1990). Official Methods of Analysis of the Association of Official Analytical Chemists. Ed. by Kenneth Helrich, 15th Edition, Arlington, Virginia, USA. A t w a l A.S., H i d i r o g l o u M., K r a m e r J.K.G., B i n n g s M.R. (1990). Manipulation of the fatty acid composition of milk by feeding protected canola seeds. J. Dairy Sci., 75: 1090 1096. B r z o s k a F. (2004). Effect of copper inhibitors in diet on cows yield, milk composition and cholesterol level in milk and blood plasma. Ann. Anim. Sci., 4 (1): 43 55. B r z o s k a F. (2005). Effect of soybean meal protected with Ca salts of fatty acids on cows yield, protein and fat components in milk and blood. Ann. Anim. Sci., 5 (1): 111 123. s B r z o s k a F., G a i o r R., S a l a K., Z y z a k W. (1999). Effect of linseed oil fatty acid calcium salts and vitamin E on milk yield and composition. J. Anim. Feed Sci., 8: 367 378. C a n f i e l d R.W., S n i f f e n C.J., B u t l e r W.R. (1990). Effects of excess degradable protein on postpartum reproduction and energy balance in dairy cattle. J. Dairy Sci., 73: 2342 2349.

Effect of protected rapeseed meal on cows yield and blood parameters

97

D a v i d s o n S., H o p k i n s B.A., D i a z D.E., B o l t S.M., B r o w n i e C., F e l l n e r V., W h i t l o w L.W. (2003). Effects of amounts and degradability of dietary protein on lactation, nitrogen utilization, and excretion in early lactation Holstein cows. J. Dairy Sci., 86: 1681 1689. D e P e t e r s E.J., C a n t J.P. (1992). Nutritional factors influenced the nitrogen composition of bovine milk: a review. J. Dairy Sci., 75: 2043 2070. D u n l a p T.F., K o h n R.A., D o u g l a s s L.W., E r d m a n R.A. (2000). Diets deficient in rumen undegraded protein did not depress milk production. J. Dairy Sci., 83: 1806 1812. E r d m a n R.A., V a n D e r s a l l J.H. (1983). Effect of rumen degradability on milk yield of dairy cows in early lactation. J. Dairy Sci., 66: 1873 1880. G o r d o n W.G., K o l a n E.B. (1983). Protein in milk. In: Fundamentals of Dairy Chemistry. 2nd Edition. B.W. Webb, A.H. Johnson, J.A. Alford (eds). AVI Publ. Co., Inc., West Port, CT, 78 pp. H o r n g h e r h o l t D.D., M u l l e r L.D. (1998). Supplementation of rumen-undegradable protein to the diets of early lactation Holstein cows on grass pasture. J. Dairy Sci., 81: 2204 2214. INRA (1988). Ruminant Nutrition: Recommended Allowances and Feed Tables. R. Jarrige (ed.), INRA, John Libbey Eurotext, Paris. K l u s m a y e r T.H., L y n c h G.L., C l a r k J. H. (1989). Effects of source of protein and calcium salts of long chain nutrients to the small intestine of lactating dairy cows. J. Dairy Sci., 67, Suppl., 1: p. 482. K r a s z e w s k i J., W a w r z y n c z a k S., M a n d e c k a B. (2003). Ocena efektywnosci preparatu MEGAPRO w zywieniu wysoko produkcyjnych krow. Rocz. Nauk. Zoot., 30 (1): 69 77. L a r d y G.P., A d a m s D.C., K l o p f e n s t e i n T.J., C l a r k R.T. (1999). First limiting nutrient for summer calving cows grazing autumn-winter range. J. Range Management, 52 (4): 317 326. M c C o r m i c k M.E., F r e n c h D.D., B r o w n T.F., C u o m o G.J., C h a p a A.M., F e r n a d e z J.M., B e a t t y J.F., B l o u i n D.C. (1999). Crude protein and rumen undegradable protein effects on reproduction and lactation performance of Holstein cows. J. Dairy Sci., 82: 2697 2708. M c C o r m i c k M.E., W a r d J.D., R e d f e a r n D.D., F r e n c h D.D., B l o u i n D.C., C h a p a A.M., F e r n a n d e z J.M. (2001). Supplemental dietary protein for grazing dairy cows: effect on pasture intake and lactation performance. J. Dairy Sci., 84: 896 907. N a k a m u r a T., K l o p f e n s t e i n T.J., O w e n F.G., B r i t t o n R.A., G r a n t R.J., W i n o w s k i T.S. (1992). Non-enzymatically browned soybean meal for lactating dairy cows. J. Dairy Sci., 75: 3519 3523. NRC (2001). Nutrient requirements of dairy cattle. 7th ed., National Academy Press, Washington, DC. P a l m q u i s t D.L., W e i s s W.P. (1994). Blood and hydrolyzed feather meals as sources of undegradable protein in high fat diets for cows in early lactation. J. Dairy Sci., 77: 1630 1643. P i e s z k a M., B r z o s k a F. (2000). Rumen degradability and intestinal digestibility of rapeseed meal protein and dry matter protected by calcium salts of fatty acid. Ann. Anim. Sci. Rocz. Nauk. Zoot., 27 (4): 279 292. P i e s z k a M., B r z o s k a F. (2001 a). Wpyw osony biaka paszowego przed rozkadem w zwaczu przy uzyciu soli wapniowych kwasow tuszczowych na procesy trawienne w zwaczu i jelicie cienkim. Rocz. Nauk. Zoot., 28 (2): 237 249. P i e s z k a M., B r z o s k a F. (2001 b). Effect of protected rapeseed or soybean meal supplementation on milk yield and physico-chemical composition in cows fed grass silage. Ann. Anim. Sci., 1 (2): 75 87. P i e s z k a M., B r z o s k a F., S a l a K. (2000). Wpyw osaniania solami wapniowymi kwasow tuszczowych biaka pasz wysokobiakowych na jego strawnosc w zwaczu i jelicie cienkim. Rocz. Nauk. Zoot., Suppl., 6: 420 424. R o g e r s G.I., P o s t e r R.H.D., C l a r k T., S t e w a r t J.A. (1980). Effect of protected casein supplementation on pasture intake, milk yield and composition of cows in early lactation. Austr. J. Agric. Res., 31: 1147 1152. R o h r K., L e b z i e n P., D a e n i c k e R., E n g l i n g F.P. (1993). Milk yield and milk composition of high-producing cows as influenced by calcium salts of plants oil fatty acids in combination with protected protein or grain maize. J. Anim. Physiol. Anim. Nutr., 69 (5): 251 259. R o s s i F., F i o r e n t i n i L., M a s o e r o F., P i v a G. (1999). Effect of fat coating on rumen degradation and intestinal digestibility of soybean meal. Anim. Feed Sci. Techn., 81 (3/4): 309 318.

98

F. Brzoska

R u p p e r t L.D., D r a c k l e y J.K., B r e m m e r D.R., C l a r k J.H. (2003). Effect of tallow in diets based on corn silage or alfalfa silage on digestion and nutrient use by lactating dairy cows. J. Dairy Sci., 86: 593 609. S a n t o s F.A.P., S a n t o s J.E.P., T h e u r e r C.B., H u b e r J.T. (1998). Effects or rumen-undegradable protein on dairy cow performance: A 12-year literature review. J. Dairy Sci., 81: 3182 3213. S c h i n g o e t h e D.J. (1996). Dietary influence on protein level in milk and milk yield in dairy cows. Anim. Feed Sci. Techn., 60: 181 190. S c h o r A., G a g l i o s t r o G.A. (2001). Undegradable protein supplementation to early lactation dairy cows in grazing conditions. J. Dairy Sci., 84: 1507 1606. S c h r o e d e r G.F., G a g l i o s t r o G.A. (2000). Fishmeal supplementation to grazing dairy cows in early lactation. J. Dairy Sci., 83: 2899 2906. S c h r o e d e r G.F., E r a s m u s L.J., L e e u w K.J., M e i s s n e r H.H. (1995). Effects of roasting on ruminal degradation intestinal digestibility and absorbable amino acid profile of cottonseed and soybean oil cake meals. South. Afr. J. Anim. Sci., 25: 109 117. S t a n d f o r d K., M c A l l i s t e r T.A., X u Z., P i c k a r d M., C h e n g K.J. (1995). Comparison of lignosulfonate-treated canola meal and soybean meal as rumen undegradable protein supplements for lambs. Can. J. Anim. Sci., 75: 371 377. S u b n e l A.P.J., M e i j e r R.G.M., S t r a a l e n W.M. Van, T a m m i n g a S. (1994). Efficiency of milk protein production in the DVE protein evaluation system. Liv. Prod. Sci., 40: 215 224. S u b u h A.M.H., R o w a n T.G., L a w r e n c e T.L.J. (1996). Effect of heat or formaldehyde treatment on the rumen degradability and intestinal tract apparent digestibility of protein in soybean meal and in rapeseed meal of different glucosinolate content. Anim. Feed Sci. Techn., 57: 257 265. T a m m i n g a S., S t r a a l e n W.M. Van, S u b n e l A.P.J., M e i j e r R.G.M., S t e g A., W e v e r C.J.G., B l o k M.C. (1994). The Dutch protein evaluation system: The DVE/OEB system. Livest. Prod. Sci., 40: 139 155. W h i t e l a w F.G., M i l n e J.S., r s k o v E.R., S m i t h J.S. (1986). The nitrogen and energy metabolism of lactating cows given abomasal infusions of casein. Br. J. Nutr., 55: 537 556. k Z e b r o w s k a T., D u g o e c k a Z., P a j a J.J., K o r c z y n s k i M. (1997). Rumen degradability of concentrate protein, amino acids and starch, and their digestibility in the small intestine of cows. J. Anim. Sci., 6: 451 470.

Accepted for printing 28 III 2006

FRANCISZEK BRZOSKA
Wpyw sruty rzepakowej chronionej solami Ca-KT oleju lnianego na wydajnosc krow i parametry mleka oraz krwi STRESZCZENIE Doswiadczenie wykonano na 32 krowach rasy czb, podzielonych na 4 grupy w ukadzie analogowym, z czterema okresami, kazdy po 32 dni. Krowy zywiono na pastwisku, a ponadto . otrzymyway one zielonke z upraw polowych, moto browarniane swieze i mieszanke paszowa Mieszanka paszowa zawieraa srute poekstrakcyjna rzepakowa nie chroniona przed rozkadem zwaczo wym w ilosci 20% (grupa kontrolna) i srute poekstrakcyjna rzepakowa chroniona solami Ca-KT z oleju lnianego w ilosci 20, 25 i 30% mieszanki paszowej (grupy doswiadczalne). Odpowiadao to pobraniu sruty rzepakowej w ilosci 1,56 i odpowiednio 1,61; 1,80; 2,15 kg/dobe. Ilosc biaka nierozkadalnego w dietach wynosia odpowiednio 26, 28, 30 i 32% biaka ogolnego a pobranie paszy przez krowy srednio 22,3 kg s.m./dzien, w tym mieszanek paszowych 7,54 kg s.m./dzien. Wydajnosc mleczna krow

Effect of protected rapeseed meal on cows yield and blood parameters

99

wynosia w grupie kontrolnej 25,47, a w grupach doswiadczalnych odpowiednio 26,76, 27,72 i 26,08 kg/dzien i roznia sie pomiedzy grupami istotnie. Ilosc mleka skorygowanego na zawartosc biaka i tuszczu to 25,14 w grupie kontrolnej, a grupach doswiadczalnych odpowiednio 25,80, 25,97 i 26,50 kg/dzien i bya ona istotnie wyzsza. Podawanie sruty rzepakowej chronionej w porownaniu z nie chroniona zwiekszyo wydajnosc krow o 1 2,5 kg/dzien. Zawartosc tuszczu i biaka w mleku wykazaa ca tendencje rosna , lecz roznice byy statystycznie nieistotne. Podawanie sruty rzepakowej chronionej istotnie zwiekszyo ilosc tuszczu i biaka wydzielana w mlekiem. Wydajnosc tuszczu wynosia 986 g/dzien w grupie kontrolnej i odpowiednio 982, 1120 i 1067 g/dzien w grupach doswiadczalnych. Nie stwierdzono istotnych roznic w zawartosci frakcji N mleka i pomiedzy grupami krow w kwasowo sci, czasie krzepniecia i gestosci mleka. Nie zauwazono roznic w zawartosci glukozy, biaka cakowitego i trojglicerydow w osoczu krwi krow z poszczegolnych grup. Podawanie krowom sruty rzepakowej chronionej solami Ca-KT istotnie zwiekszyo w krwi zawartosc mocznika. Nie stwierdzono istotnych roznic pomiedzy grupami krow w zawartosci kwasow tuszczowych w mleku, w tym nasyconych i nienasyconych oraz ich wzajemnych proporcjach. Na podstawie wykonanych badan mozna stwierdzic, ze podawanie krowom, o przecietnej wydajnosci 26 kg mleka/dzien, sruty poekstrakcyjnej rzepakowej chronionej solami Ca-KT z oleju lnianego zwieksza wydajnosc mleczna istotnie oraz zwieksza dobowa produkcje tuszczu i biaka, natomiast nie wpywa na pozostae wskazniki jakosci mleka, a takze ogolny metabolizm krow, przy wzroscie stezenia N mocznikowego w mleku.

Ann. Anim. Sci., Vol. 6, No. 1 (2006) 101 108

EFFECT OF GLUCANASE AND XYLANASE SUPPLEMENTATION OF FEED FOR WEANED PIGLETS*

t E w a H a n c z a k o w s k a 1, J e r z y U r b a n c z y k 1, I m k e K h n 2, M a g o r z a t a S w i a k i e w i c z 1
1 Department of Animal Nutrition and Feed Science, National Research Institute of Animal Production, 32-083 Balice n. Krakow, Poland 2 AB Enzymes GmbH, D-64293 Darmstadt Felabergstrasse 78, Germany

Abstract Two experiments were conducted to estimate the effect of the preparation Econase containing beta-glucanase or xylanase on the performance of early-weaned piglets. All piglets were fed with barley, wheat and soybean diets. In experiment I, piglets (n = 146) were weaned at 28 days of age and received a basal diet (control) or a diet supplemented with beta-glucanase: group II 26000 BU and group III 39000 BU per kg of feed. Group IV received xylanase 24000 BXU. The design of experiment II was the same as experiment I but piglets were weaned at 42 days of age. Experiment I was concluded at 99 days and experiment II at 84 days of age. It was found that beta-glucanase was more efficient in younger piglets. Between 28 and 56 days of age, the weight gains of experimental animals were up to 36% higher than those of control animals. Between 56 and 70 days this difference was smaller (up to 26%). In the whole of experiment I, a lower supplement of glucanase improved weight gains by 7.2% and a higher supplement by 17%, while xylanase improved weight gains by 14%. In older piglets (experiment II), only the difference between the control and xylanase groups was statistically significant, although all the experimental animals grew faster than the control animals. Key words: piglets, beta-glucanase, xylanase

The time when piglets are weaned from a sow is always a very stressful moment. Such a change in the environment and feed requires a change in the animals ability to secrete endogenous enzymes. In order for piglets to be able to fully utilize feed postweaning it might be appropriate to supplement their diet with exogenous enzymes. An additional problem is caused by the removal of feed antibiotic, which negatively affects the health status and nutrient digestibility in piglets.

* This work was conducted as part of NRIAP statutory activity, project no. 2244.1.

102

E. Hanczakowska et al.

Non-starch polysaccharides (NSP) present in the cell walls of cereal grains are unfavourable, especially for young monogastric animals. Many experiments with NSP hydrolyzing enzyme preparations have been performed on poultry. Glucanase and/or xylanase produced good results in the nutrition of laying hens (Lazaro et al., 2003), broiler chickens (Meng et al., 2005) and turkeys (Mathlouthi et al., 2003). Fewer studies have been carried out using these preparations in pig feeding. Li et al. (1996) supplemented hulled barley- or wheat-soybean meal diets with beta-glucanase. They found higher gross energy and crude protein ileal digestibility in the case of the barley diet, but no such improvement was found when the enzyme was added to the wheat-soybean meal diet. Higher apparent ileal digestibility of amino acids in pigs fed wheat-based diets after supplementation with xylanase was also reported by Barrera et al. (2004). Omogbenigun et al. (2004) reported increased total-tract digestibility of nutrients using multienzyme preparations containing the enzymes glucanase and xylanase, among others. The objective of this experiment was to determine the effect of different doses of beta-glucanase or xylanase supplements in a barley-wheat-soybean diet on piglet performance.

Material and methods Animals and diets Experiment I. The experiment was carried out on 146 piglets originating from 16 sows (Polish Landrace Polish Large White) mated to a Duroc Pietrain boar. Before the start of the experiment, piglets were fed with a standard PP prestarter mixture with no enzyme supplement. Piglets were assigned to four groups, with 4 litters in each. Animals were fed with the same basal barley-wheat-soybean diet, differing in additives (Table 1). Group I (control) basal diet with no enzyme supplement. Group II basal diet supplemented with beta-glucanase at 26000 BU*/kg of feed. Group III basal diet supplemented with beta-glucanase at 39000 BU*/kg of feed. Group IV basal diet supplemented with xylanase at 24000 BXU*/kg of feed. Each litter was kept in a separate pen, fed ad libitum until weaning and then restricted. The experiment lasted until day 99 of age (about 32 kg of body weight) and piglets were weaned at 28 days of age. The body weight of piglets was recorded at 28, 56, 70, 84 and 99 days of age. Experiment II. The design of the experiment, feed composition and enzyme supplementation were the same as in experiment I. A total of 110 piglets of the same origin as in the former experiment were weaned at 42 days of age and kept in the experiment until 84 days of age (about 25 kg of body weight). Each feeding group comprised 3 litters. Piglets were weighed at 42, 56, 70 and 84 days of age.

* BU and BXU units of enzyme activity.

Effect of glucanase and xylanase supplementation of feed for piglets Table 1. Composition and nutritional value of the experimental feed mixture Components Barley Wheat Rapeseed meal Soybean meal Dried whey Rapeseed oil Limestone NaCl Lys Premix 0.5% Standard starter1 Dicalcium phosphate Metabolizable energy (MJ) Dry matter (%) Crude protein (%) Ether extract (%) Crude fibre (%) ADF (%) NDF (%) ADL (%) Crude ash (%) N-free extractives (%) Lys (g) Met + Cys (g) Thr (g) Trp (g) Ca (g) P (g) Content (%) 49.90 14.00 6.00 20.00 5.00 2.00 1.20 0.25 0.15 0.50 1.00 13.37 89.51 19.09 3.52 4.20 5.21 20.23 0.17 4.93 57.77 11.12 6.58 7.14 2.32 9.80 6.99

103

1 Premix composition: Vitamin: A 2700000 IU; D3 400000 IU; E 8.0 g; K3 0.5 g; B1 0.5 g; B2 0.8 g; B6 0.8 g; B12 0.008 g; pantothenic acid 2.8 g; choline cloride 70 g; folic acid 0.2 g; nicotinic acid 5.0 g; magnesium 10 g; manganese 12 g; iodine 0.1 g; zinc 30 g; iron 20g; copper 32 g; cobalt 0.06 g; selenium 0.04 g; complete limestone to 1000 g.

The feed intake of each litter was measured and feed utilization of each litter was calculated.
Chemical analysis

The gross composition of feed and its components was analysed using standard methods (AOAC, 1990). The amino acid (lysine, sulphur amino acids, tryptophan and threonine) content of the feed was analysed using a Beckmann automatic analyser. Fractions of feed fibre (ADF, NDF and ADL) were estimated according to Goering and Van Soest (1970).
Statistics

The results obtained were analysed using the one-way ANOVA procedure and the significance of differences between mean values was estimated using Duncans test (Statistica, 1995).

104

E. Hanczakowska et al.

Results
Experiment I

Piglets weaned at 28 days of age reacted positively to beta-glucanase and xylanase supplements (Table 2). Body weight gains between 28 and 56 days of age were significantly higher in the groups receiving beta-glucanase (by 20 36%) and in the group receiving xylanase (by 19%) in comparison to the control group. In the case of glucanase, these differences were smaller (13 26%) but still statistically significant in the older animals (between 56 70 days of age). During the whole
Table 2. Piglets rearing indexes (Exp. I) Supplement Item Control betabetaglucanase glucanase 26000 BU/kg 39000 BU/kg 37 9.25 3 7 35 8.75 3 9 xylanase 24000 BXU/kg 36 9.00 2 8 SEM

No. of piglets in group Average no. of piglets in litter No. of dead piglets No. of piglets with diarrhoea Average body weight of 1 piglet at days of age (kg): 28 56 70 84 99 Average daily weight gains of 1 piglet at days of age (g): 28 56 56 70 70 84 84 99 28 99 Daily feed intake per piglet at days of age (kg): 28 56 56 70 70 84 84 99 28 99 Average feed utilization per kg body weight gain at days of age (kg): 28 56 56 70 70 84 84 99 28 99

38 9.50 4 16

6.20 9.39 13.66 20.07 29.82

5.73 9.58 14.43 21.54 31.12

5.97 10.31 15.67 22.49 33.67

6.38 10.20 15.47 22.57 33.31

0.109 0.222 0.355 0.512 0.689

114 305 458 650 333

a a a a

137 346 508 639 357

ab ab a ab

155 383 487 745 390

b b b b

136 376 507 716 379

ab ab ab ab

5.69 12.52 13.45 14.73 8.84

0.260 a 0.766 1.074 1.425 0.767

0.311 ab 0.843 1.104 1.432 0.816

0.332 b 0.865 1.042 1.523 0.851

0.294 ab 0.867 1.078 1.548 0.830

0.012 0.027 0.029 0.031 0.018

2.28 2.51 2.35 2.19 2.30

2.26 2.43 2.17 2.23 2.27

2.14 2.26 2.14 2.05 2.18

2.15 2.30 2.12 2.16 2.19

0.083 0.096 0.073 0.050 0.047

a, b mean values in the same row with different letters differ significantly at P 0.05.

Effect of glucanase and xylanase supplementation of feed for piglets

105

experimental period, glucanase supplements improved weight gains by 7.2% in group II and by 17% in group III, while in the group fed xylanase mean weight gains were improved by about 14%. Feed intake in the control group was lower than that in the experimental groups during the whole experiment, but the difference between groups I and III was statistically significant only after weaning (28 56 days of age). Diarrhoea was observed in 16 piglets in the control group and in only 7 9 piglets in each experimental group.
Experiment II

Enzyme supplements improved the body weight gains of the piglets weaned at 42 days of age (Table 3). At the end of the experiment (70 84 days) piglets receiving xylanase had significantly higher weight gains (by 16.7%) than the
Table 3. Piglets rearing indexes (Exp. II) Supplement Item Control betabetaglucanase glucanase 26000 BU/kg 39000 BU/kg 26 10.75 8 28 9.5 6 xylanase 24000 BXU/kg 29 8.75 3 SEM

No. of piglets in group Average no. of piglets in litter No. of piglets with diarrhoea Average body weight of 1 piglet at days of age (kg): 42 56 70 84 Average daily weight gains of 1 piglet at days of age (g): 42 56 56 70 70 84 42 84 Daily feed intake per piglet at days of age (kg): 42 56 56 70 70 84 42 84 Average feed utilization per kg body weight gain of litter at days of age (kg) 42 56 56 70 70 84 42 84

27 10.5 18

9.67 ab 11.19 16.81 24.62

8.78 a 10.90 16.41 24.40

10.21 b 12.03 18.02 26.86

8.65 a 10.92 16.80 25.90

0.20 0.24 0.35 0.47

108 401 557 a 356 a

151 394 571 a 372 ab

130 428 631 ab 396 ab

162 420 650 b 411 b

9.63 9.85 13.38 8.66

0.260 0.868 1.350 0.826

0.347 0.801 1.318 0.822

0.310 0.865 1.357 0.856

0.313 0.780 1.274 0.789

0.05 0.04 0.07 0.04

2.39 2.16 2.42 b 2.32 b

2.29 2.03 2.31 ab 2.21 ab

2.38 2.02 2.15 ab 2.16 ab

1.93 1.86 1.96 a 1.92 a

0.04 0.03 0.05 0.06

a, b mean values in the same row with different letters differ significantly at P 0.05.

106

E. Hanczakowska et al.

control piglets and this group was the only one that significantly differed from the control group (I). Average feed conversion during the same period was 19% better in piglets fed xylanase compared with the control piglets, and this difference was also significant (P 0.05). During the whole experimental period, no piglets died or were culled (Table 3). However, some cases of diarrhoea were observed, especially in group I (18 animals) and in group II (8 animals). In groups III and IV only 6 and 3 animals were ill, respectively.

Discussion The results of both experiments suggest that the enzyme supplement produced the best results early after weaning. In the first experiment, weight gains of xylanase-supplemented piglets were 19% better than in the control group in the period 28 56 days after weaning, and only 10% better in the period 84 99 days postweaning. In the second experiment, the differences in mean weight gains between these two groups in the first period were even greater, especially in the case of piglets receiving dietary xylanase. This could be due to the increasing endogenous enzyme activity in pigs, as was suggested by Graham et al. (1988). In such a situation the addition of exogenous enzymes is less effective. It also could be due to higher feed consumption by piglets receiving enzymes. However, such early weaning was not beneficial because on day 84 of age piglets weaned on day 28 were characterized by lower individual body weight than those weaned on day 42. A positive effect of enzyme preparations in young (25-day-old) piglet feeding was found by Omogbenigun et al. (2004), but in their experiment all piglets were weaned earlier and the effect of enzyme supplementation in animals weaned later was not stated. The authors concluded that the use of enzyme additives may allow for more cost-effective and environmentally friendly formulation of diets for young pigs. A similar improvement in the weight gains of pigs after supplementing feed with beta-glucanase and xylanase was found in an earlier experiment by Bedford et al. (1992). According to Mathlouthi et al. (2002) beta-glucanase and xylanase reduce the viscosity of feedstuffs. Lower viscosity may result in better feed digestibility and higher weight gains by piglets. It is possible that enzyme supplementation also had this effect in the present experiment. A reduction in the intestinal viscosity of cereal-based feeds, especially those based on barley, and an increase in apparent nutrient digestibility after supplementing feed with betaglucanase and xylanase, were found by Lazaro et al. (2003) in an experiment with laying hens. The higher weight gains of piglets receiving beta-glucanase or xylanase could also be a result of improved protein digestibility (Barrera et al., 2004) and/or other nutrient digestibility (Diebold et al., 2004). The fact that the control group contained the highest number of piglets suffering from diarrhoea could result from the antibiotic-free diet and lower availability of nutrients for animals with no enzyme supplementation.

Effect of glucanase and xylanase supplementation of feed for piglets

107

In the present experiment the preparation was more effective when a higher dose of glucanase was added. This is in accordance with the findings of Lazaro et al. (2003) who found in the above-mentioned experiment that an excess of enzymes had no deleterious effect. In summary, it is concluded that preparations containing beta-glucanase or xylanase added to feed containing wheat and barley improve the weight gains and feed conversion of weaned piglets, especially early after weaning.

References AOAC. (1990). Official Methods of Analysis. Association of Official Analytical Chemists, 15th Ed., Arlington, Virginia, USA. B a r r e r a M., C e r v a n t e s M., S a u e r W.C., A r a i z a A.B., T o r r e n t e r a R., C e r v a n t e s M. (2004). Ileal amino acid digestibility and performance of growing pigs fed wheat-based diets supplemented with xylanase. J. Anim. Sci., 82: 1997 2003. B e d f o r d M., P a t i e n c e J.F., C l a s s e n H.L., I n b o r r J. (1992). The effect of dietary supplementation of rye- and barley-based diets on digestion and subsequent performance in weaning pigs. Can. J. Anim. Sci., 72: 97 105. D i e b o l d G., M o s e n t h i n R., P i e p h o H.P., S a u e r W.C. (2004). Effect of supplementation of xylanase and phospholipase to a wheat-based diets for weanling pigs on nutrient digestibility and concentration of microbial metabolites in ileal digesta and feces. J. Anim. Sci., 82: 2647 2656. G r a h a m H., L o w g r e n W., P e t t e r s o n D., A m a n P. (1988). Effect of enzyme supplementation on digestion of a barley/pollard-based pig diet. Nutr. Rep. Int., 38: 1073 1079. L a z a r o R., G a r c i a M., A r a n i b a r M.J., M a t e o s G.G. (2003). Effect of enzyme addition to wheat-, barley- and rye-based diets on nutrient digestibility and performance of laying hens. Brit. Poultry Sci., 44: 256 265. L i S., S a u e r W.C., H u a n g S.X., G a b e r t V.M. (1996). Effect of -glucanase supplementation to hulless barley- or wheat-soybean meal diets on the digestibilities of energy, protein, -glucans, and amino acids in young pigs. J. Anim. Sci., 74: 1649 1656. M a t h l o u t h i N., J u i n H., L a r b i e r M. (2003). Effect of xylanase and beta-glucanase supplementation of wheat- or wheat- and barley-based diets on the performance of male turkeys. Brit. Poultry Sci., 44: 291 298. M a t h l o u t h i N., S a u l n i e r L., Q u e m e n e r B., L a r b i e r M. (2002). Xylanase, beta-glucanase, and other side enzymatic activities have greater effects on the viscosity of several feedstuffs than xylanase and beta-glucanase used alone or in combination. J. Agric. Food Chem., 50: 5121 5127. M e n g X., S l o m i n s k i B.A., N y a c h o t i C.M., C a m p b e l l L.D., G u e n t e r W. (2005). Degradation of cell wall polysaccharides by combinations of carbohydrase enzymes and their effect on nutrient utilization and broiler chicken performance. Poultry Sci., 84: 37 47. O m o g b e n i g u n F.O., N y a c h o t i C.M., S l o m i n s k i B.A. (2004). Dietary supplementation with multienzyme preparations improves nutrient utilization and growth performance in weaned pigs. J. Anim. Sci., 82: 1056 1061.

Accepted for printing 19 IV 2006

108

E. Hanczakowska et al.

EWA HANCZAKOWSKA, JERZY URBANCZYK, IMKE KHN, TKIEWICZ MAGORZATA SWIA


Wpyw dodatku glukanazy i ksylanazy do paszy odsadzonych prosia t STRESZCZENIE cego beta-glukanaze W dwoch doswiadczeniach oceniano wpyw preparatu Econase, zawieraja t. lub ksylanaze na uzytkowosc wczesnie odsadzanych prosia Wszystkie prosieta zywiono jeczmieniem, . pszenica i soja W doswiadczeniu I, prosieta (n = 146) odsadzane w 28. dniu zycia otrzymyway diete ) podstawowa (kontrolna lub diete z dodatkiem beta-glukanazy: grupa II 26000 BU, grupa III 39000 BU na kg paszy. Grupa IV otrzymywaa ksylanaze 24000 BXU. Ukad doswiadczenia II by taki sam jak w przypadku doswiadczenia I, jednak prosieta odsadzano w wieku 42 dni. Doswiadczenie I zakonczono w 99. dniu, natomiast doswiadczenie II w 84. dniu ich zycia. t. Stwierdzono wieksza skutecznosc beta-glukanazy u modszych zwierza Miedzy 28. a 56. dniem t t zycia przyrost masy ciaa zwierza doswiadczalnych by do 36% wyzszy niz w przypadku zwierza kontrolnych. Miedzy 56. a 70. dniem zycia roznica ta bya mniejsza (do 26%). W caym doswiadczeniu I nizszy dodatek glukanazy poprawi przyrosty masy ciaa o 7,2%, natomiast wyzszy dodatek o 17%. t t Przyrost masy ciaa zwierza pod wpywem ksylanazy poprawi sie o 14%. U starszych prosia ca (doswiadczenie II), tylko roznica miedzy grupami kontrolna i otrzymuja dodatek ksylanazy bya statystycznie istotna, choc wszystkie zwierzeta doswiadczalne przyrastay szybciej niz zwierzeta kontrolne.

Ann. Anim. Sci., Vol. 6, No. 1 (2006) 109 116

FATTY ACID AND CHOLESTEROL CONTENT OF MEAT OF BROILERS FED LINSEED OIL OR DIFFERENT LINSEED VARIETIES*

A g n i e s z k a S z e w c z y k 1, F r a n c i s z e k B o r o w i e c 2, E w a H a n c z a k o w s k a 1
1

Department of Animal Nutrition, National Research Institute of Animal Production, 32-083 Balice n. Krakow, Poland 2 Department of Animal Nutrition, Agricultural University, al. Mickiewicza 24/28, 30-059 Krakow, Poland

Abstract A growth experiment was performed on broilers to estimate the effect of different varieties of linseed on the fatty acid composition and cholesterol content of breast and leg meat. A total of 100 broilers were divided into five groups. Birds were housed individually and fed ad libitum one of five diets: control (I), supplemented with 4% linseed oil (II), or supplemented with 10% Omega seeds (III) or Opal seeds (IV) or Linola seeds (V). The fatty acid content was estimated in seeds, feed and leg and breast meat. The cholesterol content of meat and blood serum was also analysed. No significant differences in broilers weight gains were found. The meat of experimental broilers had higher levels of polyunsaturated fatty acids (PUFA) than the meat of control broilers but lower levels of saturated (SFA) and monounsaturated (MUFA) acids. Linseed supplementation lowered the cholesterol content of meat. The Opal variety had the highest hypocholesterolemic activity. Key words: chicken, feeding, linseed, fatty acid, cholesterol

Normalization of the plasma lipid profile is the goal of nutritional intervention to prevent or reduce the development of atherosclerosis. To reach this goal, expert groups, including the 2001 National Cholesterol Education Program Adult Treatment Panel III, the American Heart Association (AHA), and the Canadian Working Group on Hypercholesterolemia and Other Dyslipidemia, recommended replacing saturated fats with unsaturated fats rather than with carbohydrates. According to the AHA diet, the proportion of saturated lipids should be reduced to 10% of total energy and cholesterol consumption limited to < 300 mg/d (Beauchesne-Rondeau et al., 2003).

* This work was conducted as part of NRIAP statutory activity, project no. 2244.1.

110

A. Szewczyk et al.

Alpha-linolenic acid (C 18:3 n-3) is the fatty acid precursor for the synthesis of eicosapentaenoic acid (EPA; C 20:5 n-3) and docosahexaenoic acid (DHA; C 22:6 n-3), which play a major role in the control of cardiovascular diseases (KrisEtherton et al., 2004). As a result of these benefits, it is now widely recommended that the consumption of long-chain n-3 polyunsaturated fatty acids (PUFA) be increased in the human diet. This is the reason for increasing the supply of long-chain n-3 PUFA by changing the diet of farm animals such as pigs, cows and poultry. The fatty acid profile in the body lipids of broiler chickens depends to a large extent on the composition of the fat contained in feed mixtures (Gonzalez-Esquerra and Leeson, 2000). The addition of linseed increases the energy concentration in feeds and makes it possible to fulfil requirements for essential fatty acids (Borowiec et al., 2001; Lopez-Ferrer et al., 2001; Bean and Leeson, 2003). Linseeds are rich in alphalinolenic acid, which is why the addition of traditional linseed varieties to broiler feeds leads to a reduction in saturated (SFA) and monounsaturated fatty acids (MUFA) and next to a possible reduction in the level of total cholesterol in broilers tissues and blood plasma. The aim of this study was to investigate the effect of feeding broiler chicks with diets supplemented with the Linum usitatissimum brown-seeded variety, Opal; the yellow-seeded varieties, Linola or Omega; or linseed oil on the fatty acid content of meat fat and the level of cholesterol in meat and blood plasma.

Material and methods The experiment was conducted on 100 Starbro broilers divided into five groups of 20 birds each, from 14 to 42 days of age. The broilers were housed individually under standard conditions in metabolic cages fitted with individual feeders and automatic drinkers. The birds were fed ad libitum with complete feeds according to the Nutrient Requirements of Poultry (Table 1). The control feed (I) was not supplemented with fat, while diet II was supplemented with 4% low-linolenic linseed oil, diet III with 10% Omega seeds, diet IV with 10% Opal seeds, and diet V with 10% Linola seeds. The energy content of the diets for the experimental groups (II V) was similar and ranged from 4130.2 to 4463.6 kcal/kg. The diets were prepared weekly and fed as mash. At 7 weeks of age, 7 chickens from each group were decapitated and left breast muscle, abdominal fat and livers were sampled. The samples were placed in plastic bags and stored at 18oC until analysis. The tissues from individual birds were homogenized and lipids were extracted using the method of Folch et al. (1957). The fatty acid profile was determined in feed fats, diets, and tissue lipids using a Varian 3400CX gas chromatograph equipped with an FID detector, with argon as the carrier gas (DB-23 column, column temperature 100 205oC, sample injector 200oC, detector 240oC). Blood was taken from 7 birds and analysed. Total cholesterol (TC) in serum was

Fatty acid and cholesterol content of meat of broilers fed linseed

111

analysed using the POCH biochemical test. The HDL fraction was analysed using the POCH test, and the LDL fraction of cholesterol was calculated as the difference between total and HDL cholesterol.
Table 1. Composition and nutrient content of experimental diets (g/kg) Yellowseeded variety Omega III 305 310 173 80 100 100 32 18.44 3.60 2.10 11.91 5.50 20.90 4130.21 32 18.13 7.61 2.16 12.22 7.00 2.98 4463.60 32 18.69 7.70 2.45 13.90 6.24 2.29 4439.51 32 18.00 7.78 2.69 14.34 7.09 2.78 4407.71 100 32 18.25 7.81 2.71 13.07 6.67 2.31 4424.42 Brownseeded variety Opal IV 315 320 153 80 Yellowseeded variety Linola V 305 310 173 80

Item

Control

Linseed oil II 315 320 213 80 40

I Ground wheat Ground maize Soybean meal Bone-blood meal Linseed oil Omega seeds Opal seeds Linola seeds Mineral and vitamin premix In 1 kg of diet: crude protein ether extract crude fibre NDF ADF ADL gross energy (kcal/kg) 335 350 203 80

The results were subjected to statistical analysis using one-way analysis of variance. Duncans test was used to determine the significance of differences between means for groups.

Results The lipid fraction of Omega and Opal seeds contained the highest amount of linolenic acid (Table 2), while diets supplemented with linseed oil and Linola seeds were rich in linoleic acid (51.7 56.2%). The experimental diets contained more fat than the control diet therefore the weight gain was lowest in the control group (1662 g), while the average weight gain in the experimental groups ranged from 1790 to 1812 g. The leg meat of broilers receiving linseed oil or Linola seeds contained the highest amount of linoleic acid (Table 3) and this difference was statistically significant (P<0.01). The leg meat of all the experimental chicks contained more linolenic acid than that of the controls. The highest level of this acid was found in

112

A. Szewczyk et al.

the leg meat of chicks fed Omega and Opal linseed (5.06 and 5.01%, respectively). The accumulation of PUFA in broilers leg meat in group II increased at the expense of MUFA.
Table 2. Fatty acid content of feed mixtures and linseed (%) Mixture Fatty acid control linseed oil yellowseeded variety Omega III 0.53 11.41 0.62 5.11 28.66 26.35 25.18 0.28 0.84 brownseeded variety Opal IV 0.58 12.21 0.72 6.45 28.73 26.89 23.87 0.10 0.31 yellowseeded variety Linola V 0.48 11.97 0.61 4.77 22.95 56.24 2.47 0.20 5.82 3.89 29.96 16.43 43.93 5.31 4.66 23.15 19.13 47.75 6.81 3.40 14.79 71.36 3.63 yellowseeded variety Omega Seed brownseeded variety Opal Yellow seeded variety Linola

I C C C C C C C C C 14 16 16:1 18 18:1 18:2 18:3 20 20:1 0.89 13.54 1.43 5.17 28.94 38.85 2.07 0.28 1.36

II 0.75 12.84 1.00 4.67 24.55 51.73 2.90 0.17 0.78

Table 3. Fatty acid composition in leg meat of broiler chickens (%) Yellowseeded variety Omega III A a Aa C A 0.87 22.05 3.20 11.23 39.94 14.31 5.06 0.86 0.22 0.42 1.20 44.01 21.23 34.16 65.24 2.07 128.6 A a Bc A B Brownseeded variety Opal IV 0.80 22.66 3.85 10.85 39.19 13.92 5.01 0.82 0.31 0.56 1.26 43.87 21.08 34.32 64.96 1.86 112.8 AA ab Bbc A B Yellowseeded variety Linola V 0.90 22.62 3.34 10.46 37.91 19.08 1.88 0.76 0.34 0.49 1.34 42.02 23.16 34,00 65.19 2.19 131.4 A a Bb B A 0.02 0.18 0.14 0.25 0.36 0.63 0.39 0.03 0.02 0.03 0.11 0.42 0.56 0.36 0.37 0.05 1.65

Item

Control

Linseed oil II

SEM

I C 14 C 16 C 16:1 C 18 C 18:1 C 18:2 C 18:3 C 20:1 C 20:2 C 20:3 C 20:4 MUFA PUFA SFA UFA 0.83 23.97 4.37 11.28 39.23 14.40 0.88 0.81 0.37 0.56 2.29 44.42 18.52 36.10 62.94 B b Bbc A A

B Bc Aa b A

0.75 22.19 3.37 10.19 35.68 22.00 1.58 0.76 0.35 0.47 2.10 39.82 26.52 33.14 66.34 2.31 127.6

B Aa Cc a B

A Bb ABb ab AB

A Bb ABb ab AB

A ABb Bb ab AB

Total fat in meat (%) 2.24 *Cholesterol in meat (mg/100 g) 137.6

a, b, c values in the same rows with different letters differ significantly (P < 0.05). A, B, C values in the same rows with different letters differ significantly (P < 0.01).

Fatty acid and cholesterol content of meat of broilers fed linseed

113

The ratios of particular fatty acids in the breast meat of broilers (Table 4) were similar to those found in their leg meat.
Table 4. Fatty acid composition in breast meat of broiler chickens (%) Linseed oil II Bc B Bb Aa Aa ab b b AB b Aa Bb ABa 0.66 22.40 3.06 10.33 34.85 21.28 1.69 0.62 0.49 0.64 3.54 38.54 27.65 33.40 66.20 1.62 97.1 Aa A Aa Cb ABa ab b b B a Bc Aa Cb Yellowseeded variety Omega III 0.98 24.97 3.16 11.53 36.36 15.32 3.15 0.55 0.24 0.45 2.06 40.08 21.23 37.49 61.32 1.40 94.1 Bc AB ABab ABa Bb a a a AB ab Aab Bb ABa Brownseeded variety Opal IV 0.94 24.39 2.80 13.04 38.37 12.90 2.86 0.88 0.32 0.51 1.34 42.06 17.93 38.35 60.00 1.10 89.4 Bbc B ABb Aa Bb b ab b A b Aa Bc Aa Yellowseeded variety Linola V 0.83 23.22 2.51 11.33 37.19 19.23 1.27 0.87 0.43 0.62 2.03 40.57 23.59 35.37 64.16 1.30 87.9 0.04 ABab 0.25 0.13 AB 0.25 ABab 0.44 BCb 0.71 Aa 0.21 b 0.05 ab 0.03 b 0.03 AB 0.20 ab 0.53 ABbc 0.87 ABab 0.52 BCb 0.45 0.10 3.39

Item

Control

SEM

I C 14 C 16 C 16:1 C 18 C18:1 C 18:2 C 18:3 C 20:1 C 20:2 C 20:3 C 20:4 MUFA PUFA SFA UFA Total fat in meat (%) Cholesterol in meat (mg/100 g) 0.92 24.62 3.17 12.18 39.07 13.61 1.23 0.77 0.50 0.64 2.36 43.02 18.37 37.74 61.39 1.25 96.9

a, b, c values in the same rows with different letters differ significantly (P < 0.05). A, B, C values in the same rows with different letters differ significantly (P < 0.01).

Table 5. Lipid profile of serum in broiler chickens Linseed oil II 128.61 109.25 19.36 Bb 0.85 Bb 28.38 333 Yellowseeded variety Omega III 141.32 98.38 42.93 Aa 0.69 Aa 24.48 330 Brownseeded variety Opal IV 152.2 104.73 47.49 Aa 0.68 Aa 30.81 303 Yellowseeded variety Linola V 146.96 110.43 36.52 Aa 0.75 Aa 31.15 338 3.91 3.25 2.82 0.02 1.72 10.75

Item

Control

SEM

I Total cholesterol TC (mg/dl) HDL-C fraction (mg/dl) LDL-C fraction (mg/dl) HDL-C/TC ratio Triacylglycerols (mg/dl) Total lipids (mg/dl) 154.35 115.16 39.18 Aa 0.74 Aa 29.40 357

a, b values in the same rows with different letters differ significantly (P < 0.05). A, B values in the same rows with different letters differ significantly (P < 0.01).

114

A. Szewczyk et al.

The cholesterol content of meat was lowered by linseed supplementation. The highest hypocholesterolemic activity was characteristic of the brown-seeded variety, Opal, which lowered the cholesterol content of breast meat from 96.9 to 89.4 and that of leg meat from 137.6 to 112.8 mg/100 g. Supplements of linseed and linseed oil lowered the TC and HDL-C content of blood (Table 5) but these differences were not statistically significant. Linseed oil significantly lowered the LDL-C fraction in broilers blood when compared to the control and other experimental groups. The highest (best) HDL-C to TC ratio was also found in this group.

Discussion According to Schuman et al. (2000), feeding laying hens flaxseed reduced body weight and hepatic fat as compared to the control hens receiving animal or other vegetable oil. In this experiment, a lower level of total fat in meat was found only in the experimental group fed the Opal linseed variety. Banno et al. (1997) showed a higher cholesterol ester content in the liver and blood of chickens fed saturated fat (palm oil) than in those receiving linseed oil. Liver triacylglycerol and free cholesterol levels significantly decreased in chicks fed a diet containing n-3 fatty acids (linseed oil or fish oil). These authors also reported increased levels of linoleic and linolenic acids in chicks tissue. The results of our experiment are consistent with the results of Lopez-Ferrer et al. (2001), who found lower amounts of SFA and MUFA but higher amounts of PUFA in the leg meat of chicks fed linseed oil. In an experiment by Gonzales-Esquerra and Leeson (2000), linolenic acid was preferentially deposited in dark meat and other long-chain omega-3 fatty acids in white meat. In this experiment, also, alphalinolenic acid was deposited mainly in dark meat. Cholesterol levels were lowered by linseed, especially in the case of dark meat (leg) compared to breast meat, although these differences were not statistically significant. There were also some differences in the level of blood cholesterol, found to be lower in the experimental groups than in the control group, which concurs with the results of An et al. (1997) and Eder et al. (2005). Wiesenfeld et al. (2003) showed that flaxseed meal significantly reduces serum cholesterol and increases levels of alpha-linoleic and eicosapentaenoic acids in the serum and tissues of rats. Other authors found that feeding animals extracts of linseed and rapeseed increases the level of alpha-linolenic acid by 20- to 40-fold in eggs, 10-fold in chickens, 6-fold in pork, and less than 2-fold in beef (Bourre, 2005). It is concluded from this experiment that different varieties of linseed have different fatty acid contents and can change the fatty acid profile of chicks meat fat. They also have different hypocholesterolemic activity.

Fatty acid and cholesterol content of meat of broilers fed linseed References

115

A n B.K., B a n n o C., X i a Z.S., T a n a n k a K., O h t a n i S. (1997). Effects of dietary fat sources on lipid metabolism in growing chicks (Gallus domesticus). Comp. Biochem. Physiol. Biochem. Mol. Biol., 116, 1: 119 125. B a n n o C., X i a Z.S., T a n a k a K, O h t a n i S. (1997). Effects of dietary fat sources on lipid metabolism in growing chicks (Gallus domesticus). Comp. Biochem. Physiol. Biochem. Mol. Biol., 116(1): 119 225. B e a n LD., L e e s o n S. (2003). Long-term effects of feeding flaxseed on performance and egg fatty acid composition of brown and white hens. Poultry Sci., 82(3): 388 394. B e a u c h e s n e - R o n d e a u E., G a s c o n A., B e r g e r o n J., J a c q u e s H. (2003). Plasma lipids and lipoproteins in hypercholesterolemic men fed a lipid-lowering diet containing lean beef, lean fish, or poultry. Am. J. Clin. Nutr., 77: 587 593. c B o r o w i e c F., Z a j a T., K o w a l s k i Z.M., M i c e k P., M a r c i n s k i M. (2001). Comparison of nutritive value of some new commercial linseed oily cultivars for ruminants. J. Anim. Feed. Sci., 10: 301 308. B o u r r e J.M. (2005). Effect of increasing the omega-3 fatty acid in the diets of animals on the animal products consumed by humans. Med. Sci. (Paris), 21(8 9): 773. E d e r K., G r u n t h a l G., K l u g e H., H i r c h e F., S p i k e J., B r a n d s c h C. (2005). Concentration of cholesterol oxidation products in raw, heat-processed and frozen-stored meat of broiler chickens fed diets differing in the type of fat and vitamin E concentrations. Brit. J. Nutr., 93(5): 633 643. F o l c h J., L e e s M., S t a n l e y G.H.S. (1957). A simple method for the isolation and purification of total lipids from animal tissues. J. Biol. Chem., 226: 497 509. G o n z a l e z - E s q u e r r a R., L e e s o n S. (2000). Effects of menhaden oil and flaxseed in broiler diets on sensory quality and lipid composition of poultry meat. Brit. Poultry Sci., 41(4): 481 488. K r i s - E t h e r t o n P.M., H e c k e r K.D., B i n k o s k i A.E. (2004). Polyunsaturated fatty acids and cardiovascular health. Nutr. Rev., 64(11): 414 426. L o p e z - F e r r e r S., B a u c e l l s M.D., B a r r o e t a A.C., G a l o b a r t J., G r a s h o r n M.A. (2001). n-3 enrichment of chicken meat. 2. Use of precursor of long-chain polyunsaturated fatty acids: linseed oil. Poultry Sci., 80(6): 753 761. S c h u m a n B.E., S q u i r e s E.S., L e e s o n S. (2000). Effect of dietary flaxseed, flax oil and n-3 fatty acid supplement on hepatic and plasma characteristics relevant to fatty liver haemorrhagic syndrome in laying hens. Brit. Poultry Sci., 41(4): 465 472. W i e s e n f e l d P.W., B a b u U.S., C o l l i n s T.F., S p r a n d o R., O D o n n e l l M.W., F l y n n T.J., B l a c k T., O l e j n i k N. (2003). Flaxseed increased -linolenic and eicosapentaenoic acid and decreased arachidonic acid in serum and tissues of rat dams and offspring. Food Chem. Toxicol., 41, 6: 841 855.

Accepted for printing 19 IV 2006

AGNIESZKA SZEWCZYK, FRANCISZEK BOROWIEC, EWA HANCZAKOWSKA Zawartosc kwasow tuszczowych i cholesterolu w miesie brojlerow zywionych olejem lnianym lub roznymi odmianami lnu STRESZCZENIE W doswiadczeniu wzrostowym na brojlerach oceniano wpyw roznych odmian lnu na skad kwasow tuszczowych i zawartosc cholesterolu w miesie piersi i nog. Sto brojlerow podzielono na

116

A. Szewczyk et al.

5 grup. Ptaki utrzymywano pojedynczo i zywiono do woli jedna z pieciu diet: kontrolna (I), z dodatkiem 4% oleju lnianepo (II), z dodatkiem 10% nasion odmiany Omega (III), Opal (IV) lub Linola (V). Zawartosc kwasow tuszczowych oceniano w nasionach, paszy oraz miesie piersi i nog. Analizowano takze zawartosc cholesterolu w miesie i surowicy krwi. Nie stwierdzono istotnych roznic w przyrostach masy ciaa brojlerow. Mieso brojlerow doswiad czalnych miao wyzsza zawartosc wielonienasyconych kwasow tuszczowych (PUFA) niz mieso brojlerow kontrolnych ale nizsza zawartosc kwasow nasyconych (SFA) i jednonienasyconych (MUFA). Dodatek lnu obnizy zawartosc cholesterolu w miesie. Nasiona odmiany Opal wykazyway najwieksze dziaanie hipocholesterolemiczne.

Ann. Anim. Sci., Vol. 6, No. 1 (2006) 117 128

EFFECT OF FEED SUPPLEMENTATION WITH VITAMIN C ON HAEMATOLOGICAL INDICES, CORTICOSTERONE CONCENTRATION IN BLOOD AND DURATION OF TONIC IMMOBILITY IN PHEASANTS

S e b a s t i a n N o w a c z e w s k i1, H e l e n a K o n t e c k a1, E w a P r u s z y n s k a - O s z m a e k2 Department of Poultry Science, Agricultural University of Poznan, Witosa 45, 61-693 Poznan, Poland 2 Department of Animal Physiology and Biochemistry, Woynska 35, 60-637 Poznan, Poland Abstract The aim of the study was to investigate whether the inclusion of vitamin C in feed affects haematological indices, corticosterone in blood and the duration of tonic immobility in pheasants. In experiment I, the material comprised 72 one-year-old birds (8 cocks and 64 hens) kept in aviaries. Investigations were conducted for 11 weeks during the reproductive season (April June). The birds were divided into four groups, group I control and groups II, III and IV experimental in which birds were fed diets supplemented with 100, 200 and 300 mg/kg vitamin C, respectively. At week 8 of the experiment, blood was collected once from all females. In experiment II, the experimental material comprised 300 growing pheasants, 1 to 28 days old, kept indoors. The birds were divided into three groups of 100 animals each, group I control, group II experimental, in which the feed was supplemented with 1200 mg/kg vitamin C 24 hours before fasting and investigating tonic immobility and group III experimental in which pheasants were fed diets supplemented with 1200 mg/kg vitamin C every day. Blood was sampled from 4-week-old pheasants (15 birds from each group). Tonic immobility was studied on day 21 of age in 30 pheasants from each group. In comparison with the control and the second group, in experiment I we observed a higher number of erythrocytes in the blood of the breeding pheasants fed diets supplemented with vitamin C in amounts of 200 and 300 mg/kg of feed. The heterophil to lymphocyte ratio in the pheasant hens fed diets supplemented with 100 mg/kg vitamin C was significantly lower (by 0.19) in comparison with the control group. In experiment II, pheasants fed daily up to 4 weeks of age, diets containing 1200 mg/kg vitamin C were characterized, in comparison with the control group, by a higher number of erythrocytes, higher haemoglobin levels and a higher hematocrit value. The corticosterone concentration in the blood serum of these birds, however, was significantly lower (by 26.7 ng/ml) in comparison with the control group. No differences in the duration of tonic immobility between the examined groups were observed.
1

Key words: pheasant, vitamin C, haematological indices, corticosterone, tonic immobility

118

S. Nowaczewski et al.

The environmental conditions under which indoor-reared pheasants are kept differ considerably from natural conditions. This is associated with the exposure of birds to a number of stress factors (e.g. restriction of the living space, contact with man, zootechnical and veterinary treatments), which can have a negative impact on their health and production results. Many investigations carried out on poultry have shown that stress is often accompanied by changes in the values of haematological indices (Zhou et al., 1999; Yahav, 1999). It was found that some blood traits, i.e. the heterophil to lymphocyte (H:L) ratio and corticosterone concentration, can be good indicators of stress in poultry (Maxwell, 1993; Puvadolpirod and Thaxton, 2000). Meanwhile, according to Gallup (1979), the duration of tonic immobility can be a good indicator of fear in birds. Under stress conditions, the values of these indices increase. However, many investigations (Jaffar and Blha, 1996; Keshavarz, 1996; Andreasen and Frank, 1999; Whitehead and Keller, 2003) have revealed that vitamin C administered in feed can alleviate the effect of different stress factors on birds organisms and thus improve their health and production results. In addition, it was demonstrated that this vitamin can influence the values of haematological indices, the corticosterone concentration in blood and tonic immobility in chickens (Kutlu and Forbes, 1994; Kontecka et al., 1997; Zulkifli et al., 2000). The objective of this study was to determine whether feed supplementation with vitamin C can influence haematological indices in breeding pheasants and whether one-time or daily administration of vitamin C to growing pheasants affects the corticosterone concentration in blood or the duration of tonic immobility.

Material and methods Two experiments were carried out in 2001 at a pheasant farm belonging to the Agricultural University in Poznan. In experiment I, the experimental material was a group of 72 one-year-old birds kept in aviaries in flocks made up of one cock and 8 hens, at a stocking density of 1.2 birds per m2. Investigations were conducted for a period of 11 weeks during the pheasants reproductive season (April June). The birds were fed complete diets ad libitum (Table 1). Four groups of two flocks each (2 cockerels and 16 hens) were formed, group I control and groups II, III and IV experimental, in which the birds were fed complete diets supplemented with 100, 200 and 300 mg/kg vitamin C, respectively. At 8 weeks, blood was collected once from all hens (64 birds). In experiment II, the experimental material included 300 birds (both males and females) aged 1 to 28 days and maintained indoors. It was not possible to identify the birds sex at that age. The birds were fed complete diets ad libitum (Table 2). Three groups of 100 birds were established, group I control and group II experimental in which the birds were fed 1200 mg/kg vitamin C 24 hours before fasting and investigating tonic immobility, and group III experimental in which pheasants were fed 1200 mg/kg feed of vitamin C every day. Blood was sampled from 4-week-old pheasants (15 birds from each group).

Effect of vitamin C supplementation of pheasant diets Table 1. Diet composition of reproductive pheasants Ingredients and analysis Ground wheat Soybean meal Rapeseed meal 00 Meat meal Plant oil Calcium III phosphate Calcium carbonate DL methionine Sodium chloride Premix DJR forte In 1 kg: Metabolizable energy (MJ) Crude protein (%) Crude fibre (%) Lys (%) Met (%) Met + Cys (%) Thr (%) Try (%) Total Ca (%) Available P (%) Total Na (%) NaCl (%) Vitamin A (I.U.) Vitamin D3 (I.U.) Vitamin E (mg) Vitamin K (mg) Vitamin B1 (mg) Vitamin B2 (mg) Vitamin B6 (mg) Vitamin B12 (mg) Biotin (mg) Folic acid (mg) Nicotinic acid (mg) Calcium pantothenate (mg) Choline chloride (mg) Manganese (mg) Iodine (mg) Zinc (mg) Copper (mg) Iron (mg) Selenium (mg) Calcium (g) (%) 61.3 13.5 10.0 5.0 3.5 1.7 4.0 0.2 0.3 0.5 Quantity 11.7 19.1 3.64 1.03 0.43 0.78 0.72 0.26 2.62 0.58 0.19 0.43 12500 2500 30.00 2.50 2.50 10.00 3.00 0.02 0.05 0.40 20.00 10.00 400.00 45.00 0.35 40.00 2.50 25.00 0.15 1.14

119

In both experiments, blood was sampled from the subcutaneous elbow vein (vena ulnaris cutanea) following 12-hour fasting. Heparin was used as an anticoagulant. The following parameters were determined in blood: haemoglobin

120

S. Nowaczewski et al.

content, hematocrit value, number of erythrocytes and leukocytes. Leukocytes were classified into granulocytes (heterophils, eosinophils and basophils) and agranulocytes (lymphocytes and monocytes). The level of haemoglobin was determined using the cyanomethemoglobin method and the hematocrit value using the micro-hematocrit method. The number of erythrocytes and leukocytes was counted under a microscope in the Brker chamber. Blood smears were dyed using the Pappenheim method and then, using a microscope, 100 successive leukocytes were counted and divided into granulocytes and agranulocytes. The corticosterone concentration in the pheasants blood serum was determined using the standard test of the Corticosterone 125J RIA Kit (ICN Biomedicals, Inc., Costa Mesa CA 92626 ).
Table 2. Diet composition of pheasants in the rearing period (%) Ingredients and analysis 1 Wheat Triticale Soybean meal Rapeseed meal Yeasts Meat meal Calcium II phosphate Sodium chloride Calcium carbonate Dry lucerne PH premix In 1 kg: Metabolizable energy (MJ) Crude protein (%) Crude fibre (%) Lys (%) Met (%) Met + Cys (%) Thr (%) Try (%) Total Ca (%) Available P (%) Total Na (%) NaCl (%) Vitamin A (I.U.) Vitamin D3 (I.U.) Vitamin E (mg) Vitamin K (mg) Vitamin B1 (mg) Vitamin B2 (mg) Vitamin B3 (mg) Vitamin B6 (mg) Vitamin B12 (mg) Age of pheasants (weeks) 03 46 2 47.0 39.0 0.9 10.0 2.0 0.1 3 41.9 10.0 24.0 12.0 0.5 5.0 0.8 0.1 0.7 4.0 1.0 Quantity 11.50 28.13 3.95 1.60 0.57 1.31 0.93 0.37 1.17 0.71 0.17 0.31 12500 3000 30.00 2.50 2.00 6.00 0.00 4.00 0.02 11.02 24.03 5.28 1.29 0.34 1.16 0.84 0.33 1.05 0.41 0.14 0.29 12500 3000 30.00 2.50 2.00 6.00 0.00 4.00 0.02

1.0

Effect of vitamin C supplementation of pheasant diets Table 2 contd. 1 Nicotinic acid (mg) Calcium pantothenate (mg) Folic acid (mg) Biotin (mg) Choline chloride (mg) Iron (mg) Copper (mg) Cobalt (mg) Zinc (mg) Manganese (mg) Iodine (mg) Selenium (mg) 2 20.00 12.00 0.60 0.10 600.00 35.00 2.50 0.40 55.00 65.00 0.35 0.15 3 20.00 12.00 0.60 0.10 600.00 35.00 2.50 0.40 55.00 65.00 0.35 0.15

121

Tonic immobility (TI) was checked on day 21 of age (30 birds from each group) using the method described by Jones (1986). Each bird was placed on its back in a wooden trough and held in the trough for 15 seconds, i.e. long enough to arouse TI. Next the researcher left the bird and moved away to a distance of about 2 m and registered the duration of TI until the bird raised. The minimum and maximum durations of TI were assumed to be 10 and 480 seconds, respectively. In both experiments, the vitamin C was administered in crystalline form (acidum ascorbicum Polfa, Krakow). The appropriate dose of this vitamin was introduced into the mash mixture shortly before feeding to birds. In order to ensure appropriate feed homogeneity, three pre-mixtures were made before administering the feed. Statistical calculations for haematological indices and blood hematocrit content were performed using one-way analysis of variance. In the case of TI duration, a trait that does not show normal distribution, the analysis of variance was preceded by data transformation: x = log 10y, where y = trait value. The significance of differences between means for individual groups was verified using Fishers test. For statistical analysis the SAS (v. 9.1) package was used.

Results In experiment I (Table 3), pheasants from the control group and group II were characterized by a significantly lower (by 0.23 and 0.16 mln/l, respectively) number of erythrocytes in blood in comparison with the other birds. On the other hand, none of the groups differed statistically significantly with respect to the blood haemoglobin content or hematocrit value, or the number of leukocytes in blood. A statistically significant difference was found between groups II and IV in the percentage of eosinophils. The value of the H:L ratio in the blood of females from

122

S. Nowaczewski et al.

group II was significantly lower in comparison with the control group. Pheasants whose diets were supplemented with vitamin C had good health throughout the experiment. Deaths were recorded only in the control group (approximately 16.7% of the initial number of birds in this group).

Table 3. Effect of feed supplementation with vitamin C on haematological indices of reproductive pheasants (exp. I) Groups Trait I control (n = 16) II III IV 100 mg vit. C 200 mg vit. C 300 mg vit. C (n = 16) (n = 16) (n = 16)

Erythrocytes (mln/l) x SEM Haemoglobin (mmol/l) x SEM Hematocrit (%) x SEM Leucocytes (thous./l) x SEM Basophils (%) x SEM Eosinophils (%) x SEM Heterophils (%) x SEM Lymphocytes (%) x SEM Monocytes (%) x SEM Heterophil to lymphocyte ratio (1:1) (H:L) x SEM

2.90 a 0.04 6.03 a 0.29 34.0 a 0.85 16.1 a 2.06 12.1 a 1.37 2.2 ab 0.53 26.3 a 2.62 56.1 a 2.80 3.4 a 0.81

2.97 a 0.07 5.85 a 0.21 34.0 a 0.77 16.8 a 0.95 12.2 a 1.53 4.4 a 1.46 18.8 a 2.74 62.1 a 2.78 2.5 a 0.52

3.13 b 0.04 6.09 a 0.22 33.0 a 0.79 14.5 a 1.23 10.8 a 1.23 2.3 ab 0.88 21.1 a 2.82 63.2 a 2.71 2.7 a 0.71

3.13 b 0.04 5.72 a 0.26 33.0 a 1.41 15.1 a 0.99 11.1 a 1.64 1.8 b 0.39 25.3 a 2.02 59.1 a 1.77 2.9 a 0.89

0.51 a 0.07

0.32 b 0.05

0.37 ab 0.07

0.44 ab 0.05

Mean values in rows with different letters differ significantly (P 0.05).

Effect of vitamin C supplementation of pheasant diets

123

Table 4. Effect of feed supplementation with vitamin C on haematological indices of 4-week-old pheasants (exp. II) Trait Groups I control (n = 15) 2.38 a 0.12 7.35 a 0.36 31.0 a 0.98 17.9 a 1.09 3.8 a 1.95 1.7 a 0.55 22.6 a 2.80 66.6 a 3.16 5.3 a 1.30 0.37 a 0.05 40.1 a 5.28 296 a 0.07 II (n = 15) 2.43 ab 0.12 8.37 ab 0.25 35.0 b 0.62 19.4 a 1.36 4.1 a 1.17 1.6 a 0.47 24.0 a 2.43 65.6 a 2.46 4.7 a 1.10 0.39 a 0.05 29.8 ab 7.98 328 a 0.05 III (n = 15) 2.48 b 0.12 8.40 b 0.49 34.0 b 0.60 20.5 a 1.26 2.1 a 0.71 1.6 a 0.48 27.3 a 2.37 63.8 a 2.04 5.2 a 0.63 0.45 a 0.05 13.4 b 1.76 274 a 0.08

Erythrocytes (mln/l) x SEM Haemoglobin (mmol/l) x SEM Hematocrit (%) x SEM Leucocytes (thous./l) x SEM Basophils (%) x SEM Eosinophils (%) x SEM Heterophils (%) x SEM Lymphocytes (%) x SEM Monocytes (%) x SEM Heterophil to lymphocyte ratio (1:1) (H:L) x SEM Corticosterone (ng/ml) x SEM Tonic immobility (s) (TI) x SEM

Mean values in rows with different letters differ significantly (P 0.05).

In experiment II (Table 4), birds from group III had a significantly higher (by 0.1 mln/l) mean number of erythrocytes, about 1.1 mmol/l higher haemoglobin in blood and 3 percentage points higher hematocrit in blood in comparison with the control group. On the other hand, birds from group II, in comparison with group I, had a significantly higher (by 4 percentage points) hematocrit value. No significant

124

S. Nowaczewski et al.

differences were found between the examined groups of birds in the number of leukocytes or percentage of agranulocytes or granulocytes, or in the H:L ratio. The corticosterone concentration in the blood of the pheasants from group I was significantly higher (by 26.7 ng/ml) in comparison with group III. In addition, birds from this group were characterized by a 22 second shorter TI duration than those from the control group. However, this difference was not confirmed statistically. The mortality of birds was similar in the examined groups and amounted to 6% on average.

Discussion The number of erythrocytes, the hematocrit value and the haemoglobin content determined in the blood of breeding pheasants were similar to the values reported by Jamroz et al. (1983). Pheasant hens fed diets supplemented with 200 or 300 mg/kg vitamin C were characterized by a higher number of erythrocytes than the birds from the control group and group II (100 mg/kg vitamin C). A significantly higher number of erythrocytes (by about 0.56 mln/l) in comparison with the control group was also reported by Kontecka et al. (1997) in experiments on laying hens fed diets supplemented with 200 mg/kg vitamin C. However, this study, as well as experiments carried out by Torgowski and Kontecka (1998) on pheasants fed diets supplemented with vitamin C and iron, failed to show significant differences between the control and experimental groups with regard to the number of leukocytes or proportions of individual types of granulocytes and agranulocytes. However, in our study, the basophil content of the blood of pheasants from individual groups was similar to that reported by Lucas and Jamroz after Campbell (1995) and Torgowski and Kontecka (1998). An increased number of monocytes accompanied by a decreased number of eosinophils may be indicative of the organisms response to stress factors (Maxwell et al., 1990). In the experiments performed, no differences were found between the control group and the experimental groups with regard to the percentage of the above-mentioned granulocytes. Nevertheless, both in the control group and in the group fed 300 mg/kg vitamin C, a trend was observed towards a reduced number of eosinophils and an increased number of monocytes in blood. Gross and Siegel, after Maxwell and Robertson (1998), distinguished three stress levels (low, medium and high) in relation to the value of the H:L ratio determined in the blood of birds (0.2, 0.5 and 0.8, respectively). The elevated value of the H:L ratio (x = 0.41) determined in experiment I indicates that the birds were exposed to a medium stress level. This could have been caused by the weather conditions (air temperature ranged from 25 to 30oC) that prevailed on the farm for a few days before blood sampling. Kontecka et al. (1999) also reported a higher H:L ratio in ducks two days after exposure of the birds to various stress factors. The value of the H:L ratio in pheasants fed diets supplemented with vitamin C (100 mg/kg) was significantly lower than in the control group. Moreover, the

Effect of vitamin C supplementation of pheasant diets

125

200 mg dose of vitamin C did not affect this trait. Similar results were reported by Kontecka et al. (1997) who failed to find a lower H:L ratio in laying hens fed diets supplemented with 200 mg/kg vitamin C in comparison with the control group. The application of a higher dose of 1200 mg vitamin C in experiment II was motivated by the lower biosynthesis of this vitamin by young organisms and its significantly higher metabolism (Seeman, 1991). Moreover, many experiments have indicated that growing birds require vitamin C in quantities over 1000 mg per kg feed or per l of water when they are exposed to stress factors such as catching, transport or zootechnical treatments (Pardue et al., 1984; Satterlee et al., 1989; Zulkifli et al., 2000). Growing pheasants fed daily diets containing 1200 mg/kg vitamin C, in comparison with the control group, were characterized by a significantly higher number of erythrocytes, a higher hematocrit value and higher haemoglobin levels. On the other hand, no significant differences were observed in the H:L ratio between the birds from the experimental groups and the control group. Januszewski (1988) added vitamin C (200 mg/l) and rutin (50 mg/l) to water for chickens and found that, in comparison with the control group, they were characterized by a higher number of erythrocytes, a higher hematocrit value and higher blood haemoglobin. It should be added here that neither the above-mentioned author nor our study found significant differences between groups in the percentage of individual types of leukocytes. Catching birds and keeping them in order to collect blood constitute strong stress factors that cause increased secretion of corticosterone (Littin and Cockrem, 2001). In addition, it was demonstrated that with an increase in the amount of vitamin C in blood, the level of this hormone decreases (Kutlu and Forbes, 1994). The concentration of corticosterone in the blood of pheasants fed 1200 mg/kg vitamin C every day was significantly lower (by about 67%) than in birds from the control group. Satterlee et al. (1989) also found a decline in blood corticosterone in chickens supplemented with vitamin C at a rate of 1200 mg/l water 24 hours before blood sampling. However, this difference was smaller and amounted to about 10%. Mahmoud et al. (1999) obtained similar results using a lower dose of vitamin C (500 mg/kg) and an additional stress factor, i.e. cyclical changes of temperature in the room (21 30 21oC). The results of the above investigations indicate that vitamin C supplemented daily to feed for growing pheasants could alleviate the effects of stress caused by bird catching and collection of blood (lower corticosterone concentration in blood). The observed lack of differences between groups in the value of the H:L ratio can probably be attributed to the fact that the proportion of these leukocytes in blood undergoes changes after a longer period of time from the moment the stress stimulus occurs. This was shown by Gross after Maxwell (1993) who reported a higher H:L ratio in broiler chickens only 18 hours after the application of the stress factor (noise), while Kontecka et al. (1999) reported significant differences in H:L values in ducks only 2 days after application of the stress factor (no access to water).

126

S. Nowaczewski et al.

Pheasants fed daily diets containing 1200 mg/kg vitamin C were characterized by a shorter, but non-significant, TI duration in comparison with birds from the other groups. Also, Satterlee et al. (1994) and Jones et al. (1996) reported, in comparison with the control group, a shorter TI duration in broiler chickens and Japanese quails which were administered water with 1000 mg/l vitamin C 24 hours before sampling. On the basis of the investigations performed, it can be stated that reproductive pheasants fed diets supplemented with 200 or 300 mg/kg vitamin C are characterized by a higher number of erythrocytes in blood. Pheasants which were fed 100 mg/kg vitamin C in their diets were characterized by a lower H:L ratio value in comparison with the control group. In comparison with the control group, the blood of growing pheasants fed daily diets containing 1200 mg/kg vitamin C was characterized by a higher number of erythrocytes, higher haemoglobin levels and a higher hematocrit value. Moreover, the lower corticosterone concentration obtained in the blood of pheasants from this group leads us to assume that vitamin C probably influenced the increased resistance of birds to the stress caused by catching and blood sampling. Our findings also indicate that supplementing feeds given to breeding and growing pheasants with vitamin C is useful, as it may alleviate the effects of stress under farm rearing conditions.
References A n d r e a s e n C.B., F r a n k D.E. (1999). The effects of ascorbic acid on in vitro heterophil function. Avian Dis., 43: 656 663. C a m p b e l l T.W. (1995). Avian hematology and cytology. Iowa State University Press. Ames Iowa, 104 pp. G a l l u p G.G. Jr. (1979). Tonic immobility as a measure of fear in domestic fowl. Anim. Beh., 27: 316 317. J a f f a r G.H., B l h a J. (1996). Effect of ascorbic acid supplementation in drinking water on growth rate, feed consumption and feed efficiency of broiler chickens maintained under acute heat stress conditions. ivoc. Vyr., 41: 485 490. J a m r o z D., B a r t c z a k R., G i e b e l O., M a z u r k i e w i c z M., M r o z A. (1983). Efekty produkcyjne dzonymi i stan zdrowotny bazantow zywionych niskobiakowymi mieszankami tresciwymi, sporza z surowcow krajowych. Med. Wet., 38: 357 360. t J a n u s z e w s k i J. (1988). Wpyw rutiny i rutinoscorbinu na stan zdrowotny i efekty tuczu kurcza brojlerow. Zesz. Nauk. AR Wroc., Wet., 44: 87 107. J o n e s R.B. (1986). The tonic immobility reaction of the domestic fowl: a review. Worlds Poultry Sci., J. 42: 82 96. J o n e s R.B., S a t t e r l e e D.G., M o r e a u J., W a d d i n g t o n D. (1996). Vitamin C supplementation and fear-reduction in Japanese quail: short-term cumulative effects. Brit. Poultry Sci., 37: 33 42. K e s h a v a r z K. (1996). The effect of different levels of vitamin C and cholecalciferol with adequate or marginal levels of dietary calcium on performance and eggshell quality of laying hens. Poultry Sci., 75: 1227 1235. K o n t e c k a H., W i t k i e w i c z K., S o b c z a k J. (1997). Wpyw dodatku witaminy C do paszy na wskazniki produkcyjne i hematologiczne kur niesnych. Zesz. Nauk. PTZ, Prz. Hod., 32: 139 145. z K o n t e c k a H., K s i a k i e w i c z J.M., N o g o w s k i L. (1999). Effects of different stressors on laying rate and selected blood indices in reproductive ducks. J. Anim. Feed. Sci., 8: 63 72.

Effect of vitamin C supplementation of pheasant diets

127

K u t l u H.R., F o r b e s J.M. (1994). Response of broiler chicks to dietary ascorbic acid and corticosterone. Brit. Poultry Sci., 35: 184 186. L i t t i n K.E., C o c k r e m J.F. (2001). Individual variation in corticosterone secretion in laying hens. Brit. Poultry Sci., 42: 536 546. M a h m o u d K.Z., E d e n s F.W., E i s e n E. (1999). Vitamin C reduces HSP70 and plasma corticosterone responses in broilers subjected to cyclic heat stress. Poultry Sci., Suppl. (Ann. Meet. Abstr.) 1: 106. M a x w e l l M.H. (1993). Avian blood leucocyte responses to stress. World Poultry Sci. J., 49: 34 43. M a x w e l l M.H., R o b e r t s o n G.W. (1998). The avian heterophil leucocyte: a review. World Poultry Sci. J., 54: 155 178. M a x w e l l M.H., R o b e r t s o n G.W., S p e n c e S., M c C o r q u o d a l e C. (1990). Comparison of haematological values in restricted- and ad libitum-fed domestic fowls: white blood cells and thrombocytes. Brit. Poultry Sci., 31: 399 405. P a r d u e S.L., T h a x t o n J.P., B r a k e J. (1984). Plasma ascorbic acid concentration following ascorbic acid loading in chicks. Poultry Sci., 63: 2492 2496. P u v a d o l p i r o d S., T h a x t o n J.P. (2000). Model of physiological stress in chickens. 1. Response parameters. Poultry Sci., 79: 363 369. S a t t e r l e e D.G., A q u i l e r a - Q u i n t a n a I.A., M u n n B.J., K r a u t m a n n B.A. (1989). Vitamin C amelioration of the adrenal stress response in broiler chickens being prepared for slaughter. Comp. Biochem. Physiol., 94A: 569 574. S a t t e r l e e D.G., J o n e s R.B., R y d e r F.H. (1994). Effects of ascorbyl-2-polyphosphate on adrenocortical activation and fear-related behavior in broiler chickens. Poultry Sci., 73: 194 201. S e e m a n M. (1991). Is vitamin C essential in poultry nutrition? Worlds Poultry Misset, 7: 17 19. T o r g o w s k i J., K o n t e c k a H. (1998). Wpyw dodatku witaminy C i zelaza do paszy na wskazniki produkcyjne i hematologiczne bazantow ownych (Phasianus colchicus). Rocz. AR Pozn. 302., Zoot., 50: 235 242. W h i t e h e a d C.C., K e l l e r T. (2003). An update on ascorbic acid in poultry. World Poultry Sci. J., 59: 161 184. Y a h a v S. (1999). The effect of constant and diurnal cyclic temperatures on performance and blood system of young turkeys. J. Therm. Biol., 24: 71 78. Z h o u W.T., F u j i t a M., Y a m a m o t o S. (1999). Effects of ambient temperatures on blood viscosity and plasma protein concentration of broiler chickens (Gallus domesticus). J. Therm. Biol., 24: 105 112. Z u l k i f l i I., C h e N o r m a M.T., C h o n g C.H., L o h T.C. (2000). The effects of crating and road transportation on stress and fear responses of broiler chickens treated with ascorbic acid. Arch. Geflgelkunde, 65: 33 37.

Accepted for printing 20 IV 2006

SEBASTIAN NOWACZEWSKI, HELENA KONTECKA, EWA PRUSZYNSKA-OSZMAEK


Wpyw dodatku witaminy C do paszy na wskazniki hematologiczne, zawartosc kortykosteronu we krwi i czas trwania bezruchu tonicznego bazantow STRESZCZENIE Celem pracy byo sprawdzenie czy podawana do paszy witamina C ma wpyw na wskazniki hematologiczne, zawartosc kortykosteronu we krwi oraz czas trwania bezruchu tonicznego u bazantow. W doswiadczeniu I materia badawczy stanowiy 72 jednoroczne ptaki (8 kogutow i 64 kury)

128

S. Nowaczewski et al.

utrzymywane w wolierach. Badania prowadzono przez 11 tygodni w sezonie reprodukcyjnym (kwiecien czerwiec). Utworzono 4 grupy: I kontrolna oraz II, III i IV doswiadczalne, w ktorych ptaki otrzymyway w mieszance dodatek odpowiednio 100, 200 i 300 mg/kg witaminy C. W 8. tygodniu pobrano jednorazowo krew od wszystkich samic. W doswiadczeniu II materia badawczy stanowio 300 cych bazantow, w wieku od 1. do 28. dnia zycia, utrzymywanych w pomieszczeniu. Utworzono rosna 3 grupy po 100 bazantow w kazdej: I kontrolna, II doswiadczalna, ktorej na 24 godziny przed godzeniem i badaniem bezruchu tonicznego ptakow dodawano do paszy 1200 mg/kg witaminy C oraz III doswiadczalna, w ktorej bazanty zywiono codziennie pasza z dodatkiem 1200 mg/kg witaminy C. Krew pobrano od 4-tygodniowych ptakow (15 szt. z kazdej grupy). Bezruch toniczny badano w 21. dniu zycia bazantow (30 ptakow z kazdej grupy). W doswiadczeniu I wykazano wieksza niz w grupie kontrolnej liczbe erytrocytow we krwi bazantow reprodukcyjnych zywionych pasza z dodatkiem 200 i 300 mg/kg witaminy C. Wartosc cych do paszy dodatek 100 mg/kg stosunku heterofili do limfocytow u kur bazancich otrzymuja witaminy C bya istotnie mniejsza (o 0,19) niz w grupie kontrolnej. W doswiadczeniu II, bazanty zywione codziennie pasza z dodatkiem 1200 mg/kg witaminy C charakteryzowaa wieksza niz ptakow z grupy kontrolnej liczba erytrocytow, zawartosc hemoglobiny i wartosc hematokrytu, a zawartosc kortykosteronu w surowicy krwi tych ptakow bya istotnie mniejsza o 26,7 ng/ml. Nie stwierdzono roznic miedzy badanymi grupami w czasie trwania bezruchu tonicznego.

Ann. Anim. Sci., Vol. 6, No. 1 (2006) 129 138

DYNAMICS OF SMALL STRONGYLE (CYATHOSTOMINAE) INFECTION IN HORSES UNDER DIFFERENT MANAGEMENT SYSTEMS
S a w o m i r K o r n a s, B o g u s a w N o w o s a d, M a r t a S k a l s k a Department of Zoology and Ecology, Agricultural University, Al. Mickiewicza 24/28, 30-059 Krakow, Poland Abstract On the basis of coproscopical and larvoscopical examinations carried out in 2000 2002, the level of small strongyle (Cyathostominae) infection in horses was determined in four production facilities. In two cycles of one year each, faecal samples from 291 horses kept under stable or stable and pasture management systems were examined. The prevalence of infection and the number of eggs per gram of faeces (EPG) were calculated for horses of different ages. The prevalence of horse infection in the stable management system (ND) ranged from 16.7 to 79.3% in the first cycle and from 34.2 to 80% in the second cycle. EPG was 78 675 and 88 340, respectively. The prevalence of infection in horses under the stable and pasture management system (NS) was higher (71.4 97.4% and 10.5 96.4%), with EPG counts of 138 969 and 90 649, respectively. At the first riding club, pastured horses were more infected than horses kept in paddocks. In yearling and 2-year-old horses kept under the stable and pasture management system (NS), the classic dynamics of infection in the annual cycle were ascertained, with two peaks of strongyle egg excretion the first in spring and the second at the end of the pasture season. An increase in egg output in spring (April to May) was found in all the analysed facilities and in the summer-autumn months in horses kept on pasture. Key words: horses, infection, Cyathostominae, management system

Small strongyles (Cyathostominae) constitute a major problem in horse breeding because of their high prevalence, survival strategy in the host and environment, and ability to acquire resistance to antiparasitic drugs. The dynamics of small strongyle egg output are closely related to their development. After being eaten with grass, the infective larvae (L3) of the nematodes penetrate the mucous or submucous membranes of the horse colon or caecum. After moulting to L4 they return to the lumen of the intestine and mature to adults or arrest their development (hypobiosis), especially during winter (Ogbourne, 1978). The development from L3 to adult stages from spring to early autumn lasts 1.5 to 3 months. Hypobiosis occurs in late autumn (Mirck, 1982). The number of hypobiotic larvae can be very high and can even reach 25 100 per cm2 of the mucous membrane of the intestines (Mariotti et al., 1996).

130

S. Kornas et al.

Clinical cyathostomosis occurs more commonly in young horses between late winter and early spring. Clinical signs depend on many factors, but mainly on the level of infection. The major symptoms are weight loss, diarrhoea, and sometimes death in horses within 2 3 weeks (Love et al., 1999). The objective of this study was to compare the dynamics of small strongyle infection in horses of different age kept under different management systems.

Material and methods The study was carried out at the national stud (NS), national depots (ND) and two horse riding clubs (HC-1 and HC-2) in southwest Poland (Table 1). The individual faecal samples from horses of different breeds, mainly Silesian, were examined monthly from April 2000 to March 2002 (two annual cycles in adult horses at NS and ND, one cycle at HC-1 and HC-2, and one cycle in yearlings and 2-year-old horses). Horses were treated with Antiverm (pyrantel embonate) except yearlings and 2-year-old horses, which were treated with Eqvalan (ivermectin). The McMaster method was used to estimate EPG and prevalence of infection monthly in horses under all the management systems analysed.
Table 1. Design of the study Type of facility National stud (NS) Management system stable-pasture Age of horses Annual cycles Number of examined horses 43 48 22 65 74 13 26 Treatment (month) Apr; Oct Apr; Oct Apr; Oct Apr; Oct Apr; Oct May; Oct May, Oct

mares Apr 2000 (4 18 years old) Mar 2001 Apr 2001 Mar 2002 yearling and two years old Apr 2000 Mar 2001

National depot (ND)

stable

stallions Apr 2000 (4 20 years old) Mar 2001 Apr 2001 Mar 2002 2 to 28 years old Apr 2000 Mar 2001

Horse riding club 1 (HC-1) Horse riding club 2 (HC-2)

stable-pasture

stable 3 to 20 years old Apr 2000 with paddocks Mar 2001

The faecal cultures were performed according to Henriksen and Korsholme (1983) and infective larvae (100 larvae where possible) were identified according to Soulsby (1965) to define small (Cyathostominae) or large (Strongylinae) strongyles.

Dynamics of small strongyle infection in horses

131

Results Based on the larvae differentiation, a very low level of large strongyle infections was found in the examined horses. Infective larvae of large strongyles were identified only at the National Stud, at a very low percentage (0.05%). The remaining 99.95% of larvae were small strongyles. The dynamics of small strongyle infections were different in all the analysed management systems. The mean prevalence of small strongyle infections in stabled stallions (ND) ranged from 16.7% (April) to 79.3% (July) in the first cycle, and from 34.2% (April) to 80% (November) in the second cycle (Figure 1). The dynamics of small strongyle egg output showed a larger peak in April (675 EPG) and a smaller peak (386 EPG) in August in the first cycle. In the second cycle, the respective values were 340 EPG in April and 285 EPG in September (Figure 2). The mean prevalence of mare infections under the stable and pasture system (NS) was higher than in stabled stallions (ND), from 71.4% (May) to 97.4% (December) in the first cycle, and from 10.5% to 96.4% in the second cycle (Figure 1). For the dynamics of small strongyle egg output, a higher peak was observed in August (969 EPG) than in March (484 EPG) in the first cycle, and in September (649 EPG) than in March (360 EPG) in the second cycle (Figure 2). On average, small strongyle infections were the most prevalent in horses under stable and pasture management (the first riding club, HC-1) in the period from July to October (75 95%) and the intensity of egg output peaked in May (792 EPG), whereas in July-October it ranged from 672 to 910 EPG. Prevalence and EPG decreased in June and November as a result of treatments applied in May and October (Figures 1 and 2). The prevalence of small strongyle infection in horses under the stable management system with paddocks from the second riding club (HC-2) was lower (especially EPG) than in those under the other management systems analysed. The highest prevalence of infections was in March and April (around 80%) and the highest egg output in May (495 EPG), despite the treatment of horses in April (Figures 1 and 2). The dynamics of small strongyle infections in yearling and 2-year-old horses were typical of the stable and pasture system (NS). The mean prevalence of infection was very high (85.7 100%) except in the month after treatment (Figure 3). The Cyathostominae egg output increased from April to September (633 EPG), then decreased after treatment in October (33 EPG) and slowly increased once more until the end of the study in March (369 EPG) (Figure 4).

132
S. Kornas et al.

Figure 1. Prevalence of small strongyle infection in adult horses

Dynamics of small strongyle infection in horses

133

Figure 2. Dynamics of small strongyle egg output in adult horses

134

S. Kornas et al.

Figure 3. Prevalence of small strongyle infection in yearling and 2-year-old horses

Figure 4. Dynamics of small strongyle egg output in yearling and 2-year-old horses

Dynamics of small strongyle infection in horses

135

Discussion The increase in small strongyle egg output was observed in spring (from April to May) in all types of facilities and also during the summer and autumn months in horses under the stable and pasture management system (NS, HC-1). The peak of small strongyle egg output observed in early spring may have resulted from the large quantities of hypobiotic larvae being released from the mucous membrane of the horse intestines, which reached maturity and produced many eggs excreted with horse faeces. The development of hypobiotic larvae may be triggered not only by a temperature increase (Reinemeyer, 1986) but also by drug treatment (after removal of adult stages of this parasite) (Gibson, 1953). The greatest emergence of hypobiotic larvae was observed in late winter and early spring (Reinemeyer et al., 1986). As a result of this, large numbers of sexually mature, female small strongyles appeared in horse intestines from spring to autumn (Reinemeyer et al., 1986), from April to June (Ogbourne, 1976) and in June (Mirck, 1982). In the present study, the small strongyle egg output also increased from June to October in horses under the stable and pasture system (NS and HC-1). In stabled stallions (ND), the dynamics were similar but the number of eggs found in faeces was considerably lower. The lower intensity of infection during the autumn and winter months (from November to January) observed in the present study may be possibly due to the decrease in the adult population of small strongyles. The smallest number of adult females was found from October to December, and a large number of females with limited reproductive ability were found from the end of autumn and during the winter (Ogbourne, 1976; Reinemeyer et al., 1986). The dynamics of small strongyle egg output with two peaks in early spring and late summer, observed in the present study in horses under the stable and pasture system in particular, were similar to the results reported by other authors (Mage, 1996; Betlejewska, 2000). Rapid growth of infection intensity from early spring to late summer and early autumn, followed by a decrease in the winter, has been observed by other authors such as Slocombe et al. (1987) and Baudena et al. (2000). Depending on local weather conditions, the grazing season in Poland lasts from April/May to October/November. During this time horses excrete many strongyle eggs while becoming infected with larvae, which develop from these eggs. The development of larvae on the pasture to the infective stage depends on the latitude, local weather conditions and type of pasture. In a study in Denmark, low pasture infections occurred from April to June, then increased in July with a peak at the end of pasture season (Henriksen, 1985). In a study in the Czech Republic, larvae were present on the pasture from May to October, and the number increased from July to October (Langrova, 1999). In a German study, pastures were more infected in June, August and October (Hasslinger and Bittner, 1984) and in a French study, at the turn of summer and autumn (Mage, 1996). Weather conditions in these countries are similar to those in Poland, so the dynamics of strongyle larvae occurrence on pasture could be similar to ours.

136

S. Kornas et al.

The prepatent period of small strongyles lasts from 1.5 to 3 months. The common genus Cylicocyclus spp. (subfamily Cyathostominae) develops for approximately 2 months. The pasture season in Poland is about 6 months long, which allows for the occurrence of 2 or 3 generations of these parasites in horse intestines. This was confirmed by an experiment conducted under German weather conditions, which shows three peaks of infective larvae on pasture at 9, 16 and 24 weeks of the 6-month pasture season and three generations of small strongyles in horse intestines (Bittner, 1983). In the present study, there was only one peak of small strongyle egg output from August to October, because anthelminthics were given mostly in April and October, which changed the seasonal dynamics of this nematode. The dynamics of small strongyle egg output in stabled horses with paddocks from the second riding club (HC-2) was different. At this facility, like at others, an increased level of egg output was observed in spring (April May). This was probably due to the emergence of hypobiotic larvae from horse mucus or infections with larvae surviving in small paddocks where horses stay from early spring (Lindberg, 1976). The output of small strongyle eggs in horses housed only in paddocks (HC-2) was constant from July to October and was lower than in spring. The high moisture and rise in temperature in paddocks in the spring stimulated the activity of larvae, which developed to the infective stage. No peaks in small strongyle egg output were observed during the summer, due to the absence of pasture which is a very important source of small strongyle infection in horses. It is very difficult to determine the interaction between the species of Cyathostominae subfamily using coprological tests. Knowledge of the reproductive biology, dynamics and developmental processes of this nematode species is still insufficient, as is knowledge of the influence of and competition between different species or genera of small strongyles, in spite of the high prevalence and numerous species of these parasites described in horses (Kornas et al., 2004). Gawor (1995) described 23 species of small strongyles in Poland. The number of small strongyle species found in one host varies, with reports of 2 16 (Gawor, 1995), 4 16 (Ougbourne, 1976) and 2 11 (Reinemeyer et al., 1984). The present study suggests that the dynamics of small strongyle infections depend not only on the biology of this nematode, but also on environmental factors and management systems. Knowledge of the dynamics of infection could help to create treatment programmes adapted to local management conditions.

References B a u d e n a M.A., C h a p m a n M.R., F r e n c h D.D., K l e i T. R. (2000). Seasonal development and survival of equine cyathostome larvae on pasture in South Louisiana. Vet. Parasitol., 1 2: 51 60. B e t l e j e w s k a K. (2000). The dynamics of small strongyles (Cyathostominae) invasion in horses during an annual cycle. Med. Wet., 1: 36 38. B i t t n e r G. (1983). Ein Beitrag zur Epizootologie der Strongylideninfektion des Pferdes in einem bayerischen Gestutsareal. Tierrztliche Fakultt, Ludwig-Maximilians-Universitat Mnchen, 68.

Dynamics of small strongyle infection in horses

137

G a w o r J. (1995). The prevalence and abundance of internal parasites in working horses autopsied in Poland. Vet. Parasitol., 1 2: 99 108. G i b s o n T.E. (1953). The effect of repeated anthelmintic treatment with phenotiazine on fecal egg counts of housed horses, with some observations on the life cycle of Trichonema spp. in the horse. J. Helminthol., 1/2: 29 40. H a s s l i n g e r M.A., B i t t n e r G. (1984). Zur Saisondynamik der larven von Pferdestrongyliden und deren Beziehung zum Infektionsrisiko auf der Weide. Zentralblatt fr Veterinrmedizin, 1: 25 31. H e n r i k s e n S.A., K o r s h o l m e M. (1983). A method for culture and recovery of gastrointestinal strongyle larvae. Nord Vet., 35: 429 430. H e n r i k s e n S.A. (1985). Seasonal variation of pasture contamination with infective larvae of equine strongyles preliminary studies. Dansk Vet., 7: 364 367. K o r n a s S., N o w o s a d B., S k a l s k a M. (2004). Zarazenie pasozytami przewodu pokarmowego koni w zaleznosci od warunkow utrzymania. Med. Wet., 60: 853 857. L a n g r o v a I. (1999). The importance of contaminated pastures and litter in stables for the infection with nematodes of family Strongylidae in horses on studfarm Xaverov. Helminthologia, 4: 241 249. L i n d b e r g R. (1976). Survival of infective larvae of horse strongyles on pasture grass. An introductory field study. Svensk Vet., 11: 509 514. L o v e S., M u r p h y D., M e l l o r D. (1999). Pathogenicity of cyathostome infection. Vet Parasitol., 85: 113 122. M a g e C. (1996). Epidemiologie parasitaire chez les juments de trait au paturage. Rev. Med. Vet., 3: 211 214. M a r i o t t i F., M a n d a r a M.T., M u g h e t t i L., V i t e l l o z z i G. (1996). La ciatostomiasi larvale del cavallo. Aspetti anatomo-istopatologici. Ob. Doc. Vet., 5: 71 80. M i r c k M.H. (1982). The prevalence, relative abundance and site distribution of Strongylidae in Shetland ponies in the Netherlands. Parasitology, 84: 1. O g b o u r n e C.P. (1976). The prevalence, relative abundance and site distribution of nematodes of the subfamily Cyathostominae in horses killed in Britain. J. Helminthol., 3: 203 214. O g b o u r n e C.P. (1978). Pathogenesis of cyathostome (Trichonema) infections of the horses: a review. Commonwealth Institute of Helminthology. Commonwealth Agricultural Bureaux of the United Kingdom, Misc. Publ., 5: 25. R e i n e m e y e r C.R., S m i t h S.A., G a b e l A.A., H e r d R.P. (1984). The prevalence and intensity of internal parasites of horses in the U.S.A. Vet. Parasitol., 1: 75 83. R e i n e m e y e r C.R. (1986). Small strongyles. Recent advances. Vet. Clin. N. Am. Equine Prac., 2: 281 312. R e i n e m e y e r C.R., S m i t h S.A., G a b e l A.A., H e r d R.P. (1986). Observations on the population dynamics of five cyathostome nematode species of horses in northern USA. Equine Vet. J., 2: 121 124. S l o c o m b e J.O.D., V a l e n z u e l a J., L a k e M.C. (1987). Epidemiology of strongyles in ponies in Ontario. Can. J. Vet. Res., 4: 470 474. S o u l s b y E.J.L. (1965). Textbook of veterinary clinical parasitology. Vol. I. Helminths. Blackwell Scient. Public., Oxford.

Accepted for printing 23 XI 2005

138

S. Kornas et al.

SAWOMIR KORNAS, BOGUSAW NOWOSAD, MARTA SKALSKA


Dynamika zarazenia supkowcami maymi (Cyathostominae) koni z roznego systemu chowu STRESZCZENIE W oparciu o badania koproskopowe i larwoskopowe w latach 2000-2002 okreslono poziom zarazenia koni supkowcami maymi (Cyathostominae) w czterech typach obiektow. W dwoch cyklach rocznych proby kau pobrano od 291 koni utrzymywanych systemem alkierzowym i alkierzowo pastwiskowym. Na podstawie uzyskanych wynikow obliczono ekstensywnosc zarazenia i srednia liczbe jaj supkowcow w 1 g kau (EPG) koni w roznym wieku. Ekstensywnosc zarazenia koni utrzymywanych alkierzowo (Stado Ogierow) wynosia 16,7 79,3% w pierwszym cyklu rocznym i 34,2 80% w drugim, a EPG odpowiednio: 78 675 i 88 340. Zarazenie koni utrzymywanych w systemie alkierzowo-pastwiskowym (Stadnina) byo wieksze i wynosio: 71,4 97,4% i 10,5 96,4%, a EPG 138 969 i 90 649 odpowiednio. W pierwszym klubie jezdzieckim, ce konie wypasane na pastwiskach byy bardziej zarazone niz konie z klubu jezdzieckiego korzystaja z padokow. U koni jednorocznych i dwuletnich utrzymywanych systemem alkierzowo-pastwiskowym (Stadnina) wykazano klasyczna dynamike zarazenia w cyklu rocznym, z dwoma szczytami wydalania jaj supkowcow, tj. wiosna i pod koniec sezonu pastwiskowego. W kale koni z wszystkich badanych obiektow liczba wydalanych jaj supkowcow wzrastaa wiosna (od kwietnia do maja), a w kale koni utrzymywanych systemem alkierzowo-pastwiskowym takze w czasie miesiecy letnio-jesiennych.

Ann. Anim. Sci., Vol. 6, No. 1 (2006) 139 148

EFFECT OF CROSSBREEDING ON PASTURE REARING OF LAMBS AND CHEMICAL AND SENSORY PROPERTIES OF SLAUGHTER MATERIAL*

Pawe Paraponiak Department of Technology, Ecology and Economics of Animal Production, National Resarch Institute of Animal Production, 32-083 Balice n. Krakow, Poland Abstract The aim of the study was to determine the effect of crossing Polish Mountain Sheep (PMS) ewes with Bergschaf (BF) and Weisse Alpenschaf (WAS) rams on the fattening and slaughter traits of the crossbreds and some chemical and sensory properties of their meat. A total of 140 ram lambs were investigated in 7 groups: PMS, BF, WAS, BF PMS, WAS PMS, BF (BF PMS) and WAS (WAS PMS), with 20 rams per group (10 animals in experiment and 10 animals in replication). From around 4 months of age, lambs were grazed in the rotational system and additionally fed with ground barley and ground wheat. The mean daily gains of the rams were calculated between 2 and 200 days of age. The cold dressing percentage was determined and the weight and proportion of valuable cuts in the right half-carcass were estimated. Detailed leg dissection was performed. Selected chemical and sensory properties of lamb meat were studied. WAS rams were characterized by the highest weight gains (211 g/day) and the highest empty body weight and cold carcass weight. The mean weight gains of the crossbred rams were 12 37% higher compared to those of PMS lambs. The dressing percentage of all the crossbreds was higher than the value established for PMS rams (P 0.01). The meat obtained from all the experimental rams was characterized by a desirable water to protein ratio, fat to protein ratio and pH value. The results of sensory analysis showed that the meat of F1 and R1 crossbred lambs has high taste value. In this respect, the meat of purebred WAS rams achieved lower scores. Key words: sheep, crossbreeding, growth, meat quality, carcass quality

Since the mid-1980s, there has been a dramatic decline in the Polish sheep population, in principle due to the marginalization of wool as a commercial product. Several programmes oriented towards meat performance and the optimum commercial utilization of slaughter material were developed to halt this negative trend. Considering this, and the fact that lamb meat is the only highly valued kind of meat

* This work was conducted as part of NRIAP statutory activity, project no. 1111.1.

140

P. Paraponiak

whose production fails to meet the domestic market demand within the European Union, a decision was made to increase the quota of imported Polish lamb by 10% a year (Okularczyk, 2000). This limit is not used due to the weak lamb meat market and poor reproductive and meat parameters of the native sheep breeds. The primitive Polish Mountain breed, which is the only native breed to be optimally suited to mountain conditions, serves as a good example. It is safe to assume that the carcasses of crossbreds derived from PMS ewes and rams with superior meatiness traits can be valuable export material and thus help to improve the profitability of sheep production in Poland. The aim of the present study was to determine the effect of crossing PMS ewes with BF and WAS rams on the fattening and slaughter traits of the crossbreds and the chemical and sensory properties of their meat.

Material and methods The study was conducted at the Sheep Breeding Research and Implementation decki Centre in Piorunka near Krynica Zdroj, located in the region of the Beskid Sa Mountains (550 m above sea-level). There were 140 ram lambs representing 7 groups: Polish Mountain Sheep (PMS), Bergschaf (BF), Weisse Alpenschaf (WAS), BF PMS, WAS PMS, BF (BF PMS) and WAS (WAS PMS), with 20 rams per group (10 animals in experiment and 10 animals in replication). To weaning at approximately 70 days of age, in addition to mothers milk the lambs received meadow hay and CJ concentrate mixture at 0.25 kg/day/animal (containing 5.33 MJ net energy and 190 g crude protein per kg). After weaning, rams were fed according to feeding standards with farm-produced fodders (hay, ensiled hay, ground maize) and commercial feeds (wheat and barley bran, sugar beet pulp with added whey). From the beginning of the grazing season (middle of May, around 4 months of age) rams were pastured in a rotational system and additionally fed with ground barley and ground wheat at approximately 0.25 kg/day/animal. The daily gains of the rams were calculated for the whole experiment. The body weight of the rams was determined prior to slaughter (after 24-h fasting). Slaughter at the age of 200 days and carcass processing were performed in accordance with the methods used at the National Research Institute of Animal Production. Cold carcass weight (after 24-h cooling at +4oC) and dressing percentage were determined. The proportion of valuable cuts (leg, saddle, best end of neck and shoulder) was calculated for the right half-carcass. Detailed leg dissection was performed to determine the weight and percentage of muscular, adipose and bone tissue in the leg. The chemical parameters of the meat, i.e. the water to protein ratio (W/P), the fat to protein ratio (F/P) and pH24 value (Radelkis device), were analysed on the longissimus dorsi muscle. The sensory analysis of the meat (musculus semimembranosus, 5-point scale) covered determination of the taste intensity and quality of meat samples.

Effect of crossbreeding on pasture rearing of lambs

141

The results were analysed statistically using multivariate analysis of variance, with experimental group, year and replication being the differentiating factors. No significant differences were found between years and replications in any of the traits studied. The statistical differences found between the groups are given in the tables. Post-hoc analysis was performed using Tukeys honestly significant difference test. The calculations were performed using the Anova/Manova procedure of Statistica for Windows.

Results PMS rams were characterized by the lowest dynamics of growth expressed as daily gains, and the differences in relation to the other experimental groups were highly significant (P 0.01). Of all the crossbreds, the highest rate of growth in the experimental period was found in the WAS (WAS PMS) group (mean gains of 199 g/day), and the growth rate was higher than that found in purebred BF lambs (185 g/day). The difference proved highly significant (P 0.01) (Table 1). The body weight of rams after 24-hour fasting ranged from 30.9 to 44.9 kg (Table 1). Both the PMS group (lowest body weight) and the WAS group (highest body weight) differed highly significantly from each other and from the other experimental groups. R1 crossbred rams were heavier than F1 crossbred rams, with no significant differences found between them. The high variation in pre-slaughter body weight resulted in considerable differences in cold carcass weight, with the heaviest carcasses found in the WAS group (20.2 kg) and the lightest in the PMS group (12.0 kg) (Table 1). The highest dressing percentage was characteristic of the meat of WAS rams (45.0%), and the difference in relation to the other groups, except R1 WAS (WAS PMS) crossbreds (44.0%), was highly significant (Table 1). The lowest weight of valuable cuts was found in PMS half-carcasses (3.35 kg) and this value was highly significantly different from the analogous results obtained in the other experimental groups, except the BF PMS crossbreds group (Table 2). Meanwhile, the highest proportion of valuable cuts was noted in WAS half-carcasses (58.49%) followed by 58.28% in WAS (WAS PMS) crosses. These experimental groups were significantly different in terms of this trait from the analogous values found in the half-carcasses of PMS, BF and BF PMS rams (55.14, 57.31 and 57.53%, respectively). The leg dissection results showed that the highest percentage of muscles was to be found in WAS rams (73.64%), and the differences in relation to all the other groups were statistically significant. The lowest meat content was found in PMS legs (63.03%), with a slightly higher proportion in BF PMS (64.44%) animals. The differences in relation to WAS, WAS (WAS PMS) and BF animals proved significant (Table 2). The highest proportion of adipose tissue (12.01%) occurred in the legs of F2 rams with 75% WAS blood. The proportion of leg bone tissue ranged from 16.55 (WAS) to 25.58% (PMS) (P 0.05).

142 Tab. 1, 2

P. Paraponiak

Effect of crossbreeding on pasture rearing of lambs

143

tab. 3

144

P. Paraponiak

Relative parameters of meat quality (longissimus dorsi muscle), i.e. the W/P ratio and the F/P ratio, were determined (Table 3). The highest W/P value (3.90) was found in the WAS PMS experimental group and the lowest (3.76) in the groups of F1 and F2 rams with 50 and 75% BF blood (P > 0.05). In the other experimental groups, this trait ranged from 3.77 in PMS to 3.86 in WAS. The lowest F/P ratio (0.09) was found in three groups (PMS, BF and BF PMS), although the differences in relation to all the other groups were not significant (Table 3). The lowest pH, measured 24 h postmortem, was characteristic of the meat of WAS rams (5.54), followed by BF PMS (5.55) and PMS (5.57) rams. These measurements in the above three groups were significantly lower than those obtained in all the other rams. The highest pH (5.69) was measured in the meat of BF (BF PMS) F2 crosses (Table 3). The lowest score for taste (4.09 points) was awarded to the meat of WAS rams. This value was highly significantly lower than the values obtained in all the other experimental groups (P=0.01). The best score for taste was awarded to the meat of WAS (WAS PMS) (4.58 pts), followed by BF (BF PMS) (4.54 pts), WAS PMS (4.53 pts), BF PMS (4.49 pts) and BF (4.44 pts) crossbreds. The differences between these groups were not significant. The taste intensity of PMS meat (4.31 pts) was significantly lower than that found in the meat of WAS PMS, WAS (WAS PMS) and BF (BF PMS) crosses (Table 3). The results of meat taste evaluation followed a similar pattern to the scores given for taste intensity. The meat of WAS rams was given a significantly lower score for taste (4.08 pts) compared to the score obtained in all the other experimental groups (P 0.01). The most favourable level of this trait was obtained by WAS (WAS PMS) (4.59 pts), BF (BF PMS) (4.54 pts) and WAS PMS rams (4.53 pts). The differences in this trait between the above three experimental groups and WAS and PMS animals were statistically significant (Table 3).

Discussion PMS rams were characterized by the lowest weight gains obtained throughout the experiment. In a study by Roborzynski and Petkowski (1989), PMS lambs had an inadequate growth rate, which averaged 87 137 g/day. BF rams had more dynamic weight gains than F1 and R1 crosses with 50 and 75% BF blood, and their weight gains during the period 2 200 days of age were lower than those of intensively fattened lambs. This applies to both purebred BF lambs 230 305 g/day (Ringdorfer, 1990; Niznikowski and Ringdorfer, 1994; Ringdorfer, 1997) and F1 crosses of BF ewes with WAS rams 322 405 g/day (Ringdorfer, 1998). WAS rams were characterized by the highest weight gains, which averaged 211 g/day, and were higher than the 199 g/day reported by Marguerat et al. (1995) and Schneeberger (1997). In accordance with the findings of Ciurus et al. (1980) and Roborzynski (1984), a beneficial effect of crossing PMS with meat breeds on

Effect of crossbreeding on pasture rearing of lambs

145

daily weight gains was found. The mean weight gains of crossbred rams were 12% (F1 BF PMS) to 37% [WAS (WAS PMS)] higher compared to the weight gains of PMS rams. The weight gains for the whole rearing period were higher in F1 crosses than in PMS lambs by 5-28% (Roborzynski, 1984; Roborzynski and Petkowski, 1989; Kiec, 1997). The lowest empty body weight (30.9 kg) was found in PMS rams. The results obtained by other authors concerning the body weight of PMS rams, reared to 180-210 days of age and fed in a similar way as in the present experiment, were lower and did not exceed 27 kg (Ciurus and Drozdz, 1988). Roborzynski and Petkowski (1989) reported a higher pre-slaughter weight of PMS animals (34.0 kg). Compared to PMS rams, the empty body weight of crossbred rams was 9.1 and 15.2% higher in F1 and R1 rams with BF breeding and 26.2 and 33.0% higher in F1 and R1 crosses sired by WAS fathers. Drozdz and Ciurus (1996) showed that compared to the maternal breed, pasture-reared F1 crosses (PMS ewes Friesian rams) experienced a 20-25% increase in body weight. Crossbred rams of the R1 generation WAS (WAS PMS) achieved the highest body weight of all the crossbred groups. The results of an experiment by Roborzynski et al. (2000) confirm the special predisposition of crossbreds sired by RAS rams to pasture fattening. The cold carcass weight of PMS rams was lower than that reported by Roborzynski and Petkowski (1989), who reared lambs on pasture to a higher final body weight of 34 35 kg. The weight of the heaviest carcasses from WAS animals was 68.3% higher than the analogous values obtained in PMS carcasses. The dressing percentage (38.8-45.0%) was close to the analogous results for pasture fattening reported by Ciurus et al. (1995) and Roborzynski et al. (2000). The lowest dressing percentage was characteristic of PMS rams (38.8%). The value reported by Ciurus and Drozdz (1988) was slightly lower (37.8%). Previous efforts to improve meatiness traits, in particular to increase the dressing percentage in PMS animals through the intensification of feeding, have not been successful. The dressing percentage of intensively fattened PMS rams reported by Kiec (1997), 38.2%, is similar to our results obtained for pasture fattening. A highly significantly higher dressing percentage, compared to that of PMS animals, was obtained in BF rams (42.7%), and this value was similar to the results obtained by Roborzynski et al. (2000). According to foreign language sources (Ringdorfer, 1988; Niznikowski and Ringdorfer, 1994; Ringdorfer, 1995; Ringdor fer, 1997), the dressing percentage of BF rams raised in Austria ranges from 45.1 to 49.5% and is considerably higher than the Polish results. These differences can be attributed to the use of different management systems for BF sheep. In Austria, BF lambs are fattened intensively to 22 42 kg final body weight using a feed rich in protein and energy (Ringdorfer, 1997). As in the study by Roborzynski et al. (2000), WAS meat rams were charac terized by the highest dressing percentage (45.0%) of all the experimental groups. Our results were 1.4 percentage units lower than the analogous results obtained during pasture fattening in Switzerland (Marguerat et al., 1995), but higher than the

146

P. Paraponiak

results obtained in Poland by Roborzynski et al. (2000). In all the groups of crossbred rams, the dressing percentage was significantly higher than in PMS rams. In terms of this trait, R1 crossbred rams were superior to F1 crossbreds derived from the same paternal breeds. This relationship may be linked to the increasing and beneficial effect of paternal breeds in the second generation. Contrary to the findings of Roborzynski et al. (2000), no significant differences were found in the above-mentioned trait between F1 rams originating from fathers of different breeds. One of the most important parameters of carcass meatiness is the weight and percentage of valuable cuts with the highest commercial and eating value. We found that the crossbreeding scheme used had an effect on the valuable cut content of carcass, with results similar to the findings of Roborzynski (1984). The poor meatiness of PMS animals in comparison with the other experimental breeds and crossbreds is confirmed by the fact that these animals had the lowest proportion of valuable cuts (55.14%). The percentage of valuable cuts in the half-carcasses of F1 and F2 crossbreds with the BF paternal component (57.53 and 57.95%, respectively) was significantly higher than the result obtained for the half-carcasses of PMS animals and did not show significant differences in relation to purebred BF rams (57.31%). The results we obtained for BF rams are consistent with those reported by Roborzynski et al. (2000) 57.68%. The half-carcasses of WAS meat rams were characterized by the highest proportion of valuable cuts (58.49%). This result is similar to that reported by Roborzynski et al. (2000) 58.52%. A very important indicator of carcass quality is the tissue composition of carcass, in particular that of the leg. The more muscle tissue it contains in relation to adipose and bone tissue, the more valuable a carcass cut is. The fat content of leg in all the experimental groups is considered desirable. The percentage of muscle tissue in WAS rams was inversely proportional to the fat content, and these animals achieved the highest value (73.64%), with a statistically significant difference compared to all of the other experimental groups. These results are consistent with the results of a study by Roborzynski et al. (2000), in which WAS rams had a significantly higher meat content (71.31%) and a low fat content (10.24%) compared to the other animals. The W/P ratio in meat ranged from 3.76 to 3.90 and was close to the results obtained by Kedzior (1995). The Feder number in adult slaughter animals ranges from 3.3 to 3.9. The level of this trait in the present study leads us to conclude that the analysed meat was derived from animals of normal somatic maturity. The F/P ratio ranged from 0.09 to 0.11 and the value of this ratio was reflected in the stable fat and protein content of the muscles of experimental rams. Covington et al. (1970) showed that a lower degree of the physiological maturity of muscles is associated with a high water content and low amount of intramuscular fat in the muscles. The mean pH values of the analysed meat ranged from 5.54 in the group of purebred WAS rams to 5.69 in the group of BF (BF PMS) crossbreds, and despite statistically significant differences these values were typical of meat with

Effect of crossbreeding on pasture rearing of lambs

147

normal properties (5.3 5.8) (Hofmann, 1987). These results are similar to those obtained by other authors (Freudenreich et al., 1985; Kedzior, 1995). High scores for taste intensity and quality were characteristic of the meat of F1 rams WAS PMS and F2 rams WAS (WAS PMS) and BF (BF PMS). The taste of WAS ram meat was given lower scores compared to the analogous results determined for the meat samples of rams from the other groups. The results of Roborzynski et al. (2000) have confirmed the poorer sensory value of the meat of WAS lambs. It is concluded that crossbred rams are characterized by more favourable fattening and slaughter traits compared to purebred PMS rams. The desirable level achieved for the selected chemical and sensory parameters of the meat obtained from the rams of all the experimental groups, in particular the crossbreds, is evidence of the high eating quality of the meat.
References C i u r u s J., D r o z d z A., K r u p i n s k i J. (1980). Przydatnosc do tuczu i wartosc rzezna mieszancow F1 z krzyzowania towarowego polskiej owcy gorskiej z trykami ras miesnych. Rocz. Nauk. Zoot., 7, 2: 125 135. t C i u r u s J., D r o z d z A. (1988). Porownanie wartosci rzeznej jagnia polskiej owcy gorskiej i jej mieszancow trojrasowych. Rocz. Nauk. Zoot., 15, 1: 69 78. t C i u r u s J., D r o z d z A., K o w a l s k i Z.M. (1995). Proby zwiekszenia przyrostow masy ciaa jagnia ca w odchowie i tuczu pastwiskowym do 6. miesia zycia. Rocz. Nauk. Zoot., 22, 1: 247 258. C o v i n g t o n R.C., T u m a H.J., G r a n t D.L., D a y t o n A.D. (1970). Various chemical and histological characteristices of beef muscle as related to tenderness. J. Anim. Sci., 30: 191. t D r o z d z A., C i u r u s J. (1996). Wartosc rzezna jagnia mlecznych owiec gorskich i ich mieszancow. Rocz. Nauk. Zoot., 23, 2: 43 55. F r e u d e n r e i c h P., W o l l n y C., W a s s m u t h R. (1985). Untersuchungen an Lmmern verschiedener Rassen und Kreuzungen. II. Chemische, physikalische und sensorische Ergebnisse. Mitteilungsblatt der Bundesanstalt fr Fleischforschung. Kulmbach, 90: 6694 6699. H o f m a n n K. (1987). Der pH Wert. Ein Qualittskriterium fr Fleisch. Fleischwirtschaft, 67, 5: 557 562. t. K e d z i o r W. (1995). Towaroznawcza charakterystyka jakosci miesa jagnia Zesz. Nauk. AE Krak., Monogr., 123. t K i e c W. (1997). Badania nad wykorzystaniem owiec gorskich do produkcji jagnia rzeznych. Mat. miedz. konf. nauk.: Rola owczarstwa gorskiego w realizacji krajowych programow hodowlanych dla owiec. IZ, Balice, 14.11.1997, ss. 33 40. M a r g u e r a t C., L u c h i n g e r R., L e u e n b e r g e r H., K u n z i N. (1995). Lammfleischproduktion auf der Weide. Die Grune, 2: 22 23. N i z n i k o w s k i R., R i n g d o r f e r F. (1994). Lammfleischproduktion im Alpenraum mit Bergschafen und deren Kreuzungen mit Merino und Schwarzkpfigem Fleischschaf. Zchtungskunde, 66, 1: 73 81. O k u l a r c z y k S. (2000). Ekonomiczne i rynkowe prognozy produkcji owczarskiej i koziej w Polsce. Zesz. Nauk. AR Wroc., 399: 49 56. R i n g d o r f e r F. (1988). Ausschlachtung und Verwertung von Schafen. Der fortschrittliche Landwirt: Zeitgemasse Schafhaltung, 12: 5. R i n g d o r f e r F. (1990). Gebrautskreuzungen mit Fleischrassen beim Schaf. Bericht ber die 17. Tierzuchttagung: Aktuelle Fragen der Milchvieh- und Schafhaltung, BAL Gumpenstein, 10.05.1990, ss. 1 9.

148

P. Paraponiak

R i n g d o r f e r F. (1995). Der Einfluss des Absetztermines auf die Zwischenlammzeit sowie auf die Qualitt der Mastlmmer beim Bergschaf. Bundesanstalt fr alpenlndische Landwirtschaft, Referat fr Schafe, Ziegen und Kleintiere, A-8952 Irdning. R i n g d o r f e r F. (1997). Das sterreichische Bergschaf und seine wirtschaftliche Bedeutung. Mat. konf. miedz:. Rola owczarstwa gorskiego w realizacji krajowych programow hodowlanych dla owiec. IZ, Balice, 14.11.1997, ss. 53 60. R i n g d o r f e r F. (1998). Qualittsverbesserung mit WAS Widder. Schafe aktuell, 3: 10 11. cych z krzyzowania t R o b o r z y n s k i M. (1984). Uzytkowosc miesna jagnia mieszancow F1, pochodza maciorek polskiej owcy gorskiej z trykami roznych ras. Acta Agr. Silv., Ser. Zoot., 23: 53 65. R o b o r z y n s k i M., P e t k o w s k i J. (1989). Przydatnosc polskich owiec nizinnych, dugowenistych i gorskich utrzymywanych w warunkach gor i pogorza do produkcji jagnieciny. Biul. Inf. IZ, 27, 5 6: 65 77. R o b o r z y n s k i M., K i e c W., K e d z i o r W., K n a p i k J., K r u p i n s k i J. (2000). Wyniki odchowu t pastwiskowego, wartosc rzezna oraz jakosc miesa jagnia mieszancow polskiej owcy gorskiej z trykami ras alpejskich. Rocz. Nauk. Zoot., Supl., 8: 98 103. S c h n e e b e r g e r M. (1997). Das Weisse Alpenschaf Hauptrasse fr die Lammfleischerzeugung in der Schweiz. Mat. miedz. konf. nauk.: Rola owczarstwa gorskiego w realizacji krajowych programow hodowlanych dla owiec. IZ, Balice, 14.11.1997, ss. 61 76.

Accepted for printing 18 IV 2006

PAWE PARAPONIAK

Wpyw krzyzowania miedzyrasowego na wyniki odchowu pastwiskowego jagnia t oraz wasciwosci chemiczne i sensoryczne surowca rzeznego STRESZCZENIE Celem podjetych badan byo okreslenie wpywu krzyzowania maciorek polskiej owcy gorskiej z trykami ras Bergschaf i Weisse Alpenschaf na cechy tuczne i rzezne mieszancow oraz na wybrane wasciwosci chemiczne i sensoryczne pozyskanego od nich miesa. Materia doswiadczalny stanowio 140 tryczkow podzielonych na siedem grup: polska owca gorska (pog), Bergschaf (BF), Weisse Alpenschaf (WAS), BF pog, WAS pog, BF (BF pog) i WAS (WAS pog) po 20 szt. tryczkow w kazdej grupie (10 szt. doswiadczenie, ca zycia jagnieta pasiono systemem kwaterowym, 10 szt. powtorzenie). Od okoo 4. miesia c . dokarmiaja sruta jeczmienno-pszenna Obliczono srednie przyrosty dobowe tryczkow od 2. do 200. dnia zycia. Okreslono wydajnosc rzezna zimna i oszacowano mase oraz udzia wyrebow wartosciowych w prawej potuszy. Prze prowadzono szczegoowa dysekcje udzca. Zbadano wybrane wasciwosci chemiczne i sensoryczne jagnieciny. Tryczki WAS charakteryzoway sie najwyzszymi przyrostami masy ciaa (211 g/dobe) oraz najwyzsza masa ciaa po godzeniu i masa tuszy schodzonej. Srednie przyrosty masy ciaa tryczkow mieszancow byy o 12 37% wyzsze niz przyrosty uzyskane przez jagnieta pog. Wydajnosc rzezna wszystkich mieszancow bya wyzsza od ustalonej dla tryczkow pog (P 0,01). Mieso pozyskane od danym stosunkiem wody do biaka, tuszczu wszystkich tryczkow doswiadczalnych odznaczao sie poza do biaka i wartoscia pH. Na podstawie wynikow oceny sensorycznej wykazano wysokie walory t smakowe miesa jagnia mieszancow pokolenia F1 i R1. Nizej pod tym wzgledem sklasyfikowano mieso czysto rasowych tryczkow WAS.

Ann. Anim. Sci., Vol. 6, No. 1 (2006) 149 167

EFFECTS OF YEAR-ROUND NESTBOX AVAILABILITY AND TEMPERAMENT ON WELFARE AND PRODUCTION PERFORMANCE IN BLUE FOXES (ALOPEX LAGOPUS)

H a n n u T . K o r h o n e n 1, L a u r i J a u h i a i n e n 2, T e p p o R e k i l 1 MTT Agrifood Research Finland Animal Production Research, Fur Animals FIN-69100 Kannus, Finland 2 Data and Information Services, FIN-31600 Jokioinen, Finland

Abstract This study was designed to evaluate the long-term effects of nestbox and temperament traits on welfare and performance in juvenile and adult blue foxes (Alopex lagopus). Fearful and confident animals were raised with and without nestboxes during the growing and breeding seasons. Experimental groups formed at weaning were: 1) confident, no nestbox available; 2) confident, with a year-round nestbox; 3) fearful, no nestbox available; and 4) fearful, with a year-round nestbox. Each group was comprised of 60 females housed singly. The results showed that foxes without nestboxes grew significantly (P = 0.01) better than those with nestboxes. Temperament had no effect on final body weights. Confident foxes were more explorative (P < 0.01) than fearful ones, and foxes without nestboxes were more explorative than those with nestboxes (P = 0.06). Capture tests revealed that access to a permanent nestbox significantly (P < 0.001) increased fearfulness in the long run. Foxes with nestboxes more frequently showed an escape reaction to human presence than foxes without nestboxes. No significant differences were detected between temperament or nestbox availability groups in the frequency of stereotypical behaviours, the cortisol:creatinine ratio or reproductive success. The fur coat of foxes with nestboxes was dirty, which significantly (P < 0.001) reduced the quality of fur. It can be concluded that year-round access to nestboxes increases fearfulness in farmed blue foxes. Nestboxes may also otherwise compromise animal welfare. Key words: blue fox, year-round shelter, welfare

Central tools in the enhancement of animal welfare are the proper construction and enrichments of housing conditions where farmed animals are kept (Chamove, 1989; Newberry, 1995). These modifications should be done so that they allow the performance of species-specific behaviour and provide essential needs as well as possible. Previously, farmed blue foxes (Alopex lagopus) were kept in a barren wire-mesh environment, but now their cages are furnished with a netting platform and an activity object made of wood (European Convention, 1999; Korhonen and

150

H.T. Korhonen et al.

Niemel, 2000; Korhonen et al., 2002 a). Although these enrichments provide foxes with an opportunity to perform behaviours such as observing, resting, playing and chewing, they do not necessarily satisfy all of their behavioural needs. Recent European welfare stipulations (European Convention, 1999; Hovland and Bakken, 2000) have put pressures on farmers to also enrich housing cages with year-round nestboxes. It is assumed that foxes need a constant place to hide or seek shelter from humans and their surroundings. Until now, boxes have only been provided for breeding vixens as a nest or a place to deliver and nurse the cubs from April onwards. Breeding boxes have been taken away before weaning in July. The elimination of fear in farmed foxes is one of the main objectives in European animal welfare legislation (European Convention, 1999). This is because fear can be a distinct state of suffering and a significant damaging stressor (Jones, 1997; Korhonen et al., 2002 b, c). However, the provision of year-round nestboxes may run counter to European legislative goals as they might have detrimental effects on fox temperament (Hovland and Bakken, 2000). It seems that constant access to cover from man allows animals the opportunity to develop a behavioural strategy of hiding. Thus, instead of domestication it would lead to a process of feralization, where a domesticated temperament evolves back into a wild one, producing individuals with a fearful reaction towards humans (Korhonen et al., 2000; Ahola, 2002). If this prediction holds true, it may have further consequences due to the close link between fear and welfare. For example, decreased fear in blue foxes is associated with a decreased stress response (Rekil et al., 1997), and positive behavioural and physiological changes have been found in silver foxes selected for tameness or against fear (Koleshnikova et al., 1985; Osadchuk, 1992). Moreover, fear has a negative influence on reproductive physiology. Examples include the finding that confident silver and blue foxes tend to have a better reproductive performance than fearful ones (Braastad, 1988; Kristensen, 1989, Bakken 1994) or non-selected ones (Hansen, 1998; Kenttmies et al., 1997; Jeppesen and Pedersen, 1998). Temperament appears to affect reproduction in several ways. For example, fearful vixens may be difficult to mate, or sensitive to abortion, or they may lose their cubs because of pronounced behavioural disorders or poor maternal ability (Ilukha et al., 1997; Korhonen and Niemel, 1996). Year-round nestboxes could also pose other problems as foxes may use them as a place to defecate. Dirty boxes may increase hygiene problems and cause a deterioration in fur quality (Hovland and Bakken, 2000; Korhonen et al., 2003 a, b). A dirty fur coat may also be problematic because it has a lower insulation capacity, exposing the animal to excessive cold during the autumn and winter (Korhonen, 1987; Korhonen et al., 2001, 2003 a). Detrimental effects of dirty nestboxes would be more pronounced in fearful than confident animals because the former are expected to frequently hide and seek cover in the nestbox. Thus, whether there is an actual causal relationship between permanent access to a nestbox and welfare, or between nestbox availability, temperament and productive performance, is a matter of real concern and requires further investigations.

Effects of nestbox availability and temperament on blue fox welfare

151

The aim of the present study was to examine how year-round access to nestboxes and temperament affect the welfare and production performance of farmed blue foxes (Alopex lagopus). Animals of fearful and confident origin were therefore housed with and without nestboxes during the growing and breeding seasons.

Material and methods


Subjects and general managements

This study was carried out at the Fur Farming Research Station of MTT Agrifood Research Finland (MTT), in western Finland (63.54oN, 23.54oE). In mid-October 2002, 50 confident and 50 fearful primiparous vixens (Alopex lagopus) were selected from the research farms breeding stock. Selection was based on the feeding test (Rekil et al., 1997) which was performed as follows: the experimenter gave the tested fox a feed portion and then withdrew 50 cm from the cage door. If the animal did not start eating within 1 min, it was considered fearful. Foxes that dared to eat were classified as confident. Feed was withheld from the animals for 24 h before the test. In March 2003, vixens were artificially inseminated according to conventional farming procedures. Cubs were born during May 2003. Until weaning, they were housed with their mothers and littermates in conventional shed cages measuring 120 cm long 105 cm wide 70 cm high. At weaning on 30 July, cubs were divided into four experimental groups: 1) confident, no nestbox available; 2) confident, with a year-round nestbox; 3) fearful, no nestbox available; and 4) fearful, with a year-round nestbox. Each group was comprised of 60 individuallyhoused females. The cage size was 120 cm long 105 cm wide 70 cm high for both groups. Each cage contained a wire-mesh platform (105 cm long 25 cm wide) positioned 23 cm from the ceiling. A birchwood block (7 cm long diameter 5 cm) was available as an activity and chewing objects. Nestbox groups (1 and 3) had a permanently available wooden nestbox (40 cm wide 70 cm long 40 cm high). The foxes were placed in the shed with one animal from groups 1, 2, 3 and 4 being placed after each other. Thus, every second cage contained a nestbox. Freshly mixed fox feed was supplied twice a day by a commercial feeding machine. The daily feed ration was the same for each group, ranging from a minimum of 500 g (July) to a maximum of 1000 g (October) per animal daily. Feed was made by the local feed kitchen (Kannus Minkinrehu Ltd), with the main ingredients consisting of slaughterhouse offal, fish, fish offal and cereals, in accordance with the standard Finnish recommendations. Fresh water was available ad libitum from automatic watering devices. The health of the experimental animals was visually checked daily.
Behavioural tests

Capture test: foxes were caught by using neck tongs. The reaction to capture was classified as follows: 1=confident, accepting capture; 2=fearful, trying to

152

H.T. Korhonen et al.

escape; and 3=non-reactive, passive (Harri et al., 1995). Evaluations were made each time by the same person. After capture, body weights were measured on a Vaakakoskinen AD-4326A balance (accuracy 20 g).
Table 1. Behaviour categories and short description of behavioural elements Category In locomotion Jump onto platform On platform Jump off platform Escape Passive Inside nestbox On nestbox roof Description walking, moving on the cage floor jump from the cage floor to the platform sleeping, lying or sitting on the platform jump from platform to the cage floor escape to the nestbox, nestbox roof, platform or backwards on cage floor non-reactive on the cage floor, motionless staying inside the box; animal cannot be seen sleeping, lying or sitting on the nestbox roof

Walking test: the animals position in the cage and reaction towards man were evaluated here by scanning observations. These took place from Monday to Friday, i.e. during 5 days between August-November, and January-March. The total number of scannings was 40 and 30 per fox during the growing and breeding seasons, respectively. They were performed twice each day at 09.30 and 14.30. The experimenter walked quietly and slowly along the feed alley and recorded the animals location and behaviour of each animal in the cage when the experimenter was at a distance of 1 m from the cage (Harri et al., 1998; Korhonen et al., 2001). During each scanning observation, half of all cages were approached from the right side and the other half from the left side. The behavioural categories recorded are presented in Table 1. Stereotypical behaviour was evaluated on the basis of the categorization of Korhonen et al. (2001). However, different forms of stereotypical behaviour were not recorded separately. Ball test: this test was used to identify foxes showing exploratory behaviour towards novel objects. A baseball (diameter 7 cm) was placed in the cage, close to the door opening, after which the cage door was closed. The number of animals that made contact with the ball during 1 min were recorded. The ball was cleaned with paper after each test (Rouvinen et al., 1999). Feeding test: the reaction (confident vs fearful) of foxes in the presence of man was evaluated here. The test began with the experimenter giving the fox a feed portion and then withdrawing 50 cm from the cage door. If the fox did not begin eating it within 1 min, it was considered fearful (Rekil et al., 1997). Feed was withheld from the animals for 24 h before the test. The feeding test was carried out on the same days as the ball test.
Urine and blood analyses

Wooden trays were placed under the cages to collect samples of urine over 24 h. The trays were covered with gauze to separate faeces from urine. Urine was

Effects of nestbox availability and temperament on blue fox welfare

153

collected in August and October 2003, and in February and July 2004. After each 24-h collection period, the urine samples were weighed and bottled, and stored at 20oC. The collection trays were carefully cleaned before each sampling day. Samples were delivered frozen for analysis at the University of Kuopio (cortisol) and Kuopio University Hospital (creatinine). The urine cortisol concentration (nmol/l) was determined using a competitive immunoassay technique (Coat-ACount Cortisol Assay by Diagnostic Products Corporation, Los Angeles, CA). The urine creatinine concentration was determined by kinetic Jaffes reaction (Lasley and Kirkpatrick, 1991). Urinary cortisol was finally expressed as the cortisol:creatinine ratio to correct for variation in the dilution of urine. For the blood analysis, a fox was caught with neck tongs, and a blood sample was drawn from the cephalic vein into 5-ml sampling tubes. All samples were taken within 2.5 min of the start of capture. Blood stabilized with K-EDTA was used for the determination of haemoglobin (Hb), the erythrocyte count (RBC), whole blood cell count (WBC), and haematocrit (HCT) by a Cell-Dyn 400 counter (SequoiaTurner Corp., USA). Blood samples were immediately sent to the Equine Research Station at Ypj (MTT), where analysis was carried out during the next day.
Conditions of nestboxes and furs

The dirtiness of nestboxes was visually evaluated in August and October 2003, and March 2004 on a scale of 1 4 where: 1=clean, 2=slightly dirty, 3=moderately dirty and 4=very dirty (Korhonen et al., 2003 b). Evaluations were made by the same person. The dirtiness of furs was evaluated in December 2003 on a scale of 1 4 where: 1=clean, 2=slightly dirty (few dirty spots), 3=moderately dirty (several dirty spots) and 4=very dirty (most of fur covered by dirty spots).
Matings and whelpings

Before matings (20 February 2004), the occurrence of urine inflammation in vixens was evaluated. After visual inspection, the pH, and levels of protein and glucose in the urine were measured using Bayer urine test sticks (Bayer Diagnostics Ltd, Bridgend, UK). The test is based on a colour reaction, providing a rough estimate of the occurrence of inflammation in the urinary tract. Ten vixens from each nestbox group were tested. Breedings started on 25 March and lasted until 1 May, 2004. The animals were artificially inseminated on the second day after the peak in vaginal electrical resistance. Re-mating took place on the following day. Three weeks before whelping, all vixens were provided new breeding nestboxes (40 cm wide 70 cm long 40 cm high) made of wood. The number of cubs was counted on the first day after parturition, and at 3 weeks and 7 weeks postpartum.
Statistical methods

The experimental design was the completely randomized design and it was taken into account in each statistical analysis. Body weight, the logarithm of the cortisol:creatinine ratio, and different variables measured from blood samples (e.g. Hb, HCT, RBC, and WBC) were normally distributed. Body weight and the cortisol:creatinine ratio were measured several times during the study from the same animal. However, both variables were analysed in two periods: the growing

154

H.T. Korhonen et al.

season and the breeding season, with more than one measurement time in each periods. Repeated measurements from the same animal were correlated and the correlation was taken into account in a standard repeated measurement analysis of variance model (Littell et al., 1996). An unstructured covariance structure for repeated measurements was selected in each analysis based on Akaikes Information Criteria (Wolfinger, 1996). Simple one-way ANOVA was used to analyse the blood sample data. The assumptions of both models were checked by graphical methods: a box-plot for normality of errors; and plots of residuals for constancy of error variance. Analyses were performed using the SAS system for Windows, release 8.2 and the MIXED procedure (SAS, 1999). All categories in the walking test, the number of cubs per vixens, the feeding test, the ball test, capture reaction, fur quality, and dirtiness of fur and the nestbox were measured on at least an ordinal scale. These variables were therefore analysed using Kruskall-Wallis ANOVA or the chi-square test. Statistical comparisons for the two main factors, temperament and nestbox, were performed with the SAS/IML program developed by Berry (1995) using Kruskall-Wallis ANOVA. The chisquare test was performed using the SAS/FREQ-procedure and the two main factors were tested separately.

Results
Growing season

Initial body weights were similar in each group (Table 2). Furthermore, no significant differences were found in final body weights between animals of confident and fearful temperament (P = 0.12). However, the nestbox-by-time interaction was significant (P = 0.02). At the final weighing (Nov 17), foxes without nestboxes were significantly heavier than those having nestboxes (10.7 vs 10.4 kg; P = 0.01).
Table 2. Comparison of measured physiological, behavioural and fur variables during the growing season 2003. P1: between the four groups, P2: effect of temperament, P3: effect of nestbox Variable 1 Body weight (kg): July 22 Sept 30 Nov 17 Contact with ball (%)a July 24 Nov 18 Come to eat (%)b July 25 Nov 18 Confident 2 2.8 8.4 10.6 22 53 70 43 Confident box 3 2.8 8.2 10.2 10 40 90 43 Fearful 4 2.7 8.4 10.8 13 35 85 42 Fearful box 5 2.7 8.3 10.5 13 25 70 22 P1 6 ns ns 0.02 ns 0.01 < 0.01 0.04 P2 7 ns ns ns ns < 0.01 ns 0.06 P3 8 ns ns 0.01 ns 0.06 ns ns

Effects of nestbox availability and temperament on blue fox welfare Table 2 contd. 1 Capture on July 22 (%) confident fearful non-reactive Capture on Nov 17 (%) confident fearful non-reactive Cortisol:creatinine Aug 19 Oct 23 Red blood cells (109 cells 1 1) Dec 3 White blood cells (109 cells l1) Dec 3 Haematocrit (%) Dec 3 Haemoglobin (g/l) Dec 3 Clean fur coat (%) Dec 11 Excellent fur quality (%) Dec 11
a b

155

2 12 8 80 68 7 25 9.6 9.5 8.8 7.4 52 164 100 32

3 13 8 78 57 22 22 7.6 8.3 8.9 9.2 53 163 37 8

4 0 30 70 49 10 41 7.6 9.2 8.9 8.0 53 165 100 27

5 0 32 68 52 27 22 8.2 8.3 8.9 8.4 52 163 58 10

< 0.001 < 0.001

ns

< 0.01

ns

< 0.005

ns ns ns ns ns ns < 0.001 ns

ns ns ns ns ns ns 0.08 ns

ns ns ns 0.06 ns ns < 0.001 < 0.001

ball test. feeding test.

Initially, the ball test (July 24) did not reveal any substantial differences in explorative behaviour between the groups (Table 2). On November 18, however, confident animals were more explorative than fearful ones (47 vs 30% of animals touched the ball, P < 0.01). Furthermore, foxes without nestboxes were more explorative than those with nestboxes (44 vs 33% of animals touched the ball, P = 0.06). Capture tests revealed significant differences between the groups (P<0.001; Table 2). On July 22, foxes grouped initially as confident showed a more confident temperament at capture than those initially grouped as fearful (13 vs 0% of animals, P < 0.001). The same tendency was found on November 17 (63 vs 50% of animals). Correspondingly, foxes initially grouped as fearful had more fearful temperament on July 22 than those grouped as confident (31 vs 8% of animals, P<0.001). On November 17, however, this difference was no longer significant (31 vs 23% of animals). In the capture test in July, 74% of all animals were non-reactive (passive), while in November 59% and 11% of these animals were changed to behaving confidently or fearfully, respectively, and the remaining animals (30%) were non-reactive in both tests. The change was not similar in all treatment groups (P < 0.001). However, no statistically significant difference was found between the two temperament groups (P = 0.21). The difference between animals with and

156

H.T. Korhonen et al.

without nestbox was clear (P < 0.005). Only 3% of animals without a nestbox changed from the non-reactive class to the fearful class, while the change for animals with a nestbox was 18%. The corresponding percentages were 5% and 24% (P < 0.01) when animals that were non-reactive in both tests were excluded from the statistical analysis.
Table 3. Behavioural reactions during the walking tests (% of observations). Recorded during the growing season 2003. P1: between the four groups, P2: effect of temperament, P3: effect of nestbox Variable In locomotion July 28 Aug 1 Sept 1 9 Oct 6 10 Nov 10 14 Jump onto platform July 28 Aug 1 Sept 1 9 Oct 6 10 Nov 10 14 On platform July 28 Aug 1 Sept 1 9 Oct 6 10 Nov 10 14 Jump off platform July 28 Aug 1 Sept 1 9 Oct 6 10 Nov 10 14 Escape July 28 Aug 1 Sept 1 9 Oct 6 10 Nov 10 14 Passive July 28 Aug 1 Sept 1 9 Oct 6 10 Nov 10 14 Inside nestbox July 28 Aug 1 Sept 1 9 Oct 6 10 Nov 10 14 On nestbox roof July 28 Aug 1 Sept 1 9 Oct 6 10 Nov 10 14 Confident Confident box 5.0 11.2 18.2 29.8 0.2 1.2 1.5 2.9 30.8 35.0 25.2 10.6 1.2 5.2 2.3 3.3 2.2 6.2 5.5 8.1 30.2 21.5 26.5 19.0 10.8 7.5 7.7 17.9 15.7 6.2 8.2 2.9 Fearful Fearful box 5.4 12.2 15.6 31.8 0 0.9 3.7 2.3 35.6 42.2 33.1 17.2 1.2 3.2 1.9 2.8 1.9 4.1 6.3 8.5 34.1 19.3 21.4 14.0 8.8 5.2 8.1 15.9 11.2 5.8 5.4 1.9 P1 < 0.001 ns ns 0.07 ns 0.03 ns 0.09 < 0.01 < 0.001 < 0.001 < 0.001 0.09 0.05 ns ns 0.03 0.08 0.02 ns < 0.01 ns 0.02 ns ns ns ns ns ns ns ns ns P2 P3 < 0.001 0.03 ns ns ns 0.02 ns ns < 0.005 < 0.001 < 0.001 < 0.001 0.02 0.07 ns ns < 0.005 0.04 < 0.005 ns < 0.001 ns 0.02 ns

10.5 15.5 21.5 35.6 0.3 4.5 5.2 8.8 42.2 52.7 50.3 37.1 0.2 3.8 4.0 3.8 0.3 4.5 5.2 8.8 46.2 22.2 18.3 13.3

11.6 17.5 15.9 29.3 0.2 1.8 2.5 5.7 42.3 54.1 62.1 46.7 0.2 2.1 1.6 2.9 0.2 3.1 2.8 6.4 44.3 22.1 16.4 12.5

ns ns ns ns ns ns ns ns ns ns 0.05 ns ns 0.04 ns ns ns ns ns ns ns ns 0.06 ns ns ns ns ns ns ns ns ns

Effects of nestbox availability and temperament on blue fox welfare

157

No significant differences were found in cortisol:creatinine ratio between the groups (Table 2). White blood cell counts were significantly higher (P = 0.06) in foxes with nestboxes compared to those without nestboxes. No other differences were found in blood picture parameters. All furs in animals without nestboxes were clean whereas the furs of foxes having nestboxes were mostly very dirty. Furthermore, fur quality was significantly poorer (P < 0.001) in animals with nestboxes (Table 2). Walking tests revealed several significant differences between the groups (Table 3). Temperament had some effects on locomotion, i.e. foxes having nestboxes were less frequently observed moving on the cage floor both in July August (11.1 vs 5.2% of animals in locomotion; P < 0.001) and September (16.5 vs 11.7% of animals, P = 0.03). Foxes without nestboxes used platforms significantly more frequently than foxes having nestboxes during each walking test period (Table 3). Temperament affected platform use only during September when fearful foxes were more frequently observed on the platform than confident ones (47.8 vs 37.8% of animals, P = 0.05). Foxes with nestboxes showed more frequent escape reaction compared to those without nestboxes. In confident foxes in August, September, October and November the escape reaction of moving into the nestbox comprised 1.7, 4.0, 2.3 and 2.3%, respectively, of all escapes. The corresponding percentages in fearful foxes were 1.7, 2.5, 2.0 and 3.2. No significant differences were recorded in the relative frequency of escaping to the nestbox between fearful and confident foxes. Temperament did not affect the use of nestbox or nestbox roof. Initially, foxes without nestboxes were more passive in the walking test than foxes with nestboxes. In September, however, no differences were found, while in October foxes with nestboxes were more passive but differences did not exist in November (Table 3). No stereotypical behaviours were observed in August, September and October at all. In November, the percentages of observations in which stereotypical behaviours were recorded were 1.3, 0.8, 0.2 and 0 in Groups 1 4, respectively.
Breeding season

Significant differences were recorded in body weights between the groups during the pre-mating period January-March (Table 4). Confident foxes were significantly lighter than fearful ones (on January 7: 9.9 vs 10.2 kg; on February 5: 9.8 vs 9.6 kg; on March 16: 8.9 vs 8.6 kg). Furthermore, foxes without nestboxes were significantly heavier than those with nestboxes (on January 7: 10.2 vs 9.9 kg; on February 5: 9.9 vs 9.6 kg; on March 16: 8.9 vs 8.5 kg). The ball test on January 22 (Table 4) showed that confident animals were more explorative than fearful ones (66 vs 47% of animals). This difference was no longer significant in February or March. Foxes with nestboxes were more explorative (63 vs 50% of animals) than those without nestboxes on February 18. Feeding tests did not indicate any differences between the groups (Table 4). The capture test demonstrated that foxes without nestboxes were more confident (77 vs 60% of animals) than those with nestboxes. None of foxes were classified as non-reactive on capture (Table 4). Originally (July 22), however, 74% of all animals were

158

H.T. Korhonen et al.

non-reactive in the capture test. In March, 71% and 29% of these animals were changed to behaving confidently or fearfully, respectively. The change was not similar in all treatment groups (P < 0.005). However, no statistically significant difference was found between the two temperament groups (P = 0.22). The difference between animals with and without a nestbox was clear (P < 0.001). Only 16% of animals without a nestbox were changed from the non-reactive class to the fearful class, while the percentage was 42% for animals with a nestbox.

Table 4. Comparison of measured physiological, behavioural and fur variables during the 2004 breeding season. P1: between the four groups, P2: effect of temperament, P3: effect of nestbox Variable Body weight (kg): Jan 7 Feb 5 Mar 16 Contact with ball (%)a Jan 22 Feb 18 Mar 10 Come to eat (%)b Jan 21 Feb 19 Mar 11 Capture on March 16 (%) confident fearful non-reactive Cortisol:creatinine Feb 20 July 30 Clean fur coat (%) Mar 16 Confident Confident box Fearful Fearful box P1 P2 P3

10.1 9.8 8.8 68 67 57 27 32 22 80 20 0 6.2 2.5 77

9.7 9.4 8.4 63 48 60 40 43 28 55 45 0 7.4 2.5 15

10.3 10.0 9.1 44 59 54 34 32 32 74 26 0 5.9 2.3 83

10.0 9.7 8.7 50 51 43 32 31 28 66 34 0 6.4 2.6 27

< 0.01 < 0.01 < 0.005 0.03 ns ns ns ns ns

0.07 0.06 0.03 < 0.005 ns ns ns ns ns

< 0.005 < 0.005 < 0.001 ns 0.04 ns ns ns ns

0.02

ns

< 0.01

ns ns < 0.001

ns ns ns

ns ns < 0.001

Table 5. Condition (%) of nestboxes in confident and fearful nestbox groups Scale 1 4, where 1 = clean, 2 = slightly dirty, 3 = dirty, 4 = very dirty Variable Aug 26: Oct 2: March 16: confident fearful confident fearful confident fearful Clean 6.7 8.3 6.7 10.0 0 0 Slightly dirty 65.0 70.0 31.7 45.0 16.9 24.1 Dirty 28.3 21.7 41.7 36.7 18.6 20.7 Very dirty 0 0 20.0 8.3 64.4 55.2

Effects of nestbox availability and temperament on blue fox welfare

159

The cortisol:creatinine ratio was the same order of magnitude in each group in both February and July (Table 4). Evaluation of the dirtiness of the fur coat (on March 16) showed that the percentage of foxes with a clean fur coat was significantly higher among foxes without nestboxes than those having a nestbox (80 vs 21% of animals) (Table 4). The temperament of the foxes did not affect the dirtiness of nestboxes (Table 5).

Table 6. Behavioural reactions during the walking tests (% of observations) recorded during the 2004 breeding season. P1: between the four groups, P2: effect of temperament, P3: effect of nestbox Variable In locomotion Jan 12 16 Feb 9 13 Mar 1 5 Jump onto platform Jan 12 16 Feb 9 13 Mar 1 5 On platform Jan 12 16 Feb 9 13 Mar 1 6 Jump off platform Jan 12 16 Feb 9 13 Mar 1 6 Escape Jan 12 16 Feb 9 13 Mar 1 5 Passive Jan 12 16 Feb 9 13 Mar 1 5 Stereotypy Jan 12 16 Feb 9 13 Mar 1 5 Inside nestbox Jan 12 16 Feb 9 13 Mar 1 5 On nestbox roof Jan 12 16 Feb 8 13 Mar 1 5 Confident Confident box 24.7 24.2 22.5 1.8 3.5 3.5 12.2 8.5 9.3 1.2 5.0 4.3 4.7 8.5 7.8 37.7 33.3 32.5 0.2 0.2 0.3 4.7 3.9 4.9 3.3 3.5 2.8 Fearful Fearful box 24.6 21.2 20.7 2.5 4.9 6.1 21.5 21.4 18.5 1.0 3.9 5.8 4.8 9.7 10.5 32.4 19.0 20.0 0 0 0.5 4.0 4.1 4.5 3.6 2.0 2.4 P1 P2 P3

26.8 13.0 13.7 9.0 20.7 21.0 24.2 24.8 28.8 3.2 4.8 4.8 9.0 20.8 21.0 36.5 32.8 28.5 0 1.8 1.7

24.9 11.8 11.3 5.3 13.9 15.6 38.4 37.9 40.5 0.8 3.3 2.1 5.7 14.6 16.1 25.4 23.4 21.0 0.5 2.8 1.6

ns 0.01 < 0.01 0.08 < 0.001 < 0.01 < 0.005 < 0.001 < 0.001 0.06 ns ns ns ns ns ns 0.05 0.02 ns ns ns ns ns ns ns ns ns

ns ns ns ns ns ns 0.05 < 0.01 ns 0.04 ns ns ns ns ns 0.05 < 0.001 < 0.01 ns ns ns ns ns ns ns ns ns

ns < 0.005 < 0.005 0.02 < 0.001 < 0.005 < 0.001 < 0.001 < 0.001 ns ns ns ns ns ns ns ns ns ns ns ns

160

H.T. Korhonen et al.

According to walking tests (Table 6), foxes with nestboxes were significantly more often in motion both in February (22.7 vs 12.4% of animals) and March (21.6 vs 12.5% of animals). Furthermore, foxes with nestboxes spent significantly less time on platform in January (16.8 vs 31.3% of animals), February (14.9 vs 31.4% of animals) and March (13.9 vs 34.7% of animals). Temperament also affected platform use, i.e. fearful foxes stayed significantly more frequently on the platform in January (30.1 vs 18.2% of animals), February (29.8 vs 16.7% of animals) and March (29.7 vs 19.1% of animals). However, more confident than fearful animals were seen to jump onto the platform (Table 6). The number of foxes showing an escape reaction, passive behaviour or stereotypy during the walking tests did not differ between the groups. Among confident foxes the reaction of escaping to the nestbox comprised 0.5, 0 and 0.7% of all escapes in January, February and March. The corresponding percentages in fearful foxes were 1.5, 2.4 and 1.9. Temperament did not affect the number of foxes staying inside nestbox or on nestbox roof. Urine analyses revealed no immediate signs of urinary inflammation before the mating season (on February 20). In each group, the urine pH was 6.1. Furthermore, no glucose was detected in the urine at all. A slight tendency for an increased protein level in the urine (< 0.5 g/l) was found from 10 and 7 animals in confident and fearful nestbox groups, respectively.
Table 7. Reproductive performance in experimental groups. Litter size and cub losses are given as number of kits per vixen. P1: between the four groups, P2: effect of temperament, P3: effect of nestbox Variable Total N of vixens Mated, N Whelped, N Breeding vixens litter size at 1 wk 3 wks 7 wks Mated vixens litter size at 1 wk 3 wks 7 wks Whelped vixens litter size at 1 wk 3 wks 7 wks cub losses (1 7 wks) Confident 60 30 29 3.9 3.1 2.9 6.0 4.7 4.4 9.0 7.2 6.7 2.3 Confident box 60 40 25 4.0 2.8 2.7 7.3 5.1 4.8 10.0 7.1 6.7 3.4 Fearful 60 35 29 4.4 3.4 3.1 7.6 5.3 5.0 9.1 7.0 6.4 2.7 Fearful box 60 35 26 3.6 3.1 2.9 6.3 5.3 4.9 9.0 7.7 7.2 1.8 P1 P2 P3

ns ns ns ns ns ns ns ns ns ns ns ns

ns ns ns ns ns ns ns ns ns ns ns ns

ns ns ns ns ns ns ns ns ns ns ns ns

Matings started in confident and fearful animals with nestboxes on April 1, and in those without nestboxes on April 2. Mating was first completed in fearful animals with nestboxes on May 5, then in fearful foxes without nestboxes on May 8, and

Effects of nestbox availability and temperament on blue fox welfare

161

finally in confident animals with and without nestboxes on May 8. Mating percentages were: confident, no nestbox 66.7%; confident with nestbox 50.0%; fearful, no nestbox 59.3%; and fearful, with nestbox 58.3%. Reproductive performance is summarized in Table 7. No significant differences were found between the groups in whelping results as calculated per breeding or per mated or whelped vixens. Furthermore, litter size did not differ between the groups as calculated at 1 week, 3 weeks or 7 weeks.

Discussion One of main predictions in this study was that constant access to a nestbox intensifies fearfulness in farm-raised foxes. This prediction was directly evaluated here by two methods, namely, using the feeding and capture tests. The former test is assumed to elicit the conflicting motivations of hunger and fear whereas the latter measures animals immediate reaction to capture. Consequently, the two tests differ in strength (Korhonen and Niemel, 1996; 2000), i.e. the capture test is considered more powerful because the cage door is opened and the animal is reached for, and finally caught. Our results showed that the number of foxes being fearful in feeding tests was of the same order of magnitude, whether a nestbox was present or not. The result was the same during both the growing and breeding seasons. Our capture tests, however, demonstrated significant differences between foxes with and without nestboxes. During the growing season the percentage of fearful animals increased significantly more among foxes with than those without a nestbox. The result was the same when comparing the development of a fearful temperament in the long term, i.e. the change from July near weaning to March near matings. These findings clearly support our prediction that permanent access to a nestbox increases fearfulness in blue foxes.

Figure 1. Experimental set-up for animals with nestboxes, a) wooden nestbox; b) wire-mesh platform; and c) wooden block. Animals without nestboxes had an otherwise similar set-up, except the nestbox was lacking

162

H.T. Korhonen et al.

Fearfulness can also be indirectly assessed from our walking test results. Data from the growing season showed that an escape reaction occurred more frequently in foxes having nestboxes compared to those without nestboxes. This is a clear indication of greater fearfulness in foxes with nestboxes. During the breeding season, however, the difference between foxes with and without nestboxes disappeared. At the approach of the breeding season, hormonal changes in the foxes may influence their temperament so that they become less trustful to humans. Our results unambiguously proved that constant nestbox availability leads to a dirty fur coat. This can be problematic, as a dirty coat typically increases hygiene and disease problems (Hovland and Bakken, 2000; Korhonen et al., 2003 a, b). Furthermore, a dirty fur coat also lowers the insulation of the coat, therefore creating a welfare problem due to excessive heat loss particularly at cold (Korhonen, 1987; Korhonen et al., 2000). Temperament was also found to affect the dirtiness of the fur, as the fur coat became dirtier in fearful than in confident animals. However, this result was found only during the growing season. During the breeding season no differences between groups existed. A dirtier fur coat in fearful animals was not due to a greater amount of time spent inside the nestbox, as walking tests results indicated no substantial differences between temperament classes. An alternative explanation could be that the nestboxes of fearful foxes were dirtier than those of confident ones. However, no differences in the degree of dirtiness were found between temperament classes. Thus, it remains open what actually explains higher dirtiness of fur coat in fearful animals. Perhaps fearful animals were more rolling and rubbing themselves to dirt. According to Mononen et al. (1999), the litter size per mated vixen at weaning is a practical index of reproductive performance in foxes. This figure is a net result of various components, ranging from the proportion of barren vixens via the number of ova shed, the litter size at birth and number of stillborn cubs, to postnatal cub losses. More detailed information can be obtained if reproductive success is also calculated per breeding and per whelped vixen, as we did in this study. We also counted the number of cubs lost as well as the mating and whelping percentages. However, none of these figures revealed marked differences between the study groups. Because of the multifactorial nature of reproductive performance, attempts to relate a single environmental factor, such as a nest box type or presence of a platform, to reproductive success have generally failed to give a significant result (Korhonen and Niemel, 1995; 1996; Ilukha et al., 1997). Taking this into account, it is not actually surprising that we find no marked group differences. However, we also found no differences between fearful and confident animals. Several previous studies have shown that confident silver foxes in particular (Braastad, 1988; Kristensen, 1989; Bakken, 1994; Jeppesen and Pedersen, 1998), but also blue foxes (Hansen, 1998; Kenttmies et al., 1997), tend to have a better reproductive performance than fearful or non-selected ones. A potential explanation for the non-significance in our study could be that mating percentages in each group were rather low (Ilukha et al., 1997), i.e. only slightly more than half of vixens could be mated. Therefore, the number of vixens from which final reproductive success was

Effects of nestbox availability and temperament on blue fox welfare

163

calculated was low. Often the variation in litter size is large in blue foxes, and it thus requires fairly high number of vixens to reveal statistically significant group differences. The main reason for the low mating percentage here was most likely the presence of nestboxes in the shed. They seemed to prevent light from penetrating the shed, thus negatively affecting the development of oestrus (Korhonen et al., 2004). One issue worth further consideration is that although increased fearfulness due to nestboxes did not have a significant effect on reproduction in this study, it may have long term effects. If nestboxes are provided to foxes year after year, this could easily multiply the number of fearful animals and lead to more pronounced effects on the temperament. The welfare of an animal cannot be directly measured but it must be assessed. Unfortunately, there is no simple method, even in the assessment of welfare (Simonsen, 1996; Veasey et al., 1996). This is because no single factor can precisely reveal the objective welfare status of the animal in question. As a consequence, a multi-perspective approach with different physiological and behavioural variables is recommended to use (Harri et al., 1995). In the present study, we also measured several parameters that are indicative of wellbeing in foxes, namely, the cortisol:creatinine ratio, blood status, the occurrence of stereotypical behaviours, explorativity, temperament, growth and reproduction. Of these, the frequency of stereotypical behaviours and the cortisol:creatinine ratio are often considered the two most striking indicators of welfare status (Korhonen et al., 2000, 2001). These parameters did not reveal any substantial differences between the experimental groups. However, the blood status, a typical indicator of the health status, revealed one crucial difference, namely, the white blood cell count was elevated in foxes with nestboxes in November. Nestboxes were dirty and also made animals and their fur coat dirty. Increased numbers of white blood cells are here likely to be indicative of some latent inflammation or disease outbreak. Thus, it seems that presence of a permanent nestbox to a certain extent does compromise animal welfare. Some differences found in explorativity, temperament development and growth between foxes with and without nestboxes tempt us to conclude that nestboxes may have some additional welfare consequences. Housing systems promoting exploration can be expected to improve animal welfare or, conversely, conditions which do not encourage animals to behave exploratively often tend to be unfavourable also in terms of animal welfare (Mononen, 1998). Foxes with nestboxes were less explorative in ball tests than foxes without nestboxes. Thus, the presence of nestboxes does not encourage animals to explore, but keeps them less open to novel objects or situations. Furthermore, our results showed that confident foxes were more explorative than fearful ones. This also confirms the expectation that explorativity is positively related to welfare. The lower weight gain in foxes with nestboxes was also a negative result arguing against the permanent use of shelters. In theory, the main reasons for lower growth may be that animals 1) were more active, 2) ate less or 3) the conditions in which they were kept were otherherwise unfavourable for maximum growth performance (Korhonen et al., 2003 b). Our walking test results affirmed that the

164

H.T. Korhonen et al.

lower weights recorded were not a result of higher acitivity, on the contrary, foxes with nestboxes tended to be less in locomotion than those without nestboxes. Furthermore, animals in each group were fed with the same feed portion, which eliminates explanation number 2. Thus, it appears that housing conditions otherwise explain lower weights. For example, it is known that parasitic infections due to poor hygienic conditions are one important reason for cessation of growth (Korhonen et al., 2003 b). In the present study, we did not determine the occurrence of parasites but dirty fur coats as well as elevated level of white blood cells are good indicators of poorer hygiene in foxes with nestboxes. It is known that foxes prefer higher places because they provide a good opportunity to watch the surroundings (Korhonen et al., 1996). In the present study, foxes with nestboxes used platforms less frequently than foxes without nestboxes. This can be explained by the additional use of the nestbox roof as the walking test results clearly indicated. The nestbox roof is thus also an elevated level that enables observation of the environment (Mononen, 1996; Mononen et al., 1998). However, there is no need to simultaneously provide both a nestbox roof and a platform for the same behavioural purpose. Platforms serve this function well. According to Hovland and Bakken (2000), the presence of nestboxes may serve the function as an alternative option to withdrawal in challenging situations, thereby assisting the coping attempts of the individual. In the present study, foxes with nestboxes indeed showed more frequent escape reactions compared to foxes without nestboxes. However, there were no differences between confident and fearful foxes. Furthermore, our physiological and behavioural results do not support the concept that a more frequent escape reaction in foxes with nestboxes is beneficial to them in terms of animal welfare.
Conclusions

The breeding goal in fox farming is to produce a fur of high value with the lowest possible production costs without compromising animal welfare. The present results tempt us to conclude that this can be achieved by keeping blue foxes in wire mesh cages with a platform and activity object but without permanent access to nestboxes. To a certain extent, year-round nestboxes seem to compromise both animal welfare and productivity.
Acknowledgements

This study was funded by the Ministry of Agriculture and Fishery, the Finnish Fur Breeders Associaton and MTT Agrifood Research Finland. The staff of the Fur Farming Research Station of Kannus (MTT) are gratefully acknowledged for their valuable help in carrying out these experiments. Many thanks also to Seppo Kukkonen, Juhani Sepponen and Hannele Johansson for additional help.
References A h o l a L. (2002). Effects of social and physical housing environment on the welfare in silver foxes (Vulpes vulpes). Ph.D. Thesis. Kuopio University Publications C. Natural and environmental sciences 145, 69 p.

Effects of nestbox availability and temperament on blue fox welfare

165

B a k k e n M. (1994). Infanticidal behaviour and reproductive performance in relation to competition capacity among farmed silver fox vixens, Vulpes vulpes. Ph.D. Thesis, University of Trondheim, Norway 1994, 35 p. B e r r y J.J. (1995). A simulation-based approach to some nonparametric statistics problems. Observations, 1: 19 26. B r a a s t a d B. (1988). Sammenhangen mellem atferd og reproduksjonsresultater hos rev. Aktuelt fra Statens fagtjeneste for Landbruket, 1: 422 427. C h a m o v e A.S. (1989). Environmental enrichment: a review. Anim. Tech., 40: 155 178. H a n s e n S.W. (1998). Selection for trusting blue foxes reproduction results and stability of temperament. NJF seminar no 295, 7 9 September 1998, Bergen, Norway, 10 pp. H a r r i M., R e k i l T., M o n o n e n J. (1995). Factor analysis of behavioural tests in farmed silver and blue foxes. Appl. Anim. Behav. Sci., 42: 217 230. H a r r i M., M o n o n e n J., R e k i l T., K o r h o n e n H., N i e m e l P. (1998). Effects of top nest box on growth, fur quality and behaviour of blue foxes (Alopex lagopus) during their growing season. Acta Agricult. Scand., 48: 184 191. H o v l a n d A-H., B a k k e n M. (2000). The welfare situation of farmed foxes in relation to domestication status and compared to other farmed species. Agric. Univ. of Norway (NLH), Dept. of Anim. Sci., 2000, 88 pp. I l u k h a V.A., H a r r i M., R e k i l T. (1997). Reproductive success of farmed blue foxes. J. Anim. Breed. Gen., 114: 465 474. J e p p e s e n L.L., P e d e r s e n V. (1998). Selektionforsog for tillidsfulla solvrev i Danmark. NJF seminar no 295, 7 9 September 1998, Bergen, Norway, 8 pp. J o n e s B.R. (1997). Fear and distress. In: Appleby M.C., Hughes B.O. (eds.), Animal Welfare, CAB International, Wallingford, Oxford, UK, Ch. 6, pp. 75 87. K e n t t m i e s H., S m e d s K., R e k i l T. (1997). Preliminary results from a selection experiment for more confident foxes. NJF seminar no 280, 6 8 October 1997, Helsingfors, Finland, pp. 227 233. K o l e s n i k o v a L., L u c e n k o N., T r u t L., J u r i s o v a M., B e l y a e v D. (1985). Selection of silver foxes for domestic type of behaviour: morphological and functional characteristics of organ systems, pp. 663 670. In: J. Milkovsky & V.J.A. Novak, eds. Evolution and morphogenesis. Academia, Prague, Czech Republic. K o r h o n e n H. (1987). Significance of sleeping plate as a thermal protection for farmed raccoon dogs (Nyctereutes procyonoides). Comp. Biochem. Physiol., 87A: 631 633. K o r h o n e n H., N i e m e l P. (1995). Comparison of production results between blue foxes housed with and without platforms. Agricult. Sci. Fin., 4: 351 361. K o r h o n e n H., N i e m e l P. (1996). Temperament and reproductive success in farmbred silver foxes housed with and without platforms. J. Anim. Breed. Gen., 113: 209 218. K o r h o n e n H., N i e m e l P., T u u r i H. (1996). Seasonal changes in platform use by farmed blue foxes (Alopex lagopus). Appl. Anim. Beh. Sci., 48: 99 114. K o r h o n e n H., N i e m e l P. (2000). Enrichment value of wooden blocks for farmed blue foxes (Alopex lagopus). Anim. Welf., 9: 177 191. K o r h o n e n H., N i e m e l P., J a u h i a i n e n L., T u p a s e l a T. (2000). Effects of space allowance and earthen floor on welfare-related physiological and behavioural responses in male blue foxes. Physiol. Behav., 69: 571 580. K o r h o n e n H., J a u h i a i n e n L., N i e m e l P., H a r r i M., S a u n a - a h o R. (2001). Physiological and behavioural responses in blue foxes (Alopex lagopus): comparisons between space quantity and floor material. Anim. Sci., 72: 375 387. K o r h o n e n H., J a u h i a i n e n L., N i e m e l P., S a u n a - a h o R. (2002 a). Wooden block and straw as environmental enrichments for juvenile blue foxes (Alopex lagopus). Acta Ethol., 5: 29 37. K o r h o n e n H., H a n s e n S.W., M a l m k v i s t J., H o u b a k B. (2002 b). Effect of capture, immobilization and handling on rectal temperatures of confident and fearful male mink. J. Anim. Breed. Gen., 117: 337 345. K o r h o n e n H., J a u h i a i n e n L., R e k i l T. (2002 c). Effect of temperament and behavioural

166

H.T. Korhonen et al.

reactions to the presence of a human during pre-mating period on reproductive performance in farmed mink (Mustela vison). Canad. J. Anim. Sci., 82: 275 282. K o r h o n e n H., J a u h i a i n e n L., N i e m e l P., R e k i l T. (2003 a). Access to ground contact and its welfare implications in farmed foxes. Proc. of the NJFs 22nd Congress, Nordic Agriculture in Global Perspective, July 1 4, 2003, Turku, Finland, pp. 261 264. K o r h o n e n H.T., J a u h i a i n e n L., R e k i l T. (2003 b). In-cage sandbox as a ground substitute for farmed blue foxes (Alopex lagopus): effects on digging activity and welfare. Canad. J. Anim. Sci., 83: 703 712. K o r h o n e n H., R e k i l T., K i v i n e n T., J a u h i a i n e n L. (2004). Comparison of hall and shed as housing environments for blue foxes. Scientifur, 28 (3): 7 10. K r i s t e n s e n M.P. (1989). An evaluation of exploratory and fear-motivated behaviour as a predictor of reproductive success in silver fox vixens. Scientifur, 12: 199 205. L a s l e y B.L., K i r k p a t r i c k J.F. (1991). Monitoring ovarian function in captive and free-ranging wildlife by means of urinary and fecal steroids. J. Zoo. Wild. Med., 22: 23 31. L i t t e l l R.C., M i l l i k e n G.A., S t r o u p W.W., W o l f i n g e r R.D. (1996). SAS System for Mixed Models, Cary, NC: SAS Institute Inc, 633 pp. M o n o n e n J. (1996). Resting platform and nest boxes for farmed blue foxes (Alopex lagopus) and silver foxes (Vulpes vulpes): the extent of use, reasons for use and welfare effects. Kuopio University Publications C. Natural and Environmental Sciences 52, 62 pp. M o n o n e n J. (1998). Evaluation of the open field test. In: Proceedings of the Nordic ISAE Winter Meeting, Tune, Denmark, 1998. Royal Veterinary and Agricultural University of Denmark, Copenhagen, p. 6. M o n o n e n J., K o r h o n e n H., H a r r i M., K a s a n e n S. (1998). A comparison of the use of resting platforms and nest boxes in growing farmed silver foxes (Vulpes vulpes). Appl. Anim. Behav. Sci., 58: 383 396. M o n o n e n J., H a r r i M., S e p p o n e n J., K o r h o n e n H., R e k i l T., A h o l a L. (1999). A top and a floor box as breeding nest boxes in farmed blue foxes (Alopex lagopus): reproductive performance, use of boxes and cub carrying. Acta Agricult. Scand., Sect. A, Anim. Sci., 49: 206 210. N e w b e r r y R. (1995). Environmental enrichment: increasing the biological relevance of captive environments. Appl. Anim. Behav. Sci., 44: 229 243. O s a d c h u k L.V. (1992). Endocrine gonadal function in silver fox under domestication. Scientifur, 16: 116 121. R e k i l T., H a r r i M., A h o l a L. (1997). Validation of the feeding test as an index of fear in farmed blue (Alopex lagopus) and silver foxes (Vulpes vulpes). Physiol. Behav. 62: 805 810. R o u v i n e n K., A r c h b o l d S., L a f f i n S., H a r r i M. (1999). Long-term effects of tryptophan on behavioural response and growing-furring performance in silver foxes. Appl. Anim. Behav. Sci., 63: 65 77. S i m o n s e n H.B. (1996). Assessment of animal welfare by a holistic approach: behaviour, health and measured opinion. Acta Agricult. Scand., 27: 91 96. V e a s e y J.S., W a r a n N.K., Y o u n g R.J. (1996). On comparing the behaviour of zoo housed animals with wild conspecifics as a welfare indicator. Anim. Welf., 5: 13 24. W o l f i n g e r R. (1996). Heterogeneous Variance-Covariance Structures for Repeated Measures. J. Agricult., Biol. Environ. Statist., 1 (2): 205 230.

Accepted for printing 9 V 2006

Effects of nestbox availability and temperament on blue fox welfare HANNU T. KORHONEN, LAURI JAUHIAINEN, TEPPO REKIL Wpyw caorocznej dostepnosci skrzynek wykotowych i temperamentu na dobrostan i produkcyjnosc lisow niebieskich (Alopex lagopus) STRESZCZENIE

167

Celem doswiadczenia bya ocena dugotrwaego wpywu skrzynek wykotowych i temperamentu na dobrostan i uzytkowosc modych i dorosych lisow niebieskich (Alopex lagopus). Zwierzeta bojazliwe i pewne siebie odchowywano w okresie wzrostu i reprodukcji z uzyciem skrzynek wykotowych lub bez. ce Przy odsadzeniu utworzono nastepuja grupy doswiadczalne: 1) zwierzeta pewne siebie brak skrzynek wykotowych; 2) zwierzeta pewne siebie skrzynka wykotowa dostepna przez cay rok; 3) zwierzeta bojazliwe brak skrzynek wykotowych; 4) zwierzeta bojazliwe skrzynka wykotowa dostepna przez cay rok. W kazdej grupie byo 60 samic, ktore utrzymywano pojedynczo. Stwierdzono, ze lisy pozbawione skrzynek wykotowych rosy istotnie (P = 0,01) lepiej niz lisy ce maja dostep do skrzynek. Temperament nie mia wpywu na koncowa mase ciaa. Zachowanie lisow pewnych siebie byo bardziej eksploracyjne (P < 0,01) niz zachowanie lisow bojazliwych, natomiast zachowanie lisow pozbawionych skrzynek wykotowych byo bardziej eksploracyjne niz zachowanie t cych dostep do skrzynek (P = 0,06). Testy wyapywania ujawniy, ze stay dostep do zwierza maja ce skrzynki wykotowej istotnie (P < 0,001) zwieksza bojazliwosc w duzszym okresie. Lisy maja dostep do skrzynek wykotowych byy bardziej skonne do ucieczki na widok czowieka anizeli zwierzeta pozbawione skrzynek. Nie stwierdzono istotnych roznic pomiedzy grupami zroznicowanymi pod wzgledem temperamentu i w zaleznosci od dostepu do skrzynek wykotowych w czestosci zachowan steterotypowych, stosunku kortyzolu do kreatyniny i reprodukcyjnosci. Okrywa wosowa lisow cych dostep do skrzynek wykotowych bya zabrudzona, co istotnie (P < 0.001) obnizao jakosc maja futra. Stwierdzono, ze caoroczny dostep do skrzynek wykotowych zwieksza bojazliwosc fermowych lisow niebieskich. Obecnosc skrzynek wykotowych moze rowniez w inny sposob negatywnie wpywac t. na dobrostan zwierza

Ann. Anim. Sci., Vol. 6, No. 1 (2006) 169 177

USE OF AN EARTH-TUBE HEAT EXCHANGER TO OPTIMIZE BROILER HOUSE CLIMATE DURING THE SUMMER PERIOD*
I w o n a S k o m o r u c h a, E u g e n i u s z H e r b u t Department of Technology, Ecology and Economics of Animal Production, National Research Institute of Animal Production, 32-083 Balice n. Krakow, Poland Abstract This study was designed to determine the effect of an earth-tube heat exchanger (ETHE) on broiler house climate and on the productivity of broiler chickens during the summer period. Group I was the control broiler house in which broilers were reared under standard conditions. Group II was the experimental broiler house equipped with an ETHE, intended to act as an air conditioner and thus optimize thermal conditions for chicken rearing. The results obtained showed that the air temperature in the ETHE broiler house was 2 3oC lower than in the control broiler house. The lower and thus optimum temperature inside the experimental building highly significantly increased body weights, improved feed conversion and reduced the mortality of birds compared to the birds from the control house. The better productivity of birds from the experimental group was reflected in a higher European Production Index (EPI) in this group. Key words: broiler chickens, earth-tube heat exchanger, productivity

Genetic progress in poultry is making birds increasingly sensitive to environmental conditions, of which house climate plays a significant role (Dobrzanski et al., 2003). Having optimum climatic conditions inside livestock buildings guarantees that the life processes of birds will be normal, while any deviation from animal hygiene standards may cause stress resulting in disturbed homeostasis inside the body. Recent practice has shown that the recommended indoor climate standards are often exceeded during the summer heat-wave in Poland. This results in an excessively high indoor temperature, which, in addition to excessively low or high air humidity, causes hyperthermia in birds. Hyperthermia, or heat stress, causes losses related to lower productivity, poorer health, and mass mortality (Sokoowicz and Herbut, 2004).

* This work was conducted as part of NRIAP statutory activity, project no. 4127.1.

170

I. Skomorucha and E. Herbut

Efforts are therefore being made to introduce solutions that do not increase production costs but allow the optimum temperature to be maintained without causing any unfavourable fluctuations in temperature or excessive cooling of birds (Biaas and Dobrzanski, 2000). This is intended to increase the comfort and health of birds, thus making production more effective. Analysis of the research findings on the subject shows that new possibilities are offered by earth-tube heat exchangers (ETHE), which can be used to heat or cool the inlet air stream as required (Viedt, 1991; Shingari et al., 1995; Bieda and Herbut, 1999; Alchalabi, 2001; Bieda et al., 2001). The aim of the present study was to determine the effect of an ETHE on house climate and on the productivity of broiler chickens during the summer production cycle.

Material and methods The experiment was performed at the Experimental Station of the National Research Institute of Animal Production in Rossocha using 30,400 Starbro broiler chickens, during the summer production cycle, from 10 June to 22 July 2002. The study was carried out in two modern broiler houses (standard control and experimental with an ETHE), each with a production area of 800 m2, fully automated feed and water administration, and air heating with propane. The experimental broiler house was fitted with a mechanical negative pressure ventilation system containing an ETHE, which covers 10% of the summer requirement for ventilation air. The principle of ETHE operation consists in an exchange of heat between the air stream flowing through the exchanger pipes and the surrounding ground. During the summer, warm air leaving the exchanger pipes is cooled and radiates heat towards the ground, which has a lower temperature than atmospheric air. Used air is eliminated by way of mechanical ventilation of the broiler house only. Broiler chickens were reared on straw bedding until 42 days of age. They were fed standard diets prepared on the basis of starter (1 3 weeks of rearing), grower (4 5 weeks of rearing) and finisher concentrates (6 weeks of rearing). Throughout the study, birds had free access to water drinkers. The light regime was 16 hours light : 8 hours dark with a light intensity of 3 5 lux. Broilers were assigned to two groups at a stocking rate of 19 birds/m2, and their response to indoor thermal conditions was examined: Group I control broiler house in which chickens were reared under standard conditions, Group II experimental broiler house equipped with an ETHE, intended to act as an air conditioner and thus optimize thermal conditions for chicken rearing. Throughout the 42 days of rearing, the following basic climate parameters were monitored every week inside and outside the buildings: temperature measured three times a day at 08.00, 14.00 and 18.00, relative humidity, water vapour pressure, air movement and dry cooling measured once a day at 14.00.

Earth-tube heat exchanger and broiler house climate

171

The indoor climate was measured with wall ventilators turned on, at 3 diagonal points in the building at a height of 30 cm above the floor, i.e. in the living area of the broilers. Outside, the measurements were made 2 m away from each wall of the building, at a height of around 1 m. Temperature and air humidity measurements were taken using an Assmann aspiration psychrometer according to the animal hygiene testing method described by T. M. Janowski (1979). Water vapour pressure was calculated using a formula based on the temperature and air humidity values obtained. Dry cooling was measured with a dry-bulb katathermometer, and air movement was read from tables based on the dry cooling values. Body weight in 100 randomly selected birds and the number of dead birds were checked every week, as were feed intake from 1 to 21 and from 1 to 42 days of rearing. Based on the production results obtained, the efficiency of broiler rearing was expressed as the European Production Index, which was calculated using the formula: EPI = mp ta 100

where: EPI European Production Index, m mean body weight of broiler (kg), p survival, number of chickens reared (%), t number of days of rearing, a feed conversion (kg feed/kg gain). The results were analysed statistically using analysis of variance and significant differences were estimated using Duncans test.

Results The results of the climate tests are given in Tables 1 3. Air temperature measured in the morning in weeks of rearing was similar in both buildings and no statistically significant differences were found (Table 1). A highly significantly lower temperature was found in the experimental broiler house at 14.00 on days 21, 35 and 42 of rearing. The difference in temperature between the buildings was 2.7, 3.6 and 3.1oC, respectively. Analysis of the air temperature at 18.00 showed that throughout rearing it was lowest in the ETHE broiler house. Highly significant differences were noted on days 21 and 35 of rearing only. In the experimental building, lower diel fluctuations in the temperature of the inlet air stream were found. The difference in the minimum and maximum temperature between the control and experimental buildings was 4.1 and 2.5oC on

172

I. Skomorucha and E. Herbut

day 21, 5.6 and 3.7oC on day 35, and 2.2 and 0.4oC on day 42 of the experiment, respectively (Table 1).
Table 1. Mean air temperature (oC) inside and outside the broiler house 08.00 I 7 14 21 28 35 42 28.0 0.1 25.0 0.1 24.2 0.1 24.8 0.1 23.6 0.2 18.9 0.1 II 28.2 0.1 25.2 0.2 23.1 0.1 22.2 0.1 21.9 0.2 17.6 0.1 I Inside 14.00 group II I 27.7 0.2 24.9 0.1 25.7 0.2 A 27.3 0.3 27.5 0.2 A 18.9 0.1 II 27.7 0.3 27.2 0.3 25.2 0.1 25.00 0.1 28.3 0.4 A 25.6 0.1 B 28.4 0.5 26.2 0.4 29.2 0.4 A 25.6 0.1 B 21.1 0.4 A 18.0 0.50 B 18.00 Outside (14.00) x

Day of rearing

27.0 0.2 27.0 24.8 0.1 21.1 23.6 0.1 B 28.9 25.8 0.2 28.5 25.0 0.1 B 28.2 17.7 0.1 20.2

A, B values marked with different letters differ highly significantly (P 0.01).

The measurements of relative air humidity are given in Table 2. In both group I and group II, the lowest relative humidity was found at 21 days of rearing (57.7 and 60.3%) and the highest at 35 days of rearing (73.3 and 77.0%, respectively). The water vapour pressure results were similar in both buildings to 35 days of rearing (Table 2). On day 42 of the experiment, the water vapour pressure in building II was 19.1 hPa and was significantly higher than in broiler house I (17.3 hPa).

Table 2. Mean relative air humidity and water vapour pressure inside and outside the broiler house Relative air humidity (%) Day of rearing I 7 14 21 28 35 42 71.7 1.20 63.0 0.58 57.7 0.07 65.0 1.53 73.3 1.76 69.7 1.45 inside group II 72.7 1.45 64.0 0.58 60.3 1.20 64.0 0.58 77.0 1.15 71.3 1.76 outside x 65 59 54 63 70 71 I 26.5 0.31 20.1 0.21 22.2 0.23 25.0 0.24 29.8 0.40 17.3 0.22 a Water vapour pressure (hPa) inside group II 27.1 0.71 20.3 0.24 21.6 0.36 26.1 0.63 29.5 1.05 19.1 0.23 b outside x 23.92 14.65 21.71 25.10 26.62 16.91

a, b values marked with different letters differ significantly (P 0.05).

No statistically significant differences were found in air movement between groups I and II (Table 3). This climate parameter ranged from 0.259 to 1.167 m/s in building I and from 0.259 to 0.933 m/s in building II.

Earth-tube heat exchanger and broiler house climate Table 3. Mean air velocity and dry cooling inside and outside the broiler house Air movement (m/s) Day of rearing I 7 14 21 28 35 42 0.259 0.01 0.377 0.07 0.279 0.04 0.709 0.19 1.167 0.18 1.072 0.28 inside group II 0.259 0.06 0.272 0.05 0.597 0.11 0.933 0.15 0.537 0.21 0.716 0.28 outside x 0.420 1.160 0.519 1.949 1.308 1.250 I 14.97 0.55 21.30 1.10 14.11 1.06 18.05 2.12 19.43 1.76 39.61 4.92 Dry cooling (mW/cm2) inside group II 14.53 1.12 19.53 0.73 20.57 1.27 17.68 0.38 16.65 2.96 31.55 3.76

173

outside x 15.84 38.75 13.65 23.80 22.03 42.81

Building I was characterized by greater dry cooling during almost the whole study period (Table 3), with 6.46 mW/cm2 lower cooling than in group II found on day 21 only. The highest cooling was found in both broiler houses on day 42 (39.61 and 31.55 mW/cm2, respectively). The production results for the broiler chickens are given in Table 4. On day 42, the body weight of broiler chickens averaged 2017 g in group I and 2120 g in the experimental group, and the difference was highly significant. Analysis of the results of feed conversion per kg weight gain showed 90 g lower feed intake by chickens from the experimental group in the first period of rearing. For the whole experimental period, this parameter was 1950 and 1840 g, respectively. A markedly lower proportion of dead chickens was found in the experimental broiler house. From 1 to 21 days of rearing, bird mortality was 1.93% in group I and 1.47% in group II. In the second period of the experiment, the difference in the proportion of dead chickens was 0.95%. Mortality during the whole rearing period was 4.33% in group I and 2.92% in group II.
Table 4. Reproductive performance of broiler chickens Item Body weight Feed intake (g) per kg weight gain Mortality (%) Day of rearing 42 1 21 1 42 1 21 22 42 1 42 Group I 2017 10.14 A 1530 1950 1.93 2.4 4.33 236 II 2120 6.73 B 1440 1840 1.47 1.45 2.92 269

EPI (pts)

A, B values marked with different letters differ highly significantly (P 0.01).

Birds from the experimental building were characterized by a higher EPI compared to broiler chickens reared in the control building (269 vs. 236 points) (Table 4).

174

I. Skomorucha and E. Herbut

Discussion The optimum temperature for broiler chickens should be gradually decreased with age by 2 3oC a week to reach 18 20oC during the final weeks of rearing (Journal of Laws, 03.167.1629). Analysis of the measurements shows that air temperature standards were exceeded in both the control and experimental broiler houses, especially during the final weeks of rearing. However, comparison of this climate parameter in both houses showed that in the ETHE building, air temperature was around 2 3.5oC lower, especially in the afternoon hours when the building was most vulnerable to being affected by sunrays and the external temperature. Considering that the ETHE studied accounted for only 10% of the air exchange necessary for the summer period, its efficiency proved relatively high. In preliminary studies on the use of ETHE for cooling a stream of ventilation air during the summer production cycle of broilers, Bieda et al. (2001) noted that the temperature of the internal air in the experimental building with an ETHE was approximately 2.5 K lower compared to the control building in which air was not cooled with an ETHE. Shingari et al. (1995) showed that with the use of an ETHE, the air temperature in the building studied decreased by approximately 6 7 K compared to the control building. A fairly high decrease in temperature and small diel fluctuations inside the building were reported by Alchalabi (2001). The use of double cooling of inlet air (in the ground and by way of evaporation) resulted in a considerable decrease in indoor temperature, and the difference between the minimum and maximum temperature was 3.8oC, compared to a difference of 19.5oC outside the building. It is equally important to maintain the required level of air humidity, which is strictly connected with temperature. The Regulation of the Ministry of Agriculture and Rural Development of 2 September 2003 (Journal of Laws, 03.167.1629) concerning the minimum housing conditions for different animal species indicates that the optimum relative air humidity in a broiler house should be 70, 65 and 60% in the first, second and subsequent weeks of rearing, respectively. In our study, relative air humidity in both groups was similar, as evidenced by the lack of statistically significant differences, and ranged from 57.7 to 77%. It should be noted, however, that in the second period of rearing, relative air humidity standards were exceeded in both buildings and, as reported by Herbut and Walczak (2001), this may increase the negative effect of heat stress, because it inhibits the radiation of heat by the release of excess water vapour. Niedzioka and Tombarkiewicz (1989) reported that water vapour pressure should range from 6 to 8 mmHg (8 to 10.7 hPa), but at higher temperatures it can reach 11 mmHg (14.7 hPa). During the summer period, when it is quite difficult to keep water vapour pressure up to the standard level, it is assumed that the difference in pressure inside and outside the building should be as low as possible and range from 2 to 4 mmHg (Niedzioka and Tombarkiewicz, 1989). Our own findings indicate that this difference, calculated from the mean values for the whole rearing period, did not exceed the upper limit of 4 mmHg (5.3 hPa) either in the control or

Earth-tube heat exchanger and broiler house climate

175

experimental house, where it was 1.5 and 1.8 mmHg (2 and 2.4 hPa), respectively. Cooling, which is directly related to air temperature, humidity and velocity, is an important factor in poultry facilities. Dobrzanski (1983) reported that cooling in poultry houses should range from 16.72 to 35.44 mW/cm2, and the permissible air velocity value should not exceed 1.0 m/s regardless of the season of the year. In our study, dry cooling in the experimental broiler house fell below the recommended level only on day 7 of rearing, while air velocity did not exceed 1.0 m/s. It is well known that air temperature has a significant effect on bird bodies. In the present study, we found that thermal and humidity conditions in broiler houses had an effect on the productivity of broiler chickens: at 42 days of rearing, the difference in the body weight of chickens was 103 g (P 0.01). Likewise, Yahav and Hurwitz (1996) found significantly lower body weight in chickens exposed to high temperature compared to the control chickens. Yalin et al. (2001) reported that the body weight of broiler chickens in a building with an air temperature higher than that recommended decreased by 23%, while zkan et al. (2003) reported a 34% decrease in the weight gains of birds reared during the summer months in countries with a subtropical climate. A decreased growth rate in birds exposed to high temperature has also been reported by Cooper and Washburn (1998), Deeb and Cahaner (2001), and Sokoowicz and Herbut (2001). During short-term heat stress (for 2 hours, temperature elevated by 10oC in relation to the recommended temperature), Sosnowka-Czajka and Herbut (2003) did not find lower weight gains or final body weights, nor did they note poorer feed conversion per kg weight gain in birds exposed to high air temperature. Different results were obtained by Sokoowicz and Herbut (2001), who noted a 30 g higher feed intake per kg weight gain by broiler chickens during the last week of rearing when birds were exposed to an air temperature 12oC higher than the optimum temperature. This is confirmed by our own findings, in which broiler chickens from group II, subject to additional cooling through ETHE, were characterized by roughly 6% lower feed intake in both the first and second periods of rearing. Increased feed intake by birds reared under elevated temperature conditions has also been reported by Yahav and Hurwitz (1996) and Cooper and Washburn (1998). During the summer period, when poultry house temperatures exceed the recommended values, bird mortality due to hyperthermia is very frequent. Sokoowicz and Herbut (2004) observed 100% mortality among 40-day-old broiler chickens exposed to 3-day heat stress during the summer production cycle. Researchers studying the issue of elevated rearing temperature for broiler chickens often report increased bird mortality (Mennicken et al., 1994; Sokoowicz and Herbut, 2001; zkan et al., 2003). In our study, we observed 1.41% higher mortality in chickens in the control broiler house. May and Lott (2000) reported that bird mortality is the best indicator of whether rearing temperature is correct. It can therefore be stated that thermal and humidity conditions in the experimental broiler house were more favourable, as reflected in the lower proportion of dead birds during the whole rearing period. In

176

I. Skomorucha and E. Herbut

contrast, the results of Cooper and Washburn (1998) fail to confirm the relationship between elevated rearing temperature (32oC) and mortality. Environmental conditions have a considerable effect on EPI (Krawczyk and Sokoowicz, 2001). In the present study, chickens reared in the experimental broiler house achieved a 33-point higher EPI compared to the control chickens. Similar results were obtained by Skomorucha and Herbut (2005), who noted higher EPI in the group of broilers reared in a building equipped with an ETHE. It is concluded from the present study that the use of an ETHE to cool the stream of ventilation air has a beneficial effect on house climate mainly as a result of the lower temperature inside the building (by 2 3oC) in relation to the control broiler house. The lower air temperature in the ETHE broiler house improved the thermal comfort of broiler chickens reared in this building. This was reflected in better productivity and lower mortality compared to birds from the control group and, as a consequence, in higher EPI values.

References A l c h a l a b i D. (2001). Two-stage air cooling for very hot environments. Poultry Internat., 40, 11: 28 32. B i a a s W., D o b r z a n s k i Z. (2000). Ochadzanie strefy nadsciolkowej w budynku brojlerni z paszczyznowym ogrzewaniem podogowym. Zesz. Nauk. Politechniki Opolskiej, Seria: Budownictwo, 44: 25 31. B i e d a W., H e r b u t E. (1999). Koncepcja rurowo, gruntowo-powietrznego wymiennika ciepa cego w systemie wentylacyjnym brojlerni. Zesz. Nauk. AR Krak., 355, Inz. Srod., 19: dziaaja 153 163. B i e d a W., H e r b u t E., K o z b i a M. (2001). Cooling of air blown into broiler house in an air-earth tube heat exchanger. Proc. of the International Symposium of the C.I.G.R. 2nd Technical Section. Animal welfare consideration in livestock housing systems. Szklarska Poreba, October 23 25: 421 426. C o o p e r M.A., W a s h b u r n K.W. (1998). The relationships of body temperature to weight gain, feed consumption, and feed utilization in broilers under heat stress. Poultry Sci., 77: 237 242. D e e b N., C a h a n e r A. (2001). Genotype by environment interaction with broiler genotypes differing in growth rate: 2. The effects of high ambient temperature on dwarf versus normal broilers. Poultry Sci., 80: 541 548. D o b r z a n s k i Z. (1983). Zastosowanie bonitacyjno-statystycznej metody do okreslania zaleznosci t. miedzy warunkami srodowiskowymi w brojlerniach a efektywnoscia odchowu kurcza Zesz. Nauk. AR Wroc., 37, Rozprawy. D o b r z a n s k i Z., R u d n i c k a A., S k o w r o n s k i W. (2003). Physical factors of microclimate in laying hens battery system as a criterion of welfare. Ann. Anim. Sci., Suppl., 1: 51 53. t H e r b u t E., W a l c z a k J. (2001). Aktualne wymagania cieplno-wilgotnosciowe zwierza gospodars kich. II Miedz. Konf. Nauk. Aktualne problemy fizyki budowli w budownictwie wiejskim. Krakow, 9 10 listopada, ss. 92 100. K r a w c z y k J., S o k o o w i c z Z. (2001). Wpyw czynnikow genetyczno-zywieniowych na opacal t nosc produkcji kurcza brojlerow. Zesz. Nauk. PTZ XII Miedz. Symp. Modych Drobiarzy P. O. WPSA, 11 12.09.2001 r. Krakow, ss. 287 298. M a y J.D., L o t t B.D. (2000). The effect of environmental temperature on growth and feed conversion of broilers to 21 days of age. Poultry Sci., 79: 669 671.

Earth-tube heat exchanger and broiler house climate

177

M e n n i c k e n L., V a l l e - Z a r a t e A., H o r s t P. (1994). Effects of air velocity and drinking water temperature on the performance of broiler breeder hens under tropical conditions. Proc. of the 9th European Poultry Conference Glasgow UK, August 7 12th 1994, pp. 127 128. cznego elektroniczN i e d z i o k a J., T o m b a r k i e w i c z B. (1989). Zoohigieniczna ocena efektow a nego sterowania ogrzewaniem i wentylacja w kurnikach. Acta Agr. Sillv, Ser. Zoot., 28: 117 122. z k a n S., A k b a s Y., A l t a n ., A l t a n A., A y h a n A., z k a n K. (2003). The effects of short-term fasting on performance traits and rectal temperature of broilers during the summer season. Brit. Poultry Sci., 44: 88 95. S h i n g a r i B.K., S i n g h A., S a p r a K.L. (1995). Earth tube exchangers. Poultry Internat., 12: 92 96. S k o m o r u c h a I., H e r b u t E. (2005). Effect of an earth tube heat exchanger on broiler house climate in the summer period. Proc. of XIIth International Congress ISAH Animals and Environment, Warsaw, Poland, vol. 2: 174 177. S o k o o w i c z Z., H e r b u t E. (2001). Effect of thermal acclimation of broiler chickens on their performance, metabolic rate, and thyroid activity. Ann. Anim. Sci., 1, 2: 199 205. S o k o o w i c z Z., H e r b u t E. (2004). Economic effects of disturbing broiler chicken welfare by overheating. Ann. Anim. Sci., Suppl., 1: 197 199. S o s n o w k a - C z a j k a E., H e r b u t E. (2003). Physiological and production indicators of broiler chickens exposed to short-term thermal stress. Ann. Anim. Sci., 3, 2: 365 375. V i e d t W. (1991). Erdwrmetauscher in Mastschweine- und Abferkelstllen. Landtechnik, 7/8: 377 379. Y a h a v S., H u r w i t z S. (1996). Induction of thermotolerance in male broiler chickens by temperature conditioning at an early age. Poultry Sci., 75: 402 406. Y a l i n S., z k a n S., T r k m u t L., S i e g e l P.B. (2001). Responses to heat stress in commercial and local broiler stocks. 1. Performance traits. Brit. Poultry Sci., 42: 149 152.

Accepted for printing 10 IV 2006

IWONA SKOMORUCHA, EUGENIUSZ HERBUT Zastosowanie gruntowego wymiennika ciepa do optymalizacji mikroklimatu brojlerni w okresie letnim STRESZCZENIE Celem przeprowadzonych badan byo okreslenie wpywu gruntowego wymiennika ciepa (GWC) t na mikroklimat i wyniki produkcyjne kurcza brojlerow podczas letniego cyklu produkcyjnego. Grupe I stanowiy kurczeta brojlery odchowywane w warunkach standardowych, grupe II doswiad czalna kurczeta odchowywane w brojlerni z zamontowanym gruntowym wymiennikiem ciepa (GWC), ktory powinien speniac role klimatyzatora, a zatem zoptymalizowac warunki termiczne t. odchowu kurcza Stwierdzono, ze w brojlerni z zamontowanym GWC temperatura powietrza bya o 2 3oC nizsza niz w brojlerni kontrolnej. Nizsza, a zatem optymalna temperatura w budynku doswiadczalnym wpynea na statystycznie wysoko istotnie wyzsza mase ciaa, lepsze wykorzystanie paszy oraz mniejsza smiertelnosc ptakow. Lepsze wyniki produkcyjne ptakow z grupy doswiadczalnej miay swoje odzwierciedlenie w wyzszym EWW.

INSTRUCTIONS TO AUTHORS OF RESEARCH PAPERS PUBLISHED IN THE ANNALS OF ANIMAL SCIENCE

I. General Rules 1. The Annals of Animal Science include original research papers which have not been published either in part or as a whole in any other scientific journal, except for proceedings of symposia and scientific conferences. The submitted papers should be written and documented so as to form an integrated whole. 2. The Annals of Animal Science cover the following range of topics: genetics and farm animal breeding; the biology, physiology and reproduction of animals; animal nutrition and feedstuffs; environment, hygiene and animal production technology; economics and the organization of animal production. The assignment of a paper to a given section should be proposed by the author(s), but the final decision rests with the Editors. 3. Papers are printed in English with a Polish summary. 4. Papers to be published should not exceed 16 manuscript pages (size A4) including tables, figures, photographs, etc. and a summary. 5. Papers are reviewed by two reviewers who are research workers specializing in the relevant field. One unfavourable review means that the paper will not be published. The costs of printing are covered by the authors or by the institutions from which the papers were sent, according to current rates of paper preparation and printing. Authors will receive 25 offprints of their paper free of charge. II. Submission of Manuscripts 1. Manuscripts for publication are submitted to the Editor-in-Chief by research workers or the heads of research institutions where the studies were carried out, who take responsibility for their content, scientific value and the preparation of the text. 2. Manuscripts should be submitted in triplicate to: The Editors of Annals of Animal Science, National Research Institute of Animal Production, Sarego 2, 31-047 Krakow, Poland, tel. (+48) 12 422-73-33, fax (+48) 12 422-80-65, e-mail: annals@izoo.krakow.pl on diskettes, and meet the following requirements: Diskettes: 3 1/2 format Printout: 3 copies Word processor: Microsoft Word Paper size: A4 (210 297 mm) Font: CG Times 11 pt or Times New Roman 12 pt Margins: 25 mm (left, right, top, bottom) Line spacing: double Justification: full Formulae: equation editor

180
Tables: table function The ENTER key should only be used to start a new paragraph. 3. Attached to the manuscript should be the Manuscript Submission Form as appended at the end of this Instruction. III. Layout of the Text 1. Title page (unnumbered), not included in the paper volume, should contain: the title of the paper, the full name(s) of author(s) with superscript numbers indicating the full postal address (postcode, street, no.) of the department and affiliated institution where the study was carried out, e.g.: Jan Kowalski1, Maria Anna Rokicka2, Adam Nowacki3 Department of Zoology, Jagiellonian University, sw. Anny 12, 30-017 Krakow, Poland 2 Department of Immuno- and Cytogenetics, National Research Institute of Animal Production, 32-083 Balice n. Krakow, Poland 3 Experimental Station of the National Research Institute of Animal Production, 39-331 Chorzelow, Poland
1

abbreviated title (5-6 words as in the paper title or synonyms) source of research financing, e.g. work financed from: statutory activity, project no. authors project of the Ministry of Science and Information Society Technologies, project no. funds of the Ministry of Agriculture and Rural Development, project no. 2. Manuscripts should be organized in the following order: a) Abstract. Not more than 15-20 lines in length, containing the aim, principal methods and most important results of the experiment. b) Key words. Maximum five items that best describe the papers content, beginning with words of wider meaning, e.g. ruminants, dairy cows, somatotropin, prolactin, milk. c) Abbreviations. Abbreviations, if any, should be defined immediately below Key words. d) Introduction. This should justify the research based on references and conclude with a clearly formulated aim of the study or research hypothesis. e) Material and methods. This section should contain all information needed to replicate the experiment, e.g. experimental factors, experimental design, species, breed, sex and number of animals, duration of experiment, feed rations and their composition, laboratory techniques and statistical methods used. In the descriptions of methods (biological, chemical, statistical) it is enough to refer to source material if applied accordingly. Modifications made to the methods should be described in detail. f) Results can be presented in tabular or graphic form (figures, diagrams, photographs) and given a brief description. The text of the description should not repeat tabular data. g) Discussion. This should interpret the results in terms of the influence of experimental factors according to the aim of the experiment or to the hypothesis made in the Introduction. The experimental results should be interpreted using the current state of knowledge to help the reader accept or reject the hypothesis tested. This section should conclude with a summing-up and generalization of the results obtained. The direction of further studies in the relevant field may be also hinted at here. h) Acknowledgments (if any). i) References. Publications cited in the text must be organized in strict alphabetical order according to name of author. Each citation should include the authors name and initials, year of publication, full title of paper, abbreviated name of journal, number of volume and issue, and initial and final page numbers. When more than one paper published by the same author(s) in the same year is cited, and the authors appear in the same order, the different papers should be assigned successive letters of the alphabet (e.g. 1983 a, 1983 b) and arranged chronologically. Below are provided examples of proper citations of references from scientific journals, congress proceedings and books (manuals).

181
Papers published in periodicals: Jenkins K.J., Hidiroglou M. (1991). Tolerance of the preruminant calf for excess manganese or zinc in milk replacer. J. Dairy Sci., 74: 1047-1053. Papers published in multi-author monographs, occasional publications, symposium or congress proceedings: Miller E.L. (1982). Forage protein in ruminant animal nutrition. The nitrogen needs of ruminants. In: D.J. Thomas (Editor), Proceedings of an International Symposium on Protein Requirements for Cattle. Kansas State University, Kansas City, KN, pp. 254 269. Manuals and multi-author books: Bock H.D., Eggum B.O., Low A.G., Simon O., Zebrowska T. (1989). Editors. Protein metabolism in farm animals: evaluation, digestion, absorption and metabolism. Oxford, UK, Oxford University Press (1989), 452 pp. Manuals and books: Cuhna T.J. (1991). Horse feeding and nutrition. San Diego, USA, Academic Press, Inc. (1991). Second edition, 445 pp. j) Summary in Polish the same as the Abstract (Polish summary is not included in the text volume) with full names of the author(s) and title of the paper. Literature citations in the text. Research findings (or their authors) should be cited if strictly connected with the study topic or research methods used. The number of citations should not exceed the 20 most important items quoted in the text. When a citation has more than two authors, the name of the first author should be followed with et al., e.g. Nowacki et al. (1992). Unpublished papers should be listed in the text, e.g. Bonski (personal communication) or (Bonski, unpublished data). Tables should present the most important data. The column on the left should list the parameters studied, while the columns in the middle and on the right should contain the results for individual experimental factors. Tables should contain numerical data, which are the mean values for a set of observations or measurements, replications and their statistical interpretation (e.g standard error, coefficient of variation). Tables numbered consecutively in Arabic numerals should be submitted on separate sheets. The titles of the tables should be brief. Each column should have a heading. Columns and lines should be spaced. No vertical lines are allowed. Horizontal lines can only be used for strictly justified purposes. Tabular data should not be repeated in graphic form (figures, diagrams, etc.). If there are no data for a given parameter, leave a blank. If an explanation is necessary, use an abbreviation and explain it as a footnote at the bottom of the table (e.g. ND not determined or not detected). To designate the significance of differences between two means or interaction between factors, an additional column is recommended with the heading significance level, using the signs x, xx, xxx for P 0.05, 0.01 and 0.001 respectively. When the number of means is greater than two, the significance of differences should be designated with letters which follow tabular data. Their meaning should be explained below the bottom line of the table, e.g.: a, b, c, d values in rows (or columns) with different letters differ significantly (P 0.05). A, B, C, D as above for P 0.01. Statistical interpretation of the results should fit the design of the experiment and the hypotheses tested. Figures and photographs. Research results, presented in the form of figures, charts and diagrams, should be made on tracing paper or in other forms ready for reproduction. A single figure or diagram must fit half of the text page. Black-and-white or colour photographs of postcard size should have good contrast. Each figure or photograph should be provided with a brief description of its content and, if necessary, a legend in English. References to figures or photographs in the text of the paper should be provided with a reference mark or information. Figures and photographs should be submitted in two sets. Abbreviations should be explained on their first appearance. SI units of measure should be used. This also concerns the energy value of feeds, which should be given in Joules. Supplementary information. After receiving a review of the paper the authors should follow the reviewers guidelines for changes and corrections, and return all the materials received together with a corrected version of the manuscript within 10 days at the most. A failure to return it in due time will delay publication by half a year. The correction of a galley-proof, confirming the final version of the paper, should be made within 5 days of it being sent to the author(s). If this deadline is not met, the Editors bear no responsibility for changes made.

3.

4.

5.

6. 7.

place

date

Annals of Animal Science Manuscript Submission Form

AAS issue To be filled in by Editors

I am asking you to review and print the enclosed paper in Annals of Animal Science 1. Author(s), title of the paper . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2. Notifying person: Full name . . . . . . . . . . . . . . . . . . . . . . . . . . . . Address (postcode, town, street, no.) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Telephone, fax, e-mail . . . . . . . . . . . . . . . . . . . . . . . . Institutions NIP number (for Polish authors only) . . . . . . . . . . . . . . . 3. Suggested section in Annals of Animal Science: Genetics and farm animal breeding Biology, physiology and animal reproduction Animal nutrition and feedstuffs Environment, hygiene and animal production technology Economics and organization of animal production 4. I hereby warrant that the manuscript submitted for publication has neither in part nor as a whole been published or submitted for publication in any other scientific journal. 5. I warrant that the co-authors of this manuscript are familiar with its content and have given consent to its publication in the presented form. 6. I commit myself to covering the costs of the papers publication after it is published, in accordance with the prices valid at the moment of printing.

........................... Signature of the notifying person

This journal is included in the POLISH SCIENTIFIC JOURNALS CONTENTS AGRIC.&BIOL. SCI. database which can be accessed on the World Wide Web at the following URL address: http://psjc.icm.edu.pl

Distribution Subscriptions and single copies of the journal can be ordered from: Instytut Zootechniki, Zespo Wydawnictw i Poligrafii, 32-083 Balice k. Krakowa, Poland Annual subscription price is PLN 40.00 within Poland and US$ 35.00 outside Poland.

Printing Department of Publications and Printing, National Research Institute of Animal Production, 32-083 Balice n. Krakow, Poland