European Journal of Pharmacology 684 (2012) 132145

Contents lists available at SciVerse ScienceDirect

European Journal of Pharmacology

journal homepage: www.elsevier.com/locate/ejphar

Pulmonary, Gastrointestinal and Urogenital Pharmacology

Protein dependent fate of hepatic cells under nicotine induced stress and curcumin ameliorated condition
Satyam Banerjee a, Krishna Chattopadhyay b, Jasmeet Kaur Chhabra c, Brajadulal Chattopadhyay a,
a b c

Department of Physics, Jadavpur University, Raja S.C. Mullick Road, Kolkata-700032, India Department of Chemical Technology, Calcutta University, 92 A.P.C. Road, Kolkata-700009, India Immuno Biology Division, Indian Institute of Toxicology Research, M. G. Marg, Lucknow-226001, India

a r t i c l e

i n f o

a b s t r a c t
Nicotine is mainly metabolized in liver. Its abuse elicits acute phase response by activating macrophages to produce pro-inammatory cytokines, which play critical role in apoptosis or cell proliferation. The protective pharmacological mechanism of curcumin against nicotine-induced toxicity on protein malnourished liver is still remaining unclear. This study investigated the ameliorative mechanism of curcumin against nicotineinduced toxicity and also fate of liver particularly under protein restricted condition. Female Albino-rats maintained under normal/protein-restricted diets, were subcutaneously injected with nicotine tartrate (2.5 mg/kg body weight/day) and orally supplemented with curcumin (80 mg/kg body weight/day) for 21 days. The animals were then sacriced to dissect out liver and proceed with further experiments. Interactions of nicotine with DNA both in vivo and in vitro were observed by thermal denaturation and DNA laddering assays. Effects of nicotine on hepatic cells were monitored by differential staining, comet assay, cytokine proling, mRNA and protein expression. Nicotine caused more intense DNA damage, promoted hepatic cell death through up-regulating pro-apoptotic proteins and signaling molecules in protein malnourished individuals. Through up-regulation of anti-apoptotic proteins and proliferation promoting molecules, nicotine dysregulated homeostasis in normal protein condition. Curcumin signicantly ameliorated the nicotineinduced toxicity in both conditions and regulated the imbalance between cell survival and death induced by nicotine. The protein content present in the nicotine induced hepatic cell decides either cell-survival pathway or cytotoxic pathway. 2012 Elsevier B.V. All rights reserved.

Article history: Received 1 July 2011 Received in revised form 1 February 2012 Accepted 9 February 2012 Available online 23 February 2012 Keywords: Apoptosis Cell proliferation Curcumin Nicotine Protein-restriction Signaling molecule

1. Introduction Large populations in developing countries are deprived of proper nutrition and addicted to tobacco consumption (Ortner et al., 2002). Malnutrition is a recurring problem particularly protein-energy malnutrition is widely observed in India and other developing countries (Mller and Krawinkel, 2005). Nicotine, the major addictive alkaloid of tobacco is mainly metabolized in liver (Hukkanen et al., 2005; Nakajima et al., 1998), though its toxic effects on hepatic cells remain unclear. Low dietary protein possesses a constraint on the metabolic activity thereby resulting in impaired detoxication machinery of liver (Nakajima et al., 1998). Based on human autopsy samples from smokers, the highest afnity for nicotine is in the liver, kidney, spleen and lung (Benowitz et al., 2009). Nicotine abuse elicits acute phase response in liver by activating monocytes and macrophages to produce pro-inammatory cytokines like IL-6, TNF-, etc. (Song et al., 1999) whose over exposure eventually

Corresponding author. Tel.: + 91 9433343917. E-mail address: bdc_physics@yahoo.co.in (B. Chattopadhyay). 0014-2999/$ see front matter 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.ejphar.2012.02.009

contribute to acute liver injuries (Hoek and Pastorino, 2002). IL-6 phosphorylates Signal Transducers and Activators of Transcription (STAT) by activating Janus Kinases (Jaks) (Streetz et al., 2000). Phosphorylated STATs form dimers which function as transcription factors for themselves and induce expression of one of its member's proteins e.g. STAT 3. The induction of Suppressor of Cytokine Signaling (SOCS) genes is facilitated by the STATs, with several putative STAT-binding sites in different SOCS promoter regions. Constitutive activation of STAT 3 has been reported in various carcinomas (Macha et al., 2011; Shukla et al., 2010) whereas over expression of SOCS3 has been proved to be detrimental for cell survival (Provost et al., 2005). SOCS proteins have been shown to be negative regulators of cytokine signaling (Alexander and Hilton, 2004). TNF- is an enigmatic cytokine controlling signaling pathways towards cell proliferation and cell death. Complex-I and complex-II are the two complexes formed by TNF- by binding with TNF-R (Wullaert et al., 2007). Complex I activates IKK, which in turn phosphorylates IB resulting in ubiquitination and further proteosomal degradation of IB. This leads to activation of NFB, which comprises of homodimers of p65 or heterodimers of p50 and p65. These dimers then translocate to the nucleus and bind to the promoter

S. Banerjee et al. / European Journal of Pharmacology 684 (2012) 132145

133

region of genes having NF-B consensus site (Tripathi and Aggarwal, 2006). Complex II induces pro-apoptotic protein BAX that leads to release of cytochrome C and reactive oxygen species (ROS) from the mitochondria. Cytochrome C along with a cascade of caspases causes apoptosis whereas ROS induces necrosis of the cell (Wullaert et al., 2007). Curcumin, an active ingredient in the rhizome of Curcuma longa exhibits a variety of pharmacological effects including anti-tumor, anti-inammatory and anti-genotoxic activities (Aggarwal et al., 2003; Menon and Sudheer, 2007). Our previous study showed that nicotine could bind to DNA causing signicantly higher genotoxic effect in protein-restricted condition (Bandyopadhyaya et al., 2008; Banerjee et al., 2010). The number of smokers in female population is increasing day by day who are also deprived of healthy diet. Nicotine seems to be a greater risk factor in women than man (Prescott et al., 1998; Zang and Wynder, 1996). Smoking affects the reproductive health of women and causes infertility, birth defects, ectopic pregnancy and spontaneous abortion (De Mallo et al., 2001). The present investigations elucidate the nicotine induced signaling network and fate of liver cells under normal and protein restricted conditions and the antagonistic effects of curcumin over nicotine induced changes henceforth in female population. 2. Materials and methods 2.1. Chemicals Nicotine hydrogen tartrate and curcumin were purchased (2008) from Sigma Chemicals Company, St. Louis, USA. All other analytical grade chemicals were supplied (2008 and 2009) by Spectrochem Pvt. Ldt. India and Genei, Bangalore, India. 2.2. Diet and treatments Thirty adult (4045 days old) female albino rats (Rattus norvegicus) having body weight 120130 g of Wistar strain were procured from the animal housing facility and acclimatized under standard conditions of temperature and humidity with 12 h light/dark cycles. They were maintained in accordance to the guidelines of Instructional Animal Ethics Committee of Jadavpur University, Kolkata, India as described earlier (Bandyopadhyaya et al., 2008). The animals were fed standard pellet diet (Hindustan Lever ltd., India) and water ad libitum a week prior to start with normal/protein restricted diet. Thirty rats were divided equally (n = 5) into the following groups. Group 1: animals fed with normal protein diet (18% casein, 70% carbohydrate, 7% fat, 4% salt mixture and 1% vitamin mixture) and received no nicotine treatment. Group 2: animals fed with normal protein diet and treated with nicotine, Group 3: animals fed with normal protein diet and treated with nicotine + curcumin, Group 4: animals fed with protein restricted diet (5% casein, 83% carbohydrate, 7% fat, 4% salt mixture and 1% vitamin mixture) and received no nicotine treatment. Group 5: animals fed with protein-restricted diet and treated with nicotine. Group 6: animals fed with protein restricted diet and treated with nicotine + curcumin. Nicotine tartrate was used for nicotine treatment and administered subcutaneously daily at the dose of 2.5 mg/ kg of body weight in 0.5 ml physiological saline and curcumin was administered orally at the dose of 80 mg/kg body weight/day. Compositions of diets were prepared as described by Hawk et al. (1954) and selection of nicotine dose, route of administration and the period of dosing were adopted from earlier study of Mandal et al. (2004). The dose of curcumin was selected from the study of Kalpana and Menon (2004). Nicotine and curcumin administration continued for 21 days. The animals in groups 1 and 4 received subcutaneous injection of 0.5 ml physiological saline without nicotine. One week prior to treatment till completion of the treatments, animals were kept in

their respective dietary regime. After the completion of treatments, animals were kept fasting overnight and sacriced next day by decapitation. Blood was collected from heart immediately after decapitation and serum was separated by centrifugation and stored at 20 C prior to further analysis. Livers were dissected out and wiped clear with tissue paper to remove adhering blood and tissue uid and stored in vacuum desiccators at 20 C as such without pulverization or homogenization in buffer in order to prevent exposure to auto-oxidation environment. 2.3. DNA extraction 50 mg of liver tissue was homogenized in homogenizing buffer containing 1% SDS, 50 mM EDTA, Proteinase K (100 g/l) and incubated at 45 C for 45 min. To the homogenate, equal volumes of saturated phenol and sevag (24:1 mix of chloroform and isoamyl alcohol) was added and centrifuged at 8000 g for 10 min at 4 C in Superspin Plastocraft Centrifuge. The supernatant was collected and 1.5 volumes of sevag was added to it and mixed properly. The mixture was then centrifuged at 8000 g for 10 min at 4 C and the supernatant was collected. Two times volumes of chilled absolute ethanol and 0.2 volumes of ammonium acetate (10 M) was added to the supernatant and the mixture was incubated at 20 C for 1 h. The nuclear precipitate was obtained by spinning the mixture at 14,000 g for 25 min at 4 C, which dissolved in 600 l TE buffer (pH 8). RNase (50 g/l) was added to it and incubated at 37 C for 45 min. Equal volumes of phenol and sevag was added to it, mixed properly and the mixture was centrifuged at 8000 g for 10 min at 4 C. The supernatant was collected carefully and 1.5 volumes of sevag was added to it, mixed, and centrifuged again at 8000 g for 10 min at 4 C. Finally the supernatant was collected carefully and 2 volumes of chilled absolute ethanol and 0.2 volumes of ammonium acetate (10 M) was added to it and incubated at 20 C for 1 h. The DNA precipitate was collected by centrifuging the mixture at 14,000 g for 30 min and dissolved in TE buffer (pH 8). The purity of isolated DNA and its concentration was checked and estimated by spectrophotometrically. 2.4. Thermal denaturation assay Binding interactions of nicotine and curcumin with DNA (both in vivo and in vitro) were studied by thermal denaturation experiment using liver DNA isolated from animals of each group. The absorbance ratios of DNA at 260/280 nm were found to be 1.791.84 indicating that the isolated DNA were satisfactorily free from proteins (Mller and Rajewsky, 1980). Working solutions for DNA were prepared in Millipore-puried water buffered at pH 8 using TrisEDTA (10 mM Tris; 1 mM EDTA). For in vitro study, 1 ml working solution containing 15 g DNA (isolated from rats of normal diet control group) was taken in quartz cuvette and nicotine was added to it such that the nal concentration of nicotine in the mixture became 100 M. Optical densities (OD) of the mixture were monitored at 260 nm at different temperatures (2090 C) using Jasco V-650 spectrophotometer with Teon stoppered quartz absorption cell thermostated with a circulating water heating/cooling accessory. Similar experiments were done by adding different nal concentrations of nicotine (200, 300, 400 and 500 M) and also 500 M nal concentration of nicotine along with 100 M nal concentration of curcumin respectively to 1 ml of working solution containing 15 g DNA (isolated from control rats of normal diet group). All nicotineDNA and nicotineDNAcurcumin solutions were incubated at 37 C for 1 h prior to examination. Heating was applied at 5 C min 1 from 20 C until thermal denaturation of the DNA was completed, as judged from the increase in absorption. Thermal denaturation temperature (Tm) (dened as the mid-point of the hyperchromic transition) was determined from the optical absorbance versus temperature curves. The change in Tm (Tm) following interaction of rat liver DNA with added nicotine and curcumin was

134

S. Banerjee et al. / European Journal of Pharmacology 684 (2012) 132145

evaluated from: Tm = [Tm (DNA) Tm (DNAdrug)]. In vivo thermal denaturation assay of the DNA samples isolated from the animals of each group were studied by observing the OD at different temperatures similarly. 2.5. DNA laddering assay DNA was isolated from liver tissues of animals in control groups (Group 1) as described early. The experiment was conducted by adding nicotine (nal concentration 1, 1.5 and 2 mM respectively) to 15 g DNA each and 2 mM nal concentration of nicotine along with 1 mM nal concentration of curcumin to 15 g DNA and incubated at room temperature for 1 h. The interaction products were resolved in 0.8% agarose gel electrophoresis. DNA isolated from the liver tissues of the animals in each groups were directly analyzed in 0.8% agarose gel electrophoresis to monitor the effects of nicotine and curcumin on DNA in vivo. All the gels were visualized with ethidium bromide staining in BIO View UV Light transilluminator. 2.6. Differential staining Parafn sections of dissected livers from different groups of animals were prepared to perform differential staining. Tissue sections were deparafnized in xylene and rehydrated in various percentages of ethyl alcohol. The sections were then washed with phosphate buffer saline (PBS, pH 7.4), permeabilized with 0.25% Triton X-100 and again washed with PBS. RNase (100 g/ml) treatment was given at 37 C for 20 min. The sections were then incubated in PBS containing propidium iodide (25 g/ml) for 30 min at 39 C. After washing in PBS, the sections were counter stained with bisbenzimide (5 g/ml) and photograph was taken under uorescent microscope (200). An independent examiner performed blinded differential counting. Five tissue sections from each group were stained to obtain consistent results. On the basis of morphology and stain the percentage of apoptosis and necrosis in control and treated groups were evaluated [percentage of necrotic or apoptotic cells = (total number of necrotic or apoptotic cells / total number of cells) 100]. The mean percentages of cells S.E.M. of ve observations were plotted. 2.7. Comet assay The procedure for Comet assay was followed with some modication of the method by Kido et al. (2006) and as described by Bandyopadhyaya et al. (2008). Liver tissues (50 mg) were minced, suspended at 1 ml/g in chilled homogenizing buffer (0.075 M NaCl and 0.024 M EDTA) and gently homogenized at 1000 g using Laboratory Stirrer (REMI-RQ127A) for 10 min at 0 C to obtain nuclear precipitate. The precipitate was then resuspended in 1 ml chilled homogenizing buffer. 100 l of 2% regular melting point agarose (Genei, India) was quickly layered on a pre-cooled fully frosted slide and covered with a coverslip and allowed to solidify. The nuclear preparation was mixed 1:1 (v/v) with 2% low melting point agarose (Genei, India). The cover slip was removed carefully and a second layer of 100 l of the mixture was pipette out on the slide, covered with the cover slip again and allowed to gel at 4 C for 15 min. The slide (without cover slip) was immersed in a freshly prepared and chilled lysing solution (2.5 M NaCl, 100 mM EDTA, 10 mM TrisHCl, 1% Sarkosyl, 10% DMSO and 1% Triton X-100, at pH 10; DMSO added just before use) and kept at 4 C for 2 h. Slides were then placed on a horizontal gel electrophoresis platform in alkaline electrophoresis solution (300 mM NaOH and 1 mM EDTA, pH 13) and left in dark for 15 min to allow unwinding of the DNA to occur. The DNA was then electrophoresed at 4 C in the dark for 15 min at 1 V/cm and approximately 250 mA. The slides were gently rinsed in neutralization buffer (0.4 M TrisHCl, pH 7.5) and stained with 50 l of 20 g/ml ethidium bromides and covered with a cover

slip. The photomicrograph of each slide was taken by Leica Fluorescent Microscope (Model 300 FX) at 400 magnication. 2.8. Measurement of comet parameters Measurement of the comet head diameter, tail length, and percentage of DNA damage were performed as described by Helma and Uhl (2000). A total of 50 cells were screened per animal and examined in a uorescence microscope (Leica 3000-FX with 400 magnication). Quantication of DNA damage for each cell was determined by Image J software as:
Total DNA in comet Total comet area mean DNA intensity Total DNA in comet head Total head area mean DNA intensity
% DNA damage Total DNA in cometTotal DNA in comet head 100 Total DNA in comet

2.9. ELISA Quantication of nicotine and curcumin induced IL-6 and TNF- in serum of normal and protein restricted rats were performed using Quantikine Rat IL-6 and TNF- Immunoassay Kit (Minneapolis, U.S.A.). This assay employs the quantitative sandwich enzyme immunoassay technique. A monoclonal antibody specic for rat IL-6/TNF- had been pre-coated onto a microplate. Standard controls and samples were pipetted into wells. If rat IL-6/TNF- were present, it would bind by the immobilized antibody. After washing away any unbound substances, an enzyme-linked polyclonal antibody specic for rat IL-6/TNF- was added to the wells. Following a wash to remove any unbound antibody, a substrate solution was added to the wells. The enzyme reaction yielded a blue product that turned into yellow when the stop solution was added. The intensity of the color measured was in proportion to the amount of rat IL-6/TNF- bound in the initial step. The sample values were then read off from the standard curve. 2.10. RNA extraction, quantitation and RT-PCR analysis Total RNA was isolated from liver of control and treated rats maintained under normal and protein restricted diets using Qiagen RNAeasy mini kit (Qiagen, Hilden, Germany) as per the manufacturer' instructions. The expression prole for mRNA was evaluated by qRT 2-PCR technique using QuantiTect SYBR green RT-PCR kit (Qiagen, Germany) and by conventional Reverse Transcriptase PCR using Qiagen RT-PCR kit (Qiagen, Germany). The reaction conditions for qRT2-PCR were 50 C for 30 min for reverse transcription; initial PCR activation at 95 C for 15 min followed by 40 cycles of denaturation at 94 C for 15 s, annealing at a 5 C below the Tm of primers for 30 s and extension of 30 s at 72 C. The reaction conditions for RT-PCR were 50 C for 30 min for reverse transcription; initial PCR activation at 95 C for 15 min followed by 30 cycles of denaturation at 94 C for 15 s, annealing at a 5 C below the Tm of primers for 30 s, extension of 1 min at 72 C nal extension of 10 min at 72 C. One micro liter of template RNA containing 50 ng of total RNA was used in a 50 l RT-PCR cocktail. All reactions were performed in triplicates. Relative quantications were performed in Light Cycler Real-Time PCR Machine using Light Cycler 480 relative quantication software release 1.2.0625. GAPDH was used as reference control. The amounts of the detected gene products were normalized with that of GAPDH before statistical analysis. The results are expressed as the target/reference ratio of each sample normalized by the target/reference ratio of the calibrator. The RT-PCR products were resolved on 1.2% agarose gel, stained with ethidium bromide and visualized under UV-transilluminator. Primers (Operon Biotechnologis, Gmbh, Germany) used for RT-PCR were:

S. Banerjee et al. / European Journal of Pharmacology 684 (2012) 132145

135

IL-6: Forward 5GCCCTTCAGGAACAGCTATG3 Reverse 5ACCACAGTGAGGAATGTCCA3; STAT3: Forward 5 TCTTAGGGCCTGGTGTGAAC3 Reverse 5CACTCCGAGGTCAGATCCAT3; SOCS3: Forward 5 CCTCAAGACCTTCAGCTCCA3 Reverse 5GGCTGGATTTTTGTGCTTGT3; p65: Forward 5CTCCTTTTCTCAAGCCGATG3 Reverse 5GACAGATGCCAGGTCTGTGA3; IB: Forward 5 TTGGTCAGGTGAAGGGAGAC3 Reverse 5ACAAGTCCACGTTCCTTTGG3; Bcl-2: Forward 5ATGATAACCGGGAGATCGTG3 Reverse 5 CTCACTTGTGGCCCAGGTAT3; Bax: Forward 5GAAGACAGGGGCCTTTTTGT3 Reverse 5CAGCCCATCTTCTTCCAGAT3

3. Results 3.1. NicotineDNA adduction caused subsequent shift in DNA melting curve, which was reverted by curcumin In vitro interaction study showed that nicotine alone and together with curcumin affected the DNA melting temperature as seen in Fig. 1A and B. It was observed that the hyperchromicity of normal

2.11. Western blotting Effects of nicotine and curcumin on the protein expression level of Bax, Bcl-2, IB and p65 in normal and protein-restricted liver were assessed by Western blot analysis. Cytosolic and nuclear fractions of liver tissues were prepared by using Lysis Buffer A (20 mM HEPES, 100 mM NaCl, 1 mM DTT, 1 mM EDTA, 0.05% Triton X-100, 1 Protease Inhibitor cocktail, pH 7.9) and Lysis Buffer B (20 mM HEPES, 1.5 mM MgCl2, 0.4 M NaCl, 1 mM DTT, 1 mM EDTA, 0.05% Triton X-100, 25% Glycerol, 1 protease inhibitor cocktail, pH 7.9). The tissue (30 mg) was minced in PBS (pH 7.4) containing 1 protease inhibitor cocktail and homogenized on low power using 30 s bursts until fully homogenized. The homogenate was transferred to pre-cooled centrifuge tube and centrifuged at 2900 g for 10 min at 4 C. Supernatant (a) was collected and the pellet was dissolved in lysis buffer A which again centrifuged at 3500 g for 10 min at 4 C. Supernatant (b) was collected and the pellet was dissolved in lysis buffer B, vortexed for 10 s and incubated on ice for 20 min. After incubation, it was centrifuged at 40,000 g for 15 min at 4 C and the supernatant (c) was collected. Combination of supernatants (a) and (b) was the cytoplasmic extract and supernatant (c) was the nuclear extract. Proteins were precipitated by addition of 8 volumes ice-cold acetone to the supernatants, incubated overnight at 20 C and pelleted by centrifugation at 12,000 g for 20 min at 4 C. The pellets were dissolved in buffer, containing 8 M urea, 5% mercaptoethanol, 10% SDS, 2% CHAPS and 50 mM DTT. Protein concentration was estimated by Bradford method and equal amount of proteins (20 g) were separated on 12% SDS-PAGE, which then electrophoretically transferred on nitrocellulose membranes. After blocking with 2% bovine serum albumin (BSA) in TBST (137 mM NaCl, 25 mM Tris, 1 mM Na2EDTA and 0.1% Tween 20), the membranes were incubated with rabbit anti-mouse (Bax, Bcl-2, IB and p65) antibodies (Santa Cruz Biotech, California, USA) at 4 C overnight at a dilution of 1:200 to 1:1000. After washing three times with TBST, the membranes were incubated with HRP conjugated goat anti-rabbit IgG antibody (1:2000 dilution) at room temperature for 3 h, and then washed three times with TBST before incubation with a chemiluminescent peroxides substrate (Sigma, St. Louis, USA). Reactions were visualized using an enhanced chemiluminescence system. This experiment was repeated two times. 2.12. Statistical analysis All experiments were repeated twice and data (n = 10 animals) were averaged and tabulated as mean standard deviation (S.D.). The statistical analysis of the data estimated from each group of all conditions was done by One-way analysis of variance (ANOVA) and all pair wise Multiple Comparison Procedures (HolmSidak method) by using Sigma Stat (version 3.2). Signicance levels were examined at P b 0.01 for signicant and P b 0.001 for more signicant.

Fig. 1. A. In vitro thermal denaturation of liver DNA treated with different concentrations of nicotine.Binding interactions of nicotine with DNA were studied by thermal denaturation experiments using liver DNA isolated from control group animals of normal diet. For in vitro study, 1 ml working solution (10 mM Tris; 1 mM EDTA, pH 8) containing 15 g DNA was taken in quartz cuvette and 100 M nicotine was added to it. Optical densities (OD) of the mixture were monitored at 260 nm at different temperatures (2090 C) using Jasco V-650 spectrophotometer with Teon stoppered quartz absorption cell thermostated with a circulating water heating/cooling accessory. All nicotine DNA solutions were incubated at 37 C for 1 h prior to examination. Heating was applied at 5 C min 1 from 20 C until thermal denaturation of the DNA was completed, as judged from the increase in absorption. Thermal denaturation temperature (Tm) dened as the mid-point of the hyperchromic transition was determined from the optical absorbance versus temperature curves. The change in Tm (Tm) following interaction of rat liver DNA with added nicotine and curcumin was evaluated from: Tm = [Tm (DNA) Tm (DNAdrug)]. Similar experiments were done by adding 200, 300, 400 and 500 M nicotine to DNA.B. In vitro thermal denaturation of liver DNA treated with nicotine and curcumin.The interactions of nicotine and curcumin with DNA were studied similarly as described in Fig. 1A. In this experiment 500 M nicotine along with 100 M curcumin respectively was added to 1 ml of working solution containing 15 g DNA and performed the experiment similarly.

136

S. Banerjee et al. / European Journal of Pharmacology 684 (2012) 132145 Table 1A For in vitro thermal denaturation 15 g DNA dissolves in 1 ml working solution was taken in quartz cuvette and required concentration of drug was added to it. Optical densities (OD) of the mixture were monitored at 260 nm at different temperatures (2090 C). Heating was applied at 5 C min 1 from 20 C until thermal denaturation of the DNA was completed. The experimental setup was repeated twice and all data were averaged over n = 10 animals, and given mean S.D. Signicance levels were determined using ANOVA, where a, P b 0.01; b, P b 0.001.

DNA increased with a sharp rise from 60 C and stabilized at 80 C. The mid-point of this hyperchromic transition (Tm value) of normal DNA was determined as 66 C. There was a rise in Tm observed with the increasing concentrations of nicotine used (Fig. 1A). The presence of curcumin (100 M) could inhibit the decrease of nicotine-induced (500 M) Tm value of DNA (Fig. 1B). In vivo drugDNA interaction results (Fig. 2A and B) were in line with in vitro interaction results. The drugDNA interaction at variable doses of nicotine and curcumin are summarized in Tables 1A and 1B. The Tm value of liver DNA from control rats under normal and protein restricted diet groups were 66.02 C and 65.12 C respectively and that of nicotine treated animals of normal and protein restricted diet groups decreased to 58.44 C (Tm = 7.56 C) and 54.02 C (Tm = 11.1 C) respectively (Table 1B). The Tm value for nicotine with curcumin treated animals of normal and protein restricted diet groups were 62.39 C (Tm = 3.63 C) and 63.02 C (Tm = 2.1 C) respectively.

Concentration (M)
0 Nicotine 100 200 300 400 500 NIcotine + Curcumin 500 100

Tm C
66.02 a 63.42 61.01 57.55 53.03 47.86 64.84 b b a a b a

Tm C 0 a 2.59 5.01 8.47 12.98 18.16 1.13 b b a a a a

Table 1B Determination of thermal denaturation temperature (Tm) and Tm from denaturation curves of rat liver DNA (in vitro study). For in vivo thermal denaturation DNA isolated from each animals. 15 g dissolves in 1 ml working solution was taken in quartz cuvette and optical densities (OD) of the DNA solution was monitored at 260 nm at different temperatures (2090 C). Heating was applied at 5 C min 1 from 20 C until thermal denaturation of the DNA was completed. The experimental setup was repeated twice and all data were averaged over n = 10 animals, and given mean S.D. Signicance levels were determined using ANOVA, where a, P b 0.01; b, P b 0.001.

Group Normal diet

Subgroup
Control Nicotine Treated Nicotine + Curmine Treated

Tm C
66.02 58.44 62.39 a a

Tm C 0 a 7.56 3.36 a a

Protein restricted diet

Control Nicotine Treated Nicotine + Curmine Treated

65.12 54.02 63.02

b b

0 a 11.10 2.10

b b

3.2. Nicotine treatment damaged DNA showing characteristic cleavage pattern and Comet formation, which was reverted by curcumin Fig. 3A shows the in vitro laddering nature of DNA in presence of different concentrations of nicotine. The protective role of curcumin against nicotine-induced laddering of DNA was also observed (Fig. 3A). The internucleosomal fragments appeared due to nicotine-induced damage (in vivo) in both dietary conditions are presented in Fig. 3B. Fig. 4A shows the differential staining micrographs of rat liver tissues under normal and protein-restricted conditions. Micrographs of control, nicotine treated and nicotine+ curcumin treated rat liver tissues were taken for the animals of both dietary groups. The percentage of apoptotic and necrotic cells present in the micrographs of rat liver tissue under both normal and protein restricted dietary groups are presented in Fig. 4B. The morphological details of the cells on the basis of which the cells were differentially counted are shown in Fig. 4C. Percentage of apoptotic and necrotic cells present in the protein restricted control

Fig. 2. A. In vivo thermal denaturation of liver DNA isolated from rat of normal diet treated with nicotine and nicotine + curcumin.For in vivo thermal denaturation assay, DNA samples were isolated from the animals of normal diet group. The O.D. at different temperatures of the isolated DNA (15 g DNA take in 1 ml working solution) was measured similarly as described in in vitro study.B. In vivo thermal denaturation of liver DNA isolated from rat of restricted diet treated with nicotine and nicotine + curcumin.For in vivo thermal denaturation assay, DNA samples were isolated from the animals of restricted diet group. The O.D. at different temperatures of the isolated DNA (15 g DNA take in 1 ml working solution) was measured similarly as described in in vitro study.

S. Banerjee et al. / European Journal of Pharmacology 684 (2012) 132145

137

3.3. Nicotine heightened expression of the Th1 cytokines from their basal serum levels and curcumin prevented this elevation ELISA was performed to determine the concentration of IL-6 and TNF- in serum of rats treated with nicotine and curcumin in both dietary conditions. ELISA results indicated that the protein expression prole of IL-6 (Fig. 6A) and TNF- (Fig. 6B) in basal level of protein restricted serum was more as compared to that of serum of normal diet. Nicotine increased the concentration of IL-6 by 2 folds in normal diet condition and 2.5 folds in protein restricted condition (Fig. 6A) approximately. The concentration of TNF- was found to be 2.5 folds more in normal diet serum and 1.5 folds more in protein restricted serum (Fig. 6B) due to nicotine treatment. Curcumin treatment suppressed the protein levels of both the cytokines and thereby brought down their levels approximately close to that in the control of their respective groups as seen from Fig. 6. The effects of curcumin in down regulation of the cytokines were found to be more prominent in protein restricted condition. 3.4. Nicotine and curcumin regulated a signaling cascade involving inammatory cytokines, signature signaling molecules, transcription factors and apoptosis-associated molecules that modulate cell survival and death, variably in both the dietary conditions To monitor the effects of nicotine and curcumin on the signaling molecules we measured their relative mRNA expressions by Real Time PCR. Consistent over expression of IL-6, STAT3 and SOCS3 were observed in liver of nicotine-treated rats under both dietary conditions, in comparison to their respective controls (Fig. 7A and B). But the expression levels of IL-6 and SOCS3 in restricted diet condition were comparatively higher than that of normal diet condition. At the same time the expression level of STAT3 was found to be less in protein restricted condition than that of normal diet condition. Exposure to curcumin resulted in down regulation of these molecules in comparison to their nicotine-induced expression in both dietary conditions (Fig. 7A and B). The variation in the expressions of IL-6, STAT3 and SOCS3 indicated that the basal level of IL-6 and SOCS3 was higher and that of STAT3 was lower in protein restricted condition as compared to normal diet condition (Fig. 7C). Nicotine induced STAT3/SOCS3 ratio in protein-restricted liver was found to be less as compared to normal liver (Fig. 7A). Downregulation of IL-6 and STAT3 by curcumin was more effective in proteinrestricted condition whereas SOCS3 was down regulated more in normal diet condition. The mRNA expression levels of p65, IB, Bcl-2 and Bax were elevated signicantly after nicotine treatment in both dietary conditions as observed in Fig. 7A and B. Curcumin induced down-regulation of Bcl-2, Bax and p65 whereas over-expressed IB in both dietary conditions. Comparative study between their expressions in different dietary conditions revealed that the basal levels of p65 and Bcl-2 were lower whereas IB and Bax were higher in protein restricted condition compared to normal protein condition (Fig. 7C). Nicotine induced Bcl-2/Bax ratio in protein restricted liver was lower in comparison to the ratio that of normal liver. Curcumin induced downregulation of Bcl-2 and Bax were more effective in protein-restricted condition than normal protein condition. Also curcumin induced expression level of p65 was found to be lower but that of IB was higher in liver under restricted protein condition compared to normal protein condition. 3.5. Nicotine and curcumin induced expression of apoptosis associated molecules and regulation of NFB activation in both dietary conditions The effects of nicotine and curcumin on the expression levels of pro-apoptotic protein Bax, anti-apoptotic protein Bcl-2 and transcription factor NFB under both dietary conditions were determined by Western blot analysis (Fig. 7D). The expression of Bcl-2 protein was

Fig. 3. A. Photomicrographs of gel electrophoresis showing DNA laddering (in vitro assay)DNA isolated from the liver tissues of the animals in control groups and isolated DNA (15 g) was treated with different concentrations of nicotine and curcumin. The treated DNA was analyzed in 0.8% agarose gel electrophoresis to monitor the effects of nicotine and curcumin on DNA in vitro. All the gels were visualized with ethidium bromide staining in BIO View UV Light transilluminator and photograph was taken.B. Photomicrographs of gel electrophoresis showing DNA laddering (in vivo assay)DNA sample (15 g) isolated from the liver tissues of individual animals in each groups were directly analyzed in 0.8% agarose gel electrophoresis to monitor the effects of nicotine and curcumin on DNA in vivo. All the gels were visualized with ethidium bromide staining in BIO View UV Light transilluminator and photograph was taken.

group (12.4 1.2% and 16.6 1.8% respectively) was relatively more than those of normal diet control group (8 1.2% and 11.6 2.7% respectively). Exposure to nicotine increased the percentage of apoptosis and necrosis in both dietary conditions, where the percentage of cell death was signicantly higher in protein restricted nicotine treated group (30 3.4% for apoptosis and 39 3% for necrosis) than normal diet nicotine treated group (17 1.7% for apoptosis and 25.2 2% for necrosis). Exposure to combination of nicotine and curcumin resulted in decrease of apoptosis (10.4 1.8% for normal diet and 23 2.2% for protein restricted diet) and necrosis (18.8 2.3% for normal diet and 20.4 1.2% for protein restricted diet) in the rat liver tissues. The results of Comet assay are shown in Fig. 5A. In this gure, the comet photographs of the rat liver DNA maintained under both normal protein diet and protein restricted diets are included. Comet assay showed retrenched head diameter, elongated tail length (Fig. 5B), reduced head diameter vs. tail length ratio (Fig. 5C) and heightened percentage of DNA damages (Fig. 5D), which were signicantly higher in protein-restricted condition. The percentages of DNA damages as observed in comet assay were 5.96% in normal diet control group and 13.69% in protein restricted control group respectively. Nicotine significantly elevated the percentage of DNA damages to 52.84% in proteinrestricted condition and 36.76% in normal condition (Fig. 5D). Curcumin administration more signicantly prevented the nicotine-induced damage in the protein-restricted group (Fig. 5D).

138

S. Banerjee et al. / European Journal of Pharmacology 684 (2012) 132145

higher in control of normal diet rat liver than that of control of protein restricted diet rat liver. Nicotine exposure elevated Bcl-2 expression in both dietary conditions but the expression level was distinctly higher in normal dietary condition. Curcumin exposure down regulated Bcl-2

in both dietary conditions. Bax expression levels were observed to be higher in comparison of control of protein restricted diet rat liver than control of normal diet rat liver. Nicotine exposure resulted in higher upregulation of Bax in protein-restricted liver than normal liver whereas

Fig. 4. A. Photomicrographs of rat liver tissues treated with differential staining.The tissue sections from individual animals of different groups were stained with propidium iodide and bisbenzimide and examined with uorescent microscope. Photographs of the stained liver sections were taken and presented where C designated for control, N for nicotine treated and NC designated as nicotine + curcumin treated liver tissue sections.B. Apoptotic and necrotic cells percentage in rat liver tissues.Percentage of apoptotic and necrotic cells present in rat liver tissue section for control (C), nicotine treated (N) and nicotine + curcumin treated (NC) of both normal diet and protein restricted diet groups are presented in this gure. The cells on each section were differentially counted to gain an estimate of the number of viable, apoptotic and necrotic cells respectively (Data are Mean % of cells S.D. of ve observations). Signicance levels were determined using ANOVA, where, indicates P b 0.01 and , P b 0.001.C. Typical photomicrographs of differentially stained rat liver showing the morphology of different cells.The tissue sections from different groups were stained with propidium iodide and bisbenzimide and examined with uorescent microscope. Using this technique the viable cells are identied as cells with intact nucleus and bisbenzimide positive (resulting in blue uorescence). Apoptotic cells were identied by their highly condensed or fragmented nuclei that are bisbenzimide positive (resulting in blue uorescence) indicating early apoptosis, or bisbenzimide and propidium iodide positive (resulting in pink uorescence) indicating late apoptosis. Cells with ruptured membrane and morphology that are bisbenzimide and propidium iodide positive (resulting in pink uorescence) indicate necrotic cells.

S. Banerjee et al. / European Journal of Pharmacology 684 (2012) 132145

139

the expression levels of IB and p65 in cytoplasm whereas it upregulated the expression of p65 in nucleus. Curcumin treatment led to upregulation of IB and p65 in cytoplasm whereas downregulation of p65 in nucleus. 4. Discussion Nicotine has been implicated as a potential risk factor of various cancer (Chen et al., 2008; Martnez-Garca et al., 2010) and liver diseases (Hukkanen et al., 2005). It induces enhancement of tissue perfusion and angiogenesis (Egleton et al., 2009). Protein-calorie malnutrition is found in 6590% of patients with advanced liver disease (Lautz et al., 1992) and also nicotine exposure aggravates DNA damage of liver cells in such condition (Bandyopadhyaya et al., 2008; Banerjee et al., 2010). This phenomenon prompted us to investigate the effects of nicotine on cell survival and cell death of hepatic cells in protein malnourished condition. Thermal denaturation study shows a steep fall in the Tm value of nicotine treated DNA (Fig. 1A). Previously we have observed that nicotine perturbs the structural integrity of DNA at higher (>500 M) concentrations (Banerjee et al., 2010). It may induce breakage of hydrogen bonds between the bases of the two strands for which the strands become vulnerable to thermal denaturation and result in lowering of the Tm value. Higher the concentration of nicotine used for interaction, higher will be the number of hydrogen bonds breakage in DNA resulting in further decrease of the Tm value. Curcumin seems to be potent enough to antagonize the effect of nicotine because it can bind directly to nicotine and suppress the characteristic UVabsorbance of nicotine (Banerjee et al., 2010). Signicant differences between the Tm values of DNA for nicotine treated animals in both dietary groups clearly indicate that nicotineDNA adduct formation in protein restricted liver cells is greater than that of normal protein liver cells (Fig. 2A and B and Tables 1A and 1B). It is also reported that nicotine binds to tryptophan residue of proteins as well as it binds to DNA but the binding afnity of nicotine to proteins is greater than that to DNA (Banerjee et al., 2010; Wang et al., 2000). The availability of proteins in normal hepatic cells restricts nicotine to form adduct with DNA whereas the scarcity of proteins in restricted diet hepatic cells allows more nicotine to interact with DNA and induce more changes. In vitro laddering assay (Fig. 3A) indicates fragmentation of nicotine treated (12 mM) liver DNA. In vivo results further indicate greater extent of nicotine treated DNA fragmentation of hepatic cells under protein-restricted condition (Fig. 3B). These are in agreement with our previous observations (Bandyopadhyaya et al., 2008; Banerjee et al., 2010). Curcumin (present 1 mM) prevents fragmentation of DNA that occurred due to nicotine (present 2 mM) treatment (Fig. 3A). DNA damage within the cells due to nicotine treatment may be due to direct interaction of nicotine with DNA and/or by ROS produced in response to signaling pathways induced by nicotine. Differential staining shows that nicotine exposure increases percentages of apoptotic and necrotic cells of rat liver tissues but the mode of cell deaths is predominantly due to necrosis in protein-restricted condition (Fig. 4B). This again conrms the aggravated effect of nicotine on liver tissue in protein-restricted condition. Whereas curcumin minimizes the nicotine-induced damage more effectively in proteinrestricted condition that corroborates to our previous published results (Banerjee et al., 2010). Comet assay also indicates the mode of cell death on nicotine treatment. In apoptosis, the majority of DNA fragments migrate towards the tail whereas in necrosis, the majority of DNA fragments remain in the comet head (Fairbairn and O'Neill, 1995, 1996; Fairbairn et al., 1996). Comet assay results are in line with the internucleosomal fragmentation pattern as observed in DNA laddering assay. Curcumin prevents distortion of the nuclear material and thereby protects the hepatic cells from cytotoxic effects of nicotine in both dietary conditions (Fig. 5C and D).

Fig. 4 (continued)

curcumin down regulated Bax expression in both dietary conditions. The expression levels of IB and p65 in cytoplasmic fraction were assessed to analyze NFB activation and nuclear fraction was analyzed to determine NFB translocation. Nicotine exposure downregulated

140

S. Banerjee et al. / European Journal of Pharmacology 684 (2012) 132145

Protein malnutrition also leads to various physical complexities characterized by persistent or relapsing fatigue. High expression level of IL-6 is generally related to fatigue scores and greater magnitude of TNF- can also be observed in these conditions (Gaab et al., 2005; Glaser et al., 1999). Protein deciency induces stress in liver leading to over-expression of Th1 expressed cytokines. ELISA results of our experiment conrm the previous reports in protein-restricted condition (Fig. 6A and B). Mahapatra et al. (2011) have reported that nicotine augments the secretion of pro-inammatory cytokines

and generates excess amount of ROS in macrophages. According to Song et al. (1999), nicotine increases IL-6 mRNA expression in liver and spleen. Our ndings show that nicotine induced expression of these cytokines in serum is signicantly higher in protein restricted condition as compared to normal protein condition. Stress and nicotine therefore synergistically heightens the immunological and acute phase response in protein restricted condition. Signicantly higher level of IL-6 in protein restricted (control/ treated) condition increases STAT3 expression (Fig. 7A and B),

Fig. 5. A. Photomicrographs of Comet assay of liver DNA of rats.Comet assay were done by using liver DNA from control, nicotine, and nicotine + curcumin treated rats of both normal diet and protein restricted diet groups. Comet photomicrographs of each liver DNA, where C for control, N for nicotine treated and NC for nicotine + curcumin treated are shown here.B. Determination of head diameter and tail length of Comet picture of liver DNA from rats maintained with normal and protein restricted diets.Signicance levels were determined using ANOVA, where, indicates P b 0.01 and , P b 0.001.C. Determination of head diameter vs. tail length ratio of liver DNA from rats maintained with normal and protein restricted diets.Comet head diameter vs. tail length ratios of two different diets, where C for control, N for nicotine treated and NC for nicotine + curcumin treated are shown here. Signicance levels were determined using ANOVA, where, indicates P b 0.01 and , P b 0.001.D. Determination of % of damage of liver DNA from rats maintained with normal and protein restricted diets.A total of 50 cells were screened per animal and examined in a uorescence microscope (Leica 3000-FX with 400 magnication). Quantication of DNA damage, head diameter and tail length for each cell was determined by Image J software. Data are presented as Mean S.D. Signicance levels were determined using ANOVA, where, indicates P b 0.01 and , P b 0.001.

S. Banerjee et al. / European Journal of Pharmacology 684 (2012) 132145

141

Fig. 6. A. Graphical representation of protein expression prole of inammatory cytokines: IL-6 in serum of rats.Expression prole of IL-6 of rats maintained under normal and protein-restricted diets are shown here, where C: control; N: nicotine treated; NC: nicotine+ curcumin treated. Data are presented as Mean S.D. (n= 5). Signicance levels were determined using ANOVA, where, indicates P b 0.01 and , P b 0.001.B. Graphical representation of protein expression prole of inammatory cytokines TNF- in serum of rats.Expression prole of TNF- of rats maintained under normal and protein-restricted diets are shown here, where C: control; N: nicotine treated; NC: nicotine + curcumin treated. Data are presented as Mean S.D. (n= 5). Signicance levels were determined using ANOVA, where, indicates P b 0.01 and , P b 0.001.

Fig. 5 (continued)

which binds to the promoter region of SOCS3 leading to its overexpression. SOCS3 induces a feedback inhibition on STAT3 dimerization and ultimately down-regulates STAT3 expression as observed in Fig. 7A. The level of nicotine induced IL-6 expression is lower in normal diet fed rats, which also leads to increase the expression of STAT3. It seems that the increased concentration of STAT3 is not enough to induce SOCS3 for completing the feed-back inhibition loop for which higher expression of STAT3 but lower expression of SOCS3 are observed in normal protein condition (Fig. 7A). Our result indicates constitutive activation of NF-B in normal condition than in protein-restricted condition due to nicotine exposure. Activated NF-B binds to the promoter regions of target genes (Bcl-2, IL-6 and IB etc.) and up-regulates their expression. It is

observed that expressions of Bcl-2 and p65 are signicantly higher in normal dietary condition whereas expressions of IL-6 and IB are higher in protein-restricted condition (Fig. 7C). Nicotine exposure upregulates the mRNA expression of p65 and IB in both dietary conditions (Fig. 7B) but the protein expression results reect a possibility of post-translational modication of IB and p65 (Fig. 7D). Downregulated expression of IB and p65 in cytoplasm and upregulation of p65 in nucleus (Fig. 7D) clearly indicates degradation of IB leading to translocation of NFB from cytoplasm to nucleus. Bax a major pro-apoptotic member of the Bcl2 family forms a heterodimer with Bcl2 and functions as an apoptotic activator. According to Kim et al. (2005), nicotine increases the mRNA level of Bax and decreases that of Bcl2. The higher level of mRNA expression of Bax suggests that nicotine exposure up-regulates higher level of Bax expression in liver under protein restricted condition (Fig. 7C).

142

S. Banerjee et al. / European Journal of Pharmacology 684 (2012) 132145

Over-expressed SOCS3 reduces malignant pleural mesothelioma (MPM) proliferation, induces apoptosis, partial G0/G1 arrest (Iwahori et al., 2011) and also promotes apoptosis of mammary differentiated cells (Provost et al., 2005). A balance between apoptosis and survival is maintained by regulating the levels of anti-apoptotic protein (Bcl-2) and pro-apoptotic protein (Bax). Upregulated protein expression of Bcl-2 is in line with the upregulation of p65 in nucleus (Fig. 7D), whereas the expression of Bcl-2 is signicantly higher in normal dietary condition. Nicotine also upregulates the expression of pro-apoptotic protein BAX (Fig. 7D) in both dietary conditions where the expression of BAX is signicantly higher in protein restricted condition. Difference in the expression of BAX and Bcl-2 may be due to the stress induced by protein malnutrition.

From Fig. 7A, the Bcl/Bax ratios of liver cells are determined as 0.57 and 1.33 for protein restricted diet and normal diet respectively in nicotine treated condition. This overhand expression of Bax clearly promotes apoptosis in protein-restricted condition. The over-expression in non-small-cell lung carcinoma (Yin et al., 2011) and aberrant expression and constitutive activation in cervical carcinogenesis (Shukla et al., 2010) were reported for STAT3. Macha et al. (2011) have established the nicotine-induced NF-B and STAT3 pathways in head and neck cancer cells. Constitutive activation of NF-kB causes resistance to apoptosis in human cutaneous T cell lymphoma HuT-78 cells (Giri and Aggarwal, 1998). A correlation between heavy cigarette smoking and increased expression of Bcl-2 in patients with lung, head, or neck cancer suggests that Bcl-2 may be

Fig. 7. A. Nicotine and curcumin induced mRNA expression proles of representative inammatory cytokine (IL-6), signature signaling molecules (STAT3 and SOCS3), and regulatory molecules in cell survival and apoptosis (NF-B, p65, bcl-2, bax), in different dietary conditions.Graphical representation of qRT2 PCR data, where C represents control, N represents nicotine treated, NC represents nicotine + curcumin treated. The target gene products were normalized with GAPDH, used as internal control. Data are presented as Mean S.D. (n = 5).B. RT-PCR gel image of mRNA expression prole of molecules in different dietary conditions, where C represents control, N represents nicotine treated, NC represents nicotine + curcumin treated. The housekeeping gene GADPDH was used as control.C. Graphical representation of qRT2 PCR data of nicotine and curcumin induced mRNA expression prole.This graph represents the inammatory cytokine (IL-6), signature signaling molecules (STAT3 and SOCS3), and regulatory molecules in cell survival and apoptosis (NF-B, p65, bcl-2, bax) of normal and restricted dietary conditions, where C represents control, N represents nicotine treated, NC represents nicotine + curcumin treated.D. Western blotting analysis for protein expression of rat liver under normal and protein restricted diets.Photographs of Western blotting analysis for Bax, Bcl-2, IB, cytoplasmic p65 and nuclear p65 protein expression are shown. Here NDC means normal diet control rat, NDN means normal diet with nicotine treated rat and NDNC means normal diet with nicotine + curcumin treated rat. Similarly RDC means protein restricted diet control rat, RDN means protein restricted diet with nicotine treated rat and RDNC means protein restricted diet with nicotine + curcumin treated rat. Cytoplasmic and nuclear fractions of rats of different groups were isolated and protein expression levels were determined.

S. Banerjee et al. / European Journal of Pharmacology 684 (2012) 132145

143

Fig. 7 (continued)

a target of carcinogens found in tobacco smoke (Gallo et al., 1995). Signicantly lower fragmentation of DNA, constitutive activation of NF-B and increased expressions of p65, STAT3 and Bcl-2 observed in our experiments clearly support the cellular survival in nicotine treated normal liver. The anticancer potential of curcumin stems from its ability to suppress proliferation of a wide variety of tumor cells and downregulates several transcription factors. Curcumin attenuates the expression of IL-6 and IL-8 in the TNF--treated HaCaT cells (Park et al., 2010) and inhibits Th1 cytokine prole in CD 4 + T cells (Kang et al., 1999). These results corroborate with our ndings showing that curcumin down regulates the protein expression level of IL-6 and TNF- in serum of rats in both dietary conditions (Fig. 6A and B). It is already established that nicotine increases lipid peroxidation. It signicantly increases Malondialdehyde (MDA) levels in plasma and liver tissues (Chattopadhyay and Chattopadhyay, 2008; Chattopadhyay et al., 2010). We have also observed that curcumin down regulates ROS levels in serum and protects hepatic cell membranes of nicotine induced rats from lipid peroxidation (communicated data). Suppression of IL-6 level in serum leads to suppression of signaling molecules (STAT3 and SOCS3) that are up-regulated through JAK-STAT pathway. Curcumin induces down regulation of STAT3 leading to reduction in dysregulated survival of cells that is supported by constitutive expression of STAT3. It also protects cells from dysregulated apoptosis supported by overexpressed SOCS3. Curcumin supplemented down regulation of TNF- leads to over expression of IB and suppression in the expression of

NF-B (Fig. 6 and 7). IB (an NF-B target gene) also terminates NFB activation at the transcriptional level. The increased synthesis of IB shuts down NF-B-induced gene expression by IB-mediated nuclear export of the DNA-binding subunits, thereby acting within a negative feedback loop (Arenzana-Seisdedos et al., 1997). Curcumin supplementation leads to simultaneous co-expression of IB and p65 in cytoplasm (Fig. D) along with downregulation of p65 in the nucleus (Fig. 7D). This clearly supports the phenomenon of curcumin mediated NF-B inactivation and downregulation of its target genes IL-6 and Bcl2. Also down-regulation of TNF- inhibits the expression of proapoptotic molecule (Bax) in presence of curcumin (Figs. 6 and 7).

5. Conclusion Nicotine promotes cell survival in hepatic cells maintained under normal protein condition. On the other hand, it acts as a cytotoxic agent promoting hepatic cell death, which may lead to liver cirrhosis. Thus, the protein content of the nicotine induced hepatic cell decides either the survival pathway or cytotoxic pathway. Curcumin signicantly ameliorates nicotine-induced changes in both dietary conditions and regulates the imbalance between cell survival and death induced by nicotine, which is shown in Fig. 8. Curcumin supplementation along with chemotherapy and reduced protein intake may prove therapeutically benecial in treating cancers that were resistant to chemotherapy and radiation therapy due to over expression of anti-apoptotic proteins.

144

S. Banerjee et al. / European Journal of Pharmacology 684 (2012) 132145

Fig. 8. Mechanism of the pathway of nicotine and curcumin interaction with liver in different dietary conditions.Nicotine induced IL-6 binds to IL-6 receptor gp130 inducing phosphorylation of STAT3 by Jaks and STAT3 dimerization. STAT3 dimers translocates to the nucleus and binds to STAT binding sequence TTNNNNNAA. STAT3 functions as transcription factor for STAT3 itself and binding of STAT3 on their promoter region upregulates STAT3. SOCS3 promoter region has STAT3 binding site and over-expression of STAT3 promotes SOCS3 expression. SOCS3 induces a feedback inhibition on phosphorylation of STAT3 by Jaks, inhibiting STAT3 dimerization and nuclear translocation. Over expression of STAT3 is observed in hepatic cells maintained under normal dietary conditions whereas over expression of SOCS3 is observed in hepatic cells maintained under protein restricted condition. Nicotine induced TNF- binds to its receptor inducing phosphorylation, ubiquitination of IB by IKK, activating p65-p50 (NF-B) dimers to translocate to the nucleus. NF-B functions as transcription factor for IL-6, Bcl-2 (anti-apoptotic) and IB thus upregulating their expression. TNF- induced IL-6 binds to gp130 further inducing its response through JAK-STAT signaling pathway. Binding of TNF- to TNF-R1 leads to complex II formation and caspase 8 is activated. Caspase 8 initiates the mitochondrial pathway by cleaving Bid to tBid which leads to insertion of Bak and Bax (pro-apoptotic) in the mitochondria and nally mitochondrial permeabilization. These events result in the mitochondrial release of cytochrome C and ROS. Cytochrome C contributes to apoptosis whereas ROS contributes to necrosis. Over expression of Bcl-2 is observed in hepatic cells under normal dietary condition whereas over expression of Bax is observed in hepatic cells under protein restricted condition. Curcumin supplementation down regulated IL-6 and TNF- thus downregulating the signaling molecules down the line. Curcumin upregulated the expression of IB which translocates to the nucleus, binds to p65 and importing it back to its inactive state in the cytoplasm.

Conict of interest There is no conict of interest in this research work. Acknowledgment The support for this work from Biophysics Laboratory (Physics Department, Jadavpur University, Kolkata, India) is gratefully acknowledged. We are grateful to Professor Soumen Basak, Head, Chemical Sciences Department, Saha Institute of Nuclear Physics, Kolkata, India for his kind help and cooperation in conducting some experiments in his own laboratory. We are also very much thankful to Dr. B.N Paul, Head, Immunobiology Division, Indian Institute of Toxicology Research, Lucknow, India for allowing us to conduct a part of this research work. We extend our thanks to Ms. Vani Mishra, Immunology Division, Indian Institute of Toxicology Research, Lucknow, India for her support. We also acknowledge the support of Dr. S. Biswas, IICB, Kolkata, India. The authors are also thankful to Jadavpur University for giving legal approval of the work. References
Aggarwal, B.B., Kumar, A., Bharti, A.C., 2003. Anticancer potential of curcumin: preclinical and clinical studies. Anticancer. Res. 23, 363398. Alexander, W.S., Hilton, D.J., 2004. The role of suppressors of cytokine signaling (SOCS) proteins in regulation of the immune response. Annu. Rev. Immunol. 22, 503529. Arenzana-Seisdedos, F., Turpin, P., Rodriguez, M., Thomas, D., Hay, R.T., Virelizier, J.L., Dargemont, C., 1997. Nuclear localization of I kappa B alpha promotes active transport of NF-kappa B from the nucleus to the cytoplasm. J. Cell Sci. 110, 369378. Bandyopadhyaya, G., Sinha, S., Chattopadhyay, B.D., Chakraborty, A., 2008. Protective role of curcumin against nicotine induced genotoxicity on rat liver under restricted dietary protein. Eur. J. Pharmacol. 588, 151157.

Banerjee, S., Bandhyopadhyaya, G., Chattopadhyay, K., Chattopadhyay, B.D., 2010. Amelioration of nicotine induced damage of blood cells in protein malnourished female rats by curcumin. Int. J. Pharmacol. 6, 409420. Benowitz, N.L., Hukkanen, J., Jacob, P.I.I.I., 2009. Nicotine chemistry, metabolism, kinetics and biomarkers. Handb. Exp. Pharmacol. 192, 2960. Chattopadhyay, K., Chattopadhyay, B.D., 2008. Effect of nicotine on lipid prole, peroxidation and antioxidant enzymes in female rats with restricted dietary protein. Indian J. Med. Res. 127, 571576. Chattopadhyay, K., Mandal, S., Chattopadhyay, B.D., Ghosh, S., 2010. Ameliorative effect of sesame lignans on nicotine toxicity in rats. Food Chem. Toxicol. 48, 32153220. Chen, R.J., Ho, Y.S., Guo, H.R., Wang, Y.J., 2008. Rapid activation of Stat3 and ERK1/2 by nicotine modulates cell proliferation in human bladder cancer cells. Toxicol. Sci. 104, 283293. De Mallo, B.P.R., Pinto, G.R., Botelho, C., 2001. The inuence of smoking on fertility, pregnancy and lactation. J. Pediatr. 77, 257264. Egleton, R.D., Brown, K.C., Dasgupta, P., 2009. Angiogenic activity of nicotinic acetylcholine receptors. Implications in tobacco related vascular diseases. Pharmacol. Ther. 121, 205223. Fairbairn, D.W., O'Neill, K.L., 1995. Necrotic DNA degradation mimics apoptotic nucleosomal fragmentation comet tail length. In vitro Cell Dev. Biol. 31, 171173. Fairbairn, D.W., O'Neill, K.L., 1996. The neutral comet assay is sufcient to identify an apoptotic window by visual inspection. Apoptosis 1, 9194. Fairbairn, D.W., Walburger, D.K., Fairbairn, J.J., O'Neill, K.L., 1996. Key morphologic changes and DNA strand breaks in human lymphoid cells discriminating apoptosis from necrosis. J. Scan Microsc. 18, 407416. Gaab, J., Rohleder, N., Heitz, V., Engert, V., Schad, T., Schurmeyer, T.H., Ehlert, U., 2005. Stress-induced changes in LPS-induced pro-inammatory cytokine production in chronic fatigue syndrome. Psychoneuroendocrinology 30, 188198. Gallo, O., Bianchi, S., Porrio, B., 1995. Bcl-2 overexpression and smoking history in head and neck cancer. J. Natl. Cancer Inst. 87, 10241025. Giri, D.K., Aggarwal, B.B., 1998. Constitutive activation of NF-kappaB causes resistance to apoptosis in human cutaneous T cell lymphoma HuT-78 cells. Autocrine role of tumor necrosis factor and reactive oxygen intermediates. J. Biol. Chem. 273, 1400814014. Glaser, R., Kiecolt-Glaser, J.K., Marucha, P.T., MacCallum, R.C., Laskowski, B.F., Malarkey, W.B., 1999. Stress-related changes in pro-inammatory cytokine production in wounds. Arch. Gen. Psychiatry 56, 450456. Hawk, P.B., Oser, B.L., Summerson, W.H., Oser, B.L.Ltd., 1954. Practical Physiological Chemistry, 13th Ed. Mc Graw Hill Book Comp, New York, London. Helma, C., Uhl, M., 2000. A public domain image-analysis program for the single-cell gel-electrophoresis (Comet) assay. Nutr. Res. 466, 915.

S. Banerjee et al. / European Journal of Pharmacology 684 (2012) 132145 Hoek, J.B., Pastorino, J.G., 2002. Ethanol, oxidative stress, and cytokine-induced liver cell injury. Alcohol 27, 6368. Hukkanen, J., Jacob, P., Benowitz, N.L., 2005. Metabolism and disposition kinetics of nicotine. Pharmacol. Rev. 57, 79115. Iwahori, K., Serada, S., Fujimoto, M., Nomura, S., Osaki, T., Lee, C.M., Mizuguchi, H., Takahashi, T., Ripley, B., Okumura, M., Kawase, I., Kishimoto, T., Naka, T., 2011. Overexpression of SOCS3 exhibits preclinical antitumor activity against malignant pleural mesothelioma. Int. J. Cancer 129, 9931005. Kalpana, C., Menon, V.P., 2004. Modulatory effects of curcumin on lipid peroxidation and antioxidant status during nicotine-induced toxicity. Pol. J. Pharmacol. 56, 581586. Kang, B.Y., Song, Y.J., Kim, K.M., Choe, Y.K., Hwang, S.Y., Kim, T.S., 1999. Curcumin inhibits Th1 cytokine prole in CD4 + T cells by suppressing interleukin-12 production in macrophages. Br. J. Pharmacol. 128, 380384. Kido, R., Sato, I., Tsuda, S., 2006. Detection of in vivo DNA damage induced by ethanol in multiple organs of pregnant mice using the alkaline single cell gel electrophoresis (Comet) assay. J. Vet. Med. Sci. 68 (1), 4147. Kim, K.H., Joo, K.J., Park, H.J., Kwon, C.H., Jang, M.H., Kim, C.J., 2005. Nicotine induces apoptosis in TM3 mouse Leydig cells. Fertil. Steril. 83, 10931099. Lautz, H.U., Selberg, O., Korber, J., 1992. Proteincalorie malnutrition in liver cirrhosis. Clin. Investig. 70, 478486. Macha, M.A., Matta, A., Chauhan, S.S., Michael, K.W.S., Ralhan, R., 2011. Guggulsterone (GS) inhibits smokeless tobacco and nicotine-induced NF-B and STAT3 pathways in head and neck cancer cells. Carcinogenesis 32, 368380. Mahapatra, S.K., Bhattacharjee, S., Chakraborty, S.P., Majumdar, S., Roy, S., 2011. Alteration of immune functions and Th1/Th2 cytokine balance in nicotine-induced murine macrophages: Immunomodulatory role of eugenol and N-acetylcysteine. Int. Immunopharmacol. 11, 485495. Mandal, K., Dasgupta, S., Chattopadhyay, B.D., 2004. Nicotine induced alterations on reproductive organs of female rats under protein decient condition. Indian J. Exp. Biol. 42, 330332. Martnez-Garca, E., Irigoyen, M., Gonzlez-Moreno, O., Corrales, L., Teijeira, A., Salvo, E., Rouzaut, A., 2010. Repetitive nicotine exposure leads to a more malignant and metastasis-prone phenotype of SCLC: a molecular insight into the importance of quitting smoking during treatment. Toxicol. Sci. 116, 467476. Menon, V.P., Sudheer, A.R., 2007. Antioxidant and anti-inammatory properties of curcumin. Adv. Exp. Med. Biol. 595, 105125. Mller, O., Krawinkel, M., 2005. Malnutrition and health in developing countries. CMAJ 173, 279286. Mller, R., Rajewsky, M.S., 1980. Immunological quantication by high afnity antibodies of 06-ethyldeoxyguanosine in DNA exposed to N-ethyl-N-nitrosourea. Cancer Res. 40, 887896.

145

Nakajima, M., Iwata, K., Yamamoto, T., Funae, Y., Yoshida, T., Kuroiwa, Y., 1998. Nicotine metabolism in liver microsomes from rats with acute hepatitis or cirrhosis. DMD 26, 3641. Ortner, R., Schindler, S.D., Kraigher, D., Mendelsohn, A., Fischer, G., 2002. Women addicted to nicotine. Arch Womens Ment Health 4, 103109. Park, K., Lee, J.H., Cho, H.C., Cho, S.Y., Cho, J.W., 2010. Down-regulation of IL-6, IL-8, TNF- and IL-1 by glucosamine in HaCaT cells, but not in the presence of TNF. Oncologia 1, 289292. Prescott, E., Hippe, M., Schnorr, P., Hein, H.O., Vestbo, L., 1998. Smoking and risk of myocardial infarction in women and men: longitudinal population study. Br. Med. J. 316, 10431047. Provost, F.L., Miyoshi, K., Vilotte, J.L., Bierie, B., Robinson, G.W., Hennighausen, L., 2005. SOCS3 promotes apoptosis of mammary differentiated cells. Biochem. Biophys. Res. Commun. 338, 16961701. Shukla, S., Shishodia, G., Mahata, S., Hedau, S., Pandey, A., Bhambhani, S., Batra, S., Basir, S.F., Das, B.C., Bharti, A.C., 2010. Aberrant expression and constitutive activation of STAT3 in cervical carcinogenesis: implications in high-risk human papillomavirus infection. Mol. Cancer 9, 282299. Song, D.K., Im, Y.B., Jung, J.S., Suh, H.W., Huh, S.O., Song, J.H., Kim, Y.H., 1999. Central injection of nicotine increases hepatic and splenic interleukin 6 (IL-6) mRNA expression and plasma levels in mice: involvement of the peripheral sympathetic nervous system. FASEB J. 13, 12591267. Streetz, K.L., Luedde, T., Manns, M.P., Trautwein, C., 2000. Interleukin 6 and liver regeneration. Gut 47, 309312. Tripathi, P., Aggarwal, A., 2006. NF-kB transcription factor: a key player in the generation of immune response. Curr. Sci. 90, 519531. Wang, Y., Cheng, Y., Sun, H.F., 2000. Interaction of nicotine and bovine serum albumin. Chin. Chem. Lett. 11, 247250. Wullaert, A., Loo, G.V., Heyninck, K., Beyaert, R., 2007. Hepatic tumor necrosis factor signaling and nuclear factor-B: effects on liver homeostasis and beyond. Endocr. Rev. 28, 365386. Yin, Z.J., Jin, F.G., Liu, T.G., Fu, E.Q., Xie, Y.H., Sun, R.L., 2011. Overexpression of STAT3 potentiates growth, survival, and radioresistance of non-small-cell lung cancer (NSCLC) cells. J. Surg. Res. 171, 675683. Zang, E.A., Wynder, E.L., 1996. Differences in lung cancer risk between men and women: examination of the evidence. J. Natl. Cancer Inst. 88, 183192.