Вы находитесь на странице: 1из 66

DNA, RNA Y GENOMA

DESCUBRIMIENTO
El descubrimiento de los cidos nuclecos se debe

a Friedrich Miescher, quien en el ao 1869 aisl de los ncleos de las clulas una sustancia cida a la que llam nuclena, nombre que posteriormente se cambi a cido nucleico.

QUE SON ?
Son macromolculas constituidas

por nucletidos encadenados, que se encuentran en las clulas de todos los seres vivos y en los virus. Se unen mediante enlaces fosfodister, que se produce entre un grupo hidroxilo ( OH)en el carbono 3' y un grupo fosfatoH3PO4.

COMPONENTES: LOS NUCLETIDOS


Son las unidades estructurales de los cidos nucleicos. Estn compuestos por: Una base nitrogenada BN Un azcar o pentosa A Un acido fosfrico P Estn formados por la unin de bioelementos tales como: C ,H ,O, N, P

ESTRUCTURA DE UN NUCLEOTIDO

P
Fosfoest er

A
BN
Nglicosidico

DIFERENCIA ENTRE:
Nuclesido

Nucletido

Es la molcula resultante de la unin entre la pentosa y una base nitrogenada.

Es un compuesto monomrico formado por una base nitrogenada, una pentosa y un grupo fosfato.

COMPONENTES DE UN NUCLEOTIDO
Pentosa puede ser: Dexosirribosa Ribosa Las bases nitrogenadas pueden ser: Adenina A Citosina C Guanina G Timina T Uracilo U

AZUCARES O PENTOSAS
El azcar que interviene en los nucletidos puede ser o la ribosa (R) o la desoxirribosa (DR). Conviene destacar que la nica diferencia entre ambas est en que en el carbono 2 de la desoxirribosa hay un hidrgeno (-H) en lugar del grupo alcohol (-OH).

BASES NITROGENADAS

Las bases nitrogenadas son parte fundamental de los nucletidos. Biolgicamente, existen slo cinco bases nitrogenadas divididas en dos tipos, purinas y pirimidinas.
Citosin a Timina Uracilo

Adenina Purina s Guanina

Pirimidin as

CUALES SON?
Los cidos nucledos estn representados por:

ADN
Acido desoxirribonucleicos : Son los almacenadores de la informacin biolgica

ARN
Acido Ribonucleico: Actan como transmisores de dicha informacin (ARN mensajero), como componentes de los ribosomas (ARN ribosomal) o como transferidores de aminocidos (ARN de transferencia)

ACIDO DEXOSIRRIBONUCLEICO ADN


Todas las clulas vivas codifican el material gentico en forma de ADN, cido nucleco contenido en los cromosomas de las clulas y portador de la informacin gentica (gen).
La estructura de la doble hlice constituye la base para la transmisin inalterable de los genes a travs de millones de generaciones de clulas, ya que las cadenas de ADN tienen la propiedad de autoduplicarse para formar molculas hijas idnticas (replicacin).

ADN
La secuencia de bases el ADN (cdigo gentico) contiene la Informacin gentica para la sntesis de protenas. A partir del ADN se sintetizan molculas complementarias de ARNm (cido ribonucleico mensajero) en el proceso denominado transcripcin.
Cada uno de estos nucletido se halla unido covalentemente, por medio de su grupo fosfato, a la ribosa del nucletido contiguo (puente fosfodister entre el grupo hidrxilo 5' de un nucletido y el 3 del siguiente).

LA ESTRUCTURA DEL ADN

En 1953, James Watson, Francis Crick, Maurice Wilkins y Rosalind Franklin propusieron un modelo para la estructura del ADN. Se compone de unidades llamadas nucletidos. Cada nucletido contiene un grupo fosfato, un azcar de 5 carbonos llamada desoxirribosa y una base nitrogenada.

LA ESTRUCTURA DEL ADN


Los nucletidos estn unidos por enlaces entre el grupo fosfato de un nucletido y el azcar del siguiente nucletido. Se forma una larga cadena de nucletidos enlazados del fosfato al azcar. Las bases nitrogenadas se extienden hacia dentro desde la cadena azcar-fosfato. En el ADN hay 4 bases:

adenina (A), citosina (C), guanina (G) y timina (T).

La estructura del ADN

Una molcula de ADN se compone de dos cadenas de nucletidos unidas por puentes de hidrgeno entre las bases nitrogenadas. Las cadenas de nucletidos forman una espiral alrededor de un centro comn. La forma espiral de la molcula es una doble hlice. Los puentes de hidrgeno son especficos entre las bases:

La adenina siempre forma 2 enlaces con la timina. La citosina siempre forma 3 enlaces con la guanina.

Por ello, la sucesin de bases de una cadena de nucletidos determina la sucesin de bases en la otra cadena. Son complementarias. Este apareamiento de bases nitrogenadas es la base de la replicacin del ADN.

ADN
Se pueden distinguir 3 niveles estructurales: Estructura primaria: La secuencia de los nucletidos. Estructura secundaria: La doble hlice. Estructura terciaria: Collar de perlas, estructura cristalina, ADN superenrollado.

ESTRUCTURA PRIMARIA DEL ADN:

Es la secuencia de nucletidos de una cadena o hebra. Es decir, la estructura primaria del ADN viene determinada por el orden de los nucletidos en la hebra o cadena de la molcula. Para indicar la secuencia de una cadena de ADN es suficiente con los nombres de las bases o su inicial (A, T, C, G) en su orden correcto y los extremos 5' y 3' de la cadena nucleotdica. As, por ejemplo:

5'ACGTTTAACGACAAGGACAAGTATTAA3'

ESTRUCTURA SECUNDARIA DEL ADN:

La concentracin de Adenina es igual a la de Timina, y la de Citosina a la de Guanina. Los grupos fosfato estaran hacia el exterior y de este modo sus cargas negativas interaccionaran con los cationes presentes en el nucleoplasma dando ms estabilidad a la molcula. Las dos primeras establecen dos puentes de hidrgeno entre ellas, y las ltimas tres puentes. La cantidad de purinas es igual a la cantidad de pirimidinas.

Ambas cadenas seran antiparalelas, una ira en sentido 3-5' y la otra en sentido inverso, 5' - 3'.

ESTRUCTURA SECUNDARIA

ESTRUCTURA TERCIARIA
Se encuentra sper empaquetada , ocupando as menos espacio en el ncleo celular , y adems como mecanismo para facilitar su transcripcin; En las clulas eucariotas el ADN se encuentra en el ncleo asociado a ciertas protenas: formando la cromatina (Constituye el Cromosoma).

DIMENSIONES DEL DNA

LA REPLICACIN DEL ADN

LA REPLICACIN DEL ADN


Es el proceso mediante el cual la molcula de ADN hace copias de s misma (y, por tanto del cromosoma). En el ncleo hay muchos nucletidos libres que son los bloques de construccin del nuevo ADN .

PASOS DE LA REPLICACIN DEL ADN


La doble hlice se desdobla de modo que las dos cadenas de nucletidos quedan paralelas y se rompen los enlaces entre las bases. Las dos cadenas de nucletidos se separan, empezando en un extremo y abrindose hasta el otro. Cada mitad de la molcula sirve como un molde para la formacin de una nueva mitad del ADN. Las bases de los nucletidos libres se unen con las bases correspondientes en las dos cadenas de nucletidos expuestas. La unin especfica de A con T y de C con G, asegura que las copias nuevas de ADN sean copias exactas del original.

Pasos de la replicacin del ADN

Se forman enlaces entre los fosfatos y los azcares de los nucletidos que se han apareado con las cadenas de ADN. El resultado es que se forman dos copias idnticas de la molcula original de ADN. Las dos nuevas molculas de ADN se enroscan y de nuevo toman la forma de una doble hlice.

PROTEINAS PRINCIPALES REPLICACIN


Topoisomerasas:

rompen una hebra y la tensin del enrrollamiento de la hlice se relaja Helicasas: completan el desenrrollamiento ADN polimerasas: complejos agregados de diferentes protenas. Primasas: sintetizan los iniciadores de ARN que se necesitan para iniciar la replicacin Ligasas: sellan las lagunas dejadas por las ribonucleasas cuando remueven los primers, catalizan la unin fosfodiester entre nucletidos adyacentes. Proteinas de unin a la hebra sencilla del ADN: estabilizan la horquilla de replicacin.

LA SNTESIS DE PROTENAS

LA TRANSCRIPCIN
La

informacin para fabricar todas las protenas est almacenada en las molculas de ADN de los cromosomas. La sucesin de bases en las molculas de ADN es un cdigo qumico para la sucesin de aminocidos en las protenas. Un segmento de ADN que codifica para una protena en particular se llama gene.

EL CDIGO GENTICO
Est compuesto por palabras

de tres letras. Las cuatro bases se unen en palabras de tres letras (AGC, CGT y as sucesivamente) y se obtienen 64 grupos o palabras diferentes. Las 64 combinaciones son suficientes para codificar los 20 aminocidos diferentes.

Las sucesiones de tres bases se llaman tripletes. Cada triplete codifica para un solo tipo de aminocido. La mayora de los aminocidos se codifican por ms de un triplete.

Tercera letra

CIDO RIBONUCLEICO (ARN)


El ARN es un cido nucleico que se compone de una sola cadena de nucletidos. Los nucletidos de ARN estn formados por ribosa en lugar de la desoxirribosa del ADN, y tienen la base nitrogenada uracilo (U) en lugar de timina.

TIPOS DE ARN

ARN mensajero o ARNm: lleva las instrucciones para hacer una protena en particular, desde el ADN en el ncleo hasta los cromosomas. ARN de transferencia o ARNt: lleva los aminocidos a los ribosomas, se encuentra en el citoplasma. ARN ribosomal o ARNr: forma parte de los ribosmas.

PASOS DE LA TRANSCRIPCIN

La porcin del ADN que contiene el cdigo para la protena que se necesita, se desdobla y se separa. El resultado es que se exponen las bases. Los nucletidos de ARN libres que estn en el ncleo, se aparean con las bases expuestas del ADN. Como resultado, de los tripletes del ADN se forman tripletes complementarios en la molcula de ARNm. Una sucesin de tres nucletidos en una molcula que codifica para un aminocido se llama un codn.

La molcula de ARNm se completa por la formacin de enlaces entre los nucletidos del ARN. La molcula de ARNm se separa de la molcula de ADN. La molcula completa de ARNm, sale del ncleo, pasa por la membrana nuclear y va a los ribosomas.

PROCESAMIENTO POSTRANSCRIPCIONAL DEL ARN


Corte

en 5 y unin de un cap(5-metilguanosina), para proteger del ataque de las exonucleasas, facilitar el transporte ncleo-citoplasma, y el anclaje del ARNm al ribosoma Corte en 3 y unin de una cola de poli-A (200 AMP), confiere estabilidad y ayuda en la traduccin Eliminacin de los intrones, por formacin de un complejo snARNs-proteinas: spliceosoma, el cual es especfico. La especificidad de la reaccin est dada por la complementaridad de las bases entre los pequeos ARNs nucleares y el ARN transcrito primario

TRADUCCIN
Es la sntesis de una molcula de protena, de acuerdo con el cdigo contenido en la molcula de ARNm. Se llama traduccin porque comprende el cambio del lenguaje de cidos nucleicos (sucesin de bases) al lenguaje de protenas (sucesin de aminocidos). En el citoplasma, el ARNm se mueve hacia los ribosomas. Los aminocidos que se necesitan estn dispersos por el citoplasma. Los aminocidos correctos llegan al ARNm por el ARNt.

Las molculas de ARNt son ms cortas que las de ARNm y tienen la forma de una hoja de trbol. En uno de los lazos de la molcula de ARNt hay un conjunto de tres bases llamado anticodn. El lado opuesto transporta un aminocido. Las bases de los anticodones del ARNt son complementarias a las bases de los codones del ARNm.

PASOS DE LA TRADUCCIN

Un extremo de la molcula de ARNm se pega al ribosoma. Las molculas de ARNt recogen ciertos aminocidos y se mueven hacia el punto donde el ARNm est pegado al ribosoma. Una molcula de ARNt con el anticodn correcto se enlaza con el codn complementario en el ARNm.

A medida que el ARNm se mueve a lo largo del ribosoma, el siguiente codn hace contacto con el ribosoma. El siguiente ARNt se mueve a su posicin con su aminocido. Los aminocidos adyacentes se enlazan por medio de un enlace peptdico. Se desprende la primera molcula de ARNt. El siguiente codn se mueve a su posicin y el siguiente aminocido se coloca en su posicin.

El proceso se repite hasta que se traduzca el mensaje completo y se forme un cadena grande de aminocidos que formar parte de una protena.

CROMOSOMAS

Son los portadores de la mayor parte del material gentico y condicionan la organizacin de la vida y las caractersticas hereditarias de cada especie, formado por la cromatina que es un material microscpico que lleva la informacin gentica de los organismos eucariotas y est constituida por ADN asociado a protenas especiales llamadas histonas.

PROPIEDADES DE LOS CROMOSOMAS

Todos los individuos de una misma especie tienen el mismo nmero de cromosomas Los cromosomas se duplican durante la divisin celular, una vez completada, recuperan el estado original. Los cromosomas de una clula difieren en tamao y forma, de cada tipo se encuentran dos ejemplares, 2N (diploida)

Durante la formacin de clulas sexuales el nmero de cromosomas baja a N.


Existen los cromosomas X e Y que condicionan el sexo. Cromosomas se observan al microscopio durante la metafase, el DNA se ha duplicado y la cromatina est muy condensada, formando las cromtidas (2 hebras de DNA unidas por un solo centrmero). A partir de las fotografas obtenidas en esta fase, se crea el cariotipo, agrupando los cromosomas por parejas

ESTRUCTURA DE UN CROMOSOMA

CARIOTIPO HUMANO

CARIOTIPO HUMANO

Para identificar anormalidades morfolgicas y numricas ms importantes se realiza en centros genticos mdicos. El resultado es demostracin grfica del complemento cromosmico -o dotacin cromosmica- conocida como cariotipo. El proceso de divisin celular se interrumpe en la metafase, aadiendo colchicina, droga que evita siguientes pasos de la mitosis, interfiere con los microtbulos del huso. A partir del cariotipo pueden detectarse ciertas anormalidades, como la aparicin de un cromosoma o de un segmento cromosmico supernumerario.

EUCARIOTAS
Existen dos tipos de cromatina que difieren en su grado de condensacin, la heterocromatina y la eucromatina.
Heterocromatina: cromatina densamente empaquetada, cambia poco el grado de condensacin a travs del ciclo celular. Aqu el material gentico es transcripcionalmente inactivo. Eucromatina: cromatina poco condensada (se encuentra relativamente dispersa en el ncleo, aqu el material gentico es transcripcionalmente activo. El nivel de condensacin de la eucromatina vara a travs del ciclo celular

En la interfase las clulas tienen dos clases de heterocromatina:


*Constitutiva: regin de la cromatina que no se expresa. Incluye secuencias cortas repetidas (DNA satlite) y puede tener un papel estructural en el cromosoma. Se localiza en lugares caractersticos, por ejemplo, en centrmeros y telmeros. *Facultativa: toma la forma de cromosomas enteros que son inactivos en una lnea celular, aunque pueden ser expresados en otra. El cromosoma X de mamferos, por ejemplo, el cual es enteramente inactivo en las hembras lo que compensa el que haya dos en la hembra y uno en el macho. El cromosoma inactivo es perpetuado en estado heterocromtico y el activo forma parte de la eucromatina.

Niveles de compactacin de la cromatina


1. Nucleosoma 2. Solenoide (filamento 30 nm) 3. Cromosoma metafsico

El nucleosoma
Primer nivel de organizacin de la cromatina
-Evidencias experimentales como difraccin de rayos X, ME, tratamiento enzimticos, etc. Permitieron concluir que existe una entidad que se repite a lo largo de las fibras de cromatina.

-Nucleosoma formado por dos copias de


histonas H2A, H2B, H3 y H4 las cuales forman un octmero alrededor del cual se asocian aproximadamente 200 bp de DNA. -Funcin H1 difiere del resto no se encuentra formando parte del ncleo de histonas, se ubica en el exterior de la partcula.

- Se puede dividir el DNA del nucleosoma en dos tipos:


-DNA nuclear (core DNA): consta 146 bp, relativamente resistente a la digestin con nucleasas. - DNA de enlace (linker DNA): comprende el resto del DNA, longitud vara de 8 hasta 114 bp segn el tejido y la especie, aunque por lo general es de aproximadamente 55 bp. Es susceptible a la digestin con nucleasas.

En el ensamblaje del nucleosoma participan otras protenas que se unen a las histonas que conforman el octmero: *Nucleoplasmina (N1)

* Topoisomerasa I

*Protena cida
La protena cida se une H2A y H2B y la N1 se une a H3 e H4.
Actan como chaperonas moleculares controlando la unin del DNA a las histonas.

Al ser cidas reducen la densidad de carga positiva de las histonas (protenas bsicas) y por tanto la posibilidad de formacin de otro complejo inespecfico que resulte de la afinidad DNA-histonas. *Topoisomerasa I proporciona al DNA el grado de superenrrollamiento adecuado.

Los nucleosomas pueden ensamblarse in vitro sin tener en cuenta ninguna secuencia pero in vivo no ocurre as.
Ensamblado el nucleosoma se organizan en la llamada fibra de 10 nm La fibra de 10 nm es una cadena continua de nucleosomas donde las caras de los discos estn en contacto unas con otras. Esta estructura es obtenida a baja fuerza inica y no requiere de la histona H1.

Filamento de 30 nm, segundo nivel de organizacin de la cromatina.


Una elevada fuerza inica e H1, la fibra de 10 nm se puede enrollar en un solenoide que gira a la izquierda y contiene seis nucleosomas por vuelta organizados radialmente, con un paso de rosca de 110 A (dimetro de nucleosoma), formando fibra de 30 nm. Los nucleosomas interactan a travs de la molcula H1, la cual estabiliza la estructura solenoidal.

Tercer nivel de organizacin de la cromatina.


-Cuando en los cromosomas metafsicos desprovistos de histonas, se observa un esqueleto central de protenas fibrosas rodeado de un extenso halo de DNA. -Se observa DNA forma bucles o lazos que entran y salen del esqueleto prcticamente por el mismo punto. -Sugieren que las fibras de cromatina se encuentran dispuestas radialmente formando fibras de 30 nm.

Modificaciones de las histonas controlan el estado de la cromatina


Cambios locales en la cromatina que afecten la expresin de un gen especfico, regiones tan largas como un cromosoma completo pueden estar afectadas. Los cambios estn dados por modificaciones en la cola N-terminal de las histonas (H3 y H4). Pueden ser modificadas por introduccin de grupos acetilos, metilos y fosfatos los cuales disminuyen la carga de la protena. Cambiar las caractersticas del nucleosoma o crear sitios de unin de protenas no histonas que provocan un cambio en las propiedades de la cromatina. La metilacin esta relacionada con la cromatina inactiva y la acetilacin con la cromatina activa sin embargo esta regla no es general ya que se han encontrado regiones metiladas en la cromatina activa.

ENFERMEDADES

QU ES UN GEN?
Es

una secuencia de nucletidos en la molcula de ADN, equivalente a una unidad de transcripcin. Contiene la informacin, a partir de la cual se sintetiza un polipptido, una enzima, un cido ribonucleico: mensajero, de transferencia o ribosomal. En el genoma humano la mayora de los genes son nicos y se expresan en forma independiente. Los genes segregan cuando ocurre la meiosis.

Modelo simplificado de un gen humano


PROMOTOR Secuencia que no se traduce
Intrn 1 Intrn 2 Intrn 3

Secuencia que no se traduce

5`
Regin reguladora EXON 1 EXON 2 EXON 3 EXON 4 EXON n Regin reguladora

3`

Unidad de transcripcin

Despus del procesamiento postranscripcional del ARN transcrito primario, la secuencia de ARNm corresponde a las secuencias de los exones y las no codificantes (UTRs).

Genoma humano

DNA codificante (exones) 0.8% Intrones, 30.8%

DNA intergnico DNA, 68.3%

5'UTR, 4.7% 3'UTR, 0.7%

DOGMA CENTRAL DE LA BIOLOGA MOLECULAR

Hebra molde Transcripcin

Traduccin

Похожие интересы