Вы находитесь на странице: 1из 36

1

PROTENAS

Cumprem papel fundamental em todos os organismos


2

Funes das protenas:


Suporte estrutural;

Proteo mecnica e bioqumica;


Transporte;

Movimento;
Catlise de reaes bioqumicas
3

As protenas so constitudas de aminocidos...

Os aminocidos esto ligados entre si por ligaes peptdicas

Peptdeos: conjuntos de dois ou mais aminocidos ligados entre si


5

Os peptdeos so classificados de acordo com o nmero de aminocidos que forma a sua cadeia:

Dipeptdeo

Polipeptdeo
7

As protenas apresentam tamanhos variados: Ex: insulina (51 AAs); Ribonuclease de bovino (124 AAs); Titina (27.000 Aas!!)
8

Estrutura das protenas:


As protenas apresentam quatro nveis estruturais...

Estrutura primria

Estrutura secundria

Pontes de hidrognio

Dobramento da cadeia pode ocorrer de duas formas variadas!


10

Estrutura terciria

Dobramento da cadeia secundria sobre ela mesma!


11

Estrutura quaternria

Duas ou mais cadeias de polipeptdeos associadas entre si!!

12

Exemplo:

Molcula de hemoglobina
As cadeias de polipeptdeos que compem a molcula de hemoglobina so codificadas por genes diferentes!! 13

Revisando...

14

Nem sempre isso ocorre...

Nem todos os polipeptdeos so protenas; isso depende do nmero de AAs que formam a cadeia!!
15

Enzimas: um grupo especfico (e importante) de protenas

As enzimas atuam de forma muito especfica sobre seus substratos especficos e tm funo catalisadora de reaes qumicas
16

E qual a relao entre protenas e cidos nuclecos?? Veremos agora...


17

Os cidos nuclicos: DNA e RNA

Funo: armazenamento, transmisso e uso da informao gentica


18

Os cidos nuclicos so formados por nucleotdeos...

19

Estruturas do DNA e RNA


Funes: DNA: molcula informacional

RNA: diretamente envolvida na sntese de protenas

20

21

Diferenas estruturais entre DNA e RNA


Acar do nucleotdeo Tipo de filamento Funo
DNA Desoxirribose Simples Porta a informao gentica Adenina, Citosina, Guanina e Timina RNA Ribose duplo Atua na sntese proteica Adenina, Citosina, Guanina e Uracila
22

Bases nitrogenadas

Determinadas sequncias de nucleotdeos do DNA constituem os genes:

Gene: unidade bsica da hereditariedade


23

J o RNA cumpre papel na sntese de protenas. Existem trs tipos de RNA:

24

Cada sequncia de trs bases de nucleotdeos (cdons) especifica um aminocido


25

E qual o papel do DNA e do RNA na sntese das protenas?


Resp.: o seguinte:

O DNA transcreve o RNA mensageiro;

A mensagem contida no RNA mensageiro traduzida em protenas...


26

...em acordo com o cdigo gentico

Cada aminocido codificado por mais de uma trinca de nucleotdeos; por isso, diz-se que o cdigo gentico degenerado 27

Esquematizando:

Transcrio: primeira etapa da sntese de protenas


28

Traduo: segunda etapa da sntese

Esquema simplificado do evento de traduo do cdigo gentico

29

anticdon cdon

Ligao do tRNA ao mRNA pelas trincas de nucleotdeos

30

Esquema simplificado da sntese proteca


31

E, enfim, o processo completo, com mais detalhes

32

ATIVIDADE 01:
Um gene hipottico de uma determinada espcie de feijo apresenta a seguinte seqencia de nucleotdeos:

3TCTCATCACAACAGG 5 (15 letras)


a) Identifique os cdons que compem esse gene: b) Escreva a sequncia de nucleotdeos que formar a fita de mRNA transcrita a partir desse gene, identificando os anticdons; c) Escreva a cadeia de aminocidos formada a partir dessa fita de mRNA.
33

ATIVIDADE 03:
A tabela abaixo representa uma verso fictcia do cdigo gentico. Entretanto, esse cdigo segue o padro do cdigo gentico universal, no qual trs bases codificam um aminocido:
Trinca de bases Aminocido Trinca de bases Aminocido

AAC AAU
AGG AUC AUG

N O
C O Iniciao

CUA GAA
GCA GCC GCU

R K
T N T

a. Cite o nome da enzima que catalisa a sntese de RNA mensageiro. b. Escreva a sequncia de aminocidos resultante da traduo da seguinte molcula de RNAm: 5AUGGCACUAGAAAGGAACGCC AAUGCCGCUAGG AAC 3
34

ATIVIDADE 02:
Suponha que uma fita hipottica de mRNA transcrita a partir de um determinado gene de uma planta apresente a seguinte sequncia de nucleotdeos: 5UUUUUCCACCAUAAUGGAAGGAUACUAGUCGUU 3 (33 letras)

a) Escreva a cadeia de aminocidos a ser traduzido a partir da fita de mRNA acima;


b) Classifique essa cadeia de acordo com o nmero de aminocidos que a compem; c) Essa cadeia pode ser considerada uma protena, com relao ao nmero de aminocidos que ela apresenta? Porque? 35

E por hoje s pessoal... Int a prxima!!

36

Похожие интересы