You are on page 1of 9

Implementacin de un mtodo

basado en PCR, para el


diagnstico de Ehrlichia spp., en
caninos de Medelln (Colombia).
REVISTA CES MEDICINA VETERINARIA Y ZOOTECNIA / VOLUMEN 7 /
NMERO 2 / JULIO DICIEMBRE DE 2012/ ISSN 1900-9607

Introduccin

Ehrlichia spp. corresponde a un grupo de bacterias intracelulares


gramnegativas, de la familia Rickettsiae.

La Ehrlichiosis Canina es una enfermedad grave, cuyos signos


clnicos son inespecficos, e incluyen: depresin, letargia, anorexia,
fiebre, linfoadenomegalia, esplenomegalia y prdida moderada
de peso. Pueden presentarse petequias y equimosis en la piel y
membranas mucosas y, ocasionalmente, epistaxis. Aunque las
alteraciones hematolgicas son complejas y multifactoriales, tanto
en pacientes agudos como crnicos, la trombocitopenia se
presenta frecuentemente en la infeccin por Ehrlichia spp.,
acompaada de anemia y de cambios en el recuento de
leucocitos

Las tcnicas utilizadas actualmente


para su diagnstico:

Inmunofluorescencia indirecta (IFI) prueba de oro (Gold estndar)

ELISA

Frotis directo

Cromatografa en capa slida

Reaccin en cadena de la polimerasa (PCR)

Se demostr una sensibilidad de la IFI de slo el 67%, comparada con


la PCR; mientras que la sensibilidad y especificidad del ELISA es del
96,2 y 97,7%, respectivamente, comparada con la IFI

Materiales y mtodos
Estudio a 33 caninos que ingresaron a consulta al Hospital Veterinario
de la Universidad de Antioquia.
Caninos que presentaban al menos dos de los siguientes signos y/o
sntomas como criterios de inclusin:

Presencia de garrapatas

Fiebre

Anorexia

Linfadenitis

Hematoquecia, petequias, epistaxis, hepatomegalia,


esplenomegalia, uvetis u opacidad corneal, depresin, y prdida
de peso.

Toma de muestras
Se obtuvo 1 mL de sangre de la vena safena, vena ceflica o vena
yugular, en tubos con vaco con anticoagulante EDTA (Vacutainer,
Becton Dickison, USA). Las muestras fueron conservadas en
refrigeracin a 4 C, hasta su procesamiento. Los propietarios de los
caninos firmaron un consentimiento informado acerca del uso y
objetivo de la toma de la muestra, as como de sus riesgos.

Hemograma

Se realiz un hemograma completo a las muestras de sangre para la


determinacin de anemia (hematocrito <35%), trombocitopenia
(<300000 plaquetas/L), leucocitosis (>14000 leucocitos/L) y
leucopenia (<2000 leucocitos/L).

Serologa para Ehrlichia spp

Las muestras de suero fueron procesadas con el kit SNAP 4Dx Plus (IDEXX Laboratories,
Inc, Europe), siguiendo las recomendaciones del fabricante.

PCR para Ehrlichia spp.

El ADN se purific con el DNaesy Blood and tissue kit (QIAGEN) siguiendo las
especificaciones del fabricante. Se usaron los oligonucletidos con los primers ECC Fw
(5- AGAACGAACGCTGGCGGCAAGCC-3) y ECB (5CGTATTACCGCGGCTGCTGGC3), reportados por Dawson 2004. En la regin del ADNr 16S del gnero Ehrlichia.
Protocolo PCR Desarrollado por Aguirre et al. (2004)
0,25 M de cada uno de los oligonucletidos, 200 M de cada deoxi-nucletido, 2 mM
de MgCl2, y 1,2 unidades de TaqPolimerasa (Fermentas). Se utiliz 1L de ADN
extrado para completar un volumen final de reaccin de 50L.
Posterior a una desnaturalizacin durante cuatro minutos a 94 C, el programa de
amplificacin fue de 35 ciclos de: 94C durante un minuto, 60 C durante un minuto y
72 C durante un minuto, con una extensin final de cinco minutos a 72 C. Los
productos obtenidos fueron corridos en geles de agarosa al 2% a 70V durante una
hora. Se utiliz un marcador de peso molecular de 50pb (Fermentas) y se revelaron en
transiluminador ultravioleta para verificar la presencia de ADN de Ehrlichia spp.

RESULTADOS

Lectura de la PCR