Вы находитесь на странице: 1из 40

EL CDIGO GENTICO: lectura

y traduccin del mensaje de


los genes
Comprenden la complementariedad entre un
gen y el RNA mensajero correspondiente,
derivando en los principios elementales de la
transcripcin.

Cmo se transcribe la secuencia de un


gen, a una molcula de ARN (m) de la
longitud y secuencia adecuadas?

PARA QUE SE SINTETICE UNA PROTENA ES


NECESARIO LOS SIGUIENTES EVENTOS:

DOGMA
CENTRAL DE
LA BIOLOGA
MOLECULAR.

FLUJO DE LA
INFORMACI
N GNICA.

TRANSCRIPCIN: Proceso por el cual


informacin contenida en el DNA se copia en
el RNA mensajero (ARNm). De esta manera
es el ARNm el que sale del ncleo y posibilita
que se sinteticen las protenas en el
citoplasma.

TRADUCCIN: Proceso de sntesis de


protenas llevado a cabo en los ribosomas a
partir de la informacin contenida en RNAm
que es a su vez una copia de un gen.

CLASES DE ARN:

ARN informativos.

ARN(m) mensajero: ARN intermediario entre el gen y


la sntesis del producto funcional definitivo, la protena.

ARN funcionales.

ARN(t) de transferencia: Funcionan como


transportadores que llevan los aminocidos hasta el
ARNm durante el proceso de traduccin (sntesis
proteica).
ARN(r) ribosmicos: Componentes de los ribosomas,
complejos macromoleculares que actan de guas
coordinando el ensamblaje de la cadena aminoacdica
de una protena.

SINTESIS DE ARN

ARN(m) mensajero

ARN(t) transferencia

ARN(r) ribosomal

Ncleo
Ncleo
Ribosoma

TRANSCRIPCIN

Mecanismo evolutivo que permiti tener un


mensajero capaz de llevar la informacin
almacenada en el DNA de forma parcializada,
ordenada y regulada.

El resultado de la transcripcin es una molcula de


RNA llamada transcrito.

Depende de la complementariedad de las bases y la


descondensacin de la cromatina.

ACTIVIDAD

A partir de la siguiente secuencia de ADN:


ACTCGCGTAAATCAGCCGCGGTA

Escribe la secuencia de la hebra de ADN


complementaria.

Escribe la secuencia del ARNm que se


formara a partir de la hebra de ADN original.

La transcripcin utiliza
una de las cadenas de
ADN como molde.

Separacin local de las


dos cadenas de ADN, por
efecto de la enzima
Helicasa y Girasa.

Para un gen dado


siempre es la misma
cadena molde (ambas se
utilizan como molde).

Los nucletidos libres se emparejan con el


ADN molde (complementariedad entre las
bases).

Catalizado por la polimerasa de ARN.

El crecimiento del ARN se produce siempre


en direccin 5 3

FASES DE LA TRANSCRIPCIN

INICIACIN

PROLONGACIN

TERMINACIN

INICIACIN

Factor de transcripcin se une a la caja


TATA.
La ARN polimerasa se une a una zona
del ADN llamada promotor (posee
secuencia TAC)

PROLONGACIN

La polimerasa de ARN se mueve a lo


largo del ADN.

La polimerasa aade ribonucletidos


trifosfatados libres a la cadena
expuesta del ADN molde.

TERMINACIN

El ARN polimerasa reconoce seales


especficas de terminacin ATT-ACTATC.

La cadena de ARN y la polimerasa se


disocian del molde de ADN.

PROCESAMIENTO DE ARN EN
EUCARIOTAS

El resultado de
la transcripcin
es un preARNm.
Caperuza 7
metilguanosina.
Cola poli-A.
Corte y
empalme.

EL CDIGO GENTICO

CONCLUSIN

DESCIFRANDO EL CDIGO
GENTICO

Marshall y Nirenberg (1961)


ARNm construido de guaninas.
Sntesis de protenas in vitro.
Resultado, protenas que solamente contenan
leucinas.

Cmo se encuentra escrita la


informacin en los genes?

20 aminocidos
diferentes.
Cada
aminocido es
codificado por
tres nucletidos
en el ARNm o
codn.
Cdigo
degenerado o
redundante.

Existen 4 tipos de nucltidos.

Qu pasara si los codones estaran


conformados por dos nucletidos?

4x=x

EXPRESIN DE LA INFORMACIN
CODIFICADA EN LOS GENES

ACTIVIDAD 12

Ahora a trabajar. Realiza la actividad


12 presente en la pgina 26 de tu libro
junto con un compaero.

Pieza clave de la traduccin:


ARN de transferencia

Pieza clave de la traduccin: el


ribosoma

Traduccin: iniciacin

Traduccin: prolongacin

Traduccin: prolongacin

Traduccin: terminacin

Destinos para las protenas


recin traducidas

Modificaciones posttraduccionales

Dogma central de la gentica


molecular

Origen del problema de la


replicacin