You are on page 1of 46
1/2 A 1/2 a 1/2 A AA Aa Aa aa Genética 1/2 a Genética Mendeliana Mendeliana
1/2 A
1/2 a
1/2 A
AA
Aa
Aa
aa
Genética
1/2 a
Genética
Mendeliana
Mendeliana
Razón genotípica
1/4 AA
1/2 Aa
1/4 aa
Razón fenotípica
3/4 A-
1/4 aa
1

Tema 3: Principios mendelianos y extensiones

Definición

La Genética es la rama de la Biología encargada del estudio de la herencia biológica, en
La Genética es la rama de la Biología encargada del estudio de la
herencia
biológica,
en
otras
palabras,
la
transmisión
de todo tipo de carácter: morfológico y fisiológico. Estos caracteres
se
guardan
bajo
la
forma
de
un
alfabeto
químico
(código genético) en secuencias de nucleótidos denominados genes
(cistrones)
que
forman
parte
de
la
constitución
del
ADN, presente
en
el
núcleo
de
cada
célula
del organismo.
2

Tema 3: Principios mendelianos y extensiones

TERMINOLOGÍA BÁSICA 1.-Herencia: Propiedad de todo ser vivo a través del cual sus rasgos biológicos o
TERMINOLOGÍA BÁSICA
1.-Herencia: Propiedad de todo ser vivo a través del cual sus
rasgos biológicos o caracteres son transmitidos de una
generación a otra.
2.-Gen (Cistrón) : Es la mínima unidad de la información
hereditaria; la cual porta un determinado rasgo o carácter,
confinado en una secuencia de nucleótidos de ADN. También se le
define como la porción de ADN, la cual se comporta como una
unidad que tiene información para dirigir la síntesis o fabricación
de una determinada proteína
2.1.
Locus : Es el espacio físico ocupado por un gen a lo largo del
cromosoma.
2.2.
Loci : Es el conjunto de Locus.
2.3.
Genoma : Es el conjunto de genes presentes en los juegos de
cromosomas de un organismo.
3

Tema 3: Principios mendelianos y extensiones

3. Cromosoma : Es un cuerpo nuclear que resulta de la duplicación y condensación de la
3.
Cromosoma : Es un cuerpo nuclear que resulta de la duplicación y
condensación de la cromatina durante el ciclo celular.
4.
Cromosomas Homólogos : Par de cromosomas con las siguientes
características :
* Uno es de origen paterno y el otro es de origen materno.
* Morfológicamente son iguales y genéticamente son similares porque
para ciertas características los genes pueden ser iguales y para
otras, los genes pueden ser diferentes.
5.
Alelos: Son las formas alternativas que presenta un gen
determinado y se simboliza por letras. Se le puede definir
también como un par de genes con las siguientes características :
* Están ubicados en cromosomas homólogos.
* Ocupan el mismo locus correspondiente.
* Son responsables del mismo rasgo biológico.
6.
Fenotipo : Se refiere a las características o rasgos biológicos de
un individuo. Los rasgos pueden ser, tanto internos como externos.
El fenotipo es observable, medible y cuantificable. Ejm : estatura,
color, grupo sanguíneo, etc.
4
7.-Genotipo : Es el grupo de genes presentes en los cromosomas de un organismo y que
7.-Genotipo : Es el grupo de genes presentes en los cromosomas de
un organismo y que son responsables del fenotipo o rasgos biológicos.
8. Alelo dominante : Se llama así a aquel gen o alelo cuyo fenotipo se
manifiesta o aparece en la descendencia.
Estos alelos se representan con letras mayúsculas.
Ejm : A, B, C, D, E , ......
9. Alelo recesivo : Se llama asi, a aquel gen o alelo cuyo fenotipo no
se manifiesta en la descendencia porque está presente su alelo
dominante. Éstos se representan por letras minúsculas
Ejm : a , b , c , d, e , .......
10. Homocigote : Un individuo es homocigote para una determinada
característica, cuando sus alelos correspondientes son iguales
10.1
Homocigote Dominante : Cuando los genes o alelos se presentan
en pareja con caracteres bastante expresivos. Su representación se
simboliza en parejas de letras mayúsculas
Ejm : AA; BB, CC, D D , .....
10.2
Homocigote Recesivo : Cuando los genes o alelos aparecen en
parejas pero el carácter que ilevan es poco
expresivo. Se simboliza en parejas de letras minúsculas.
Ejm : a a , bb , c c , dd , ......
5

Tema 3: Principios mendelianos y extensiones

11. Heterocigote : Un individuo será heterocigote para una determinada característica, cuando sus alelos correspondientes son
11. Heterocigote : Un individuo será heterocigote para una
determinada característica, cuando sus alelos correspondientes son
diferentes. Su representación se expresa como : Aa , Bb , Cc ,
Dd , ......
12. Híbrido : Es el producto de un cruzamiento entre individuos de
constitución genética desigual. Se toma como sinónimo de
heterocigote. Existen 3 tipos :
12.1
Monohibrido : Cuando interviene un solo carácter o rasgo.
Ejm : A a , Bb , Cc , ....
12.2
Dihibrido : Organismo con heterocigosis para 2 pares de
genes Ejm : AaBb , CcDd , ....
12.3
Fblihíbrido : Organismo con heterocigosis para muchos pares
de genes Ejm : AaBbCcDd , ....
6
HERENCIA MENDELIANA • GREGOR MENDEL trata de explicar el porqué los rasgos aparecen en mayor o
HERENCIA MENDELIANA
GREGOR MENDEL trata de explicar el porqué los rasgos
aparecen en mayor o menor medida en la descendencia,
hablando de unos "factores" que serían los responsables
de la transmisión. Estos factores se sabe ahora que son
los GENES. Mendel estudió siete caracteres en la
"arveja":
7

Tema 3: Principios mendelianos y extensiones

Flor de la planta del guisante, Pisum sativum estudiada por Mendel 8 3: Principios mendelianos y
Flor de la planta
del guisante, Pisum sativum
estudiada por Mendel
8
3: Principios mendelianos y extensiones
Los siete caracteres estudiados por Mendel 9
Los siete caracteres estudiados
por Mendel
9

Tema 3: Principios mendelianos y extensiones

Polinización cruzada Autofecundación 10
Polinización cruzada
Autofecundación
10

Método de cruzamiento empleado por Mendel

Tema 3: Principios mendelianos y extensiones

Resultados de todos los cruzamientos monohíbridos de Mendel 11
Resultados de todos los cruzamientos
monohíbridos de Mendel
11

Tema 3: Principios mendelianos y extensiones

Interpretación genética del cruce monohíbrido de Mendel

12
12

Tema 3: Principios mendelianos y extensiones

Primera ley de Mendel: Segregación equitativa Participa un solo carácter. La ley sostiene "al cruzar dos
Primera ley de Mendel: Segregación equitativa
Participa un solo carácter. La ley sostiene "al cruzar dos
líneas puras que poseen variación de un mismo carácter, en
la primera generación todos los descendientes adquieren el
carácter dominante y al cruzar los híbridos (F-,) entre sí,
el carácter dominante se presenta en relación de tres a
uno
con
respecto
al
carácter recesivo.
Razón genotípica
1/4 AA
1/2 A
1/2 a
1/2 Aa
1/2 A
AA
Aa
1/4 aa
Aa
aa
1/2 a
Razón fenotípica
3/4 A-
1/4 aa
13

Tema 3: Principios mendelianos y extensiones

Cruce dihíbrido

Gen textura semilla R (liso) > r (rugoso) 14
Gen textura semilla
R (liso) > r (rugoso)
14

Gen Color Y (amarillo) > y (verde)

Tema 3: Principios mendelianos y extensiones

Segunda ley de Mendel: Cruce dihíbrido El cuadrado de Punnett ilustra los genotipos que dan lugar
Segunda ley de
Mendel: Cruce
dihíbrido
El cuadrado de
Punnett ilustra
los genotipos que
dan lugar a las
proporciones
9
:
3 : 3
:
1
15
Tema 3: Principios mendelianos y extensiones
Segunda ley de Mendel: Transmisión independiente Cada miembro de un par de genes puede con cualquiera
Segunda ley de Mendel:
Transmisión independiente
Cada miembro de un par de genes puede con
cualquiera de los miembros de otro par cuando
la célula se divide para formar los gametos
(células sexuales). De esta forma, en nuevos
individuos de la F2 son posibles todas las
combinaciones diferentes observándose una
proporción 9 : 3 : 3 : 1.
16

Tema 3: Principios mendelianos y extensiones

Segunda ley de Mendel: Razón genotípica 1/4 AB 1/4 Ab 1/4 aB 1/4 ab AABB Aabb
Segunda ley de Mendel:
Razón genotípica
1/4 AB 1/4 Ab
1/4 aB
1/4 ab
AABB Aabb aaBB
1/4 AB
AABB
AAbB
AaBB
AaBb
1/16:1/16:1/16:
aabb AaBb AABb
1/4 Ab
1/16:4/16:2/16:
AABb
AAbb
AabB
Aabb
aaBb AaBB Aabb
2/16:2/16:2/16
1/4 aB
AaBB
AaBb
aaBB
aaBb
1/4 ab
AaBb
Aabb
aaBb
aabb
Razón fenotípica
9/16 A-B-
3/16 A-bb
3/16 aaB- 1/16 aabb
17
Tema 3: Principios mendelianos y extensiones
Segunda ley de Mendel: Cruce trihíbrido P AABBCC x aabbcc F 1 AaBbCc x AaBbCc ABC
Segunda ley de Mendel: Cruce trihíbrido
P
AABBCC x aabbcc
F 1
AaBbCc x AaBbCc
ABC
ABc
AbC
Abc
aBC
aBc
abC
abc
ABC
AABBCC
AABBCc
AABbCC
AABbCc
AaBBCC
AaBBCc
AaBbCC
AaBbCc
ABc
AABBCc
AABBcc
AABbCc
AABbcc
AaBBCc
AaBBcc
AaBbCc
AaBbcc
AbC
AABbCC
AABbCc
AAbbCC
AAbbCc
AaBbCC
AaBbCc
AabbCC
AabbCc
Abc
AABbCc
AABbcc
AAbbCc
AAbbcc
AaBbCc
AaBbcc
AabbCc
Aabbcc
aBC
AaBBCC
AaBBCc
AaBbCC
AaBbCc
aaBBCC
aaBBCc
aaBbCC
aaBbCc
aBc
AaBBCc
AaBBcc
AaBbCc
AaBbcc
aaBBCc
aaBBcc
aaBbCc
aaBbcc
abC
AaBbCC
AaBbCc
AabbCC
AabbCc
aaBbCC
aaBbCc
aabbCC
aabbCc
abc
AaBbCc
AaBbcc
AabbCc
Aabbcc
aaBbCc
aaBbcc
aabbCc
aabbcc
18

Tema 3: Principios mendelianos y extensiones

Segunda ley de Mendel: Cruce trihíbrido P AABBCC x aabbcc F 1 AaBbCc x AaBbCc ABC
Segunda ley de Mendel: Cruce trihíbrido
P
AABBCC x aabbcc
F 1
AaBbCc x AaBbCc
ABC
ABc
AbC
Abc
aBC
aBc
abC
abc
AABBCC
AABBCc
AABbCC
AABbCc
AaBBCC
AaBBCc
AaBbCC
AaBbCc
ABC
AABBCc
AABBcc
AABbCc
AABbcc
AaBBCc
AaBBcc
AaBbCc
AaBbcc
ABc
AABbCC
AABbCc
AAbbCC
AAbbCc
AaBbCC
AaBbCc
AabbCC
AabbCc
AbC
AABbCc
AABbcc
AAbbCc
AAbbcc
AaBbCc
AaBbcc
AabbCc
Aabbcc
Abc
AaBBCC
AaBBCc
AaBbCC
AaBbCc
aaBBCC
aaBBCc
aaBbCC
aaBbCc
aBC
AaBBCc
AaBBcc
AaBbCc
AaBbcc
aaBBCc
aaBBcc
aaBbCc
aaBbcc
aBc
AaBbCC
AaBbCc
AabbCC
AabbCc
aaBbCC
aaBbCc
aabbCC
aabbCc
abC
AaBbCc
AaBbcc
AabbCc
Aabbcc
aaBbCc
aaBbcc
aabbCc
aabbcc
abc
Razón fenotípica
27
9
9
9
3
3
3
1
19

Tema 3: Principios mendelianos y extensiones

Naturaleza probabilística de las leyes Mendel: Las leyes son probabilísticas (como si los alelos de los
Naturaleza probabilística de
las leyes Mendel:
Las leyes son probabilísticas (como si los
alelos de los genes se cogieran al azar de urnas), no
deterministas
•Permiten predecir la probabilidad de
los distintos genotipos y fenotipos
que resultan de un cruce
•Permiten inferir el número de genes
que influyen sobre un carácter
20

Tema 3: Principios mendelianos y extensiones

Caracteres mendelianos en humanos: •Capacidad de sentir el sabor de la feniltiocarbamida • Albinismo • Tipo
Caracteres mendelianos en
humanos:
•Capacidad de sentir el sabor de la
feniltiocarbamida
• Albinismo
• Tipo sanguíneo
•Braquidactilia (dedos de manos y pies cortos)
•Hoyuelos de la mejilla
•Lóbulos oreja sueltos o adosados
•Pecas en la cara
•Pulgar hiperlaxo
•Polidactilia
OMIM - Online Mendelian Inheritance in Man
http://www.ncbi.nlm.nih.gov/sites/entrez?db=OMIM
21

Tema 3: Principios mendelianos y extensiones

Caracteres mendelianos Albinismo 22
Caracteres mendelianos
Albinismo
22

Tema 3: Principios mendelianos y extensiones

Alelismo múltiple • Grupos AB0 •A=B>0 •Fenotipo Genotipo A- AA ó A0 B- AB BB ó
Alelismo múltiple
• Grupos AB0
•A=B>0
•Fenotipo
Genotipo
A-
AA ó A0
B-
AB
BB ó B0
AB
0
00
•Color pelaje conejo
C + > C ch > C h > c
C+
Cch
Ch
c
Himalaya
Salvaje
Chinchilla
albino
23

Tema 3: Principios mendelianos y extensiones

Alelismo múltiple A nivel de secuencia nucleotídica prácticamente cada copia de un gen es diferente en
Alelismo múltiple
A nivel de secuencia nucleotídica prácticamente cada copia
de un gen es diferente en algún nucleótido de su secuencia.
El alelismo múltiple es ubicuo.
BRCA2
Individual 1
Individual 2
Individual 3
Individual 4
Individual 5
Individual 6
Individual 7
Individual 8
Individual 9
acgtagcatcgtatgcgttagacgggggggtagcaccagtacag
acgtagcatcgtatgcgttagacggggtggtagcaccagtacag
acgtagcatcgtatgcgttagacggcggggtagcaccagtacag
acgtagcatcgtttgcgttagacgggggggtagcaccagtacag
acgtagcatcgtttgcgttagacgggggggtagcaccagtacag
acgtagcatcgtttgcgttagacggcatggcaccggcagtacag
acgtagcatcgtttgcgttagacggcatggcaccggcagtacag
acgtagcatcgtttgcgttagacggcatggcaccggcagtacag
acgtagcatcgtttgcgttagacggcatggcaccggcagtacag
24

Tema 3: Principios mendelianos y extensiones

Se usa la notación AA, Aa y aa para denominar a los genotipos mendelianos que determinan un fenotipo, pero en realidad éstos son internamente heterogéneos en el nivel de DNA. Su asignación como genotipo AA ó aa se debe generalmente a que todas las secuencias que pertenecen al genotipo AA comparten un fenotipo distinto de las que pertenecen al genotipo aa y esta diferencia fenotípica se debe posiblemente a un nucleótido (o a unos pocos) que sería el verdadero genotipo que causa los diferentes fenotipos

¿Cómo explicamos los genotipos mendelianos si en el nivel del DNA cada alelo suele ser distinto?
¿Cómo explicamos los
genotipos mendelianos si en
el nivel del DNA cada alelo
suele ser distinto?
Secuencia nucleotídica de una región del gen A en
distintos individuos
Indiv1Secuencia Indiv1Secuencia 1 1 acgtagcatcgtatgcgttagacgggggggtagcaccagtacag acgtagcatcgtatgcgttagacgggggggtagcaccagtacag
Indiv1Secuencia Indiv1Secuencia 2 2 acgtagcatcgtatgcgttagacggggtggtagcaccagtacag acgtagcatcgtatgcgttagacggggtggtagcaccagtacag
Genotipo AA = aa -> Fenotipo A
Alelo A = a
Alelo a = t
Indiv2Secuencia Indiv2Secuencia 1 1 acgtagcatcgtatgcgttagacgggggggtagcaccagtacag acgtagcatcgtatgcgttagacgggggggtagcaccagtacag
Indiv2Secuencia Indiv2Secuencia 2 2 acgtagcatcgtttgcgttagacgggggggtagcaccagtacag acgtagcatcgtttgcgttagacgggggggtagcaccagtacag
Genotipo Aa = at -> Fenotipo A
Indiv3 Indiv3 Secuencia Secuencia 1acgtagcatcgtttgcgttagacggcatggcaccggcagtacag 1acgtagcatcgtttgcgttagacggcatggcaccggcagtacag
Indiv3 Indiv3 Secuencia Secuencia 2acgtagcatcgtttgcgttagacggcatggcaccggcagtacag 2acgtagcatcgtttgcgttagacggcatggcaccggcagtacag
Genotipo aa = at -> Fenotipo a
26

Tema 8: Extensiones del análisis mendeliano

•Gen letal y esencial •Un gen que cuando está alterado es letal, es un gen esencial
•Gen letal y esencial
•Un gen que cuando está alterado es letal, es un gen esencial
•Gen y del ratón doméstico es un ejemplo
Alelo y es dominante para el color amarillo, letal en homocigosis. Alteración
proporciones mendelianas de la F 2 es 2:1
27

Tema 3: Principios mendelianos y extensiones

•Edad de aparición de un fenotipo Aparición tardía de la enfermedad de Huntington •Temprana •Tardía •Impronta
•Edad de aparición de un
fenotipo
Aparición tardía de la
enfermedad de Huntington
•Temprana
•Tardía
•Impronta parental
•Ejemplo
Factor crecimiento II tipo insulina (Igf2) en ratón.
Mutante homocigoto -> enano.
El fenotipo del heterocigoto depende del origen del alelo
Alelo salvaje es paterno -> fenotipo salvaje
Alelo salvaje es materno -> fenotipo enano
28

Tema 3: Principios mendelianos y extensiones

Relaciones genotipo-fenotipo P 1 Ausencia de dominancia en el Dondiego de noche F 1 (Mirabilis jalapa)
Relaciones genotipo-fenotipo
P 1
Ausencia de
dominancia
en el Dondiego
de noche
F 1
(Mirabilis jalapa)
F 2
29

Tema 3: Principios mendelianos y extensiones

Cruce dihíbrido con ausencia de dominancia Razón genotípica ? 1/4 A 1 B 1 1/4 A
Cruce dihíbrido con ausencia de
dominancia
Razón genotípica ?
1/4 A 1 B 1
1/4 A 1 B 2
1/4 A 2 B 1 1/4 A 2 B 2
1/4 A 1 B 1
A 1 A 1 B
1 B 1
1/4 A 1 B 2
1/4 A 2 B 1
1/4 A 1 B 2
Número fenotipos distintos? Razón fenotípica ?
30
Tema 3: Principios mendelianos y extensiones
Los número esperados de cruces mendelianos Monohíbrido Dihíbrido Trihíbrido Regla general n=1 n=2 n=3 n Tipos
Los número esperados de cruces
mendelianos
Monohíbrido
Dihíbrido Trihíbrido Regla general
n=1
n=2
n=3
n
Tipos de gametos en la F 1
2
4
8
2 n
Proporción de homocigotos
1/4
1/16
1/64
(¼) n
recesivos en la F 2
Número de fenotipos distintos de
2
4
8
2 n
la F 2 suponiendo dominancia
completa
Número de genotipos distintos de
3
9
27
3 n
la F 2 (o fenotipos si no hay
dominancia)
31

Tema 3: Principios mendelianos y extensiones

Relación genotipo-fenotipo: Variación en la dominancia 32
Relación genotipo-fenotipo:
Variación en la dominancia
32

Tema 3: Principios mendelianos y extensiones

Relación genotipo-fenotipo: Codominancia •Presencia de ambos fenotipos paternos en el heterocigoto •Grupo AB •Heterocigoto proteína detectada
Relación genotipo-fenotipo:
Codominancia
•Presencia de ambos fenotipos paternos en el
heterocigoto
•Grupo AB
•Heterocigoto proteína detectada por
electroforesis en hemoglobina
33

Tema 3: Principios mendelianos y extensiones

Relación genotipo-fenotipo: Niveles de dominancia Hb A Hb A : Normal. Hb S Hb S :
Relación genotipo-fenotipo:
Niveles de dominancia
Hb A Hb A : Normal.
Hb S Hb S : Anemia grave.
Hb A Hb S : No anemia
34

Tema 3: Principios mendelianos y extensiones

Relación genotipo-fenotipo: Retinoblastoma hereditario R > r en el nivel celular pero r > R en
Relación genotipo-fenotipo:
Retinoblastoma hereditario
R > r en el nivel celular
pero
r > R en el nivel del organismo
35

Tema 3: Principios mendelianos y extensiones

Pleiotropía Ejemplo anemia falciforme Cambio de un nucleótido en el DNA del gen de la hemoglobina
Pleiotropía
Ejemplo anemia falciforme
Cambio de un nucleótido
en el DNA del gen de
la hemoglobina
Rápida destrucción de
los glóbulos rojos
Problemas
circulatorios
Acumulación de células
falciformes en el bazo
Producción de hemoglobina S
en lugar de la A
Baja concentración de
Daño
Daños en
Daño en
oxígeno en lo tejidos
Anemia
cerebral
otros órganos
el bazo
Agregación de la hemoglobina S para
formar estructuras casi cristalinas en
aguja en los glóbulos rojos
Debilidad
Fallo
física
cardiaco
Parálisis
Distorsión de los glóbulos rojos,
adquieren forma de hoz (falciforme)
Función mental
Fallo renal
disminuida
Neumonía
Reumatismo
36

Tema 3: Principios mendelianos y extensiones

Penetrancia y expresividad Ambos conceptos se refieren a la expresión fenotípica variable de ciertos genes Penetrancia:
Penetrancia y expresividad
Ambos conceptos se refieren a la expresión
fenotípica variable de ciertos genes
Penetrancia: Proporción de individuos en una
población que presentan el fenotipo
correspondiente a su genotipo. Si P < 1 se habla
de penetrancia incompleta
Expresividad: El grado de expresión individual
de un fenotipo para un genotipo dado
37

Tema 3: Principios mendelianos y extensiones

Expresividad La polidactilia se manifiesta en grados distintos 38
Expresividad
La polidactilia se manifiesta en grados distintos
38

Tema 3: Principios mendelianos y extensiones

Expresividad 10 grados de expresividad variable en el carácter piel manchada en perros. 39
Expresividad
10 grados de expresividad variable en el
carácter piel manchada en perros.
39

Tema 3: Principios mendelianos y extensiones

Caracteres determinados por más de un gen

40
40
Caracteres determinados por más de un gen 40 Tema 3: Principios mendelianos y extensiones

Tema 3: Principios mendelianos y extensiones

Caracteres determinados por más de un gen

41
41
Caracteres determinados por más de un gen 41 Tema 3: Principios mendelianos y extensiones

Tema 3: Principios mendelianos y extensiones

Interacción entre genes:

42
42

dos o más genes determinan el fenotipo de un modo que alteran las proporciones mendelianas esperadas

Tema 3: Principios mendelianos y extensiones

Tipos de interacción genética según la modificación de las proporciones mendelianas 9 3 3 1 13:3
Tipos de interacción genética según la
modificación de las proporciones mendelianas
9
3
3
1
13:3
9:7
9:3:4
12:3:1
15:1
A-B-
A-bb
aaB- aabb
•Mutación supresora 13:3
•Duplicación génica recesiva 9:7
•Epistasia recesiva 9:3:4
•Epistasia dominante 12:3:1
•Duplicación génica dominante 15:1
43

Tema 3: Principios mendelianos y extensiones

Genética bioquímica: estudio de la relación entre genes y enzimas Hipótesis un gen - una enzima
Genética bioquímica: estudio de
la relación entre genes y
enzimas
Hipótesis un gen - una enzima (Beadle y
Tatum 1941) -> Estudio de la ruta
biosintética de la niacina (vitamina B 3 en
el hongo del pan Neurospora crassa)
44

Tema 3: Principios mendelianos y extensiones

Genética bioquímica: muchos genes cooperan en el producto final 45
Genética bioquímica: muchos genes
cooperan en el producto final
45

Tema 3: Principios mendelianos y extensiones

Explicación bioquímica de la proporción 9:7 en el color de la aleurona del maíz Precursor Intermediario
Explicación bioquímica de la proporción 9:7
en el color de la aleurona del maíz
Precursor
Intermediario
blanco
blanco
Producto final
púrpura
Enzima A
Enzima B
Gen A
Gen B
Para obtener el producto final púrpura necesitamos
que tanto el gen A como el B produzcan una enzima
funcional. Si uno de los dos genes falla (genotipo aa
ó bb), el producto final será blanco
46

Tema 3: Principios mendelianos y extensiones

Genética bioquímica: Relación

concentración enzima y producto final 47
concentración enzima y producto final
47

Tema 3: Principios mendelianos y extensiones