Вы находитесь на странице: 1из 41

SINTESIS DE

PROTEINAS
MsC Q.F. ANGELICA MINAYA

SNTESIS DE
PROTENAS

Las protenas son los productos finales de la informacin


gentica. Una clula necesita miles de protenas diferentes que
deben sintetizarse en respuesta a las necesidades celulares, ser
transportadas a la localizacin celular adecuada y degradarse
cuando no se necesita su presencia

SNTESIS DE
PROTENAS
Y CDIGO GENTICO

En qu lugar se
sintetizan las
protenas?
Experiencias con
aminocidos radioactivos
determinaron que se
realizaba en los ribosomas

Cmo se unen los


aminocidos?
Los aminocidos son activados
(ATP) antes de incorporarse al
polipptido, unindose a un
ARNt especfico (complejo
aminoacil-ARN) mediante
aminoacil-ARNt-sintetasas
especficas

SNTESIS DE PROTENAS
Y CDIGO GENTICO

Cmo se traduce el
cdigo de 4 letras (A, U,
C, G) en aminocidos?
Mediante el Cgigo Gentico,
que es prcticamente universal

SNTESIS DE PROTENAS Y CDIGO


Cada GENTICO
triplete de bases o codn representa a un aminocido o indica el final de
la cadena. Los codones no estn separados, sino contiguos, por lo que la
secuencia de una protena est definida por una secuencia lineal de codones
contiguos.

CDIGO GENTICO: Marcos de


Lectura

El primer codn de la secuencia establece el marco de lectura, en el


que empieza un nuevo codn cada tres residuos nucleotdicos. En este
esquema existen tres marcos de lectura posibles

AAUCCGGACUUACGUUAACGGUACAGUAC (1er. marco)


AAUCCGGACUUACGUUAACGGUACAGUAC (2do. marco)
AAUCCGGACUUACGUUAACGGUACAGUAC (3er. marco)
Asparagina-Prolina-Asprtico
Isoleucina-Arginina-Treonina
Serina-Glicina-Leucina
Una vez establecido el marco de lectura, los codones se traducen ordenadamente
sin solapamiento ni puntuacin hasta que se encuentra un codn de terminacin.
Los otros dos marcos de lectura posibles dentro de un gen normalmente no
contienen informacin gentica til, pero hay excepciones. En algunos virus la
misma secuencia produce dos protenas distintas al utilizar diferentes marcos de

SNTESIS DE PROTENAS: Ribosomas y


ARNt
Los ribosomas
bacterianos estn
formados por dos
subunidades: una mayor
(50S) y una menor
(30S).

Los ribosomas de clulas


eucariotas tienen tambin
dos subunidades pero con
tamaos ligeramente
mayores (60S y 40S)

SNTESIS DE PROTENAS: Ribosomas y


ARNt
Los ARNt tienen entre 73 y 93
residuos nucleotdicos. Como
mnimo cada ARNt tiene ocho
bases modificadas, muchas de las
cuales son derivados metilados de
las bases principales
Hay al menos un ARNt para cada
aminocido, pero para algunos
aminocidos se requiere ms de un
ARNt
El bucle (o brazo) de la
izquierda reconoce su lugar en
el ribosoma. El de la derecha
opera en el reconocimiento de
la aminoacil-ARNt sintetasa
correspondiente. El anticodn
reconoce la ubicacin del ARNt
en el ARN m.

SNTESIS DE
PROTENAS:
Fases de la Traduccin

La sntesis de polipptidos empieza siempre en el extremo amino


(NH2) y progresa en el sentido de la sntesis hacia el extremo
carboxilo (CO.OH). Este patrn se ha confirmado en numerosos
experimentos y es vlido para todas las sntesis en todas las clulas

SINTESIS DE PROTEINAS:
TRANSCRIPCIN

Transcripcin:
1- Iniciacin: Una ARNpolimerasa comienza la sntesis del precursor del ARN a
partir de unas seales de iniciacin "secuencias de consenso " que se encuentran
en el ADN.

ARNpolimerasa

G C

A
U

A
U

C
G

G C

T
A

T
A

G
C

C
G

C
U

A
G

Transcripcin:
2. Alargamiento: La sntesis de la cadena contina en direccin 5'3'. Despus
de 30 nucletidos se le aade al ARN una cabeza (caperuza o lder) de metilGTP
en el extremo 5 con funcin protectora.

ARNpolimerasa

m-GTP

G C

A
U

A
U

C
G

G C

T
A

T
A

G
C

C
G

C
U

A
G

Transcripcin:
3- Finalizacin: Una vez que la enzima (ARN polimerasa) llega a la regin
terminadora del gen finaliza la sntesis del ARN. Entonces, una poliApolimerasa
aade una serie de nucletidos con adenina, la cola poliA, y el ARN, llamado
ahora ARNm precursor, se libera.

poliA-polimerasa

m-GTP

ARNm precursor

G C

4. Maduracin (cont.): El ARNm precursor contiene tanto exones como intrones. Se


trata, por lo tanto, de un ARNm no apto para que la informacin que contiene sea
traducida y se sintetice la correspondiente molcula proteica. En el proceso de
maduracin un sistema enzimtico reconoce, corta y retira los intrones y las
ARNligasas unen los exones, formndose el ARNm maduro.

ARNm
maduro
precursor

cola

Cabeza
AUG

AAAAAA
UAG

Maduracin del ARNm (Visin de conjunto).

Regin codificadora del gen

ADN
Promotor

E1

I1

E2

I2

E3

Terminador

TAC

ATC

Cabeza E1
ARNm
precursor

ARNm
maduro

I1

E2

I2

cola

E3

AAAAAA

AUG

UAG

Cabeza

cola
AAAAAA

AUG

UAG

Etapas de la Sntesis de Protenas:


Inicio

La fijacin de un factor de inicio a la subunidad meno impide que las dos


subunidades se unan prematuramente. Luego se fija el ARNm a la
subunidad menor, de modo que el codn de inicio (AUG, que codifica para
formil metionina) se une en un lugar preciso, porque del lado 5 del ARNm, a
8-13 pares de bases hay una secuencia que se unir con la secuencia
complementaria del ARNr de la subunidad ribosmica menor. Luego de
unido el ARNt que transporta a la fMet se fija la subunidad ribosmica
mayor.

Etapas de la Sntesis de Protenas:


Elongacin

El aminoacil-ARNt que transporta el segundo aminocido (Val) se ubica en el


sitio A y luego se forma el primer enlace peptdico entre la fMet (unida al
sitio P) y la Val del sitio A. Esta reaccin produce un dipeptidil-ARNt en el sitio
A y un ARNt descargado en el sitio P. El siguiente paso es la translocacin:
el ribosoma se desplaza un codn hacia el extremo 3, que provoca el traslado
del dipeptidil-ARNt al sitio P, dejando el A libre para la ubicacin del siguiente
aminocido (Phe). Simultneamente el ARNt desacilado (el que estaba unido a
la fMet) se desprende del sitio P, volviendo al citosol.

Etapas de la Sntesis de Protenas:


Terminacin

La cuarta fase de la sntesis peptdica est determinada por la presencia de


uno de los tres codones de terminacin del ARNm (UAA, UAG o UGA),
que desencadenan los siguientes procesos sucesivos: (1) la hidrlisis del
enlace peptidil-ARN terminal, (2) la liberacin del polipptido
terminado y (3) la disociacin de las dos subunidades ribosmicas,
preparando la iniciacin de un nuevo ciclo de sntesis polipeptdica.

SNTESIS DE PROTENAS: Esquema de la


Traduccin

Los ARNt reconocen codones mediante apareamiento de bases entre el codn


del ARNm y una secuencia de tres bases de ARNt denominada anticodn.
Los dos ARN se aparean de forma antiparalela, aparendose la primera base
del codn (siempre leda en direccin 53) con la tercera base del anticodn.

SNTESIS DE PROTENAS: Eficiencia de la


Traduccin
Tanto a partir de clulas
procariticas como
eucariticas se pueden
aislar grandes
agrupamientos de 10 a
100 ribosomas unidos a la
misma molcula de ARNm,
denominados polisomas
o polirribosomas, que
representan diferentes
estadios de la traduccin
de la seal contenida en el
ARNm, que es traducida
simultneamente por
muchos ribosomas
prximos unos a otros, lo
que permite una utilizacin
muy eficiente del ARNm.

SINTESIS DE PROTEINAS:
TRADUCCIN

Iniciacin: La subunidad pequea del ribosoma se une a la regin lder del ARNm y el
ARNm se desplaza hasta llegar al codn AUG, que codifica el principio de la protena. Se les
une entonces el complejo formado por el ARNt-metionina (Met). La unin se produce entre el
codn del ARNm y el anticodn del ARNt que transporta la metionina (Met).

Subunidad menor del ribosoma

AAAAAAAAAAA 3

AU G C AA U G C U U A C G A U AG
U AC

Anticodn

Codn

ARNt

ARNm

Me
t
(i)

1er aminocido

Elongacin I: A continuacin se une la subunidad mayor a la menor completndose el


ribosoma. El complejo ARNt-aminocido2 , la glutamima (Gln) [ARNt-Gln] se sita enfrente del
codn correspondiente (CAA). La regin del ribosoma a la que se une el complejo ARNt-Gln
se le llama regin aminoacil (A).

Subunidad menor del ribosoma

AAAAAAAAAAA 3

AU G C AA U G C U U A C G A U AG
U AC G U U

Me
t
(i)

Gl
n

Elongacin II: Se forma el enlace peptdico entre el grupo carboxilo de la metionina (Met) y
el grupo amino del segundo aminocido, la glutamina (Gln).

ARNm

AU G C AA U G C U U A C G A U AG
U AC G U U

Gl
n-

M
et

AAAAAAAAAAA 3

Elongacin III: El ARNt del primer aminocido, la metionina (Met) se libera.

ARNm

AU G C AA U G C U U A C G A U AG
GUU
UA

Gl
n-

M
et

AAAAAAAAAAA 3

Elongacin IV: El ARNm se traslada, de tal manera que el complejo ARNt-Gln-Met queda
en la regin peptidil del ribosoma, quedando ahora la regin aminoacil (A) libre para la
entrada del complejo ARNt-aa3

ARNm

AU G C AA U G C U U A C G A U AG
GUU

Gl
n-

M
et

AAAAAAAAAAA

Elongacin V: Entrada en la posicin correspondiente a la regin aminoacil (A) del


complejo ARNt-Cys, correspondiente al tercer aminocido, la cistena (Cys).

ARNm

AU G C AA U G C U U A C G A U AG
G U U AC G

Gl
n-

M
et

Cy
s

AAAAAAAAAAA 3

Elongacin VI: Unin del pptido Met-Gln (Metionina-Glutamina) a la cistena (Cys).

ARNm

AU G C AA U G C U U A C G A U AG
G U U AC G

Cy
s-

Gl
n-

M
et

AAAAAAAAAAA 3

Elongacin VII: Se libera el ARNt correspondiente al segundo aminocido, la glutamina


(Glu).

ARNm

AU G C AA U G C U U A C G A U AG
AC G
GU

Cy
s(i)

Gl
n-

Me
t

AAAAAAAAAAA 3

Elongacin VIII: El ARNm corre hacia la otra posicin, quedando el complejo ARNt3-CysGlu-Met en la regin peptidil del ribosoma.

ARNm

AU G C AA U G C U U A C G A U AG
AC G

Cy
s-

Gl
n-

M
et

AAAAAAAAAAA 3

Elongacin IX: Entrada del complejo ARNt-Leu correspondiente al 4 aminocido, la


leucina.

ARNm

AAAAAAAAAAA 3

AU G C AA U G C U U A C G A U AG
AC G
AAU

Cy
s-

Gl
nM
et

Leu

Elongacin X: Este se sita en la regin aminoacil (A).

ARNm

AU G C AA U G C U U A C G A U AG
AC G AAU

Cy
s-G

Le
u

ln-M
et

AAAAAAAAAAA 3

Elongacin XI: Unin del pptido Met-Gln-Cys con el 4 aminocido, la leucina (Leu).
Liberacin del ARNt de la leucina. El ARNm se desplaza a la 5 posicin

ARNm

AU G C AA U G C U U A C G A U AG
AAU
AC

Le
u-C
ysGln
-M
et

AAAAAAAAAAA 3

Elongacin XII: Entrada del ARNt de la leucina, el 5 aminocido, la arginina (ARNt-Arg).

ARNm

AAAAAAAAAAA 3

AU G C AA U G C U U A C G A U AG
AAU
GCU

Le
u-C
ysGln
-M
et

Arg

Elongacin XIII: Unin del pptido Met-Gln-Cys-Leu con el 5 aminocido, la


arginina (Arg). Liberacin del ARNt de la leucina (Leu). El ARNm se desplaza a la 6
posicin, se trata del un codn de finalizacin o de stop.

ARNm

AAAAAAAAAAA 3

AU G C AA U G C U U A C G A U AG
GCU
AA

Arg-Leu-Cys-Gln-Met

Finalizacin I: Liberacin del pptido o protena. Las subunidades del ribosoma se disocian
y se separan del ARNm.

ARNm

AAAAAAAAAAA 3

AU G C AA U G C U U A C G A U AG
GCU
AA

Arg-Leu-Cys-Gln-Met

Finalizacin II: Despus unos minutos los ARNm son digeridos por las enzimas del
hialoplasma.

ARNm
AAAAAAAAAAA 3

A U G C A A U G C U U A C G A U A G

(i)

Modificaciones
Postraduccionales
Modificaciones N- y C-terminales. Todos los polipptidos empiezan con f Met
(procariotas) o Met (eucariotas), pero en la mayora de los casos son
eliminados. Un 50% de las protenas eucariticas tienen el extremo N-terminal
acetilado. Los residuos C-terminales son modificados con menor frecuencia.
Prdida de secuencias seal.
Pptidos cortos (15 a 30
aminocidos) que dirigen a la
protena hacia su destino final.
Son eliminados por proteasas
durante la sntesis en el RER
Modificacin de aminocidos. Los grupos -OH de
Ser, Tre y Tyr pueden ser
fosforilados. El carboxilo de
Asp y Glu pueden formar
amidas (Asn y Gln). Lys es
frecuentemente metilada o
hidroxilada, como Pro, en la
formacin del colgeno.

Modificaciones
Postraduccionales
Unin
de
cadenas
laterales
glucdicas. La unin es covalente con
residuos Asn (oligosacridos unidos por
enlaces N), como en el caso de las
protenas que entran el RER (a la
derecha) o residuos de Tre o Ser
(oligosacridos unidos por enlaces O)
como en los proteoglicanos de la
matriz extracelular (abajo).

Modificaciones
Postraduccionales

Adicin de grupos isoprenilo. Los


grupos isoprenilo provienen de la
biosntesis del colesterol. Las laminas
(protenas de la lmina nuclear) y
muchas protenas de membrana estn
preniladas.

Adicin de grupos prostticos. Un


ejemplo es el grupo hemo del
citocromo c (arriba) y de la
hemoglobina (izquierda).

Modificaciones
Postraduccionales
Modificacin proteoltica. La insulina, las proteasas pepsina, tripsina
y quimotripsina y el colgeno se sintetizan como precursores inactivos
(proinsulina,
pepsingeno,
tripsingeno,
quimotripsingeno
y
protocolgeno, respectivamente) que luego deben ser hidrolizados
parcialmente para convertirse en productos biolgicamente activos.
Formacin de puentes disulfuro. Pueden ser intra- o intercatenarias
y se supone que ayudan a las protenas que deben ser exportadas a
mantener su estructura nativa.

Proinsulin

Insulin