Вы находитесь на странице: 1из 16

Fall 2014

HORT6033

Molecular
Plant Breeding

INSTRUCTOR: AINONG SHI

HORT6033 web site: http://comp.uark.edu/~ashi/MB

Fall 2014 HORT6033

Molecular Plant Breeding


Lecture 5 (09/08/2014)

I. Genetic Diversity
II.Example
III.Homework
IV.Questions

Genetic Diversity and Benefit


Genetic diversity refers to any variation in the
nucleotides, genes, chromosomes, or whole
genomes of organisms. It entails looking at the
genetic characteristics in the genetic makeup of a
species. It is different from genetic variability,
which describes the tendency of genetic
characteristics
to serves
vary. as a way for populations
Genetic diversity
to adapt to changing environments. With more
variation, it is more likely that some individuals in a
population will possess variations of alleles that are
suited for the environment.
www.ask.com

Genetic Diversity in
Breeding
Select parents for crossing
Breeding varieties to fit environments,
stress, and consumer demand
Genetic structure study and trait
association analysis

Causes of Genetic Diversity

Gene recommendation
Gene mutation
Gene transfer
Selection

Classification: INTERNAL USE


ONLY

Genetic Diversity
Genetic variation between and within species, which is
measured by determining the proportion of polymorphic
loci across the genome, or by the number of
heterozygous individuals in a population.
Fruit size: large vs
small
Fruit color: red vs
yellow
Tomato spotted wilt virus (TSWV):
Resistance vs susceptible plant
TSWV resistance:
Resistance vs susceptible gene
Sw-5 vs sw-5

Resistant plant

Susceptible plant

DNA sequence diversity


SNP variation
AY007366-sw5b TAATTTTCTCCTCAACATGTCGGCAAGAACATCAACCGTAGCTCCATTGTCGTCGGAACCTGTAACTTGACTGAAAATATCTTGTAATAACTCTCTCCGA
LA3667 ------------------------------A----------------------Y-R----------------G---------------------M--C-R
400
NY07-464
------------------------------G----------------------T-A----------------A------------------------T-LA2823 ------------------------------G----------------------T-A----------------A------------------------T-400

400
400

Genetic Diversity in World-wide


Spinach
Spinach germplasm

DNA extraction

Genotyping by
Sequencing

Data Analysis

SNP Discovery

Genetic Diversity

Plant materials: A total of 413 spinach


genotypes were used in this study,
including 323 USDA-GRIN germplasm
originally collected from 33 countries.
DNA extraction: genomic DNA is extracted
from spinach leaves using the CTAB.
Sequencing: using GBS by HiSeq 2000 in
BGI
SNP discovery: GBS data analysis using
DNASTAR Lasergene Genomics Suite,
TASSEL; Around half million SNPs were
discovered from the 413 spinach genotypes
using GBS by de novo assembly.

Genetic Diversity in Spinach


Ames 2366 2 Af gha nis ta n
PI21 2328 Af ghanis tan
PI60 4787 Af ghanis tan
PI16 9670 Turkey
PI16 5012 Turkey
PI20 5235 Turkey
PI20 7518 Af ghanis tan
PI44 5782 Sy r ia
PI21 9949 Af ghanis tan
PI41 9218 China
PI52 7332 China
PI64 8940 China
PI64 8943 China
PI64 8944 China
PI64 8946 China
PI64 8948 China
PI64 8947 China
PI64 8942 China
PI64 8949 China
PI64 8945 China
PI50 8504 SouthKor ea
PI43 3210 China
PI43 3211 Franc e
Bor deav x USA
PI60 4790 Af ghanis tan
PI17 3126 Turkey
PI22 4959 Ir an
PI17 1862 Turkey
PI16 9679 Turkey
PI17 9044 Turkey
PI20 6753 Turkey
PI22 3536 Af ghanis tan
PI44 5784 Sy r ia
PI35 8247 Ser bia
PI49 1261 Gr eec e
PI36 8825 Ser bia
PI35 8249 Ser bia
PI26 2161 Spain
PI17 9508 Ir aq
PI20 5234 Turkey
PI60 4784 Af ghanis tan
PI66 4499 China
PI21 7425 SouthKor ea
PI16 9678 Turkey
PI17 1866 Turkey
PI16 3310 Pakis ta n
PI17 7081 Turkey
PI17 6777 Turkey
PI17 6778 Turkey
PI17 9041 Turkey
PI16 9682 Turkey
PI17 5932 Turkey
PI17 9043 Turkey
PI17 6771 Turkey
PI17 7557 Turkey
PI17 1863 Turkey
PI17 4385 Turkey
PI20 6473 Turkey
PI17 3122 Turkey
PI17 5931 Turkey
PI17 6776 Turkey
PI21 1632 Af ghanis tan
PI21 2119 Af ghanis tan
PI20 9646 Turkey
PI22 0686 Af ghanis tan
PI17 9588 Belgiu m
PI18 1808 Sy r ia
PI22 0546 Af ghanis tan
PI22 7045 Ir an
PI22 2838 Ir an
PI22 7383 Ir an
PI22 9792 Ir an
PI25 6079 Af ghanis tan
PI22 6671 Ir an
PI20 9644 Ir an
PI25 1507 Ir an
PI29 6393 Ir an
PI17 5595 Turkey
PI20 9647 Ir an
PI22 7230 Japan
PI17 9593 Belgiu m
PI17 3124 Turkey
PI17 9594 Belgiu m
PI19 2945 China
PI60 4786 Nepal
PI16 5994 India
PI16 6366 India
PI17 4960 India
PI17 5312 India
PI43 3212 China
PI66 4498 China
PI16 5710 Japan
Alrite USA
PI60 4785 Mongoli
Meg aton USA
PI60 4779 Japan
PI60 4780 Japan
PI60 4782 Af ghanis tan
PI17 9597 Belgiu m
PI16 9675 Turkey
NSL 184380 Califo rn ia
PI64 8962 USA.Ma ry land
NSL 184378 USA .Or ego n
NSL 184398 Califo rn ia
Van c ouv er USA
PI53 1456 Hungar y
NSL 186328 USA .Or ego n
PI35 8259 Ser bia
PI64 8950 USA.Ma ry land
PI64 8952 USA.Ma ry land
PI64 8953 USA.Ma ry land
PI64 8958 USA.Ma ry land
PI64 8959 USA.Ma ry land
PI64 8951 USA.Ma ry land
PI64 8956 USA.Ma ry land
PI64 8960 USA.Ma ry land
PI64 8957 USA.Ma ry land
PI47 8393 China
Sev enR USA
NSL 6084 Califor nia
PI26 6926 Ger many
PI60 4777 Japan
PI27 4042 England
PI37 9551 Ser bia
PI27 4050 England
PI27 4056 England
PI36 0710 Franc e
PI37 9548 Ser bia
PI27 4052 England
PI53 1448 Hungar y
PI33 9548 Turkey
PI19 3619 Ethiop ia
PI36 8824 Ser bia
PI53 1452 Denmar k
PI36 1127 England
PI36 0895 Nether land
NSL 68264 USA.Ne w Y or k
PI53 1453 Hungar y
PI36 0894 Nether land
PI27 4046 England
PI49 9373 Sov ietUnion
PI27 4051 England
PI35 8251 Ser bia
Idea l USA
PI27 4047 England
Oly mpia USA
NSL 81328 USA.Mar yland
NSL 6097 USA.Minnes ota
NSL 6092 USA.New Y ork
NSL 65915 USA.Ore gon
PI53 1449 Hungar y
PI53 1450 Hungar y
PI27 4065 England
Hec tor USA
PI53 1451 Hungar y
PI49 9372 Sov ietUnion
PI28 5751 War s z aw a
PI37 9547 Ser bia
Lion USA
Gr ey han d USA
Che etah USA
Av e nger USA
Inter c eptor USA
Che rokee USA
Cr oc odile USA
Spinner USA
Nor dicIV USA
T- Bird USA
Pola rBea r USA
Boler o USA
Bos s ano v a USA
Laz io USA
Unipac k12 USA
Mig USA
Unipac k277 USA
Eagle USA
Whale USA
PI60 6707 Nor thHo lla nd
Ty ee USA
NSL 6090 USA.Penn sy lv ania
PI18 4137 Ser bia
PI35 8248 Ser bia
PI35 8252 Ser bia
Tar py USA
PI64 8955 USA.Ma ry land
NSL 6085 Califor nia
NSL 6782 Nether land
PI17 9509 Turkey
PI27 4044 England
PI53 1454 Hungar y
PI64 8964 Califor nia
Polk a USA
NSL 6095 USA.Mis s our i
PI27 4049 England
PI53 5897 Poland
PI26 1788 Franc e
NSL 37031 Geor gia
NSL 6099 USA.Penn sy lv ania
PI16 9668 Turkey
PI16 9673 Turkey
PI66 4497 China
PI24 9920 Spain
NSL 32629 Louis an a
PI35 8250 Ser bia
PI35 8253 Ser bia
PI17 6371 Italy
PI17 6372 Italy
PI27 4048 England
PI26 3873 Gr eec e
PI17 6775 Turkey
PI17 9590 Belgiu m
NSL 26513 USA.Mic higa n
NSL 6693 USA.Mic higan
NSL 6096 USA.Mis s our i
NSL 6088 USA.New Y ork
NSL 6557 USA.Was hing ton
NSL 22003 Calif or nia
NSL 6087 USA.New Y ork
NSL 22149 Calif or nia
NSL 6082 USA.New Y ork
NSL 92513 USA.Ore gon
IndianSummer USA
PI35 8257 Ser bia
NSL 6086 Califor nia
NSL 4683 USA.Ma ry land
NSL 6098 USA.Vir ginia
NSL 28216 USA.Wy oming
NSL 28217 USA.Wy oming
PI64 8961 USA.Ma ry land
NSL 6094 USA.Penn sy lv ania
Men oroa USA
Sar dinia USA
Unipac k151 USA
04- 103FA Y UAF
08- 101 UA F
08- 140 UA F
08- 104 UA F
08- 144 UA F
08F380 UA F
08- 03- 316f ay UAF
08- 143 UA F
08- 354REG UAF
08- 135 UA F
08- 150 UA F
08- 167 UA F
04- 103V GRS UA F
08- 112 UA F
08- 128 UA F
08- 183 UA F
08- 116 UA F
08- 134 UA F
08- 86- 310 UAF
08- 166 UA F
08- 88- 212 UAF
08- 191 UA F
08- 122 UA F
08- 180 UA F
08- 109 UA F
08- 115 UA F
08- 110 UA F
97154Ne w UA F
Samis h USA
Reg al USA
Den ali USA
PI22 2270 Ir an
Melody USA
PI17 9591 Belgiu m
PI18 1923 Sy r ia
PI22 2749 Ir an
PI17 4386 Turkey
PI16 4965 Turkey
PI20 4632 Turkey
PI16 9026 Turkey
PI16 9684 Turkey
PI17 1858 Turkey
PI17 6769 Turkey
PI17 6770 Turkey
PI17 7082 Turkey
PI17 6774 Turkey
PI17 3125 Turkey
PI17 5926 Turkey
PI17 6772 Turkey
PI17 5928 Turkey
PI17 7558 Turkey
PI37 4233 Egy pt
PI22 2750 Ir an
PI37 9550 Ser bia
PI20 5231 Turkey
PI64 8936 Gr eec e
PI16 3309 India
PI64 8937 Sy r ia
PI17 1859 Turkey
PI17 5924 Turkey
PI17 5923 Turkey
PI16 9671 Turkey
PI16 9674 Turkey
PI16 9685 Turkey
PI17 5925 Turkey
PI16 7098 Turkey
PI17 1867 Turkey
PI17 3127 Turkey
PI17 3130 Turkey
PI20 4735 Turkey
PI20 4736 Turkey
PI17 4383 Turkey
PI16 4966 Turkey
PI16 9676 Turkey
PI16 9689 Turkey
PI17 3123 Turkey
PI17 4384 Turkey
PI16 9690 Turkey
PI17 1865 Turkey
PI17 1861 Turkey

PI169679Turkey

Genetic diversity:
380 SNPs were used
for genetic diversity
analysis. The genetic
diversity analysis
indicated that there
was a geography
(country) factor during
spinach variety
development and
spinach production.

0.05

NSL6086 CaliforniaVancouver USA


Menoroa USA

PI171861Turkey

08-1 5 UAF

Sardinia USA Ames236 2 Afghanistan


PI169685Turkey
NSL6085 California
NSL18439PI8 Ca6 4lifo9r7niCha ina
PI169676Turkey Samish USA
PI1696 8Turkey NSL186328 USA.Oregon
PI175924Turkey

08-183 UAF

NSL184380 California
PI165012 Turkey

NSL6090 USA.Pen sylvania


PI648956 USA.PI169M67a4ryTlaunrkdey

PI604784Afghanistan

NSL184378 USA.Oregon PI174385 Turkey


PI169670 Turkey

08-1 2 UAF

PI163 09 India

08-128 UAF

PI217425 SouthKorea

PI169678 Turkey

08-134 UAF
08-1 608UAF-03-316fayUAF
08-104 UAF 08-143 UAF08-135 UAF

PI648936Gre ce
PI606707 NoPIrth6H48ol96a4ndCalifornia
PI184PI13670Se478rb0iaJapan
Hector USA PI604782Afghanistan
PI64895 USA.Maryland

NSL6096 USA.Mis ouri

PI219 49 Afghanistan

NSLNSL660983 USA.USA.MNiecwhiYoganrk

PI17186 Turkey

PI358250Serbia
PI17904 Turkey
PI27404PIEn17g9l5PIa0n91d7T9u5rk9e7yBelgium

PI1767 8 Turkey PI205234 Turkey


PI179508Iraq

EaNSLgle6USA09 USA.Pen sylvania

PI179041 TurkeyPI212328 Afghanistan

NordicIV USA

PI3 9548 Turkey

PI4 5784 Syria

PI209647 Iran
PI206473 Turkey
PI2 0686 Afghanistan Spin er USA

PI2 4959 Iran PI256079Afghanistan

PI360710 France
PI274056 England

PI179594Belgium PI174960 India


PI175312 India
PI174383 Turkey
PI6047 9 Japan

PI43 21 France
PI508504 SouthKorea

PI165710Japan

PI5314 8Hungary
PI49 373 SovietUnion

PI648942China
PI648945 China

PI358251 Serbia
PI648947 China
PI360895 Netherland

PI648948 China
PI175926Turkey PI648940 China
PI175931 Turkey
PI175 95Turkey
PI1767 1 Turkey

PI274052 England
PI274050 EngPIlan53d1454Hungary

PI204736 Turkey

PI3795 1 Serbia

PI207518 Afghanistan

PI274065 England
PI53PI142794Hu04n9gEnarygland

NSL2 0 3 California

PI358259 Serbia
PI648951 USA.Maryland
PI604786 Nepal

Lazio USA
PI1659 4 India

NSL28216 USA.Wyoming
LionUSA NSL92513USA.ONSLregon2 149 California
PI192945 China
NSL6087 USA.NewYork
Unipack151 USA
PI1767 0 Turkey
PI181923Syria
Bordeavx USA
PI173127 Turkey
PI169026Turkey PI21 632Afghanistan Avenger USA
PI176769 Turkey
PI478393 China
PI204632 Turkey
Alrite USA
Interceptor USA

PI179593Belgium

PI171867PITu1rk7e6y7 4 Turkey

PI604787AfPI2g0h5an2i3s1taTnurkey

TarpyNSLUSA81328 USA.Maryland
Polka USAPI169675 Turkey
PI296393Iran NSL6095USA.PI17M43is86oTuurirkey

PI368 25Serbia

PI171865 Turkey
PI175932Turkey
PI174384 Turkey
PI2 2750 Iran

PI419218 China

PI211632 Afghanistan
PI212119 Afghanistan
PI209646 Turkey
PI220686 Afghanistan
PI179588 Belgium
PI181808 Syria
PI220546 Afghanistan
PI227045 Iran
PI222838 Iran
PI227383 Iran
PI229792 Iran
PI256079 Afghanistan
PI226671 Iran
PI209644 Iran
PI251507 Iran
PI296393 Iran
PI175595 Turkey
PI209647 Iran
PI227230 Japan
PI179593 Belgium
PI173124 Turkey
PI179594 Belgium
PI192945 China
PI604786 Nepal
PI165994 India
PI166366 India
PI174960 India
PI175312 India
PI433212 China
PI664498 China
PI165710 Japan
Alrite USA
PI604785 Mongoli
Megaton USA
PI604779 Japan
PI604780 Japan

The above cluster mainly consists of the


spinach germplasm from Afghanistan, Iran,
China, and India, Iran, and Japan

Ames 23662 A fghanis tan


PI212328 Af ghanistan
PI604787 Af ghanistan
PI169670 Turkey
PI165012 Turkey
PI205235 Turkey
PI207518 Af ghanistan
PI445782 Syria
PI219949 Af ghanistan
PI419218 China
PI527332 China
PI648940 China
PI648943 China
PI648944 China
PI648946 China
PI648948 China
PI648947 China
PI648942 China
PI648949 China
PI648945 China
PI508504 SouthKorea
PI433210 China
PI433211 France
Bor deavx USA
PI604790 Af ghanistan
PI173126 Turkey
PI224959 Iran
PI171862 Turkey
PI169679 Turkey
PI179044 Turkey
PI206753 Turkey
PI223536 Af ghanistan
PI445784 Syria
PI358247 Serbia
PI491261 Greec e
PI368825 Serbia
PI358249 Serbia
PI262161 Spain
PI179508 Iraq
PI205234 Turkey
PI604784 Af ghanistan
PI664499 China
PI217425 SouthKorea
PI169678 Turkey
PI171866 Turkey
PI163310 Pakis tan
PI177081 Turkey
PI176777 Turkey
PI176778 Turkey
PI179041 Turkey
PI169682 Turkey
PI175932 Turkey
PI179043 Turkey
PI176771 Turkey
PI177557 Turkey
PI171863 Turkey
PI174385 Turkey
PI206473 Turkey
PI173122 Turkey
PI175931 Turkey
PI176776 Turkey
PI211632 Af ghanistan
PI212119 Af ghanistan
PI209646 Turkey
PI220686 Af ghanistan
PI179588 Belgium
PI181808 Syria
PI220546 Af ghanistan
PI227045 Iran
PI222838 Iran
PI227383 Iran
PI229792 Iran
PI256079 Af ghanistan
PI226671 Iran
PI209644 Iran
PI251507 Iran
PI296393 Iran
PI175595 Turkey
PI209647 Iran
PI227230 Japan
PI179593 Belgium
PI173124 Turkey
PI179594 Belgium
PI192945 China
PI604786 Nepal
PI165994 India
PI166366 India
PI174960 India
PI175312 India
PI433212 China
PI664498 China
PI165710 Japan
Alrite USA
PI604785 Mongoli
Megaton USA
PI604779 Japan
PI604780 Japan
PI604782 Af ghanistan
PI179597 Belgium
PI169675 Turkey
NSL184380 Calif ornia
PI648962 USA .Maryland
NSL184378 USA .Ore gon
NSL184398 Calif ornia
Vancouver USA
PI531456 Hungary
NSL186328 USA .Ore gon
PI358259 Serbia
PI648950 USA .Maryland
PI648952 USA .Maryland
PI648953 USA .Maryland
PI648958 USA .Maryland
PI648959 USA .Maryland
PI648951 USA .Maryland
PI648956 USA .Maryland
PI648960 USA .Maryland
PI648957 USA .Maryland
PI478393 China
Sev enR USA
NSL6084 Calif ornia
PI266926 Germany
PI604777 Japan
PI274042 England
PI379551 Serbia
PI274050 England
PI274056 England
PI360710 France
PI379548 Serbia
PI274052 England
PI531448 Hungary
PI339548 Turkey
PI193619 Ethiopia
PI368824 Serbia
PI531452 Denmark
PI361127 England
PI360895 Netherland
NSL68264 USA.New York
PI531453 Hungary
PI360894 Netherland
PI274046 England
PI499373 Sov ietUnion
PI274051 England
PI358251 Serbia
Ideal USA
PI274047 England
Oly mpia USA
NSL81328 USA.Mary land
NSL6097 USA .Minnesota
NSL6092 USA .New Y ork
NSL65915 USA.Oreg on
PI531449 Hungary
PI531450 Hungary
PI274065 England
Hec tor USA
PI531451 Hungary
PI499372 Sov ietUnion
PI285751 Warsz aw a
PI379547 Serbia
Lion USA
Greyhand USA
Cheetah USA
Av enger USA
Interc eptor USA
Cherokee USA
Crocodile USA
Spinner USA
Nor dic IV USA
T-Bird USA
PolarBear USA
Bolero USA
Bos s anov a USA
Laz io USA
Unipac k12 USA
Mig USA
Unipac k277 USA
Eagle USA
Whale USA
PI606707 NorthHollan d
Ty ee USA
NSL6090 USA .Penns ylv ania
PI184137 Serbia
PI358248 Serbia
PI358252 Serbia
Tarpy USA
PI648955 USA .Maryland
NSL6085 Calif ornia
NSL6782 Netherland
PI179509 Turkey
PI274044 England
PI531454 Hungary
PI648964 Calif ornia
Polka USA
NSL6095 USA .Mis s ouri
PI274049 England
PI535897 Poland
PI261788 France
NSL37031 Georgia
NSL6099 USA .Penns ylv ania
PI169668 Turkey
PI169673 Turkey
PI664497 China
PI249920 Spain
NSL32629 Louis ana
PI358250 Serbia
PI358253 Serbia
PI176371 Italy
PI176372 Italy
PI274048 England
PI263873 Greec e
PI176775 Turkey
PI179590 Belgium
NSL26513 USA.Mic higan
NSL6693 USA .Mic hig an
NSL6096 USA .Mis s ouri
NSL6088 USA .New Y ork
NSL6557 USA .Was hington
NSL22003 Calif ornia
NSL6087 USA .New Y ork
NSL22149 Calif ornia
NSL6082 USA .New Y ork
NSL92513 USA.Oreg on
IndianSummer USA
PI358257 Serbia
NSL6086 Calif ornia
NSL4683 USA .Maryland
NSL6098 USA .V irginia
NSL28216 USA.Wy oming
NSL28217 USA.Wy oming
PI648961 USA .Maryland
NSL6094 USA .Penns ylv ania
Menoroa USA
Sar dinia USA
Unipac k151 USA
04-103FA Y UA F
08-101 UA F
08-140 UA F
08-104 UA F
08-144 UA F
08F380 UA F
08-03-316f ay UAF
08-143 UA F
08-354REG UAF
08-135 UA F
08-150 UA F
08-167 UA F
04-103VGRS UAF
08-112 UA F
08-128 UA F
08-183 UA F
08-116 UA F
08-134 UA F
08-86-310 UA F
08-166 UA F
08-88-212 UA F
08-191 UA F
08-122 UA F
08-180 UA F
08-109 UA F
08-115 UA F
08-110 UA F
97154New UAF
Samis h USA
Regal USA
Denali USA
PI222270 Iran
Melody USA
PI179591 Belgium
PI181923 Syria
PI222749 Iran
PI174386 Turkey
PI164965 Turkey
PI204632 Turkey
PI169026 Turkey
PI169684 Turkey
PI171858 Turkey
PI176769 Turkey
PI176770 Turkey
PI177082 Turkey
PI176774 Turkey
PI173125 Turkey
PI175926 Turkey
PI176772 Turkey
PI175928 Turkey
PI177558 Turkey
PI374233 Egy pt
PI222750 Iran
PI379550 Serbia
PI205231 Turkey
PI648936 Greec e
PI163309 India
PI648937 Syria
PI171859 Turkey
PI175924 Turkey
PI175923 Turkey
PI169671 Turkey
PI169674 Turkey
PI169685 Turkey
PI175925 Turkey
PI167098 Turkey
PI171867 Turkey
PI173127 Turkey
PI173130 Turkey
PI204735 Turkey
PI204736 Turkey
PI174383 Turkey
PI164966 Turkey
PI169676 Turkey
PI169689 Turkey
PI173123 Turkey
PI174384 Turkey
PI169690 Turkey
PI171865 Turkey
PI171861 Turkey

PI374233 Egypt
PI222750 Iran
PI379550 Serbia
PI205231 Turkey
PI648936 Greece
PI163309 India
PI648937 Syria
PI171859 Turkey
PI175924 Turkey
PI175923 Turkey
PI169671 Turkey
PI169674 Turkey
PI169685 Turkey
PI175925 Turkey
PI167098 Turkey
PI171867 Turkey
PI173127 Turkey
PI173130 Turkey
PI204735 Turkey
PI204736 Turkey
PI174383 Turkey
PI164966 Turkey
PI169676 Turkey
PI169689 Turkey
PI173123 Turkey
PI174384 Turkey
PI169690 Turkey
PI171865 Turkey
PI171861 Turkey

The above cluster mainly consists of the


spinach germplasm from Turkey, indicating
these turkey germplasm has the similarity
genetic background.

Ames 23662 A fghanis tan


PI212328 Af ghanistan
PI604787 Af ghanistan
PI169670 Turkey
PI165012 Turkey
PI205235 Turkey
PI207518 Af ghanistan
PI445782 Syria
PI219949 Af ghanistan
PI419218 China
PI527332 China
PI648940 China
PI648943 China
PI648944 China
PI648946 China
PI648948 China
PI648947 China
PI648942 China
PI648949 China
PI648945 China
PI508504 SouthKorea
PI433210 China
PI433211 France
Bor deavx USA
PI604790 Af ghanistan
PI173126 Turkey
PI224959 Iran
PI171862 Turkey
PI169679 Turkey
PI179044 Turkey
PI206753 Turkey
PI223536 Af ghanistan
PI445784 Syria
PI358247 Serbia
PI491261 Greec e
PI368825 Serbia
PI358249 Serbia
PI262161 Spain
PI179508 Iraq
PI205234 Turkey
PI604784 Af ghanistan
PI664499 China
PI217425 SouthKorea
PI169678 Turkey
PI171866 Turkey
PI163310 Pakis tan
PI177081 Turkey
PI176777 Turkey
PI176778 Turkey
PI179041 Turkey
PI169682 Turkey
PI175932 Turkey
PI179043 Turkey
PI176771 Turkey
PI177557 Turkey
PI171863 Turkey
PI174385 Turkey
PI206473 Turkey
PI173122 Turkey
PI175931 Turkey
PI176776 Turkey
PI211632 Af ghanistan
PI212119 Af ghanistan
PI209646 Turkey
PI220686 Af ghanistan
PI179588 Belgium
PI181808 Syria
PI220546 Af ghanistan
PI227045 Iran
PI222838 Iran
PI227383 Iran
PI229792 Iran
PI256079 Af ghanistan
PI226671 Iran
PI209644 Iran
PI251507 Iran
PI296393 Iran
PI175595 Turkey
PI209647 Iran
PI227230 Japan
PI179593 Belgium
PI173124 Turkey
PI179594 Belgium
PI192945 China
PI604786 Nepal
PI165994 India
PI166366 India
PI174960 India
PI175312 India
PI433212 China
PI664498 China
PI165710 Japan
Alrite USA
PI604785 Mongoli
Megaton USA
PI604779 Japan
PI604780 Japan
PI604782 Af ghanistan
PI179597 Belgium
PI169675 Turkey
NSL184380 Calif ornia
PI648962 USA .Maryland
NSL184378 USA .Ore gon
NSL184398 Calif ornia
Vancouver USA
PI531456 Hungary
NSL186328 USA .Ore gon
PI358259 Serbia
PI648950 USA .Maryland
PI648952 USA .Maryland
PI648953 USA .Maryland
PI648958 USA .Maryland
PI648959 USA .Maryland
PI648951 USA .Maryland
PI648956 USA .Maryland
PI648960 USA .Maryland
PI648957 USA .Maryland
PI478393 China
Sev enR USA
NSL6084 Calif ornia
PI266926 Germany
PI604777 Japan
PI274042 England
PI379551 Serbia
PI274050 England
PI274056 England
PI360710 France
PI379548 Serbia
PI274052 England
PI531448 Hungary
PI339548 Turkey
PI193619 Ethiopia
PI368824 Serbia
PI531452 Denmark
PI361127 England
PI360895 Netherland
NSL68264 USA.New York
PI531453 Hungary
PI360894 Netherland
PI274046 England
PI499373 Sov ietUnion
PI274051 England
PI358251 Serbia
Ideal USA
PI274047 England
Oly mpia USA
NSL81328 USA.Mary land
NSL6097 USA .Minnesota
NSL6092 USA .New Y ork
NSL65915 USA.Oreg on
PI531449 Hungary
PI531450 Hungary
PI274065 England
Hec tor USA
PI531451 Hungary
PI499372 Sov ietUnion
PI285751 Warsz aw a
PI379547 Serbia
Lion USA
Greyhand USA
Cheetah USA
Av enger USA
Interc eptor USA
Cherokee USA
Crocodile USA
Spinner USA
Nor dic IV USA
T-Bird USA
PolarBear USA
Bolero USA
Bos s anov a USA
Laz io USA
Unipac k12 USA
Mig USA
Unipac k277 USA
Eagle USA
Whale USA
PI606707 NorthHollan d
Ty ee USA
NSL6090 USA .Penns ylv ania
PI184137 Serbia
PI358248 Serbia
PI358252 Serbia
Tarpy USA
PI648955 USA .Maryland
NSL6085 Calif ornia
NSL6782 Netherland
PI179509 Turkey
PI274044 England
PI531454 Hungary
PI648964 Calif ornia
Polka USA
NSL6095 USA .Mis s ouri
PI274049 England
PI535897 Poland
PI261788 France
NSL37031 Georgia
NSL6099 USA .Penns ylv ania
PI169668 Turkey
PI169673 Turkey
PI664497 China
PI249920 Spain
NSL32629 Louis ana
PI358250 Serbia
PI358253 Serbia
PI176371 Italy
PI176372 Italy
PI274048 England
PI263873 Greec e
PI176775 Turkey
PI179590 Belgium
NSL26513 USA.Mic higan
NSL6693 USA .Mic hig an
NSL6096 USA .Mis s ouri
NSL6088 USA .New Y ork
NSL6557 USA .Was hington
NSL22003 Calif ornia
NSL6087 USA .New Y ork
NSL22149 Calif ornia
NSL6082 USA .New Y ork
NSL92513 USA.Oreg on
IndianSummer USA
PI358257 Serbia
NSL6086 Calif ornia
NSL4683 USA .Maryland
NSL6098 USA .V irginia
NSL28216 USA.Wy oming
NSL28217 USA.Wy oming
PI648961 USA .Maryland
NSL6094 USA .Penns ylv ania
Menoroa USA
Sar dinia USA
Unipac k151 USA
04-103FA Y UA F
08-101 UA F
08-140 UA F
08-104 UA F
08-144 UA F
08F380 UA F
08-03-316f ay UAF
08-143 UA F
08-354REG UAF
08-135 UA F
08-150 UA F
08-167 UA F
04-103VGRS UAF
08-112 UA F
08-128 UA F
08-183 UA F
08-116 UA F
08-134 UA F
08-86-310 UA F
08-166 UA F
08-88-212 UA F
08-191 UA F
08-122 UA F
08-180 UA F
08-109 UA F
08-115 UA F
08-110 UA F
97154New UAF
Samis h USA
Regal USA
Denali USA
PI222270 Iran
Melody USA
PI179591 Belgium
PI181923 Syria
PI222749 Iran
PI174386 Turkey
PI164965 Turkey
PI204632 Turkey
PI169026 Turkey
PI169684 Turkey
PI171858 Turkey
PI176769 Turkey
PI176770 Turkey
PI177082 Turkey
PI176774 Turkey
PI173125 Turkey
PI175926 Turkey
PI176772 Turkey
PI175928 Turkey
PI177558 Turkey
PI374233 Egy pt
PI222750 Iran
PI379550 Serbia
PI205231 Turkey
PI648936 Greec e
PI163309 India
PI648937 Syria
PI171859 Turkey
PI175924 Turkey
PI175923 Turkey
PI169671 Turkey
PI169674 Turkey
PI169685 Turkey
PI175925 Turkey
PI167098 Turkey
PI171867 Turkey
PI173127 Turkey
PI173130 Turkey
PI204735 Turkey
PI204736 Turkey
PI174383 Turkey
PI164966 Turkey
PI169676 Turkey
PI169689 Turkey
PI173123 Turkey
PI174384 Turkey
PI169690 Turkey
PI171865 Turkey
PI171861 Turkey

Spinach Lines Developed by UAF


All UAF spinach lines merged together, indicating
The Good: UAF has special spinach germplasm;
and
The Bad: UAF spinach lines have narrow genetic
background.

Challenge:

Continuously
develop unique
UAF spinach
varieties
Introgress other
spinach genetic
background into
UAF spinach
lines in order to
broad genetic
diversity

PI179590 Belgium
NSL26513 USA.Michigan
NSL6693 USA.Michigan
NSL6096 USA.Missouri
NSL6088 USA.NewYork
NSL6557 USA.Washington
NSL22003 California
NSL6087 USA.NewYork
NSL22149 California
NSL6082 USA.NewYork
NSL92513 USA.Oregon
IndianSummer USA
PI358257 Serbia
NSL6086 California
NSL4683 USA.Maryland
NSL6098 USA.Virginia
NSL28216 USA.Wyoming
NSL28217 USA.Wyoming
PI648961 USA.Maryland
NSL6094 USA.Pennsylvania
Menoroa USA
Sardinia USA
Unipack151 USA
04-103FAY UAF
08-101 UAF
08-140 UAF
08-104 UAF
08-144 UAF
08F380 UAF
08-03-316fay UAF
08-143 UAF
08-354REG UAF
08-135 UAF
08-150 UAF
08-167 UAF
04-103VGRS UAF
08-112 UAF
08-128 UAF
08-183 UAF
08-116 UAF
08-134 UAF
08-86-310 UAF
08-166 UAF
08-88-212 UAF
08-191 UAF
08-122 UAF
08-180 UAF
08-109 UAF
08-115 UAF
08-110 UAF
97154New UAF
Samish USA
Regal USA
Denali USA
PI222270 Iran
Melody USA

A mes23662 A f ghanistan
PI212328 A f ghanis tan
PI604787 A f ghanis tan
PI169670 Turkey
PI165012 Turkey
PI205235 Turkey
PI207518 A f ghanis tan
PI445782 Syria
PI219949 A f ghanis tan
PI419218 China
PI527332 China
PI648940 China
PI648943 China
PI648944 China
PI648946 China
PI648948 China
PI648947 China
PI648942 China
PI648949 China
PI648945 China
PI508504 Sout hKorea
PI433210 China
PI433211 France
Bor deavx USA
PI604790 A f ghanis tan
PI173126 Turkey
PI224959 Ir an
PI171862 Turkey
PI169679 Turkey
PI179044 Turkey
PI206753 Turkey
PI223536 A f ghanis tan
PI445784 Syria
PI358247 Serbia
PI491261 Gr eece
PI368825 Serbia
PI358249 Serbia
PI262161 Spain
PI179508 Ir aq
PI205234 Turkey
PI604784 A f ghanis tan
PI664499 China
PI217425 Sout hKorea
PI169678 Turkey
PI171866 Turkey
PI163310 Pakis tan
PI177081 Turkey
PI176777 Turkey
PI176778 Turkey
PI179041 Turkey
PI169682 Turkey
PI175932 Turkey
PI179043 Turkey
PI176771 Turkey
PI177557 Turkey
PI171863 Turkey
PI174385 Turkey
PI206473 Turkey
PI173122 Turkey
PI175931 Turkey
PI176776 Turkey
PI211632 A f ghanis tan
PI212119 A f ghanis tan
PI209646 Turkey
PI220686 A f ghanis tan
PI179588 Belgium
PI181808 Syria
PI220546 A f ghanis tan
PI227045 Ir an
PI222838 Ir an
PI227383 Ir an
PI229792 Ir an
PI256079 A f ghanis tan
PI226671 Ir an
PI209644 Ir an
PI251507 Ir an
PI296393 Ir an
PI175595 Turkey
PI209647 Ir an
PI227230 Japan
PI179593 Belgium
PI173124 Turkey
PI179594 Belgium
PI192945 China
PI604786 Nepal
PI165994 India
PI166366 India
PI174960 India
PI175312 India
PI433212 China
PI664498 China
PI165710 Japan
A lrite USA
PI604785 Mongoli
Megaton USA
PI604779 Japan
PI604780 Japan
PI604782 A f ghanis tan
PI179597 Belgium
PI169675 Turkey
NSL184380 Calif or nia
PI648962 USA .Mar yland
NSL184378 USA .Or egon
NSL184398 Calif or nia
V anc ouver USA
PI531456 Hungary
NSL186328 USA .Or egon
PI358259 Serbia
PI648950 USA .Mar yland
PI648952 USA .Mar yland
PI648953 USA .Mar yland
PI648958 USA .Mar yland
PI648959 USA .Mar yland
PI648951 USA .Mar yland
PI648956 USA .Mar yland
PI648960 USA .Mar yland
PI648957 USA .Mar yland
PI478393 China
SevenR USA
NSL6084 Calif ornia
PI266926 Germany
PI604777 Japan
PI274042 England
PI379551 Serbia
PI274050 England
PI274056 England
PI360710 France
PI379548 Serbia
PI274052 England
PI531448 Hungary
PI339548 Turkey
PI193619 Ethiopia
PI368824 Serbia
PI531452 Denmark
PI361127 England
PI360895 Netherland
NSL68264 USA .New Y or k
PI531453 Hungary
PI360894 Netherland
PI274046 England
PI499373 SovietUnion
PI274051 England
PI358251 Serbia
Ideal USA
PI274047 England
Olympia USA
NSL81328 USA .Mar yland
NSL6097 USA .Minnesota
NSL6092 USA .New Y or k
NSL65915 USA .Or egon
PI531449 Hungary
PI531450 Hungary
PI274065 England
Hector USA
PI531451 Hungary
PI499372 SovietUnion
PI285751 War szaw a
PI379547 Serbia
Lion USA
Greyhand USA
Cheetah USA
A venger USA
Interceptor USA
Cher okee USA
Crocodile USA
Spinner USA
Nor dic IV USA
T- Bir d USA
Polar Bear USA
Bolero USA
Bossanova USA
Laz io USA
Unipack12 USA
Mig USA
Unipack277 USA
Eagle USA
Whale USA
PI606707 Nort hHolland
Tyee USA
NSL6090 USA .Pennsylvania
PI184137 Serbia
PI358248 Serbia
PI358252 Serbia
Tar py USA
PI648955 USA .Mar yland
NSL6085 Calif ornia
NSL6782 Netherland
PI179509 Turkey
PI274044 England
PI531454 Hungary
PI648964 Calif ornia
Polka USA
NSL6095 USA .Mis sour i
PI274049 England
PI535897 Poland
PI261788 France
NSL37031 Georgia
NSL6099 USA .Pennsylvania
PI169668 Turkey
PI169673 Turkey
PI664497 China
PI249920 Spain
NSL32629 Louisana
PI358250 Serbia
PI358253 Serbia
PI176371 Italy
PI176372 Italy
PI274048 England
PI263873 Gr eece
PI176775 Turkey
PI179590 Belgium
NSL26513 USA .Michigan
NSL6693 USA .Mic higan
NSL6096 USA .Mis sour i
NSL6088 USA .New Y or k
NSL6557 USA .Washington
NSL22003 Calif ornia
NSL6087 USA .New Y or k
NSL22149 Calif ornia
NSL6082 USA .New Y or k
NSL92513 USA .Or egon
IndianSummer USA
PI358257 Serbia
NSL6086 Calif ornia
NSL4683 USA .Mar yland
NSL6098 USA .V ir ginia
NSL28216 USA .Wyoming
NSL28217 USA .Wyoming
PI648961 USA .Mar yland
NSL6094 USA .Pennsylvania
Menoroa USA
Sar dinia USA
Unipack151 USA
04- 103FA Y UA F
08- 101 UA F
08- 140 UA F
08- 104 UA F
08- 144 UA F
08F380 UA F
08- 03- 316f ay UA F
08- 143 UA F
08- 354REG UA F
08- 135 UA F
08- 150 UA F
08- 167 UA F
04- 103V GRS UAF
08- 112 UA F
08- 128 UA F
08- 183 UA F
08- 116 UA F
08- 134 UA F
08- 86- 310 UA F
08- 166 UA F
08- 88- 212 UA F
08- 191 UA F
08- 122 UA F
08- 180 UA F
08- 109 UA F
08- 115 UA F
08- 110 UA F
97154New UA F
Samish USA
Regal USA
Denali USA
PI222270 Ir an
Melody USA
PI179591 Belgium
PI181923 Syria
PI222749 Ir an
PI174386 Turkey
PI164965 Turkey
PI204632 Turkey
PI169026 Turkey
PI169684 Turkey
PI171858 Turkey
PI176769 Turkey
PI176770 Turkey
PI177082 Turkey
PI176774 Turkey
PI173125 Turkey
PI175926 Turkey
PI176772 Turkey
PI175928 Turkey
PI177558 Turkey
PI374233 Egypt
PI222750 Ir an
PI379550 Serbia
PI205231 Turkey
PI648936 Gr eece
PI163309 India
PI648937 Syria
PI171859 Turkey
PI175924 Turkey
PI175923 Turkey
PI169671 Turkey
PI169674 Turkey
PI169685 Turkey
PI175925 Turkey
PI167098 Turkey
PI171867 Turkey
PI173127 Turkey
PI173130 Turkey
PI204735 Turkey
PI204736 Turkey
PI174383 Turkey
PI164966 Turkey
PI169676 Turkey
PI169689 Turkey
PI173123 Turkey
PI174384 Turkey
PI169690 Turkey
PI171865 Turkey
PI171861 Turkey

A SNP Set for Spinach Cultivar Identification


So far, a SNP set consists of 15 SNPs postulated from genetic
diversity analysis, which can distinguish and determine all 413 tested
spinach genotypes.
(left: 15 SNPs; right: example of spinach using the 15 SNPs)
Hellcat
SNP_ID
SNP short read
record_298338
record_298339
record_298326
record_349043
record_349021
record_349037
record_349001
record_298342
record_298310
record_298366
record_349055
record_298345
record_298358
record_349050

CAGCAAAAATGAAACCAAGTTTAAGAAATACCCA[A/T]AGT
TCTATATTTGAAGAAGAGAAATTTCATAAGATACCTCTTGTAT
A
CAGCCCCATTCTAGAAATATTCATCCTCTACATCTTTAAAGG
ATGCCT[A/G]TTCACATCTCCATTCTTATAGTATCCACTTCTG
CAGCTTTTAAATCAGCTGAATTTCAACATTCGTAATCTGTTT
GT[G/T]TATTATGTTTAAAGTTGTTTCTACTGATTATTGATGT
CAGCCTAAATCAAGTGGTRATGCATTTTCTCCCCT[C/T]TTC
TGATTCACTTGAGGAATCTGTTTAGACATAGCTAATTTCATA
A
CAGCAATTCATTGTTATTTAAGGTATCGTTAAGTGTATTCAAC
GATTTTTMTAACAAAATAACAAC[A/G]TTAAGGTTCGAGGA
T
CAGCCTTATTAGGCAAACAAGTC[C/T]CTAGAACAAGATCA
ATTTGATGTTMAATTCCACGAATAGGAGGCGAACCTGGTG
GTAA
CAGCTAAAAGATTGGAGTAATAGTCGAATCCTCGAACCTTA
A[C/T]GTTGTTATTTTGTTAGAAAAATCKTTGAATACACTTAA
C
CAGCTCAAATATTAAACCCTTGCTGTTGGGATCTACTGTAC
TGAAGTAGTAACTCTTCTAAGTAAAAGAATAAGCG[A/G]CT
CTA
CAGCTGTGAA[A/G]CTGAAATTAGTGTCATTTGATGTTATTG
TGTTATTGTGTTAATTTTCAAGTGTTGCCATTAATCAGTTTAC
CAGCTCAGCAAAATCTAGCAAAGTGAATGATTTGGATCAGA
CTTATGATTTTGTAA[A/T]GGGGGACCTTTTTCCCATACATT
CC
CAGCTGGACCTRGGAAGGGGAACATGCATGTTATCTTTCT
AGATGT[C/G]TTAAAAGTTAAAACAGGTGTGTTAAGCTTACT
AAT
CAGCAATGGACATGAAGCAGGTCGAAAGACCCACTTTACT
TT[A/C]GCTACAACACGAATATTACCACAATCGAAATTGCG
RTTT
CAGCATCAGAATCTGTTTATTTCAGTCTAGATAATGTATATCA
GCTTATTGCTAGGAACT[C/T]TGATCCCTCAAAGTTCACAAT
CAGCAGTCACAGCAACCTTTATGTCCCTGGGATGGAACTG
ACCGCGATTATCTGTAT[A/G]AAGAGGTRAGCTGTTTTGATC

Unipack 277
Hector
Lion
Crocodile
Spinner
Cheetah
Polar Bear
T-Bird
Indian Summer
Megaton
Alrite
Tyee
Melody
Samish
Unipack 151
Lazio
Tarpy
Whale
Unipack 12
Eagle
Bolero
Denali
Cherokee
Vancouver
Regal

Tools for Genetic Diversity Analysis


1. Clustal X2 and TreeView X
Clustal X2: http://www.clustal.org/
TreeView X: http://darwin.zoology.gla.ac.uk/~
rpage/treeviewx/download.html

2. MEGA 6

http://www.megasoftware.net/megacc.php

Examples for Sw-5 of Tomato


Stevens-Sw5b
LA3667 Sw5b.5a
Stevens-Sw5a
LA3433 sw5
LA2823 sw5
NY07-464 sw5
Distance
StevensSw5b
LA3667_Sw5
ab
LA3433_sw5
LA2823_sw5
NY07464_sw5
StevensSw5a

Stevens-Sw5b

LA3667_Sw5a
b

LA3433_sw5

0.000

0.000

0.006
0.005

0.006
0.005

0.000
0.002

0.000

0.005

0.005

0.002

0.000

0.000

0.002

0.002

0.008

0.006

0.006

0.000

Sw-5 sample data to download

LA2823_sw5 NY07-464_sw5 Stevens-Sw5a

Examples for Spinach


Fifteen SNP data for spinach
variety determination
Download the 15 SNP set data

Genetic diversity in world


wide spinach germplasm
Download the 760 SNP data for ww spinach

Homework
1. Use Clustal X2 and TreeView X to
do genetic diversity for 15 SNP
data of spinach lines;
2. Use MEGA 6 to do genetic
diversity for 15 SNP data of
spinach lines;
3. Use MEGA 6 to do genetic
diversity for world wide spinach
germplasm