You are on page 1of 217

CÉLULAS: PROCARIOTAS Y

EUCARIOTAS
CÉLULA
Es la unidad básica de la estructura y función
biológica.
CÉLULAS: PROCARIOTAS Y
EUCARIOTAS
Membrana celular:
Constituye el límite ADN

de la célula, es
decir, la separa del
medio externo
celular

ADN: Material
genético
CÉLULAS: PROCARIOTAS Y
EUCARIOTAS
Citoplasma
- Es el contenido celular ubicado dentro de la membrana
plasmática.
- Es una sustancia formada por compuestos orgánicos e inorgánicos
es estado coloidal
- En el citoplasma se encuentran diversos organelos celulares que
cumplen funciones determinadas
CÉLULAS: PROCARIOTAS Y
EUCARIOTAS
EU: VERDADERO PRO: ANTES
KARYON: GRANO O KARYON: GRANO O
SEMILLA SEMILLA
CÉLULAS: PROCARIOTAS Y
EUCARIOTAS

PROCARIOTAS EUCARIOTAS
• No tiene núcleo definido • Núcleo definido(
(carece de envoltura envoltura nuclear)
nuclear) • Presencia de organelas
• Ausencia de organelas • Pared celular en plantas
• Presentan pared y hongos (celulosa)
celular(péptidoglicano) • Citoplasma heterogéneo
• Citoplasma homogéneo • ADN forma
• ADN forma circular lineal(dentro del núcleo)
• Unicelulares aunque • Unicelulares hasta
pueden haber filamentos pluricelulares
o colonias
Reinos de la vida
• Reino mónera : Procariotas (bacterias)
• Reino protista : Eucariotas unicelulares
(aunque algas son milticelulares), amebas
y paramecios.
• Reino Fungi: Eucariotas, mayormente
multicelulares (aunque levadura es
multicelulres), pared celular formada
por quitina, como los hongos.
Reinos de la vida
• Reino vegetal : Eucariotas,
multicelulares tales como Árboles,
hierbas y musgos.
• Reino animal : Eucariotas,
multicelulares, tales como esponjas,
arañas, pinguinos y humanos.
CÉLULAS: PROCARIOTAS Y EUCARIOTAS
PROCARIOTAS
Reino mónera moneres

Arqueobacterias Eubacterias

Extremofilos Dif. condiciones

Altas concentraciones de
sales
pH extremo ( ácidos o
básicos)
Altas temperaturas
Ausencia de nutrientes
RICKETTSIOSIS
CÉLULAS: PROCARIOTAS Y
EUCARIOTAS

EUCARIOTAS
Reino: Animal, Vegetal, fungi y protista

Células Células
animales vegetales
No presentan pared celular Presentan Pared celular
CÉLULAS: PROCARIOTAS Y
EUCARIOTAS
Organelas: Estructuras rodeadas por
membranas que se encuentran en el interior
celular.
Mitocondrias
Lisosomas
Cloroplastos
Aparato de Golgi
Vacuolas
Ribosomas
Retículo endoplasmático liso o rugoso
CÉLULAS EUCARIOTAS
CÉLULAS EUCARIOTAS
CÉLULAS EUCARIOTAS
Núcleo: centro de información de las
células
CÉLULAS EUCARIOTAS
Núcleo
o Estructura más notoria en la célula (Robert Brown in 1831)
o En este se encuentra el material genético o ADN, el cual
dirige todas las actividades de la célula
o Está separado del citoplasma por una envoltura llamada
membrana nuclear
o Mayoría de las células poseen un núcleo, sin embargo,
existen células que poseen más
o Dentro del núcleo se halla una estructura esférica
denominada nucleolo.
o Nucleolo: Lugar donde existe una alta actividad
transcripcional para producir RNA ribosomal, este
codificará para proteínas que constituyen los ribsomas
CÉLULAS EUCARIOTAS
Núcleo: centro de información de las
células
CÉLULAS EUCARIOTAS
Núcleo: centro de información de las
células
Envoltura o membrana nuclear
 La superficie del núcleo está compuesto por dos membranas,
cada una de ellas formada por una bicapa lipídica.
 La membrana externa de la envoltura nuclear es continua al
retículo endoplamático.
 Posee poros (cráteres de la luna ), son llamados poros
nucleares, miden entre 50 y 80 nm.
 Los poros nucleares están llenos de proteínas que actúan
como canales moleculares, permitiendo que ciertas moléculas
pasen dentro y fuera del núcleo.
El paso se restringe principalmente a dos tipos de moléculas:
(1) Proteínas que entran a el núcleo para ser incorporado en
estructuras nucleares o para catalizar actividades nucleares
(2) Complejos de RNA y proteína-ARN formados en el núcleo y
exportados al citoplasma.
CÉLULAS EUCARIOTAS
Retículo endoplasmático (RE)
Las células están llenas de endomembranas,
dividiéndola en compartimientos, que canalizan

el paso de moléculas a través del interior de la


célula, y proporcionan superficies para la
síntesis de lípidos y algunas proteínas
CÉLULAS EUCARIOTAS
Retículo endoplasmático (RE)
CÉLULAS EUCARIOTAS
Retículo endoplasmático (RE)
 El término endoplasmático significa "dentro del
citoplasma", y el término retículo es latino para
"Una pequeña red".
 Al igual que la membrana nuclear, la ER se
compone de una bicapa lipídica incrustada con
proteínas. Teje en láminas a través del interior de
la célula, creando una serie de canales entre sus
pliegues.
 La región interna de la ER se denomina el espacio
cisternal, y la región exterior a ella, el citosol.
CÉLULAS EUCARIOTAS
Retículo Endoplasmático Rugoso (RER)
Fabricante de proteínas para la
exportación
CÉLULAS EUCARIOTAS
Retículo Endoplasmático Rugoso (RER)
Fabricante de proteínas para la
exportación
CÉLULAS EUCARIOTAS
Retículo Endoplasmático Rugoso (RER)
Fabricante de proteínas para la exportación
 Se caracteriza por tener una apariencia en
forma de lija, debido a la presencia de
ribosomas.
 Agregados de proteínas y RNAs que traen
información del ADN para codificar proteínas
 Todas las proteínas sintetizadas en el RER son
exportadas, por lo tanto deben sufrir un
proceso
CÉLULAS EUCARIOTAS

Aparato de Golgi
Sistema de liberación de las
células
CÉLULAS EUCARIOTAS
Aparato de Golgi
Sistema de liberación de las células

 Sacos aplanados llamados cuerpos de Golgi.


 La unión de varios cuerpos de Golgi que unidos
forman el aparato de Golgi.
 El aparato de Golgi funciona en la recolección,
empaquetamiento, modificación y distribución de
moléculas sintetizadas en un lugar de la célula y
utilizadas en otro lugar de la misma.
 Posee dos “caras” : CIS y TRANS
CÉLULAS EUCARIOTAS
Aparato de Golgi
Sistema de liberación de las células
CIS, El frente, o extremo receptor, se encuentra cerca
de RE. Los materiales se desplazan a la cara cis en
vesículas de transporte que brotan de la RE. Estas
vesículas se funden con la cara cis, vaciando su contenido
en el interior, o lumen, del aparato de Golgi.

Estas moléculas sintetizadas en el RE pasan entonces a


través de los canales del aparato de Golgi hasta que
llegan a la parte posterior o final de descarga, llamada
cara TRANS, donde se descargan en vesículas
secretoras.
CÉLULAS EUCARIOTAS
Aparato de Golgi
Sistema de liberación de las células
Los liposomas son vesículas
fabricadas sintéticamente que
contienen cualquier variedad de
sustancias deseables (tales como
fármacos), y se pueden inyectar
en el cuerpo.

Debido a que la membrana de los


liposomas es similar a la
membranas plasmática y de las
organelas, estos liposomas sirven
como un sistema de suministro
eficaz y natural a las células y
pueden resultar ser de gran valor
Vesículas: almacenes de
enzimas
CÉLULAS EUCARIOTAS
Lisosomas
Centros de digestión intracelular
 Vesículas con enzimas
digestivas
 Surgen del aparato de
Golgi
 Degradación de
proteínas,
carbohidratos, lípidos
y estructuras más
complejas como
organelos celulares
 Degradan otras
células
 Funcionan a pH ácidos
CÉLULAS EUCARIOTAS
Lisosomas
Centros de digestión intracelular
Los lisosomas que no están
funcionando activamente no
mantienen un pH ácido
interno y se llaman
lisosomas primarios. Cuando
un lisosoma primario se
funde con una vesícula
alimenticia u otro organelo,
su pH cae y su arsenal de
enzimas hidrolíticas se
activa; entonces recibe el
nombre de lisosoma
secundario
CÉLULAS EUCARIOTAS
Lisosomas
Centros de digestión intracelular

Microcuerpos : Glicosomas
y peroxisomas
CÉLULAS EUCARIOTAS
Ribosomas
Sitios de síntesis de proteínas
CÉLULAS EUCARIOTAS
Ribosomas
Sitios de síntesis de proteínas

Los ribosomas están formados por varias moléculas de una


forma especial de ARN llamado ARN ribosómico, o ARNr,
unidos dentro de un complejo de varias docenas de proteínas
diferentes.
Cada ribosoma se compone de dos subunidades (50 S y 30S)
en procariotas y (60S y 40S) en eucariotas .
Las subunidades se unen para formar un ribosoma funcional
sólo cuando se unen a otro tipo de ARN, llamado ARN
mensajero (mRNA) en el citoplasma.
Para sintetizar las proteínas, el ribosoma se une al ARNm, y
utiliza la información para dirigir la síntesis de una proteína.
CÉLULAS EUCARIOTAS

Plastídios y mitocondrias
Organelos que poseen su propio
material genético
CÉLULAS EUCARIOTAS
Mitocondrias
Centrales Energéticas de las células

.
CÉLULAS EUCARIOTAS
Mitocondrias
Centrales Energéticas de las células
 Organelos de forma tubular muy parecidos a las bacterias,
. hallados en todos los eucariotas
 Aprovechan la energía contenida en moléculas como la
glucosa y la transforman en energía útil (ATP) para realizar
el metabolismo celular.
 Están limitadas por dos membranas: una membrana externa
lisa y una interna con numerosas dobleces contiguas
llamadas crestas
 Las crestas dividen la mitocondria en dos compartimentos:
una matriz, situada dentro de la membrana interna, y un
compartimiento exterior, o espacio intermembranal, situado
entre las dos membranas mitocondriales.
CÉLULAS EUCARIOTAS
Mitocondrias
Centrales Energéticas de las células
 En la superficie de la
. membrana interna y dentro de
ella, están las proteínas que
llevan a cabo el metabolismo
oxidativo, el proceso que
requiere oxígeno por el cual la
energía de las macromoléculas
se almacena en forma de ATP.
 La cantidad de mitocondrías
es tejido-dependiente, pues
está asociado con la tasa
metabólica las respectivas
células.
CÉLULAS EUCARIOTAS
Cloroplastos
Donde la fotosíntesis toma lugar

.
CÉLULAS EUCARIOTAS
Cloroplastos
Donde la fotosíntesis toma lugar
 Organelo en que se lleva a cabo la fotosíntesis.
 Poseen un pigmento denominado clorofila,
.
 Presentes en los productores
 Al igual que las mitocondrías están formados por una doble
membrana y poseen su propio material genético.
 Poseen un compartimiento interno de membranas agrupadas,
llamadas granas.
 Cada grana esta formada por pequeños discos llamados
tilacoides
 Alrededor de cada tilacoide se encuentran los pigmentos
fotosintéticos
 Alrededor de los tilacoides hay una matriz fluida llamada
estroma
CÉLULAS EUCARIOTAS
Lisosomas
Centros de digestión intracelular

Leucoplastos y
Amiloplastos
CÉLULAS EUCARIOTAS
Organelos celulares especiales de células
vegetales
Vacuolas
• Son vesículas grandes, rodeadas por
membrana, que pueden llegar a ocupar
el 90% del volumen celular.
• Su función es almacenar agua y
sustancias en solución, lo que permite
regular la presión osmótica.
• Pueden almacenar otras macromoléculas
y reciben nombre diferentes
CÉLULAS EUCARIOTAS
Organelos celulares especiales de células vegetales
Pared celular

• Las células vegetales se encuentran


rodeadas por una pared rígida formada
por fibrillas de celulosa, esta recibe el
nombre de pared celular.
• Su función es dar sostén y proteger la
célula.
CÉLULAS EUCARIOTAS
Centriolos
CÉLULAS EUCARIOTAS
Centriolos
CÉLULAS EUCARIOTAS
Centriolos

 Los centriolos son orgánulos en forma de


barril que se encuentran en las células de los
animales y la mayoría de los protistas.
 Se presentan en pares, cerca de la membrana
nuclear
 La región que rodea el par en casi todas las
células animales se conoce como un
centrosoma.
CÉLULAS EUCARIOTAS
Centriolos

 Ayudan a ensamblar los microtúbulos, largos cilindros


huecos de la proteína tubulina.
 Los microtubulos influencian la forma celular,
movimiento de los cromosomas en la división celular, y
proporcionar la estructura interna funcional de los
cilios y flagelos.
 Los centriolos pueden estar contenidos en áreas
llamadas centros organizadores de microtúbulos
(COMT).
 Las células de plantas y hongos carecen de centriolos.
CÉLULAS EUCARIOTAS
Citoesqueleto
El citoplasma de
todas las células
eucariotas está
atravesada por una
red de fibras de
proteína que son
compatibles con la
forma de los
organelos celulares
y anclajes a
ubicaciones fijas,
esta red es llamada
citoesqueleto
CÉLULAS EUCARIOTAS
Citoesqueleto
CÉLULAS EUCARIOTAS
Citoesqueleto
El citoesqueleto está formado por tres tipos de filamentos: filamentos de
actina , microtúbulos y filamentos intermedios.

Filamentos de actina: Están formados por dos péptidos unidos llamados


filamentos de actina. El diámetro promedio de los filamentos es
aproximadamente 7 nm. Sus funciones son movimiento y formación de
extensiones celulares.
CÉLULAS EUCARIOTAS
Citoesqueleto
El citoesqueleto está formado por tres tipos de filamentos: filamentos de
actina , microtúbulos y filamentos intermedios.

Filamentos intermedios : Es el elemento más duradero entre los diferentes


filamentos. Los filamentos tienen un tamaño intermedio (8 – 10 nm), están
formados por subunidades proteícas: Vimemtina y Queratina, dependiendo
del tipo de célula.
CÉLULAS EUCARIOTAS
Citoesqueleto
El citoesqueleto está formado por tres tipos de filamentos: filamentos de
actina , microtúbulos y filamentos intermedios.

Microtúbulos: Están formados por dos subunidades péptidicas de alfa y


beta tubulina. Estos dímeros forman los microtúbulos. Los microtúbulos
tienen una diámetro promedio de 25 nm. Sus funciones son movimiento
intracelular y repartición del material genético durante la división celular
DIFERENCIAS CÉLULAS
VEGETALES Y ANIMALES
ENDOSIMBIOSIS
La adquisición de las
mitocondrias se produjo cuando
una célula protoeucariota
(eucariota en formación)
fagocitó una bacteria que
empleaba oxígeno para respirar.

Simbiosis
Andreas Schimper
Células eucariotas
SIMBIOGÉNESIS
Primera incorporación:
Una bacteria nadadora similar a
una espiroqueta se incorpora
por simbiosis al interior de una
arqueobacteria termocidófila y
dio como resultado la primera
célula eucariota ciliada y
flagelada, cuyo ADN quedaría
LYNN MARGULIS en un núcleo interno separado
del citoplasma por la membrana
SIMBIOGÉNESIS
Primera incorporación:

LYNN MARGULIS
SIMBIOGÉNESIS
Segunda incorporación:
Esta vez el nuevo endosimbionte sería
una célula de respiración aerobia
(utiliza oxígeno). Este se convertiría
en las mitocondrias de las células
eucariotas. Esta incorporación
facilitaría la vida en ambientes ricos
en oxigeno como lo es la biosfera.
Esto daría como resultado la
LYNN MARGULIS
formación de células animales y los
hongos.
SIMBIOGÉNESIS
Segunda incorporación:

LYNN MARGULIS
SIMBIOGÉNESIS
Segunda incorporación:
El ultimo organismo en
incorporarse sería una forma
ancestral de las
cianobacterias(bacterias que
realizan fotosíntesis) y estas
darían origen a las actuales células
vegetales.
LYNN MARGULIS
SIMBIOGÉNESIS
Segunda incorporación:

LYNN MARGULIS
SIMBIOGÉNESIS
Membrana celular y procesos
de transporte
• La membrana celular separa la célula de
todo lo que lo rodea.
• Las membranas internas delimitan
funciones de las células.
• Estas membranas funcionan como
barreras selectivas entre el interior de
la célula y su entorno, esto quiere decir
que todas las moléculas pasan a través
de la membrana, fenómeno llamado
permeabilidad.
Membrana celular y procesos
de transporte
Selectivamente
permeable:
permite el paso de
ciertos iones y
moléculas
impidiendo el paso
de otros.
Membrana celular y procesos
de transporte
Polar

No polar

Polar

La membrana celular no solo está


compuesta por fosfolípidos,
también, por proteínas y
carbohidratos.

Los fosfolípidos y las proteínas


no mantienen la misma posición
en la membrana celular, son
cambiantes, es decir, la
membrana es fluida.
Membrana celular y procesos
de transporte
Modelo mosaico fluido
 La membrana está compuesta por una
bicapa lipídica
 Las proteínas están embebidas en la
membrana celular
 Las membranas celulares están
soportadas por una red de fibras.
 La membrana está revestida por
marcadores de identidad celular
Membrana celular y procesos
de transporte
Componentes de la membrana celular
Bicapa lipídica: Cada membrana celular se compone de dos
capas de fosfolípidos. Los otros componentes de la membrana
están inmersos dentro de la bicapa, que proporciona una matriz
flexible y, al mismo equipo, impone una barrera de
permeabilidad.
Membrana celular y procesos
de transporte
Componentes de la membrana celular
Proteínas transmembrana. El componente principal de cada
membrana es una colección de proteínas que están
incrustadas en la bicapa lipídica. Estas proteínas proporcionan
pasadizos que le permiten a las sustancias cruzar la
membrana.
Membrana celular y procesos
de transporte
Componentes de la membrana celular
Proteínas externas y glicolípidos: Las células exhiben proteínas y
glicolípidos que son exportadas por el aparato de Golgi a la
membrana celular. Este recubrimientos de azúcares se denomina
Glicocalix. Las células de diferentes organismos exhiben diferentes
Glicocalix, los cuales actúan los marcadores de identidad celular.
Membrana celular y procesos
de transporte
Clases de proteínas de membrana
Membrana celular y procesos
de transporte
Clases de proteínas de membrana
Transportadoras: permiten la Marcadores de superficie:
entrada o salida de sustancias Proteínas unidas a carbohidratos
de la célula, actúan como que diferencian a unas células de
canales. otras.
Enzimas: Llevan a cabo muchas Adhesión celular: proteínas
reacciones químicas en la específicas para formar
superficie interna de la interacciones entre las
membrana plasmática. membranas de células adyacentes.
Receptores: reconocen Anclaje a citoesqueleto:
mensajes químicos externos y Proteínas de la superficie celular
producen cambios a nivel que interactúan con el
intracelular citoesqueleto
Membrana celular y procesos
de transporte
Mecanismos de transporte

Nutrientes Desechos
Membrana celular y procesos
de transporte
Mecanismos de transporte

Transporte pasivo Transporte activo


Transporte pasivo
Consiste en el movimiento aleatorio de las moléculas a
través de los espacios de la membrana o en
combinación con proteínas transportadoras, durante
el cual no hay gasto de energía (ATP), debido a que
estas moléculas se mueven a favor del gradiente de
concentración o a favor del gradiente electroquímico,
es decir, de mayor a menor concentración o de
mayor a menor carga eléctrica.
Transporte pasivo
Transporte pasivo

Osmosis Difusión

Simple Facilitada
OSMOSIS
Es un caso especial de difusión simple por el cual se
transportan moléculas de agua, a través de una
membrana, desde una zona de menor concentración de
solutos a otra de mayor concentración. De esta manera
se genera una distribución diferente de los volúmenes de
agua a ambos lados de la membrana.
OSMOSIS
El agua atraviesa la membrana mediante proteínas
transmembrana, llamadas genéricamente acuaporinas, por
donde el agua ingresa o sale de la célula. Sin embargo,
debido a que la molécula de agua es polar y de pequeño
tamaño, este movimiento se realiza también mediante los
espacios que quedan entre los fosfolípidos de la bicapa
producto de su movimiento y el de las proteínas.
OSMOSIS
Presión hidrostática: La presión que ejerce el
citoplasma contra la membrana celular, o presión
hidrostática, aumentaría.
Presión osmótica: La presión que debe aplicarse para
detener el movimiento osmótico del agua a través de una
membrana.
OSMOSIS
Solución isotónica: la concentración de solutos está en equilibrio
con el interior de la célula.
Solución hipotónica: presenta menor concentración de solutos que
el interior de la célula.
Solución hipertónica: es aquella que presenta mayor concentración
de solutos que el interior de la célula.
Turgencia y Plasmólisis
Turgencia se le conoce al estado de
rigidez de una célula. Es el fenómeno
por el cual las células al absorber agua, se
hinchan, ejerciendo presión contra las
membranas celulares, las cuales se ponen
tensas.
Plasmólisis fenómeno contrario a las
turgencia, las células al perder aguar se
contraen separándose de la pared celular
DIFUSIÓN
Es el movimiento de moléculas o iones de una
región de alta concentración a una región de
baja concentración.
Las moléculas se mueven en línea recta en
una dirección aleatoria.
La difusión suele ocurrir hasta que la
concentración es la misma en todo el
ambiente, es decir, se alcanza el equilibrio.
DIFUSIÓN SIMPLE
Algunas moléculas pequeñas y sin carga eléctrica
atraviesan la bicapa lipídica a favor del gradiente
de concentración. Por ejemplo, O2, N2, CO2,
alcohol (etanol), urea, entre otras. Este tipo de
transporte se le denomina, difusión simple y no
implica el uso proteínas transportadoras.
DIFUSIÓN FACILITADA
Las moléculas que no pueden atravesar directa y
libremente la bicapa lipídica, a pesar de que su
gradiente de concentración es favorable, son
transportadas a través de proteínas
transmembrana.
Gracias a este proceso, moléculas hidrofílicas,
iones, aminoácidos, glucosa, entre muchas otras,
traspasan la membrana plasmática de un lado a
otro.
DIFUSIÓN FACILITADA
Canales iónicos
Canales iónicos
Están constituidos por proteínas que
forman canales o poros a través de las
bicapas lipídicas y por ellas se transportan
iones, como el cloruro (Cl-), Calcio(Ca++),
entre otros.
Los canales iónicos no son orificios en la
membrana plasmática, son proteínas que
modifican su permeabilidad.
Transportadores.
Transportadores.
Proteínas que se encargan del transporte
de moléculas más grandes. Para poder
llevar a cabo el transporte, estas
proteínas experimentan un cambio
conformacional, es decir, la proteína
cambia su forma. Esta modificación de su
estructura hace que la velocidad de
transporte sea menor al del canal iónico.
Transportadores.
Estas proteínas facilitan el movimiento de
solutos a través de la membrana uniéndose
físicamente a ellos en un lado de la membrana y
liberándolos por el otro.
La dirección del movimiento neto del soluto
depende de su gradiente de concentración a
través de la membrana.
Si el Concentración es mayor en el citoplasma,
es más probable que se unan al transportador en
el lado citoplasmático de la membrana y se
liberan en el lado extracelular.
Transporte pasivo
Transporte activo
Proceso en el cual el transporte de iones y
moléculas a través de la membrana
semipermeable se efectúa en contra de un
gradiente de concentración con gasto de
energía.
Transporte activo
Endocitosis y
Exocitosis
Mecanismos mediante los cuales se
transportan materiales del medio exterior
al interior de la célula (endocitosis) y del
interior al exterior celular (exocitosis) sin
atravesar la membrana y con cierto gasto
de energía.
Transporte activo
ENDOCITOSIS

FAGOCITOSIS PINOCITOSIS

ENDOCITOSIS
MEDIADA POR
RECEPTOR

Vesícula pinocitica
Transporte activo
ENDOCITOSIS

FAGOCITOSIS

Proceso mediante el cual la célula engloba


material sólido( restos orgánicos,
bacterias o parásitos) que incorpora a su
citoplasma. Ej: Ameba
Transporte activo
ENDOCITOSIS

PINOCITOSIS

La pinocitosis es un tipo de endocitosis que


consiste en la captación de material del espacio
extracelular por invaginación de la membrana
citoplasmática con desprendimiento hacia el
interior celular de una vesícula que contiene líquido
con posibles moléculas disueltas o partículas sólidas
en suspensión.
Transporte activo
ENDOCITOSIS
ENDOCITOSIS
MEDIADA POR
RECEPTOR
Receptor: Proteínas o
glicoproteínas que se
encuentran frecuentemente
unidas a la membrana
celular y que pueden
reconocer moléculas de
diferente carácter químico
(ligando)

Ligando: Molécula que puede


ser reconocida y formar enlaces
estables con el receptor
Transporte activo
ENDOCITOSIS
ENDOCITOSIS
MEDIADA POR
RECEPTOR
Es la captación de macromoléculas por la célula basada en la
formación de complejo Receptor - Ligando en vesículas
recubiertas.
Las macromoléculas se unen a receptores de la superficie de la
célula y se acumulan en fosas recubiertas de Clatrina.
Estas invaginaciones se desprenden de las membranas bajo la
forma de vesículas que contienen los complejos Receptor -
Ligando.
El colesterol es un ejemplo de sustancias que son transportadas
hasta la célula por endocitosis mediada por Receptor
Transporte activo
EXOCITOSIS

Es el proceso contrario a la endocitosis, consiste en el movimiento


de moléculas del interior de la célula hacia el exterior.
Esto se lleva en cabo en pequeñas estructuras membranosas que
se forman en el aparato de Golgi, las que al fusionarse con la
membrana plasmática de la célula originan un orificio que permite
liberar la sustancia al medio extracelular.
División celular

 Los procesos de nutrición y excreción celular ocurren a través de la


membrana.
 A mayor volumen, mayor necesidad de nutrientes.
 El tamaño de la membrana determina la cantidad de nutrientes que la
célula puede tomar del medio
 Cuando una estructura tridimensional se agranda su área de superficie
aumenta en una menor proporción que su volumen.
 Las células deben dividirse para aumentar la relación de volumen-
superficie celular.
División celular

8
DIVISIÓN CELULAR

FISIÓN BINARIA O
GEMACIÓN
BIPARTICIÓN

ESPORULACIÓN

MITOSIS MEIOSIS
DIVISIÓN CELULAR
FISIÓN BINARIA O BIPARTICIÓN

La fisión binaria es una forma de reproducción asexual que por lo general se da en


organismo unicelulares como las bacterias.

Este tipo de reproducción consiste e inicia cuando la célula se alarga y más tarde
se presenta una fragmentación en el centro y el material genético se va alargando.

Después dela fragmentación la célula se divide totalmente formando así dos


células nuevas que tienen las mismas características que la original.
DIVISIÓN CELULAR
FISIÓN BINARIA O BIPARTICIÓN

1. La replicación de la molécula de ADN dentro de la célula.


DIVISIÓN CELULAR
FISIÓN BINARIA O BIPARTICIÓN

2. ADN replicado se mueve a cualquiera de los polos de la célula y la célula se


alarga.
3. La placa ecuatorial de la célula se contrae y separa la membrana plasmática
por lo que cada nueva célula tiene exactamente el mismo material genético.
DIVISIÓN CELULAR
FISIÓN BINARIA O BIPARTICIÓN

4. Citocinesis: separación física del citoplasma de dos células hijas durante la


división celular
DIVISIÓN CELULAR
GEMACIÓN
DIVISIÓN CELULAR
CÉLULAS EUCARIOTAS

GEMACIÓN

Es un tipo de reproducción asexual directa que se da en organismos


unicelulares como en los ascomicetos que son un tipo de hongos.

El proceso comienza cuando sus células van formando una protuberancia


llamada yema o gema, simultáneamente su material genético se duplica y
posteriormente el núcleo se direcciona hacia la protuberancia e
ingresando a la yema.

Con el tiempo se profundiza la protuberancia y se da una fragmentación


por la cual se separa la célula hija de la célula madre con la misma
información genética pero diferente tamaño .
DIVISIÓN CELULAR
CÉLULAS EUCARIOTAS

ESPORULACIÓN
DIVISIÓN CELULAR
CÉLULAS EUCARIOTAS

ESPORULACIÓN

Este proceso de reproducción consiste en la división del núcleo en

diferentes partes ,las cuales se rodean por el citoplasma y de esta

forma se produce la conformación de esporas. Este es un proceso de

diferenciación celular con el fin de la generación de esporas y su

expulsión al ambiente ,este tipo de reproducción se produce en hongos

,amebas , líquenes ,casos específicos de bacterias ,protozoos

esporofitos y frecuentemente en vegetales.


DIVISIÓN CELULAR
CÉLULAS EUCARIOTAS

ESPORULACIÓN
1. La duplicación del material genético por medio de la meiosis es el primer paso de dicho

proceso de esporulación .

2. Seguido del inicio de la formación del septo de la espora y el inicio del aislamiento del

material genético recién replicado a una pequeña porción de citoplasma .

3. La membrana plasmática empieza a rodear al material genético ,citoplasma y membrana

aislada anteriormente en el paso 2 .

4. El septo de la espora rodea la porción aislada formándose la forespora .

5. Se conforma una capa compuesta de peptidoglicano entre las membranas .

6. Las espora se recubre de una cubierta de resistencia .

7. Liberación de la endospora al medio .


Reproducción celular
Todos los organismos vivos utilizan la división
celular, bien como mecanismo de reproducción, o
como mecanismo de crecimiento del individuo
Reproducción celular
CICLO CELULAR

El ciclo
celular es un
conjunto
ordenado de
sucesos que
conducen al
crecimiento
de la célula y
la división en
células hijas
Reproducción celular
ORGANIZACIÓN DEL
GENOMA
Reproducción celular
ORGANIZACIÓN DEL
GENOMA
Reproducción celular
ORGANIZACIÓN DEL
GENOMA
Conceptos
Cromatina: El complejo de ADN y
proteínas de las que se componen los
cromosomas eucariotas.
Cromosoma: Estructura más condensada
del ADN presente en eucariotas
Cromátide: Una de las dos copias de un
cromosoma replicado, unida por un
centrómero único a la otra hebra.
Conceptos
Centrómero: Región estrecha del ADN
compuesta secuencias de ADN repetidas, útiles
para la estabilidad de los cromosomas y
garantizar la migración de los cromosomas
durante la división celular. Alli se forma el
cinetotoco
Cinetocoro: Disco de proteínas unidos al
centrómero y unido a los microtúbulos durante
la mitosis, uniendo cada cromátide del huso
acromático.
Diploide: Organismos que poseen dos juegos de
cromosomas en cada una de células somáticas
Reproducción celular
INTERFASE

Fase G1.
Es una fase que se
caracteriza por ser
genéticamente activa:
1. el ADN se transcribe y se
traduce, dando lugar a
proteínas necesarias para
la vida celular y
sintetizando las enzimas
y la maquinaria necesaria
para la síntesis del ADN.
2. Se aumenta el número de
organelos
3. La célula aumenta en
tamaño
Reproducción celular
INTERFASE

Fase S
Es la fase en la cual se duplica
por entero el material
hereditario(ADN).
El cromosoma pasa de tener una
cromatide a tener dos, cada una
de ellas compuesta por una
doble hélice de ADN producto
de la duplicación de la original,
las dos dobles hélices hijas
serán exactamente iguales, y
por tanto las cromatides
hermanos, genéticamente
idénticos.
Reproducción celular
INTERFASE

Fase G2
Durante este período se
ultima la preparación de
todos los componentes
de la división celular.
Hay aumento en el
número de organelos
El material genético se
condensa y cesa la
producción de proteínas.
Reproducción celular
FASE M O MITOSIS

Mitosis

Citocinesis
Reproducción celular
FASE M O MITOSIS

Mitosis
Proceso que forma
parte del ciclo
celular en el cual,
los cromosomas en
el núcleo de la
célula son
separados en dos
conjuntos identicos
con su respectiva
envoltura nuclear
Final de
fase G2
Reproducción celular
FASE M O MITOSIS

1. Profase 2, Prometafase 3. Metafase


4. Anafase 5. Telofase
Profase
Profase

Aster
Reproducción celular
FASE M O MITOSIS

PROFASE
• Cromatina comienza condensarse y se observan los
cromosomas ( no están bien definidos)
• los centriolos migran a los polos de las células
• Los microtúbulos se extienden desde los centriolos hasta la
membrana celular y formar el Aster, cuya función es fijar los
centriolos a la membrana celular y facilitar la separación de lo
cromosomas
• La envoltura nuclear comienza a romperse y sus partes son
absorbidos por el RE.
• Las células vegetales no poseen centriolos, sin embargos,
forman el huso acromático, pero no forman Aster
Prometafase
Reproducción celular
FASE M O MITOSIS

PROMETAFASE
• La membrana nuclear ha desaparecido y los
cromosomas se encuentran dispersos en el
citoplasma
• Los centriolos que se encuentran en los polos
comienzan a formar fibras de microtúbulos
que darán origen al huso acromático
• Cada cromosoma posee dos cinetocoros a los
cuales se unirán las fibras de microtúbulos
Metafase
Reproducción celular
FASE M O MITOSIS

METAFASE
• Las fibras de microtúbulos se han unido al
cinetocoro de cada una de las cromátides
• Los cromosomas se alinean en el centro de la
célula
• La ubicación de los cromosomas en esta fase,
se le conoce como placa matefásica
• Los cromosomas quedan equidistantes de cada
uno de los polos
• Formación de huso acromático
Anafase
Reproducción celular
FASE M O MITOSIS

ANAFASE
• Comienza cuando los centrómeros se dividen en dos,
cada uno con una cromátide hermana
• Los cromosomas comienzan a migrar a los polos
• Los cromosomas se separan con ayuda del Aster.
• Los centrómeros se mueven hacia los polos a medida
que los microtúbulos que los conectan a los polos se
acortan. Este proceso de acortamiento no es una
contracción pues los microtúbulos no se ponen más
gruesos, sino que las subunidades de tubulina se
eliminan
Telofase
Reproducción celular
FASE M O MITOSIS

TELOFASE
El huso acromático desaparece, y los
monómeros de tubulina son usados para
formar el citoesqueleto.
Se forma una envoltura nuclear alrededor
que cada uno de los grupos de cromosomas
Los cromosomas comienzan a
descondensarse y comienza a activarse la
expresión génica
Citocinesis
Reproducción celular
FASE M O MITOSIS

CITOCINESIS
En las células animales, la
citocinesis es contráctil,
pellizcando la célula en dos
como un monedero con un
cordón. El "cordón" es una
banda de filamentos hechos
de una proteína llamada
actina, y el pliegue de
pellizco se conoce como el
surco de división.
Reproducción celular
FASE M O MITOSIS

CITOCINESIS
La rígida pared celular no puede ser pellizcada
como en las células vegetales.
Aparato de Golgi envía vesículas que llevan los
compuestos necesarios para la formación de la
pared celular
Aparece la placa celular en el centro de la célula
La pared celular llena espacios, diviendo la célula
en dos.
Duración de la mitósis

5 a 12
horas
Humanos
Dos juegos de cromosomas(se agrupan en pares)

2(n)Diploides

23 pares de cromosomas (célula sin duplicar su


material genético)

Cada par de cromosomas recibe el nombre


cromosomas homólogos
Un juego más de
Todas las células de los cromosomas se
humanos son diploides considera anomalía
genética

Cigoto

2n 2n 4n
Si esto sucediera, cada vez que se unieran dos células sexuales tendríamos
más cromosomas, lo cual, constituiría un anomalía genética.
¿ como deben estar constituidas las células para que el número 2n se
mantenga de generación en generación?
Un juego más de
Todas las células de los cromosomas se
humanos son diploides considera anomalía
genética

Cigoto

n n 2n
Durante la mitosis las células
que se producen son idénticas a
la células madre, es decir, todas
las células son 2n.

Meiosis
Meiosis
La meiosis es un mecanismo de división celular que permite la obtención a
partir de células diploides (2n) de células haploides (n) con diferentes
combinaciones de genes.

La meiosis es un proceso de división presente en las células germinales que


genera gametos femeninos y masculinos (haploides) a partir de células
diploides (2n), que experimentarán dos divisiones celulares sucesivas con la
finalidad de generar cuatro células haploides (1n).
Meiosis
OBJETIVOS
Reducción del número de
cromosomas.
Establecer reestructuraciones en los
cromosomas homólogos mediante
intercambios de material genético.

LA MEIOSIS PODRÍAN SER DOS MITOSIS


JUNTAS
Meiosis

MEIOSIS I MEIOSIS II

Interfase I Interfase II(No hay


Profase I duplicación del ADN)
Metafase I Profase II
Anafase I Metafase II
Telofase I Anafase II
Telofase II
Meiosis
MEIOSIS I

Interfase I
Meiosis
MEIOSIS I

Profase I
En esta fase suceden los acontecimientos más
característicos de la meiosis. La envoltura nuclear se
conserva hasta el final de la fase que es cuando se
desintegra, al mismo tiempo desaparece el nucléolo y se
forma el huso.
Dada su duración y
complejidad se subdivide
en cinco etapas:
leptoteno, zigoteno,
paquiteno, diploteno y
diacinesis.
Meiosis
MEIOSIS I

Profase I
Leptoteno.
Los cromosomas aparecen
como largos filamentos que de
trecho en trecho presentan
unos gránulos: los cromómeros.
Cada cromosoma ya está
constituido por dos
cromátidas, pero aún no se
observan bien diferenciadas al
microscopio óptico, y se
encuentran unidos en diversos
puntos a la envoltura nuclear.
Meiosis
MEIOSIS I

Profase I
Zigoteno:
En esta etapa los cromosomas
homólogos se aparean punto por
punto en toda su longitud. Este
apareamiento puede comenzar
bien por el centro o por los
extremos y continuar a todo lo
largo. Cuando los homólogos se
aparean cada gen queda
yuxtapuesto con su homólogo.
Meiosis
MEIOSIS I

Profase I Paquiteno
Los pares de cromosomas homólogos aparecen
íntimamente unidos: bivalentes. Se puede ya
observar que cada cromosoma tiene sus dos
cromátidas.
Mientras están estrechamente unidos tienen
lugar roturas entre cromátidas próximas de
cromosomas homólogos que intercambian
material cromosómico. Este intercambio se
llama entrecruzamiento o sobrecruzamiento
(crossing-over) y supone una redistribución
cromosómica del material genético. Aunque los
sobrecruzamientos se producen en esta fase
no aún visibles y se apreciarán más tarde en
forma de quiasmas.
Meiosis
MEIOSIS I

Profase I
Diploteno
Los bivalentes inician su separación,
aunque se mantienen unidos por los
puntos donde tuvo lugar el
sobrecruzamiento, estas uniones
reciben ahora el nombre de quiasmas y
permiten ver los puntos en los que hubo
sobrecruzamientos. En cada par de
cromosomas homólogos pueden persistir
uno o varios quiasmas, todo depende de
cuántos sobrecruzamientos hayan
tenido lugar a lo largo del bivalente.
Meiosis
MEIOSIS I

Profase I

Diacinesis
Las cromátidas aparecen muy
condensadas preparándose para la
metafase. La separación entre
bivalentes persiste y permanecen los
quiasmas.
Al final de la profase la envoltura
nuclear ha desaparecido totalmente y
ya se ha formado el huso acromático.
Meiosis
MEIOSIS I

Metafase I
Los bivalentes se disponen sobre el ecuador del huso, pero
lo hacen de tal forma que los dos cinetocoros que tiene
cada homólogo se orientan hacia el mismo polo, que es el
opuesto hacia el que se orientan los dos cinetocoros del
otro homólogo.
Meiosis
MEIOSIS I

Anafase I
 Los cromosomas sólo presentan un centrómero para las dos
cromátidas. Debido a esto, se separan a polos opuesto cromosomas
completos con sus dos cromátidas.
 No se separan 2n cromátidas, sino n cromosomas dobles.
 Esta disyunción o separación de los cromosomas da lugar a una
reducción cromosómica.
 Como consecuencia, desaparecen los quiasmas.

La distribución al azar de los cromosomas es una de las fuentes de


variabilidad, ya que pueden producirse como consecuencia de este
proceso una gran cantidad de gametos (2n siendo n el número haploide).
Meiosis
MEIOSIS I

Anafase I

La distribución al azar de los cromosomas es una de las fuentes de


variabilidad, ya que pueden producirse como consecuencia de este
proceso una gran cantidad de gametos (2n siendo n el número haploide).
Meiosis
MEIOSIS I

Telofase I
Es una telofase normal pero que da lugar a dos células hijas
cuyos núcleos tienen cada uno n cromosomas con dos
cromátidas
Meiosis
MEIOSIS II

INTERFASE II
Puede ser variable en su duración, incluso puede
faltar por completo de manera que tras la
telofase I se inicia sin interrupción la segunda
división. En cualquier caso, nunca hay síntesis de
ADN; es decir, es una interfase sin periodo S.
Meiosis
MEIOSIS II

Es una mitosis normal en la que las dos células


anteriores separan en la anafase II las
cromátidas de sus n cromosomas. Surgen así 4
células con n cromátidas cada una.
GENÉTICA
Es la ciencia que estudia la herencia biológica, es decir,
la transmisión de caracteres morfológicos y fisiológicos
de un individuo a su descendencia.

1. Gen
2. Alelo
3. Cromosoma
4. Haploidia y Diploidia
5. Leyes de Mendel
6. Cruces
7. Proporciones
Genética
Herencia

Genes: Secuencias de ADN que


codifican para proteínas

Locus: Ubicación de un gen en un


Alelos: Diferentes variantes de un gen
cromosoma
Genética

GATTTAAGGCGTAGTAGCTAGATAG GATTTAGGGCGTAGTAGCTAGATAG

Gen Gen
Genética
Herencia
DOBLE HÉLICE A
CROMOSOMAS
SECUENCIA DE ADN

DOBLE HÉLICE

CROMATINA

CROMOSOSMAS
DOBLE HÉLICE A
CROMOSOMAS
DOBLE HÉLICE A
CROMOSOMAS
DOBLE HÉLICE A
CROMOSOMAS
La unión del ADN por las histonas genera
una estructura llamada nucleosoma.
DOBLE HÉLICE A
CROMOSOMAS
Los nucleosomas, que en este punto se asemejan a los
perlas de un collar, se compactan más en forma
helicoidal a través de las interacciones de los extremos
NH2 de las histonas octaméricas, y forman una
estructura llamada solenoide(segundo grado de
compactación del ADN.
DOBLE HÉLICE A
CROMOSOMAS
Asas: tercer grado de compactación del ADN,
se conoce también como cromatina extendida, es
una estructura de 200 - 300 nm y corresponde
al enrrollamiento de los selonoides
DOBLE HÉLICE A
CROMOSOMAS
Cromatina extendida o Roseta : Cuarto grado
de compactación ADN, se produce por el
enrrollamiento de la fibra de 200 - 300 nm
sobre sí misma y corresponde a 6 asas. Esta
estructura tiene un diámetro de 700 nm
DOBLE HÉLICE A
CROMOSOMAS
Cromatina condensada: corresponde al
superenrollamiento de 30 rocetas, es el último
grado de compactación del ADN corresponde al
cromosoma metafasico con sus dos cromatides
es una estructura de 1400 nm
Los humanos tenemos 2n (diploides)

Existen dos cromosomas muy parecidos, por


no decir idénticos, llamados cromosomas
homólogos.

Por cada cromosoma al menos un gen( tenemos


al menos dos genes en cada célula)

¿ cuantos alelos podemos tener en una célula?


HOMOCIGOCIDAD Y
HETEROCIGOCIDAD
Los individuos diploides poseen en sus
células dos juegos de cromosomas, uno
aportado por el gameto masculino y el otro
por el gameto femenino.
Dado que los genes residen en los
cromosomas, resulta evidente que para
cada carácter el individuo tendrá dos
genes.
HOMOCIGOCIDAD Y
HETEROCIGOCIDAD
Si en ambos cromosomas homólogos reside el
mismo alelo diremos que el individuo es
homocigótico para ese carácter.
Si en cada cromosoma hay un alelo distinto, el
individuo será heterocigótico para ese carácter.
DOMINANCIA Y RECESIVIDAD
Ocurre que algunos alelos se manifiestan siempre,
aunque el individuo posea otro alelo que determine
la característica opuesta, en este caso se dice que
es un alelo dominante.

Nomenclatura alélica
Se utiliza mayúscula para el dominante y minúscula para el recesivo
DOMINANCIA Y RECESIVIDAD
GENOTIPO Y FENOTIPO
GENOTIPO Y FENOTIPO
LA INFORMACIÓN GENÉTICA
QUE CONTIENE CADA Al conjunto de genes que informan sobre
ORGANISMO CONSTITUYE las características de un ser vivo se le
SU GENOTIPO, EN GENOTIPO denomina genotipo
NO ES OBSERVABLE.

Al conjunto de caracteres observables en un organismo se le llama


fenotipo.
Los rasgos visibles diferencian a un individuo de otros e incluso de
sus parientes más cercanos.
GENOTIPO Y FENOTIPO
CODOMINANCIA
Cuando en un heterocigoto el fenotipo no corresponde a ninguno
de los alelos sino que es una mezcla de ambos, se dice que los
alelos son codominantes

AMBOS ALELOS SE EXPRESAN, EL FENOTIPO RESULTANTE ES


UN FENOTIPO INTERMEDIO
HERENCIA MENDELIANA

¿QUIEN FUE GREGOR


JOHANN MENDEL?
HISTORIA Y
APORTES A LA
CIENCIA
1ra Ley de Mendel
Ley de la uniformidad
Los dos miembros de un par génico(alelos)
se separan durante la meiosis y cada uno
pasa a un gameto diferente.

Todos los organismos tienen un par de


factores determinantes de una
característica dada(alelos) que se separan
o se segregan en gametos.
1ra Ley de Mendel
Ley de la uniformidad
1ra Ley de Mendel
Ley de la uniformidad
Cuando se cruzan dos razas puras
(homocigóticas) de una misma especie, la
generación híbrida resultante (F1) es uniforme,
esto es, todos sus individuos son iguales
genotípica y fenotípicamente.
1ra Ley de Mendel
Ley de la uniformidad

 Material: Pisum sativum (guisante).


 Los guisantes eran baratos y fáciles de obtener en el mercado.
 Ocupaban poco espacio y tenían un tiempo de generación relativamente corto.
 Producían muchos descendientes.
 Existían variedades diferentes que mostraban distinto, color, forma, tamaño,
etc. Por tanto, presentaba Variabilidad Genética.
 Es una especie Autógama, se autopoliniza, de manera que el polen de las anteras
de una flor cae sobre el estigma de la misma flor.
 Era fácil realizar cruzamientos entre distintas variedades a voluntad.
 Es posible evitar o prevenir la autopolinización castrando las flores de una
planta (eliminando las anteras).
1ra Ley de Mendel
Ley de la uniformidad

Cruces de líneas
puras durante 34
generaciones, para
observar si se
mantenía la
característica.
1ra Ley de Mendel
Ley de la uniformidad
Cruce de prueba
Cruzamiento de un individuo que manifiesta el
fenotipo dominante con un homocigoto recesivo
para distinguir (dependiendo de las proporciones
fenotípicas en la descendencia) si se trata de una
raza pura o de un híbrido.
Ejercicio 1
Se realizó el cruce de una planta cuyas
semillas son verdes (alelo verde recesivo)
y una planta cuyas semillas son grises
(alelo gris dominante), la generación F1
serán todas verdes?.
1ra Ley de Mendel
Ley de la uniformidad

AA aa

A A a a
1ra Ley de Mendel
Ley de la uniformidad
a a

A Aa Aa

A Aa Aa

Fenotipo: Todas las plantas de generación F1 serán grises


Genotipo: todas plantan en la generación F1 serán heterocigotas
Ejercicio 2
Si una planta homocigótica de tallo alto
(AA) se cruza con una homocigótica de
tallo enano (aa),sabiendo que el tallo alto
es dominante sobre el tallo enano, ¿Cómo
serán los genotipos y fenotipos de la F1 y
de la F2?

aa AA
1ra Ley de Mendel
Ley de la uniformidad
a a

A Aa Aa
F1
A Aa Aa

Fenotipo: Todas las plantas de generación F1 serán de tallo alto


Genotipo: todas plantan en la generación F1 serán heterocigotas
Ejercicio 2

Aa Aa
1ra Ley de Mendel
Ley de la uniformidad
A a

A AA Aa
F2
a Aa aa

Fenotipo: Tres plantas serán de tallo alto altas y solo una será de
tallo bajo(proporción 3:1)
Genotipo: Una planta presenta es homocigota recesiva, una
homocigota dominante, y dos heterocigotas.
Proporciones

GENOTIPO PROPORCIÓN PORCENTAJE

AA 1/4 25%
Aa 2/4 50%
aa 1/4 25%

FENOTIPO PROPORCIÓN PORCENTAJE

TALLO ALTO 3/4 75%

TALLO BAJO 1/4 25%


Ejercicio 3
Al cruzar dos moscas negras se obtiene
una descendencia formada por 216 moscas
negras y 72 blancas.
Representando por NN el color negro y
por nn el color blanco, razónese el
cruzamiento y cuál será el genotipo de las
moscas que se cruzan y de la descendencia
obtenida
Las enfermedades
genéticas se derivan por
diferentes causas, las
cuales afectan a nuestro
estado emocional, físico y
psicológico