manipulating DNA

I. DNA polymerases
II. Endonuclease
III. Exonuclease
IV. Kinase and alkaline phosphatase
V. Ligase
VI. Topoisomerase
VII. Transcriptase
VIII. Transferase
Buffers are crucial for activity of enzymes!

Ideal biochemical buffers:

• pKa between 6 and 8

• Chemically inert
• Polar (soluble and not membrane permeable)
• Non-toxic
• Inexpensive
• Salt and temperature indifferent

Tris: pKa is 8.0

Tris(hydroxymethyl)aminomethane (THAM): the free base for (pH 7.5-8

Tris-HCl: the acidic form (for pH 7-8)
Tris is widely used, but it isn’t perfect:

• Buffering is weak below pH 7.5 and above pH 9.0

• pH must be measured using a special pH meter electrode
• Toxic to many types of mammalian cell cultures
• Tris solution pH changes with temperature! Drops 0.03 pH units for eac
• Tris solution pH changes with concentration! Example: 10mM Tris pH 7

• Below pH 7.5, use a “Good” buffer: HEPES, Tricine, BES, MOPS, MES
Enzyme “reaction buffers”:

• Buffer: Tris, HEPES, etc.

• Salt: NaCl, KCl, PO4-, etc.--stabilizes protein structure, facilitates pr
• Divalent metal ions: Mg2+, Ca2+, Zn2+, etc.--often required for enzy
• Glycerol: (for storage)--stabilizes protein structure
• EDTA: chelates (removes) divalent cations--important especially fo
• Beta mercaptoethanol or dithiothreitol: reducing agents that pre
• Non-specific protein: Bovine serum albumin (BSA)
• Other cofactors, eg. ATP, NADH
Enzyme
• Definition
– A protein that speeds up chemical reactions in the body.
– Any of a group of chemical substances which are produc

• How it works?
– Stabilize the transition state
– Lower the activation energy

• What can we do?

– Manipulation of nucleic acids (DNA, RNA)
ssification

• Enzymes that break DNA and RNA backbone bond

• Enzymes that mend DNA and RNA backbone bond
• Enzymes that synthesize new DNA and RNA backb

• Enzymes that add or remove phosphate at nucleic

• Enzymes and proteins that protect, coat, twist and u
Enzymes that break DNA and RNA backbone bonds
• Endonucleases
– Restriction enzymes : Three types
– Deoxyrebinucleases (DNase)
• DNase I and Mung Bean Nuclease
– Ribonucleases (RNase)
• RNase T1, U2, A, CL3, PhyM, B, H
• Exonucleases
– Exonuclease III
– Exonuclease VII
– Lambda Exonuclease
– T7 Gene 6 Exonuclease
– Venom phosphodiesterase
– Spleen phosphodiesterase
Endo- and Exonuclease
Nuclease Bal31
Neurospora Crassa Nuclease
Nuclease P1
Nuclease S1
ew DNA and RNA backbone bonds
• DNA Polymerase I
• Large fragment DNA polymerase I (Klenow fragment)
• T4 DNA polymerase
• Modified T7 DNA polymerase
• Taq DNA polymerase
• RNA polymerases polymerase
– Bacterial RNA polymerase
– Bacteriophage RNA polymerase (T3, T7, and SP6)
• Reverse transcriptase
• Poly(A) polymerase
• Terminal deoxynucleotidyl transferase
• Polynucleotide phosphorylase
transferase
e phosphate at nucleic acid termini

• T4 polynucleotide kinase
• Alkaline phosphatase
• Tobacco acid pyrophosphatase
protect, coat, twist and untwist DNA

• DNA methylase
• Single-stranded nucleic acid binding proteins
– RecA protein, SSB, Gene 32 protein
• Topoisomerases
Nucleases
6. Nucleases: DNase and RNase
Most of the time nucleases are evil when you are trying to preserve the integrity of
Many types differing in substrate specificity, cofactor requirements, and whether they cl
.
The most widely used nucleases are DNase I and RNase A
Deoxyribonuclease I cleaves double-stranded or single stranded DNA.
• Cleavage preferentially occurs adjacent to pyrimidine (C or T) residues
• an endonuclease.
• Major products are 5'-phosphorylated di, tri and tetranucleotides.
• In the presence of magnesium ions, DNase I hydrolyzes each strand of duplex DNA in
• In the presence of manganese ions, the enzyme cleaves both strands of DNA at appro
• DNase I does not cleave RNA
Some of the common applications of DNase I are:
• Eliminating DNA (e.g. plasmid) from preparations of RNA.
• Analyzing DNA-protein interactions via DNase footprinting.
• Nicking DNA prior to labeling by nick translation.
eases cont.

Ribonuclease A is an endoribonuclease that cleaves single-stranded R

• It degrades the RNA into 3'-phosphorylated mononucleotides and oligo

Some of the major use of RNase A are:

• Eliminating or reducing RNA contamination in preparations of plasmid

• Mapping mutations in DNA or RNA by mismatch cleavage. RNase will
Endonucleases

Also called restriction enzymes

1962: “molecular scissors” discovered in in bacteria

E. coli bacteria have an enzymatic immune system that recognizes and

3,000 enzymes have been identified, around 200 have unique propertie
Endonucleases

Named for bacterial genus, species, strain, and type

Example: EcoR1
Genus: Escherichia
Species: coli
Strain: R
Order discovered: 1
Endonucleases

Recognition sites have symmetry (palindromic)

“Able was I, ere, I saw Elba”

5’-GGATCC-3’
Bam H1 site:
3’-CCTAGG-5’
Endonucleases

Enzymes recognize specific 4-8 bp sequences

Some enzymes cut in a staggered fashion - “sticky ends”

EcoRI 5’…GAATTC…3’
3’…CTTAAG…5’

Some enzymes cut in a direct fashion – “blunt ends”

PvuII 5’…CAGCTG…3’
3’…GTCGAC…5’
ction enzyme

• Definition
• A degregative enzyme that recognizes and cuts up DNA at

• Three types
– Type I : random cleaving at unmethylated dsDNA 4000~7
– Type II : twofold symmetry in dsDNA
– Type III : specific pentameric or hexameric cognate seque
scovery

• Arbor and Dussoix in 1962 discovered that certain bacteria c

• In 1970 Smith and colleagues purified and characterized the
• Werner Arbor, Hamilton Smith and Daniel Nathans shared th
tion Endonucleases

• Restriction endonucleases, first discovered in the late 1960s

• These enzymes cut at sites within the foreign DNA instead o
• By cutting DNA at specific sites they function as finely honed
ogical Role

• Most bacteria use Restriction Enzymes as a defence agains

• Restriction enzymes prevent the replication of the phage by
• The host DNA is protected by Methylases which add methyl
al Role of RE

• Restriction Modification System -restriction enzymes are paired with m

• Methylases are enzymes that add methyl groups to specific nucleotide

• Therefore, the restriction enzyme within a cell doesn’t destroy its own
striction Enzymes

Cleavage Location of Examples

site methylase

Type I Random Endonuclease EcoK I

Around 1000bp and methylase EcoA I
away from located on a CfrA I
recognition site single protein
molecule

Type II Specific Endonuclease EcoR I

Within the and methylase BamH I
recognition site are separate Hind III
entities

Type III Random Endonuclease EcoP I

24-26 bp away and methylase Hinf III
from recognition located on a EcoP15 I
site single protein
molecule
on Endonucleases

Restriction endonucleases are named using the 1st three lette

– First letter is from the genus H from Haemophilus
– Next two letters are the 1st two letters of the species name in from in
– Sometimes the strain designation is included “d
– If microorganism produces only 1 restriction enzyme, end the name w
– If more than one restriction enzyme is produced, the others are numb
ucleases

• Exonucleases
–Remove nucleotides one at a time from a DNA molecule

• Endonucleases
–Break phosphodiester bonds within a DNA molecule
–Include restriction enzymes
onuclease

• Exonuclease III
– 3’  5’ exonuclease activity and other three activites
– Manifested with double-stranded but not single-stranded
• Exonuclease VII
– 3’  5’ or 5’  3’ direction
– Single-strand specific exonuclease
– Does not release mononucleotides
• Lambda Exonuclease
– 5’  3’ direction
– Double-stranded exonuclease
nd Exonuclease

• Nuclease Bal31
– Highly specific single-stranded endodeoxynuclease activ
– Exonuclease activity capable of simultaneously degradin
• Neurospora crassa Nuclease
– On ssDNA or RNA : acts as an endonuclease
– On dsDNA (and ssDNA) : acts as an exonuclease
onucleases

• Bal 31
–Double-stranded exonuclease, operates in a time-depend
–Degrades both 5’ and 3’ ends of DNA

–Useful for generating deletion sets, get bigger deletions w

onucleases

• Exonuclease III--double-stranded DNA

–3’-5’ exonuclease activity
–3’ overhangs resistant to activity, can use this property to
onucleases

• Exonuclease I
–3’-5’ exonuclease
–Works only on single-stranded DNA
–Useful for removing unextended primers from PCR reactio
e and RNase

• DNase I
– Degrades DNA by hydrolyzing internal phosphoester link
• Mung Bean Nuclease
– Highly specific for DNA or RNA lacking an ordered structu
– 5’  3’
• RNase H
– Specifically degrades the RNA strands in DNA:RNA heter
ucleases

• Dnase I
–Cleaves double-stranded DNA randomly (also cleaves sin
–Mn++: both strands of DNA cut
–Mg++: single strands nicked
–Very useful for defining binding sites for DNA binding prot
uclease Specificity

Restriction endonucleases recognize a specific DNA sequence

– They recognize 4-bp, 6-bp, 8-bp palindromic sequences
– The frequency of cuts lessens as the recognition sequence is longer
– They cut DNA reproducibly in the same place
odification System

• What prevents these enzymes from cutting up the host DNA?

– They are paired with methylases
– Theses enzymes recognize, methylate the same site
• Together they are called a restriction-modification system, R-M
• Methylation protects DNA, after replication the parental strand
me Activity

Scanning

GGACGCTAGCTGATGAATTCGCATCGGATCCGAATCCGCTCTTTCAA
CCTGCGATCGACTACTTAAGCGTAGCCTAGGCTTAGGCGAGAAAGTT

Recognition Sequence

GGACGCTAGCTGATGAATTCGCATCGGATCCGAATCCGCTCTTTCAA
CCTGCGATCGACTACTTAAGCGTAGCCTAGGCTTAGGCGAGAAAGTT

Cleavage
GGACGCTAGCTGATG AATTCGCATCGGATCCGAATCCGCTCTTTCAA
CCTGCGATCGACTACTTAA GCGTAGCCTAGGCTTAGGCGAGAAAGTT
y of Enzymes

EcoRI Esherichia coli R G/AATTC

BamHI Baccilu amyloliquefaciens H G/GATCC

HindIII Haemophilus influenzae Rd A/AGCCT

PstI Providencia stuartii CTGCA/G

PmeI Psuedomonas mendocina GTTT/AAAC

on Sequences

EcoRI G/AATTC Features

Palindromic
BamHI G/GATCC Length
4 cutters, 6 cutters etc
HindIII A/AGCCT Site of cleavage
PstI CTGCA/G Sticky ends
3’ overhang
PmeI GTTT/AAAC 5’ overhang
blunt end
HincII GTY/RAC Compatibility
Multiple Recognition sequences
FunII G/AATTC Isoschisomers
Type II vs Type III RE
n Conditions

• XbaI
– Buffer 2: (10 mM Tris-HCl, 10 mM MgCl2, 50 mM NaCl, 1 mM DTT, p

– 100 μg/ml BSA

– Incubate at 37°

– 1 Unit digest 1 μg DNA in 1 hour

– Heat inactivate 65° for 20min

RE Reaction

20 μl reaction.

10 μl DNA (~1 μg total)

7 μl water
2 μl 10X reaction buffer
1 μl RE 10units/μl

Incubate 1 hour at appropriate temperature

Note:
1.10 fold excess enzyme ensures complete digestion.
2.Enzyme should never exceed 1/10th of reaction.
3.BSA is often recommended because it stabilizes the enzyme
4. For plasmid minipreps – add 1 μl RNase the last 5 min of dig
ootprinting

Calibrate the nicking: 1 hit per DNA molecule

 Drosophila heat-shock
otprinting reaction 0 factor

Sites for interaction of HSF w

 Why don’t bacteria destroy their own DNA with their restriction
enzymes?
thylation
striction Enzymes

RFLP analysis (Restriction Fragment Length Polymorphism)

DNA sequencing

DNA storage – libraries

Transformation

Large scale analysis – gene chips

mes for Transformation

Human DNA cleaved with EcoRI Corn DNA cleaved with EcoRI
PO4-A-A-T-T-C-A-G-C-T-A-C-G-3’
5’-C-G-G-T-A-C-T-A-G-OH
3’-G-C-C-A-T-G-A-T-C-T-T-A-A-PO4 + HO-G-T-C-G-A-T-G-C-5’

Complementary base pairing

5’-A-C-G-G-T-A-C-T-A-G A-A-T-T-C-A-G-C-T-A-C-G-3’
3’-T-G-C-C-A-T-G-A-T-C-T-T-A-A G-T-C-G-A-T-G-C-5’

+ DNA Ligase, + rATP

5’-A-C-G-G-T-A-C-T-A-G-A-A-T-T-C-A-G-C-T-A-C-G-3’
3’-T-G-C-C-A-T-G-A-T-C-T-T-A-A-G-T-C-G-A-T-G-C-5’

recombinant DNA molecule

Enzymes for RFLP

_
DNA is negatively charged from the pho

Visualize DNA with ethidium bromide –

nzymes have a twofold rotational symmetry

Restriction enzymes have corresponding symmetry to facilitate recognition and

Ligation efficiency depends on the DNA ends in the

Complementary “sticky” ends

• Ligation is efficient
• annealing of complementary overhangs brings 5’P and 3’OH into clos

“Blunt” ends
• Ligation is inefficient
• need high concentrations of ligase and DNA
• molecular crowding reagents (like PEG 8000) improve intermolecular

Follow the manufacturer’s instructions…

be blunt ended or sticky ended

5’ G A A T T C 3’ 5’ G A T A T C 3’
3’ C T T A A G 5’ 3’ C T A T A G 5’

Sticky Ends Blunt Ends

Sticky ends or blunt ends can be used to join DNA fragments.

Sticky ends are more cohesive compared to blunt ends.
and Neochischizomers

• Restriction enzymes that have the same recognition sequence as well as the same

• Restriction enzymes that have the same recognition sequence but cleave the DNA a

CCCGGG CCCGGG
GGGCCC GGGCCC
Xma I Sma I
nism of Action

Restriction Endonuclease scan the length of the DNA , binds

hilic attack at the phosphorous atom

3’OH and 5’ PO43- is produced. Mg2+ is required for the catalytic activity of the enzy
coR V endonuclease

• Consists of two subunits – dimers re

• Binds to the matching symmetry of t
Hydrogen bonding interactions between EcoRv and its DNA substrate
A comparison of cognate and non-specific DNA in the EcorV-DNA complex.
striction Enzymes

Restriction Enzymes can be used to generate a restriction map. This

Uses….

Restriction Fragment Length Polymorphism is a tool to study variations among individ

Uses….

Restriction enzymes are most widely used in recombinant DNA techn

Cutting and pasting DNA

I.Restriction and modification systems

II.Recognition and cleavage of DNA by restriction end
III.Joining (ligating) DNA molecules
IV.Cloning techniques
ng techniques

A) Modify the ends of the DNAs to make foreign DNA seque

B) Directional cloning (generate easily cloned PCR fragmen
C) Treat the vector DNA with alkaline phosphatase to improv
of type II REases

EcoRI

5´ ... G^A A T T C ... 3´

3´ ... C T T A A^G ... 5´

EcoRI

5´ ... G^ 3’ 5’ A A T T C ... 3´
3´ ... C T T A A 5’ 3’ ^G ... 5´
n sequences for REases

4-cutters:
AluI 5´ ... AG^CT ... 3´ blunt ends
MspI 5´ ... C^CGG ... 3´ 5’ overhang (2 bp)
6-cutters
PvuII 5´ ... CAG^CTG ... 3´ blunt ends
KpnI 5´ ... GGTAC^C ... 3´ 3’ overhang (4 bp)
8-cutters
NotI 5´ ... GC^GGCCGC ... 3´ 5’ overhang (4 bp)
Unusual sites
MwoI 5´ ... GCNNNNN^NNGC ... 3´ 3’ overhang
3´ ... CGNN^NNNNNCG ... 5´ (3 bp)
ase cut my sequence?

1)Known sequence: scan for sites by computer (eg. at www.rebase.ne

2)Unknown sequence: hypothetical calculations
4 cutter: site occurs randomly every 44 (256) base pairs
6 cutter: every 46 (4096) bp
8 cutter: every 48 (65536) bp
But sequences are not distributed randomly (table 3.4)
1)Sequence context effects
Some sites are preferred over others by enzyme
 The ligation reaction

Biological function of ligases:

• Lagging strand DNA synthesis
• genetic recombination
• DNA repair
binant DNA molecule

Plasmid vector:
a cloning vehicle

it can replicate itself in a bacterial host and contains a means for selection (
aq PCR products

• Taq PCR products have a 3’ “A” overhang

• Prepare vector to have a 3’ “T” overhang
Enzymes; Practical considerations
• Expensive
• Many are cloned recombinant enzymes but still can be expensive
• One unit of a Restriction enzyme is defined as the amount that will cut 1ug of a test D
• Rate of cutting is dependent on
1. Number of sites/ug DNA
2. linear, circular or supercoiled DNA
3. R.E. sites near ends may not cut well
4. Contaminated DNA may not cut well
5. More enzyme required if buffer conditions are not optimum
6. Ability to cleave depends on surrounding sequence
Enzymes; Practical considerations cont………

• Manufacturers catalogues give optimum buffers, temps and stabilities

• If xs enzyme is used may result in non specific cutting (called star activity)
• Contamination of enzyme stocks is disasterous. Use clean tips all the time.
• Enzymes should be stored in -20C freezer(not frost free)
• Enzymes should be placed on ice immediately on removal from freezer
• Enzymes should be used immediately and then returned to freezer
• Diluted enzymes are generally unstable. Do not dilute for long term storage
• Wear gloves to prevent contaminating enzymes with proteases and RNases often present o