Nucleic Acids

Adopted from: Francine Williams

Excelsior Community College
Nucleic acids

 One of the most important molecules in living

organisms as they make up the genetic
material which is passed from one generation
to another
 Nucleic acids are macromolecules made up
of nucleotide monomers
 There are two types of nucleic acids DNA
and RNA
Structure of nucleotides

 Nucleotides consist of three constituents

– A pentose sugar
– An organic base
– A phosphate group
 An organic base and a pentose sugar is
called a nucleoside
Structure of nucleotides
 Pentose sugar
– The type of sugar in the nucleotide determines which nucleic
acid is produced
– The presence of ribose indicates RNA
– The presence of deoxyribose indicates DNA
Structure of nucleotides

 There are five organic bases

 Each nucleic acid has only four
 DNA contains Adenine (A), Cytosine (C),
Guanine (G) and thymine (T)
 RNA contains A, C, G and uracil
 The base is attached to carbon number one
of the pentose sugar
Structure of nucleotides

 A phosphate group is
attached to carbon number
five of the pentose sugar
 Nucleosides may have one,
two or three phosphate
groups attached (mono, di,
triphosphates
Structure of nucleotides
Polymerisation of the nucleotides

 When nucleotides polymerise the phosphate

group joins with carbon number three of the
pentose sugar of another nucleotide
 The reaction is a condensation reaction and
results in the formation of a phosphodiester
bond
Polymerisation of the nucleotides

 The phosphate and sugar forms a sugar

phosphate backbone
 The phosphodiester bonds are strong
covalent bonds which are important for
preventing breakage during replication
A polynucleotide
Structure of DNA

 DNA consists of two polynucleotide strands

joined together by their bases
 Bases are capable of complementary pairing
 Adenine pairs with thymine forming two
hydrogen bonds
 Guanine pairs with cytosine forming three
hydrogen bonds
Structure of DNA

 The sequence of bases

on one strand
determines the
sequence of bases on
the other strand
 E.g.
– ACGT
– TGCA
Structure of DNA

 The polynucleotide strands

run antiparallel one strand
running 5’ to 3’ while the
other runs 3’ to 5’
 The strands are twisted into
a double helix
Structure of DNA
Structure of RNA

 RNA is made up of a single polynucleotide

strand.
 It contains the bases A, G, C and U.
 There are 3 types of RNA molecules in cells,
– Ribosomal RNA (rRNA)
– Transfer RNA (tRNA)
– Messenger RNA (mRNA)
rRNA

 Made in the nucleus by the nucleolus

 Major constituent of ribosomes
mRNA

 Made in the nucleus during the process of

transcription
 Complementary to DNA
 Carries information from the nucleus to the
cytoplasm
tRNA

 Found in the cytoplasm

 Has an amino acid binding site to which only specific
amino acids can attach
 It also has a sequence of three bases
complementary to the codon on the mRNA called an
anticodon
 Transports amino acids to the ribosomes for the
formation of polypeptide chains in translation
tRNA
DNA replication

 DNA molecules have the ability to make

exact copies of itself
 DNA replication occurs just before cell
division to ensure that each cell gets the
correct number and type of chromosomes
 Each step in the process is assisted and
controlled by enzymes
DNA replication

 1. The enzyme DNA helicase causes the

double helix to uncoil
 2. The hydrogen bonds between the bases
are broken and the two strands separate
exposing the bases
DNA replication

 3. DNA polymerase attaches to the strands

and moves in the 3’ to 5’ direction
 4. Free DNA nucleotides from the
nucleoplasm binds complementarily to the
exposed bases of both polynucleotide
strands (strand forms in the 5’ to 3’ direction)
DNA replication
DNA replication

 Hydrogen bonds are formed between the

bases
 The two strands are sealed together forming
a new DNA molecule
 DNA replication is said to be
semiconservative because the new molecule
consists of one old strand and a newly
synthesised one.
The genetic code

 The information on the DNA is read to

produce polypeptide chains
 One gene one polypeptide
 Sections of the DNA (genes) are read one at
a time to produce a polypeptide chain
The genetic code

 There are twenty naturally occurring amino

acids and DNA must code for each of them
 The bases on the DNA are therefore read
three at a time (triplet code)
 There are therefore 64 possible codes
The genetic code

 Each amino acid will have more than one

codes
 The DNA is first read to form a molecule of
mRNA
 Each sequence of three bases on the mRNA
is called a codon
The genetic code
The genetic code

 The codon, AUG has 2 functions:

– START codon - signals the start of translation
– incorporation of the amino acid Met
(methionine) into the polypeptide chain.

 The 3 STOP codons (UAG, UGA and UAA) do

not code for amino acids.
Transcription

 This involves one strand of the DNA double

helix acting as a template to synthesise an
mRNA molecule
 This process occurs in the nucleus
 A section of the DNA will unwind and
separate exposing the bases
Transcription

 Unlike in DNA replication only one strand will

act as a template
 RNA nucleotides will bind temporarily to the
DNA strand
 When the mRNA strand is complete it will
detach and the DNA double helix reforms
Transcription

 The RNA nucleotides are added

complementarily ie A with U and G with C
 The process is facilitated by the enzyme
RNA polymerase
Transcription

 TACCCTGACGCGGCGAGTACT
 AUGGGACUGCGCCGCUCAUGA
Translation

 This process involves the reading of the

mRNA molecule to produce a polypeptide
chain
 This process occurs in the cytoplasm
 The mRNA strand leaves the nucleus and
attaches to a ribosome in the cytoplasm
Translation

 The process involves five steps

– Activation of tRNA
– Initiation
– Elongation
– Termination
– Post-translational processing
Translation
Translation

 Two codons are covered by the ribosome

 tRNA molecules pick up amino acid
molecules from the cytoplasm (activation)
 The start codon is read and a tRNA molecule
bearing a methionine amino acid will enter
the ribosome and bind temporarily with the
mRNA (initiation)
Translation (elongation)

 The tRNA molecule bearing the anticodon to

the next codon in the sequence will enter the
ribosome and occupy the space beside the
start codon
 The anticodon will bind to the codon
 This brings the two amino acids into close
proximity to each other and a peptide bond is
formed between them
Translation
Translation

 The first tRNA molecule will detach from the

codon and the amino acid and leave the
ribosome
 The ribosomes moves one codon along in
the 5’ to 3’ direction
Translation (termination)

 The tRNA with the complementary anticodon

brings in the next amino acid and the
process continues until the stop codon is
reached
Translation (Post-translational
processing)

 The polypeptide chain is released from the

ribosome into the endoplasmic reticulum
 The ribosome is free to translate another
mRNA strand
 The polypeptide may then be modified to
form a protein or glycoprotein
Mutations

 A mutation is a change in the DNA material

 There are two types of mutations
– Gene/point mutations involve a change in the
base sequence of DNA molecules
– Chromosome mutations involve changes in the
number of chromosomes
Mutations

 Changes in the base sequence can translate

to changes in the amino acid sequence and
therefore the protein produced
 Mutagens are substances that cause
changes to the structure of a DNA molecule
Mutations

 There are five types of point mutations

– Addition – one or more bases added to the
sequence
– Deletion – one or more bases lost from the
sequence
– Substitution – one base is substituted for another
– Duplication – a portion of the sequence becomes
repeated
– Inversion – a portion of the sequence becomes
reversed